Salerno, Paola; Larsson, Jessica; Bucca, Giselda; Laing, Emma; Smith, Colin P.; Flärdh, Klas
2009-01-01
Streptomyces genomes encode two homologs of the nucleoid-associated HU proteins. One of them, here designated HupA, is of a conventional type similar to E. coli HUα and HUβ, while the other, HupS, is a two-domain protein. In addition to the N-terminal part that is similar to that of HU proteins, it has a C-terminal domain that is similar to the alanine- and lysine-rich C termini of eukaryotic linker histones. Such two-domain HU proteins are found only among Actinobacteria. In this phylum some organisms have only a single HU protein of the type with a C-terminal histone H1-like domain (e.g., Hlp in Mycobacterium smegmatis), while others have only a single conventional HU. Yet others, including the streptomycetes, produce both types of HU proteins. We show here that the two HU genes in Streptomyces coelicolor are differentially regulated and that hupS is specifically expressed during sporulation, while hupA is expressed in vegetative hyphae. The developmental upregulation of hupS occurred in sporogenic aerial hyphal compartments and was dependent on the developmental regulators whiA, whiG, and whiI. HupS was found to be nucleoid associated in spores, and a hupS deletion mutant had an average nucleoid size in spores larger than that in the parent strain. The mutant spores were also defective in heat resistance and spore pigmentation, although they possessed apparently normal spore walls and displayed no increased sensitivity to detergents. Overall, the results show that HupS is specifically involved in sporulation and may affect nucleoid architecture and protection in spores of S. coelicolor. PMID:19717607
Mitochondrial Nucleoid: Shield and Switch of the Mitochondrial Genome
2017-01-01
Mitochondria preserve very complex and distinctively unique machinery to maintain and express the content of mitochondrial DNA (mtDNA). Similar to chromosomes, mtDNA is packaged into discrete mtDNA-protein complexes referred to as a nucleoid. In addition to its role as a mtDNA shield, over 50 nucleoid-associated proteins play roles in mtDNA maintenance and gene expression through either temporary or permanent association with mtDNA or other nucleoid-associated proteins. The number of mtDNA(s) contained within a single nucleoid is a fundamental question but remains a somewhat controversial issue. Disturbance in nucleoid components and mutations in mtDNA were identified as significant in various diseases, including carcinogenesis. Significant interest in the nucleoid structure and its regulation has been stimulated in relation to mitochondrial diseases, which encompass diseases in multicellular organisms and are associated with accumulation of numerous mutations in mtDNA. In this review, mitochondrial nucleoid structure, nucleoid-associated proteins, and their regulatory roles in mitochondrial metabolism are briefly addressed to provide an overview of the emerging research field involving mitochondrial biology. PMID:28680532
Targeting Mycobacterium tuberculosis nucleoid-associated protein HU with structure-based inhibitors
Bhowmick, Tuhin; Ghosh, Soumitra; Dixit, Karuna; Ganesan, Varsha; Ramagopal, Udupi A.; Dey, Debayan; Sarma, Siddhartha P.; Ramakumar, Suryanarayanarao; Nagaraja, Valakunja
2014-06-01
The nucleoid-associated protein HU plays an important role in maintenance of chromosomal architecture and in global regulation of DNA transactions in bacteria. Although HU is essential for growth in Mycobacterium tuberculosis (Mtb), there have been no reported attempts to perturb HU function with small molecules. Here we report the crystal structure of the N-terminal domain of HU from Mtb. We identify a core region within the HU-DNA interface that can be targeted using stilbene derivatives. These small molecules specifically inhibit HU-DNA binding, disrupt nucleoid architecture and reduce Mtb growth. The stilbene inhibitors induce gene expression changes in Mtb that resemble those induced by HU deficiency. Our results indicate that HU is a potential target for the development of therapies against tuberculosis.
Berger, Michael; Farcas, Anca; Geertz, Marcel; Zhelyazkova, Petya; Brix, Klaudia; Travers, Andrew; Muskhelishvili, Georgi
2010-01-01
The histone-like protein HU is a highly abundant DNA architectural protein that is involved in compacting the DNA of the bacterial nucleoid and in regulating the main DNA transactions, including gene transcription. However, the coordination of the genomic structure and function by HU is poorly understood. Here, we address this question by comparing transcript patterns and spatial distributions of RNA polymerase in Escherichia coli wild-type and hupA/B mutant cells. We demonstrate that, in mutant cells, upregulated genes are preferentially clustered in a large chromosomal domain comprising the ribosomal RNA operons organized on both sides of OriC. Furthermore, we show that, in parallel to this transcription asymmetry, mutant cells are also impaired in forming the transcription foci—spatially confined aggregations of RNA polymerase molecules transcribing strong ribosomal RNA operons. Our data thus implicate HU in coordinating the global genomic structure and function by regulating the spatial distribution of RNA polymerase in the nucleoid. PMID:20010798
Mitochondrial nucleoid interacting proteins support mitochondrial protein synthesis.
He, J; Cooper, H M; Reyes, A; Di Re, M; Sembongi, H; Litwin, T R; Gao, J; Neuman, K C; Fearnley, I M; Spinazzola, A; Walker, J E; Holt, I J
2012-07-01
Mitochondrial ribosomes and translation factors co-purify with mitochondrial nucleoids of human cells, based on affinity protein purification of tagged mitochondrial DNA binding proteins. Among the most frequently identified proteins were ATAD3 and prohibitin, which have been identified previously as nucleoid components, using a variety of methods. Both proteins are demonstrated to be required for mitochondrial protein synthesis in human cultured cells, and the major binding partner of ATAD3 is the mitochondrial ribosome. Altered ATAD3 expression also perturbs mtDNA maintenance and replication. These findings suggest an intimate association between nucleoids and the machinery of protein synthesis in mitochondria. ATAD3 and prohibitin are tightly associated with the mitochondrial membranes and so we propose that they support nucleic acid complexes at the inner membrane of the mitochondrion.
In vitro-reconstituted nucleoids can block mitochondrial DNA replication and transcription.
Farge, Géraldine; Mehmedovic, Majda; Baclayon, Marian; van den Wildenberg, Siet M J L; Roos, Wouter H; Gustafsson, Claes M; Wuite, Gijs J L; Falkenberg, Maria
2014-07-10
The mechanisms regulating the number of active copies of mtDNA are still unclear. A mammalian cell typically contains 1,000-10,000 copies of mtDNA, which are packaged into nucleoprotein complexes termed nucleoids. The main protein component of these structures is mitochondrial transcription factor A (TFAM). Here, we reconstitute nucleoid-like particles in vitro and demonstrate that small changes in TFAM levels dramatically impact the fraction of DNA molecules available for transcription and DNA replication. Compaction by TFAM is highly cooperative, and at physiological ratios of TFAM to DNA, there are large variations in compaction, from fully compacted nucleoids to naked DNA. In compacted nucleoids, TFAM forms stable protein filaments on DNA that block melting and prevent progression of the replication and transcription machineries. Based on our observations, we suggest that small variations in the TFAM-to-mtDNA ratio may be used to regulate mitochondrial gene transcription and DNA replication. Copyright © 2014 The Authors. Published by Elsevier Inc. All rights reserved.
He, J; Cooper, H M; Reyes, A; Di Re, M; Kazak, L; Wood, S R; Mao, C C; Fearnley, I M; Walker, J E; Holt, I J
2012-07-01
The bacterial homologue of C4orf14, YqeH, has been linked to assembly of the small ribosomal subunit. Here, recombinant C4orf14 isolated from human cells, co-purified with the small, 28S subunit of the mitochondrial ribosome and the endogenous protein co-fractionated with the 28S subunit in sucrose gradients. Gene silencing of C4orf14 specifically affected components of the small subunit, leading to decreased protein synthesis in the organelle. The GTPase of C4orf14 was critical to its interaction with the 28S subunit, as was GTP. Therefore, we propose that C4orf14, with bound GTP, binds to components of the 28S subunit facilitating its assembly, and GTP hydrolysis acts as the release mechanism. C4orf14 was also found to be associated with human mitochondrial nucleoids, and C4orf14 gene silencing caused mitochondrial DNA depletion. In vitro C4orf14 is capable of binding to DNA. The association of C4orf14 with mitochondrial translation factors and the mitochondrial nucleoid suggests that the 28S subunit is assembled at the mitochondrial nucleoid, enabling the direct transfer of messenger RNA from the nucleoid to the ribosome in the organelle.
International Nuclear Information System (INIS)
Cordeiro, T.N.; Garcia, J.; Pons, M.
2005-01-01
NMR and fluorescence anisotropy are both valuable tools for studying bio molecular interactions. NMR can provide structural insights at atomic resolution. Still, it can be wisely complemented by lower-resolution biophysical techniques, such as fluorescence anisotropy. In this article we report the combination of NMR and fluorescence anisotropy in establishing novel structure-function insights into the interaction between two bacterial nucleoid-associated proteins, H ha and H-NS. H ha (H-NS) complexes are known to play an important role in modulating the expression of some environmentally regulated genes that confer survival advantage in a particular growth condition. (author)
Energy Technology Data Exchange (ETDEWEB)
Cordeiro, T.N.; Garcia, J. [Institut de Recerca Biomedica-Parc Cientific de (Spain). Lab. of Biomolecular NMR; Pons, M. [Universitat de Barcelona (Spain). Dept. de Quimica Organica]. E-mail: mpons@ub.edu
2005-07-01
NMR and fluorescence anisotropy are both valuable tools for studying bio molecular interactions. NMR can provide structural insights at atomic resolution. Still, it can be wisely complemented by lower-resolution biophysical techniques, such as fluorescence anisotropy. In this article we report the combination of NMR and fluorescence anisotropy in establishing novel structure-function insights into the interaction between two bacterial nucleoid-associated proteins, H ha and H-NS. H ha (H-NS) complexes are known to play an important role in modulating the expression of some environmentally regulated genes that confer survival advantage in a particular growth condition. (author)
Energy Technology Data Exchange (ETDEWEB)
Alán, Lukáš, E-mail: lukas.alan@fgu.cas.cz; Špaček, Tomáš; Pajuelo Reguera, David; Jabůrek, Martin; Ježek, Petr
2016-07-01
Mitochondrial DNA (mtDNA) is compacted in ribonucleoprotein complexes called nucleoids, which can divide or move within the mitochondrial network. Mitochondrial nucleoids are able to aggregate into clusters upon reaction with intercalators such as the mtDNA depletion agent Ethidium Bromide (EB) or anticancer drug Doxorobicin (DXR). However, the exact mechanism of nucleoid clusters formation remains unknown. Resolving these processes may help to elucidate the mechanisms of DXR-induced cardiotoxicity. Therefore, we addressed the role of two key nucleoid proteins; mitochondrial transcription factor A (TFAM) and mitochondrial single-stranded binding protein (mtSSB); in the formation of mitochondrial nucleoid clusters during the action of intercalators. We found that both intercalators cause numerous aberrations due to perturbing their native status. By blocking mtDNA replication, both agents also prevented mtDNA association with TFAM, consequently causing nucleoid aggregation into large nucleoid clusters enriched with TFAM, co-existing with the normal nucleoid population. In the later stages of intercalation (> 48 h), TFAM levels were reduced to 25%. In contrast, mtSSB was released from mtDNA and freely distributed within the mitochondrial network. Nucleoid clusters mostly contained nucleoids with newly replicated mtDNA, however the nucleoid population which was not in replication mode remained outside the clusters. Moreover, the nucleoid clusters were enriched with p53, an anti-oncogenic gatekeeper. We suggest that mitochondrial nucleoid clustering is a mechanism for protecting nucleoids with newly replicated DNA against intercalators mediating genotoxic stress. These results provide new insight into the common mitochondrial response to mtDNA stress and can be implied also on DXR-induced mitochondrial cytotoxicity. - Highlights: • The mechanism for mitochondrial nucleoid clustering is proposed. • DNA intercalators (Doxorubicin or Ethidium Bromide) prevent TFAM
Robustness of the Process of Nucleoid Exclusion of Protein Aggregates in Escherichia coli
Neeli-Venkata, Ramakanth; Martikainen, Antti; Gupta, Abhishekh; Gonçalves, Nadia; Fonseca, Jose
2016-01-01
ABSTRACT Escherichia coli segregates protein aggregates to the poles by nucleoid exclusion. Combined with cell divisions, this generates heterogeneous aggregate distributions in subsequent cell generations. We studied the robustness of this process with differing medium richness and antibiotics stress, which affect nucleoid size, using multimodal, time-lapse microscopy of live cells expressing both a fluorescently tagged chaperone (IbpA), which identifies in vivo the location of aggregates, and HupA-mCherry, a fluorescent variant of a nucleoid-associated protein. We find that the relative sizes of the nucleoid's major and minor axes change widely, in a positively correlated fashion, with medium richness and antibiotic stress. The aggregate's distribution along the major cell axis also changes between conditions and in agreement with the nucleoid exclusion phenomenon. Consequently, the fraction of aggregates at the midcell region prior to cell division differs between conditions, which will affect the degree of asymmetries in the partitioning of aggregates between cells of future generations. Finally, from the location of the peak of anisotropy in the aggregate displacement distribution, the nucleoid relative size, and the spatiotemporal aggregate distribution, we find that the exclusion of detectable aggregates from midcell is most pronounced in cells with mid-sized nucleoids, which are most common under optimal conditions. We conclude that the aggregate management mechanisms of E. coli are significantly robust but are not immune to stresses due to the tangible effect that these have on nucleoid size. IMPORTANCE Escherichia coli segregates protein aggregates to the poles by nucleoid exclusion. From live single-cell microscopy studies of the robustness of this process to various stresses known to affect nucleoid size, we find that nucleoid size and aggregate preferential locations change concordantly between conditions. Also, the degree of influence of the nucleoid
Sharadamma, N; Harshavardhana, Y; Singh, Pawan; Muniyappa, K
2010-06-01
A number of studies have shown that the structure and composition of bacterial nucleoid influences many a processes related to DNA metabolism. The nucleoid-associated proteins modulate not only the DNA conformation but also regulate the DNA metabolic processes such as replication, recombination, repair and transcription. Understanding of how these processes occur in the context of Mycobacterium tuberculosis nucleoid is of considerable medical importance because the nucleoid structure may be constantly remodeled in response to environmental signals and/or growth conditions. Many studies have concluded that Escherichia coli H-NS binds to DNA in a sequence-independent manner, with a preference for A-/T-rich tracts in curved DNA; however, recent studies have identified the existence of medium- and low-affinity binding sites in the vicinity of the curved DNA. Here, we show that the M. tuberculosis H-NS protein binds in a more structure-specific manner to DNA replication and repair intermediates, but displays lower affinity for double-stranded DNA with relatively higher GC content. Notably, M. tuberculosis H-NS was able to bind Holliday junction (HJ), the central recombination intermediate, with substantially higher affinity and inhibited the three-strand exchange promoted by its cognate RecA. Likewise, E. coli H-NS was able to bind the HJ and suppress DNA strand exchange promoted by E. coli RecA, although much less efficiently compared to M. tuberculosis H-NS. Our results provide new insights into a previously unrecognized function of H-NS protein, with implications for blocking the genome integration of horizontally transferred genes by homologous and/or homeologous recombination.
Ouafa, Zghidi-Abouzid; Reverchon, Sylvie; Lautier, Thomas; Muskhelishvili, Georgi; Nasser, William
2012-01-01
Dickeya dadantii is a pathogen infecting a wide range of plant species. Soft rot, the visible symptom, is mainly due to the production of pectate lyases (Pels) that can destroy the plant cell walls. Previously we found that the pel gene expression is modulated by H-NS and FIS, two nucleoid-associated proteins (NAPs) modulating the DNA topology. Here, we show that relaxation of the DNA in growing D. dadantii cells decreases the expression of pel genes. Deletion of fis aggravates, whereas that of hns alleviates the negative impact of DNA relaxation on pel expression. We further show that H-NS and FIS directly bind the pelE promoter and that the response of D. dadantii pel genes to stresses that induce DNA relaxation is modulated, although to different extents, by H-NS and FIS. We infer that FIS acts as a repressor buffering the negative impact of DNA relaxation on pel gene transcription, whereas H-NS fine-tunes the response of virulence genes precluding their expression under suboptimal conditions of supercoiling. This novel dependence of H-NS effect on DNA topology expands our understanding of the role of NAPs in regulating the global bacterial gene expression and bacterial pathogenicity. PMID:22275524
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. C...
Structure of the nucleoid in cells of Streptococcus faecalis.
Daneo-Moore, L; Dicker, D; Higgins, M L
1980-01-01
The structure of the nucleoid of Streptococcus faecalis (ATCC 9790) was examined and compared in the unfixed and fixed states by immersive refractometry and electron microscopy. It appears from these studies that the nucleoid structure is much more centralized in unfixed chloramphenicol-treated (stationary-phase) cells than it is in cells in the exponential phase of growth. The more dispersed configuration of the exponential-phase nucleoid could be preserved by fixation in glutaraldehyde, but...
PHB granules are attached to the nucleoid via PhaM in Ralstonia eutropha.
Wahl, Andreas; Schuth, Nora; Pfeiffer, Daniel; Nussberger, Stephan; Jendrossek, Dieter
2012-11-16
Poly(3-hydroxybutyrate) (PHB) granules are important storage compounds of carbon and energy in many prokaryotes which allow survival of the cells in the absence of suitable carbon sources. Formation and subcellular localization of PHB granules was previously assumed to occur randomly in the cytoplasm of PHB accumulating bacteria. However, contradictionary results on subcellular localization of PHB granules in Ralstonia eutropha were published, recently. Here, we provide evidence by transmission electron microscopy that PHB granules are localized in close contact to the nucleoid region in R. eutropha during growth on nutrient broth. Binding of PHB granules to the nucleoid is mediated by PhaM, a PHB granule associated protein with phasin-like properties that is also able to bind to DNA and to phasin PhaP5. Over-expression of PhaM resulted in formation of many small PHB granules that were always attached to the nucleoid region. In contrast, PHB granules of ∆phaM strains became very large and distribution of granules to daughter cells was impaired. Association of PHB granules to the nucleoid region was prevented by over-expression of PhaP5 and clusters of several PHB granules were mainly localized near the cell poles. Subcellular localization of PHB granules is controlled in R. eutropha and depends on the presence and concentrations of at least two PHB granule associated proteins, PhaM and PhaP5.
HupB Is a Bacterial Nucleoid-Associated Protein with an Indispensable Eukaryotic-Like Tail
Directory of Open Access Journals (Sweden)
Joanna Hołówka
2017-11-01
Full Text Available In bacteria, chromosomal DNA must be efficiently compacted to fit inside the small cell compartment while remaining available for the proteins involved in replication, segregation, and transcription. Among the nucleoid-associated proteins (NAPs responsible for maintaining this highly organized and yet dynamic chromosome structure, the HU protein is one of the most conserved and highly abundant. HupB, a homologue of HU, was recently identified in mycobacteria. This intriguing mycobacterial NAP is composed of two domains: an N-terminal domain that resembles bacterial HU, and a long and distinctive C-terminal domain that contains several PAKK/KAAK motifs, which are characteristic of the H1/H5 family of eukaryotic histones. In this study, we analyzed the in vivo binding of HupB on the chromosome scale. By using PALM (photoactivated localization microscopy and ChIP-Seq (chromatin immunoprecipitation followed by deep sequencing, we observed that the C-terminal domain is indispensable for the association of HupB with the nucleoid. Strikingly, the in vivo binding of HupB displayed a bias from the origin (oriC to the terminus (ter of the mycobacterial chromosome (numbers of binding sites decreased toward ter. We hypothesized that this binding mode reflects a role for HupB in organizing newly replicated oriC regions. Thus, HupB may be involved in coordinating replication with chromosome segregation.
Four dimensional imaging of E. coli nucleoid organization and dynamics in living cells
Fisher, J. K.; Bourniquel, A.; Witz, G.; Weiner, B.; Prentiss, M.; Kleckner, N.
2013-01-01
Visualization of living E. coli nucleoids, defined by HupA-mCherry, reveals a discrete, dynamic helical ellipsoid. Three basic features emerge. (i) Nucleoid density efficiently coalesces into longitudinal bundles, giving a stiff, low DNA density ellipsoid. (ii) This ellipsoid is radially confined within the cell cylinder. Radial confinement gives helical shape and drives and directs global nucleoid dynamics, including sister segregation. (iii) Longitudinal density waves flux back and forth along the nucleoid, with 5–10% of density shifting within 5s, enhancing internal nucleoid mobility. Furthermore, sisters separate end-to-end in sequential discontinuous pulses, each elongating the nucleoid by 5–15%. Pulses occur at 20min intervals, at defined cell cycle times. This progression is mediated by sequential installation and release of programmed tethers, implying cyclic accumulation and relief of intra-nucleoid mechanical stress. These effects could comprise a chromosome-based cell cycle engine. Overall, the presented results suggest a general conceptual framework for bacterial nucleoid morphogenesis and dynamics. PMID:23623305
International Nuclear Information System (INIS)
Meeusen, S.; Tieu, Q.; Wong, E.; Weiss, E.; Schieltz, D.; Yates, J.R.; Nunnari, J.
1999-01-01
Maintenance of mitochondrial DNA (mtDNA) during cell division is required for progeny to be respiratory competent. Maintenance involves the replication, repair, assembly, segregation, and partitioning of the mitochondrial nucleoid. MGM101 has been identified as a gene essential for mtDNA maintenance in S. cerevisiae, but its role is unknown. Using liquid chromatography coupled with tandem mass spectrometry, we identified Mgm101p as a component of highly enriched nucleoids, suggesting that it plays a nucleoid-specific role in maintenance. Subcellular fractionation, indirect immunofluorescence and GFP tagging show that Mgm101p is exclusively associated with the mitochondrial nucleoid structure in cells. Furthermore, DNA affinity chromatography of nucleoid extracts indicates that Mgm101p binds to DNA, suggesting that its nucleoid localization is in part due to this activity. Phenotypic analysis of cells containing a temperature sensitive mgm101 allele suggests that Mgm101p is not involved in mtDNA packaging, segregation, partitioning or required for ongoing mtDNA replication. We examined Mgm101p's role in mtDNA repair. As compared with wild-type cells, mgm101 cells were more sensitive to mtDNA damage induced by UV irradiation and were hypersensitive to mtDNA damage induced by gamma rays and H2O2 treatment. Thus, we propose that Mgm101p performs an essential function in the repair of oxidatively damaged mtDNA that is required for the maintenance of the mitochondrial genome. (author)
The small nucleoid protein Fis is involved in Vibrio cholerae quorum sensing.
Lenz, Derrick H; Bassler, Bonnie L
2007-02-01
Quorum sensing is a process of cell-cell communication that bacteria use to relay information to one another about the cell density and species composition of the bacterial community. Quorum sensing involves the production, secretion and population-wide detection of small signalling molecules called autoinducers. This process allows bacteria to synchronize group behaviours and act as multicellular units. The human pathogen, Vibrio cholerae, uses quorum sensing to co-ordinate such complex behaviours as pathogenicity and biofilm formation. The quorum-sensing circuit of V. cholerae consists of two autoinducer/sensor systems, CAI-1/CqsS and AI-2/LuxPQ, and the VarS/A-CsrA/BCD growth-phase regulatory system. Genetic analysis suggests that an additional regulatory arm involved in quorum sensing exists in V. cholerae. All of these systems channel information into the histidine phosphotransfer protein, LuxU, and/or the response regulator, LuxO. LuxO, when phosphorylated, activates the expression of four genes encoding the Qrr (quorum regulatory RNAs) small RNAs (sRNAs). The Qrr sRNAs destabilize the hapR transcript encoding the master regulator of quorum sensing, HapR. Here we identify the nucleoid protein Fis as playing a major role in the V. cholerae quorum-sensing circuit. Fis fulfils the predictions required to be the putative additional component that inputs information into the cascade: its expression is regulated in a growth phase-dependent manner; it requires LuxO but acts independently of LuxU, and it regulates all four qrr genes and, in turn, HapR by directly binding to the qrr gene promoters and modulating their expression.
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Valkenburg, J A; Woldringh, C L
1984-01-01
The refractive indices of nucleoid and cytoplasm in Escherichia coli were derived theoretically and experimentally. For the theoretical estimates, we made use of the known macromolecular composition of E. coli B/r (G. Churchward and H. Bremer, J. Theor. Biol. 94:651-670, 1982) and of estimates of cell and nucleoid volumes. These were obtained from micrographs of living bacteria made with a confocal scanning light microscope. The theoretical values were calculated, assuming that all DNA occurred in the nucleoid and that all protein and RNA occurred in the cytoplasm. Comparison with experimental refractive index values directly obtained by immersive refractometry showed that, besides its DNA, the nucleoid must contain an additional amount of solids equivalent to 8.6% (wt/vol) protein. With the nucleoid containing 6.8% (wt/vol) DNA and 8.6% (wt/vol) protein and the cytoplasm containing 21% (wt/vol) protein and 4% (wt/vol) RNA, a mass difference is obtained, which accounts for the phase separation observed between the nucleoid and cytoplasm in living cells by phase-contrast microscopy. The decrease in the refractive index of the nucleoid relative to that of the cytoplasm observed upon, for instance, OsO4 fixation was interpreted as being indicative of the loss of protein content in the nucleoid. Images PMID:6389508
FtsZ placement in nucleoid-free bacteria.
Directory of Open Access Journals (Sweden)
Manuel Pazos
Full Text Available We describe the placement of the cytoplasmic FtsZ protein, an essential component of the division septum, in nucleoid-free Escherichia coli maxicells. The absence of the nucleoid is accompanied in maxicells by degradation of the SlmA protein. This protein, together with the nucleoid, prevents the placement of the septum in the regions occupied by the chromosome by a mechanism called nucleoid occlusion (NO. A second septum placement mechanism, the MinCDE system (Min involving a pole-to-pole oscillation of three proteins, nonetheless remains active in maxicells. Both Min and NO act on the polymerization of FtsZ, preventing its assembly into an FtsZ-ring except at midcell. Our results show that even in the total absence of NO, Min oscillations can direct placement of FtsZ in maxicells. Deletion of the FtsZ carboxyl terminal domain (FtsZ*, a central hub that receives signals from a variety of proteins including MinC, FtsA and ZipA, produces a Min-insensitive form of FtsZ unable to interact with the membrane-anchoring FtsA and ZipA proteins. This protein produces a totally disorganized pattern of FtsZ localization inside the maxicell cytoplasm. In contrast, FtsZ*-VM, an artificially cytoplasmic membrane-anchored variant of FtsZ*, forms helical or repetitive ring structures distributed along the entire length of maxicells even in the absence of NO. These results show that membrane anchoring is needed to organize FtsZ into rings and underscore the role of the C-terminal hub of FtsZ for their correct placement.
FtsZ placement in nucleoid-free bacteria.
Pazos, Manuel; Casanova, Mercedes; Palacios, Pilar; Margolin, William; Natale, Paolo; Vicente, Miguel
2014-01-01
We describe the placement of the cytoplasmic FtsZ protein, an essential component of the division septum, in nucleoid-free Escherichia coli maxicells. The absence of the nucleoid is accompanied in maxicells by degradation of the SlmA protein. This protein, together with the nucleoid, prevents the placement of the septum in the regions occupied by the chromosome by a mechanism called nucleoid occlusion (NO). A second septum placement mechanism, the MinCDE system (Min) involving a pole-to-pole oscillation of three proteins, nonetheless remains active in maxicells. Both Min and NO act on the polymerization of FtsZ, preventing its assembly into an FtsZ-ring except at midcell. Our results show that even in the total absence of NO, Min oscillations can direct placement of FtsZ in maxicells. Deletion of the FtsZ carboxyl terminal domain (FtsZ*), a central hub that receives signals from a variety of proteins including MinC, FtsA and ZipA, produces a Min-insensitive form of FtsZ unable to interact with the membrane-anchoring FtsA and ZipA proteins. This protein produces a totally disorganized pattern of FtsZ localization inside the maxicell cytoplasm. In contrast, FtsZ*-VM, an artificially cytoplasmic membrane-anchored variant of FtsZ*, forms helical or repetitive ring structures distributed along the entire length of maxicells even in the absence of NO. These results show that membrane anchoring is needed to organize FtsZ into rings and underscore the role of the C-terminal hub of FtsZ for their correct placement.
DNA loop domain organization in nucleoids from cells of different types.
Afanasieva, Katerina; Chopei, Marianna; Lozovik, Alexandra; Semenova, Anastasia; Lukash, Lyubov; Sivolob, Andrei
2017-01-29
The loop domain organization of chromatin plays an important role in transcription regulation and thus may be assumed to vary in cells of different types. We investigated the kinetics of DNA loop migration during single cell gel electrophoresis (the comet assay) for nucleoids obtained from human lymphocytes, lymphoblasts and glioblastoma T98G cells. The results confirm our previous observation that there are three parts of DNA in nucleoids: DNA on the nucleoid surface, loops up to ∼150 kb inside the nucleoid, and larger loops that cannot migrate. However, the relative amounts of the three parts were found to be very different for different cell types. The distributions of the loop length up to 150 kb were shown to be exponential, with the distribution parameter, the loop density, to be dependent on the cell type. Copyright © 2016 Elsevier Inc. All rights reserved.
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Changes in nucleoid viscosity following X-irradiation of rat thymic and splenic cells in vitro
International Nuclear Information System (INIS)
Tempel, K.
1990-01-01
In the present investigations, damage and repair of DNA supercoiling was measured in T- and S-cells following X-irradiation in vitro by using the nucleoid sedimentation technique and a simplified low-shearing viscometric test. - X-irradiation resulted in a dose(0.6-19.2 Gy)-dependent reduction in sedimentation and viscosity of nucleoids. Within a post-irradiation period of 30-45 min after a challenge dose of 19.2 Gy, DNA repair was accompanied by an increase in nucleoid sedimentation and viscosity in T-cells by about 60 and 300, in S-cells by almost 40 and 100%, resp. The increase in nucleoid viscosity within a 30 min repair period could be reduced in a concentration-dependent manner by DNA polymerase-inhibitors and proteinase K. - The higher DNA repair capacity of T-cells as reflected by UDS is confirmed therefore by the nucleoid characteristics. A part from this suggestion, measuring nucleoid viscosity may be considered as a sensitive, simple and rapid device to detect radiation-induced DNA supercoiling phenomena. (orig./MG)
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Histone H3 is absent from organelle nucleoids in BY-2 cultured tobacco cells.
Takusagawa, Mari; Tamotsu, Satoshi; Sakai, Atsushi
2013-07-01
The core histone proteins (H2A, H2B, H3 and H4) are nuclear-localised proteins that play a central role in the formation of nucleosome structure. They have long been considered to be absent from extra-nuclear, DNA-containing organelles; that is plastids and mitochondria. Recently, however, the targeting of core histone H3 to mitochondria, and the presence of nucleosome-like structures in mitochondrial nucleoids, were proposed in cauliflower and tobacco respectively. Thus, we examined whether histone H3 was present in plant organelles and participated in the organisation of nucleoid structure, using highly purified organelles and organelle nucleoids isolated from BY-2 cultured tobacco cells. Immunofluorescence microscopic observations and Western blotting analyses demonstrated that histone H3 was absent from organelles and organelle nucleoids, consistent with the historical hypothesis. Thus, the organisation of organelle nucleoids, including putative nucleosome-like repetitive structures, should be constructed and maintained without participation of histone H3. © 2013 International Federation for Cell Biology.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
International Nuclear Information System (INIS)
Bouthier de la Tour, Claire; Passot, Fanny Marie; Toueille, Magali; Servant, Pascale; Sommer, Suzanne; Mirabella, Boris; Blanchard, Laurence; Groot, Arjan de; Guerin, Philippe; Armengaud, Jean
2013-01-01
The nucleoids of radiation-resistant Deinococcus species show a high degree of compaction maintained after ionizing irradiation. We identified proteins recruited after irradiation in nucleoids of Deinococcus radiodurans and Deinococcus deserti by means of comparative proteomics. Proteins in nucleoid-enriched fractions from unirradiated and irradiated Deinococcus were identified and semi quantified by shotgun proteomics. The ssDNA-binding protein SSB, DNA gyrase subunits GyrA and GyrB, DNA topoisomerase I, RecA recombinase, UvrA excinuclease, RecQ helicase, DdrA, DdrB, and DdrD proteins were found in significantly higher amounts in irradiated nucleoids of both Deinococcus species. We observed, by immunofluorescence microscopy, the subcellular localization of these proteins in D. radiodurans, showing for the first time the recruitment of the DdrD protein into the D. radiodurans nucleoid. We specifically followed the kinetics of recruitment of RecA, DdrA, and DdrD to the nucleoid after irradiation. Remarkably, RecA proteins formed irregular filament-like structures 1 h after irradiation, before being redistributed throughout the cells by 3 h post-irradiation. Comparable dynamics of DdrD localization were observed, suggesting a possible functional interaction between RecA and DdrD. Several proteins involved in nucleotide synthesis were also seen in higher quantities in the nucleoids of irradiated cells, indicative of the existence of a mechanism for orchestrating the presence of proteins involved in DNA metabolism in nucleoids in response to massive DNA damage. All MS data have been deposited in the ProteomeXchange with identifier PXD00196. (authors)
The nucleoid protein Dps binds genomic DNA of Escherichia coli in a non-random manner
Kondrashov, F. A.; Toshchakov, S. V.; Dominova, I.; Shvyreva, U. S.; Vrublevskaya, V. V.; Morenkov, O. S.; Panyukov, V. V.
2017-01-01
Dps is a multifunctional homododecameric protein that oxidizes Fe2+ ions accumulating them in the form of Fe2O3 within its protein cavity, interacts with DNA tightly condensing bacterial nucleoid upon starvation and performs some other functions. During the last two decades from discovery of this protein, its ferroxidase activity became rather well studied, but the mechanism of Dps interaction with DNA still remains enigmatic. The crucial role of lysine residues in the unstructured N-terminal tails led to the conventional point of view that Dps binds DNA without sequence or structural specificity. However, deletion of dps changed the profile of proteins in starved cells, SELEX screen revealed genomic regions preferentially bound in vitro and certain affinity of Dps for artificial branched molecules was detected by atomic force microscopy. Here we report a non-random distribution of Dps binding sites across the bacterial chromosome in exponentially growing cells and show their enrichment with inverted repeats prone to form secondary structures. We found that the Dps-bound regions overlap with sites occupied by other nucleoid proteins, and contain overrepresented motifs typical for their consensus sequences. Of the two types of genomic domains with extensive protein occupancy, which can be highly expressed or transcriptionally silent only those that are enriched with RNA polymerase molecules were preferentially occupied by Dps. In the dps-null mutant we, therefore, observed a differentially altered expression of several targeted genes and found suppressed transcription from the dps promoter. In most cases this can be explained by the relieved interference with Dps for nucleoid proteins exploiting sequence-specific modes of DNA binding. Thus, protecting bacterial cells from different stresses during exponential growth, Dps can modulate transcriptional integrity of the bacterial chromosome hampering RNA biosynthesis from some genes via competition with RNA polymerase
Interplay between the bacterial nucleoid protein H-NS and macromolecular crowding in compacting DNA
Wintraecken, C.H.J.M.
2012-01-01
In this dissertation we discuss H-NS and its connection to nucleoid compaction and organization. Nucleoid formation involves a dramatic reduction in coil volume of the genomic DNA. Four factors are thought to influence coil volume: supercoiling, DNA charge neutralization, macromolecular
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
The Nucleoid Binding Protein H-NS Biases Genome-Wide Transposon Insertion Landscapes
Directory of Open Access Journals (Sweden)
Satoshi Kimura
2016-08-01
Full Text Available Transposon insertion sequencing (TIS; also known as TnSeq is a potent approach commonly used to comprehensively define the genetic loci that contribute to bacterial fitness in diverse environments. A key presumption underlying analyses of TIS datasets is that loci with a low frequency of transposon insertions contribute to fitness. However, it is not known whether factors such as nucleoid binding proteins can alter the frequency of transposon insertion and thus whether TIS output may systematically reflect factors that are independent of the role of the loci in fitness. Here, we investigated whether the histone-like nucleoid structuring (H-NS protein, which preferentially associates with AT-rich sequences, modulates the frequency of Mariner transposon insertion in the Vibrio cholerae genome, using comparative analysis of TIS results from wild-type (wt and Δhns V. cholerae strains. These analyses were overlaid on gene classification based on GC content as well as on extant genome-wide identification of H-NS binding loci. Our analyses revealed a significant dearth of insertions within AT-rich loci in wt V. cholerae that was not apparent in the Δhns insertion library. Additionally, we observed a striking correlation between genetic loci that are overrepresented in the Δhns insertion library relative to their insertion frequency in wt V. cholerae and loci previously found to physically interact with H-NS. Collectively, our findings reveal that factors other than genetic fitness can systematically modulate the frequency of transposon insertions in TIS studies and add a cautionary note to interpretation of TIS data, particularly for AT-rich sequences.
In Escherichia coli the genome must be compacted ∼1,000-fold to be contained in a cellular structure termed the nucleoid. It is proposed that the structure of the nucleoid is determined by a balance of multiple compaction forces and one major expansion force. The latter is mediated by transertion, a coupling of transcription, translation, and translocation of nascent membrane proteins and/or exported proteins.
van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.
2012-01-01
Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417
Directory of Open Access Journals (Sweden)
Sebastiaan M Bol
Full Text Available BACKGROUND: Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD. While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. METHODS: We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs affecting HIV-1 replication in macrophages in vitro were also tested. RESULTS: The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2 × 10(-5. Prep1 has recently been identified as a transcription factor preferentially binding the -2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. CONCLUSION: These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders.
Energy Technology Data Exchange (ETDEWEB)
Choi, Joon, W.; Sherr, E.B.; Sherr, B.F. [Oregon State Univ., Corvallis, OR (United States)
1996-09-01
We investigated the report of Zweifel and Hagstroem that only a portion of marine bacteria contain nucleoids--the DNA-containing regions of procaryotic cells-- and that such bacteria correspond to the active or viable fraction of bacterioplankton. In Oregon coastal waters, 21-64% of bacteria had visible nucleoids; number of nucleoid-visible (NV) bacteria were greater than numbers of metabolically active bacteria, based on cells with active electron transport systems (ETS) and intact cell membranes. During log growth of a marine isolate, proportions of NV and ETS-active cells approached 100%. In stationary growth phase, the fraction of ETS-active cells decreased rapidly, while that of NV cells remained high for 7 d. When starved cells of the isolate were resupplied with nutrient (50 mg liter{sup -1} peptone), total cell number did not increase during the initial 6 h, but the proportion of NV cells increased from 27 to 100%, and that of ETS-active cells from 6 to 75%. In an analogous experiment with a bacterioplankton assemblage, a similar trend was observed: the number of NV cells double during the initial 6 h prior to an increase in total cell counts. These results show that some bacteria without visible nucleoids are capable of becoming NV cells, and thus have DNa in a nucleoid region not detectable with the method used here. 18 refs., 4 figs., 1 tab.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Wong, Yee-Chin
2018-05-29
A Burkholderia cenocepacia infection usually leads to reduced survival and fatal cepacia syndrome in cystic fibrosis patients. The identification of B. cenocepacia essential genes for in vivo survival is key to designing new anti-infectives therapies. We used the Transposon-Directed Insertion Sequencing (TraDIS) approach to identify genes required for B. cenocepacia survival in the model infection host, Caenorhabditis elegans. A B. cenocepacia J2315 transposon pool of ∼500,000 mutants was used to infect C. elegans. We identified 178 genes as crucial for B. cenocepacia survival in the infected nematode. The majority of these genes code for proteins of unknown function, many of which are encoded by the genomic island BcenGI13, while other gene products are involved in nutrient acquisition, general stress responses and LPS O-antigen biosynthesis. Deletion of the glycosyltransferase gene wbxB and a histone-like nucleoid structuring (H-NS) protein-encoding gene (BCAL0154) reduced bacterial accumulation and attenuated virulence in C. elegans. Further analysis using quantitative RT-PCR indicated that BCAL0154 modulates B. cenocepacia pathogenesis via transcriptional regulation of motility-associated genes including fliC, fliG, flhD, and cheB1. This screen has successfully identified genes required for B. cenocepacia survival within the host-associated environment, many of which are potential targets for developing new antimicrobials.
Wong, Yee-Chin; Abd El Ghany, Moataz; Ghazzali, Raeece N. M.; Yap, Soon-Joo; Hoh, Chee-Choong; Pain, Arnab; Nathan, Sheila
2018-01-01
A Burkholderia cenocepacia infection usually leads to reduced survival and fatal cepacia syndrome in cystic fibrosis patients. The identification of B. cenocepacia essential genes for in vivo survival is key to designing new anti-infectives therapies. We used the Transposon-Directed Insertion Sequencing (TraDIS) approach to identify genes required for B. cenocepacia survival in the model infection host, Caenorhabditis elegans. A B. cenocepacia J2315 transposon pool of ∼500,000 mutants was used to infect C. elegans. We identified 178 genes as crucial for B. cenocepacia survival in the infected nematode. The majority of these genes code for proteins of unknown function, many of which are encoded by the genomic island BcenGI13, while other gene products are involved in nutrient acquisition, general stress responses and LPS O-antigen biosynthesis. Deletion of the glycosyltransferase gene wbxB and a histone-like nucleoid structuring (H-NS) protein-encoding gene (BCAL0154) reduced bacterial accumulation and attenuated virulence in C. elegans. Further analysis using quantitative RT-PCR indicated that BCAL0154 modulates B. cenocepacia pathogenesis via transcriptional regulation of motility-associated genes including fliC, fliG, flhD, and cheB1. This screen has successfully identified genes required for B. cenocepacia survival within the host-associated environment, many of which are potential targets for developing new antimicrobials.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Tong, Jingfeng; Meng, Lu; Wang, Xinwei; Liu, Lixia; Lyu, Liangdong; Wang, Chuan; Li, Yang; Gao, Qian; Yang, Chen; Niu, Chen
2016-01-01
Lipids have been identified as important carbon sources for Mycobacterium tuberculosis (Mtb) to utilize in vivo. Thus gluconeogenesis bears a key role for Mtb to survive and replicate in host. A rate-limiting enzyme of gluconeogenesis, fructose 1, 6-bisphosphatase (FBPase) is encoded by the gene glpX. The functions of glpX were studied in M. marinum, a closely related species to Mtb. The glpX deletion strain (ΔglpX) displayed altered gluconeogenesis, attenuated virulence, and altered bacterial proliferation. Metabolic profiles indicate an accumulation of the FBPase substrate, fructose 1, 6-bisphosphate (FBP) and altered gluconeogenic flux when ΔglpX is cultivated in a gluconeogenic carbon substrate, acetate. In both macrophages and zebrafish, the proliferation of ΔglpX was halted, resulting in dramatically attenuated virulence. Intracellular ΔglpX exhibited an elongated morphology, which was also observed when ΔglpX was grown in a gluconeogenic carbon source. This elongated morphology is also supported by the observation of unseparated multi-nucleoid cell, indicating that a complete mycobacterial division in vivo is correlated with intact gluconeogenesis. Together, our results indicate that glpX has essential functions in gluconeogenesis, and plays an indispensable role in bacterial proliferation in vivo and virulence of M. marinum.
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Wang, Yan; Zhang, Yiquan; Yin, Zhe; Wang, Jie; Zhu, Yongzhe; Peng, Haoran; Zhou, Dongsheng; Qi, Zhongtian; Yang, Wenhui
2018-01-01
Swarming motility is ultimately mediated by the proton-powered lateral flagellar (laf) system in Vibrio parahaemolyticus. Expression of laf genes is tightly regulated by a number of environmental conditions and regulatory factors. The nucleoid-associated DNA-binding protein H-NS is a small and abundant protein that is widely distributed in bacteria, and H-NS-like protein-dependent expression of laf genes has been identified in Vibrio cholerae and V. parahaemolyticus. The data presented here show that H-NS acts as a repressor of the swarming motility in V. parahaemolyticus. A single σ 28 -dependent promoter was detected for lafA encoding the flagellin of the lateral flagella, and its activity was directly repressed by H-NS. Thus, H-NS represses swarming motility by directly acting on lafA. Briefly, this work revealed a novel function for H-NS as a repressor of the expression of lafA and swarming motility in V. parahaemolyticus.
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
The terminal region of the E. coli chromosome localises at the periphery of the nucleoid
Directory of Open Access Journals (Sweden)
Stouf Mathieu
2011-02-01
Full Text Available Abstract Background Bacterial chromosomes are organised into a compact and dynamic structures termed nucleoids. Cytological studies in model rod-shaped bacteria show that the different regions of the chromosome display distinct and specific sub-cellular positioning and choreographies during the course of the cell cycle. The localisation of chromosome loci along the length of the cell has been described. However, positioning of loci across the width of the cell has not been determined. Results Here, we show that it is possible to assess the mean positioning of chromosomal loci across the width of the cell using two-dimension images from wide-field fluorescence microscopy. Observed apparent distributions of fluorescent-tagged loci of the E. coli chromosome along the cell diameter were compared with simulated distributions calculated using a range of cell width positioning models. Using this method, we detected the migration of chromosome loci towards the cell periphery induced by production of the bacteriophage T4 Ndd protein. In the absence of Ndd production, loci outside the replication terminus were located either randomly along the nucleoid width or towards the cell centre whereas loci inside the replication terminus were located at the periphery of the nucleoid in contrast to other loci. Conclusions Our approach allows to reliably observing the positioning of chromosome loci along the width of E. coli cells. The terminal region of the chromosome is preferentially located at the periphery of the nucleoid consistent with its specific roles in chromosome organisation and dynamics.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
In vitro-reconstituted nucleoids can block mitochondrial DNA replication and transcription
Farge, Géraldine; Mehmedovic, Majda; Baclayon, Marian; van den Wildenberg, Siet M J L; Roos, Wouter H; Gustafsson, Claes M; Wuite, Gijs J L; Falkenberg, Maria
2014-01-01
The mechanisms regulating the number of active copies of mtDNA are still unclear. A mammalian cell typically contains 1,000-10,000 copies of mtDNA, which are packaged into nucleoprotein complexes termed nucleoids. The main protein component of these structures is mitochondrial transcription factor A
Association of Candidate Genes With Submergence Response in Perennial Ryegrass
Directory of Open Access Journals (Sweden)
Xicheng Wang
2017-05-01
Full Text Available Perennial ryegrass is a popular cool-season grass species due to its high quality for forage and turf. The objective of this study was to identify associations of candidate genes with growth and physiological traits to submergence stress and recovery after de-submergence in a global collection of 94 perennial ryegrass accessions. Accessions varied largely in leaf color, plant height (HT, leaf fresh weight (LFW, leaf dry weight (LDW, and chlorophyll fluorescence (Fv/Fm at 7 days of submergence and in HT, LFW and LDW at 7 days of recovery in two experiments. Among 26 candidate genes tested by various models, single nucleotide polymorphisms (SNPs in 10 genes showed significant associations with traits including 16 associations for control, 10 for submergence, and 8 for recovery. Under submergence, Lp1-SST encoding sucrose:sucrose 1-fructosyltransferase and LpGA20ox encoding gibberellin 20-oxidase were associated with LFW and LDW, and LpACO1 encoding 1-aminocyclopropane-1-carboxylic acid oxidase was associated with LFW. Associations between Lp1-SST and HT, Lp6G-FFT encoding fructan:fructan 6G-fructosyltransferase and Fv/Fm, LpCAT encoding catalase and HT were also detected under submergence stress. Upon de-submergence, Lp1-SST, Lp6G-FFT, and LpPIP1 encoding plasma membrane intrinsic protein type 1 were associated with LFW or LDW, while LpCBF1b encoding C-repeat binding factor were associated with HT. Nine significant SNPs in Lp1-SST, Lp6G-FFT, LpCAT, and LpACO1 resulted in amino acid changes with five substitutions found in Lp1-SST under submergence or recovery. The results indicated that allelic diversity in genes involved in carbohydrate and antioxidant metabolism, ethylene and gibberellin biosynthesis, and transcript factor could contribute to growth variations in perennial ryegrass under submergence stress and recovery after de-submergence.
Chromosome replication, cell growth, division and shape: a personal perspective
Directory of Open Access Journals (Sweden)
Arieh eZaritsky
2015-08-01
Full Text Available The origins of Molecular Biology and Bacterial Physiology are reviewed, from our personal standpoints, emphasizing the coupling between bacterial growth, chromosome replication and cell division, dimensions and shape. Current knowledge is discussed with historical perspective, summarizing past and present achievements and enlightening ideas for future studies. An interactive simulation program of the Bacterial Cell Division Cycle (BCD, described as The Central Dogma in Bacteriology, is briefly represented. The coupled process of transcription/translation of genes encoding membrane proteins and insertion into the membrane (so-called transertion is invoked as the functional relationship between the only two unique macromolecules in the cell, DNA and peptidoglycan embodying the nucleoid and the sacculus respectively. We envision that nucleoid complexity, defined as the weighted-mean DNA content associated with the replication terminus, is directly related to cell shape through the transertion process. Accordingly, the primary signal for cell division transmitted by DNA dynamics (replication, transcription and segregation to the peptidoglycan biosynthetic machinery is of a physico-chemical nature, eg stress in the plasma membrane, relieving nucleoid occlusion in the cell's center hence enabling the divisome to assemble and function between segregated daughter nucleoids.
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
DEFF Research Database (Denmark)
Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther
2009-01-01
). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Restricted diffusion of DNA segments within the isolated Escherichia coli nucleoid.
Cunha, S.; Woldringh, C.L.; Odijk, T.
2005-01-01
To study the dynamics and organization of the DNA within isolated Escherichia coli nucleoids, we track the movement of a specific DNA region. Labeling of such a region is achieved using the Lac-O/Lac-I system. The Lac repressor-GFP fusion protein binds to the DNA section where tandem repeats of the
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
E. coli Fis protein insulates the cbpA gene from uncontrolled transcription.
Chintakayala, Kiran; Singh, Shivani S; Rossiter, Amanda E; Shahapure, Rajesh; Dame, Remus T; Grainger, David C
2013-01-01
The Escherichia coli curved DNA binding protein A (CbpA) is a poorly characterised nucleoid associated factor and co-chaperone. It is expressed at high levels as cells enter stationary phase. Using genetics, biochemistry, and genomics, we have examined regulation of, and DNA binding by, CbpA. We show that Fis, the dominant growth-phase nucleoid protein, prevents CbpA expression in growing cells. Regulation by Fis involves an unusual "insulation" mechanism. Thus, Fis protects cbpA from the effects of a distal promoter, located in an adjacent gene. In stationary phase, when Fis levels are low, CbpA binds the E. coli chromosome with a preference for the intrinsically curved Ter macrodomain. Disruption of the cbpA gene prompts dramatic changes in DNA topology. Thus, our work identifies a novel role for Fis and incorporates CbpA into the growing network of factors that mediate bacterial chromosome structure.
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Energy Technology Data Exchange (ETDEWEB)
Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others
1994-09-15
Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
Directory of Open Access Journals (Sweden)
Schwerin Manfred
2003-06-01
Full Text Available Abstract In this study the mRNA differential display method was applied to identify mastitis-associated expressed DNA sequences based on different expression patterns in mammary gland samples of non-infected and infected udder quarters of a cow. In total, 704 different cDNA bands were displayed in both udder samples. Five hundred-and-thirty two bands, (75.6% were differentially displayed. Ninety prominent cDNA bands were isolated, re-amplified, cloned and sequenced resulting in 87 different sequences. Amongst the 19 expressed sequence tags showing a similarity with previously described genes, the majority of these sequences exhibited homology to protein kinase encoding genes (26.3%, to genes involved in the regulation of gene expression (26.3%, to growth and differentiation factor encoding genes (21.0% and to immune response or inflammation marker encoding genes (21.0%. These sequences were shown to have mastitis-associated expression in the udder samples of animals with and without clinical mastitis by quantitative RT-PCR. They were mapped physically using a bovine-hamster somatic cell hybrid panel and a 5000 rad bovine whole genome radiation hybrid panel. According to their localization in QTL regions based on an established integrated marker/gene-map and their disease-associated expression, four genes (AHCY, PRKDC, HNRPU, OSTF1 were suggested as potentially involved in mastitis defense.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Valkovicova, Lenka; Vavrova, Silvia Minarikova; Mravec, Jozef; Grones, Jozef; Turna, Jan
2013-12-01
Gene cluster "ter" conferring high tellurite resistance has been identified in various pathogenic bacteria including Escherichia coli O157:H7. However, the precise mechanism as well as the molecular function of the respective gene products is unclear. Here we describe protein-protein association and localization analyses of four essential Ter proteins encoded by minimal resistance-conferring fragment (terBCDE) by means of recombinant expression. By using a two-plasmid complementation system we show that the overproduced single Ter proteins are not able to mediate tellurite resistance, but all Ter members play an irreplaceable role within the cluster. We identified several types of homotypic and heterotypic protein-protein associations among the Ter proteins by in vitro and in vivo pull-down assays and determined their cellular localization by cytosol/membrane fractionation. Our results strongly suggest that Ter proteins function involves their mutual association, which probably happens at the interface of the inner plasma membrane and the cytosol.
Directory of Open Access Journals (Sweden)
Saki Kondo
Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
International Nuclear Information System (INIS)
Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin
2006-01-01
Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Srivastava, Preeti; Demarre, Gäelle; Karpova, Tatiana S; McNally, James; Chattoraj, Dhruba K
2007-10-01
MreB is an actin homolog required for the morphogenesis of most rod-shaped bacteria and for other functions, including chromosome segregation. In Caulobacter crescentus and Escherichia coli, the protein seems to play a role in the segregation of sister origins, but its role in Bacillus subtilis chromosome segregation is less clear. To help clarify its role in segregation, we have here studied the protein in Vibrio cholerae, whose chromosome I segregates like the one in C. crescentus and whose chromosome II like the one in E. coli or B. subtilis. The properties of Vibrio MreB were similar to those of its homologs in other bacteria in that it formed dynamic helical filaments, was essential for viability, and was inhibited by the drug A22. Wild-type (WT) cells exposed to A22 became spherical and larger. The nucleoids enlarged correspondingly, and the origin positions for both the chromosomes no longer followed any fixed pattern. However, the sister origins separated, unlike the situation in other bacteria. In mutants isolated as A22 resistant, the nucleoids in some cases appeared compacted even when the cell shape was nearly normal. In these cells, the origins of chromosome I were at the distal edges of the nucleoid but not all the way to the poles where they normally reside. The sister origins of chromosome II also separated less. Thus, it appears that the inhibition or alteration of Vibrio MreB can affect both the nucleoid morphology and origin localization.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Charged residues in the H-NS linker drive DNA binding and gene silencing in single cells.
Gao, Yunfeng; Foo, Yong Hwee; Winardhi, Ricksen S; Tang, Qingnan; Yan, Jie; Kenney, Linda J
2017-11-21
Nucleoid-associated proteins (NAPs) facilitate chromosome organization in bacteria, but the precise mechanism remains elusive. H-NS is a NAP that also plays a major role in silencing pathogen genes. We used genetics, single-particle tracking in live cells, superresolution microscopy, atomic force microscopy, and molecular dynamics simulations to examine H-NS/DNA interactions in single cells. We discovered a role for the unstructured linker region connecting the N-terminal oligomerization and C-terminal DNA binding domains. In the present work we demonstrate that linker amino acids promote engagement with DNA. In the absence of linker contacts, H-NS binding is significantly reduced, although no change in chromosome compaction is observed. H-NS is not localized to two distinct foci; rather, it is scattered all around the nucleoid. The linker makes DNA contacts that are required for gene silencing, while chromosome compaction does not appear to be an important H-NS function.
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Primary structure and mapping of the hupA gene of Salmonella typhimurium.
Higgins, N P; Hillyard, D
1988-01-01
In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. Comparison of hupA of E. coli and S. typhimurium revealed that the HU-2 proteins were identical and that there was high conservation of nucleotide sequences outside the coding frames of the genes. A 300-member genomic library of S. typhimurium was constructed by using random transposition of MudP, a specialized chimeric P22-Mu phage that packages chromosomal DNA unidirectionally from its insertion point. Oligonucleotide hybridization against the library identified one MudP insertion that lies within 28 kilobases of hupA; the MudP was 12% linked to purH at 90.5 min on the standard map. Plasmids expressing HU-2 had a surprising phenotype; they caused growth arrest when they were introduced into E. coli strains bearing a himA or hip mutation. These results suggest that IHF and HU have interactive roles in bacteria. Images PMID:3056912
Force-extension behavior of DNA in the presence of DNA-bending nucleoid associated proteins
Dahlke, K.; Sing, C. E.
2018-02-01
Interactions between nucleoid associated proteins (NAPs) and DNA affect DNA polymer conformation, leading to phenomena such as concentration dependent force-extension behavior. These effects, in turn, also impact the local binding behavior of the protein, such as high forces causing proteins to unbind, or proteins binding favorably to locally bent DNA. We develop a coarse-grained NAP-DNA simulation model that incorporates both force- and concentration-dependent behaviors, in order to study the interplay between NAP binding and DNA conformation. This model system includes multi-state protein binding and unbinding, motivated by prior work, but is now dependent on the local structure of the DNA, which is related to external forces acting on the DNA strand. We observe the expected qualitative binding behavior, where more proteins are bound at lower forces than at higher forces. Our model also includes NAP-induced DNA bending, which affects DNA elasticity. We see semi-quantitative matching of our simulated force-extension behavior to the reported experimental data. By using a coarse-grained simulation, we are also able to look at non-equilibrium behaviors, such as dynamic extension of a DNA strand. We stretch a DNA strand at different rates and at different NAP concentrations to observe how the time scales of the system (such as pulling time and unbinding time) work in concert. When these time scales are similar, we observe measurable rate-dependent changes in the system, which include the number of proteins bound and the force required to extend the DNA molecule. This suggests that the relative time scales of different dynamic processes play an important role in the behavior of NAP-DNA systems.
Finster, Sabrina; Eggert, Erik; Zoschke, Reimo; Weihe, Andreas; Schmitz-Linneweber, Christian
2013-12-01
Plastid genes are transcribed by two types of RNA polymerases: a plastid-encoded eubacterial-type RNA polymerase (PEP) and nuclear-encoded phage-type RNA polymerases (NEPs). To investigate the spatio-temporal expression of PEP, we tagged its α-subunit with a hemagglutinin epitope (HA). Transplastomic tobacco plants were generated and analyzed for the distribution of the tagged polymerase in plastid sub-fractions, and associated genes were identified under various light conditions. RpoA:HA was detected as early as the 3rd day after imbibition, and was constitutively expressed in green tissue over 60 days of plant development. We found that the tagged polymerase subunit preferentially associated with the plastid membranes, and was less abundant in the soluble stroma fraction. Attachment of RpoA:HA to the membrane fraction during early seedling development was independent of DNA, but at later stages of development, DNA appears to facilitate attachment of the polymerase to membranes. To survey PEP-dependent transcription units, we probed for nucleic acids enriched in RpoA:HA precipitates using a tobacco chloroplast whole-genome tiling array. The most strongly co-enriched DNA fragments represent photosynthesis genes (e.g. psbA, psbC, psbD and rbcL), whose expression is known to be driven by PEP promoters, while NEP-dependent genes were less abundant in RpoA:HA precipitates. Additionally, we demonstrate that the association of PEP with photosynthesis-related genes was reduced during the dark period, indicating that plastome-wide PEP-DNA association is a light-dependent process. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
International Nuclear Information System (INIS)
Heinzelmann, R.
1987-01-01
The reaction to irradiation of thymocytes was tested immediately and 6 hours after whole body X-irradiation of rats with doses from 190 cGy up to 1520 cGy by nucleoid sedimentation. For comparison, examinations of thymus and spleen cells after X-irradiation in vitro were done. Preliminary analyses should find a possible coergism between X-rays on one side and hyperthermia and inhibitors of DNA-synthesis or DNA-repair (cytosinearabinoside, dideoxythymidine, 3-amino-benzamide, ethidiumbromide, and novobiocine) on the other side. From the results the following conclusions may be drawn: 1) With respect to the detection of in vivo effects of X-irradiation, the nucleoid sedimentation is less sensitive than biochemical methods. 2) Some hours after sublethal X-irradiation in vivo, free DNA and/or polydesoxyribonucleotides appear. At the same time cross-links can be detected in the chromatin fraction. 3) The reduction of the nucleoid sedimentation immediately after high doses of whole-body irradiation is the result of primary DNA lesions. The changes detectable some hours after are due to the secondary enzymatic changes, that are connected with the interphase death of thymocytes, and coincide with the present opinions about the irradiation induced apoptosis of cells. (orig./ECB) [de
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Differentially expressed genes associated with dormancy or germination of Arabidopsis thaliana seeds
Toorop, P.E.; Barroco, R.M.; Engler, G.; Groot, S.P.C.; Hilhorst, H.W.M.
2005-01-01
Differential display analysis using dormant and non-dormant Arabidopsis thaliana (L.) Heynh seeds resulted in a set of genes that were associated with either dormancy or germination. Expression of the germination-associated genes AtRPL36B and AtRPL27B, encoding two ribosomal proteins, was
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Directory of Open Access Journals (Sweden)
Vargas-Alarcon Gilberto
2012-02-01
Full Text Available Abstract Background A consistent line of investigation suggests that autonomic nervous system dysfunction may explain the multi-system features of fibromyalgia (FM; and that FM is a sympathetically maintained neuropathic pain syndrome. Dorsal root ganglia (DRG are key sympathetic-nociceptive short-circuit sites. Sodium channels located in DRG (particularly Nav1.7 act as molecular gatekeepers for pain detection. Nav1.7 is encoded in gene SCN9A of chromosome 2q24.3 and is predominantly expressed in the DRG pain-sensing neurons and sympathetic ganglia neurons. Several SCN9A sodium channelopathies have been recognized as the cause of rare painful dysautonomic syndromes such as paroxysmal extreme pain disorder and primary erythromelalgia. The aim of this study was to search for an association between fibromyalgia and several SCN9A sodium channels gene polymorphisms. Methods We studied 73 Mexican women suffering from FM and 48 age-matched women who considered themselves healthy. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ. Genomic DNA from whole blood containing EDTA was extracted by standard techniques. The following SCN9A single-nucleotide polymorphisms (SNP were determined by 5' exonuclease TaqMan assays: rs4371369; rs4387806; rs4453709; rs4597545; rs6746030; rs6754031; rs7607967; rs12620053; rs12994338; and rs13017637. Results The frequency of the rs6754031 polymorphism was significantly different in both groups (P = 0.036 mostly due to an absence of the GG genotype in controls. Interestingly; patients with this rs6754031 GG genotype had higher FIQ scores (median = 80; percentile 25/75 = 69/88 than patients with the GT genotype (median = 63; percentile 25/75 = 58/73; P = 0.002 and the TT genotype (median = 71; percentile 25/75 = 64/77; P = 0.001. Conclusion In this ethnic group; a disabling form of FM is associated to a particular SCN9A sodium channel gene variant. These preliminary results raise the possibility that
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Physical descriptions of the bacterial nucleoid at large scales, and their biological implications
Energy Technology Data Exchange (ETDEWEB)
Benza, Vincenzo G [Dipartimento di Fisica e Matematica, Universita dell' Insubria, Como (Italy); Bassetti, Bruno [Universita degli Studi di Milano, Dip. Fisica, Via Celoria 16, 20133 Milano (Italy); Dorfman, Kevin D [Department of Chemical Engineering and Materials Science, University of Minnesota-Twin Cities, 421 Washington Ave. SE, Minneapolis, MN 55455 (United States); Scolari, Vittore F; Lagomarsino, Marco Cosentino [CNRS, UMR 7238 ' Microorganism Genomics' , Genomic Physics Group (France); Bromek, Krystyna; Cicuta, Pietro [Cavendish Laboratory, University of Cambridge, Cambridge CB3 0HE (United Kingdom)
2012-07-15
Recent experimental and theoretical approaches have attempted to quantify the physical organization (compaction and geometry) of the bacterial chromosome with its complement of proteins (the nucleoid). The genomic DNA exists in a complex and dynamic protein-rich state, which is highly organized at various length scales. This has implications for modulating (when not directly enabling) the core biological processes of replication, transcription and segregation. We overview the progress in this area, driven in the last few years by new scientific ideas and new interdisciplinary experimental techniques, ranging from high space- and time-resolution microscopy to high-throughput genomics employing sequencing to map different aspects of the nucleoid-related interactome. The aim of this review is to present the wide spectrum of experimental and theoretical findings coherently, from a physics viewpoint. In particular, we highlight the role that statistical and soft condensed matter physics play in describing this system of fundamental biological importance, specifically reviewing classic and more modern tools from the theory of polymers. We also discuss some attempts toward unifying interpretations of the current results, pointing to possible directions for future investigation. (review article)
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Rossin, Elizabeth J.; Lage, Kasper; Raychaudhuri, Soumya; Xavier, Ramnik J.; Tatar, Diana; Benita, Yair
2011-01-01
Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed by these risk variants. It has previously been observed that different genes harboring causal mutations for the same Mendelian disease often physically interact. We sought to evaluate the degree to which this is true of genes within strongly associated loci in complex disease. Using sets of loci defined in rheumatoid arthritis (RA) and Crohn's disease (CD) GWAS, we build protein–protein interaction (PPI) networks for genes within associated loci and find abundant physical interactions between protein products of associated genes. We apply multiple permutation approaches to show that these networks are more densely connected than chance expectation. To confirm biological relevance, we show that the components of the networks tend to be expressed in similar tissues relevant to the phenotypes in question, suggesting the network indicates common underlying processes perturbed by risk loci. Furthermore, we show that the RA and CD networks have predictive power by demonstrating that proteins in these networks, not encoded in the confirmed list of disease associated loci, are significantly enriched for association to the phenotypes in question in extended GWAS analysis. Finally, we test our method in 3 non-immune traits to assess its applicability to complex traits in general. We find that genes in loci associated to height and lipid levels assemble into significantly connected networks but did not detect excess connectivity among Type 2 Diabetes (T2D) loci beyond chance. Taken together, our results constitute evidence that, for many of the complex diseases studied here, common genetic associations implicate regions encoding proteins that physically interact in a preferential manner, in
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Yun, Choong-Soo; Suzuki, Chiho; Naito, Kunihiko; Takeda, Toshiharu; Takahashi, Yurika; Sai, Fumiya; Terabayashi, Tsuguno; Miyakoshi, Masatoshi; Shintani, Masaki; Nishida, Hiromi; Yamane, Hisakazu; Nojiri, Hideaki
2010-09-01
Histone-like protein H1 (H-NS) family proteins are nucleoid-associated proteins (NAPs) conserved among many bacterial species. The IncP-7 plasmid pCAR1 is transmissible among various Pseudomonas strains and carries a gene encoding the H-NS family protein, Pmr. Pseudomonas putida KT2440 is a host of pCAR1, which harbors five genes encoding the H-NS family proteins PP_1366 (TurA), PP_3765 (TurB), PP_0017 (TurC), PP_3693 (TurD), and PP_2947 (TurE). Quantitative reverse transcription-PCR (qRT-PCR) demonstrated that the presence of pCAR1 does not affect the transcription of these five genes and that only pmr, turA, and turB were primarily transcribed in KT2440(pCAR1). In vitro pull-down assays revealed that Pmr strongly interacted with itself and with TurA, TurB, and TurE. Transcriptome comparisons of the pmr disruptant, KT2440, and KT2440(pCAR1) strains indicated that pmr disruption had greater effects on the host transcriptome than did pCAR1 carriage. The transcriptional levels of some genes that increased with pCAR1 carriage, such as the mexEF-oprN efflux pump genes and parI, reverted with pmr disruption to levels in pCAR1-free KT2440. Transcriptional levels of putative horizontally acquired host genes were not altered by pCAR1 carriage but were altered by pmr disruption. Identification of genome-wide Pmr binding sites by ChAP-chip (chromatin affinity purification coupled with high-density tiling chip) analysis demonstrated that Pmr preferentially binds to horizontally acquired DNA regions. The Pmr binding sites overlapped well with the location of the genes differentially transcribed following pmr disruption on both the plasmid and the chromosome. Our findings indicate that Pmr is a key factor in optimizing gene transcription on pCAR1 and the host chromosome.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Directory of Open Access Journals (Sweden)
Zhou Yong
2018-01-01
Full Text Available Stress associated proteins (SAPs play important roles in developmental processes, responses to various stresses and hormone stimulation in plants. However, little is known about the SAP gene family in Medicago truncatula. In this study, a total of 17 MtSAP genes encoding A20/AN1 zinc-finger proteins were characterized. Out of these 17 genes, 15 were distributed over all 8 chromosomes at different densities, and two segmental duplication events were detected. The phylogenetic analysis of these proteins and their orthologs from Arabidopsis and rice suggested that they could be classified into five out of the seven groups of SAP family genes, with genes in the same group showing similar structures and conserved domains. The cis-elements of the MtSAP promoters were studied, and many cis-elements related to stress and plant hormone responses were identified. We also investigated the stress-responsive expression patterns of the MtSAP genes under various stresses, including drought, exposure to NaCl and cold. The qRT-PCR results showed that numerous MtSAP genes exhibited transcriptional responses to multiple abiotic stresses. These results lay the foundation for further functional characterization of SAP genes. To the best of our knowledge, this is the first report of a genome-wide analysis of the SAP gene family in M. truncatula.
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Directory of Open Access Journals (Sweden)
Hsin-Chou Yang
Full Text Available Hypertension is a complex disorder with high prevalence rates all over the world. We conducted the first genome-wide gene-based association scan for hypertension in a Han Chinese population. By analyzing genome-wide single-nucleotide-polymorphism data of 400 matched pairs of young-onset hypertensive patients and normotensive controls genotyped with the Illumina HumanHap550-Duo BeadChip, 100 susceptibility genes for hypertension were identified and also validated with permutation tests. Seventeen of the 100 genes exhibited differential allelic and expression distributions between patient and control groups. These genes provided a good molecular signature for classifying hypertensive patients and normotensive controls. Among the 17 genes, IGF1, SLC4A4, WWOX, and SFMBT1 were not only identified by our gene-based association scan and gene expression analysis but were also replicated by a gene-based association analysis of the Hong Kong Hypertension Study. Moreover, cis-acting expression quantitative trait loci associated with the differentially expressed genes were found and linked to hypertension. IGF1, which encodes insulin-like growth factor 1, is associated with cardiovascular disorders, metabolic syndrome, decreased body weight/size, and changes of insulin levels in mice. SLC4A4, which encodes the electrogenic sodium bicarbonate cotransporter 1, is associated with decreased body weight/size and abnormal ion homeostasis in mice. WWOX, which encodes the WW domain-containing protein, is related to hypoglycemia and hyperphosphatemia. SFMBT1, which encodes the scm-like with four MBT domains protein 1, is a novel hypertension gene. GRB14, TMEM56 and KIAA1797 exhibited highly significant differential allelic and expressed distributions between hypertensive patients and normotensive controls. GRB14 was also found relevant to blood pressure in a previous genetic association study in East Asian populations. TMEM56 and KIAA1797 may be specific to
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
International Nuclear Information System (INIS)
Wang, J.; Basu, H.S.; Hu, L.; Feuerstein, B.G.; Deen, D.F.
1995-01-01
Nucleoid halo diameters were measured to assay changes in DNA supercoiling in human brain tumor cell line SF-126 after irradiation under aerobic or hypoxic conditions. In unirradiated aerobic cells, a typical propidium iodide titration curve showed that with increasing concentrations of propodium iodide, the halo diameter increased and then decreased with the unwinding and subsequent rewinding of DNA supercoils. In irradiated cells, the rewinding of DNA supercoils was inhibited, resulting in an increased halo diameter, in a radiation dose-dependent manner. To produce equal increases in halo diameter required about a threefold higher radiation dose in hypoxic cells than in aerobic cells. Quantitatively similiar differences in the radiation sensitivities of hypoxic and aerobic cells were demonstrated by a colony-forming efficiency assay. These findings suggest that the nucleoid halo assay may be used as a rapid measure of the inherent radiation sensitivity of human tumors. 22 refs., 5 figs
Are Toll-like receptor gene polymorphisms associated with prostate cancer?
International Nuclear Information System (INIS)
Kutikhin, Anton G; Yuzhalin, Arseniy E
2012-01-01
The suggestion that there is a connection between chronic intraprostatic inflammation and prostate cancer was declared some years ago. As Toll-like receptors (TLRs) are the key players in the processes of chronic intraprostatic inflammation, there is a hypothesis that TLR gene polymorphisms may be associated with prostate cancer risk. Although a number of comprehensive studies have been conducted on large samples in various countries, reliable connections between these single nucleotide polymorphisms and prostate cancer risk, stage, grade, aggressiveness, ability to metastasize, and mortality have not been detected. Results have also varied slightly in different populations. The data obtained regarding the absence of connection between the polymorphisms of the genes encoding interleukin-1 receptor-associated kinases (IRAK1 and IRAK4) and prostate cancer risk might indicate a lack of association between inherited variation in the TLR signaling pathway and prostate cancer risk. It is possible to consider that polymorphisms of genes encoding TLRs and proteins of the TLR pathway also do not play a major role in the etiology and pathogenesis of prostate cancer. Feasibly, it would be better to focus research on associations between TLR single nucleotide polymorphisms and cancer risk in other infection-related cancer types
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Kawano, Mitsuoki; Oshima, Taku; Kasai, Hiroaki; Mori, Hirotada
2002-07-01
Genome sequence analyses of Escherichia coli K-12 revealed four copies of long repetitive elements. These sequences are designated as long direct repeat (LDR) sequences. Three of the repeats (LDR-A, -B, -C), each approximately 500 bp in length, are located as tandem repeats at 27.4 min on the genetic map. Another copy (LDR-D), 450 bp in length and nearly identical to LDR-A, -B and -C, is located at 79.7 min, a position that is directly opposite the position of LDR-A, -B and -C. In this study, we demonstrate that LDR-D encodes a 35-amino-acid peptide, LdrD, the overexpression of which causes rapid cell killing and nucleoid condensation of the host cell. Northern blot and primer extension analysis showed constitutive transcription of a stable mRNA (approximately 370 nucleotides) encoding LdrD and an unstable cis-encoded antisense RNA (approximately 60 nucleotides), which functions as a trans-acting regulator of ldrD translation. We propose that LDR encodes a toxin-antitoxin module. LDR-homologous sequences are not pre-sent on any known plasmids but are conserved in Salmonella and other enterobacterial species.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Directory of Open Access Journals (Sweden)
Anne-Sophie Coquel
2013-04-01
Full Text Available Aggregates of misfolded proteins are a hallmark of many age-related diseases. Recently, they have been linked to aging of Escherichia coli (E. coli where protein aggregates accumulate at the old pole region of the aging bacterium. Because of the potential of E. coli as a model organism, elucidating aging and protein aggregation in this bacterium may pave the way to significant advances in our global understanding of aging. A first obstacle along this path is to decipher the mechanisms by which protein aggregates are targeted to specific intercellular locations. Here, using an integrated approach based on individual-based modeling, time-lapse fluorescence microscopy and automated image analysis, we show that the movement of aging-related protein aggregates in E. coli is purely diffusive (Brownian. Using single-particle tracking of protein aggregates in live E. coli cells, we estimated the average size and diffusion constant of the aggregates. Our results provide evidence that the aggregates passively diffuse within the cell, with diffusion constants that depend on their size in agreement with the Stokes-Einstein law. However, the aggregate displacements along the cell long axis are confined to a region that roughly corresponds to the nucleoid-free space in the cell pole, thus confirming the importance of increased macromolecular crowding in the nucleoids. We thus used 3D individual-based modeling to show that these three ingredients (diffusion, aggregation and diffusion hindrance in the nucleoids are sufficient and necessary to reproduce the available experimental data on aggregate localization in the cells. Taken together, our results strongly support the hypothesis that the localization of aging-related protein aggregates in the poles of E. coli results from the coupling of passive diffusion-aggregation with spatially non-homogeneous macromolecular crowding. They further support the importance of "soft" intracellular structuring (based on
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
A Model of H-NS Mediated Compaction of Bacterial DNA
Joyeux, M.; Vreede, J.
2013-01-01
The histone-like nucleoid structuring protein (H-NS) is a nucleoid-associated protein, which is involved in both gene regulation and DNA compaction. H-NS can bind to DNA in two different ways: in trans, by binding to two separate DNA duplexes, or in cis, by binding to different sites on the same
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Noar, Roslyn D; Daub, Margaret E
2016-08-30
Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of
Neutron activation analysis of antimony in chromatin and nucleoids of HeLa cells
International Nuclear Information System (INIS)
Ashry, H.A.; Topaloglou, A.; Altmann, H.
1988-02-01
Antimony seems to be cancerogenic in men. In the present investigations we tried to find out if Sb +++ are also bound to the cell nucleus. HeLa cells were incubated with SbCl 3 and after a 18 h incubation time cells were lysed and crude chromatin isolated. In this preparation Sb was determined by neutron activation analysis. From the same cell culture nucleoids were prepared by ultracentrifugation and also Sb detected in these structures. 12 refs., 2 tabs. (Author)
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Belkina, G G; Pogul'skaia, E V; Iurina, N P
2004-01-01
DNA topoisomerase was isolated for the first time from nucleoids of white mustard (Sinapis alba L.) chloroplasts. The enzyme had a molecular weight of 70 kDa; it was ATP-independent, required the presence of mono- (K+) and bivalent (Mg2+) cations, and was capable of relaxing both negatively and positively supercoiled DNA. These results suggest that the enzyme isolated belongs to type IB DNA topoisomerases.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
International Nuclear Information System (INIS)
Alth, G.; Weniger, P.; Turtzer, K.; Klein, W.; Kocsis, F.; Krankenhaus der Stadt Wien-Lainz; Oesterreichisches Forschungszentrum Seibersdorf G.m.b.H. Inst. fuer Biologie)
1982-01-01
In order to find out possible differences of the biologic efficacy of rapid electrons of different energies, the authors examined the influence of rapid electrons of 20 MeV and 45 MeV upon the survival rate of Hela cells S3, their cell growth, DNA synthesis, DNA reparation, and sedimentation of nucleoids. The results show a difference only for the nucleoid sedimentation, i.e. there are more fractured DNA cords after 45 MeV irradiation. No significant differences could be demonstrated for the parameters of the survival curve, DNA synthesis and DNA reparation. Four double tests were carried out corresponding to the indicated types of examination. (orig.) [de
Marques, T; Patente, T A; Monteiro, M B; Cavaleiro, A M; Queiroz, M S; Nery, M; de Azevedo, M J; Canani, L H; Parisi, M C; Moura-Neto, A; Passarelli, M; Giannella-Neto, D; Machado, U F; Corrêa-Giannella, M L
2015-04-15
Mesangial cells subject to high extracellular glucose concentrations, as occur in hyperglycaemic states, are unable to down regulate glucose influx, resulting in intracellular activation of deleterious biochemical pathways. A high expression of GLUT1 participates in the development of diabetic glomerulopathy. Variants in the gene encoding GLUT1 (SLC2A1) have been associated to this diabetic complication. The aim of this study was to test whether polymorphisms in SLC2A1 confer susceptibility to diabetic nephropathy (DN) in Brazilian type 1 diabetes patients. Four polymorphisms (rs3820589, rs1385129, rs841847 and rs841848) were genotyped in a Brazilian cohort comprised of 452 patients. A prospective analysis was performed in 155 patients. Mean duration of follow-up was 5.6 ± 2.4 years and the incidence of renal events was 18.0%. The rs3820589 presented an inverse association with the prevalence of incipient DN (OR: 0.36, 95% CI: 0.16 - 0.80, p=0.01) and with progression to renal events (HR: 0.20; 95% CI: 0.03 - 0.70; p=0.009). AGGT and AGAC haplotypes were associated with the prevalence of incipient DN and the AGAC haplotype was also associated with the prevalence of established/advanced DN. In conclusion, rs3820589 in the SLC2A1 gene modulates the risk to DN in Brazilian patients with inadequate type 1 diabetes control. Copyright © 2015 Elsevier B.V. All rights reserved.
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Chenthamara, Komal; Zhang, Jian; Atanasova, Lea; Yang, Dongqing; Miao, Youzhi; Grujic, Marica; Pourmehdi, Shadi; Pretzer, Carina; Kopchinskiy, Alexey G.; Hundley, Hope; Wang, Mei; Aerts, Andrea; Salamov, Asaf; Lipzen, Anna; Barry, Kerrie; Grigoriev, Igor V.; Shen, Qirong; Kubicek, Christian P.
2018-01-01
Unlike most other fungi, molds of the genus Trichoderma (Hypocreales, Ascomycota) are aggressive parasites of other fungi and efficient decomposers of plant biomass. Although nutritional shifts are common among hypocrealean fungi, there are no examples of such broad substrate versatility as that observed in Trichoderma. A phylogenomic analysis of 23 hypocrealean fungi (including nine Trichoderma spp. and the related Escovopsis weberi) revealed that the genus Trichoderma has evolved from an ancestor with limited cellulolytic capability that fed on either fungi or arthropods. The evolutionary analysis of Trichoderma genes encoding plant cell wall-degrading carbohydrate-active enzymes and auxiliary proteins (pcwdCAZome, 122 gene families) based on a gene tree / species tree reconciliation demonstrated that the formation of the genus was accompanied by an unprecedented extent of lateral gene transfer (LGT). Nearly one-half of the genes in Trichoderma pcwdCAZome (41%) were obtained via LGT from plant-associated filamentous fungi belonging to different classes of Ascomycota, while no LGT was observed from other potential donors. In addition to the ability to feed on unrelated fungi (such as Basidiomycota), we also showed that Trichoderma is capable of endoparasitism on a broad range of Ascomycota, including extant LGT donors. This phenomenon was not observed in E. weberi and rarely in other mycoparasitic hypocrealean fungi. Thus, our study suggests that LGT is linked to the ability of Trichoderma to parasitize taxonomically related fungi (up to adelphoparasitism in strict sense). This may have allowed primarily mycotrophic Trichoderma fungi to evolve into decomposers of plant biomass. PMID:29630596
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Chu, Chishih; Wei, Yajiun; Chuang, Shih-Te; Yu, Changyou; Changchien, Chih-Hsuan; Su, Yaochi
2013-03-01
A total of 117 mastitis-associated Staphylococcus aureus isolates from cow, goat, and human patients were analyzed for differences in antibiotic susceptibility, virulence genes, and genotypes using accessory gene regulator (agr) typing, pulsed-field gel electrophoresis (PFGE) and multilocus sequence typing (MLST). Multidrug-resistant (MDR) S. aureus were commonly found in all sources, though they were predominantly found in human and goat isolates. Almost 70% of the isolates were resistant to ampicillin and penicillin. Host-associated virulence genes were identified as follows: tst, a gene encoding toxic shock syndrome toxin, was found in goat isolates; lukED and lukM, genes encoding leukocidin, found in cow isolates; lukPV, a gene encoding leukocidin, found in human isolates; and eta, a gene encoding for exfoliative toxin, found in both human and cow isolates. All four types of hemolysin, α, β, γ, and δ, were identified in human isolates, three types (α, γ, and δ), were identified in cow isolates, and two types (α and δ) were identified in goat isolates. Agr-typing determined agr1 to be the main subtype in human and cow isolates. PFGE and MLST analysis revealed the presence of diverse genotypes among the three sources. In conclusion, mastitis-associated, genetically diverse strains of MDR S. aureus differed in virulence genes among human, cow, and goat isolates.
Association between FOXO3A gene polymorphisms and human longevity: a meta-analysis
Bao, Ji-Ming; Song, Xian-Lu; Hong, Ying-Qia; Zhu, Hai-Li; Li, Cui; Zhang, Tao; Chen, Wei; Zhao, Shan-Chao; Chen, Qing
2014-01-01
Numerous studies have shown associations between the FOXO3A gene, encoding the forkhead box O3 transcription factor, and human or specifically male longevity. However, the associations of specific FOXO3A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. A comprehensive search was conducted to identify studies of FOXO3A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% confidence interval...
Association analyses of depression and genes in the hypothalamus-pituitary-adrenal axis
DEFF Research Database (Denmark)
Buttenschøn, Henriette Nørmølle; Krogh, Jesper; Nielsen, Marit Nyholm
2017-01-01
OBJECTIVE: Dysregulation of the hypothalamic-pituitary-adrenal (HPA) axis has been reported in depression. The aim was to investigate the potential association between depression and seven genes regulating or interfering with the HPA axis, including the gene encoding angiotensin converting enzyme......) was investigated. RESULTS: After quality control, 68 genetic variants were left for analyses. Four of nine variants within ACE were nominally associated with depression and a gene-wise association was likewise observed. However, none of the SNPs located within AVP, CRH, CRHR1, CRHR2, FKBP5 or NC3C1 were associated...... with depression. One nominally significant interaction, most likely due to chance, was identified. CONCLUSION: The results indicate that ACE could be a potential candidate gene for depression....
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Directory of Open Access Journals (Sweden)
Dmitry eKremnev
2014-08-01
Full Text Available Chloroplast biogenesis and function is essential for proper plant embryo and seed development but the molecular mechanisms underlying the role of plastids during embryogenesis are poorly understood. Expression of plastid encoded genes is dependent on two different transcription machineries; a plastid-encoded bacterial-type RNA polymerase (PEP and a nuclear-encoded phage-type RNA polymerase (NEP, which recognize distinct types of promoters. However, the division of labor between PEP and NEP during plastid development and in mature chloroplasts is unclear. We show here that PRIN2 and CSP41b, two proteins identified in plastid nucleoid preparations, are essential for proper plant embryo development. Using Co-IP assays and native PAGE we have shown a direct physical interaction between PRIN2 and CSP41b. Moreover, PRIN2 and CSP41b form a distinct protein complex in vitro that binds DNA. The prin2.2 and csp41b-2 single mutants displayed pale phenotypes, abnormal chloroplasts with reduced transcript levels of photosynthesis genes and defects in embryo development. The respective csp41b-2prin2.2 homo/heterozygote double mutants produced abnormal white colored ovules and shrunken seeds. Thus, the csp41b-2prin2.2 double mutant is embryo lethal. In silico analysis of available array data showed that a large number of genes traditionally classified as PEP dependent genes are transcribed during early embryo development from the pre-globular stage to the mature-green-stage. Taken together, our results suggest that PEP activity and consequently the switch from NEP to PEP activity, is essential during embryo development and that the PRIN2-CSP41b DNA binding protein complex possibly is important for full PEP activity during this process.
Czech Academy of Sciences Publication Activity Database
Tauber, Jan; Dlasková, Andrea; Šantorová, Jitka; Smolková, Katarína; Alán, Lukáš; Špaček, Tomáš; Plecitá-Hlavatá, Lydie; Ježek, Petr
2013-01-01
Roč. 45, č. 3 (2013), s. 593-603 ISSN 1357-2725 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA ČR(CZ) GPP304/10/P204; GA ČR(CZ) GAP305/12/1247 Institutional research plan: CEZ:AV0Z50110509 Institutional support: RVO:67985823 Keywords : mitochondrial DNA nucleoids * mitochondrial fission * mitochondrial network fragmentation * mitochondrial network reintegration Subject RIV: ED - Physiology Impact factor: 4.240, year: 2013
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Czech Academy of Sciences Publication Activity Database
Alán, Lukáš; Špaček, Tomáš; Pajuelo-Reguera, David; Jabůrek, Martin; Ježek, Petr
2016-01-01
Roč. 302, Jul 1 (2016), s. 31-40 ISSN 0041-008X R&D Projects: GA ČR(CZ) GAP305/12/1247; GA MŠk(CZ) LQ1604; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : Doxorubicin * Ethidium Bromide * nucleoid clusters * mitochondrial DNA stress * mitochondrial transcription factor A Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.791, year: 2016
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
International Nuclear Information System (INIS)
Togi, Sumihito; Nakasuji, Misa; Muromoto, Ryuta; Ikeda, Osamu; Okabe, Kanako; Kitai, Yuichi; Kon, Shigeyuki; Oritani, Kenji; Matsuda, Tadashi
2015-01-01
Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded latency-associated nuclear antigen (LANA), which interacts with cellular proteins, plays a central role in modification of viral and/or cellular gene expression. Here, we show that LANA associates with glucocorticoid receptor (GR), and that LANA enhances the transcriptional activity of GR. Co-immunoprecipitation revealed a physical interaction between LANA and GR in transiently transfected 293T and HeLa cells. In human B-lymphoma cells, LANA overexpression enhanced GR activity and cell growth suppression following glucocorticoid stimulation. Furthermore, confocal microscopy showed that activated GR was bound to LANA and accumulated in the nucleus, leading to an increase in binding of activated GR to the glucocorticoid response element of target genes. Taken together, KSHV-derived LANA acts as a transcriptional co-activator of GR. Our results might suggest a careful use of glucocorticoids in the treatment of patients with KSHV-related malignancies such as Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman disease. - Highlights: • KSHV-LANA enhances the transcriptional activity of GR in 293T and HeLa cells. • KSHV-LANA physically associates with GR. • KSHV-LANA enhances GR activation and cell growth suppression in human B-lymphocytes. • KSHV-LANA influences the nuclear retention and DNA binding activity of GR
Energy Technology Data Exchange (ETDEWEB)
Togi, Sumihito; Nakasuji, Misa; Muromoto, Ryuta; Ikeda, Osamu; Okabe, Kanako; Kitai, Yuichi; Kon, Shigeyuki [Department of Immunology, Graduate School of Pharmaceutical Sciences Hokkaido University, Sapporo 060-0812 (Japan); Oritani, Kenji [Department of Hematology and Oncology, Graduate School of Medicine, Osaka University, 2-2 Yamada-oka, Suita, Osaka 565-0871 (Japan); Matsuda, Tadashi, E-mail: tmatsuda@pharm.hokudai.ac.jp [Department of Immunology, Graduate School of Pharmaceutical Sciences Hokkaido University, Sapporo 060-0812 (Japan)
2015-07-31
Kaposi's sarcoma-associated herpesvirus (KSHV)-encoded latency-associated nuclear antigen (LANA), which interacts with cellular proteins, plays a central role in modification of viral and/or cellular gene expression. Here, we show that LANA associates with glucocorticoid receptor (GR), and that LANA enhances the transcriptional activity of GR. Co-immunoprecipitation revealed a physical interaction between LANA and GR in transiently transfected 293T and HeLa cells. In human B-lymphoma cells, LANA overexpression enhanced GR activity and cell growth suppression following glucocorticoid stimulation. Furthermore, confocal microscopy showed that activated GR was bound to LANA and accumulated in the nucleus, leading to an increase in binding of activated GR to the glucocorticoid response element of target genes. Taken together, KSHV-derived LANA acts as a transcriptional co-activator of GR. Our results might suggest a careful use of glucocorticoids in the treatment of patients with KSHV-related malignancies such as Kaposi's sarcoma, primary effusion lymphoma, and multicentric Castleman disease. - Highlights: • KSHV-LANA enhances the transcriptional activity of GR in 293T and HeLa cells. • KSHV-LANA physically associates with GR. • KSHV-LANA enhances GR activation and cell growth suppression in human B-lymphocytes. • KSHV-LANA influences the nuclear retention and DNA binding activity of GR.
Kong, Y.; Cave, M. D.; Yang, D.; Zhang, L.; Marrs, C. F.; Foxman, B.; Bates, J. H.; Wilson, F.; Mukasa, L. N.; Yang, Z. H.
2005-01-01
The Mycobacterium tuberculosis genome contains four phospholipase C (PLC)-encoding genes, designated plcA, plcB, plcC, and plcD, respectively. Each of the four genes contributes to the overall PLC activity of M. tuberculosis. PLC is hypothesized to contribute to M. tuberculosis virulence. Infection of M. tuberculosis strains carrying a truncated plcD gene is associated with the occurrence of extrathoracic tuberculosis. However, whether the other three plc genes are also associated with extrat...
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Baltussen, Tim J H; Coolen, Jordy P M; Zoll, Jan; Verweij, Paul E; Melchers, Willem J G
2018-04-26
Aspergillus fumigatus is a saprophytic fungus that extensively produces conidia. These microscopic asexually reproductive structures are small enough to reach the lungs. Germination of conidia followed by hyphal growth inside human lungs is a key step in the establishment of infection in immunocompromised patients. RNA-Seq was used to analyze the transcriptome of dormant and germinating A. fumigatus conidia. Construction of a gene co-expression network revealed four gene clusters (modules) correlated with a growth phase (dormant, isotropic growth, polarized growth). Transcripts levels of genes encoding for secondary metabolites were high in dormant conidia. During isotropic growth, transcript levels of genes involved in cell wall modifications increased. Two modules encoding for growth and cell cycle/DNA processing were associated with polarized growth. In addition, the co-expression network was used to identify highly connected intermodular hub genes. These genes may have a pivotal role in the respective module and could therefore be compelling therapeutic targets. Generally, cell wall remodeling is an important process during isotropic and polarized growth, characterized by an increase of transcripts coding for hyphal growth and cell cycle/DNA processing when polarized growth is initiated. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
John Paul SanGiovanni
Full Text Available Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs and use of peroxisome proliferator activator receptor (PPAR-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG co-activator 1 alpha (PPARGC1A, a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR transcription complex, may influence neovascularization (NV in age-related macular degeneration (AMD.We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A.A DNA coding variant (rs3736265 and a 3'UTR-resident regulatory variant (rs3774923 in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs. SNP-SNP interactions existed for NV AMD (P<0.005 with rs3736265 and a AMD-associated variant in complement factor B (CFB, rs512559. PPARGC1A influences activation of the AMD-associated complement component 3 (C3 promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003 of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033, a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678 showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003. C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
AB126. Association between FOX03A gene polymorphisms and human longevity: a meta-analysis
Zhao, Shanchao; Bao, Jiming; Song, Xianlu
2016-01-01
Objective Numerous studies have shown associations between the FOX03A gene, encoding the forkhead box 03 transcription factor, and human or specifically male longevity. However, the associations of specific FOX03A polymorphisms with longevity remain inconclusive. We performed a meta-analysis of existing studies to clarify these potential associations. Methods A comprehensive search was conducted to identify studies of FOX03A gene polymorphisms and longevity. Pooled odds ratios (ORs) and 95% c...
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
PPAR-γ and CYP46A1 genes polymorphism is associated with ...
African Journals Online (AJOL)
Syed Tasleem Raza
2016-04-30
Apr 30, 2016 ... Abstract Background: Involvement of genetic factors like gene polymorphisms was found to con- ... PPAR-c is a type II nuclear receptor which is encoded by the PPAR-c ... nificantly associated with diabetic retinopathy [10,11].
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
SanGiovanni, John Paul; Chen, Jing; Sapieha, Przemyslaw; Aderman, Christopher M; Stahl, Andreas; Clemons, Traci E; Chew, Emily Y; Smith, Lois E H
2013-01-01
Increased intake of ω-3 long-chain polyunsaturated fatty acids (LCPUFAs) and use of peroxisome proliferator activator receptor (PPAR)-activating drugs are associated with attenuation of pathologic retinal angiogenesis. ω-3 LCPUFAs are endogenous agonists of PPARs. We postulated that DNA sequence variation in PPAR gamma (PPARG) co-activator 1 alpha (PPARGC1A), a gene encoding a co-activator of the LCPUFA-sensing PPARG-retinoid X receptor (RXR) transcription complex, may influence neovascularization (NV) in age-related macular degeneration (AMD). We applied exact testing methods to examine distributions of DNA sequence variants in PPARGC1A for association with NV AMD and interaction of AMD-associated loci in genes of complement, lipid metabolism, and VEGF signaling systems. Our sample contained 1858 people from 3 elderly cohorts of western European ancestry. We concurrently investigated retinal gene expression profiles in 17-day-old neonatal mice on a 2% LCPUFA feeding paradigm to identify LCPUFA-regulated genes both associated with pathologic retinal angiogenesis and known to interact with PPARs or PPARGC1A. A DNA coding variant (rs3736265) and a 3'UTR-resident regulatory variant (rs3774923) in PPARGC1A were independently associated with NV AMD (exact P = 0.003, both SNPs). SNP-SNP interactions existed for NV AMD (Pcomplement factor B (CFB, rs512559). PPARGC1A influences activation of the AMD-associated complement component 3 (C3) promoter fragment and CFB influences activation and proteolysis of C3. We observed interaction (P ≤ 0.003) of rs3736265 with a variant in vascular endothelial growth factor A (VEGFA, rs3025033), a key molecule in retinal angiogenesis. Another PPARGC1A coding variant (rs8192678) showed statistical interaction with a SNP in the VEGFA receptor fms-related tyrosine kinase 1 (FLT1, rs10507386; P ≤ 0.003). C3 expression was down-regulated 2-fold in retinas of ω-3 LCPUFA-fed mice - these animals also showed 70% reduction in retinal NV (P
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Ariyarathna, H A Chandima K; Oldach, Klaus H; Francki, Michael G
2016-01-19
Although the HKT transporter genes ascertain some of the key determinants of crop salt tolerance mechanisms, the diversity and functional role of group II HKT genes are not clearly understood in bread wheat. The advanced knowledge on rice HKT and whole genome sequence was, therefore, used in comparative gene analysis to identify orthologous wheat group II HKT genes and their role in trait variation under different saline environments. The four group II HKTs in rice identified two orthologous gene families from bread wheat, including the known TaHKT2;1 gene family and a new distinctly different gene family designated as TaHKT2;2. A single copy of TaHKT2;2 was found on each homeologous chromosome arm 7AL, 7BL and 7DL and each gene was expressed in leaf blade, sheath and root tissues under non-stressed and at 200 mM salt stressed conditions. The proteins encoded by genes of the TaHKT2;2 family revealed more than 93% amino acid sequence identity but ≤52% amino acid identity compared to the proteins encoded by TaHKT2;1 family. Specifically, variations in known critical domains predicted functional differences between the two protein families. Similar to orthologous rice genes on chromosome 6L, TaHKT2;1 and TaHKT2;2 genes were located approximately 3 kb apart on wheat chromosomes 7AL, 7BL and 7DL, forming a static syntenic block in the two species. The chromosomal region on 7AL containing TaHKT2;1 7AL-1 co-located with QTL for shoot Na(+) concentration and yield in some saline environments. The differences in copy number, genes sequences and encoded proteins between TaHKT2;2 homeologous genes and other group II HKT gene families within and across species likely reflect functional diversity for ion selectivity and transport in plants. Evidence indicated that neither TaHKT2;2 nor TaHKT2;1 were associated with primary root Na(+) uptake but TaHKT2;1 may be associated with trait variation for Na(+) exclusion and yield in some but not all saline environments.
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
DEFF Research Database (Denmark)
Rossin, Elizabeth J.; Hansen, Kasper Lage; Raychaudhuri, Soumya
2011-01-01
Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed by these r......Genome-wide association studies (GWAS) have defined over 150 genomic regions unequivocally containing variation predisposing to immune-mediated disease. Inferring disease biology from these observations, however, hinges on our ability to discover the molecular processes being perturbed...... in rheumatoid arthritis (RA) and Crohn's disease (CD) GWAS, we build protein-protein interaction (PPI) networks for genes within associated loci and find abundant physical interactions between protein products of associated genes. We apply multiple permutation approaches to show that these networks are more...... that the RA and CD networks have predictive power by demonstrating that proteins in these networks, not encoded in the confirmed list of disease associated loci, are significantly enriched for association to the phenotypes in question in extended GWAS analysis. Finally, we test our method in 3 non...
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan
2016-06-01
Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
A candidate-gene association study for berry colour and anthocyanin content in Vitis vinifera L.
Directory of Open Access Journals (Sweden)
Silvana Cardoso
Full Text Available Anthocyanin content is a trait of major interest in Vitis vinifera L. These compounds affect grape and wine quality, and have beneficial effects on human health. A candidate-gene approach was used to identify genetic variants associated with anthocyanin content in grape berries. A total of 445 polymorphisms were identified in 5 genes encoding transcription factors and 10 genes involved in either the biosynthetic pathway or transport of anthocyanins. A total of 124 SNPs were selected to examine association with a wide range of phenotypes based on RP-HPLC analysis and visual characterization. The phenotypes were total skin anthocyanin (TSA concentration but also specific types of anthocyanins and relative abundance. The visual assessment was based on OIV (Organisation Internationale de la Vigne et du Vin descriptors for berry and skin colour. The genes encoding the transcription factors MYB11, MYBCC and MYC(B were significantly associated with TSA concentration. UFGT and MRP were associated with several different types of anthocyanins. Skin and pulp colour were associated with nine genes (MYB11, MYBCC, MYC(B, UFGT, MRP, DFR, LDOX, CHI and GST. Pulp colour was associated with a similar group of 11 genes (MYB11, MYBCC, MYC(B, MYC(A, UFGT, MRP, GST, DFR, LDOX, CHI and CHS(A. Statistical interactions were observed between SNPs within the transcription factors MYB11, MYBCC and MYC(B. SNPs within LDOX interacted with MYB11 and MYC(B, while SNPs within CHI interacted with MYB11 only. Together, these findings suggest the involvement of these genes in anthocyanin content and on the regulation of anthocyanin biosynthesis. This work forms a benchmark for replication and functional studies.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Li, Yun-He; Wu, Qing-Song; Huang, Xia; Liu, Sheng-Hui; Zhang, Hong-Na; Zhang, Zhi; Sun, Guang-Ming
2016-01-01
Exogenous ethylene, or ethephon, has been widely used to induce pineapple flowering, but the molecular mechanism behind ethephon induction is still unclear. In this study, we cloned four genes encoding ethylene receptors (designated AcERS1a, AcERS1b, AcETR2a, and AcETR2b). The 5' flanking sequences of these four genes were also cloned by self-formed adaptor PCR and SiteFinding-PCR, and a group of putative cis-acting elements was identified. Phylogenetic tree analysis indicated that AcERS1a, AcERS1b, AcETR2a, and AcETR2b belonged to the plant ERS1s and ETR2/EIN4-like groups. Quantitative real-time PCR showed that AcETR2a and AcETR2b (subfamily 2) were more sensitive to ethylene treatment compared with AcERS1a and AcERS1b (subfamily 1). The relative expression of AcERS1b, AcETR2a, and AcETR2b was significantly increased during the earlier period of pineapple inflorescence formation, especially at 1-9 days after ethylene treatment (DAET), whereas AcERS1a expression changed less than these three genes. In situ hybridization results showed that bract primordia (BP) and flower primordia (FP) appeared at 9 and 21 DAET, respectively, and flowers were formed at 37 DAET. AcERS1a, AcERS1b, AcETR2a, and AcETR2b were mainly expressed in the shoot apex at 1-4 DAET; thereafter, with the appearance of BP and FP, higher expression of these genes was found in these new structures. Finally, at 37 DAET, the expression of these genes was mainly focused in the flower but was also low in other structures. These findings indicate that these four ethylene receptor genes, especially AcERS1b, AcETR2a, and AcETR2b, play important roles during pineapple flowering induced by exogenous ethephon.
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Ito, Yoshihito; Nakamura, Yukako; Takahashi, Nagahide; Saito, Shinichi; Aleksic, Branko; Iwata, Nakao; Inada, Toshiya; Ozaki, Norio
2008-06-13
The FXYD domain containing ion transport regulator 6 (FXYD6) gene is located within a region of chromosome 11 (11q23.3) that has been shown by a number of genome scans to be one of the most well-established linkages to schizophrenia. FXYD6 encodes the protein phosphohippolin, which is primarily expressed in the brain. Phosphohippolin modulates the kinetic activity of Na,K-ATPase and has long-term physiological importance in maintaining cation homeostasis. A recent study reported that FXYD6 was associated with schizophrenia in the United Kingdom samples. Applying the gene-based association concept, we carried out an association study regarding FXYD6 and schizophrenia in a Japanese population, with a sample consisting of 2026 subjects (906 schizophrenics and 1120 controls). After linkage disequilibrium analysis, 23 single nucleotide polymorphisms (SNPs) were genotyped using 5'-exonuclease allelic discrimination assay. We found a significant association of two SNPs (rs11216573; genotypic P value: 0.022 and rs555577; genotypic P value: 0.026, allelic P value: 0.011, uncorrected). Nominal P values did not survive correction for multiple testing (rs11216573; genotypic P value: 0.47 and rs555577; genotypic P value: 0.55, allelic P value: 0.24, after SNPSpD correction). No association was observed between schizophrenia patients and controls in allelic, genotypic and haplotypic analyses. Our findings suggest that FXYD6 is unlikely to be related to the development of schizophrenia in a Japanese population.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-08-01
Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease. Copyright © 2015 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
The association of telomere length and genetic variation in telomere biology genes.
Mirabello, Lisa; Yu, Kai; Kraft, Peter; De Vivo, Immaculata; Hunter, David J; Prescott, Jennifer; Wong, Jason Y Y; Chatterjee, Nilanjan; Hayes, Richard B; Savage, Sharon A
2010-09-01
Telomeres cap chromosome ends and are critical for genomic stability. Many telomere-associated proteins are important for telomere length maintenance. Recent genome-wide association studies (GWAS) have identified single nucleotide polymorphisms (SNPs) in genes encoding telomere-associated proteins (RTEL1 and TERT-CLPTM1) as markers of cancer risk. We conducted an association study of telomere length and 743 SNPs in 43 telomere biology genes. Telomere length in peripheral blood DNA was determined by Q-PCR in 3,646 participants from the Prostate, Lung, Colorectal, and Ovarian Cancer Screening Trial and Nurses' Health Study. We investigated associations by SNP, gene, and pathway (functional group). We found no associations between telomere length and SNPs in TERT-CLPTM1L or RTEL1. Telomere length was not significantly associated with specific functional groups. Thirteen SNPs from four genes (MEN1, MRE11A, RECQL5, and TNKS) were significantly associated with telomere length. The strongest findings were in MEN1 (gene-based P=0.006), menin, which associates with the telomerase promoter and may negatively regulate telomerase. This large association study did not find strong associations with telomere length. The combination of limited diversity and evolutionary conservation suggest that these genes may be under selective pressure. More work is needed to explore the role of genetic variants in telomere length regulation. Published 2010 Wiley-Liss, Inc.
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Czech Academy of Sciences Publication Activity Database
Olejár, Tomáš; Pajuelo-Reguera, David; Alán, Lukáš; Dlasková, Andrea; Ježek, Petr
2015-01-01
Roč. 12, č. 4 (2015), s. 5185-5190 ISSN 1791-2997 R&D Projects: GA ČR(CZ) GAP302/10/0346; GA MŠk(CZ) EE2.3.30.0025 Institutional support: RVO:67985823 Keywords : mitochondrial nucleoid * single-stranded DNA-binding protein * photoconvertible fluorescent protein Eos Subject RIV: EA - Cell Biology Impact factor: 1.559, year: 2015
HDC gene polymorphisms are associated with age at natural menopause in Caucasian women
International Nuclear Information System (INIS)
Zhang Feng; Xiong Donghai; Wang Wei; Shen Hui; Xiao Peng; Yang Fang; Recker, Robert R.; Deng Hongwen
2006-01-01
Histidine decarboxylase gene (HDC) encodes histidine decarboxylase which is the crucial enzyme for the biosynthesis of histidine. Studies have shown that histamine is likely to be involved in the regulation of reproduction system. To find the possible correlation between HDC gene and AANM (age at natural menopause), we selected 265 postmenopausal women from 131 nuclear families and performed a transmission disequilibrium test. Significant within-family associations with AANM for SNP rs854163 and SNP rs854158 of HDC gene were observed (P values = 0.0018 and 0.0197, respectively). After 1000 permutations, SNP rs854163 still remained significant within-family association with AANM. Consistently, we also detected a significant within-family association between haplotype block 2 (defined by SNP rs854163 and rs860526) and AANM in the haplotype analyses (P value = 0.0397). Our results suggest that the HDC gene polymorphisms are significantly associated with AANM in Caucasian women
2014-01-01
Background Arsenic (As) is a toxic metalloid found ubiquitously in the environment and widely considered an acute poison and carcinogen. However, the molecular mechanisms of the plant response to As and ensuing tolerance have not been extensively characterized. Here, we report on transcriptional changes with As treatment in two Arabidopsis accessions, Col-0 and Ws-2. Results The root elongation rate was greater for Col-0 than Ws-2 with As exposure. Accumulation of As was lower in the more tolerant accession Col-0 than in Ws-2. We compared the effect of As exposure on genome-wide gene expression in the two accessions by comparative microarray assay. The genes related to heat response and oxidative stresses were common to both accessions, which indicates conserved As stress-associated responses for the two accessions. Most of the specific response genes encoded heat shock proteins, heat shock factors, ubiquitin and aquaporin transporters. Genes coding for ethylene-signalling components were enriched in As-tolerant Col-0 with As exposure. A tolerance-associated gene candidate encoding Leucine-Rich Repeat receptor-like kinase VIII (LRR-RLK VIII) was selected for functional characterization. Genetic loss-of-function analysis of the LRR-RLK VIII gene revealed altered As sensitivity and the metal accumulation in roots. Conclusions Thus, ethylene-related pathways, maintenance of protein structure and LRR-RLK VIII-mediated signalling may be important mechanisms for toxicity and tolerance to As in the species. Here, we provide a comprehensive survey of global transcriptional regulation for As and identify stress- and tolerance-associated genes responding to As. PMID:24734953
Wolosin, Sasha M.; Zeithamova, Dagmar; Preston, Alison R.
2012-01-01
Emerging evidence suggests that motivation enhances episodic memory formation through interactions between medial temporal lobe (MTL) structures and dopaminergic midbrain. In addition, recent theories propose that motivation specifically facilitates hippocampal associative binding processes, resulting in more detailed memories that are readily reinstated from partial input. Here, we used high-resolution functional magnetic resonance imaging to determine how motivation influences associative encoding and retrieval processes within human MTL subregions and dopaminergic midbrain. Participants intentionally encoded object associations under varying conditions of reward and performed a retrieval task during which studied associations were cued from partial input. Behaviorally, cued recall performance was superior for high-value relative to low-value associations; however, participants differed in the degree to which rewards influenced memory. The magnitude of behavioral reward modulation was associated with reward-related activation changes in dentate gyrus/CA2,3 during encoding and enhanced functional connectivity between dentate gyrus/CA2,3 and dopaminergic midbrain during both the encoding and retrieval phases of the task. These findings suggests that within the hippocampus, reward-based motivation specifically enhances dentate gyrus/CA2,3 associative encoding mechanisms through interactions with dopaminergic midbrain. Furthermore, within parahippocampal cortex and dopaminergic midbrain regions, activation associated with successful memory formation was modulated by reward across the group. During the retrieval phase, we also observed enhanced activation in hippocampus and dopaminergic midbrain for high-value associations that occurred in the absence of any explicit cues to reward. Collectively, these findings shed light on fundamental mechanisms through which reward impacts associative memory formation and retrieval through facilitation of MTL and VTA/SN processing
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N; Klibanski, Anne
2010-03-15
Meningiomas are common tumors, representing 15% to 25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. The chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore, it has been proposed that an as yet unidentified tumor suppressor is present at this locus. Maternally expressed gene 3 (MEG3) is an imprinted gene located at 14q32 which encodes a noncoding RNA with an antiproliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in bromodeoxyuridine incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a noncoding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism.
Oei, HHS; Sayed-Tabatabaei, FA; Hofman, A; Oudkerk, M; van Duijn, CM; Witteman, JCM
Background: An insertion/deletion (I/D) polymorphism in the gene encoding angiotensin-converting enzyme (ACE) has been associated with serum ACE levels. The association between the ACE I/D polymorphism and coronary heart disease is unclear. Electron-beam-computed tomography (EBT) is a technique to
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Neutral details associated with emotional events are encoded: evidence from a cued recall paradigm.
Mickley Steinmetz, Katherine R; Knight, Aubrey G; Kensinger, Elizabeth A
2016-11-01
Enhanced emotional memory often comes at the cost of memory for surrounding background information. Narrowed-encoding theories suggest that this is due to narrowed attention for emotional information at encoding, leading to impaired encoding of background information. Recent work has suggested that an encoding-based theory may be insufficient. Here, we examined whether cued recall-instead of previously used recognition memory tasks-would reveal evidence that non-emotional information associated with emotional information was effectively encoded. Participants encoded positive, negative, or neutral objects on neutral backgrounds. At retrieval, they were given either the item or the background as a memory cue and were asked to recall the associated scene element. Counter to narrowed-encoding theories, emotional items were more likely than neutral items to trigger recall of the associated background. This finding suggests that there is a memory trace of this contextual information and that emotional cues may facilitate retrieval of this information.
Czech Academy of Sciences Publication Activity Database
Alán, Lukáš; Špaček, Tomáš; Ježek, Petr
2016-01-01
Roč. 45, č. 5 (2016), s. 443-461 ISSN 0175-7571 R&D Projects: GA ČR(CZ) GA13-02033S; GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:67985823 Keywords : 3D object segmentation * Delaunay algorithm * principal component analysis * 3D super-resolution microscopy * nucleoids * mitochondrial DNA replication Subject RIV: BO - Biophysics Impact factor: 1.472, year: 2016
Choi, Mi-Jin; Kim, Gun-Do; Kim, Jong-Myoung; Lim, Han Kyu
2015-11-18
The Pacific abalone Haliotis discus hannai is used for commercial aquaculture in Korea. We examined the transcriptome of Pacific abalone Haliotis discus hannai siblings using NGS technology to identify genes associated with high growth rates. Pacific abalones grown for 200 days post-fertilization were divided into small-, medium-, and large-size groups with mean weights of 0.26 ± 0.09 g, 1.43 ± 0.405 g, and 5.24 ± 1.09 g, respectively. RNA isolated from the soft tissues of each group was subjected to RNA sequencing. Approximately 1%-3% of the transcripts were differentially expressed in abalones, depending on the growth rate. RT-PCR was carried out on thirty four genes selected to confirm the relative differences in expression detected by RNA sequencing. Six differentially-expressed genes were identified as associated with faster growth of the Pacific abalone. These include five up-regulated genes (including one specific to females) encoding transcripts homologous to incilarin A, perlucin, transforming growth factor-beta-induced protein immunoglobulin-heavy chain 3 (ig-h3), vitelline envelope zona pellucida domain 4, and defensin, and one down-regulated gene encoding tomoregulin in large abalones. Most of the transcripts were expressed predominantly in the hepatopancreas. The genes identified in this study will lead to development of markers for identification of high-growth-rate abalones and female abalones.
Directory of Open Access Journals (Sweden)
Mi-Jin Choi
2015-11-01
Full Text Available The Pacific abalone Haliotis discus hannai is used for commercial aquaculture in Korea. We examined the transcriptome of Pacific abalone Haliotis discus hannai siblings using NGS technology to identify genes associated with high growth rates. Pacific abalones grown for 200 days post-fertilization were divided into small-, medium-, and large-size groups with mean weights of 0.26 ± 0.09 g, 1.43 ± 0.405 g, and 5.24 ± 1.09 g, respectively. RNA isolated from the soft tissues of each group was subjected to RNA sequencing. Approximately 1%–3% of the transcripts were differentially expressed in abalones, depending on the growth rate. RT-PCR was carried out on thirty four genes selected to confirm the relative differences in expression detected by RNA sequencing. Six differentially-expressed genes were identified as associated with faster growth of the Pacific abalone. These include five up-regulated genes (including one specific to females encoding transcripts homologous to incilarin A, perlucin, transforming growth factor-beta-induced protein immunoglobulin-heavy chain 3 (ig-h3, vitelline envelope zona pellucida domain 4, and defensin, and one down-regulated gene encoding tomoregulin in large abalones. Most of the transcripts were expressed predominantly in the hepatopancreas. The genes identified in this study will lead to development of markers for identification of high-growth-rate abalones and female abalones.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Moynihan, J.A.; Morrissey, J.P.; Coppoolse, E.; Stiekema, W.J.; O'Gara, F.; Boyd, E.F.
2009-01-01
Pseudomonas fluorescens is of agricultural and economic importance as a biological control agent largely because of its plant-association and production of secondary metabolites, in particular 2, 4-diacetylphloroglucinol (2, 4-DAPG). This polyketide, which is encoded by the eight gene phl cluster,
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Metaphase chromosome and nucleoid differences between CHO-K1 and its radiosensitive derivative xrs-5
International Nuclear Information System (INIS)
Schwartz, J.L.; Stephens, J.; Vaughan, A.T.M.
1992-05-01
The Chinese hamster ovary (CHO) cell line xrs-5 is a radiation-sensitive mutant isolated from CHO-K1 cells. The radiation sensitivity is associated with a defect in DNA double-strand break rejoining. Chromatin structure also appears altered in xrs-5 cells compared to the parental CHO-K1 cells. Metaphase chromosomes from xrs-5 are more condensed in appearance than CHO-K1 chromosomes. The overcondensed look is not the result of colcemid sensitivity. Electron microscopy studies suggest that xrs-5 metaphase chromosomes have larger loops of chromatin extending out from the chromosome core. There are also differences between CHO-K1 and xrs-5 cells in the size and fluorescence pattern of ethidium bromide-stained nucleoid preparations. These results suggest that there is a fundamental difference between CHO-K1 and xrs-5 in either the organization of the supercoiled loops of DNA attached to the nuclear matrix or in the nature of the proteins that attach the DNA to the matrix. These alterations in chromosome structure may underlie, in part, the radiation sensitivity of xrs-5 cells
Metaphase chromosome and nucleoid differences between CHO-K1 and its radiosensitive derivative xrs-5
International Nuclear Information System (INIS)
Schwartz, J.L.; Stephens, J.; Vaughan, A.T.M.
1993-01-01
The Chinese hamster ovary (CHO) cell line xrs-5 is a radiation-sensitive mutant isolated from CHO-K1 cells. The radiosensitivity is associated with a defect in DNA double-strand break rejoining. Chromatin structure also appears altered in xrs-5 cells compared with the parental CHO-K1 cells. Metaphase chromosomes form xrs-5 are more condensed in appearance than CHO-K1 chromosomes. The overcondensed look is not the result of colcemid sensitivity. Electron microscopy studies suggest that xrs-5 metaphase chromosomes have larger loops of chromatin extending out from the chromosome core. There are also differences between CHO-K1 and xrs-5 cells in the size and fluorescence pattern of ethidium bromide-stained nucleoid preparations. These results suggest that there is a fundamental difference between CHO-K1 and xrs-5 in either the organization of the supercoiled loops of DNA attached to the nuclear matrix or in the nature of the proteins that attach the DNA to the matrix. These alterations in chromosome structure may underlie, in part the radiation sensitivity of xrs-5 cells. (Author)
Philippi, A; Roschmann, E; Tores, F; Lindenbaum, P; Benajou, A; Germain-Leclerc, L; Marcaillou, C; Fontaine, K; Vanpeene, M; Roy, S; Maillard, S; Decaulne, V; Saraiva, J P; Brooks, P; Rousseau, F; Hager, J
2005-10-01
Autism is a developmental disorder characterized by impairments in social interaction and communication associated with repetitive patterns of interest or behavior. Autism is highly influenced by genetic factors. Genome-wide linkage and candidate gene association approaches have been used to try and identify autism genes. A few loci have repeatedly been reported linked to autism. Several groups reported evidence for linkage to a region on chromosome 16p. We have applied a direct physical identity-by-descent (IBD) mapping approach to perform a high-density (0.85 megabases) genome-wide linkage scan in 116 families from the AGRE collection. Our results confirm linkage to a region on chromosome 16p with autism. High-resolution single-nucleotide polymorphism (SNP) genotyping and analysis of this region show that haplotypes in the protein kinase c-beta gene are strongly associated with autism. An independent replication of the association in a second set of 167 trio families with autism confirmed our initial findings. Overall, our data provide evidence that the PRKCB1 gene on chromosome 16p may be involved in the etiology of autism.
Acral peeling skin syndrome associated with a novel CSTA gene mutation.
Muttardi, K; Nitoiu, D; Kelsell, D P; O'Toole, E A; Batta, K
2016-06-01
Acral peeling skin syndrome (APSS) is a rare autosomal recessive condition, characterized by asymptomatic peeling of the skin of the hands and feet, often linked to mutations in the gene TGM5. However, more recently recessive loss of function mutations in CSTA, encoding cystatin A, have been linked with APSS and exfoliative ichthyosis. We describe the clinical features in two sisters with APSS, associated with a novel large homozygous deletion encompassing exon 1 of CSTA. © 2015 British Association of Dermatologists.
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
DEFF Research Database (Denmark)
Kory, Nora; Grond, Susanne; Kamat, Siddhesh S
2017-01-01
Variations in the gene LDAH (C2ORF43), which encodes lipid droplet-associated hydrolase (LDAH), are among few loci associated with human prostate cancer. Homologs of LDAH have been identified as proteins of lipid droplets (LDs). LDs are cellular organelles that store neutral lipids...
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
Bone-associated gene evolution and the origin of flight in birds.
Machado, João Paulo; Johnson, Warren E; Gilbert, M Thomas P; Zhang, Guojie; Jarvis, Erich D; O'Brien, Stephen J; Antunes, Agostinho
2016-05-18
Bones have been subjected to considerable selective pressure throughout vertebrate evolution, such as occurred during the adaptations associated with the development of powered flight. Powered flight evolved independently in two extant clades of vertebrates, birds and bats. While this trait provided advantages such as in aerial foraging habits, escape from predators or long-distance travels, it also imposed great challenges, namely in the bone structure. We performed comparative genomic analyses of 89 bone-associated genes from 47 avian genomes (including 45 new), 39 mammalian, and 20 reptilian genomes, and demonstrate that birds, after correcting for multiple testing, have an almost two-fold increase in the number of bone-associated genes with evidence of positive selection (~52.8 %) compared with mammals (~30.3 %). Most of the positive-selected genes in birds are linked with bone regulation and remodeling and thirteen have been linked with functional pathways relevant to powered flight, including bone metabolism, bone fusion, muscle development and hyperglycemia levels. Genes encoding proteins involved in bone resorption, such as TPP1, had a high number of sites under Darwinian selection in birds. Patterns of positive selection observed in bird ossification genes suggest that there was a period of intense selective pressure to improve flight efficiency that was closely linked with constraints on body size.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D
2008-04-01
A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
The KCNE genes in hypertrophic cardiomyopathy: a candidate gene study
DEFF Research Database (Denmark)
Hedley, Paula L; Haundrup, Ole; Andersen, Paal S
2011-01-01
The gene family KCNE1-5, which encode modulating β-subunits of several repolarising K+-ion channels, has been associated with genetic cardiac diseases such as long QT syndrome, atrial fibrillation and Brugada syndrome. The minK peptide, encoded by KCNE1, is attached to the Z-disc of the sarcomere...... as well as the T-tubules of the sarcolemma. It has been suggested that minK forms part of an "electro-mechanical feed-back" which links cardiomyocyte stretching to changes in ion channel function. We examined whether mutations in KCNE genes were associated with hypertrophic cardiomyopathy (HCM), a genetic...
Zhang, Xun; Gejman, Roger; Mahta, Ali; Zhong, Ying; Rice, Kimberley A.; Zhou, Yunli; Cheunsuchon, Pornsuk; Louis, David N.; Klibanski, Anne
2010-01-01
Meningiomas are common tumors, representing 15-25% of all central nervous system tumors. NF2 gene inactivation on chromosome 22 has been shown as an early event in tumorigenesis; however, few factors underlying tumor growth and progression have been identified. Chromosomal abnormalities of 14q32 are often associated with meningioma pathogenesis and progression; therefore it has been proposed that an as yet unidentified tumor suppressor is present at this locus. MEG3 is an imprinted gene located at 14q32 that encodes a non-coding RNA with an anti-proliferative function. We found that MEG3 mRNA is highly expressed in normal arachnoidal cells. However, MEG3 is not expressed in the majority of human meningiomas or the human meningioma cell lines IOMM-Lee and CH157-MN. There is a strong association between loss of MEG3 expression and tumor grade. Allelic loss at the MEG3 locus is also observed in meningiomas, with increasing prevalence in higher grade tumors. In addition, there is an increase in CpG methylation within the promoter and the imprinting control region of MEG3 gene in meningiomas. Functionally, MEG3 suppresses DNA synthesis in both IOMM-Lee and CH157-MN cells by approximately 60% in BrdU incorporation assays. Colony-forming efficiency assays show that MEG3 inhibits colony formation in CH157-MN cells by approximately 80%. Furthermore, MEG3 stimulates p53-mediated transactivation in these cell lines. Therefore, these data are consistent with the hypothesis that MEG3, which encodes a non-coding RNA, may be a tumor suppressor gene at chromosome 14q32 involved in meningioma progression via a novel mechanism. PMID:20179190
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Schierack, Peter; Rödiger, Stefan; Kuhl, Christoph; Hiemann, Rico; Roggenbuck, Dirk; Li, Ganwu; Weinreich, Jörg; Berger, Enrico; Nolan, Lisa K; Nicholson, Bryon; Römer, Antje; Frömmel, Ulrike; Wieler, Lothar H; Schröder, Christian
2013-01-01
We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2) and their probiotic activity against infection by enteropathogenic E. coli (EPEC). 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.
Directory of Open Access Journals (Sweden)
Peter Schierack
Full Text Available We established an automated screening method to characterize adhesion of Escherichia coli to intestinal porcine epithelial cells (IPEC-J2 and their probiotic activity against infection by enteropathogenic E. coli (EPEC. 104 intestinal E. coli isolates from domestic pigs were tested by PCR for the occurrence of virulence-associated genes, genes coding for resistances to antimicrobial agents and metals, and for phylogenetic origin by PCR. Adhesion rates and probiotic activity were examined for correlation with the presence of these genes. Finally, data were compared with those from 93 E. coli isolates from wild boars. Isolates from domestic pigs carried a broad variety of all tested genes and showed great diversity in gene patterns. Adhesions varied with a maximum of 18.3 or 24.2 mean bacteria adherence per epithelial cell after 2 or 6 hours respectively. Most isolates from domestic pigs and wild boars showed low adherence, with no correlation between adhesion/probiotic activity and E. coli genes or gene clusters. The gene sfa/foc, encoding for a subunit of F1C fimbriae did show a positive correlative association with adherence and probiotic activity; however E. coli isolates from wild boars with the sfa/foc gene showed less adhesion and probiotic activity than E. coli with the sfa/foc gene isolated from domestic pigs after 6 hour incubation. In conclusion, screening porcine E. coli for virulence associated genes genes, adhesion to intestinal epithelial cells, and probiotic activity revealed a single important adhesion factor, several probiotic candidates, and showed important differences between E. coli of domestic pigs and wild boars.
Stacey, David; Ciobanu, Liliana G; Baune, Bernhard T
2017-06-01
Cognitive impairment, or decline, is not only a feature of Alzheimer׳s disease and other forms of dementia but also normal ageing. Abundant evidence from epidemiological studies points towards perturbed inflammatory mechanisms in aged individuals, though the cause-effect nature of this apparent relationship is difficult to establish. Genetic association studies focusing on polymorphism in and around inflammatory genes represent a viable approach to establish whether inflammatory mechanisms might play a causal role in cognitive decline, whilst also enabling the identification of specific genes potentially influencing specific cognitive facets. Thus, here we provide a review of published genetic association studies investigating inflammatory genes in the context of cognitive decline in elderly, non-demented, samples. Numerous candidate gene association studies have been performed to date, focusing almost exclusively on genes encoding major cytokines. Some of these studies report significant cognitive domain-specific associations implicating Interleukin 1β (IL1β) (rs16944), Tumour Necrosis Factor α (TNFα) (rs1800629) and C-reactive protein (CRP) in various domains of cognitive function. However, the majority of these studies are lacking in statistical power and have other methodological limitations, suggesting some of them may have yielded false positive results. Genome-wide association studies have implicated less direct and less obvious regulators of inflammatory processes (i.e., PDE7A, HS3ST4, SPOCK3), indicating that a shift away from the major cytokine-encoding genes in future studies will be important. Furthermore, better cohesion across studies with regards to the cognitive test batteries administered to participants along with the continued application of longitudinal designs will be vital. Copyright © 2015 Elsevier B.V. and ECNP. All rights reserved.
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Human Transcriptome and Chromatin Modifications: An ENCODE Perspective
Directory of Open Access Journals (Sweden)
Li Shen
2013-06-01
Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Energy Technology Data Exchange (ETDEWEB)
Sanfilippo, Antonio P.; Posse, Christian; Gopalan, Banu; Tratz, Stephen C.; Gregory, Michelle L.
2006-06-08
With the rising influence of the Gene On-tology, new approaches have emerged where the similarity between genes or gene products is obtained by comparing Gene Ontology code annotations associ-ated with them. So far, these approaches have solely relied on the knowledge en-coded in the Gene Ontology and the gene annotations associated with the Gene On-tology database. The goal of this paper is to demonstrate that improvements to these approaches can be obtained by integrating textual evidence extracted from relevant biomedical literature.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
The Obesity-Associated FTO Gene Encodes a 2-Oxoglutarate–Dependent Nucleic Acid Demethylase
Gerken, Thomas; Girard, Christophe A.; Tung, Yi-Chun Loraine; Webby, Celia J.; Saudek, Vladimir; Hewitson, Kirsty S.; Yeo, Giles S. H.; McDonough, Michael A.; Cunliffe, Sharon; McNeill, Luke A.; Galvanovskis, Juris; Rorsman, Patrik; Robins, Peter; Prieur, Xavier; Coll, Anthony P.; Ma, Marcella; Jovanovic, Zorica; Farooqi, I. Sadaf; Sedgwick, Barbara; Barroso, Inês; Lindahl, Tomas; Ponting, Chris P.; Ashcroft, Frances M.; O'Rahilly, Stephen; Schofield, Christopher J.
2009-01-01
Variants in the FTO (fat mass and obesity associated) gene are associated with increased body mass index in humans. Here, we show by bioinformatics analysis that FTO shares sequence motifs with Fe(II)- and 2-oxoglutarate–dependent oxygenases. We find that recombinant murine Fto catalyzes the Fe(II)- and 2OG-dependent demethylation of 3-methylthymine in single-stranded DNA, with concomitant production of succinate, formaldehyde, and carbon dioxide. Consistent with a potential role in nucleic acid demethylation, Fto localizes to the nucleus in transfected cells. Studies of wild-type mice indicate that Fto messenger RNA (mRNA) is most abundant in the brain, particularly in hypothalamic nuclei governing energy balance, and that Fto mRNA levels in the arcuate nucleus are regulated by feeding and fasting. Studies can now be directed toward determining the physiologically relevant FTO substrate and how nucleic acid methylation status is linked to increased fat mass. PMID:17991826
Dulmage, Keely A; Todor, Horia; Schmid, Amy K
2015-09-08
In all three domains of life, organisms use nonspecific DNA-binding proteins to compact and organize the genome as well as to regulate transcription on a global scale. Histone is the primary eukaryotic nucleoprotein, and its evolutionary roots can be traced to the archaea. However, not all archaea use this protein as the primary DNA-packaging component, raising questions regarding the role of histones in archaeal chromatin function. Here, quantitative phenotyping, transcriptomic, and proteomic assays were performed on deletion and overexpression mutants of the sole histone protein of the hypersaline-adapted haloarchaeal model organism Halobacterium salinarum. This protein is highly conserved among all sequenced haloarchaeal species and maintains hallmark residues required for eukaryotic histone functions. Surprisingly, despite this conservation at the sequence level, unlike in other archaea or eukaryotes, H. salinarum histone is required to regulate cell shape but is not necessary for survival. Genome-wide expression changes in histone deletion strains were global, significant but subtle in terms of fold change, bidirectional, and growth phase dependent. Mass spectrometric proteomic identification of proteins from chromatin enrichments yielded levels of histone and putative nucleoid-associated proteins similar to those of transcription factors, consistent with an open and transcriptionally active genome. Taken together, these data suggest that histone in H. salinarum plays a minor role in DNA compaction but important roles in growth-phase-dependent gene expression and regulation of cell shape. Histone function in haloarchaea more closely resembles a regulator of gene expression than a chromatin-organizing protein like canonical eukaryotic histone. Histones comprise the major protein component of eukaryotic chromatin and are required for both genome packaging and global regulation of expression. The current paradigm maintains that archaea whose genes encode
Stacey, S.N.; Kehr, B.; Gudmundsson, J.; Zink, F.; Jonasdottir, A.; Gudjonsson, S.A.; Sigurdsson, A.; Halldorsson, B.V.; Agnarsson, B.A.; Benediktsdottir, K.R.; Aben, K.K.; Vermeulen, S.H.; Cremers, R.G.; Panadero, A.; Helfand, B.T.; Cooper, P.R.; Donovan, J.L.; Hamdy, F.C.; Jinga, V.; Okamoto, I.; Jonasson, J.G.; Tryggvadottir, L.; Johannsdottir, H.; Kristinsdottir, A.M.; Masson, G.; Magnusson, O.T.; Iordache, P.D.; Helgason, A.; Helgason, H.; Sulem, P.; Gudbjartsson, D.F.; Kong, A.; Jonsson, E.; Barkardottir, R.B.; Einarsson, G.V.; Rafnar, T.; Thorsteinsdottir, U.; Mates, I.N.; Neal, D.E.; Catalona, W.J.; Mayordomo, J.I.; Kiemeney, L.A.; Thorleifsson, G.; Stefansson, K.
2016-01-01
Transcriptional and splicing anomalies have been observed in intron 8 of the CASP8 gene (encoding procaspase-8) in association with cutaneous basal-cell carcinoma (BCC) and linked to a germline SNP rs700635. Here, we show that the rs700635[C] allele, which is associated with increased risk of BCC
Sperschneider, Jana; Gardiner, Donald M.; Thatcher, Louise F.; Lyons, Rebecca; Singh, Karam B.; Manners, John M.; Taylor, Jennifer M.
2015-01-01
Pathogens and hosts are in an ongoing arms race and genes involved in host–pathogen interactions are likely to undergo diversifying selection. Fusarium plant pathogens have evolved diverse infection strategies, but how they interact with their hosts in the biotrophic infection stage remains puzzling. To address this, we analyzed the genomes of three Fusarium plant pathogens for genes that are under diversifying selection. We found a two-speed genome structure both on the chromosome and gene group level. Diversifying selection acts strongly on the dispensable chromosomes in Fusarium oxysporum f. sp. lycopersici and on distinct core chromosome regions in Fusarium graminearum, all of which have associations with virulence. Members of two gene groups evolve rapidly, namely those that encode proteins with an N-terminal [SG]-P-C-[KR]-P sequence motif and proteins that are conserved predominantly in pathogens. Specifically, 29 F. graminearum genes are rapidly evolving, in planta induced and encode secreted proteins, strongly pointing toward effector function. In summary, diversifying selection in Fusarium is strongly reflected as genomic footprints and can be used to predict a small gene set likely to be involved in host–pathogen interactions for experimental verification. PMID:25994930
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Candidate gene association analyses for ketosis resistance in Holsteins.
Kroezen, V; Schenkel, F S; Miglior, F; Baes, C F; Squires, E J
2018-06-01
High-yielding dairy cattle are susceptible to ketosis, a metabolic disease that negatively affects the health, fertility, and milk production of the cow. Interest in breeding for more robust dairy cattle with improved resistance to disease is global; however, genetic evaluations for ketosis would benefit from the additional information provided by genetic markers. Candidate genes that are proposed to have a biological role in the pathogenesis of ketosis were investigated in silico and a custom panel of 998 putative single nucleotide polymorphism (SNP) markers was developed. The objective of this study was to test the associations of these new markers with deregressed estimated breeding values (EBV) for ketosis. A sample of 653 Canadian Holstein cows that had been previously genotyped with a medium-density SNP chip were regenotyped with the custom panel. The EBV for ketosis in first and later lactations were obtained for each animal and deregressed for use as pseudo-phenotypes for association analyses. Results of the mixed inheritance model for single SNP association analyses suggested 15 markers in 6 unique candidate genes were associated with the studied trait. Genes encoding proteins involved in metabolic processes, including the synthesis and degradation of fatty acids and ketone bodies, gluconeogenesis, lipid mobilization, and the citric acid cycle, were identified to contain SNP associated with ketosis resistance. This work confirmed the presence of previously described quantitative trait loci for dairy cattle, suggested novel markers for ketosis-resistance, and provided insight into the underlying biology of this disease. Copyright © 2018 American Dairy Science Association. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Czech Academy of Sciences Publication Activity Database
Dlasková, Andrea; Engstová, Hana; Plecitá-Hlavatá, Lydie; Lessard, M.; Alán, Lukáš; Reguera Pajuelo, David; Jabůrek, Martin; Ježek, Petr
2015-01-01
Roč. 47, č. 3 (2015), s. 255-263 ISSN 0145-479X R&D Projects: GA ČR(CZ) GAP305/12/1247; GA MŠk(CZ) EE2.3.30.0025; GA MŠk(CZ) ED1.1.00/02.0109; GA ČR(CZ) GA13-02033S Institutional support: RVO:67985823 Keywords : mitochondrial network * mitochondrial DNA * nucleoids * 4Pimicroscopy Subject RIV: EA - Cell Biology Impact factor: 2.080, year: 2015
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
Ayo, Christiane Maria; Frederico, Fábio Batista; Siqueira, Rubens Camargo; Brandão de Mattos, Cinara de Cássia; Previato, Mariana; Barbosa, Amanda Pires; Murata, Fernando Henrique Antunes; Silveira-Carvalho, Aparecida Perpétuo; de Mattos, Luiz Carlos
2016-01-01
The objective of this study was to investigate the influence of the genes encoding the KIR receptors and their HLA ligands in the susceptibility of ocular toxoplasmosis. A total of 297 patients serologically-diagnosed with toxoplasmosis were selected and stratified according to the presence (n = 148) or absence (n = 149) of ocular scars/lesions due to toxoplasmosis. The group of patients with scars/lesions was further subdivided into two groups according to the type of ocular manifestation observed: primary (n = 120) or recurrent (n = 28). Genotyping was performed by PCR-SSOP. Statistical analyses were conducted using the Chi-square test, and odds ratio with a 95% confidence interval was also calculated to evaluate the risk association. The activating KIR3DS1 gene was associated with increased susceptibility for ocular toxoplasmosis. The activating KIR together with their HLA ligands (KIR3DS1-Bw4-80Ile and KIR2DS1+/C2++ KIR3DS1+/Bw4-80Ile+) were associated with increased susceptibility for ocular toxoplasmosis and its clinical manifestations. KIR-HLA inhibitory pairs -KIR2DL3/2DL3-C1/C1 and KIR2DL3/2DL3-C1- were associated with decreased susceptibility for ocular toxoplasmosis and its clinical forms, while the KIR3DS1−/KIR3DL1+/Bw4-80Ile+ combination was associated as a protective factor against the development of ocular toxoplasmosis and, in particular, against recurrent manifestations. Our data demonstrate that activating and inhibitory KIR genes may influence the development of ocular toxoplasmosis. PMID:27827450
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Komonyi, Orban; Schauer, Tamas; Papai, Gabor; Deak, Peter; Boros, Imre M
2009-03-15
Although telomere formation occurs through a different mechanism in Drosophila compared with other organisms, telomere associations result from mutations in homologous genes, indicating the involvement of similar pathways in chromosome end protection. We report here that mutations of the Drosophila melanogaster gene CG31241 lead to high frequency chromosome end fusions. CG31241 is a bicistronic gene that encodes trimethylguanosine synthase (TGS1), which forms the m3G caps of noncoding small RNAs, and a novel protein, DTL. We show that although TGS1 has no role in telomere protection, DTL is localized at specific sites, including the ends of polytene chromosomes, and its loss results in telomere associations. Mutations of ATM- and Rad3-related (ATR) kinase suppress telomere fusions in the absence of DTL. Thus, genetic interactions place DTL in an ATR-related pathway in telomere protection. In contrast to ATR kinase, mutations of ATM (ataxia telangiectasia mutated) kinase, which acts in a partially overlapping pathway of telomere protection, do not suppress formation of telomere associations in the absence of DTL. Thus, uncovering the role of DTL will help to dissect the evolutionary conserved pathway(s) controlling ATM-ATR-related telomere protection.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Hippocampal activation during face-name associative memory encoding: blocked versus permuted design
International Nuclear Information System (INIS)
De Vogelaere, Frederick; Vingerhoets, Guy; Santens, Patrick; Boon, Paul; Achten, Erik
2010-01-01
The contribution of the hippocampal subregions to episodic memory through the formation of new associations between previously unrelated items such as faces and names is established but remains under discussion. Block design studies in this area of research generally tend to show posterior hippocampal activation during encoding of novel associational material while event-related studies emphasize anterior hippocampal involvement. We used functional magnetic resonance imaging to assess the involvement of anterior and posterior hippocampus in the encoding of novel associational material compared to the viewing of previously seen associational material. We used two different experimental designs, a block design and a permuted block design, and applied it to the same associative memory task to perform valid statistical comparisons. Our results indicate that the permuted design was able to capture more anterior hippocampal activation compared to the block design, which emphasized more posterior hippocampal involvement. These differences were further investigated and attributed to a combination of the polymodal stimuli we used and the experimental design. Activation patterns during encoding in both designs occurred along the entire longitudinal axis of the hippocampus, but with different centers of gravity. The maximal activated voxel in the block design was situated in the posterior half of the hippocampus while in the permuted design this was located in the anterior half. (orig.)
Hippocampal activation during face-name associative memory encoding: blocked versus permuted design
Energy Technology Data Exchange (ETDEWEB)
De Vogelaere, Frederick; Vingerhoets, Guy [Ghent University, Laboratory for Neuropsychology, Department of Neurology, Ghent (Belgium); Santens, Patrick; Boon, Paul [Ghent University Hospital, Department of Neurology, Ghent (Belgium); Achten, Erik [Ghent University Hospital, Department of Radiology, Ghent (Belgium)
2010-01-15
The contribution of the hippocampal subregions to episodic memory through the formation of new associations between previously unrelated items such as faces and names is established but remains under discussion. Block design studies in this area of research generally tend to show posterior hippocampal activation during encoding of novel associational material while event-related studies emphasize anterior hippocampal involvement. We used functional magnetic resonance imaging to assess the involvement of anterior and posterior hippocampus in the encoding of novel associational material compared to the viewing of previously seen associational material. We used two different experimental designs, a block design and a permuted block design, and applied it to the same associative memory task to perform valid statistical comparisons. Our results indicate that the permuted design was able to capture more anterior hippocampal activation compared to the block design, which emphasized more posterior hippocampal involvement. These differences were further investigated and attributed to a combination of the polymodal stimuli we used and the experimental design. Activation patterns during encoding in both designs occurred along the entire longitudinal axis of the hippocampus, but with different centers of gravity. The maximal activated voxel in the block design was situated in the posterior half of the hippocampus while in the permuted design this was located in the anterior half. (orig.)
Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso
2017-12-18
Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.
Prince, S.E.; Daselaar, S.M.; Cabeza, R.
2005-01-01
Using event-related functional magnetic resonance imaging, we identified brain regions involved in successful relational memory (RM) during encoding and retrieval for semantic and perceptual associations or in general, independent of phase and content. Participants were scanned while encoding and
DEFF Research Database (Denmark)
Thomsen, Stine Brinkløv; Rathcke, Camilla Noelle; Skaaby, Tea
2012-01-01
The inflammatory biomarker YKL-40 seems to play a role in atherosclerosis and is elevated in patients with obesity, cardiovascular disease and type 2 diabetes. Single nucleotide polymorphisms (SNPs) of the YKL-40 encoding gene, CHI3L1, are associated with inter-individual YKL-40 levels. One study...... of the differentiated lipid profile in a Danish general population....
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Directory of Open Access Journals (Sweden)
Hsiao-Ling Lu
Full Text Available Piwi-interacting RNAs (piRNAs are known to regulate transposon activity in germ cells of several animal models that propagate sexually. However, the role of piRNAs during asexual reproduction remains almost unknown. Aphids that can alternate sexual and asexual reproduction cycles in response to seasonal changes of photoperiod provide a unique opportunity to study piRNAs and the piRNA pathway in both reproductive modes. Taking advantage of the recently sequenced genome of the pea aphid Acyrthosiphon pisum, we found an unusually large lineage-specific expansion of genes encoding the Piwi sub-clade of Argonaute proteins. In situ hybridisation showed differential expressions between the duplicated piwi copies: while Api-piwi2 and Api-piwi6 are "specialised" in germ cells their most closely related copy, respectively Api-piwi5 and Api-piwi3, are expressed in the somatic cells. The differential expression was also identified in duplicated ago3: Api-ago3a in germ cells and Api-ago3b in somatic cells. Moreover, analyses of expression profiles of the expanded piwi and ago3 genes by semi-quantitative RT-PCR showed that expressions varied according to the reproductive types. These specific expression patterns suggest that expanded aphid piwi and ago3 genes have distinct roles in asexual and sexual reproduction.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Directory of Open Access Journals (Sweden)
Richard A Jorgensen
2012-08-01
Full Text Available Upstream open reading frames (uORFs are common in eukaryotic transcripts, but those that encode conserved peptides (CPuORFs occur in less than 1% of transcripts. The peptides encoded by three plant CPuORF families are known to control translation of the downstream ORF in response to a small signal molecule (sucrose, polyamines and phosphocholine. In flowering plants, transcription factors are statistically over-represented among genes that possess CPuORFs, and in general it appeared that many CPuORF genes also had other regulatory functions, though the significance of this suggestion was uncertain (Hayden and Jorgensen, 2007. Five years later the literature provides much more information on the functions of many CPuORF genes. Here we reassess the functions of 27 known CPuORF gene families and find that 22 of these families play a variety of different regulatory roles, from transcriptional control to protein turnover, and from small signal molecules to signal transduction kinases. Clearly then, there is indeed a strong association of CPuORFs with regulatory genes. In addition, 16 of these families play key roles in a variety of different biological processes. Most strikingly, the core sucrose response network includes three different CPuORFs, creating the potential for sophisticated balancing of the network in response to three different molecular inputs. We propose that the function of most CPuORFs is to modulate translation of a downstream major ORF (mORF in response to a signal molecule recognized by the conserved peptide and that because the mORFs of CPuORF genes generally encode regulatory proteins, many of them centrally important in the biology of plants, CPuORFs play key roles in balancing such regulatory networks.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Energy Technology Data Exchange (ETDEWEB)
Rosa, M.D.; Gottlieb, E.; Lerner, M.R.; Steitz, J.A.
1981-09-01
The nucleotide sequence of the region of the Epstein-Barr virus genome that specified two small ribonucleic acids (RNAs), EBER 1 and EBER 2, has been determined. Both of these RNAs are encoded by the right-hand 1,000 base pairs of the EcoRI J fragment of EBV deoxyribonucleic acid. EBER 1 is 166 (167) nucleotides long and EBER 2 is 172 +- 1 nucleotides long; the heterogeneity resides at the 3' termini. The EBER genes are separated by 161 base pairs and are transcribed from the same deoxyribonucleic acid strand. In vitro, both EBER genes can be transcribed by RNA polymerase III; sequences homologous to previously identified RNA polymerase III intragenic transcription control regions are present. Striking similarities are therefore apparent both between the EBERs and the two adenovirus-associated RNAs, VAI and VAII, and between the regions of the two viral genomes that specify these small RNAs. We have shown that VAII RNA as well as VAI RNA and the EBERs exist in ribonucleoprotein complexes which are precipitable by anti-La antibodies associated with systemic lupus erythematosus. Finally the authors have demonstrated that the binding of protein(s) from uninfected cells confers antigenicity on each of the four virus-encoded small RNAs.
Temporal texture of associative encoding modulates recall processes.
Tibon, Roni; Levy, Daniel A
2014-02-01
Binding aspects of an experience that are distributed over time is an important element of episodic memory. In the current study, we examined how the temporal complexity of an experience may govern the processes required for its retrieval. We recorded event-related potentials during episodic cued recall following pair associate learning of concurrently and sequentially presented object-picture pairs. Cued recall success effects over anterior and posterior areas were apparent in several time windows. In anterior locations, these recall success effects were similar for concurrently and sequentially encoded pairs. However, in posterior sites clustered over parietal scalp the effect was larger for the retrieval of sequentially encoded pairs. We suggest that anterior aspects of the mid-latency recall success effects may reflect working-with-memory operations or direct access recall processes, while more posterior aspects reflect recollective processes which are required for retrieval of episodes of greater temporal complexity. Copyright © 2013 Elsevier Inc. All rights reserved.
Activity of Proteus mirabilis FliL is viscosity dependent and requires extragenic DNA.
Lee, Yi-Ying; Patellis, Julius; Belas, Robert
2013-02-01
Proteus mirabilis is a urinary tract pathogen and well known for its ability to move over agar surfaces by flagellum-dependent swarming motility. When P. mirabilis encounters a highly viscous environment, e.g., an agar surface, it differentiates from short rods with few flagella to elongated, highly flagellated cells that lack septa and contain multiple nucleoids. The bacteria detect a surface by monitoring the rotation of their flagellar motors. This process involves an enigmatic flagellar protein called FliL, the first gene in an operon (fliLMNOPQR) that encodes proteins of the flagellar rotor switch complex and flagellar export apparatus. We used a fliL knockout mutant to gain further insight into the function of FliL. Loss of FliL results in cells that cannot swarm (Swr(-)) but do swim (Swm(+)) and produces cells that look like wild-type swarmer cells, termed "pseudoswarmer cells," that are elongated, contain multiple nucleoids, and lack septa. Unlike swarmer cells, pseudoswarmer cells are not hyperflagellated due to reduced expression of flaA (the gene encoding flagellin), despite an increased transcription of both flhD and fliA, two positive regulators of flagellar gene expression. We found that defects in fliL prevent viscosity-dependent sensing of a surface and viscosity-dependent induction of flaA transcription. Studies with fliL cells unexpectedly revealed that the fliL promoter, fliL coding region, and a portion of fliM DNA are needed to complement the Swr(-) phenotype. The data support a dual role for FliL as a critical link in sensing a surface and in the maintenance of flagellar rod integrity.
The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia
Fu, Gui Hong; Liu, Feng; Xia, Jun Hong; Yue, Gen Hua
2014-01-01
Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP) gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp) of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p tilapia resistant to A. hydrophila. PMID:25470022
Hussein, Yousri M; Shalaby, Sally M; Nassar, Amani; Alzahrani, Saad S; Alharbi, Ayman S; Nouh, Maha
2014-07-25
To determine whether IL-4, IL-4Rα and STAT6 polymorphisms are associated with susceptibility to dermatitis in Egyptian children. We genotyped three groups of children, consisting of 106 atopic dermatitis (AD) children, 95 non-AD children, and 100 of healthy controls, for IL-4 (-590 C/T), (-33 C/T), IL-4Rα (I50V), (Q576R) and STAT6 (2964 G/A), (2892 C/T) gene polymorphisms using PCR-RFLP assay. Total serum IgE and serum IL-4 levels were detected by ELISA. There was a non-significant association of IL-4 -590 C/T, -33 C/T polymorphisms in the children with non-AD or those with AD when compared with the controls. We identified a significant association between IL-4Rα I50V, Q576R polymorphisms and dermatitis susceptibility in AD (p=0.002, dermatitis was found. Patients who were carriers of IL4 -590C, IL-4Rα I50V G, STAT6 2964 A and STAT6 2892 T had an increased risk of AD [OR and 95% CI: 3.2 (2.5-4.2), p=0.005]. Furthermore, there was no relation between each polymorphism and serum IL-4 level (p>0.05 for each) while homozygosity for the risk alleles of IL-4, IL-4Rα and STAT6 SNPs were significantly associated with increased total IgE levels in all subjects. In Egyptian children, the IL-4Rα and the STAT6 polymorphism may play a role in susceptibility to AD. In addition, gene-gene interaction between the IL-4, the IL-4Rα and the STAT6 significantly increases an individual's susceptibility to AD. Copyright © 2014 Elsevier B.V. All rights reserved.
Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J
2013-12-05
The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.
Trapalis, Menelaos; Li, Song Feng; Parish, Roger W
2017-07-01
The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Energy Technology Data Exchange (ETDEWEB)
Dai, Ziyu; Mao, Xingxue; Magnuson, Jon K.; Lasure, Linda L.
2004-04-01
The morphology of citric acid production strains of Aspergillus niger is sensitive to a variety of factors including the concentration of manganese (Mn2+). Upon increasing the Mn2+ concentration in A. niger (ATCC 11414) cultures to 14 ppb or higher, the morphology switches from pelleted to filamentous, accompanied by a rapid decline in citric acid production. Molecular mechanisms through which Mn2+ exerts effects on morphology and citric acid production in A. niger have not been well defined, but our use of suppression subtractive hybridization has identified 22 genes responsive to Mn2+. Fifteen genes were differentially expressed when A. niger was grown in media containing 1000 ppb Mn2+ (filamentous form) and seven genes in 10 ppb Mn2+ (pelleted form). Of the fifteen filamentous-associated genes, seven are novel and eight share 47-100% identity to genes from other organisms. Five of the pellet-associated genes are novel, and the other two genes encode a pepsin-type protease and polyubiquitin. All ten genes with deduced functions are either involved in amino acid metabolism/protein catabolism or cell regulatory processes. Northern-blot analysis showed that the transcripts of all 22 genes were rapidly enhanced or suppressed by Mn2+. Steady-state mRNA levels of six selected filamentous associated genes remained high during five days of culture in a filamentous state and low under pelleted growth conditions. The opposite behavior was observed for four selected pellet-associated genes. The full-length cDNA of the filamentous-associated clone, Brsa-25 was isolated. Antisense expression of Brsa-25 permitted pelleted growth and increased citrate production at higher concentrations of Mn2+ than could be tolerated by the parent strain. The results suggest the involvement of the newly isolated genes in regulation of A. niger morphology.
Koichi Higashi; Toru Tobe; Akinori Kanai; Ebru Uyar; Shu Ishikawa; Yutaka Suzuki; Naotake Ogasawara; Ken Kurokawa; Taku Oshima
2016-01-01
Bacteria can acquire new traits through horizontal gene transfer. Inappropriate expression of transferred genes, however, can disrupt the physiology of the host bacteria. To reduce this risk, Escherichia coli expresses the nucleoid-associated protein, H-NS, which preferentially binds to horizontally transferred genes to control their expression. Once expression is optimized, the horizontally transferred genes may actually contribute to E. coli survival in new habitats. Therefore, we investiga...
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Genome-wide association study identifies candidate genes for male fertility traits in humans.
Kosova, Gülüm; Scott, Nicole M; Niederberger, Craig; Prins, Gail S; Ober, Carole
2012-06-08
Despite the fact that hundreds of genes are known to affect fertility in animal models, relatively little is known about genes that influence natural fertility in humans. To broadly survey genes contributing to variation in male fertility, we conducted a genome-wide association study (GWAS) of two fertility traits (family size and birth rate) in 269 married men who are members of a founder population of European descent that proscribes contraception and has large family sizes. Associations between ∼250,000 autosomal SNPs and the fertility traits were examined. A total of 41 SNPs with p ≤ 1 × 10(-4) for either trait were taken forward to a validation study of 123 ethnically diverse men from Chicago who had previously undergone semen analyses. Nine (22%) of the SNPs associated with reduced fertility in the GWAS were also associated with one or more of the ten measures of reduced sperm quantity and/or function, yielding 27 associations with p values LRRC32, which encodes a latent transforming growth factor β (TGF-β) receptor on regulatory T cells. We suggest that mutations in these genes that are more severe may account for some of the unexplained infertility (or subfertility) in the general population. Copyright © 2012 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
International Nuclear Information System (INIS)
Aldenhoff, P.; Sperling, K.
1984-01-01
The nucleoid sedimentation technique is one of the most sensitive methods for measuring DNA excision repair. With this technique, it is shown that both UV- and ionizing radiation-type repair (the latter induced by bleomycin) can be discriminated in HeLa and normal diploid cells using 1-β-D-arabinofuranosylcytosine. The latter compound inhibits UV-type repair synthesis, and thus causes DNA breaks due to enzymic incision to persist, but has no effect on rejoining DNA after ionizing radiation-type damage. It was then possible to prove that 4-nitroquinoline-1-oxide induces both types of lesions which are repaired simultaneously. This effect could be demonstrated in HeLa and normal human diploid cells in a single experimental set-up. (Auth.)
Sharma, Swarkar; Gao, Xiaochong; Londono, Douglas; Devroy, Shonn E.; Mauldin, Kristen N.; Frankel, Jessica T.; Brandon, January M.; Zhang, Dongping; Li, Quan-Zhen; Dobbs, Matthew B.; Gurnett, Christina A.; Grant, Struan F.A.; Hakonarson, Hakon; Dormans, John P.; Herring, John A.; Gordon, Derek; Wise, Carol A.
2011-01-01
Adolescent idiopathic scoliosis (AIS) is an unexplained and common spinal deformity seen in otherwise healthy children. Its pathophysiology is poorly understood despite intensive investigation. Although genetic underpinnings are clear, replicated susceptibility loci that could provide insight into etiology have not been forthcoming. To address these issues, we performed genome-wide association studies (GWAS) of ∼327 000 single nucleotide polymorphisms (SNPs) in 419 AIS families. We found strongest evidence of association with chromosome 3p26.3 SNPs in the proximity of the CHL1 gene (P protein related to Robo3. Mutations in the Robo3 protein cause horizontal gaze palsy with progressive scoliosis (HGPPS), a rare disease marked by severe scoliosis. Other top associations in our GWAS were with SNPs in the DSCAM gene encoding an axon guidance protein in the same structural class with Chl1 and Robo3. We additionally found AIS associations with loci in CNTNAP2, supporting a previous study linking this gene with AIS. Cntnap2 is also of functional interest, as it interacts directly with L1 and Robo class proteins and participates in axon pathfinding. Our results suggest the relevance of axon guidance pathways in AIS susceptibility, although these findings require further study, particularly given the apparent genetic heterogeneity in this disease. PMID:21216876
Associative false consumer memory: effects of need for cognition and encoding task.
Parker, Andrew; Dagnall, Neil
2018-04-01
Two experiments investigated the effects of product-attribute associations on false consumer memory. In both experiments, subjects were presented with sets of related product attributes under incidental encoding conditions. Later, recognition memory was tested with studied attributes, non-studied but associated attributes (critical lures) and non-studied unrelated attributes. In Experiment 1, the effect of Need for Cognition (NFC) was assessed. It was found that individuals high in NFC recognised more presented attributes and falsely recognised more associative critical lures. The increase in both true and associative false memory was accompanied by a greater number of responses that index the retrieval of detailed episodic-like information. Experiment 2, replicated the main findings through an experimental manipulation of the encoding task that required subjects to consider purchase likelihood. Explanations for these findings are considered from the perspective of activation processes and knowledge structures in the form of gist-based representations.
Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R
2015-11-09
Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.
Identification of functional elements and regulatory circuits by Drosophila modENCODE
Energy Technology Data Exchange (ETDEWEB)
Roy, Sushmita; Ernst, Jason; Kharchenko, Peter V.; Kheradpour, Pouya; Negre, Nicolas; Eaton, Matthew L.; Landolin, Jane M.; Bristow, Christopher A.; Ma, Lijia; Lin, Michael F.; Washietl, Stefan; Arshinoff, Bradley I.; Ay, Ferhat; Meyer, Patrick E.; Robine, Nicolas; Washington, Nicole L.; Stefano, Luisa Di; Berezikov, Eugene; Brown, Christopher D.; Candeias, Rogerio; Carlson, Joseph W.; Carr, Adrian; Jungreis, Irwin; Marbach, Daniel; Sealfon, Rachel; Tolstorukov, Michael Y.; Will, Sebastian; Alekseyenko, Artyom A.; Artieri, Carlo; Booth, Benjamin W.; Brooks, Angela N.; Dai, Qi; Davis, Carrie A.; Duff, Michael O.; Feng, Xin; Gorchakov, Andrey A.; Gu, Tingting; Henikoff, Jorja G.; Kapranov, Philipp; Li, Renhua; MacAlpine, Heather K.; Malone, John; Minoda, Aki; Nordman, Jared; Okamura, Katsutomo; Perry, Marc; Powell, Sara K.; Riddle, Nicole C.; Sakai, Akiko; Samsonova, Anastasia; Sandler, Jeremy E.; Schwartz, Yuri B.; Sher, Noa; Spokony, Rebecca; Sturgill, David; van Baren, Marijke; Wan, Kenneth H.; Yang, Li; Yu, Charles; Feingold, Elise; Good, Peter; Guyer, Mark; Lowdon, Rebecca; Ahmad, Kami; Andrews, Justen; Berger, Bonnie; Brenner, Steven E.; Brent, Michael R.; Cherbas, Lucy; Elgin, Sarah C. R.; Gingeras, Thomas R.; Grossman, Robert; Hoskins, Roger A.; Kaufman, Thomas C.; Kent, William; Kuroda, Mitzi I.; Orr-Weaver, Terry; Perrimon, Norbert; Pirrotta, Vincenzo; Posakony, James W.; Ren, Bing; Russell, Steven; Cherbas, Peter; Graveley, Brenton R.; Lewis, Suzanna; Micklem, Gos; Oliver, Brian; Park, Peter J.; Celniker, Susan E.; Henikoff, Steven; Karpen, Gary H.; Lai, Eric C.; MacAlpine, David M.; Stein, Lincoln D.; White, Kevin P.; Kellis, Manolis
2010-12-22
of {approx}40% of the protein and nonprotein-coding genes [FlyBase 5.12 (4)] have been determined from cDNA collections (5, 6), manual curation of gene models (7), gene mutations and comprehensive genome-wide RNA interference screens (8-10), and comparative genomic analyses (11, 12). The Drosophila modENCODE project has generated more than 700 data sets that profile transcripts, histone modifications and physical nucleosome properties, general and specific transcription factors (TFs), and replication programs in cell lines, isolated tissues, and whole organisms across several developmental stages (Fig. 1). Here, we computationally integrate these data sets and report (i) improved and additional genome annotations, including full-length proteincoding genes and peptides as short as 21 amino acids; (ii) noncoding transcripts, including 132 candidate structural RNAs and 1608 nonstructural transcripts; (iii) additional Argonaute (Ago)-associated small RNA genes and pathways, including new microRNAs (miRNAs) encoded within protein-coding exons and endogenous small interfering RNAs (siRNAs) from 3-inch untranslated regions; (iv) chromatin 'states' defined by combinatorial patterns of 18 chromatin marks that are associated with distinct functions and properties; (v) regions of high TF occupancy and replication activity with likely epigenetic regulation; (vi)mixed TF and miRNA regulatory networks with hierarchical structure and enriched feed-forward loops; (vii) coexpression- and co-regulation-based functional annotations for nearly 3000 genes; (viii) stage- and tissue-specific regulators; and (ix) predictive models of gene expression levels and regulator function.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Directory of Open Access Journals (Sweden)
Francesco Pezzini
2017-08-01
Full Text Available CLN1 disease (OMIM #256730 is an early childhood ceroid-lipofuscinosis associated with mutated CLN1, whose product Palmitoyl-Protein Thioesterase 1 (PPT1 is a lysosomal enzyme involved in the removal of palmitate residues from S-acylated proteins. In neurons, PPT1 expression is also linked to synaptic compartments. The aim of this study was to unravel molecular signatures connected to CLN1. We utilized SH-SY5Y neuroblastoma cells overexpressing wild type CLN1 (SH-p.wtCLN1 and five selected CLN1 patients’ mutations. The cellular distribution of wtPPT1 was consistent with regular processing of endogenous protein, partially detected inside Lysosomal Associated Membrane Protein 2 (LAMP2 positive vesicles, while the mutants displayed more diffuse cytoplasmic pattern. Transcriptomic profiling revealed 802 differentially expressed genes (DEGs in SH-p.wtCLN1 (as compared to empty-vector transfected cells, whereas the number of DEGs detected in the two mutants (p.L222P and p.M57Nfs*45 was significantly lower. Bioinformatic scrutiny linked DEGs with neurite formation and neuronal transmission. Specifically, neuritogenesis and proliferation of neuronal processes were predicted to be hampered in the wtCLN1 overexpressing cell line, and these findings were corroborated by morphological investigations. Palmitoylation survey identified 113 palmitoylated protein-encoding genes in SH-p.wtCLN1, including 25 ones simultaneously assigned to axonal growth and synaptic compartments. A remarkable decrease in the expression of palmitoylated proteins, functionally related to axonal elongation (GAP43, CRMP1 and NEFM and of the synaptic marker SNAP25, specifically in SH-p.wtCLN1 cells was confirmed by immunoblotting. Subsequent, bioinformatic network survey of DEGs assigned to the synaptic annotations linked 81 DEGs, including 23 ones encoding for palmitoylated proteins. Results obtained in this experimental setting outlined two affected functional modules (connected to
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
DEFF Research Database (Denmark)
Kalmykova, Alla I; Shevelyov, Yuri Y; Polesskaya, Oksana O
2002-01-01
An earlier described CK2(beta)tes gene of Drosophila melanogaster is shown to encode a male germline specific isoform of regulatory beta subunit of casein kinase 2. Western-analysis using anti-CK2(beta)tes Ig revealed CK2(beta)tes protein in Drosophila testes extract. Expression of a CK2(beta...... and coimmunoprecipitation analysis of protein extract from Drosophila testes, we demonstrated an association between CK2(beta)tes and CK2alpha. Northern-analysis has shown that another regulatory (beta') subunit found recently in D. melanogaster genome is also testis-specific. Thus, we describe the first example of two...
Qvist, Per; Christensen, Jane Hvarregaard; Vardya, Irina; Rajkumar, Anto Praveen; Mørk, Arne; Paternoster, Veerle; Füchtbauer, Ernst-Martin; Pallesen, Jonatan; Fryland, Tue; Dyrvig, Mads; Hauberg, Mads Engel; Lundsberg, Birgitte; Fejgin, Kim; Nyegaard, Mette; Jensen, Kimmo; Nyengaard, Jens Randel; Mors, Ole; Didriksen, Michael; Børglum, Anders Dupont
2017-07-01
The schizophrenia-associated BRD1 gene encodes a transcriptional regulator whose comprehensive chromatin interactome is enriched with schizophrenia risk genes. However, the biology underlying the disease association of BRD1 remains speculative. This study assessed the transcriptional drive of a schizophrenia-associated BRD1 risk variant in vitro. Accordingly, to examine the effects of reduced Brd1 expression, we generated a genetically modified Brd1 +/- mouse and subjected it to behavioral, electrophysiological, molecular, and integrative genomic analyses with focus on schizophrenia-relevant parameters. Brd1 +/- mice displayed cerebral histone H3K14 hypoacetylation and a broad range of behavioral changes with translational relevance to schizophrenia. These behaviors were accompanied by striatal dopamine/serotonin abnormalities and cortical excitation-inhibition imbalances involving loss of parvalbumin immunoreactive interneurons. RNA-sequencing analyses of cortical and striatal micropunches from Brd1 +/- and wild-type mice revealed differential expression of genes enriched for schizophrenia risk, including several schizophrenia genome-wide association study risk genes (e.g., calcium channel subunits [Cacna1c and Cacnb2], cholinergic muscarinic receptor 4 [Chrm4)], dopamine receptor D 2 [Drd2], and transcription factor 4 [Tcf4]). Integrative analyses further found differentially expressed genes to cluster in functional networks and canonical pathways associated with mental illness and molecular signaling processes (e.g., glutamatergic, monoaminergic, calcium, cyclic adenosine monophosphate [cAMP], dopamine- and cAMP-regulated neuronal phosphoprotein 32 kDa [DARPP-32], and cAMP responsive element binding protein signaling [CREB]). Our study bridges the gap between genetic association and pathogenic effects and yields novel insights into the unfolding molecular changes in the brain of a new schizophrenia model that incorporates genetic risk at three levels: allelic
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Rolfe, Rebecca A; Nowlan, Niamh C; Kenny, Elaine M; Cormican, Paul; Morris, Derek W; Prendergast, Patrick J; Kelly, Daniel; Murphy, Paula
2014-01-20
Mechanical stimulation is necessary for regulating correct formation of the skeleton. Here we test the hypothesis that mechanical stimulation of the embryonic skeletal system impacts expression levels of genes implicated in developmentally important signalling pathways in a genome wide approach. We use a mutant mouse model with altered mechanical stimulation due to the absence of limb skeletal muscle (Splotch-delayed) where muscle-less embryos show specific defects in skeletal elements including delayed ossification, changes in the size and shape of cartilage rudiments and joint fusion. We used Microarray and RNA sequencing analysis tools to identify differentially expressed genes between muscle-less and control embryonic (TS23) humerus tissue. We found that 680 independent genes were down-regulated and 452 genes up-regulated in humeri from muscle-less Spd embryos compared to littermate controls (at least 2-fold; corrected p-value ≤0.05). We analysed the resulting differentially expressed gene sets using Gene Ontology annotations to identify significant enrichment of genes associated with particular biological processes, showing that removal of mechanical stimuli from muscle contractions affected genes associated with development and differentiation, cytoskeletal architecture and cell signalling. Among cell signalling pathways, the most strongly disturbed was Wnt signalling, with 34 genes including 19 pathway target genes affected. Spatial gene expression analysis showed that both a Wnt ligand encoding gene (Wnt4) and a pathway antagonist (Sfrp2) are up-regulated specifically in the developing joint line, while the expression of a Wnt target gene, Cd44, is no longer detectable in muscle-less embryos. The identification of 84 genes associated with the cytoskeleton that are down-regulated in the absence of muscle indicates a number of candidate genes that are both mechanoresponsive and potentially involved in mechanotransduction, converting a mechanical stimulus
The LBP Gene and Its Association with Resistance to Aeromonas hydrophila in Tilapia
Directory of Open Access Journals (Sweden)
Gui Hong Fu
2014-12-01
Full Text Available Resistance to pathogens is important for the sustainability and profitability of food fish production. In immune-related genes, the lipopolysaccharide-binding protein (LBP gene is an important mediator of the inflammatory reaction. We analyzed the cDNA and genomic structure of the LBP gene in tilapia. The full-length cDNA (1901 bp of the gene contained a 1416 bp open reading frame, encoding 471 amino acid residues. Its genomic sequence was 5577 bp, comprising 15 exons and 14 introns. Under normal conditions, the gene was constitutively expressed in all examined tissues. The highest expression was detected in intestine and kidney. We examined the responses of the gene to challenges with two bacterial pathogens Streptcoccus agalactiae and Aeromonas hydrophila. The gene was significantly upregulated in kidney and spleen post-infection with S. agalactiae and A. hydrophila, respectively. However, the expression profiles of the gene after the challenge with the two pathogens were different. Furthermore, we identified three SNPs in the gene. There were significant associations (p < 0.05 of two of the three SNPs with the resistance to A. hydrophila, but not with the resistance to S. agalactiae or growth performance. These results suggest that the LBP gene is involved in the acute-phase immunologic response to the bacterial infections, and the responses to the two bacterial pathogens are different. The two SNPs associated with the resistance to A. hydrophila may be useful in the selection of tilapia resistant to A. hydrophila.
Atypical haemolytic uraemic syndrome associated with a hybrid complement gene.
Directory of Open Access Journals (Sweden)
Julian P Venables
2006-10-01
Full Text Available BACKGROUND: Sequence analysis of the regulators of complement activation (RCA cluster of genes at chromosome position 1q32 shows evidence of several large genomic duplications. These duplications have resulted in a high degree of sequence identity between the gene for factor H (CFH and the genes for the five factor H-related proteins (CFHL1-5; aliases CFHR1-5. CFH mutations have been described in association with atypical haemolytic uraemic syndrome (aHUS. The majority of the mutations are missense changes that cluster in the C-terminal region and impair the ability of factor H to regulate surface-bound C3b. Some have arisen as a result of gene conversion between CFH and CFHL1. In this study we tested the hypothesis that nonallelic homologous recombination between low-copy repeats in the RCA cluster could result in the formation of a hybrid CFH/CFHL1 gene that predisposes to the development of aHUS. METHODS AND FINDINGS: In a family with many cases of aHUS that segregate with the RCA cluster we used cDNA analysis, gene sequencing, and Southern blotting to show that affected individuals carry a heterozygous CFH/CFHL1 hybrid gene in which exons 1-21 are derived from CFH and exons 22/23 from CFHL1. This hybrid encodes a protein product identical to a functionally significant CFH mutant (c.3572C>T, S1191L and c.3590T>C, V1197A that has been previously described in association with aHUS. CONCLUSIONS: CFH mutation screening is recommended in all aHUS patients prior to renal transplantation because of the high risk of disease recurrence post-transplant in those known to have a CFH mutation. Because of our finding it will be necessary to implement additional screening strategies that will detect a hybrid CFH/CFHL1 gene.
Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui
2017-01-01
Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.
Directory of Open Access Journals (Sweden)
Takayuki Ueno
Full Text Available The hypopharyngeal glands (HPGs of worker honeybees undergo physiological changes along with the age-dependent role change from nursing to foraging: nurse bee HPGs secrete mainly major royal jelly proteins, whereas forager HPGs secrete mainly α-glucosidase III, which converts the sucrose in the nectar into glucose and fructose. We previously identified two other genes, Apis mellifera buffy (Ambuffy and Apis mellifera matrix metalloproteinase 1 (AmMMP1, with enriched expression in nurse bee and forager HPGs, respectively. In the present study, to clarify the molecular mechanisms that coordinate HPG physiology with worker behavior, we first analyzed whether Ambuffy, AmMMP1, mrjp2 (a gene encoding one of major royal jelly protein isoforms, and Hbg3 (a gene encoding α-glucosidase III expression, is associated with worker behavior in 'single-cohort colonies' where workers of almost the same age perform different tasks. Expression of these genes correlated with the worker's role, while controlling for age, indicating their regulation associated with the worker's behavior. Associated gene expression suggested the possible involvement of some hormonal factors in its regulation. We therefore examined the relationship between ecdysone- and juvenile hormone (JH-signaling, and the expression profiles of these 'indicator' genes (nurse bee HPG-selective genes: mrjp2 and Ambuffy, and forager HPG-selective genes: Hbg3 and AmMMP1. Expression of both ecdysone-regulated genes (ecdysone receptor, mushroom body large type Kenyon cell specific protein-1, and E74 and JH-regulated genes (Methoprene tolerant and Krüppel homolog 1 was higher in the forager HPGs than in the nurse bee HPGs, suggesting the possible roles of ecdysone- and JH-regulated genes in worker HPGs. Furthermore, 20-hydroxyecdysone-treatment repressed both nurse bee- and forager-selective gene expression, whereas methoprene-treatment enhanced the expression of forager-selective genes and repressed
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Cohen, Rony; Basel-Vanagaite, Lina; Goldberg-Stern, Hadassah; Halevy, Ayelet; Shuper, Avinoam; Feingold-Zadok, Michal; Behar, Doron M; Straussberg, Rachel
2014-11-01
To characterize a new subset of early myoclonic encephalopathy usually associated with metabolic etiologies with a new genetic entity. We describe two siblings with early myoclonic encephalopathy born to consanguineous parents of Arab Muslim origin from Israel. We used homozygosity mapping and candidate gene sequencing to reveal the genetic basis of the myoclonic syndrome. We found a rare missense mutation in the gene encoding one of the two mitochondrial glutamate/H symporters, SLC25A22. The phenotype of early myoclonic encephalopathy was first linked to the same mutation in 2005 in patients of the same ethnicity as our family. Owing to the devastating nature of this encephalopathy, we focus attention on its clinical history, epileptic semiology, distinct electroencephalography features, and genetic basis. We provide the evidence that an integrated diagnostic strategy combining homozygosity mapping with candidate gene sequencing is efficient in consanguineous families with highly heterogeneous autosomal recessive diseases. Copyright © 2014 European Paediatric Neurology Society. Published by Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
LENUS (Irish Health Repository)
Dunlop, Rebecca L E
2012-02-01
Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jeremy E Koenig
Full Text Available Integrons are genetic platforms that accelerate lateral gene transfer (LGT among bacteria. They were first detected on plasmids bearing single and multiple drug resistance determinants in human pathogens, and it is abundantly clear that integrons have played a major role in the evolution of this public health menace. Similar genetic elements can be found in nonpathogenic environmental bacteria and in metagenomic environmental DNA samples, and it is reasonable to suppose that integrons have facilitated microbial adaptation through LGT in niches outside infectious disease wards. Here we show that a heavily impacted estuary, exposed for almost a century to products of coal and steel industries, has developed a rich and unique cassette metagenome, containing genes likely to aid in the catabolism of compounds associated with industrial waste found there. In addition, we report that the most abundant cassette recovered in this study is one that encodes a putative LysR protein. This autoregulatory transcriptional regulator is known to activate transcription of linked target genes or unlinked regulons encoding diverse functions including chlorocatechol and dichlorophenol catabolism. Finally, only class 1 integrase genes were amplified in this study despite using different primer sets, and it may be that the cassettes present in the Tar Ponds will prove to be associated with class 1 integrase genes. Nevertheless, our cassette library provides a snapshot of a complex evolutionary process involving integron-meditated LGT likely to be important in natural bioremediation.
Daniel, Dianne C; Johnson, Edward M
2018-02-15
The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding
Mutations in STX1B, encoding a presynaptic protein, cause fever-associated epilepsy syndromes
DEFF Research Database (Denmark)
Schubert, J.; Siekierska, A.; Langlois, M.
2014-01-01
Febrile seizures affect 2-4% of all children(1) and have a strong genetic component(2). Recurrent mutations in three main genes (SCN1A, SCN1B and GABRG2)(3-5) have been identified that cause febrile seizures with or without epilepsy. Here we report the identification of mutations in STX1B, encoding...... syntaxin-1B(6), that are associated with both febrile seizures and epilepsy. Whole-exome sequencing in independent large pedigrees(7,8) identified cosegregating STX1B mutations predicted to cause an early truncation or an in-frame insertion or deletion. Three additional nonsense or missense mutations...... and a de novo microdeletion encompassing STX1B were then identified in 449 familial or sporadic cases. Video and local field potential analyses of zebrafish larvae with antisense knockdown of stx1b showed seizure-like behavior and epileptiform discharges that were highly sensitive to increased temperature...
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny
2015-08-01
Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene-associated
Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J
2015-07-01
Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
MOXD2, a Gene Possibly Associated with Olfaction, Is Frequently Inactivated in Birds.
Directory of Open Access Journals (Sweden)
Chul Jun Goh
Full Text Available Vertebrate MOXD2 encodes a monooxygenase DBH-like 2 protein that could be involved in neurotransmitter metabolism, potentially during olfactory transduction. Loss of MOXD2 in apes and whales has been proposed to be associated with evolution of olfaction in these clades. We analyzed 57 bird genomes to identify MOXD2 sequences and found frequent loss of MOXD2 in 38 birds. Among the 57 birds, 19 species appeared to have an intact MOXD2 that encoded a full-length protein; 32 birds had a gene with open reading frame-disrupting point mutations and/or exon deletions; and the remaining 6 species did not show any MOXD2 sequence, suggesting a whole-gene deletion. Notably, among 10 passerine birds examined, 9 species shared a common genomic deletion that spanned several exons, implying the gene loss occurred in a common ancestor of these birds. However, 2 closely related penguin species, each of which had an inactive MOXD2, did not share any mutation, suggesting an independent loss after their divergence. Distribution of the 38 birds without an intact MOXD2 in the bird phylogenetic tree clearly indicates that MOXD2 loss is widespread and independent in bird lineages. We propose that widespread MOXD2 loss in some bird lineages may be implicated in the evolution of olfactory perception in these birds.
MOXD2, a Gene Possibly Associated with Olfaction, Is Frequently Inactivated in Birds.
Goh, Chul Jun; Choi, Dongjin; Park, Dong-Bin; Kim, Hyein; Hahn, Yoonsoo
2016-01-01
Vertebrate MOXD2 encodes a monooxygenase DBH-like 2 protein that could be involved in neurotransmitter metabolism, potentially during olfactory transduction. Loss of MOXD2 in apes and whales has been proposed to be associated with evolution of olfaction in these clades. We analyzed 57 bird genomes to identify MOXD2 sequences and found frequent loss of MOXD2 in 38 birds. Among the 57 birds, 19 species appeared to have an intact MOXD2 that encoded a full-length protein; 32 birds had a gene with open reading frame-disrupting point mutations and/or exon deletions; and the remaining 6 species did not show any MOXD2 sequence, suggesting a whole-gene deletion. Notably, among 10 passerine birds examined, 9 species shared a common genomic deletion that spanned several exons, implying the gene loss occurred in a common ancestor of these birds. However, 2 closely related penguin species, each of which had an inactive MOXD2, did not share any mutation, suggesting an independent loss after their divergence. Distribution of the 38 birds without an intact MOXD2 in the bird phylogenetic tree clearly indicates that MOXD2 loss is widespread and independent in bird lineages. We propose that widespread MOXD2 loss in some bird lineages may be implicated in the evolution of olfactory perception in these birds.
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Association of Forced Vital Capacity with the Developmental Gene NCOR2.
Directory of Open Access Journals (Sweden)
Cosetta Minelli
Full Text Available Forced Vital Capacity (FVC is an important predictor of all-cause mortality in the absence of chronic respiratory conditions. Epidemiological evidence highlights the role of early life factors on adult FVC, pointing to environmental exposures and genes affecting lung development as risk factors for low FVC later in life. Although highly heritable, a small number of genes have been found associated with FVC, and we aimed at identifying further genetic variants by focusing on lung development genes.Per-allele effects of 24,728 SNPs in 403 genes involved in lung development were tested in 7,749 adults from three studies (NFBC1966, ECRHS, EGEA. The most significant SNP for the top 25 genes was followed-up in 46,103 adults (CHARGE and SpiroMeta consortia and 5,062 children (ALSPAC. Associations were considered replicated if the replication p-value survived Bonferroni correction (p<0.002; 0.05/25, with a nominal p-value considered as suggestive evidence. For SNPs with evidence of replication, effects on the expression levels of nearby genes in lung tissue were tested in 1,111 lung samples (Lung eQTL consortium, with further functional investigation performed using public epigenomic profiling data (ENCODE.NCOR2-rs12708369 showed strong replication in children (p = 0.0002, with replication unavailable in adults due to low imputation quality. This intronic variant is in a strong transcriptional enhancer element in lung fibroblasts, but its eQTL effects could not be tested due to low imputation quality in the eQTL dataset. SERPINE2-rs6754561 replicated at nominal level in both adults (p = 0.036 and children (p = 0.045, while WNT16-rs2707469 replicated at nominal level only in adults (p = 0.026. The eQTL analyses showed association of WNT16-rs2707469 with expression levels of the nearby gene CPED1. We found no statistically significant eQTL effects for SERPINE2-rs6754561.We have identified a new gene, NCOR2, in the retinoic acid signalling pathway pointing
Faris Elbahi Joatar; Ali Ahmed Al Qarni; Muhalab E. Ali; Abdulaziz Al Masaud; Abdirashid M. Shire; Nagalla Das; Khalid Gumaa; Hayder A. Giha
2017-01-01
Background Ghrelin (GHRL), a gastric peptide encoded by the GHRL gene, is known to be involved in energy homeostasis via its G protein receptor, encoded by the growth hormone secretagogue receptor (GHSR) gene. Some studies have shown associations between plasma GHRL levels and GHRL single-nucleotide polymorphisms (SNPs), namely the Leu72Met polymorphism (rs696217 TG), with type 2 diabetes mellitus (T2DM) and insulin resistance (IR), while others have not. The controversies in these associatio...
Hampras, S.S.; Sucheston-Campbell, L.E.; Cannioto, R.; Chang-Claude, J.; Modugno, F.; Dork, T.; Hillemanns, P.; Preus, L.; Knutson, K.L.; Wallace, P.K.; Hong, C.C.; Friel, G.; Davis, W.; Nesline, M.; Pearce, C.L.; Kelemen, L.E.; Goodman, M.T.; Bandera, E.V.; Terry, K.L.; Schoof, N.; Eng, K.H.; Clay, A.; Singh, P.K.; Joseph, J.M.; Aben, K.K.H.; Anton-Culver, H.; Antonenkova, N.; Baker, H.; Bean, Y.; Beckmann, M.W.; Bisogna, M.; Bjorge, L.; Bogdanova, N.; Brinton, L.A.; Brooks-Wilson, A.; Bruinsma, F.; Butzow, R.; Campbell, I.G.; Carty, K.; Cook, L.S.; Cramer, D.W; Cybulski, C.; Dansonka-Mieszkowska, A.; Dennis, J.; Despierre, E.; Dicks, E.; Doherty, J.A.; Bois, A. du; Durst, M.; Easton, D.; Eccles, D.; Edwards, R.P.; Ekici, A.B.; Fasching, P.A.; Fridley, B.L.; Gao, Y.T.; Gentry-Maharaj, A.; Giles, G.G.; Glasspool, R.; Gronwald, J.; Harrington, P.; Harter, P.; Hasmad, H.N.; Hein, A.; Heitz, F.; Hildebrandt, M.A.T.; Hogdall, C.; Hogdall, E.; Hosono, S.; Iversen, E.S.; Jakubowska, A.; Jensen, A.; Ji, B.T.; Karlan, B.Y.; Kellar, M.; Kelley, J.L.; Kiemeney, L.A.L.M.; Klapdor, R.; Kolomeyevskaya, N.; Krakstad, C.; Kjaer, S.K.; Kruszka, B.; Kupryjanczyk, J.; Lambrechts, D.; Lambrechts, S.; Le, N.D.; Lee, A.W.; Lele, S.; Leminen, A.; Lester, J.; Levine, D.A.; Liang, D.; Lissowska, J.; Liu, S.; Lu, K.; Lubinski, J.; Lundvall, L.; Massuger, L.F.A.G.; Matsuo, K.; McGuire, V.; et al.,
2016-01-01
BACKGROUND: Regulatory T (Treg) cells, a subset of CD4+ T lymphocytes, are mediators of immunosuppression in cancer, and, thus, variants in genes encoding Treg cell immune molecules could be associated with ovarian cancer. METHODS: In a population of 15,596 epithelial ovarian cancer (EOC) cases and
DEFF Research Database (Denmark)
Hampras, Shalaka S; Sucheston-Campbell, Lara E; Cannioto, Rikki
2016-01-01
BACKGROUND: Regulatory T (Treg) cells, a subset of CD4+ T lymphocytes, are mediators of immunosuppression in cancer, and, thus, variants in genes encoding Treg cell immune molecules could be associated with ovarian cancer. METHODS: In a population of 15,596 epithelial ovarian cancer (EOC) cases a...
DEFF Research Database (Denmark)
Andreou, Dimitrios; Saetre, Peter; Kähler, Anna K
2011-01-01
The dystrobrevin binding protein-1 (DTNBP1) gene encodes dysbindin-1, a protein involved in neurodevelopmental and neurochemical processes related mainly to the monoamine dopamine. We investigated possible associations between eleven DTNBP1 polymorphisms and cerebrospinal fluid (CSF) concentratio...
Directory of Open Access Journals (Sweden)
Chen Yuan
2005-05-01
Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.
Yan, H; Guo, Y; Yang, T-L; Zhao, L-J; Deng, H-W
2012-08-06
The cytochrome P450c17α gene (CYP17) encodes a key biosynthesis enzyme of estrogen, which is critical in regulating adipogenesis and adipocyte development in humans. We therefore hypothesized that CYP17 is a candidate gene for predicting obesity. In order to test this hypothesis, we performed a family-based association test to investigate the relationship between the CYP17 gene and obesity phenotypes in a large sample comprising 1873 subjects from 405 Caucasian nuclear families of European origin recruited by the Osteoporosis Research Center of Creighton University, USA. Both single SNPs and haplotypes were tested for associations with obesity-related phenotypes, including body mass index (BMI) and fat mass. We identified three SNPs to be significantly associated with BMI, including rs3740397, rs6163, and rs619824. We further characterized the linkage disequilibrium structure for CYP17 and found that the whole CYP17 gene was located in a single-linkage disequilibrium block. This block was observed to be significantly associated with BMI. A major haplotype in this block was significantly associated with both BMI and fat mass. In conclusion, we suggest that the CYP17 gene has an effect on obesity in the Caucasian population. Further independent studies will be needed to confirm our findings.
Jurecka-Lubieniecka, Beata; Ploski, Rafal; Kula, Dorota; Krol, Aleksandra; Bednarczuk, Tomasz; Kolosza, Zofia; Tukiendorf, Andrzej; Szpak-Ulczok, Sylwia; Stanjek-Cichoracka, Anita; Polanska, Joanna; Jarzab, Barbara
2013-01-01
Background Graves' disease (GD) is a complex disease in which genetic predisposition is modified by environmental factors. The aim of the study was to examine the association between genetic variants in genes encoding proteins involved in immune response and the age at diagnosis of GD. Methods 735 GD patients and 1216 healthy controls from Poland were included into the study. Eight genetic variants in the HLA-DRB1, TNF, CTLA4, CD40, NFKb, PTPN22, IL4 and IL10 genes were genotyped. Patients were stratified by the age at diagnosis of GD and the association with genotype was analysed. Results Polymorphism in the HLA-DRB1, TNF and CTLA4 genes were associated with GD. The carriers of the HLA DRB1*03 allele were more frequent in patients with age at GD diagnosis ≤30 years than in patients with older age at GD diagnosis. Conclusions HLADRB1*03 allele is associated with young age at diagnosis of Graves' disease in polish population. PMID:23544060
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Differential regulation of the foraging gene associated with task behaviors in harvester ants
Directory of Open Access Journals (Sweden)
Kleeman Lindsay
2011-08-01
Full Text Available Abstract Background The division of labor in social insect colonies involves transitions by workers from one task to another and is critical to the organization and ecological success of colonies. The differential regulation of genetic pathways is likely to be a key mechanism involved in plasticity of social insect task behavior. One of the few pathways implicated in social organization involves the cGMP-activated protein kinase gene, foraging, a gene associated with foraging behavior in social insect species. The association of the foraging gene with behavior is conserved across diverse species, but the observed expression patterns and proposed functions of this gene vary across taxa. We compared the protein sequence of foraging across social insects and explored whether the differential regulation of this gene is associated with task behaviors in the harvester ant, Pogonomyrmex occidentalis. Results Phylogenetic analysis of the coding region of the foraging gene reveals considerable conservation in protein sequence across insects, particularly among hymenopteran species. The absence of amino acid variation in key active and binding sites suggests that differences in behaviors associated with this gene among species may be the result of changes in gene expression rather than gene divergence. Using real time qPCR analyses with a harvester ant ortholog to foraging (Pofor, we found that the brains of harvester ant foragers have a daily fluctuation in expression of foraging with mRNA levels peaking at midday. In contrast, young workers inside the nest have low levels of Pofor mRNA with no evidence of daily fluctuations in expression. As a result, the association of foraging expression with task behavior within a species changes depending on the time of day the individuals are sampled. Conclusions The amino acid protein sequence of foraging is highly conserved across social insects. Differences in foraging behaviors associated with this gene among
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist
Directory of Open Access Journals (Sweden)
Wernegreen Jennifer J
2010-12-01
Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
DEFF Research Database (Denmark)
Gravgaard Thomsen, Karina Hedelund; Lyng, Maria Bibi; Elias, Daniel
2015-01-01
predictive of outcome of ER+ breast cancer patients treated with AIs are needed. Global gene expression analysis was performed on ER+ primary breast cancers from patients treated with adjuvant AI monotherapy; half experienced recurrence (median follow-up 6.7 years). Gene expression alterations were validated...... by qRT-PCR, and functional studies evaluating the effect of siRNA-mediated gene knockdown on cell growth were performed. Twenty-six genes, including TFF3, DACH1, RGS5, and GHR, were shown to exhibit altered expression in tumors from patients with recurrence versus non-recurrent (fold change ≥1.5, p ....05), and the gene expression alterations were confirmed using qRT-PCR. Ten of these 26 genes could be linked in a network associated with cellular proliferation, growth, and development. TFF3, which encodes for trefoil factor 3 and is an estrogen-responsive oncogene shown to play a functional role in tamoxifen...
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.
Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu
2010-09-20
Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Zhu, Bi; Chen, Chuansheng; Xue, Gui; Lei, Xuemei; Li, Jin; Moyzis, Robert K; Dong, Qi; Lin, Chongde
2014-11-15
The GABRB1 gene encodes the beta 1 subunit of the gamma-aminobutyric acid A receptor (GABA A receptor), which is responsible for mediating inhibitory neurotransmission in the thalamus. Potential relationships between the GABRB1 gene, thalamus volume, and intelligence have been suggested by previous clinical studies, but have not been directly examined among nonclinical samples. The current study collected structural MRI, genetic, and behavioral data from 316 healthy Chinese adults (including 187 females and 129 males), and examined associations between GABRB1 variants, thalamus volume, and intelligence (measured by the Wechsler Adult Intelligence Scale Revised). After controlling for intracranial volume, sex, and age, GABRB1 genetic polymorphism at the SNP rs7435958 had the strongest association with thalamus volume (p = 0.002 and 0.00008 for left and right thalamus volumes, respectively), with GG homozygotes having smaller bilateral thalamus volumes than the other genotypes. Furthermore, there were positive correlations between bilateral thalamus volumes and intelligence, especially for GABRB1 rs7435958 GG female homozygotes (r's = 0.31 and 0.29, p intelligence with left and right thalamus volumes, respectively). This study provides the first evidence for the involvement of the GABRB1 gene in the thalamus structure and their interactive effects on intelligence. Future studies of the thalamus-intelligence associations should consider genetic factors as potential moderators. Copyright © 2014 Elsevier Inc. All rights reserved.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Thomson, Cynthia J.; Rajala, Amelia K.; Carlson, Scott R.; Rupert, Jim L.
2014-01-01
Sensation seeking is a personality trait that has been associated with disinhibited behaviours including substance use and gambling, but also with high-risk sport practices including skydiving, paragliding, and downhill skiing. Twin studies have shown that sensation seeking is moderately heritable, and candidate genes encoding components involved in dopaminergic transmission have been investigated as contributing to this type of behaviour. To determine whether variants in the regulatory regio...
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
The ‘Pokemon’ (ZBTB7) Gene: No Evidence of Association with Sporadic Breast Cancer
Salas, Antonio; Vega, Ana; Milne, Roger L.; García-Magariños, Manuel; Ruibal, Álvaro; Benítez, Javier; Carracedo, Ángel
2008-01-01
It has been proposed that the excess of familiar risk associated with breast cancer could be explained by the cumulative effect of multiple weakly predisposing alleles. The transcriptional repressor FBI1, also known as Pokemon, has recently been identified as a critical factor in oncogenesis. This protein is encoded by the ZBTB7 gene. Here we aimed to determine whether polymorphisms in ZBTB7 are associated with breast cancer risk in a sample of cases and controls collected in hospitals from North and Central Spanish patients. We genotyped 15 SNPs in ZBTB7, including the flanking regions, with an average coverage of 1 SNP/2.4 Kb, in 360 sporadic breast cancer cases and 402 controls. Comparison of allele, genotype and haplotype frequencies between cases and controls did not reveal associations using Pearson’s chi-square test and a permutation procedure to correct for multiple test. In this, the first study of the ZBTB7 gene in relation to, sporadic breast cancer, we found no evidence of an association. PMID:21892298
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
DEFF Research Database (Denmark)
Afzal, Shoaib; Gusella, Milena; Vainer, Ben
2011-01-01
PURPOSE: The purpose of this study was to investigate whether specific combinations of polymorphisms in genes encoding proteins involved in 5-fluorouracil (5-FU) pharmacokinetics and pharmacodynamics are associated with increased risk of treatment-induced toxicity. EXPERIMENTAL DESIGN: We analyze...
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Organization of Mitochondrial Gene Expression in Two Distinct Ribosome-Containing Assemblies
Directory of Open Access Journals (Sweden)
Kirsten Kehrein
2015-02-01
Full Text Available Mitochondria contain their own genetic system that provides subunits of the complexes driving oxidative phosphorylation. A quarter of the mitochondrial proteome participates in gene expression, but how all these factors are orchestrated and spatially organized is currently unknown. Here, we established a method to purify and analyze native and intact complexes of mitochondrial ribosomes. Quantitative mass spectrometry revealed extensive interactions of ribosomes with factors involved in all the steps of posttranscriptional gene expression. These interactions result in large expressosome-like assemblies that we termed mitochondrial organization of gene expression (MIOREX complexes. Superresolution microscopy revealed that most MIOREX complexes are evenly distributed throughout the mitochondrial network, whereas a subset is present as nucleoid-MIOREX complexes that unite the whole spectrum of organellar gene expression. Our work therefore provides a conceptual framework for the spatial organization of mitochondrial protein synthesis that likely developed to facilitate gene expression in the organelle.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Manz, Judith; Rodríguez, Elke; ElSharawy, Abdou; Oesau, Eva-Maria; Petersen, Britt-Sabina; Baurecht, Hansjörg; Mayr, Gabriele; Weber, Susanne; Harder, Jürgen; Reischl, Eva; Schwarz, Agatha; Novak, Natalija; Franke, Andre; Weidinger, Stephan
2016-12-01
Gene-mapping studies have consistently identified a susceptibility locus for atopic dermatitis and other inflammatory diseases on chromosome band 11q13.5, with the strongest association observed for a common variant located in an intergenic region between the two annotated genes C11orf30 and LRRC32. Using a targeted resequencing approach we identified low-frequency and rare missense mutations within the LRRC32 gene encoding the protein GARP, a receptor on activated regulatory T cells that binds latent transforming growth factor-β. Subsequent association testing in more than 2,000 atopic dermatitis patients and 2,000 control subjects showed a significant excess of these LRRC32 variants in individuals with atopic dermatitis. Structural protein modeling and bioinformatic analysis predicted a disruption of protein transport upon these variants, and overexpression assays in CD4 + CD25 - T cells showed a significant reduction in surface expression of the mutated protein. Consistently, flow cytometric (FACS) analyses of different T-cell subtypes obtained from atopic dermatitis patients showed a significantly reduced surface expression of GARP and a reduced conversion of CD4 + CD25 - T cells into regulatory T cells, along with lower expression of latency-associated protein upon stimulation in carriers of the LRRC32 A407T variant. These results link inherited disturbances of transforming growth factor-β signaling with atopic dermatitis risk. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
Lower Parietal Encoding Activation Is Associated with Sharper Information and Better Memory.
Lee, Hongmi; Chun, Marvin M; Kuhl, Brice A
2017-04-01
Mean fMRI activation in ventral posterior parietal cortex (vPPC) during memory encoding often negatively predicts successful remembering. A popular interpretation of this phenomenon is that vPPC reflects "off-task" processing. However, recent fMRI studies considering distributed patterns of activity suggest that vPPC actively represents encoded material. Here, we assessed the relationships between pattern-based content representations in vPPC, mean activation in vPPC, and subsequent remembering. We analyzed data from two fMRI experiments where subjects studied then recalled word-face or word-scene associations. For each encoding trial, we measured 1) mean univariate activation within vPPC and 2) the strength of face/scene information as indexed by pattern analysis. Mean activation in vPPC negatively predicted subsequent remembering, but the strength of pattern-based information in the same vPPC voxels positively predicted later memory. Indeed, univariate amplitude averaged across vPPC voxels negatively correlated with pattern-based information strength. This dissociation reflected a tendency for univariate reductions to maximally occur in voxels that were not strongly tuned for the category of encoded stimuli. These results indicate that vPPC activity patterns reflect the content and quality of memory encoding and constitute a striking example of lower univariate activity corresponding to stronger pattern-based information. © The Author 2016. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.
Xia, Kun; Ding, Rongjing; Zhang, Zhiyong; Li, Weiming; Shang, Xiaoming; Yang, Xinchun; Wang, Lefeng; Zhang, Qi
2017-08-15
Adrenergic receptors play a key role in activating the sympathetic nervous system, which often accompanies with the development of myocardial infarction (MI). Here, we aimed to test the association of eight potentially functional polymorphisms in five adrenergic receptor-encoding genes with MI risk. Genotypes were available for 717 MI patients and 612 controls. There were no detectable deviations from the Hardy-Weinberg equilibrium for all study polymorphisms. Allele frequencies differed remarkably for ADRA2B D/I (P<0.001), ADRB1 Ser49Gly (P=0.002), ADRB2 Gln27Glu (P=0.005), and ADRB3 Trp64Arg (P<0.001) polymorphisms, even after the Bonferroni correction. Systolic blood pressure was significantly lower in ADRA2B II genotype carriers than in the DD genotype carriers (P=0.006), while plasma high-density lipoprotein cholesterol was significantly higher in patients carrying ADRA2B I allele and ADRB1 49Ser allele than in patients with the DD genotype and 49Gly/49Gly genotype, respectively (P=0.018 and 0.033). Overall best interaction model consisted of ADRA2B D/I, ADRB1 Ser49Gly, dyslipidemia and hypertension, with the highest testing accuracy of 0.627 and the maximal 10-fold cross-validation consistency (P=0.017). Finally, a nomogram was depicted based on four significant polymorphisms and metabolic risk factors, and it had a better predictive utility and was internally validated with a discrimination C-index of 0.723 (P<0.001). Altogether, we identified two polymorphisms, ADRA2B D/I and ADRB1 Ser49Arg, which not only altered genetic susceptibility to MI, but also impacted on blood pressure and plasma lipid changes, and their combination with metabolic risk factors constituted the overall best interaction model. Copyright © 2017. Published by Elsevier B.V.
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Visually encoded working memory is closely associated with mobility in older adults.
Kawagoe, Toshikazu; Sekiyama, Kaoru
2014-06-01
Previous research suggests that older adults' motor performance is associated with cognitive function. Although this has been reported especially for executive function, it is not yet clear for various types of working memory (WM). In fact, age-related decline in WM is more severe for faces than other types of visual objects. The present study focused on the relationship between diverse WM and two types of motor performance (mobility and manual dexterity), which are implicated in pathological decline. To measure diverse WM, we adopted N-back tasks using three distinct types of stimuli (numbers, locations, and faces). Mobility was measured with the timed up and go test and manual dexterity was measured with the Pegboard Test. Participants were community-dwelling older adults (age: mean 78.6 years). Comparisons of younger and older adults' N-back performances indicated that WM for faces is more sensitive to aging compared with WM for the other stimuli. Correlation analyses within the older group indicated that WM tasks mainly correlated with mobility, but less so with manual dexterity. Among the three types of WM, spatial WM and face WM had significant partial correlation coefficients with mobility after age and general cognitive decline were controlled. These results indicate that visually encoded WM is associated only with mobility, although general cognitive function is related to both motor abilities. The selective association between the visually encoded WM and mobility is discussed in terms of the interactive processes between executive processing and perceptual encoding, where dynamic visual processing for locomotion plays a role.
Mutations in LCA5, encoding the ciliary protein lebercilin, cause Leber congenital amaurosis.
Hollander, A.I. den; Koenekoop, R.K.; Mohamed, M.D.; Arts, H.H.; Boldt, K.; Towns, K.V.; Sedmak, T.; Beer, M. de; Nagel-Wolfrum, K.; McKibbin, M.; Dharmaraj, S.; Lopez, I.; Ivings, L.; Williams, G.A.; Springell, K.; Woods, C.G.; Jafri, H.; Rashid, Y.; Strom, T.M.; Zwaag, B. van der; Gosens, I.; Kersten, F.F.J.; Wijk, E. van; Veltman, J.A.; Zonneveld, M.N.; Beersum, S.E.C. van; Maumenee, I.H.; Wolfrum, U.; Cheetham, M.E.; Ueffing, M.; Cremers, F.P.M.; Inglehearn, C.F.; Roepman, R.
2007-01-01
Leber congenital amaurosis (LCA) causes blindness or severe visual impairment at or within a few months of birth. Here we show, using homozygosity mapping, that the LCA5 gene on chromosome 6q14, which encodes the previously unknown ciliary protein lebercilin, is associated with this disease. We
Molecular cloning and characterization of a gene encoding RING ...
Indian Academy of Sciences (India)
PRAKASH KUMAR G
such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.
Kleene, Kenneth C
2005-01-01
This review proposes that the peculiar patterns of gene expression in spermatogenic cells are the consequence of powerful evolutionary forces known as sexual selection. Sexual selection is generally characterized by intense competition of males for females, an enormous variety of the strategies to maximize male reproductive success, exaggerated male traits at all levels of biological organization, co-evolution of sexual traits in males and females, and conflict between the sexual advantage of the male trait and the reproductive fitness of females and the individual fitness of both sexes. In addition, spermatogenesis is afflicted by selfish genes that promote their transmission to progeny while causing deleterious effects. Sexual selection, selfish genes, and genetic conflict provide compelling explanations for many atypical features of gene expression in spermatogenic cells including the gross overexpression of certain mRNAs, transcripts encoding truncated proteins that cannot carry out basic functions of the proteins encoded by the same genes in somatic cells, the large number of gene families containing paralogous genes encoding spermatogenic cell-specific isoforms, the large number of testis-cancer-associated genes that are expressed only in spermatogenic cells and malignant cells, and the overbearing role of Sertoli cells in regulating the number and quality of spermatozoa.
Genome-Wide Association Study of Metabolic Traits Reveals Novel Gene-Metabolite-Disease Links
Nicholls, Andrew W.; Salek, Reza M.; Marques-Vidal, Pedro; Morya, Edgard; Sameshima, Koichi; Montoliu, Ivan; Da Silva, Laeticia; Collino, Sebastiano; Martin, François-Pierre; Rezzi, Serge; Steinbeck, Christoph; Waterworth, Dawn M.; Waeber, Gérard; Vollenweider, Peter; Beckmann, Jacques S.; Le Coutre, Johannes; Mooser, Vincent; Bergmann, Sven; Genick, Ulrich K.; Kutalik, Zoltán
2014-01-01
Metabolic traits are molecular phenotypes that can drive clinical phenotypes and may predict disease progression. Here, we report results from a metabolome- and genome-wide association study on 1H-NMR urine metabolic profiles. The study was conducted within an untargeted approach, employing a novel method for compound identification. From our discovery cohort of 835 Caucasian individuals who participated in the CoLaus study, we identified 139 suggestively significant (P<5×10−8) and independent associations between single nucleotide polymorphisms (SNP) and metabolome features. Fifty-six of these associations replicated in the TasteSensomics cohort, comprising 601 individuals from São Paulo of vastly diverse ethnic background. They correspond to eleven gene-metabolite associations, six of which had been previously identified in the urine metabolome and three in the serum metabolome. Our key novel findings are the associations of two SNPs with NMR spectral signatures pointing to fucose (rs492602, P = 6.9×10−44) and lysine (rs8101881, P = 1.2×10−33), respectively. Fine-mapping of the first locus pinpointed the FUT2 gene, which encodes a fucosyltransferase enzyme and has previously been associated with Crohn's disease. This implicates fucose as a potential prognostic disease marker, for which there is already published evidence from a mouse model. The second SNP lies within the SLC7A9 gene, rare mutations of which have been linked to severe kidney damage. The replication of previous associations and our new discoveries demonstrate the potential of untargeted metabolomics GWAS to robustly identify molecular disease markers. PMID:24586186
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
SnoVault and encodeD: A novel object-based storage system and applications to ENCODE metadata.
Directory of Open Access Journals (Sweden)
Benjamin C Hitz
Full Text Available The Encyclopedia of DNA elements (ENCODE project is an ongoing collaborative effort to create a comprehensive catalog of functional elements initiated shortly after the completion of the Human Genome Project. The current database exceeds 6500 experiments across more than 450 cell lines and tissues using a wide array of experimental techniques to study the chromatin structure, regulatory and transcriptional landscape of the H. sapiens and M. musculus genomes. All ENCODE experimental data, metadata, and associated computational analyses are submitted to the ENCODE Data Coordination Center (DCC for validation, tracking, storage, unified processing, and distribution to community resources and the scientific community. As the volume of data increases, the identification and organization of experimental details becomes increasingly intricate and demands careful curation. The ENCODE DCC has created a general purpose software system, known as SnoVault, that supports metadata and file submission, a database used for metadata storage, web pages for displaying the metadata and a robust API for querying the metadata. The software is fully open-source, code and installation instructions can be found at: http://github.com/ENCODE-DCC/snovault/ (for the generic database and http://github.com/ENCODE-DCC/encoded/ to store genomic data in the manner of ENCODE. The core database engine, SnoVault (which is completely independent of ENCODE, genomic data, or bioinformatic data has been released as a separate Python package.
The imprinted SNRPN gene is associated with a polycistronic mRNA and an imprinting control element
Energy Technology Data Exchange (ETDEWEB)
Saitoh, S.; Nicholls, R.D. [Case Western Reserve Univ., Cleveland, OH (United States); Seip, J. [Pennsylvania State Univ., Hershey, PA (United States)] [and others
1994-09-01
The small nuclear ribonucleoprotein-associated protein SmN (SNRPN) gene is located in the Prader-Willi syndrome (PWS) critical region in chromosome 15q11-q13. We have previously shown that it is functionally imprinted in humans, being only expressed from the paternal allele and differentially methylated on parental alleles. Therefore, SNRPN may have a role in PWS, although genetic studies suggest that at least two genes may be necessary for the classical PWS phenotype. We have characterized the SNRPN genomic structure, and shown that it comprises ten exons. Surprisingly, we identified an open reading frame (ORF) in the first three exons, 190-bp 5{prime} to the SmN ORF. Notably, the majority of base substitutions bewteen human and rodents in the upstream ORF occurred in the wobble position of codons, suggesting selection for a protein coding function. This ORF, which we name SNURF (SNRPN upstream reading frame) encodes a putative polypeptide of 71 amino acids. By analogy to prokaryotic operons that encode proteins with related functions, it is possible that SNURF may have a role in pre-mRNA splicing.
Manolescu, Daniel C; El-Kares, Reyhan; Lakhal-Chaieb, Lajmi; Montpetit, Alexandre; Bhat, Pangala V; Goodyer, Paul
2010-06-01
Retinoic acid (RA) is a critical regulator of gene expression during embryonic development. In rodents, moderate maternal vitamin A deficiency leads to subtle morphogenetic defects and inactivation of RA pathway genes causes major disturbances of embryogenesis. In this study, we quantified RA in umbilical cord blood of 145 healthy full-term Caucasian infants from Montreal. Sixty seven percent of values were ROL). However, we found that the (A) allele of the rs12591551 single nucleotide polymorphism (SNP) in the ALDH1A2 gene (ALDH1A2rs12591551(A)), occurring in 19% of newborns, was associated with 2.5-fold higher serum RA levels. ALDH1A2 encodes retinaldehyde dehydrogenase (RALDH) 2, which synthesizes RA in fetal tissues. We also found that homozygosity for the (A) allele of the rs12724719 SNP in the CRABP2 gene (CRABP2rs12724719(A/A)) was associated with 4.4-fold increase in umbilical cord serum RA. CRABP2 facilitates RA binding to its cognate receptor complex and transfer to the nucleus. We hypothesize that individual variation in RA pathway genes may account for subtle variations in RA-dependent human embryogenesis.
DEFF Research Database (Denmark)
Lindegaard, Marie Louise Skakkebæk; Damm, Peter; Mathiesen, Elisabeth R
2006-01-01
Maternal diabetes can cause fetal macrosomia and increased risk of obesity, diabetes, and cardiovascular disease in adulthood of the offspring. Although increased transplacental lipid transport could be involved, the impact of maternal type 1 diabetes on molecular mechanisms for lipid transport...... in placenta is largely unknown. To examine whether maternal type 1 diabetes affects placental lipid metabolism, we measured lipids and mRNA expression of lipase-encoding genes in placentas from women with type 1 diabetes (n = 27) and a control group (n = 21). The placental triglyceride (TG) concentration....... These results suggest that maternal type 1 diabetes is associated with TG accumulation and increased EL and HSL gene expression in placenta and that optimal metabolic control reduces these effects....
Directory of Open Access Journals (Sweden)
Nastassja Morel
Full Text Available Information that is processed with reference to oneself, i.e. Self-Referential Processing (SRP, is generally associated with better remembering compared to information processed in a condition not related to oneself. This positive effect of the self on subsequent memory performance is called as Self-Reference Effect (SRE. The neural basis of SRE is still poorly understood. The main goal of the present work was thus to highlight brain changes associated with SRE in terms of activity and functional coupling and during both encoding and retrieval so as to assess the relative contribution of both processes to SRE. For this purpose, we used an fMRI event-related self-referential paradigm in 30 healthy young subjects and measured brain activity during both encoding and retrieval of self-relevant information compared to a semantic control condition. We found that SRE was associated with brain changes during the encoding phase only, including both greater activity in the medial prefrontal cortex and hippocampus, and greater functional coupling between these brain regions and the posterior cingulate cortex. These findings highlight the contribution of brain regions involved in both SRP and episodic memory and the relevance of the communication between these regions during the encoding process as the neural substrates of SRE. This is consistent with the idea that SRE reflects a positive effect of the reactivation of self-related memories on the encoding of new information in episodic memory.
Bester, Michael C; Jacobson, Dan; Bauer, Florian F
2012-01-01
The outer cell wall of the yeast Saccharomyces cerevisiae serves as the interface with the surrounding environment and directly affects cell-cell and cell-surface interactions. Many of these interactions are facilitated by specific adhesins that belong to the Flo protein family. Flo mannoproteins have been implicated in phenotypes such as flocculation, substrate adhesion, biofilm formation, and pseudohyphal growth. Genetic data strongly suggest that individual Flo proteins are responsible for many specific cellular adhesion phenotypes. However, it remains unclear whether such phenotypes are determined solely by the nature of the expressed FLO genes or rather as the result of a combination of FLO gene expression and other cell wall properties and cell wall proteins. Mss11 has been shown to be a central element of FLO1 and FLO11 gene regulation and acts together with the cAMP-PKA-dependent transcription factor Flo8. Here we use genome-wide transcription analysis to identify genes that are directly or indirectly regulated by Mss11. Interestingly, many of these genes encode cell wall mannoproteins, in particular, members of the TIR and DAN families. To examine whether these genes play a role in the adhesion properties associated with Mss11 expression, we assessed deletion mutants of these genes in wild-type and flo11Δ genetic backgrounds. This analysis shows that only FLO genes, in particular FLO1/10/11, appear to significantly impact on such phenotypes. Thus adhesion-related phenotypes are primarily dependent on the balance of FLO gene expression.
Associations between variants of the HAL gene and milk production traits in Chinese Holstein cows.
Wang, Haifei; Jiang, Li; Wang, Wenwen; Zhang, Shengli; Yin, Zongjun; Zhang, Qin; Liu, Jian-Feng
2014-11-25
The histidine ammonia-lyse gene (HAL) encodes the histidine ammonia-lyase, which catalyzes the first reaction of histidine catabolism. In our previous genome-wide association study in Chinese Holstein cows to identify genetic variants affecting milk production traits, a SNP (rs41647754) located 357 bp upstream of HAL, was found to be significantly associated with milk yield and milk protein yield. In addition, the HAL gene resides within the reported QTLs for milk production traits. The aims of this study were to identify genetic variants in HAL and to test the association between these variants and milk production traits. Fifteen SNPs were identified within the regions under study of the HAL gene, including three coding mutations, seven intronic mutations, one promoter region mutation, and four 3'UTR mutations. Nine of these identified SNPs were chosen for subsequent genotyping and association analyses. Our results showed that five SNP markers (ss974768522, ss974768525, ss974768531, ss974768533 and ss974768534) were significantly associated with one or more milk production traits. Haplotype analysis showed that two haplotype blocks were significantly associated with milk yield and milk protein yield, providing additional support for the association between HAL variants and milk production traits in dairy cows (P HAL gene and milk production traits in Chinese Holstein cows, indicating the potential role of HAL variants in these traits. These identified SNPs may serve as genetic markers used in genomic selection schemes to accelerate the genetic gains of milk production traits in dairy cattle.
Directory of Open Access Journals (Sweden)
Kelton David F
2010-04-01
Full Text Available Abstract Background Johne's disease is a chronic inflammatory bowel disease (IBD of ruminants caused by Mycobacterium avium ssp. paratuberculosis (MAP. Since this pathogen has been implicated in the pathogenesis of human IBDs, the goal of this study was to assess whether single nucleotide polymorphism (SNPs in several well-known candidate genes for human IBD are associated with susceptibility to MAP infection in dairy cattle. Methods The bovine candidate genes, interleukin-10 (IL10, IL10 receptor alpha/beta (IL10RA/B, transforming growth factor beta 1 (TGFB1, TGFB receptor class I/II (TGFBR1/2, and natural resistance-associated macrophage protein 1 (SLC11A1 were sequenced for SNP discovery using pooled DNA samples, and the identified SNPs were genotyped in a case-control association study comprised of 242 MAP negative and 204 MAP positive Holstein dairy cattle. Logistic regression was used to determine the association of SNPs and reconstructed haplotypes with MAP infection status. Results A total of 13 SNPs were identified. Four SNPs in IL10RA (984G > A, 1098C > T, 1269T > C, and 1302A > G were tightly linked, and showed a strong additive and dominance relationship with MAP infection status. Haplotypes AGC and AAT, containing the SNPs IL10RA 633C > A, 984G > A and 1185C > T, were associated with an elevated and reduced likelihood of positive diagnosis by serum ELISA, respectively. Conclusions SNPs in IL10RA are associated with MAP infection status in dairy cattle. The functional significance of these SNPs warrants further investigation.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Association between CFL1 gene polymorphisms and spina bifida risk in a California population
Directory of Open Access Journals (Sweden)
Lammer Edward J
2007-03-01
Full Text Available Abstract Background CFL1 encodes human non-muscle cofilin (n-cofilin, which is an actin-depolymerizing factor and is essential in cytokinesis, endocytosis, and in the development of all embryonic tissues. Cfl1 knockout mice exhibit failure of neural tube closure at E10.5 and die in utero. We hypothesized that genetic variation within the human CFL1 gene may alter the protein's function and result in defective actin depolymerizing and cellular activity during neural tube closure. Such alterations may be associated with an increased risk for neural tube defects (NTDs. Methods Having re-sequenced the human CFL1 gene and identified five common single nucleotide polymorphisms (SNPs in our target population, we investigated whether there existed a possible association between the genetic variations of the CFL1 gene and risk of spina bifida. Samples were obtained from a large population-based case-control study in California. Allele association, genotype association and haplotype association were evaluated in two different ethnicity groups, non-Hispanic white and Hispanic white. Results Homozygosity for the minor alleles of the SNPs studied (rs652021, rs665306, rs667555, rs4621 and rs11227332 appeared to produce an increased risk for spina bifida. Subjects with the haplotype composed of all minor alleles (CCGGT appeared to have increased spina bifida risk (OR = 1.6, 95% CI: 0.9~2.9, however, this finding is not statistically significant likely due to limited sample size. Conclusion The sequence variation of human CFL1 gene is a genetic modifier for spina bifida risk in this California population.
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Directory of Open Access Journals (Sweden)
Bryan Holland
Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the
Insertion/Deletion Within the KDM6A Gene Is Significantly Associated With Litter Size in Goat
Cui, Yang; Yan, Hailong; Wang, Ke; Xu, Han; Zhang, Xuelian; Zhu, Haijing; Liu, Jinwang; Qu, Lei; Lan, Xianyong; Pan, Chuanying
2018-01-01
A previous whole-genome association analysis identified lysine demethylase 6A (KDM6A), which encodes a type of histone demethylase, as a candidate gene associated to goat fecundity. KDM6A gene knockout mouse disrupts gametophyte development, suggesting that it has a critical role in reproduction. In this study, goat KDM6A mRNA expression profiles were determined, insertion/deletion (indel) variants in the gene identified, indel variants effect on KDM6A gene expression assessed, and their association with first-born litter size analyzed in 2326 healthy female Shaanbei white cashmere goats. KDM6A mRNA was expressed in all tissues tested (heart, liver, spleen, lung, kidney, muscle, brain, skin and testis); the expression levels in testes at different developmental stages [1-week-old (wk), 2, 3 wk, 1-month-old (mo), 1.5 and 2 mo] indicated a potential association with the mitosis-to-meiosis transition, implying that KDM6A may have an essential role in goat fertility. Meanwhile, two novel intronic indels of 16 bp and 5 bp were identified. Statistical analysis revealed that only the 16 bp indel was associated with first-born litter size (P goat population (P = 0.001). Consistently, the 16 bp indel also had a significant effect on KDM6A gene expression. Additionally, there was no significant linkage disequilibrium (LD) between these two indel loci, consistent with the association analysis results. Together, these findings suggest that the 16 bp indel in KDM6A may be useful for marker-assisted selection (MAS) of goats. PMID:29616081
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun
2013-01-01
Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
van der Linden, Marieke; Berkers, Ruud M W J; Morris, Richard G M; Fernández, Guillén
2017-09-27
After consolidation, information belonging to a mental schema is better remembered, but such memory can be less specific when it comes to details. A neuronal mechanism consistent with this behavioral pattern could result from a dynamic interaction that entails mediation by a specific cortical network with associated hippocampal disengagement. We now report that, in male and female adult human subjects, encoding and later consolidation of a series of objects embedded in a semantic schema was associated with a buildup of activity in the angular gyrus (AG) that predicted memory 24 h later. In parallel, the posterior hippocampus became less involved as schema objects were encoded successively. Hippocampal disengagement was related to an increase in falsely remembering objects that were not presented at encoding. During both encoding and retrieval, the AG and lateral occipital complex (LOC) became functionally connected and this interaction was beneficial for successful retrieval. Therefore, a network including the AG and LOC enhances the overnight retention of schema-related memories and their simultaneous detachment from the hippocampus reduces the specificity of the memory. SIGNIFICANCE STATEMENT This study provides the first empirical evidence on how the hippocampus and the neocortex interact dynamically when acquiring and then effectively retaining durable knowledge that is associated to preexisting knowledge, but they do so at the cost of memory specificity. This interaction is a fundamental mnemonic operation that has thus far been largely overlooked in memory research. Copyright © 2017 the authors 0270-6474/17/379474-12$15.00/0.
Skorczyk, A; Flisikowski, K; Szydlowski, M; Cieslak, J; Fries, R; Switonski, M
2011-02-01
There are five genes encoding melanocortin receptors. Among canids, the genes have mainly been studied in the dog (MC1R, MC2R and MC4R). The MC4R gene has also been analysed in the red fox. In this report, we present a study of chromosome localization, comparative sequence analysis and polymorphism of the MC3R gene in the dog, red fox, arctic fox and Chinese raccoon dog. The gene was localized by FISH to the following chromosome: 24q24-25 in the dog, 14p16 in the red fox, 18q13 in the arctic fox and NPP4p15 in the Chinese raccoon dog. A high identity level of the MC3R gene sequences was observed among the species, ranging from 96.0% (red fox--Chinese raccoon dog) to 99.5% (red fox--arctic fox). Altogether, eight polymorphic sites were found in the red fox, six in the Chinese raccoon dog and two in the dog, while the arctic fox appeared to be monomorphic. In addition, association of several polymorphisms with body weight was analysed in red foxes (the number of genotyped animals ranged from 319 to 379). Two polymorphisms in the red fox, i.e. a silent substitution c.957A>C and c.*185C>T in the 3'-flanking sequence, showed a significant association (P < 0.01) with body weight. © 2010 The Authors, Animal Genetics © 2010 Stichting International Foundation for Animal Genetics.
Syndromes associated with Homo sapiens pol II regulatory genes.
Bina, M; Demmon, S; Pares-Matos, E I
2000-01-01
The molecular basis of human characteristics is an intriguing but an unresolved problem. Human characteristics cover a broad spectrum, from the obvious to the abstract. Obvious characteristics may include morphological features such as height, shape, and facial form. Abstract characteristics may be hidden in processes that are controlled by hormones and the human brain. In this review we examine exaggerated characteristics presented as syndromes. Specifically, we focus on human genes that encode transcription factors to examine morphological, immunological, and hormonal anomalies that result from deletion, insertion, or mutation of genes that regulate transcription by RNA polymerase II (the Pol II genes). A close analysis of abnormal phenotypes can give clues into how sequence variations in regulatory genes and changes in transcriptional control may give rise to characteristics defined as complex traits.
International Nuclear Information System (INIS)
Hesketh, T.G.
1983-01-01
In an optical encoder, light from an optical fibre input A is encoded by means of the encoding disc and is subsequently collected for transmission via optical fibre B. At some point in the optical path between the fibres A and B, the light is separated into component form by means of a filtering or dispersive system and each colour component is associated with a respective one of the coding channels of the disc. In this way, the significance of each bit of the coded information is represented by a respective colour thereby enabling the components to be re-combined for transmission by the fibre B without loss of information. (author)
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
A human-specific de novo protein-coding gene associated with human brain functions.
Directory of Open Access Journals (Sweden)
Chuan-Yun Li
2010-03-01
Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.
Directory of Open Access Journals (Sweden)
Radko Komers
Full Text Available Diabetes is among the most common causes of end-stage renal disease, although its pathophysiology is incompletely understood. We performed next-generation sequencing-based transcriptome analysis of renal gene expression changes in the OVE26 murine model of diabetes (age 15 weeks, relative to non-diabetic control, in the presence and absence of short-term (seven-day treatment with the angiotensin receptor blocker, losartan (n = 3-6 biological replicates per condition. We detected 1438 statistically significant changes in gene expression across conditions. Of the 638 genes dysregulated in diabetes relative to the non-diabetic state, >70% were downregulation events. Unbiased functional annotation of genes up- and down-regulated by diabetes strongly associated (p52-fold, encoded by the cationic amino acid transporter Slc7a12, and the gene product most highly downregulated by diabetes (>99%--encoded by the "pseudogene" Gm6300--are adjacent in the murine genome, are members of the SLC7 gene family, and are likely paralogous. Therefore, diabetes activates a near-total genetic switch between these two paralogs. Other individual-level changes in gene expression are potentially relevant to diabetic pathophysiology, and novel pathways are suggested. Genes unaffected by diabetes alone but exhibiting increased renal expression with losartan produced a signature consistent with malignant potential.
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
Global RNA association with the transcriptionally active chromosome of chloroplasts.
Lehniger, Marie-Kristin; Finster, Sabrina; Melonek, Joanna; Oetke, Svenja; Krupinska, Karin; Schmitz-Linneweber, Christian
2017-10-01
Processed chloroplast RNAs are co-enriched with preparations of the chloroplast transcriptionally active chromosome. Chloroplast genomes are organized as a polyploid DNA-protein structure called the nucleoid. Transcriptionally active chloroplast DNA together with tightly bound protein factors can be purified by gel filtration as a functional entity called the transcriptionally active chromosome (TAC). Previous proteomics analyses of nucleoids and of TACs demonstrated a considerable overlap in protein composition including RNA binding proteins. Therefore the RNA content of TAC preparations from Nicotiana tabacum was determined using whole genome tiling arrays. A large number of chloroplast RNAs was found to be associated with the TAC. The pattern of RNAs attached to the TAC consists of RNAs produced by different chloroplast RNA polymerases and differs from the pattern of RNA found in input controls. An analysis of RNA splicing and RNA editing of selected RNA species demonstrated that TAC-associated RNAs are processed to a similar extent as the RNA in input controls. Thus, TAC fractions contain a specific subset of the processed chloroplast transcriptome.
Directory of Open Access Journals (Sweden)
Inês Barroso
2003-10-01
Full Text Available Type 2 diabetes is an increasingly common, serious metabolic disorder with a substantial inherited component. It is characterised by defects in both insulin secretion and action. Progress in identification of specific genetic variants predisposing to the disease has been limited. To complement ongoing positional cloning efforts, we have undertaken a large-scale candidate gene association study. We examined 152 SNPs in 71 candidate genes for association with diabetes status and related phenotypes in 2,134 Caucasians in a case-control study and an independent quantitative trait (QT cohort in the United Kingdom. Polymorphisms in five of 15 genes (33% encoding molecules known to primarily influence pancreatic beta-cell function-ABCC8 (sulphonylurea receptor, KCNJ11 (KIR6.2, SLC2A2 (GLUT2, HNF4A (HNF4alpha, and INS (insulin-significantly altered disease risk, and in three genes, the risk allele, haplotype, or both had a biologically consistent effect on a relevant physiological trait in the QT study. We examined 35 genes predicted to have their major influence on insulin action, and three (9%-INSR, PIK3R1, and SOS1-showed significant associations with diabetes. These results confirm the genetic complexity of Type 2 diabetes and provide evidence that common variants in genes influencing pancreatic beta-cell function may make a significant contribution to the inherited component of this disease. This study additionally demonstrates that the systematic examination of panels of biological candidate genes in large, well-characterised populations can be an effective complement to positional cloning approaches. The absence of large single-gene effects and the detection of multiple small effects accentuate the need for the study of larger populations in order to reliably identify the size of effect we now expect for complex diseases.
Association of Ugrp2 gene polymorphisms with adenoid hypertrophy in the pediatric population.
Atilla, Mahmut Huntürk; Özdaş, Sibel; Özdaş, Talih; Baştimur, Sibel; Muz, Sami Engin; Öz, Işılay; Kurt, Kenan; İzbirak, Afife; Babademez, Mehmet Ali; Vatandaş, Nilgün
2017-08-01
Adenoid hypertrophy is a condition that presents itself as the chronic enlargement of adenoid tissues; it is frequently observed in the pediatric population. The Ugrp2 gene, a member of the secretoglobin superfamily, encodes a low-molecular weight protein that functions in the differentiation of upper airway epithelial cells. However, little is known about the association of Ugrp2 genetic variations with adenoid hypertrophy. The aim of this study is to investigate the association of single nucleotide polymorphisms in the Ugrp2 gene with adenoid hypertrophy and its related phenotypes. A total of 219 children, comprising 114 patients suffering from adenoid hypertrophy and 105 healthy patients without adenoid hypertrophy, were enrolled in this study. Genotypes of the Ugrp2 gene were determined by DNA sequencing. We identified four single nucleotide polymorphisms (IVS1-189G>A, IVS1-89T>G, c.201delC, and IVS2-15G>A) in the Ugrp2 gene. Our genotype analysis showed that the Ugrp2 (IVS1-89T>G) TG and (c.201delC) CdelC genotypes and their minor alleles were associated with a considerable increase in the risk of adenoid hypertrophy compared with the controls (p=0.012, p=0.009, p=0.013, and p=0.037, respectively). Furthermore, Ugrp2 (GTdelCG, GTdelCA) haplotypes were significantly associated with adenoid hypertrophy (four single nucleotide polymorphisms ordered from 5' to 3'; p=0.0001). Polymorfism-Polymorfism interaction analysis indicated a strong interaction between combined genotypes of the Ugrp2 gene contributing to adenoid hypertrophy, as well as an increased chance of its diagnosis (p<0.0001). In addition, diplotypes carrying the mutant Ugrp2 (c.201delC) allele were strongly associated with an increased risk of adenoid hypertrophy with asthma and adenoid hypertrophy with allergies (p=0.003 and p=0.0007, respectively). Some single nucleotide polymorphisms and their combinations in the Ugrp2 gene are associated with an increased risk of developing adenoid hypertrophy
Directory of Open Access Journals (Sweden)
Wang Heng
2008-06-01
Full Text Available Abstract Background In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and production efficiency, we determined how porcine PNAS-4 gene regulates meat production. Therefore, this gene has been sequenced, expression analyzed and associated with meat production traits. Results We cloned the full-length cDNA of porcine PNAS-4 gene encoding a protein of 194 amino acids which was expressed in the Golgi complex. This gene was mapped to chromosome 10, q11–16, in a region of conserved synteny with human chromosome 1 where the human homologous gene was localized. Real-time PCR revealed that PNAS-4 mRNA was widely expressed with highest expression levels in skeletal muscle followed by lymph, liver and other tissues, and showed a down-regulated expression pattern during prenatal development while a up-regulated expression pattern after weaning. Association analysis revealed that allele C of SNP A1813C was prevalent in Chinese indigenous breeds whereas A was dominant allele in Landrace and Large White, and the pigs with homozygous CC had a higher fat content than those of the pigs with other genotypes (P Conclusion Porcine PNAS-4 protein tagged with green fluorescent protein accumulated in the Golgi complex, and its mRNA showed a widespread expression across many tissues and organs in pigs. It may be an important factor affecting the meat production efficiency, because its down-regulated expression pattern during early embryogenesis suggests involvement in increase of muscle fiber number. In addition, the SNP A1813C associated with fat traits might be a genetic marker for molecular-assisted selection in animal breeding.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Brain region-specific altered expression and association of mitochondria-related genes in autism.
Anitha, Ayyappan; Nakamura, Kazuhiko; Thanseem, Ismail; Yamada, Kazuo; Iwayama, Yoshimi; Toyota, Tomoko; Matsuzaki, Hideo; Miyachi, Taishi; Yamada, Satoru; Tsujii, Masatsugu; Tsuchiya, Kenji J; Matsumoto, Kaori; Iwata, Yasuhide; Suzuki, Katsuaki; Ichikawa, Hironobu; Sugiyama, Toshiro; Yoshikawa, Takeo; Mori, Norio
2012-11-01
Mitochondrial dysfunction (MtD) has been observed in approximately five percent of children with autism spectrum disorders (ASD). MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA). Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG), motor cortex (MC) and thalamus (THL)) from autism patients (n=8) and controls (n=10) were obtained from the Autism Tissue Program (Princeton, NJ, USA). Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct) method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2), neurofilament, light polypeptide (NEFL) and solute carrier family 25, member 27 (SLC25A27) showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066) and SLC25A27 (P = 0.046; Z-score 1.990) showed genetic association with autism in Caucasian and Japanese samples, respectively. The expression of DNAJC19, DNM1L, LRPPRC
Brain region-specific altered expression and association of mitochondria-related genes in autism
Directory of Open Access Journals (Sweden)
Anitha Ayyappan
2012-11-01
Full Text Available Abstract Background Mitochondrial dysfunction (MtD has been observed in approximately five percent of children with autism spectrum disorders (ASD. MtD could impair highly energy-dependent processes such as neurodevelopment, thereby contributing to autism. Most of the previous studies of MtD in autism have been restricted to the biomarkers of energy metabolism, while most of the genetic studies have been based on mutations in the mitochondrial DNA (mtDNA. Despite the mtDNA, most of the proteins essential for mitochondrial replication and function are encoded by the genomic DNA; so far, there have been very few studies of those genes. Therefore, we carried out a detailed study involving gene expression and genetic association studies of genes related to diverse mitochondrial functions. Methods For gene expression analysis, postmortem brain tissues (anterior cingulate gyrus (ACG, motor cortex (MC and thalamus (THL from autism patients (n=8 and controls (n=10 were obtained from the Autism Tissue Program (Princeton, NJ, USA. Quantitative real-time PCR arrays were used to quantify the expression of 84 genes related to diverse functions of mitochondria, including biogenesis, transport, translocation and apoptosis. We used the delta delta Ct (∆∆Ct method for quantification of gene expression. DNA samples from 841 Caucasian and 188 Japanese families were used in the association study of genes selected from the gene expression analysis. FBAT was used to examine genetic association with autism. Results Several genes showed brain region-specific expression alterations in autism patients compared to controls. Metaxin 2 (MTX2, neurofilament, light polypeptide (NEFL and solute carrier family 25, member 27 (SLC25A27 showed consistently reduced expression in the ACG, MC and THL of autism patients. NEFL (P = 0.038; Z-score 2.066 and SLC25A27 (P = 0.046; Z-score 1.990 showed genetic association with autism in Caucasian and Japanese samples, respectively. The
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
A powerful score-based test statistic for detecting gene-gene co-association.
Xu, Jing; Yuan, Zhongshang; Ji, Jiadong; Zhang, Xiaoshuai; Li, Hongkai; Wu, Xuesen; Xue, Fuzhong; Liu, Yanxun
2016-01-29
The genetic variants identified by Genome-wide association study (GWAS) can only account for a small proportion of the total heritability for complex disease. The existence of gene-gene joint effects which contains the main effects and their co-association is one of the possible explanations for the "missing heritability" problems. Gene-gene co-association refers to the extent to which the joint effects of two genes differ from the main effects, not only due to the traditional interaction under nearly independent condition but the correlation between genes. Generally, genes tend to work collaboratively within specific pathway or network contributing to the disease and the specific disease-associated locus will often be highly correlated (e.g. single nucleotide polymorphisms (SNPs) in linkage disequilibrium). Therefore, we proposed a novel score-based statistic (SBS) as a gene-based method for detecting gene-gene co-association. Various simulations illustrate that, under different sample sizes, marginal effects of causal SNPs and co-association levels, the proposed SBS has the better performance than other existed methods including single SNP-based and principle component analysis (PCA)-based logistic regression model, the statistics based on canonical correlations (CCU), kernel canonical correlation analysis (KCCU), partial least squares path modeling (PLSPM) and delta-square (δ (2)) statistic. The real data analysis of rheumatoid arthritis (RA) further confirmed its advantages in practice. SBS is a powerful and efficient gene-based method for detecting gene-gene co-association.
Qiao, Liang; Cao, Minghao; Zheng, Jian; Zhao, Yihong; Zheng, Zhi-Liang
2017-10-30
The ratio of sugars to organic acids, two of the major metabolites in fleshy fruits, has been considered the most important contributor to fruit sweetness. Although accumulation of sugars and acids have been extensively studied, whether plants evolve a mechanism to maintain, sense or respond to the fruit sugar/acid ratio remains a mystery. In a prior study, we used an integrated systems biology tool to identify a group of 39 acid-associated genes from the fruit transcriptomes in four sweet orange varieties (Citrus sinensis L. Osbeck) with varying fruit acidity, Succari (acidless), Bingtang (low acid), and Newhall and Xinhui (normal acid). We reanalyzed the prior sweet orange fruit transcriptome data, leading to the identification of 72 genes highly correlated with the fruit sugar/acid ratio. The majority of these sugar/acid ratio-related genes are predicted to be involved in regulatory functions such as transport, signaling and transcription or encode enzymes involved in metabolism. Surprisingly, only three of these sugar/acid ratio-correlated genes are weakly correlated with sugar level and none of them overlaps with the acid-associated genes. Weighted Gene Coexpression Network Analysis (WGCNA) has revealed that these genes belong to four modules, Blue, Grey, Brown and Turquoise, with the former two modules being unique to the sugar/acid ratio control. Our results indicate that orange fruits contain a possible mechanistically distinct class of genes that may potentially be involved in maintaining fruit sugar/acid ratios and/or responding to the cellular sugar/acid ratio status. Therefore, our analysis of orange transcriptomes provides an intriguing insight into the potentially novel genetic or molecular mechanisms controlling the sugar/acid ratio in fruits.
Huang, Hao; Mackel, Brian J; Grove, Anne
2013-11-01
Many transcriptional regulators control gene activity by responding to specific ligands. Members of the multiple-antibiotic resistance regulator (MarR) family of transcriptional regulators feature prominently in this regard, and they frequently function as repressors in the absence of their cognate ligands. Plant pathogens such as Dickeya dadantii encode a MarR homolog named PecS that controls expression of a gene encoding the efflux pump PecM in addition to other virulence genes. We report here that the soil bacterium Streptomyces coelicolor also encodes a PecS homolog (SCO2647) that regulates a pecM gene (SCO2646). S. coelicolor PecS, which exists as a homodimer, binds the intergenic region between pecS and pecM genes with high affinity. Several potential PecS binding sites were found in this intergenic region. The binding of PecS to its target DNA can be efficiently attenuated by the ligand urate, which also quenches the intrinsic fluorescence of PecS, indicating a direct interaction between urate and PecS. In vivo measurement of gene expression showed that activity of pecS and pecM genes is significantly elevated after exposure of S. coelicolor cultures to urate. These results indicate that S. coelicolor PecS responds to the ligand urate by attenuated DNA binding in vitro and upregulation of gene activity in vivo. Since production of urate is associated with generation of reactive oxygen species by xanthine dehydrogenase, we propose that PecS functions under conditions of oxidative stress.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
Rubisco activity and gene expression of tropical tree species under ...
African Journals Online (AJOL)
Young
2013-05-15
May 15, 2013 ... Proteomics analysis associated with gene expression of plants reveal .... Consequently, Rubisco enzyme plays a role in assi- milating into ... technique for examining gene expression encoded at the. mRNA level .... Ammonia.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Genome-wide associations of gene expression variation in humans.
Directory of Open Access Journals (Sweden)
Barbara E Stranger
2005-12-01
Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.
Genome-Wide Associations of Gene Expression Variation in Humans.
Directory of Open Access Journals (Sweden)
2005-12-01
Full Text Available The exploration of quantitative variation in human populations has become one of the major priorities for medical genetics. The successful identification of variants that contribute to complex traits is highly dependent on reliable assays and genetic maps. We have performed a genome-wide quantitative trait analysis of 630 genes in 60 unrelated Utah residents with ancestry from Northern and Western Europe using the publicly available phase I data of the International HapMap project. The genes are located in regions of the human genome with elevated functional annotation and disease interest including the ENCODE regions spanning 1% of the genome, Chromosome 21 and Chromosome 20q12-13.2. We apply three different methods of multiple test correction, including Bonferroni, false discovery rate, and permutations. For the 374 expressed genes, we find many regions with statistically significant association of single nucleotide polymorphisms (SNPs with expression variation in lymphoblastoid cell lines after correcting for multiple tests. Based on our analyses, the signal proximal (cis- to the genes of interest is more abundant and more stable than distal and trans across statistical methodologies. Our results suggest that regulatory polymorphism is widespread in the human genome and show that the 5-kb (phase I HapMap has sufficient density to enable linkage disequilibrium mapping in humans. Such studies will significantly enhance our ability to annotate the non-coding part of the genome and interpret functional variation. In addition, we demonstrate that the HapMap cell lines themselves may serve as a useful resource for quantitative measurements at the cellular level.
Directory of Open Access Journals (Sweden)
Hongyu Chen
2018-02-01
Full Text Available In higher plants, embryo development originated from fertilized egg cell is the first step of the life cycle. The chloroplast participates in many essential metabolic pathways, and its function is highly associated with embryo development. However, the mechanisms and relevant genetic components by which the chloroplast functions in embryogenesis are largely uncharacterized. In this paper, we describe the Arabidopsis EMB1990 gene, encoding a plastid-targeted YlmG protein which is required for chloroplast biogenesis and embryo development. Loss of the EMB1990/YLMG1-1 resulted in albino seeds containing abortive embryos, and the morphological development of homozygous emb1990 embryos was disrupted after the globular stage. Our results showed that EMB1990/YLMG1-1 was expressed in the primordia and adaxial region of cotyledon during embryogenesis, and the encoded protein was targeted to the chloroplast. TEM observation of cellular ultrastructure showed that chloroplast biogenesis was impaired in emb1990 embryo cells. Expression of certain plastid genes was also affected in the loss-of-function mutants, including genes encoding core protein complex subunits located in the thylakoid membrane. Moreover, the tissue-specific genes of embryo development were misexpressed in emb1990 mutant, including genes known to delineate cell fate decisions in the SAM (shoot apical meristem, cotyledon and hypophysis. Taken together, we propose that the nuclear-encoded YLMG1-1 is targeted to the chloroplast and required for normal plastid gene expression. Hence, YLMG1-1 plays a critical role in Arabidopsis embryogenesis through participating in chloroplast biogenesis.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Genes2FANs: connecting genes through functional association networks
2012-01-01
Background Protein-protein, cell signaling, metabolic, and transcriptional interaction networks are useful for identifying connections between lists of experimentally identified genes/proteins. However, besides physical or co-expression interactions there are many ways in which pairs of genes, or their protein products, can be associated. By systematically incorporating knowledge on shared properties of genes from diverse sources to build functional association networks (FANs), researchers may be able to identify additional functional interactions between groups of genes that are not readily apparent. Results Genes2FANs is a web based tool and a database that utilizes 14 carefully constructed FANs and a large-scale protein-protein interaction (PPI) network to build subnetworks that connect lists of human and mouse genes. The FANs are created from mammalian gene set libraries where mouse genes are converted to their human orthologs. The tool takes as input a list of human or mouse Entrez gene symbols to produce a subnetwork and a ranked list of intermediate genes that are used to connect the query input list. In addition, users can enter any PubMed search term and then the system automatically converts the returned results to gene lists using GeneRIF. This gene list is then used as input to generate a subnetwork from the user’s PubMed query. As a case study, we applied Genes2FANs to connect disease genes from 90 well-studied disorders. We find an inverse correlation between the counts of links connecting disease genes through PPI and links connecting diseases genes through FANs, separating diseases into two categories. Conclusions Genes2FANs is a useful tool for interpreting the relationships between gene/protein lists in the context of their various functions and networks. Combining functional association interactions with physical PPIs can be useful for revealing new biology and help form hypotheses for further experimentation. Our finding that disease genes in
Leppanen, Jukka M.; Peltola, Mikko J.; Puura, Kaija; Mantymaa, Mirjami; Mononen, Nina; Lehtimaki, Terho
2011-01-01
Background: Allelic variation in the promoter region of a gene that encodes tryptophan hydroxylase isoform 2 (TPH2), a rate-limiting enzyme of serotonin synthesis in the central nervous system, has been associated with variations in cognitive function and vulnerability to affective spectrum disorders. Little is known about the effects of this gene…
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
International Nuclear Information System (INIS)
Grzybowska, Ewa A.
2012-01-01
Highlights: ► Functional characteristics of intronless genes (IGs). ► Diseases associated with IGs. ► Origin and evolution of IGs. ► mRNA processing without splicing. -- Abstract: Intronless genes (IGs) constitute approximately 3% of the human genome. Human IGs are essentially different in evolution and functionality from the IGs of unicellular eukaryotes, which represent the majority in their genomes. Functional analysis of IGs has revealed a massive over-representation of signal transduction genes and genes encoding regulatory proteins important for growth, proliferation, and development. IGs also often display tissue-specific expression, usually in the nervous system and testis. These characteristics translate into IG-associated diseases, mainly neuropathies, developmental disorders, and cancer. IGs represent recent additions to the genome, created mostly by retroposition of processed mRNAs with retained functionality. Processing, nuclear export, and translation of these mRNAs should be hampered dramatically by the lack of splice factors, which normally tightly cover mature transcripts and govern their fate. However, natural IGs manage to maintain satisfactory expression levels. Different mechanisms by which IGs solve the problem of mRNA processing and nuclear export are discussed here, along with their possible impact on reporter studies.
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E; Thwai, Kyaw L; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O
2015-06-15
The A581 G: mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased placental inflammation and decreased infant birth weight among women receiving intermittent preventive treatment with sulfadoxine-pyrimethamine (IPTp-SP) during pregnancy. Between 2009 and 2011, delivering women without human immunodeficiency virus infection were enrolled in an observational study of IPTp-SP effectiveness in Malawi. Parasites were detected by polymerase chain reaction (PCR); positive samples were sequenced to genotype the dhfr and dhps loci. The presence of K540 E: in dhps was used as a marker for the quintuple mutant. Samples from 1809 women were analyzed by PCR; 220 (12%) were positive for P. falciparum. A total of 202 specimens were genotyped at codon 581 of dhps; 17 (8.4%) harbored the sextuple mutant. The sextuple mutant was associated with higher risks of patent infection in peripheral blood (adjusted prevalence ratio [aPR], 2.76; 95% confidence interval [CI], 1.82-4.18) and placental blood (aPR 3.28; 95% CI, 1.88-5.78) and higher parasite densities. Recent SP use was not associated with increased parasite densities or placental pathology overall and among women with parasites carrying dhps A581 G: . IPTp-SP failed to inhibit parasite growth but did not exacerbate pathology among women infected with sextuple-mutant parasites. New interventions to prevent malaria during pregnancy are needed urgently. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2015. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Chasman, Daniel I; Fuchsberger, Christian; Pattaro, Cristian; Teumer, Alexander; Böger, Carsten A; Endlich, Karlhans; Olden, Matthias; Chen, Ming-Huei; Tin, Adrienne; Taliun, Daniel; Li, Man; Gao, Xiaoyi; Gorski, Mathias; Yang, Qiong; Hundertmark, Claudia; Foster, Meredith C; O'Seaghdha, Conall M; Glazer, Nicole; Isaacs, Aaron; Liu, Ching-Ti; Smith, Albert V; O'Connell, Jeffrey R; Struchalin, Maksim; Tanaka, Toshiko; Li, Guo; Johnson, Andrew D; Gierman, Hinco J; Feitosa, Mary F; Hwang, Shih-Jen; Atkinson, Elizabeth J; Lohman, Kurt; Cornelis, Marilyn C; Johansson, Asa; Tönjes, Anke; Dehghan, Abbas; Lambert, Jean-Charles; Holliday, Elizabeth G; Sorice, Rossella; Kutalik, Zoltan; Lehtimäki, Terho; Esko, Tõnu; Deshmukh, Harshal; Ulivi, Sheila; Chu, Audrey Y; Murgia, Federico; Trompet, Stella; Imboden, Medea; Coassin, Stefan; Pistis, Giorgio; Harris, Tamara B; Launer, Lenore J; Aspelund, Thor; Eiriksdottir, Gudny; Mitchell, Braxton D; Boerwinkle, Eric; Schmidt, Helena; Cavalieri, Margherita; Rao, Madhumathi; Hu, Frank; Demirkan, Ayse; Oostra, Ben A; de Andrade, Mariza; Turner, Stephen T; Ding, Jingzhong; Andrews, Jeanette S; Freedman, Barry I; Giulianini, Franco; Koenig, Wolfgang; Illig, Thomas; Meisinger, Christa; Gieger, Christian; Zgaga, Lina; Zemunik, Tatijana; Boban, Mladen; Minelli, Cosetta; Wheeler, Heather E; Igl, Wilmar; Zaboli, Ghazal; Wild, Sarah H; Wright, Alan F; Campbell, Harry; Ellinghaus, David; Nöthlings, Ute; Jacobs, Gunnar; Biffar, Reiner; Ernst, Florian; Homuth, Georg; Kroemer, Heyo K; Nauck, Matthias; Stracke, Sylvia; Völker, Uwe; Völzke, Henry; Kovacs, Peter; Stumvoll, Michael; Mägi, Reedik; Hofman, Albert; Uitterlinden, Andre G; Rivadeneira, Fernando; Aulchenko, Yurii S; Polasek, Ozren; Hastie, Nick; Vitart, Veronique; Helmer, Catherine; Wang, Jie Jin; Stengel, Bénédicte; Ruggiero, Daniela; Bergmann, Sven; Kähönen, Mika; Viikari, Jorma; Nikopensius, Tiit; Province, Michael; Ketkar, Shamika; Colhoun, Helen; Doney, Alex; Robino, Antonietta; Krämer, Bernhard K; Portas, Laura; Ford, Ian; Buckley, Brendan M; Adam, Martin; Thun, Gian-Andri; Paulweber, Bernhard; Haun, Margot; Sala, Cinzia; Mitchell, Paul; Ciullo, Marina; Kim, Stuart K; Vollenweider, Peter; Raitakari, Olli; Metspalu, Andres; Palmer, Colin; Gasparini, Paolo; Pirastu, Mario; Jukema, J Wouter; Probst-Hensch, Nicole M; Kronenberg, Florian; Toniolo, Daniela; Gudnason, Vilmundur; Shuldiner, Alan R; Coresh, Josef; Schmidt, Reinhold; Ferrucci, Luigi; Siscovick, David S; van Duijn, Cornelia M; Borecki, Ingrid B; Kardia, Sharon L R; Liu, Yongmei; Curhan, Gary C; Rudan, Igor; Gyllensten, Ulf; Wilson, James F; Franke, Andre; Pramstaller, Peter P; Rettig, Rainer; Prokopenko, Inga; Witteman, Jacqueline; Hayward, Caroline; Ridker, Paul M; Parsa, Afshin; Bochud, Murielle; Heid, Iris M; Kao, W H Linda; Fox, Caroline S; Köttgen, Anna
2012-12-15
In conducting genome-wide association studies (GWAS), analytical approaches leveraging biological information may further understanding of the pathophysiology of clinical traits. To discover novel associations with estimated glomerular filtration rate (eGFR), a measure of kidney function, we developed a strategy for integrating prior biological knowledge into the existing GWAS data for eGFR from the CKDGen Consortium. Our strategy focuses on single nucleotide polymorphism (SNPs) in genes that are connected by functional evidence, determined by literature mining and gene ontology (GO) hierarchies, to genes near previously validated eGFR associations. It then requires association thresholds consistent with multiple testing, and finally evaluates novel candidates by independent replication. Among the samples of European ancestry, we identified a genome-wide significant SNP in FBXL20 (P = 5.6 × 10(-9)) in meta-analysis of all available data, and additional SNPs at the INHBC, LRP2, PLEKHA1, SLC3A2 and SLC7A6 genes meeting multiple-testing corrected significance for replication and overall P-values of 4.5 × 10(-4)-2.2 × 10(-7). Neither the novel PLEKHA1 nor FBXL20 associations, both further supported by association with eGFR among African Americans and with transcript abundance, would have been implicated by eGFR candidate gene approaches. LRP2, encoding the megalin receptor, was identified through connection with the previously known eGFR gene DAB2 and extends understanding of the megalin system in kidney function. These findings highlight integration of existing genome-wide association data with independent biological knowledge to uncover novel candidate eGFR associations, including candidates lacking known connections to kidney-specific pathways. The strategy may also be applicable to other clinical phenotypes, although more testing will be needed to assess its potential for discovery in general.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Flex, Elisabetta; Niceta, Marcello; Cecchetti, Serena; Thiffault, Isabelle; Au, Margaret G.; Capuano, Alessandro; Piermarini, Emanuela; Ivanova, Anna A.; Francis, Joshua W.; Chillemi, Giovanni; Chandramouli, Balasubramanian; Carpentieri, Giovanna; Haaxma, Charlotte A.; Ciolfi, Andrea; Pizzi, Simone; Douglas, Ganka V.; Levine, Kara; Sferra, Antonella; Dentici, Maria Lisa; Pfundt, Rolph R.; Le Pichon, Jean-Baptiste; Farrow, Emily; Baas, Frank; Piemonte, Fiorella; Dallapiccola, Bruno; Graham, John M.; Saunders, Carol J.; Bertini, Enrico; Kahn, Richard A.; Koolen, David A.; Tartaglia, Marco
2016-01-01
Microtubules are dynamic cytoskeletal elements coordinating and supporting a variety of neuronal processes, including cell division, migration, polarity, intracellular trafficking, and signal transduction. Mutations in genes encoding tubulins and microtubule-associated proteins are known to cause
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
Yang, Yunxia; Xu, Shixia; Xu, Junxiao; Guo, Yan; Yang, Guang
2014-01-01
Insects are unique among invertebrates for their ability to fly, which raises intriguing questions about how energy metabolism in insects evolved and changed along with flight. Although physiological studies indicated that energy consumption differs between flying and non-flying insects, the evolution of molecular energy metabolism mechanisms in insects remains largely unexplored. Considering that about 95% of adenosine triphosphate (ATP) is supplied by mitochondria via oxidative phosphorylation, we examined 13 mitochondrial protein-encoding genes to test whether adaptive evolution of energy metabolism-related genes occurred in insects. The analyses demonstrated that mitochondrial DNA protein-encoding genes are subject to positive selection from the last common ancestor of Pterygota, which evolved primitive flight ability. Positive selection was also found in insects with flight ability, whereas no significant sign of selection was found in flightless insects where the wings had degenerated. In addition, significant positive selection was also identified in the last common ancestor of Neoptera, which changed its flight mode from direct to indirect. Interestingly, detection of more positively selected genes in indirect flight rather than direct flight insects suggested a stronger selective pressure in insects having higher energy consumption. In conclusion, mitochondrial protein-encoding genes involved in energy metabolism were targets of adaptive evolution in response to increased energy demands that arose during the evolution of flight ability in insects.
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Wohlfart, Sigrun; Söder, Stephan; Smahi, Asma; Schneider, Holm
2016-01-01
Hypohidrotic ectodermal dysplasia (HED) is a rare disorder characterized by deficient development of structures derived from the ectoderm including hair, nails, eccrine glands, and teeth. HED forms that are caused by mutations in the genes EDA, EDAR, or EDARADD may show almost identical phenotypes, explained by a common signaling pathway. Proper interaction of the proteins encoded by these three genes is important for the activation of the NF-κB signaling pathway and subsequent transcription of the target genes. Mutations in the gene EDARADD are most rarely implicated in HED. Here we describe a novel missense mutation, c.367G>A (p.Asp123Asn), in this gene which did not appear to influence the interaction between EDAR and EDARADD proteins, but led to an impaired ability to activate NF-κB signaling. Female members of the affected family showed either unilateral or bilateral amazia. In addition, an affected girl developed bilateral ovarian teratomas, possibly associated with her genetic condition. © 2015 Wiley Periodicals, Inc.
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Calpain-5 gene variants are associated with diastolic blood pressure and cholesterol levels
Directory of Open Access Journals (Sweden)
Morón Francisco J
2007-01-01
Full Text Available Abstract Background Genes implicated in common complex disorders such as obesity, type 2 diabetes mellitus (T2DM or cardiovascular diseases are not disease specific, since clinically related disorders also share genetic components. Cysteine protease Calpain 10 (CAPN10 has been associated with T2DM, hypertension, hypercholesterolemia, increased body mass index (BMI and polycystic ovary syndrome (PCOS, a reproductive disorder of women in which isunlin resistance seems to play a pathogenic role. The calpain 5 gene (CAPN5 encodes a protein homologue of CAPN10. CAPN5 has been previously associated with PCOS by our group. In this new study, we have analysed the association of four CAPN5 gene variants(rs948976A>G, rs4945140G>A, rs2233546C>T and rs2233549G>A with several cardiovascular risk factors related to metabolic syndrome in general population. Methods Anthropometric measurements, blood pressure, insulin, glucose and lipid profiles were determined in 606 individuals randomly chosen from a cross-sectional population-based epidemiological survey in the province of Segovia in Central Spain (Castille, recruited to investigate the prevalence of anthropometric and physiological parameters related to obesity and other components of the metabolic syndrome. Genotypes at the four polymorphic loci in CAPN5 gene were detected by polymerase chain reaction (PCR. Results Genotype association analysis was significant for BMI (p ≤ 0.041, diastolic blood pressure (p = 0.015 and HDL-cholesterol levels (p = 0.025. Different CAPN5 haplotypes were also associated with diastolic blood pressure (DBP (0.0005 ≤ p ≤ 0.006 and total cholesterol levels (0.001 ≤ p ≤ 0.029. In addition, the AACA haplotype, over-represented in obese individuals, is also more frequent in individuals with metabolic syndrome defined by ATPIII criteria (p = 0.029. Conclusion As its homologue CAPN10, CAPN5 seems to influence traits related to increased risk for cardiovascular diseases. Our
Directory of Open Access Journals (Sweden)
Douglas R Smith
Full Text Available Rare genetic variants in the core endocannabinoid system genes CNR1, CNR2, DAGLA, MGLL and FAAH were identified in molecular testing data from 6,032 patients with a broad spectrum of neurological disorders. The variants were evaluated for association with phenotypes similar to those observed in the orthologous gene knockouts in mice. Heterozygous rare coding variants in CNR1, which encodes the type 1 cannabinoid receptor (CB1, were found to be significantly associated with pain sensitivity (especially migraine, sleep and memory disorders-alone or in combination with anxiety-compared to a set of controls without such CNR1 variants. Similarly, heterozygous rare variants in DAGLA, which encodes diacylglycerol lipase alpha, were found to be significantly associated with seizures and neurodevelopmental disorders, including autism and abnormalities of brain morphology, compared to controls. Rare variants in MGLL, FAAH and CNR2 were not associated with any neurological phenotypes in the patients tested. Diacylglycerol lipase alpha synthesizes the endocannabinoid 2-AG in the brain, which interacts with CB1 receptors. The phenotypes associated with rare CNR1 variants are reminiscent of those implicated in the theory of clinical endocannabinoid deficiency syndrome. The severe phenotypes associated with rare DAGLA variants underscore the critical role of rapid 2-AG synthesis and the endocannabinoid system in regulating neurological function and development. Mapping of the variants to the 3D structure of the type 1 cannabinoid receptor, or primary structure of diacylglycerol lipase alpha, reveals clustering of variants in certain structural regions and is consistent with impacts to function.
International Nuclear Information System (INIS)
Mangin, M.; Webb, A.C.; Dreyer, B.E.
1988-01-01
Humoral hypercalcemia of malignancy is a common paraneoplastic syndrome that appears to be mediated in many instances by a parathyroid hormone-like peptide. Poly(A) + RNA from a human renal carcinoma associated with this syndrome was enriched by preparative electrophoresis and used to construct an enriched cDNA library in phage λgt10. The library was screened with a codon-preference oligonucleotide synthesized on the basis of a partial N-terminal amino acid sequence from a human tumor-derived peptide, and a 2.0 kilo-base cDNA was identified. The cDNA encodes a 177 amino acid protein consisting of a 36 amino acid leader sequence and a 141 amino acid mature peptide. The first 13 amino acids of the deduced sequence of the mature peptide display strong homology to human PTH, with complete divergence thereafter. RNA blot-hybridization analysis revealed multiple transcripts in mRNA from tumors associated with the humor syndrome and also in mRNA from normal human keratinocytes. Southern blot analysis of genomic DNA from humans and rodents revealed a simple pattern compatible with a single-copy gene. The gene has been mapped to chromosome 12
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial