Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Topology of transmembrane channel-like gene 1 protein.
Labay, Valentina; Weichert, Rachel M; Makishima, Tomoko; Griffith, Andrew J
2010-10-05
Mutations of transmembrane channel-like gene 1 (TMC1) cause hearing loss in humans and mice. TMC1 is the founding member of a family of genes encoding proteins of unknown function that are predicted to contain multiple transmembrane domains. The goal of our study was to define the topology of mouse TMC1 expressed heterologously in tissue culture cells. TMC1 was retained in the endoplasmic reticulum (ER) membrane of five tissue culture cell lines that we tested. We used anti-TMC1 and anti-HA antibodies to probe the topologic orientation of three native epitopes and seven HA epitope tags along full-length TMC1 after selective or complete permeabilization of transfected cells with digitonin or Triton X-100, respectively. TMC1 was present within the ER as an integral membrane protein containing six transmembrane domains and cytosolic N- and C-termini. There is a large cytoplasmic loop, between the fourth and fifth transmembrane domains, with two highly conserved hydrophobic regions that might associate with or penetrate, but do not span, the plasma membrane. Our study is the first to demonstrate that TMC1 is a transmembrane protein. The topologic organization revealed by this study shares some features with that of the shaker-TRP superfamily of ion channels.
Transmembrane Signaling Proteoglycans
DEFF Research Database (Denmark)
Couchman, John R
2010-01-01
Virtually all metazoan cells contain at least one and usually several types of transmembrane proteoglycans. These are varied in protein structure and type of polysaccharide, but the total number of vertebrate genes encoding transmembrane proteoglycan core proteins is less than 10. Some core prote...... proteins, including those of the syndecans, always possess covalently coupled glycosaminoglycans; others do not. Syndecan has a long evolutionary history, as it is present in invertebrates, but many other transmembrane proteoglycans are vertebrate inventions. The variety of proteins...... proteins has been obtained in mouse knockout experiments. Here some of the latest developments in the field are examined in hopes of stimulating further interest in this fascinating group of molecules. Expected final online publication date for the Annual Review of Cell and Developmental Biology Volume 26...
DEFF Research Database (Denmark)
Rosenkilde, M M; Smit, M J; Waldhoer, M
2008-01-01
A number of human and animal herpes viruses encode G-protein coupled receptors with seven transmembrane (7TM) segments-most of which are clearly related to human chemokine receptors. It appears, that these receptors are used by the virus for immune evasion, cellular transformation, tissue targeting...... pathogenesis is still poorly understood. Here we focus on the current knowledge of structure, function and trafficking patterns of virally encoded chemokine receptors and further address the putative roles of these receptors in virus survival and host -cell and/or -immune system modulation. Finally, we...
Mutations in a novel gene with transmembrane domains underlie Usher syndrome type 3.
Joensuu, T; Hämäläinen, R; Yuan, B; Johnson, C; Tegelberg, S; Gasparini, P; Zelante, L; Pirvola, U; Pakarinen, L; Lehesjoki, A E; de la Chapelle, A; Sankila, E M
2001-10-01
Usher syndrome type 3 (USH3) is an autosomal recessive disorder characterized by progressive hearing loss, severe retinal degeneration, and variably present vestibular dysfunction, assigned to 3q21-q25. Here, we report on the positional cloning of the USH3 gene. By haplotype and linkage-disequilibrium analyses in Finnish carriers of a putative founder mutation, the critical region was narrowed to 250 kb, of which we sequenced, assembled, and annotated 207 kb. Two novel genes-NOPAR and UCRP-and one previously identified gene-H963-were excluded as USH3, on the basis of mutational analysis. USH3, the candidate gene that we identified, encodes a 120-amino-acid protein. Fifty-two Finnish patients were homozygous for a termination mutation, Y100X; patients in two Finnish families were compound heterozygous for Y100X and for a missense mutation, M44K, whereas patients in an Italian family were homozygous for a 3-bp deletion leading to an amino acid deletion and substitution. USH3 has two predicted transmembrane domains, and it shows no homology to known genes. As revealed by northern blotting and reverse-transcriptase PCR, it is expressed in many tissues, including the retina.
DEFF Research Database (Denmark)
Rosenkilde, M M; Kledal, T N; Bräuner-Osborne, Hans
1999-01-01
A number of CXC chemokines competed with similar, nanomolar affinity against 125I-interleukin-8 (IL-8) binding to ORF-74, a constitutively active seven-transmembrane receptor encoded by human herpesvirus 8. However, in competition against 125I-labeled growth-related oncogene (GRO)-alpha, the ORF-74...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
DEFF Research Database (Denmark)
Rosenkilde, M M; Kledal, T N; Holst, Peter Johannes
2000-01-01
Open reading frame 74 (ORF74) encoded by human herpesvirus 8 is a highly constitutively active seven transmembrane (7TM) receptor stimulated by angiogenic chemokines, e.g. growth-related oncogene-alpha, and inhibited by angiostatic chemokines e.g. interferon-gamma-inducible protein. Transgenic mice...
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
International Nuclear Information System (INIS)
Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.
1987-01-01
The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor
Are TMEM genes potential candidate genes for panic disorder?
DEFF Research Database (Denmark)
NO, Gregersen; Buttenschøn, Henriette Nørmølle; Hedemand, Anne
2014-01-01
We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12...
Poxvirus-encoded TNF decoy receptors inhibit the biological activity of transmembrane TNF.
Pontejo, Sergio M; Alejo, Ali; Alcami, Antonio
2015-10-01
Poxviruses encode up to four different soluble TNF receptors, named cytokine response modifier B (CrmB), CrmC, CrmD and CrmE. These proteins mimic the extracellular domain of the cellular TNF receptors to bind and inhibit the activity of TNF and, in some cases, other TNF superfamily ligands. Most of these ligands are released after the enzymic cleavage of a membrane precursor. However, transmembrane TNF (tmTNF) is not only a precursor of soluble TNF but also exerts specific pro-inflammatory and immunological activities. Here, we report that viral TNF receptors bound and inhibited tmTNF and describe some interesting differences in their activity against the soluble cytokine. Thus, CrmE, which does not inhibit mouse soluble TNF, could block murine tmTNF-induced cytotoxicity. We propose that this anti-tmTNF effect should be taken into consideration when assessing the role of viral TNF decoy receptors in the pathogenesis of poxvirus.
Evolution of vertebrate interferon inducible transmembrane proteins
Directory of Open Access Journals (Sweden)
Hickford Danielle
2012-04-01
Full Text Available Abstract Background Interferon inducible transmembrane proteins (IFITMs have diverse roles, including the control of cell proliferation, promotion of homotypic cell adhesion, protection against viral infection, promotion of bone matrix maturation and mineralisation, and mediating germ cell development. Most IFITMs have been well characterised in human and mouse but little published data exists for other animals. This study characterised IFITMs in two distantly related marsupial species, the Australian tammar wallaby and the South American grey short-tailed opossum, and analysed the phylogeny of the IFITM family in vertebrates. Results Five IFITM paralogues were identified in both the tammar and opossum. As in eutherians, most marsupial IFITM genes exist within a cluster, contain two exons and encode proteins with two transmembrane domains. Only two IFITM genes, IFITM5 and IFITM10, have orthologues in both marsupials and eutherians. IFITM5 arose in bony fish and IFITM10 in tetrapods. The bone-specific expression of IFITM5 appears to be restricted to therian mammals, suggesting that its specialised role in bone production is a recent adaptation specific to mammals. IFITM10 is the most highly conserved IFITM, sharing at least 85% amino acid identity between birds, reptiles and mammals and suggesting an important role for this presently uncharacterised protein. Conclusions Like eutherians, marsupials also have multiple IFITM genes that exist in a gene cluster. The differing expression patterns for many of the paralogues, together with poor sequence conservation between species, suggests that IFITM genes have acquired many different roles during vertebrate evolution.
[Research advances in CKLF-like MARVEL transmembrane domain containing member 5].
Yuan, Ye-qing; Xiao, Yun-bei; Liu, Zhen-hua; Zhang, Xiao-wei; Xu, Tao; Wang, Xiao-feng
2012-12-01
CKLF-like MARVEL transmembrane domain containing member(CMTM)is a novel generic family firstly reported by Peking University Center for Human Disease Genomics. CMTM5 belongs to this family and has exhibited tumor-inhibiting activities. It can encode proteins approaching to the transmembrane 4 superfamily(TM4SF). CMTM5 is broadly expressed in normal adult and fetal human tissues, but is undetectable or down-regulated in most carcinoma cell lines and tissues. Restoration of CMTM5 may inhibit the proliferation, migration, and invasion of carcinoma cells. Although the exact mechanism of its anti-tumor activity remains unclear, CMTM5 may be involved in various signaling pathways governing the occurrence and development of tumors. CMTM5 may be a new target in the gene therapies for tumors, while further studies on CMTM5 and its anti-tumor mechanisms are warranted.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Polarization encoded all-optical multi-valued shift operators
Roy, Jitendra Nath; Bhowmik, Panchatapa
2014-08-01
Polarization encoded multi-valued (both ternary and quaternary logic) shift operators have been designed using linear optical devices only. There are six ternary and 24 quaternary shift operators in multi-valued system. These are also known as reversible literals. This circuit will be useful in future all-optical multi-valued logic based information processing system. Different states of polarization of light are taken as different logic states.
Multi-level and Multi-component Bitmap Encoding for Efficient Search Operations
Directory of Open Access Journals (Sweden)
Madhu BHAN, Department of Computer Applications
2012-12-01
Full Text Available The growing interest in data warehousing for decision makers is becoming more and more crucial to make faster and efficient decisions. On-line decision needs short response times. Many indexing techniques have been created to achieve this goal in read only environments. Indexing technique that has attracted attention in multidimensional databases is Bitmap Indexing. The paper discusses the various existing bitmap indexing techniques along with their performance characteristics. The paper proposes two new bitmap indexing techniques in the class of multi-level and multi-component encoding schemes and prove that the two techniques have better space–time performance than some of the existing techniques used for range queries. We provide an analytical model for comparing the performance of our proposed encoding schemes with that of the existing ones.
Population structuring of multi-copy, antigen-encoding genes in Plasmodium falciparum
Artzy-Randrup, Yael; Rorick, Mary M; Day, Karen; Chen, Donald; Dobson, Andrew P; Pascual, Mercedes
2012-01-01
The coexistence of multiple independently circulating strains in pathogen populations that undergo sexual recombination is a central question of epidemiology with profound implications for control. An agent-based model is developed that extends earlier ‘strain theory’ by addressing the var gene family of Plasmodium falciparum. The model explicitly considers the extensive diversity of multi-copy genes that undergo antigenic variation via sequential, mutually exclusive expression. It tracks the dynamics of all unique var repertoires in a population of hosts, and shows that even under high levels of sexual recombination, strain competition mediated through cross-immunity structures the parasite population into a subset of coexisting dominant repertoires of var genes whose degree of antigenic overlap depends on transmission intensity. Empirical comparison of patterns of genetic variation at antigenic and neutral sites supports this role for immune selection in structuring parasite diversity. DOI: http://dx.doi.org/10.7554/eLife.00093.001 PMID:23251784
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Taghanaki, Saeid Asgari; Kawahara, Jeremy; Miles, Brandon; Hamarneh, Ghassan
2017-07-01
Feature reduction is an essential stage in computer aided breast cancer diagnosis systems. Multilayer neural networks can be trained to extract relevant features by encoding high-dimensional data into low-dimensional codes. Optimizing traditional auto-encoders works well only if the initial weights are close to a proper solution. They are also trained to only reduce the mean squared reconstruction error (MRE) between the encoder inputs and the decoder outputs, but do not address the classification error. The goal of the current work is to test the hypothesis that extending traditional auto-encoders (which only minimize reconstruction error) to multi-objective optimization for finding Pareto-optimal solutions provides more discriminative features that will improve classification performance when compared to single-objective and other multi-objective approaches (i.e. scalarized and sequential). In this paper, we introduce a novel multi-objective optimization of deep auto-encoder networks, in which the auto-encoder optimizes two objectives: MRE and mean classification error (MCE) for Pareto-optimal solutions, rather than just MRE. These two objectives are optimized simultaneously by a non-dominated sorting genetic algorithm. We tested our method on 949 X-ray mammograms categorized into 12 classes. The results show that the features identified by the proposed algorithm allow a classification accuracy of up to 98.45%, demonstrating favourable accuracy over the results of state-of-the-art methods reported in the literature. We conclude that adding the classification objective to the traditional auto-encoder objective and optimizing for finding Pareto-optimal solutions, using evolutionary multi-objective optimization, results in producing more discriminative features. Copyright © 2017 Elsevier B.V. All rights reserved.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Molecular evolution of the insect chemoreceptor gene superfamily in Drosophila melanogaster
Robertson, Hugh M.; Warr, Coral G.; Carlson, John R.
2003-01-01
The insect chemoreceptor superfamily in Drosophila melanogaster is predicted to consist of 62 odorant receptor (Or) and 68 gustatory receptor (Gr) proteins, encoded by families of 60 Or and 60 Gr genes through alternative splicing. We include two previously undescribed Or genes and two previously undescribed Gr genes; two previously predicted Or genes are shown to be alternative splice forms. Three polymorphic pseudogenes and one highly defective pseudogene are recognized. Phylogenetic analysis reveals deep branches connecting multiple highly divergent clades within the Gr family, and the Or family appears to be a single highly expanded lineage within the superfamily. The genes are spread throughout the Drosophila genome, with some relatively recently diverged genes still clustered in the genome. The Gr5a gene on the X chromosome, which encodes a receptor for the sugar trehalose, has transposed from one such tandem cluster of six genes at cytological location 64, as has Gr61a, and all eight of these receptors might bind sugars. Analysis of intron evolution suggests that the common ancestor consisted of a long N-terminal exon encoding transmembrane domains 1-5 followed by three exons encoding transmembrane domains 6-7. As many as 57 additional introns have been acquired idiosyncratically during the evolution of the superfamily, whereas the ancestral introns and some of the older idiosyncratic introns have been lost at least 48 times independently. Altogether, these patterns of molecular evolution suggest that this is an ancient superfamily of chemoreceptors, probably dating back at least to the origin of the arthropods. PMID:14608037
Energy Technology Data Exchange (ETDEWEB)
Zane, Grant M.; Yen, Huei-chi Bill; Wall, Judy D.
2010-03-18
The pathway of electrons required for the reduction of sulfate in sulfate-reducing bacteria (SRB) is not yet fully characterized. In order to determine the role of a transmembrane protein complex suggested to be involved in this process, a deletion of Desulfovibrio vulgaris Hildenborough was created by marker exchange mutagenesis that eliminated four genes putatively encoding the QmoABC complex and a hypothetical protein (DVU0851). The Qmo complex (quinone-interacting membrane-bound oxidoreductase) is proposed to be responsible for transporting electrons to the dissimilatory adenosine-5?phosphosulfate (APS) reductase in SRB. In support of the predicted role of this complex, the deletion mutant was unable to grow using sulfate as its sole electron acceptor with a range of electron donors. To explore a possible role for the hypothetical protein in sulfate reduction, a second mutant was constructed that had lost only the gene that codes for DVU0851. The second constructed mutant grew with sulfate as the sole electron acceptor; however, there was a lag that was not present with the wild-type or complemented strain. Neither deletion strain was significantly impaired for growth with sulfite or thiosulfate as terminal electron acceptor. Complementation of the D(qmoABC-DVU0851) mutant with all four genes or only the qmoABC genes restored its ability to grow by sulfate respiration. These results confirmed the prediction that the Qmo complex is in the electron pathway for sulfate-reduction and revealed that no other transmembrane complex could compensate when Qmo was lacking.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
DEFF Research Database (Denmark)
Holm, Dorte; Fink, Dorte Rosenbek; Grønlund, Jørn
2009-01-01
We have cloned and characterized a novel murine transmembrane molecule, mSCART1 belonging to the scavenger receptor cysteine-rich superfamily. The cDNA encodes a polypeptide chain of 989 amino acids, organized as a type I transmembrane protein that contains eight extracellular SRCR domains followed...
Directory of Open Access Journals (Sweden)
Nishida Mutsumi
2007-11-01
Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.
Deorphanizing the human transmembrane genome: A landscape of uncharacterized membrane proteins.
Babcock, Joseph J; Li, Min
2014-01-01
The sequencing of the human genome has fueled the last decade of work to functionally characterize genome content. An important subset of genes encodes membrane proteins, which are the targets of many drugs. They reside in lipid bilayers, restricting their endogenous activity to a relatively specialized biochemical environment. Without a reference phenotype, the application of systematic screens to profile candidate membrane proteins is not immediately possible. Bioinformatics has begun to show its effectiveness in focusing the functional characterization of orphan proteins of a particular functional class, such as channels or receptors. Here we discuss integration of experimental and bioinformatics approaches for characterizing the orphan membrane proteome. By analyzing the human genome, a landscape reference for the human transmembrane genome is provided.
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Directory of Open Access Journals (Sweden)
Hubert Pausch
2014-01-01
Full Text Available Genetic variants underlying reduced male reproductive performance have been identified in humans and model organisms, most of them compromising semen quality. Occasionally, male fertility is severely compromised although semen analysis remains without any apparent pathological findings (i.e., idiopathic subfertility. Artificial insemination (AI in most cattle populations requires close examination of all ejaculates before insemination. Although anomalous ejaculates are rejected, insemination success varies considerably among AI bulls. In an attempt to identify genetic causes of such variation, we undertook a genome-wide association study (GWAS. Imputed genotypes of 652,856 SNPs were available for 7962 AI bulls of the Fleckvieh (FV population. Male reproductive ability (MRA was assessed based on 15.3 million artificial inseminations. The GWAS uncovered a strong association signal on bovine chromosome 19 (P = 4.08 × 10(-59. Subsequent autozygosity mapping revealed a common 1386 kb segment of extended homozygosity in 40 bulls with exceptionally poor reproductive performance. Only 1.7% of 35,671 inseminations with semen samples of those bulls were successful. None of the bulls with normal reproductive performance was homozygous, indicating recessive inheritance. Exploiting whole-genome re-sequencing data of 43 animals revealed a candidate causal nonsense mutation (rs378652941, c.483C>A, p.Cys161X in the transmembrane protein 95 encoding gene TMEM95 which was subsequently validated in 1990 AI bulls. Immunohistochemical investigations evidenced that TMEM95 is located at the surface of spermatozoa of fertile animals whereas it is absent in spermatozoa of subfertile animals. These findings imply that integrity of TMEM95 is required for an undisturbed fertilisation. Our results demonstrate that deficiency of TMEM95 severely compromises male reproductive performance in cattle and reveal for the first time a phenotypic effect associated with genomic
Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.
1998-01-01
Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.
International Nuclear Information System (INIS)
Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.
1989-01-01
The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Functional characterization of transmembrane adenylyl cyclases from the honeybee brain.
Balfanz, Sabine; Ehling, Petra; Wachten, Sebastian; Jordan, Nadine; Erber, Joachim; Mujagic, Samir; Baumann, Arnd
2012-06-01
The second messenger cAMP has a pivotal role in animals' physiology and behavior. Intracellular concentrations of cAMP are balanced by cAMP-synthesizing adenylyl cyclases (ACs) and cAMP-cleaving phosphodiesterases. Knowledge about ACs in the honeybee (Apis mellifera) is rather limited and only an ortholog of the vertebrate AC3 isoform has been functionally characterized, so far. Employing bioinformatics and functional expression we characterized two additional honeybee genes encoding membrane-bound (tm)ACs. The proteins were designated AmAC2t and AmAC8. Unlike the common structure of tmACs, AmAC2t lacks the first transmembrane domain. Despite this unusual topography, AmAC2t-activity could be stimulated by norepinephrine and NKH477 with EC(50s) of 0.07 μM and 3 μM. Both ligands stimulated AmAC8 with EC(50s) of 0.24 μM and 3.1 μM. In brain cryosections, intensive staining of mushroom bodies was observed with specific antibodies against AmAC8, an expression pattern highly reminiscent of the Drosophila rutabaga AC. In a current release of the honeybee genome database we identified three additional tmAC- and one soluble AC-encoding gene. These results suggest that (1) the AC-gene family in honeybees is comparably large as in other species, and (2) based on the restricted expression of AmAC8 in mushroom bodies, this enzyme might serve important functions in honeybee behavior. Copyright © 2012 Elsevier Ltd. All rights reserved.
A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor
International Nuclear Information System (INIS)
Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.
1989-01-01
The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development
DEFF Research Database (Denmark)
Waldhoer, Maria; Casarosa, Paola; Rosenkilde, Mette M
2003-01-01
are separable entities in this viral chemokine receptor. We generated chimeric and mutant US28 proteins that were altered in either their constitutive endocytic (US28 Delta 300, US28 Delta 317, US28-NK1-ctail, and US28-ORF74-ctail) or signaling properties (US28R129A). By using this series of mutants, we show...... further show that the constitutive endocytic property of US28 affects the action of its chemokine ligand fractalkine/CX3CL1 and show that in the absence of the US28 C terminus, fractalkine/CX3CL1 acts as an agonist on US28. This demonstrates for the first time that the endocytic properties of a 7TM......US28 is one of four 7 transmembrane (7TM) chemokine receptors encoded by human cytomegalovirus and has been shown to both signal and endocytose in a ligand-independent, constitutively active manner. Here we show that the constitutive activity and constitutive endocytosis properties of US28...
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
Endele, S; Fuhry, M; Pak, S J; Zabel, B U; Winterpacht, A
1999-09-01
Deletions within human chromosome 4p16.3 cause Wolf-Hirschhorn syndrome (WHS), which is characterized by severe mental and developmental defects. It is thought that haploinsufficiency of more than one gene contributes to the complex phenotype. We have cloned and characterized a novel gene (LETM1) that is deleted in nearly all WHS patients. LETM1 encodes a putative member of the EF-hand family of Ca(2+)-binding proteins. The protein contains two EF-hands, a transmembrane domain, a leucine zipper, and several coiled-coil domains. On the basis of its possible Ca(2+)-binding property and involvement in Ca(2+) signaling and/or homeostasis, we propose that haploinsufficiency of LETM1 may contribute to the neuromuscular features of WHS patients. Copyright 1999 Academic Press.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.
Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C
2001-01-01
Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Tian, Guilian; Zhou, Yun; Hajkova, Dagmar; Miyagi, Masaru; Dinculescu, Astra; Hauswirth, William W; Palczewski, Krzysztof; Geng, Ruishuang; Alagramam, Kumar N; Isosomppi, Juha; Sankila, Eeva-Marja; Flannery, John G; Imanishi, Yoshikazu
2009-07-10
Clarin-1 is the protein product encoded by the gene mutated in Usher syndrome III. Although the molecular function of clarin-1 is unknown, its primary structure predicts four transmembrane domains similar to a large family of membrane proteins that include tetraspanins. Here we investigated the role of clarin-1 by using heterologous expression and in vivo model systems. When expressed in HEK293 cells, clarin-1 localized to the plasma membrane and concentrated in low density compartments distinct from lipid rafts. Clarin-1 reorganized actin filament structures and induced lamellipodia. This actin-reorganizing function was absent in the modified protein encoded by the most prevalent North American Usher syndrome III mutation, the N48K form of clarin-1 deficient in N-linked glycosylation. Proteomics analyses revealed a number of clarin-1-interacting proteins involved in cell-cell adhesion, focal adhesions, cell migration, tight junctions, and regulation of the actin cytoskeleton. Consistent with the hypothesized role of clarin-1 in actin organization, F-actin-enriched stereocilia of auditory hair cells evidenced structural disorganization in Clrn1(-/-) mice. These observations suggest a possible role for clarin-1 in the regulation and homeostasis of actin filaments, and link clarin-1 to the interactive network of Usher syndrome gene products.
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
DEFF Research Database (Denmark)
Rosenkilde, Mette M; David, Ralf; Oerlecke, Ilka
2006-01-01
The extracellular part of transmembrane segment V (TM-V) is expected to be involved in the activation process of 7TM receptors, but its role is far from clear. Here, we study the highly constitutively active CXC-chemokine receptor encoded by human herpesvirus 8 (ORF74-HHV8), in which a metal ion ...
Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.
Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D
2015-04-01
Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Energy Technology Data Exchange (ETDEWEB)
Lee, Cha Bum; Lee, Sun Kyu [Gwangju Institute of Science and Technology, Gwangju (Korea, Republic of)
2013-01-15
Recently, in accordance with the increasing market demand for ultra precision technology, a high precision multi-degree-of-freedom displacement measurement technology has become important for industrial applications such as the field of manufacturing and inspection because those physical quantities, linear and angular displacements, are key parameters for keeping and improving quality control of a production system. A number of instruments capable of precise multi-degree-of-freedom measurements have been built and some novel techniques have been introduced. The current state-of-art techniques for multi-degree-of-freedom motion error measurement in a linear stage using laser encoder-implemented system are reviewed. First, we summarize the basic principles behind the measurement technology of the motion error in a stage and simple encoder system. Next, the basic design principles of practical laser encoder system are discussed using the experience of past and existing cases to refer to the important points and the major scientific results. The current trends in the field are significantly discussed, including the novel techniques under construction and advanced technologies. Lastly, the future of multi-functional laser encoder-implemented system, highlighting the kinds of new science upcoming in the next few years, is discussed.
International Nuclear Information System (INIS)
Lee, Cha Bum; Lee, Sun Kyu
2013-01-01
Recently, in accordance with the increasing market demand for ultra precision technology, a high precision multi-degree-of-freedom displacement measurement technology has become important for industrial applications such as the field of manufacturing and inspection because those physical quantities, linear and angular displacements, are key parameters for keeping and improving quality control of a production system. A number of instruments capable of precise multi-degree-of-freedom measurements have been built and some novel techniques have been introduced. The current state-of-art techniques for multi-degree-of-freedom motion error measurement in a linear stage using laser encoder-implemented system are reviewed. First, we summarize the basic principles behind the measurement technology of the motion error in a stage and simple encoder system. Next, the basic design principles of practical laser encoder system are discussed using the experience of past and existing cases to refer to the important points and the major scientific results. The current trends in the field are significantly discussed, including the novel techniques under construction and advanced technologies. Lastly, the future of multi-functional laser encoder-implemented system, highlighting the kinds of new science upcoming in the next few years, is discussed.
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
The ALMT Gene Family Performs Multiple Functions in Plants
Directory of Open Access Journals (Sweden)
Jie Liu
2018-02-01
Full Text Available The aluminium activated malate transporter (ALMT gene family is named after the first member of the family identified in wheat (Triticum aestivum L.. The product of this gene controls resistance to aluminium (Al toxicity. ALMT genes encode transmembrane proteins that function as anion channels and perform multiple functions involving the transport of organic anions (e.g., carboxylates and inorganic anions in cells. They share a PF11744 domain and are classified in the Fusaric acid resistance protein-like superfamily, CL0307. The proteins typically have five to seven transmembrane regions in the N-terminal half and a long hydrophillic C-terminal tail but predictions of secondary structure vary. Although widely spread in plants, relatively little information is available on the roles performed by other members of this family. In this review, we summarized functions of ALMT gene families, including Al resistance, stomatal function, mineral nutrition, microbe interactions, fruit acidity, light response and seed development.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
Directory of Open Access Journals (Sweden)
Li Li
Full Text Available Aerial plant surfaces are covered by epicuticular waxes that among other purposes serve to control water loss. Maize glossy mutants originally identified by their "glossy" phenotypes exhibit alterations in the accumulation of epicuticular waxes. By combining data from a BSR-Seq experiment and the newly developed Seq-Walking technology, GRMZM2G118243 was identified as a strong candidate for being the glossy13 gene. The finding that multiple EMS-induced alleles contain premature stop codons in GRMZM2G118243, and the one knockout allele of gl13, validates the hypothesis that gene GRMZM2G118243 is gl13. Consistent with this, GRMZM2G118243 is an ortholog of AtABCG32 (Arabidopsis thaliana, HvABCG31 (barley and OsABCG31 (rice, which encode ABCG subfamily transporters involved in the trans-membrane transport of various secondary metabolites. We therefore hypothesize that gl13 is involved in the transport of epicuticular waxes onto the surfaces of seedling leaves.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Si, Ying; Dane, Fenny; Rashotte, Aaron; Kang, Kwonkyoo; Singh, Narendra K
2010-06-01
A full-length drought-responsive gene Ccrboh, encoding the respiratory burst oxidase homologue (rboh), was cloned in Citrullus colocynthis, a very drought-tolerant cucurbit species. The robh protein, also named NADPH oxidase, is conserved in plants and animals, and functions in the production of reactive oxygen species (ROS). The Ccrboh gene accumulated in a tissue-specific pattern when C. colocynthis was treated with PEG, abscisic acid (ABA), salicylic acid (SA), jasmonic acid (JA), or NaCl, while the homologous rboh gene did not show any change in C. lanatus var. lanatus, cultivated watermelon, during drought. Grafting experiments were conducted using C. colocynthis or C. lanatus as the rootstock or scion. Results showed that the rootstock significantly affects gene expression in the scion, and some signals might be transported from the root to the shoot. Ccrboh in C. colocynthis was found to function early during plant development, reaching high mRNA transcript levels 3 d after germination. The subcellular location of Ccrboh was investigated by transient expression of the 35S::Ccrboh::GFP fusion construct in protoplasts. The result confirmed that Ccrboh is a transmembrane protein. Our data suggest that Ccrboh might be functionally important during the acclimation of plants to stress and also in plant development. It holds great promise for improving drought tolerance of other cucurbit species.
DEFF Research Database (Denmark)
Egelund, Jack; Skjøt, Michael; Geshi, Naomi
2004-01-01
Plant cell wall (CW) synthesizing enzymes can be divided into the glycan (i.e. cellulose and callose) synthases, which are multimembrane spanning proteins located at the plasma membrane, and the glycosyltransferases (GTs), which are Golgi localized single membrane spanning proteins, believed....... Although much is known with regard to composition and fine structures of the plant CW, only a handful of CW biosynthetic GT genes-all classified in the CAZy system-have been characterized. In an effort to identify CW GTs that have not yet been classified in the CAZy database, a simple bioinformatics...... approach was adopted. First, the entire Arabidopsis proteome was run through the Transmembrane Hidden Markov Model 2.0 server and proteins containing one or, more rarely, two transmembrane domains within the N-terminal 150 amino acids were collected. Second, these sequences were submitted...
DEFF Research Database (Denmark)
Spiess, Katja; Fares, Suzan; Sparre-Ulrich, Alexander H
2015-01-01
Coevolution of herpesviruses with their respective host has resulted in a delicate balance between virus-encoded immune evasion mechanisms and host antiviral immunity. BILF1 encoded by human Epstein-Barr virus (EBV) is a 7-transmembrane (7TM) G-protein-coupled receptor (GPCR) with multiple immuno...
DEFF Research Database (Denmark)
Hertz, Jens Michael; Nørgaard Hansen, K; Juncker, I
1998-01-01
Hypohidrotic ectodermal dysplasia (EDA), or Christ-Siemens-Touraine syndrome, is clinically characterized by hypohidrosis, hypoodontia and hypotrichosis. The X-linked form of the disease has been mapped to Xq12-q13.1, and a gene from this region has recently been cloned. This gene encodes a predi...... in the protein. This mutation cosegregates with the disease in the family and is the first mutation described which affects the predicted transmembrane, hydrophobic domain of the protein.......Hypohidrotic ectodermal dysplasia (EDA), or Christ-Siemens-Touraine syndrome, is clinically characterized by hypohidrosis, hypoodontia and hypotrichosis. The X-linked form of the disease has been mapped to Xq12-q13.1, and a gene from this region has recently been cloned. This gene encodes...... a predicted transmembrane protein of 135 amino acids, which was found to be expressed in keratinocytes, hair follicles, and sweat glands. A variety of rearrangements in this gene have been found in patients with hypohidrotic ectodermal dysplasia. We have screened the probands from nine unrelated Danish...
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Gozu, Hulya; Avsar, Melike; Bircan, Rifat; Claus, Maren; Sahin, Serap; Sezgin, Ozlem; Deyneli, Oguzhan; Paschke, Ralf; Cirakoglu, Beyazit; Akalin, Sema
2005-04-01
Autonomously functioning thyroid nodules (AFTNs) can present as hyperfunctioning adenomas or toxic multinodular goiters. In the last decade, a large number of activating mutations have been identified in the thyrotropin receptor (TSHR) gene in autonomously functioning thyroid nodules. Most have been situated close to, or within the sixth transmembrane segment and third intracellular loop of the TSHR where the receptor interacts with the Gs protein. In this study we describe two novel mutations in the sixth transmembrane segment of the TSHR causing hyperfunctioning thyroid nodules. Genomic DNAs were isolated from four hyperfunctioning thyroid nodules, normal tissues and peripheral leukocytes of two patients with toxic multinodular goiter. After amplifying the related regions, TSHR and G(s)alpha genes were analyzed by single-strand conformation polymorphism (SSCP) analysis. The precise localization of the mutations was identified by automatic DNA sequence analysis. Functional studies were done by site-directed mutagenesis and transfection of a mutant construct into COS-7 cells. We identified two novel TSHR mutations in two hyperfunctioning thyroid nodules: Phe631Val in the first patient and Iso630Met in the second patient. Both mutant receptors display an increase in constitutive stimulation of basal cyclic adenosine monophosphate (cAMP) levels compared to the wild-type receptor. This confirms that these mutant receptors cause hyperfunctioning thyroid nodules.
Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing
2015-01-01
The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Nonlinear inversion of potential-field data using a hybrid-encoding genetic algorithm
Chen, C.; Xia, J.; Liu, J.; Feng, G.
2006-01-01
Using a genetic algorithm to solve an inverse problem of complex nonlinear geophysical equations is advantageous because it does not require computer gradients of models or "good" initial models. The multi-point search of a genetic algorithm makes it easier to find the globally optimal solution while avoiding falling into a local extremum. As is the case in other optimization approaches, the search efficiency for a genetic algorithm is vital in finding desired solutions successfully in a multi-dimensional model space. A binary-encoding genetic algorithm is hardly ever used to resolve an optimization problem such as a simple geophysical inversion with only three unknowns. The encoding mechanism, genetic operators, and population size of the genetic algorithm greatly affect search processes in the evolution. It is clear that improved operators and proper population size promote the convergence. Nevertheless, not all genetic operations perform perfectly while searching under either a uniform binary or a decimal encoding system. With the binary encoding mechanism, the crossover scheme may produce more new individuals than with the decimal encoding. On the other hand, the mutation scheme in a decimal encoding system will create new genes larger in scope than those in the binary encoding. This paper discusses approaches of exploiting the search potential of genetic operations in the two encoding systems and presents an approach with a hybrid-encoding mechanism, multi-point crossover, and dynamic population size for geophysical inversion. We present a method that is based on the routine in which the mutation operation is conducted in the decimal code and multi-point crossover operation in the binary code. The mix-encoding algorithm is called the hybrid-encoding genetic algorithm (HEGA). HEGA provides better genes with a higher probability by a mutation operator and improves genetic algorithms in resolving complicated geophysical inverse problems. Another significant
Arias, C A; Peña, J; Panesso, D; Reynolds, P
2003-03-01
Enterococcus gallinarum BM4175 (a vancomycin-susceptible derivative of BM4174 obtained by insertional inactivation of vanC-1) was transformed with plasmid constructs pCA10 (containing the genes necessary for resistance, vanC-1-XYc-T), pJP1 (with a fragment lacking the DNA encoding the transmembrane region of VanT, -vanC-1-XYc-T((Delta))(2-322)-) and with plasmids containing fragments encoding either the transmembrane (mvanT(1-322)) or racemase (svanT(323-698)) domains of VanT under the control of a constitutive promoter. Accumulated peptidoglycan precursors were measured in all strains in the presence of L-Ser, D-Ser (50 mM) or in the absence of any growth supplement. Uptake of 0.1 mM L-[(14)C]serine was also determined in BM4174, BM4175 and BM4175/pCA10. Vancomycin resistance was restored in BM4175 transformed with pCA10(C-1-XYc-T), and the profile of peptidoglycan precursors was similar to wild-type E. gallinarum BM4174. Transformation of E. gallinarum BM4175 with plasmid pJP1(vanC-1-XYc-T((Delta))(2-322)) resulted in: (i) vancomycin MICs remaining within susceptible levels (VanT is likely to be involved in the transport of L-Ser, and that in its absence the resistance phenotype is compromised.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Energy Technology Data Exchange (ETDEWEB)
Mercier, B.; Audrezet, M.P.; Guillermit, H.; Quere, I.; Verlingue, C.; Ferec, C. (CDTS, Brest (France)); Lissens, W.; Bonduelle, M.; Liebaers, I. (University Hospital VUB, Brussels (Belgium)); Novelli, G.; Sangiuolo, F.; Dallapiccola, B. (IRCCS, Rotondo (Italy)); Kalaydjieva, L. (Inst. of Obstetrics, Sofia (Bulgaria)); Arce, M. De; Cashman, S. (Trinity College, Dublin (Ireland)); Kapranov, N. (NRC of medical Genetics, Moscow (Russian Federation)); Canki Klain, N. (Tozd Univerzitetna Ginekoloska Klinika, Ljubljana (Yugoslavia)); Lenoir, G. (Hopital des Enfants Malades Necker, Paris (France)); Chauveau, P. (Centre Hospitalier General, Le Havre (France)); Lanaerts, C. (Centre Hospitalier Regional et Universitaire, Amiens (France)); Rault, G. (Centre Helio-Marin, Roscoff (France))
1993-04-01
Cystic fibrosis transmembrane conductance regulator (CFTR), the gene responsible, when mutated, for cystic fibrosis (CF), spans over 230 kb on the long arm of chromosome 7 and is composed of 27 exons. The most common mutation responsible for CF worldwide is the deletion of a phenylalanine amino acid at codon 508 in the first nucleotide-binding fold and accounts for approximately 70% of CF chromosomes studied. More than 250 other mutations have been reported through the CF Genetic Analysis Consortium. The majority of the mutations previously described lie in the two nucleotide-binding folds. To explore exhaustively other regions of the gene, particularly exons coding for transmembrane domains, the authors have initiated a collaborative study between different laboratories to screen 369 non-[Delta]F508 CF chromosomes of seven ethnic European populations (Belgian, French, Breton, Irish, Italian, Yugoslavian, Russian). Among these chromosomes carrying an unidentified mutation, 63 were from Brittany, 50 of various French origin, 45 of Irish origin, 56 of Italian origin, 41 of Belgian origin, 2 of Turkish origin, 38 of Yugoslavian origin, 22 of Russian origin, and 52 of Bulgarian origin. Diagnostic criteria for CF included at least one positive sweat test and pulmonary disease with or without pancreatic disease. Using a denaturing gradient gel electrophoresis (DGGE) assay, they have identified eight novel mutations in exon 17b coding for part of the second transmembrane domain of the CFTR and they describe them in this report. 8 refs., 1 fig., 1 tab.
Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A
2015-09-01
Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
Trabanino, Rene J; Vaidehi, Nagarajan; Hall, Spencer E; Goddard, William A; Floriano, Wely
2013-02-05
The invention provides computer-implemented methods and apparatus implementing a hierarchical protocol using multiscale molecular dynamics and molecular modeling methods to predict the presence of transmembrane regions in proteins, such as G-Protein Coupled Receptors (GPCR), and protein structural models generated according to the protocol. The protocol features a coarse grain sampling method, such as hydrophobicity analysis, to provide a fast and accurate procedure for predicting transmembrane regions. Methods and apparatus of the invention are useful to screen protein or polynucleotide databases for encoded proteins with transmembrane regions, such as GPCRs.
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Directory of Open Access Journals (Sweden)
Libia Sanz
2016-07-01
Full Text Available The molecular events underlying the evolution of the Snake Venom Metalloproteinase (SVMP family from an A Disintegrin And Metalloproteinase (ADAM ancestor remain poorly understood. Comparative genomics may provide decisive information to reconstruct the evolutionary history of this multi-locus toxin family. Here, we report the genomic organization of Echis ocellatus genes encoding SVMPs from the PII and PI classes. Comparisons between them and between these genes and the genomic structures of Anolis carolinensis ADAM28 and E. ocellatus PIII-SVMP EOC00089 suggest that insertions and deletions of intronic regions played key roles along the evolutionary pathway that shaped the current diversity within the multi-locus SVMP gene family. In particular, our data suggest that emergence of EOC00028-like PI-SVMP from an ancestral PII(e/d-type SVMP involved splicing site mutations that abolished both the 3′ splice AG acceptor site of intron 12* and the 5′ splice GT donor site of intron 13*, and resulted in the intronization of exon 13* and the consequent destruction of the structural integrity of the PII-SVMP characteristic disintegrin domain.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Directory of Open Access Journals (Sweden)
MATHODIYIL S. MANJULA
2015-12-01
Full Text Available Plant disease resistance genes (R-genes are responsible for initiation of defense mechanism against various phytopathogens. The majority of plant R-genes are members of very large multi-gene families, which encode structurally related proteins containing nucleotide binding site domains (NBS and C-terminal leucine rich repeats (LRR. Other classes possess' an extracellular LRR domain, a transmembrane domain and sometimes, an intracellular serine/threonine kinase domain. R-proteins work in pathogen perception and/or the activation of conserved defense signaling networks. In the present study, sequences representing resistance gene analogues (RGAs of coconut, arecanut, oil palm and date palm were collected from NCBI, sorted based on domains and assembled into a database. The sequences were analyzed in PRINTS database to find out the conserved domains and their motifs present in the RGAs. Based on these domains, we have also developed a tool to predict the domains of palm R-genes using various machine learning algorithms. The model files were selected based on the performance of the best classifier in training and testing. All these information is stored and made available in the online ‘PRGpred' database and prediction tool.
Wu, Sangwook
2016-04-01
The three transmembrane and the four transmembrane helix models are suggested for human vitamin K epoxide reductase (VKOR). In this study, we investigate the stability of the human three transmembrane/four transmembrane VKOR models by employing a coarse-grained normal mode analysis and molecular dynamics simulation. Based on the analysis of the mobility of each transmembrane domain, we suggest that the three transmembrane human VKOR model is more stable than the four transmembrane human VKOR model.
Edgren, Tomas; Nordlund, Stefan
2004-04-01
In our efforts to identify the components participating in electron transport to nitrogenase in Rhodospirillum rubrum, we used mini-Tn5 mutagenesis followed by metronidazole selection. One of the mutants isolated, SNT-1, exhibited a decreased growth rate and about 25% of the in vivo nitrogenase activity compared to the wild-type values. The in vitro nitrogenase activity was essentially wild type, indicating that the mutation affects electron transport to nitrogenase. Sequencing showed that the Tn5 insertion is located in a region with a high level of similarity to fixC, and extended sequencing revealed additional putative fix genes, in the order fixABCX. Complementation of SNT-1 with the whole fix gene cluster in trans restored wild-type nitrogenase activity and growth. Using Western blotting, we demonstrated that expression of fixA and fixB occurs only under conditions under which nitrogenase also is expressed. SNT-1 was further shown to produce larger amounts of both ribulose 1,5-bisphosphate carboxylase/oxygenase and polyhydroxy alkanoates than the wild type, indicating that the redox status is affected in this mutant. Using Western blotting, we found that FixA and FixB are soluble proteins, whereas FixC most likely is a transmembrane protein. We propose that the fixABCX genes encode a membrane protein complex that plays a central role in electron transfer to nitrogenase in R. rubrum. Furthermore, we suggest that FixC is the link between nitrogen fixation and the proton motive force generated in the photosynthetic reactions.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Genome-Wide Identification and Expression Analysis of the UGlcAE Gene Family in Tomato
Xing Ding; Jinhua Li; Yu Pan; Yue Zhang; Lei Ni; Yaling Wang; Xingguo Zhang
2018-01-01
The UGlcAE has the capability of interconverting UDP-d-galacturonic acid and UDP-d-glucuronic acid, and UDP-d-galacturonic acid is an activated precursor for the synthesis of pectins in plants. In this study, we identified nine UGlcAE protein-encoding genes in tomato. The nine UGlcAE genes that were distributed on eight chromosomes in tomato, and the corresponding proteins contained one or two trans-membrane domains. The phylogenetic analysis showed that SlUGlcAE genes could be divided into s...
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Cancer Research Advance in CKLF-like MARVEL Transmembrane Domain Containing Member Family (Review).
Lu, Jia; Wu, Qian-Qian; Zhou, Ya-Bo; Zhang, Kai-Hua; Pang, Bing-Xin; Li, Liang; Sun, Nan; Wang, Heng-Shu; Zhang, Song; Li, Wen-Jian; Zheng, Wei; Liu, Wei
2016-01-01
CKLF-like MARVEL transmembrane domain-containing family (CMTM) is a novel family of genes first reported at international level by Peking University Human Disease Gene Research Center. The gene products are between chemokines and the transmembrane-4 superfamily. Loaceted in several human chromosomes, CMTMs, which are unregulated in kinds of tumors, are potential tumor suppressor genes consisting of CKLF and CMTM1 to CMTM8. CMTMs play important roles in immune, male reproductive and hematopoietic systems. Also, it has been approved that CMTM family has strong connection with diseases of autoimmunity, haematopoietic system and haematopoietic system. The in-depth study in recent years found the close relation between CMTMs and umorigenesis, tumor development and metastasis. CMTM family has a significant clinical value in diagnosis and treatment to the diseases linking to tumor and immune system.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
Schuster, M; Wasserbauer, E; Aversa, G; Jungbauer, A
2001-02-01
Protein expression using the secretory pathway in Saccharomyces cerevisiae can lead to high amounts of overexpressed and secreted proteins in culture supernatants in a short period of time. These post-translational modified expression products can be purified up to >90% in a single step. The overexpression and secretion of the transmembrane glycoprotein signaling lymphocytic activation molecule (SLAM) was studied. SLAM belongs to the immunoglobulin superfamily and its engagement results in T-cell expansion and INF-gamma production. The molecule is composed of an extracellular, a single-span transmembrane and a cytoplasmatic domain. The extracellular part may be relevant for stimulation studies in vitro since SLAM is a high-affinity self-ligand. Therefore several fragments of this region have been expressed as Flag-fusions in S. cerevisiae: a full-length fragment containing the transmembrane region and the autologous signal sequence, another without the transmembrane region, and two fragments without the autologous signal sequence with and without the transmembrane region. By molecular cloning, the different deletion mutants of the cDNA encoding the full-length construct have been inserted in a yeast episomal plasmid. Upstream of the cDNA, the alpha-leader sequence of a yeast mating pheromone has been cloned to direct the fusion proteins into the secretory protein maturation pathway. All four fragments were expressed but yield, location, and maturation were highly influenced by the transmembrane domain and the autologous signal sequence. Only the fragment without autologous signal sequence and transmembrane domain could be efficiently secreted. High-mannose glycosylation was analyzed by lectin mapping and digestion with specific glycosidases. After enzyme treatment, a single band product with the theoretical size could be detected and identified as SLAM by a specific monoclonal antibody. The fusion protein concentration in the supernatant was 30 microg/ml. The
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
Sousa, C S; Barros, B A; Barh, D; Ghosh, P; Azevedo, V; Barros, E G; Moreira, M A
2016-08-26
The enzymes 1,2-diacylglycerol cholinephosphotrans-ferase (CPT) and lysophosphatidylcholine acyltransferase (LPCAT) are important in lipid metabolism in soybean seeds. Thus, understand-ing the genes that encode these enzymes may enable their modification and aid the improvement of soybean oil quality. In soybean, the genes encoding these enzymes have not been completely described; there-fore, this study aimed to identify, characterize, and analyze the in silico expression of these genes in soybean. We identified two gene models encoding CPT and two gene models encoding LPCAT, one of which presented an alternative transcript. The sequences were positioned on the physical map of soybean and the promoter regions were analyzed. Cis-elements responsible for seed-specific expression and responses to biotic and abiotic stresses were identified. Virtual expression analysis of the gene models for CPT and LPCAT indicated that these genes are expressed under different stress conditions, in somatic embryos during differentiation, in immature seeds, root tissues, and calli. Putative ami-no acid sequences revealed the presence of transmembrane domains, and analysis of the cellular localization of these enzymes revealed they are located in the endoplasmic reticulum.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Obando S, Tobias A; Babykin, Michael M; Zinchenko, Vladislav V
2018-05-21
The unicellular freshwater cyanobacterium Synechocystis sp. PCC 6803 is capable of using dihydroxamate xenosiderophores, either ferric schizokinen (FeSK) or a siderophore of the filamentous cyanobacterium Anabaena variabilis ATCC 29413 (SAV), as the sole source of iron in the TonB-dependent manner. The fecCDEB1-schT gene cluster encoding a siderophore transport system that is involved in the utilization of FeSK and SAV in Synechocystis sp. PCC 6803 was identified. The gene schT encodes TonB-dependent outer membrane transporter, whereas the remaining four genes encode the ABC-type transporter FecB1CDE formed by the periplasmic binding protein FecB1, the transmembrane permease proteins FecC and FecD, and the ATPase FecE. Inactivation of any of these genes resulted in the inability of cells to utilize FeSK and SAV. Our data strongly suggest that Synechocystis sp. PCC 6803 can readily internalize Fe-siderophores via the classic TonB-dependent transport system.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein
Wang, W.; Takezawa, D.; Poovaiah, B. W.
1996-01-01
A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Bioinformatic Analysis of Strawberry GSTF12 Gene
Wang, Xiran; Jiang, Leiyu; Tang, Haoru
2018-01-01
GSTF12 has always been known as a key factor of proanthocyanins accumulate in plant testa. Through bioinformatics analysis of the nucleotide and encoded protein sequence of GSTF12, it is more advantageous to the study of genes related to anthocyanin biosynthesis accumulation pathway. Therefore, we chosen GSTF12 gene of 11 kinds species, downloaded their nucleotide and protein sequence from NCBI as the research object, found strawberry GSTF12 gene via bioinformation analyse, constructed phylogenetic tree. At the same time, we analysed the strawberry GSTF12 gene of physical and chemical properties and its protein structure and so on. The phylogenetic tree showed that Strawberry and petunia were closest relative. By the protein prediction, we found that the protein owed one proper signal peptide without obvious transmembrane regions.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
LENUS (Irish Health Repository)
Rogan, Mark P
2012-02-01
Recent advances in basic science have greatly expanded our understanding of the cystic fibrosis (CF) transmembrane conductance regulator (CFTR), the chloride and bicarbonate channel that is encoded by the gene, which is mutated in patients with CF. We review the structure, function, biosynthetic processing, and intracellular trafficking of CFTR and discuss the five classes of mutations and their impact on the CF phenotype. The therapeutic discussion is focused on the significant progress toward CFTR mutation-specific therapies. We review the results of encouraging clinical trials examining orally administered therapeutics, including agents that promote read-through of class I mutations (premature termination codons); correctors, which overcome the CFTR misfolding that characterizes the common class II mutation F508del; and potentiators, which enhance the function of class III or IV mutated CFTR at the plasma membrane. Long-term outcomes from successful mutation-specific treatments could finally answer the question that has been lingering since and even before the CFTR gene discovery: Will therapies that specifically restore CFTR-mediated chloride secretion slow or arrest the deleterious cascade of events leading to chronic infection, bronchiectasis, and end-stage lung disease?
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Boris, K V; Kochieva, E Z; Kudryavtsev, A M
2014-12-01
The sequences that encode the main functional glucosyltransferase domain of sucrose synthase genes have been identified for the first time in 14 species of the genus Malus and related species of the family Rosaceae, and their polymorphism was investigated. Single nucleotide substitutions leading to amino acid substitutions in the protein sequence, including the conservative transmembrane motif sequence common to all sucrose synthase genes of higher plants, were detected in the studied sequences.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
The cystic fibrosis transmembrane recruiter the alter ego of CFTR as a multi-kinase anchor.
Mehta, Anil
2007-11-01
This review focuses on a newly discovered interaction between protein kinases involved in cellular energetics, a process that may be disturbed in cystic fibrosis for unknown reasons. I propose a new model where kinase-mediated cellular transmission of energy provides mechanistic insight to a latent role of the cystic fibrosis transmembrane conductance regulator (CFTR). I suggest that CFTR acts as a multi-kinase recruiter to the apical epithelial membrane. My group finds that, in the cytosol, two protein kinases involved in cell energy homeostasis, nucleoside diphosphate kinase (NDPK) and AMP-activated kinase (AMPK), bind one another. Preliminary data suggest that both can also bind CFTR (function unclear). The disrupted role of this CFTR-kinase complex as 'membrane transmitter to the cell' is proposed as an alternative paradigm to the conventional ion transport mediated and CFTR/chloride-centric view of cystic fibrosis pathogenesis. Chloride remains important, but instead, chloride-induced control of the phosphohistidine content of one kinase component (NDPK, via a multi-kinase complex that also includes a third kinase, CK2; formerly casein kinase 2). I suggest that this complex provides the necessary near-equilibrium conditions needed for efficient transmission of phosphate energy to proteins controlling cellular energetics. Crucially, a new role for CFTR as a kinase controller is proposed with ionic concentration acting as a signal. The model posits a regulatory control relay for energy sensing involving a cascade of protein kinases bound to CFTR.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Weber, K; Mock, U; Petrowitz, B; Bartsch, U; Fehse, B
2010-04-01
Vector-encoded fluorescent proteins (FPs) facilitate unambiguous identification or sorting of gene-modified cells by fluorescence-activated cell sorting (FACS). Exploiting this feature, we have recently developed lentiviral gene ontology (LeGO) vectors (www.LentiGO-Vectors.de) for multi-gene analysis in different target cells. In this study, we extend the LeGO principle by introducing 10 different drug-selectable FPs created by fusing one of the five selection marker (protecting against blasticidin, hygromycin, neomycin, puromycin and zeocin) and one of the five FP genes (Cerulean, eGFP, Venus, dTomato and mCherry). All tested fusion proteins allowed both fluorescence-mediated detection and drug-mediated selection of LeGO-transduced cells. Newly generated codon-optimized hygromycin- and neomycin-resistance genes showed improved expression as compared with their ancestors. New LeGO constructs were produced at titers >10(6) per ml (for non-concentrated supernatants). We show efficient combinatorial marking and selection of various cells, including mesenchymal stem cells, simultaneously transduced with different LeGO constructs. Inclusion of the cytomegalovirus early enhancer/chicken beta-actin promoter into LeGO vectors facilitated robust transgene expression in and selection of neural stem cells and their differentiated progeny. We suppose that the new drug-selectable markers combining advantages of FACS and drug selection are well suited for numerous applications and vector systems. Their inclusion into LeGO vectors opens new possibilities for (stem) cell tracking and functional multi-gene analysis.
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
a permutation encoding te algorithm solution of reso tation encoding
African Journals Online (AJOL)
eobe
Keywords: Genetic algorithm, resource constrained. 1. INTRODUCTION. 1. .... Nigerian Journal of Technology. Vol. 34, No. 1, January 2015. 128 ... 4. ENCODING OF CHROMOSOME. ENCODING OF CHROMOSOME .... International Multi conference of Engineers and ... method”, Naval Research Logistics, vol 48, issue 2,.
Multi-label literature classification based on the Gene Ontology graph
Directory of Open Access Journals (Sweden)
Lu Xinghua
2008-12-01
Full Text Available Abstract Background The Gene Ontology is a controlled vocabulary for representing knowledge related to genes and proteins in a computable form. The current effort of manually annotating proteins with the Gene Ontology is outpaced by the rate of accumulation of biomedical knowledge in literature, which urges the development of text mining approaches to facilitate the process by automatically extracting the Gene Ontology annotation from literature. The task is usually cast as a text classification problem, and contemporary methods are confronted with unbalanced training data and the difficulties associated with multi-label classification. Results In this research, we investigated the methods of enhancing automatic multi-label classification of biomedical literature by utilizing the structure of the Gene Ontology graph. We have studied three graph-based multi-label classification algorithms, including a novel stochastic algorithm and two top-down hierarchical classification methods for multi-label literature classification. We systematically evaluated and compared these graph-based classification algorithms to a conventional flat multi-label algorithm. The results indicate that, through utilizing the information from the structure of the Gene Ontology graph, the graph-based multi-label classification methods can significantly improve predictions of the Gene Ontology terms implied by the analyzed text. Furthermore, the graph-based multi-label classifiers are capable of suggesting Gene Ontology annotations (to curators that are closely related to the true annotations even if they fail to predict the true ones directly. A software package implementing the studied algorithms is available for the research community. Conclusion Through utilizing the information from the structure of the Gene Ontology graph, the graph-based multi-label classification methods have better potential than the conventional flat multi-label classification approach to facilitate
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
An encoding readout method used for Multi-gap Resistive Plate Chambers (MRPCs) for muon tomography
Yue, X.; Zeng, M.; Wang, Y.; Wang, X.; Zeng, Z.; Zhao, Z.; Cheng, J.
2014-09-01
A muon tomography facility has been built in Tsinghua University. Because of the low flux of cosmic muon, an encoding readout method, based on the fine-fine configuration, was implemented for the 2880 channels induced signals from the Multi-gap Resistive Plate Chamber (MRPC) detectors. With the encoding method, the number of the readout electronics was dramatically reduced and thus the complexity and the cost of the facility was reduced, too. In this paper, the details of the encoding method, and the overall readout system setup in the muon tomography facility are described. With the commissioning of the facility, the readout method works well. The spatial resolution of all MRPC detectors are measured with cosmic muon and the preliminary imaging result are also given.
An encoding readout method used for Multi-gap Resistive Plate Chambers (MRPCs) for muon tomography
International Nuclear Information System (INIS)
Yue, X; Zeng, M; Wang, Y; Wang, X; Zeng, Z; Zhao, Z; Cheng, J
2014-01-01
A muon tomography facility has been built in Tsinghua University. Because of the low flux of cosmic muon, an encoding readout method, based on the fine-fine configuration, was implemented for the 2880 channels induced signals from the Multi-gap Resistive Plate Chamber (MRPC) detectors. With the encoding method, the number of the readout electronics was dramatically reduced and thus the complexity and the cost of the facility was reduced, too. In this paper, the details of the encoding method, and the overall readout system setup in the muon tomography facility are described. With the commissioning of the facility, the readout method works well. The spatial resolution of all MRPC detectors are measured with cosmic muon and the preliminary imaging result are also given
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
DEFF Research Database (Denmark)
Madsen, Jack Egelund; Petersen, Bent Larsen; Motawia, Mohammed Saddik
2006-01-01
in rhamnogalacturonan-II, a complex polysaccharide essential to vascular plants, and is conserved across higher plant families. Rhamnogalacturonan-II isolated from both RGXT1 and RGXT2 T-DNA insertional mutants functioned as specific acceptor molecules in the xylosyltransferase assay. Expression of RGXT1- and RGXT2......Two homologous plant-specific Arabidopsis thaliana genes, RGXT1 and RGXT2, belong to a new family of glycosyltransferases (CAZy GT-family-77) and encode cell wall (1,3)-alpha-d-xylosyltransferases. The deduced amino acid sequences contain single transmembrane domains near the N terminus, indicative...
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Multi-targeted priming for genome-wide gene expression assays
Directory of Open Access Journals (Sweden)
Adomas Aleksandra B
2010-08-01
Full Text Available Abstract Background Complementary approaches to assaying global gene expression are needed to assess gene expression in regions that are poorly assayed by current methodologies. A key component of nearly all gene expression assays is the reverse transcription of transcribed sequences that has traditionally been performed by priming the poly-A tails on many of the transcribed genes in eukaryotes with oligo-dT, or by priming RNA indiscriminately with random hexamers. We designed an algorithm to find common sequence motifs that were present within most protein-coding genes of Saccharomyces cerevisiae and of Neurospora crassa, but that were not present within their ribosomal RNA or transfer RNA genes. We then experimentally tested whether degenerately priming these motifs with multi-targeted primers improved the accuracy and completeness of transcriptomic assays. Results We discovered two multi-targeted primers that would prime a preponderance of genes in the genomes of Saccharomyces cerevisiae and Neurospora crassa while avoiding priming ribosomal RNA or transfer RNA. Examining the response of Saccharomyces cerevisiae to nitrogen deficiency and profiling Neurospora crassa early sexual development, we demonstrated that using multi-targeted primers in reverse transcription led to superior performance of microarray profiling and next-generation RNA tag sequencing. Priming with multi-targeted primers in addition to oligo-dT resulted in higher sensitivity, a larger number of well-measured genes and greater power to detect differences in gene expression. Conclusions Our results provide the most complete and detailed expression profiles of the yeast nitrogen starvation response and N. crassa early sexual development to date. Furthermore, our multi-targeting priming methodology for genome-wide gene expression assays provides selective targeting of multiple sequences and counter-selection against undesirable sequences, facilitating a more complete and
Jaquemar, D; Schenker, T; Trueb, B
1999-03-12
We have identified a novel transformation-sensitive mRNA, which is present in cultured fibroblasts but is lacking in SV40 transformed cells as well as in many mesenchymal tumor cell lines. The corresponding gene is located on human chromosome 8 in band 8q13. The open reading frame of the mRNA encodes a protein of 1119 amino acids forming two distinct domains. The N-terminal domain consists of 18 repeats that are related to the cytoskeletal protein ankyrin. The C-terminal domain contains six putative transmembrane segments that resemble many ion channels. This overall structure is reminiscent of TRP-like proteins that function as store-operated calcium channels. The novel protein with an Mr of 130 kDa is expressed at a very low level in human fibroblasts and at a moderate level in liposarcoma cells. Overexpression in eukaryotic cells appears to interfere with normal growth, suggesting that it might play a direct or indirect role in signal transduction and growth control.
Energy Technology Data Exchange (ETDEWEB)
Satheshkumar, P.S.; Chavre, James; Moss, Bernard, E-mail: bmoss@nih.gov
2013-09-15
The vaccinia virus O3 protein, a component of the entry–fusion complex, is encoded by all chordopoxviruses. We constructed truncation mutants and demonstrated that the transmembrane domain, which comprises two-thirds of this 35 amino acid protein, is necessary and sufficient for interaction with the entry–fusion complex and function in cell entry. Nevertheless, neither single amino acid substitutions nor alanine scanning mutagenesis revealed essential amino acids within the transmembrane domain. Moreover, replication-competent mutant viruses were generated by randomization of 10 amino acids of the transmembrane domain. Of eight unique viruses, two contained only two amino acids in common with wild type and the remainder contained one or none within the randomized sequence. Although these mutant viruses formed normal size plaques, the entry–fusion complex did not co-purify with the mutant O3 proteins suggesting a less stable interaction. Thus, despite low specific sequence requirements, the transmembrane domain is sufficient for function in entry. - Highlights: • The 35 amino acid O3 protein is required for efficient vaccinia virus entry. • The transmembrane domain of O3 is necessary and sufficient for entry. • Mutagenesis demonstrated extreme sequence flexibility compatible with function.
Structure and function of the cystic fibrosis transmembrane conductance regulator
Directory of Open Access Journals (Sweden)
M.M. Morales
1999-08-01
Full Text Available Cystic fibrosis (CF is a lethal autosomal recessive genetic disease caused by mutations in the CF transmembrane conductance regulator (CFTR. Mutations in the CFTR gene may result in a defective processing of its protein and alter the function and regulation of this channel. Mutations are associated with different symptoms, including pancreatic insufficiency, bile duct obstruction, infertility in males, high sweat Cl-, intestinal obstruction, nasal polyp formation, chronic sinusitis, mucus dehydration, and chronic Pseudomonas aeruginosa and Staphylococcus aureus lung infection, responsible for 90% of the mortality of CF patients. The gene responsible for the cellular defect in CF was cloned in 1989 and its protein product CFTR is activated by an increase of intracellular cAMP. The CFTR contains two membrane domains, each with six transmembrane domain segments, two nucleotide-binding domains (NBDs, and a cytoplasmic domain. In this review we discuss the studies that have correlated the role of each CFTR domain in the protein function as a chloride channel and as a regulator of the outwardly rectifying Cl- channels (ORCCs.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Ouvrier, Robert; Grew, Simon
2010-01-01
Mitofusin 2, a large transmembrane GTPase located in the outer mitochondrial membrane, promotes membrane fusion and is involved in the maintenance of the morphology of axonal mitochondria. Mutations of the gene encoding mitofusin 2 ("MFN2") have recently been identified as the cause of approximately one-third of dominantly inherited cases of the…
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Cloning and expression analysis of a novel ammonium transporter gene from eichhornia
International Nuclear Information System (INIS)
Li, Y.; Yan, G.; Zheng, L.
2014-01-01
In order to explore the molecular mechanism for Eichhornia crassipes to transport ammonium from outside, we cloned a novel ammonium transporter (EcAMT) gene from E. crassipes and identified its function by using yeast complementation experiment. The full-length cDNA of EcAMT contains a 1506 nucletide-long open reading frame which encodes a protein of 501 amino acids. Bioinformatics analysis predicted that EcAMT had 8 transmembrane regions. The expressions of EcAMT gene under three different nitrogen conditions were evaluated by quantitative reverse transcriptase PCR (qRT-PCR) and the results showed that the expression of EcAMT gene was up-regulated under nitrogen starvation. Our study results revealed some molecular mechanism of E. crassipes to absorb the ammonium in eutrophic water. (author)
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Quackenbush, E.; Clabby, M.; Gottesdiener, K.M.; Barbosa, J.; Jones, N.H.; Strominger, J.L.; Speck, S.; Leiden, J.M.
1987-01-01
Complementary DNA (cDNA) clones encoding the heavy chain of the heterodimeric human membrane glycoprotein 4F2 have been isolated by immunoscreening of a λgt11 expression library. The identity of these clones has been confirmed by hybridization to RNA and DNA prepared from mouse L-cell transfectants, which were produced by whole cell gene transfer and selected for cell-surface expression of the human 4F2 heavy chain. DNA sequence analysis suggest that the 4F2 heavy-chain cDNAs encode an approximately 526-amino acid type II membrane glycoprotein, which is composed of a large C-terminal extracellular domain, a single potential transmembrane region, and a 50-81 amino acid N-terminal intracytoplasmic domain. Southern blotting experiments have shown that the 4F2 heavy-chain cDNAs are derived from a single-copy gene that has been highly conserved during mammalian evolution
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Energy Technology Data Exchange (ETDEWEB)
Jin, Ming-hao; Uratani, Yoshihiko; Arimatsu, Yasuyoshi [Mitsubishi Kasei Institute of Life Sciences, Tokyo (Japan)
1997-02-01
Latexin was first found as a 29-kDa antigen expressed in a subset of neurons in infragranular layers of lateral, but not dorsal, neocortical areas in the rat using a monoclonal antibody PC3.1. It was found that the vast majority of latexin-expressing neurons in both layers V and VI within the lateral neocortex were generated concurrently at Embryonic Day 15, demonstrating a strict correlation between the molecular identity of neurons and the time of their generation. Since neurons expressing latexin are located in the restricted part of the neocortex, latexin has been used as a useful molecular marker to elucidate the mechanism underlying cortical regional specification. The latexin cDNA isolated from a cDNA library of the rat cerebral cortex encodes a protein composed of 223-amino-acid residues containing two potential Ca{sup 2+}/calmodulin-dependent protein kinase sites and one cGMP-dependent protein kinase phosphorylation site. The absence of any signal peptide or potential transmembrane domain is consistent with the apparent cytosolic localization of latexin in the rat brain. The transcripts of latexin were expressed in not only neutral but also nonneural tissues (e.g., lung, spleen, kidney, heart, and digestive tracts). Recently, it has been demonstrated that latexin purified from the rat brain has inhibitory activity against carboxypeptidase A1, carboxypeptidase A2, and mast cell carboxypeptidase A, with less carboxypeptidase B-inhibiting activity. The amino acid sequence deduced from the rat latexin cDNA has no strict homology to any sequences so far known. Genomic Southern blot analysis using a cDNA probe of rat latexin suggested that the gene encoding latexin in the rat has homologues in other mammalian species and in the chicken, but not in the nematode, fly, or frog. 9 refs., 1 fig.
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Discovery and Characterization of Two Novel Salt-Tolerance Genes in Puccinellia tenuiflora
Directory of Open Access Journals (Sweden)
Ying Li
2014-09-01
Full Text Available Puccinellia tenuiflora is a monocotyledonous halophyte that is able to survive in extreme saline soil environments at an alkaline pH range of 9–10. In this study, we transformed full-length cDNAs of P. tenuiflora into Saccharomyces cerevisiae by using the full-length cDNA over-expressing gene-hunting system to identify novel salt-tolerance genes. In all, 32 yeast clones overexpressing P. tenuiflora cDNA were obtained by screening under NaCl stress conditions; of these, 31 clones showed stronger tolerance to NaCl and were amplified using polymerase chain reaction (PCR and sequenced. Four novel genes encoding proteins with unknown function were identified; these genes had no homology with genes from higher plants. Of the four isolated genes, two that encoded proteins with two transmembrane domains showed the strongest resistance to 1.3 M NaCl. RT-PCR and northern blot analysis of P. tenuiflora cultured cells confirmed the endogenous NaCl-induced expression of the two proteins. Both of the proteins conferred better tolerance in yeasts to high salt, alkaline and osmotic conditions, some heavy metals and H2O2 stress. Thus, we inferred that the two novel proteins might alleviate oxidative and other stresses in P. tenuiflora.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Yamamoto, Shouji; Mitobe, Jiro; Ishikawa, Takahiko; Wai, Sun Nyunt; Ohnishi, Makoto; Watanabe, Haruo; Izumiya, Hidemasa
2014-01-01
In Vibrio cholerae, 41 chitin-inducible genes, including the genes involved in natural competence for DNA uptake, are governed by the orphan two-component system (TCS) sensor kinase ChiS. However, the mechanism by which ChiS controls the expression of these genes is currently unknown. Here, we report the involvement of a novel transcription factor termed 'TfoS' in this process. TfoS is a transmembrane protein that contains a large periplasmic domain and a cytoplasmic AraC-type DNA-binding domain, but lacks TCS signature domains. Inactivation of tfoS abolished natural competence as well as transcription of the tfoR gene encoding a chitin-induced small RNA essential for competence gene expression. A TfoS fragment containing the DNA-binding domain specifically bound to and activated transcription from the tfoR promoter. Intracellular TfoS levels were unaffected by disruption of chiS and coexpression of TfoS and ChiS in Escherichia coli recovered transcription of the chromosomally integrated tfoR::lacZ gene, suggesting that TfoS is post-translationally modulated by ChiS during transcriptional activation; however, this regulation persisted when the canonical phosphorelay residues of ChiS were mutated. The results presented here suggest that ChiS operates a chitin-induced non-canonical signal transduction cascade through TfoS, leading to transcriptional activation of tfoR. © 2013 John Wiley & Sons Ltd.
Energy Technology Data Exchange (ETDEWEB)
Heighway, J.; Betticher, D.C.; Altermatt, H.J. [Univ. Hospital of Berne (Switzerland)] [and others
1996-07-01
Analysis of a region of DNA, coamplified in tumors with KRAS2, resulted in the identification of the human homologue of the mouse KRAG gene. The gene was widely expressed in range of cell lines, tumors, and normal tissue and demonstrated a high degree of alternate splicing. A human KRAG cDNA sequence, with a structure similar to that encoded by the amplified gene in mouse Y1 adrenal carcinoma cells, was isolated by RT-PCR. The predicted amino acid similarity between the two sequences was 91%, and hydrophobicity plots suggested a structure closely resembling that of transmembrane 4 superfamily members. Identification of a PCR-based restriction fragment length polymorphism allele-specific splicing differences in tumors. Northern analysis of mRNA derived from a range of tissues suggested high level expression in muscle and confirmed alternate splicing. To facilitate the analysis of exon junctions, a YAC clone encoding the genomic sequence was identified. This allowed the localization of KRAG to human chromosome 12p11.2. Isolation of one end of this nonchimeric clone demonstrated a perfect match with a 247-bp sequence within the 3{prime} untranslated region of the type 2 1,4,5-inositol triphosphate receptor gene. Multiplex PCR confirmed the inclusion of both genes. Multiplex PCR confirmed the inclusion of both genes in the KRAS2 amplicon in human malignancy, suggesting that either may contribute to the malignant phenotypes. 35 refs., 6 figs., 1 tab.
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Encoding atlases by randomized classification forests for efficient multi-atlas label propagation.
Zikic, D; Glocker, B; Criminisi, A
2014-12-01
We propose a method for multi-atlas label propagation (MALP) based on encoding the individual atlases by randomized classification forests. Most current approaches perform a non-linear registration between all atlases and the target image, followed by a sophisticated fusion scheme. While these approaches can achieve high accuracy, in general they do so at high computational cost. This might negatively affect the scalability to large databases and experimentation. To tackle this issue, we propose to use a small and deep classification forest to encode each atlas individually in reference to an aligned probabilistic atlas, resulting in an Atlas Forest (AF). Our classifier-based encoding differs from current MALP approaches, which represent each point in the atlas either directly as a single image/label value pair, or by a set of corresponding patches. At test time, each AF produces one probabilistic label estimate, and their fusion is done by averaging. Our scheme performs only one registration per target image, achieves good results with a simple fusion scheme, and allows for efficient experimentation. In contrast to standard forest schemes, in which each tree would be trained on all atlases, our approach retains the advantages of the standard MALP framework. The target-specific selection of atlases remains possible, and incorporation of new scans is straightforward without retraining. The evaluation on four different databases shows accuracy within the range of the state of the art at a significantly lower running time. Copyright © 2014 Elsevier B.V. All rights reserved.
Molecular cloning and expression of heteromeric ACCase subunit genes from Jatropha curcas.
Gu, Keyu; Chiam, Huihui; Tian, Dongsheng; Yin, Zhongchao
2011-04-01
Acetyl-CoA carboxylase (ACCase) catalyzes the biotin-dependent carboxylation of acetyl-CoA to produce malonyl-CoA, which is the essential first step in the biosynthesis of long-chain fatty acids. ACCase exists as a multi-subunit enzyme in most prokaryotes and the chloroplasts of most plants and algae, while it is present as a multi-domain enzyme in the endoplasmic reticulum of most eukaryotes. The heteromeric ACCase of higher plants consists of four subunits: an α-subunit of carboxyltransferase (α-CT, encoded by accA gene), a biotin carboxyl carrier protein (BCCP, encoded by accB gene), a biotin carboxylase (BC, encoded by accC gene) and a β-subunit of carboxyltransferase (β-CT, encoded by accD gene). In this study, we cloned and characterized the genes accA, accB1, accC and accD that encode the subunits of heteromeric ACCase in Jatropha (Jatropha curcas), a potential biofuel plant. The full-length cDNAs of the four subunit genes were isolated from a Jatropha cDNA library and by using 5' RACE, whereas the genomic clones were obtained from a Jatropha BAC library. They encode a 771 amino acid (aa) α-CT, a 286-aa BCCP1, a 537-aa BC and a 494-aa β-CT, respectively. The single-copy accA, accB1 and accC genes are nuclear genes, while the accD gene is located in chloroplast genome. Jatropha α-CT, BCCP1, BC and β-CT show high identity to their homologues in other higher plants at amino acid level and contain all conserved domains for ACCase activity. The accA, accB1, accC and accD genes are temporally and spatially expressed in the leaves and endosperm of Jatropha plants, which are regulated by plant development and environmental factors. Copyright © 2011 Elsevier Ireland Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Chromosomal localization of the human and mouse hyaluronan synthase genes
Energy Technology Data Exchange (ETDEWEB)
Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others
1997-05-01
We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Directory of Open Access Journals (Sweden)
Bora İrer
2017-12-01
Full Text Available Objective: In this study, we aimed to determine the relationship between the RNA and protein expression profile of six transmembrane protein of prostate 2 (STAMP2 gene and androgen and the intracellular localization of STAMP2. Materials and Methods: RNA and protein were obtained from androgen treated lymph node carcinoma of the prostate (LNCaP cells, untreated LNCaP cells, DU145 cells with no androgen receptor, and STAMP2 transfected COS-7 cells. The expression profile of STAMP2 gene and the effect of androgenes on the expression was shown in RNA and protein levels by using Northern and Western blotting methods. In addition, intracellular localization of the naturally synthesized STAMP2 protein and the transfected STAMP2 protein in COS-7 cells after androgen administration in both LNCaP cells was determined by immunofluorescence microscopy. Results: We found that the RNA and protein expression of STAMP2 gene in LNCaP cells are regulated by androgenes, the power of expression is increased with the duration of androgen treatment and there is no STAMP2 expression in DU145 cells which has no androgen receptor. As a result of the immunofluorescence microscopy study we observed that STAMP2 protein was localized at golgi complex and cell membrane. Conclusion: In conclusion, we have demonstrated that STAMP2 may play an important role in the pathogenesis of the prostate cancer and in the androgen-dependent androgen-independent staging of prostate cancer. In addition, STAMP2 protein, which is localized in the intracellular golgi complex and cell membrane, may be a new target molecule for prostate cancer diagnosis and treatment.
DEFF Research Database (Denmark)
Rosenkilde, Mette M; Benned-Jensen, Tau; Holst, Peter J
2006-01-01
Epstein-Barr virus (EBV)-induced receptor 2 (EBI2) is an orphan seven-transmembrane (7TM) receptor originally identified as the most up-regulated gene (>200-fold) in EBV-infected cells. Here we show that EBI2 signals with constitutive activity through Galpha(i) as determined by a receptor...
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
A stochastic approach to multi-gene expression dynamics
International Nuclear Information System (INIS)
Ochiai, T.; Nacher, J.C.; Akutsu, T.
2005-01-01
In the last years, tens of thousands gene expression profiles for cells of several organisms have been monitored. Gene expression is a complex transcriptional process where mRNA molecules are translated into proteins, which control most of the cell functions. In this process, the correlation among genes is crucial to determine the specific functions of genes. Here, we propose a novel multi-dimensional stochastic approach to deal with the gene correlation phenomena. Interestingly, our stochastic framework suggests that the study of the gene correlation requires only one theoretical assumption-Markov property-and the experimental transition probability, which characterizes the gene correlation system. Finally, a gene expression experiment is proposed for future applications of the model
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Control of phospholipid flip-flop by transmembrane peptides
International Nuclear Information System (INIS)
Kaihara, Masanori; Nakao, Hiroyuki; Yokoyama, Hirokazu; Endo, Hitoshi; Ishihama, Yasushi; Handa, Tetsurou; Nakano, Minoru
2013-01-01
Highlights: ► Phospholipid flip-flop in transmembrane peptide-containing vesicles was investigated. ► Peptides that contained polar residues in the center of the transmembrane region promoted phospholipid flip-flop. ► A bioinformatics approach revealed the presence of polar residues in the transmembrane region of ER membrane proteins. ► Polar residues in ER membrane proteins possibly provide flippase-like activity. - Abstract: We designed three types of transmembrane model peptides whose sequence originates from a frequently used model peptide KALP23, and we investigated their effects on phospholipid flip-flop. Time-resolved small-angle neutron scattering and a dithionite fluorescent quenching assay demonstrated that TMP-L, which has a fully hydrophobic transmembrane region, did not enhance phospholipid flip-flop, whereas TMP-K and TMP-E, which have Lys and Glu, respectively, in the center of their transmembrane regions, enhanced phospholipid flip-flop. Introduction of polar residues in the membrane-spanning helices is considered to produce a locally polar region and enable the lipid head group to interact with the polar side-chain inside the bilayers, thereby reducing the activation energy for the flip-flop. A bioinformatics approach revealed that acidic and basic residues account for 4.5% of the central region of the transmembrane domain in human ER membrane proteins. Therefore, polar residues in ER membrane proteins are considered to provide flippase-like activity
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Multi-lipofection efficiently transfected genes into astrocytes in primary culture.
Wu, B Y; Liu, R Y; So, K L; Yu, A C
2000-10-30
This study demonstrated that liposome-mediated transfection - lipofection - is suitable for delivering genes into astrocytes. By repeatedly lipofecting the same astrocyte cultures, a process we call multi-lipofection, the transfection efficiency of the beta-galactosidase (beta-gal) gene was improved from 2.6+/-0.6 to 17. 4+/-1.1%. This is the highest efficiency ever reported in gene-transfer with Lipofectin(R) in a primary culture of mouse cerebral cortical astrocytes. Furthermore, multi-lipofection did not cause observable disturbance to astrocytes as indicated by insignificant changes in the glial fibrillary acidic protein content in the cultures. In order to demonstrate that the transfected gene achieved a physiologically relevant expression level, a plasmid containing the pEF-hsp70 protein gene was lipofected into astrocytes. This produced colonies of astrocytes showing an increased resistance to heat-induced cell death. A similar experiment was performed with the glial-derived neurotrophic factor (GDNF) gene. Control astrocytes had no detectable GDNF. In the transfected astrocytes, the GDNF protein could be identified intracellularly by immunocytochemistry. Western blot analysis revealed, as compared to astrocytes with one lipofection, a 2.9-fold increase of GDNF with four lipofections. GDNF remained detectable in astrocytes 2 weeks after four lipofections. Thus, multi-lipofection provides a mild and efficient means of delivering foreign genes into astrocytes in a primary culture, making astrocytes good candidate vehicle cells for gene/cell therapy in the CNS.
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Directory of Open Access Journals (Sweden)
Thea Bismo Strøm
2014-01-01
Full Text Available More than 1700 mutations in the low density lipoprotein receptor (LDLR gene have been found to cause familial hypercholesterolemia (FH. These are commonly divided into five classes based upon their effects on the structure and function of the LDLR. However, little is known about the mechanism by which mutations in the transmembrane domain of the LDLR gene cause FH. We have studied how the transmembrane mutation G805R affects the function of the LDLR. Based upon Western blot analyses of transfected HepG2 cells, mutation G805R reduced the amounts of the 120 kDa precursor LDLR in the endoplasmic reticulum. This led to reduced amounts of the mature 160 kDa LDLR at the cell surface. However, significant amounts of a secreted 140 kDa G805R-LDLR ectodomain fragment was observed in the culture media. Treatment of the cells with the metalloproteinase inhibitor batimastat largely restored the amounts of the 120 and 160 kDa forms in cell lysates, and prevented secretion of the 140 kDa ectodomain fragment. Together, these data indicate that a metalloproteinase cleaved the ectodomain of the 120 kDa precursor G805R-LDLR in the endoplasmic reticulum. It was the presence of the polar Arg805 and not the lack of Gly805 which led to ectodomain cleavage. Arg805 also prevented γ-secretase cleavage within the transmembrane domain. It is conceivable that introducing a charged residue within the hydrophobic membrane lipid bilayer, results in less efficient incorporation of the 120 kDa G805R-LDLR in the endoplasmic reticulum membrane and makes it a substrate for metalloproteinase cleavage.
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
Satheesh, Viswanathan; Chidambaranathan, Parameswaran; Jagannadham, Prasanth Tejkumar; Kumar, Vajinder; Jain, Pradeep K; Chinnusamy, Viswanathan; Bhat, Shripad R; Srinivasan, R
2016-01-01
Steroidogenic acute regulatory related transfer (StART) proteins that are involved in transport of lipid molecules, play a myriad of functions in insects, mammals and plants. These proteins consist of a modular START domain of approximately 200 amino acids which binds and transfers the lipids. In the present study we have performed a genome-wide search for all START domain proteins in chickpea. The search identified 36 chickpea genes belonging to the START domain family. Through a phylogenetic tree reconstructed with Arabidopsis, rice, chickpea, and soybean START proteins, we were able to identify four transmembrane START (TM-START) proteins in chickpea. These four proteins are homologous to the highly conserved mammalian phosphatidylcholine transfer proteins. Multiple sequence alignment of all the transmembrane containing START proteins from Arabidopsis, rice, chickpea, and soybean revealed that the amino acid residues to which phosphatidylcholine binds in mammals, is also conserved in all these plant species, implying an important functional role and a very similar mode of action of all these proteins across dicots and monocots. This study characterizes a few of the not so well studied transmembrane START superfamily genes that may be involved in stress signaling. Expression analysis in various tissues showed that these genes are predominantly expressed in flowers and roots of chickpea. Three of the chickpea TM-START genes showed induced expression in response to drought, salt, wound and heat stress, suggesting their role in stress response.
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
Ben-Eliezer, Noam; Solomon, Eddy; Harel, Elad; Nevo, Nava; Frydman, Lucio
2012-12-01
An approach has been recently introduced for acquiring arbitrary 2D NMR spectra or images in a single scan, based on the use of frequency-swept RF pulses for the sequential excitation and acquisition of the spins response. This spatiotemporal-encoding (SPEN) approach enables a unique, voxel-by-voxel refocusing of all frequency shifts in the sample, for all instants throughout the data acquisition. The present study investigates the use of this full-refocusing aspect of SPEN-based imaging in the multi-shot MRI of objects, subject to sizable field inhomogeneities that complicate conventional imaging approaches. 2D MRI experiments were performed at 7 T on phantoms and on mice in vivo, focusing on imaging in proximity to metallic objects. Fully refocused SPEN-based spin echo imaging sequences were implemented, using both Cartesian and back-projection trajectories, and compared with k-space encoded spin echo imaging schemes collected on identical samples under equal bandwidths and acquisition timing conditions. In all cases assayed, the fully refocused spatiotemporally encoded experiments evidenced a ca. 50 % reduction in signal dephasing in the proximity of the metal, as compared to analogous results stemming from the k-space encoded spin echo counterparts. The results in this study suggest that SPEN-based acquisition schemes carry the potential to overcome strong field inhomogeneities, of the kind that currently preclude high-field, high-resolution tissue characterizations in the neighborhood of metallic implants.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Singh, Arpita; Rella, Antonella; Schwacke, John; Vacchi-Suzzi, Caterina; Luberto, Chiara; Del Poeta, Maurizio
2015-11-16
disrupt transmembrane signaling complex, which in turn contributes to cryptococcal osmotic, pH, ion homeostasis and its pathobiology. Six genes identified from gene expression microarrays by gene set enrichment analysis and validated by RT-PCR, are membrane located and associated with the growth defect at neutral-alkaline pH due to the absence and or presence of a structurally modified GlcCer. They may be involved in the transmembrane signaling network in Cryptococcus neoformans, and therefore the pathobiology of the fungus in these conditions.
Directory of Open Access Journals (Sweden)
Yang Deming
2016-01-01
Full Text Available Domestic guinea pig is a model animal for human disease research. Uridine diphosphate glucuronosyltransferase 1 family, polypeptide A1 (UGT1A1 is an important human disease-related gene. In this study, the complete coding sequence of domestic guinea pig gene UGT1A1 was amplified by reverse transcription-polymerase chain reaction. The open reading frame of the domestic guinea pig UGT1A1 gene is 1602 bp in length and was found to encode a protein of 533 amino acids. Sequence analysis revealed that the UGT1A1 protein of domestic guinea pig shared high homology with the UGT1A1 proteins of degu (84%, damara mole-rat (84%, human (80%, northern white-cheeked gibbon (80%, Colobus angolensis palliatus (80% and golden snub-nosed monkey (79%. This gene contains five exons and four introns, as revealed by the computer-assisted analysis. The results also showed that the domestic guinea pig UGT1A1 gene had a close genetic relationship with the UGT1A1 gene of degu. The prediction of transmembrane helices showed that domestic guinea pig UGT1A1 might be a transmembrane protein. Expression profile analysis indicated that the domestic guinea pig UGT1A1 gene was differentially expressed in detected domestic guinea pig tissues. Our experiment laid a primary foundation for using the domestic guinea pig as a model animal to study the UGT1A1-related human diseases.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
Leu, Jiann-Horng; Liu, Kuan-Fu; Chen, Kuan-Yu; Chen, Shu-Hwa; Wang, Yu-Bin; Lin, Chung-Yen; Lo, Chu-Fang
2015-04-01
By microarray screening, we identified a white spot syndrome virus (WSSV)-strongly induced novel gene in gills of Penaeus monodon. The gene, PmERP15, encodes a putative transmembrane protein of 15 kDa, which only showed some degree of similarity (54-59%) to several unknown insect proteins, but had no hits to shrimp proteins. RT-PCR showed that PmERP15 was highly expressed in the hemocytes, heart and lymphoid organs, and that WSSV-induced strong expression of PmERP15 was evident in all tissues examined. Western blot analysis likewise showed that WSSV strongly up-regulated PmERP15 protein levels. In WSSV-infected hemocytes, immunofluorescence staining showed that PmERP15 protein was colocalized with an ER enzyme, protein disulfide isomerase, and in Sf9 insect cells, PmERP15-EGFP fusion protein colocalized with ER -Tracker™ Red dye as well. GRP78, an ER stress marker, was found to be up-regulated in WSSV-infected P. monodon, and both PmERP15 and GRP78 were up-regulated in shrimp injected with ER stress inducers tunicamycin and dithiothreitol. Silencing experiments showed that although PmERP15 dsRNA-injected shrimp succumbed to WSSV infection more rapidly, the WSSV copy number had no significant changes. These results suggest that PmERP15 is an ER stress-induced, ER resident protein, and its induction in WSSV-infected shrimp is caused by the ER stress triggered by WSSV infection. Furthermore, although PmERP15 has no role in WSSV multiplication, its presence is essential for the survival of WSSV-infected shrimp. Copyright © 2014 Elsevier Ltd. All rights reserved.
The transmembrane collagen COL-99 guides longitudinally extending axons in C. elegans.
Taylor, Jesse; Unsoeld, Thomas; Hutter, Harald
2018-06-01
We have identified the transmembrane collagen, COL-99, in a genetic screen for novel genes involved in axon guidance in the nematode C. elegans. COL-99 is similar to transmembrane collagens type XIII, XXIII and XXV in vertebrates. col-99 mutants exhibit guidance defects in axons extending along the major longitudinal axon tracts, most prominently the left ventral nerve cord (VNC). COL-99 is expressed in the hypodermis during the time of axon outgrowth. We provide evidence that a furin cleavage site in COL-99 is essential for function, suggesting that COL-99 is released from the cells producing it. Vertebrate homologs of COL-99 have been shown to be expressed in mammalian nervous systems and linked to various neurological disease but have not been associated with guidance of extending neurons. col-99 acts genetically with the discoidin domain receptors ddr-1 and ddr-2, which are expressed by neurons affected in col-99 mutants. Discoidin domain receptors are activated by collagens in vertebrates. DDR-1 and DDR-2 may function as receptors for COL-99. Our results establish a novel role for a transmembrane collagen in axonal guidance and asymmetry establishment of the VNC. Copyright © 2018 Elsevier Inc. All rights reserved.
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
Park, M; Costa, E L V; Maciel, A T; Barbosa, E V S; Hirota, A S; Schettino, G de P; Azevedo, L C P
2014-11-01
Transmembrane pressure drop reflects the resistance of an artificial lung system to blood transit. Decreased resistance (low transmembrane pressure drop) enhances blood flow through the oxygenator, thereby, enhancing gas exchange efficiency. This study is part of a previous one where we observed the behaviour and the modulation of blood pressure drop during the passage of blood through artificial lung membranes. Before and after the induction of multi-organ dysfunction, the animals were instrumented and analysed for venous-venous extracorporeal membrane oxygenation, using a pre-defined sequence of blood flows. Blood flow and revolutions per minute (RPM) of the centrifugal pump varied in a linear fashion. At a blood flow of 5.5 L/min, pre- and post-pump blood pressures reached -120 and 450 mmHg, respectively. Transmembrane pressures showed a significant spread, particularly at blood flows above 2 L/min; over the entire range of blood flow rates, there was a positive association of pressure drop with blood flow (0.005 mmHg/mL/minute of blood flow) and a negative association of pressure drop with temperature (-4.828 mmHg/(°Celsius). These associations were similar when blood flows of below and above 2000 mL/minute were examined. During its passage through the extracorporeal system, blood is exposed to pressure variations from -120 to 450 mmHg. At high blood flows (above 2 L/min), the drop in transmembrane pressure becomes unpredictable and highly variable. Over the entire range of blood flows investigated (0-5500 mL/min), the drop in transmembrane pressure was positively associated with blood flow and negatively associated with body temperature. © The Author(s) 2014.
Directory of Open Access Journals (Sweden)
Quadri Luis EN
2009-04-01
Full Text Available Abstract Background Cystic fibrosis (CF is caused by mutations in the cystic fibrosis transmembrane conductance regulator (CFTR gene. Infections of the respiratory tract are a hallmark in CF. The host immune responses in CF are not adequate to eradicate pathogens, such as P. aeruginosa. Dendritic cells (DC are crucial in initiation and regulation of immune responses. Changes in DC function could contribute to abnormal immune responses on multiple levels. The role of DC in CF lung disease remains unknown. Methods This study investigated the expression of CFTR gene in bone marrow-derived DC. We compared the differentiation and maturation profile of DC from CF and wild type (WT mice. We analyzed the gene expression levels in DC from naive CF and WT mice or following P. aeruginosa infection. Results CFTR is expressed in DC with lower level compared to lung tissue. DC from CF mice showed a delayed in the early phase of differentiation. Gene expression analysis in DC generated from naive CF and WT mice revealed decreased expression of Caveolin-1 (Cav1, a membrane lipid raft protein, in the CF DC compared to WT DC. Consistently, protein and activity levels of the sterol regulatory element binding protein (SREBP, a negative regulator of Cav1 expression, were increased in CF DC. Following exposure to P. aeruginosa, expression of 3β-hydroxysterol-Δ7 reductase (Dhcr7 and stearoyl-CoA desaturase 2 (Scd2, two enzymes involved in the lipid metabolism that are also regulated by SREBP, was less decreased in the CF DC compared to WT DC. Conclusion These results suggest that CFTR dysfunction in DC affects factors involved in membrane structure and lipid-metabolism, which may contribute to the abnormal inflammatory and immune response characteristic of CF.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Obif, a Transmembrane Protein, Is Required for Bone Mineralization and Spermatogenesis in Mice.
Directory of Open Access Journals (Sweden)
Koji Mizuhashi
Full Text Available Various kinds of transmembrane and secreted proteins play pivotal roles in development through cell-cell communication. We previously reported that Obif (Osteoblast induction factor, Tmem119, encoding a single transmembrane protein, is expressed in differentiating osteoblasts, and that Obif-/- mice exhibit significantly reduced bone volume in the femur. In the current study, we characterized the Obif protein and further investigated the biological phenotypes of a variety of tissues in Obif-/- mice.First, we found that O-glycosylation of the Obif protein occurs at serine residue 36 in the Obif extracellular domain. Next, we observed that Obif-/- mice exhibit bone dysplasia in association with significantly increased osteoid volume per osteoid surface (OV/OS and osteoid maturation time (Omt, and significantly decreased mineral apposition rate (MAR and bone formation rate per bone surface (BFR/BS. In addition, we observed that Obif-/- mice show a significant decrease in testis weight as well as in sperm number. By histological analysis, we found that Obif is expressed in spermatocytes and spermatids in the developing testis and that spermatogenesis is halted at the round spermatid stage in the Obif-/- testis that lacks sperm. However, the number of litters fathered by male mice was slightly reduced in Obif-/- mice compared with wild-type mice, although this was not statistically significant.Our results, taken together with previous observations, indicate that Obif is a type Ia transmembrane protein whose N-terminal region is O-glycosylated. In addition, we found that Obif is required for normal bone mineralization and late testicular differentiation in vivo. These findings suggest that Obif plays essential roles in the development of multiple tissues.
Obif, a Transmembrane Protein, Is Required for Bone Mineralization and Spermatogenesis in Mice.
Mizuhashi, Koji; Chaya, Taro; Kanamoto, Takashi; Omori, Yoshihiro; Furukawa, Takahisa
2015-01-01
Various kinds of transmembrane and secreted proteins play pivotal roles in development through cell-cell communication. We previously reported that Obif (Osteoblast induction factor, Tmem119), encoding a single transmembrane protein, is expressed in differentiating osteoblasts, and that Obif-/- mice exhibit significantly reduced bone volume in the femur. In the current study, we characterized the Obif protein and further investigated the biological phenotypes of a variety of tissues in Obif-/- mice. First, we found that O-glycosylation of the Obif protein occurs at serine residue 36 in the Obif extracellular domain. Next, we observed that Obif-/- mice exhibit bone dysplasia in association with significantly increased osteoid volume per osteoid surface (OV/OS) and osteoid maturation time (Omt), and significantly decreased mineral apposition rate (MAR) and bone formation rate per bone surface (BFR/BS). In addition, we observed that Obif-/- mice show a significant decrease in testis weight as well as in sperm number. By histological analysis, we found that Obif is expressed in spermatocytes and spermatids in the developing testis and that spermatogenesis is halted at the round spermatid stage in the Obif-/- testis that lacks sperm. However, the number of litters fathered by male mice was slightly reduced in Obif-/- mice compared with wild-type mice, although this was not statistically significant. Our results, taken together with previous observations, indicate that Obif is a type Ia transmembrane protein whose N-terminal region is O-glycosylated. In addition, we found that Obif is required for normal bone mineralization and late testicular differentiation in vivo. These findings suggest that Obif plays essential roles in the development of multiple tissues.
Directory of Open Access Journals (Sweden)
Ke Wu
2016-08-01
Full Text Available In recent years, a novel matching classification strategy inspired by the artificial deoxyribonucleic acid (DNA technology has been proposed for hyperspectral remote sensing imagery. Such a method can describe brightness and shape information of a spectrum by encoding the spectral curve into a DNA strand, providing a more comprehensive way for spectral similarity comparison. However, it suffers from two problems: data volume is amplified when all of the bands participate in the encoding procedure and full-band comparison degrades the importance of bands carrying key information. In this paper, a new multi-probe based artificial DNA encoding and matching (MADEM method is proposed. In this method, spectral signatures are first transformed into DNA code words with a spectral feature encoding operation. After that, multiple probes for interesting classes are extracted to represent the specific fragments of DNA strands. During the course of spectral matching, the different probes are compared to obtain the similarity of different types of land covers. By computing the absolute vector distance (AVD between different probes of an unclassified spectrum and the typical DNA code words from the database, the class property of each pixel is set as the minimum distance class. The main benefit of this strategy is that the risk of redundant bands can be deeply reduced and critical spectral discrepancies can be enlarged. Two hyperspectral image datasets were tested. Comparing with the other classification methods, the overall accuracy can be improved from 1.22% to 10.09% and 1.19% to 15.87%, respectively. Furthermore, the kappa coefficient can be improved from 2.05% to 15.29% and 1.35% to 19.59%, respectively. This demonstrated that the proposed algorithm outperformed other traditional classification methods.
Rep, M; Nooy, J; Guélin, E; Grivell, L A
1996-08-01
The AFG3 gene of Saccharomyces cerevisiae encodes a mitochondrial inner membrane protein with ATP-dependent protease activity. To gain more insight into the function of this protein, multi-copy suppressors of an afg3-null mutation were isolated. Three genes were found that restored partial growth on non-fermentable carbon sources, all of which affect the biogenesis of respiratory competent mitochondria: PIM1(LON) encodes a matrix-localized ATP-dependent protease involved in the turnover of matrix proteins; OXA1(PET1402) encodes a putative mitochondrial inner membrane protein involved in the biogenesis of the respiratory chain; and MBA1 encodes a mitochondrial protein required for optimal respiratory growth. All three genes also suppressed a null mutation in a related gene, RCA1, as well as in the combination of afg3- and rca1-null.
Institute of Scientific and Technical Information of China (English)
Xu Liu; Tiao-Tiao Liu; Wen-Wen Bai; Hu Yi; Shuang-Yan Li; Xin Tian
2013-01-01
Working memory plays an important role in human cognition.This study investigated how working memory was encoded by the power of multi-channel local field potentials (LFPs) based on sparse nonnegative matrix factorization (SNMF).SNMF was used to extract features from LFPs recorded from the prefrontal cortex of four Sprague-Dawley rats during a memory task in a Y maze,with 10 trials for each rat.Then the power-increased LFP components were selected as working memory-related features and the other components were removed.After that,the inverse operation of SNMF was used to study the encoding of working memory in the timefrequency domain.We demonstrated that theta and gamma power increased significantly during the working memory task.The results suggested that postsynaptic activity was simulated well by the sparse activity model.The theta and gamma bands were meaningful for encoding working memory.
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Allcock, Richard J N; Barrow, Alexander D; Forbes, Simon; Beck, Stephan; Trowsdale, John
2003-02-01
We have characterized a cluster of single immunoglobulin variable (IgV) domain receptors centromeric of the major histocompatibility complex (MHC) on human chromosome 6. In addition to triggering receptor expressed on myeloid cells (TREM)-1 and TREM2, the cluster contains NKp44, a triggering receptor whose expression is limited to NK cells. We identified three new related genes and two gene fragments within a cluster of approximately 200 kb. Two of the three new genes lack charged residues in their transmembrane domain tails. Further, one of the genes contains two potential immunotyrosine Inhibitory motifs in its cytoplasmic tail, suggesting that it delivers inhibitory signals. The human and mouse TREM clusters appear to have diverged such that there are unique sequences in each species. Finally, each gene in the TREM cluster was expressed in a different range of cell types.
Yin, Ling-Ling; Ruan, Su-Hong; Tian, Yu; Zhao, Kai; Xu, Kai Lin
2015-10-01
To clone the variable region genes of human anti-IL1RAP (IL-1 receptor accessory protein) monoclonal antibodies (McAb) and to construct IL1RAP chimeric antigen receptors (CARs). The VH and VL DNA of IL1RAP single chain antibodies were amplified by RACE and overlap extension PCR from total RNA extracted from 3H6E10 and 10D8A7 hybridoma and ligated into specific IL1RAP single-chain variable fragments (scFv). CD8α transmembrane domain, CD137 intracellular domain, TCR ζ chain, human CD8α signal peptide and scFv-anti-IL1RAP were cloned into plasmid LV-lac. Recombinant lentiviruses were generated by co-transfection of recombinant plasmid LV-lac, pMD2. G, and psPAX2 helper vectors into 293FT packing cells. The VH and VL genes of 2 human anti-IL1RAP McAb were acquired. The 3H6E10 VH and VL genes consisted of 402 bp and 393 bp encoding 134 and 131 aminoacid residues, respectively; 10D8A7 VH and VL genes consisted of 423 bp and 381 bp encoding 141 and 127 amine acid residues, respectively. Recombinant expression vertors LV-3H6E10 scFv-ICD and LV-10D8A7 scFv-ICD (ICD: CD8α transmembrane domain-CD137 intracellular domain-TCR ζ chain) were constructed. The target fragments were demonstrated by sequencing analysis. Recombinant plasmids were transfected into 293FT cells and lentiviral particles were acquired. Human anti-IL1RAP recombinant receptors are constructed successfully and lay a good foundation for the construction of IL1RAP-CAR killer T cell vaccine.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Directory of Open Access Journals (Sweden)
Iva Polakovicova
Full Text Available Non-T cell activation linker (NTAL; also called LAB or LAT2 is a transmembrane adaptor protein that is expressed in a subset of hematopoietic cells, including mast cells. There are conflicting reports on the role of NTAL in the high affinity immunoglobulin E receptor (FcεRI signaling. Studies carried out on mast cells derived from mice with NTAL knock out (KO and wild type mice suggested that NTAL is a negative regulator of FcεRI signaling, while experiments with RNAi-mediated NTAL knockdown (KD in human mast cells and rat basophilic leukemia cells suggested its positive regulatory role. To determine whether different methodologies of NTAL ablation (KO vs KD have different physiological consequences, we compared under well defined conditions FcεRI-mediated signaling events in mouse bone marrow-derived mast cells (BMMCs with NTAL KO or KD. BMMCs with both NTAL KO and KD exhibited enhanced degranulation, calcium mobilization, chemotaxis, tyrosine phosphorylation of LAT and ERK, and depolymerization of filamentous actin. These data provide clear evidence that NTAL is a negative regulator of FcεRI activation events in murine BMMCs, independently of possible compensatory developmental alterations. To gain further insight into the role of NTAL in mast cells, we examined the transcriptome profiles of resting and antigen-activated NTAL KO, NTAL KD, and corresponding control BMMCs. Through this analysis we identified several genes that were differentially regulated in nonactivated and antigen-activated NTAL-deficient cells, when compared to the corresponding control cells. Some of the genes seem to be involved in regulation of cholesterol-dependent events in antigen-mediated chemotaxis. The combined data indicate multiple regulatory roles of NTAL in gene expression and mast cell physiology.
DEFF Research Database (Denmark)
Becker, F.; Schnorr, K.; Wilting, R.
2004-01-01
To identify genes encoding extracytosolic proteins, a minitransposon, TnSig, containing a signal-less beta-lactamase ('bla) as reporter gene, was constructed and used for in vitro transposition of genomic libraries made in Escherichia coli. The 'bla gene was cloned into a bacteriophage MU...... minitransposon enabling translational fusions between 'bla and target genes. Fusion of TnSig in the correct reading frame to a protein carrying transmembrane domains or signal peptides resulted in ampicillin resistance of the corresponding clone. Prokaryotic gene libraries from the alkaliphilic bacterium...... Bacillus halodurans C125 and the hyperthermophilic archaeon Sulfolobus solfataricus P2 were tagged with TnSig. The genomic sequences, which are publicly available (EMBL BA000004 and EMBL AE006641), were used for rapid open reading frame (ORF) identification and prediction of protein localisation...
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Premraj, A; Aleyas, A G; Nautiyal, B; Rasool, T J
2013-10-01
The mechanism by which type I interferon-mediated antiviral response is mounted by hosts against invading pathogen is an intriguing one. Of late, an endoplasmic reticulum transmembrane protein encoded by a gene called stimulator of interferon genes (STING) is implicated in the innate signalling pathways and has been identified and cloned in few mammalian species including human, mouse and pig. In this article, we report the identification of STING from three different species of a highly conserved family of mammals - the camelids. cDNAs encoding the STING of Old World camels - dromedary camel (Camelus dromedarius) and bactrian camel (Camelus bactrianus) and a New World camel - llama (Llama glama) were amplified using conserved primers and RACE. The complete STING cDNA of dromedary camel is 2171 bp long with a 706-bp 5' untranslated regions (UTR), an 1137-bp open reading frame (ORF) and a 328-bp 3' UTR. Sequence and phylogenetic analysis of the ORF of STING from these three camelids indicate high level of similarity among camelids and conservation of critical amino acid residues across different species. Quantitative real-time PCR analysis revealed high levels of STING mRNA expression in blood, spleen, lymph node and lung. The identification of camelid STING will help in better understanding of the role of this molecule in the innate immunity of the camelids and other mammals. © 2013 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Kwang-Hyung Kim
2009-11-01
Full Text Available The regulation of intracellular levels of reactive oxygen species (ROS is critical for developmental differentiation and virulence of many pathogenic fungi. In this report we demonstrate that a novel transmembrane protein, TmpL, is necessary for regulation of intracellular ROS levels and tolerance to external ROS, and is required for infection of plants by the necrotroph Alternaria brassicicola and for infection of mammals by the human pathogen Aspergillus fumigatus. In both fungi, tmpL encodes a predicted hybrid membrane protein containing an AMP-binding domain, six putative transmembrane domains, and an experimentally-validated FAD/NAD(P-binding domain. Localization and gene expression analyses in A. brassicicola indicated that TmpL is associated with the Woronin body, a specialized peroxisome, and strongly expressed during conidiation and initial invasive growth in planta. A. brassicicola and A. fumigatus DeltatmpL strains exhibited abnormal conidiogenesis, accelerated aging, enhanced oxidative burst during conidiation, and hypersensitivity to oxidative stress when compared to wild-type or reconstituted strains. Moreover, A. brassicicola DeltatmpL strains, although capable of initial penetration, exhibited dramatically reduced invasive growth on Brassicas and Arabidopsis. Similarly, an A. fumigatus DeltatmpL mutant was dramatically less virulent than the wild-type and reconstituted strains in a murine model of invasive aspergillosis. Constitutive expression of the A. brassicicola yap1 ortholog in an A. brassicicola DeltatmpL strain resulted in high expression levels of genes associated with oxidative stress tolerance. Overexpression of yap1 in the DeltatmpL background complemented the majority of observed developmental phenotypic changes and partially restored virulence on plants. Yap1-GFP fusion strains utilizing the native yap1 promoter exhibited constitutive nuclear localization in the A. brassicicola DeltatmpL background. Collectively, we
Hidden markov model for the prediction of transmembrane proteins using MATLAB.
Chaturvedi, Navaneet; Shanker, Sudhanshu; Singh, Vinay Kumar; Sinha, Dhiraj; Pandey, Paras Nath
2011-01-01
Since membranous proteins play a key role in drug targeting therefore transmembrane proteins prediction is active and challenging area of biological sciences. Location based prediction of transmembrane proteins are significant for functional annotation of protein sequences. Hidden markov model based method was widely applied for transmembrane topology prediction. Here we have presented a revised and a better understanding model than an existing one for transmembrane protein prediction. Scripting on MATLAB was built and compiled for parameter estimation of model and applied this model on amino acid sequence to know the transmembrane and its adjacent locations. Estimated model of transmembrane topology was based on TMHMM model architecture. Only 7 super states are defined in the given dataset, which were converted to 96 states on the basis of their length in sequence. Accuracy of the prediction of model was observed about 74 %, is a good enough in the area of transmembrane topology prediction. Therefore we have concluded the hidden markov model plays crucial role in transmembrane helices prediction on MATLAB platform and it could also be useful for drug discovery strategy. The database is available for free at bioinfonavneet@gmail.comvinaysingh@bhu.ac.in.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Pirkmajer, Sergej; Kirchner, Henriette; Lundell, Leonidas S; Zelenin, Pavel V; Zierath, Juleen R; Makarova, Kira S; Wolf, Yuri I; Chibalin, Alexander V
2017-07-15
Small transmembrane proteins such as FXYDs, which interact with Na + ,K + -ATPase, and the micropeptides that interact with sarco/endoplasmic reticulum Ca 2+ -ATPase play fundamental roles in regulation of ion transport in vertebrates. Uncertain evolutionary origins and phylogenetic relationships among these regulators of ion transport have led to inconsistencies in their classification across vertebrate species, thus hampering comparative studies of their functions. We discovered the first FXYD homologue in sea lamprey, a basal jawless vertebrate, which suggests small transmembrane regulators of ion transport emerged early in the vertebrate lineage. We also identified 13 gene subfamilies of FXYDs and propose a revised, phylogeny-based FXYD classification that is consistent across vertebrate species. These findings provide an improved framework for investigating physiological and pathophysiological functions of small transmembrane regulators of ion transport. Small transmembrane proteins are important for regulation of cellular ion transport. The most prominent among these are members of the FXYD family (FXYD1-12), which regulate Na + ,K + -ATPase, and phospholamban, sarcolipin, myoregulin and DWORF, which regulate the sarco/endoplasmic reticulum Ca 2+ -ATPase (SERCA). FXYDs and regulators of SERCA are present in fishes, as well as terrestrial vertebrates; however, their evolutionary origins and phylogenetic relationships are obscure, thus hampering comparative physiological studies. Here we discovered that sea lamprey (Petromyzon marinus), a representative of extant jawless vertebrates (Cyclostomata), expresses an FXYD homologue, which strongly suggests that FXYDs predate the emergence of fishes and other jawed vertebrates (Gnathostomata). Using a combination of sequence-based phylogenetic analysis and conservation of local chromosome context, we determined that FXYDs markedly diversified in the lineages leading to cartilaginous fishes (Chondrichthyes) and bony
DEFF Research Database (Denmark)
Radjabova, Valeria; Mastroeni, Piero; Skjødt, Karsten
2015-01-01
We identified a novel, evolutionarily conserved receptor encoded within the human leukocyte receptor complex and syntenic region of mouse chromosome 7, named T cell-interacting, activating receptor on myeloid cells-1 (TARM1). The transmembrane region of TARM1 contained a conserved arginine residu...
DEFF Research Database (Denmark)
Koene, S; Rodenburg, R J; van der Knaap, M S
2012-01-01
cases and 126 from literature) with mutations in nuclear genes encoding structural complex I proteins or those involved in its assembly. Complex I deficiency caused by a nuclear gene defect is usually a non-dysmorphic syndrome, characterized by severe multi-system organ involvement and a poor prognosis...
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
Proteomic and Functional Analyses of the Virion Transmembrane Proteome of Cyprinid Herpesvirus 3.
Vancsok, Catherine; Peñaranda, M Michelle D; Raj, V Stalin; Leroy, Baptiste; Jazowiecka-Rakus, Joanna; Boutier, Maxime; Gao, Yuan; Wilkie, Gavin S; Suárez, Nicolás M; Wattiez, Ruddy; Gillet, Laurent; Davison, Andrew J; Vanderplasschen, Alain F C
2017-11-01
major findings were: (i) the FL strain encodes 16 virion transmembrane proteins; (ii) eight of these proteins are essential for viral growth in vitro ; (iii) seven of the nonessential proteins affect viral growth in vitro , and two affect virulence in vivo ; and (iv) a mutant lacking ORF25 is highly attenuated but induces moderate immune protection. This study represents a major breakthrough in understanding the biology of CyHV-3 and will contribute to the development of prophylactic methods. It also provides a firm basis for the further research on alloherpesvirus virion transmembrane proteins. Copyright © 2017 Vancsok et al.
Kihara, A; Akiyama, Y; Ito, K
1997-05-27
The cII gene product of bacteriophage lambda is unstable and required for the establishment of lysogenization. Its intracellular amount is important for the decision between lytic growth and lysogenization. Two genetic loci of Escherichia coli are crucial for these commitments of infecting lambda genome. One of them, hflA encodes the HflKC membrane protein complex, which has been believed to be a protease degrading the cII protein. However, both its absence and overproduction stabilized cII in vivo and the proposed serine protease-like sequence motif in HflC was dispensable for the lysogenization control. Moreover, the HflKC protein was found to reside on the periplasmic side of the plasma membrane. In contrast, the other host gene, ftsH (hflB) encoding an integral membrane ATPase/protease, is positively required for degradation of cII, since loss of its function stabilized cII and its overexpression accelerated the cII degradation. In vitro, purified FtsH catalyzed ATP-dependent proteolysis of cII and HflKC antagonized the FtsH action. These results, together with our previous finding that FtsH and HflKC form a complex, suggest that FtsH is the cII degrading protease and HflKC is a modulator of the FtsH function. We propose that this transmembrane modulation differentiates the FtsH actions to different substrate proteins such as the membrane-bound SecY protein and the cytosolic cII protein. This study necessitates a revision of the prevailing view about the host control over lambda lysogenic decision.
International Nuclear Information System (INIS)
Kudo, Shinichi; Fukuda, Minoru
1989-01-01
Glycophorins A (GPA) and B (GPB) are two major sialoglycoproteins of the human erythrocyte membrane. Here the authors present a comparison of the genomic structures of GPA and GPB developed by analyzing DNA clones isolated from a K562 genomic library. Nucleotide sequences of exon-intron junctions and 5' and 3' flanking sequences revealed that the GPA and GPB genes consist of 7 and 5 exons, respectively, and both genes have >95% identical sequence from the 5' flanking region to the region ∼ 1 kilobase downstream from the exon encoding the transmembrane regions. In this homologous part of the genes, GPB lacks one exon due to a point mutation at the 5' splicing site of the third intron, which inactivates the 5' cleavage event of splicing and leads to ligation of the second to the fourth exon. Following these very homologous sequences, the genomic sequences for GPA and GPB diverge significantly and no homology can be detected in their 3' end sequences. The analysis of the Alu sequences and their flanking direct repeat sequences suggest that an ancestral genomic structure has been maintained in the GPA gene, whereas the GPB gene has arisen from the acquisition of 3' sequences different from those of the GPA gene by homologous recombination at the Alu repeats during or after gene duplication
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Teixeira, Monica C; Carvalho, Isabel S; Brodelius, Maria
2010-02-10
Two full-length cDNA clones PoleFAD7 and PoleFAD8, encoding plastidial omega-3 fatty acid desaturases were isolated from purslane (Portulaca oleracea). The encoded enzymes convert linoleic to alpha-linolenic acid (C18:3n-3). Three histidine clusters characteristic of fatty acid desaturases, a putative chloroplast transit peptide in the N-terminal, and three putative transmembrane domains were identified in the sequence. Both genes were expressed in all analyzed tissues showing different levels of expression. PoleFAD7 was up-regulated by wounding but not by low temperature. PoleFAD8 was up-regulated by cold stress but not by wounding. Total fatty acid and linolenic acid content were higher both, in wounded and intact leaves of plants exposed to low temperature.
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Eaton, T E; Weiner Miller, P; Garrett, J E; Cutting, G R
2002-05-01
Previous work suggests that cystic fibrosis transmembrane conductance regulator (CFTR) gene mutations may be implicated in the aetiology of allergic bronchopulmonary aspergilosis (ABPA). To compare the frequency of CF gene mutations in asthmatics with ABPA of varying severity with asthmatics who were skin prick test (SPT)-positive to Aspergillus fumigatus (Af) without evidence of ABPA and asthmatics SPT-negative to Af. Thirty-one Caucasian patients with ABPA were identified, together with asthmatics SPT positive to Af without evidence of ABPA (n = 23) and SPT negative to Af (n = 28). Genomic DNA was tested for 16 CF mutations accounting for approximately 85% of CF alleles in Caucasian New Zealanders. Four (12.9%) ABPA patients were found to be carriers of a CF mutation (DeltaF508 n = 3, R117H n = 1), one (4.3%) asthmatic SPT positive to Af without ABPA (DeltaF508), and one (3.6%) asthmatic SPT negative to Af (R117H). All patients with a CF mutation had normal sweat chloride (< 40 mM). There was no significant difference between the frequency of CF mutations in the ABPA patients and asthmatics without ABPA. However, the frequency of CF mutations in the ABPA patients was significantly different (P = 0.0125) to the expected carrier rate in the general population. These results lend further support to a possible link between CF mutations and ABPA.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Cloning and bioinformatics analysis of CcPILS gene of Hickory (Carya cathayensis)
Guo, Wenbin; Yuan, Huwei; Gao, Liuxiao; Guo, Haipeng; Qiu, Lingling; Xu, Dongbin; Yan, Daoliang; Zheng, Bingsong
2017-04-01
PILS is a key auxin efflux carrier protein in the auxin signal transduction. A CcPILS gene related to hickory (Carya carthayensis) grafting process was obtained by RACE techniques. The full length of CcPILS gene was1541bp contained a 1263bp length open reading flame (ORF). The CcPILS encoded 294 amino acids with molecular weight of 46 kDa, PI 5.38 and localized at endoplasmic reticulum membrane. The gene contained a central hydrophilic loop separating two hydrophobic domains of about five transmembrane regions each. The gene of CcPILS belonged to Clade III sub-family of PILS and its sequence had high homology with Arabidopsis. Real Time RT-PCR analysis showed that the gene expressions were weakly induced in bud, inflorescence, fruit, leaf and stem, while strongly in root. The expression levels were strongly induced and reached a peak at the third day of grafting in scion and rootstock of hickory, which were 1.45 and 3.45 times higher, respectively, compared to that of control. The results indicated that CcPILS may be involved in regulating the expression of genes related to auxin signal transduction during hickory graft process.
Gene number determination and genetic polymorphism of the gamma delta T cell co-receptor WC1 genes
Directory of Open Access Journals (Sweden)
Chen Chuang
2012-10-01
Full Text Available Abstract Background WC1 co-receptors belong to the scavenger receptor cysteine-rich (SRCR superfamily and are encoded by a multi-gene family. Expression of particular WC1 genes defines functional subpopulations of WC1+ γδ T cells. We have previously identified partial or complete genomic sequences for thirteen different WC1 genes through annotation of the bovine genome Btau_3.1 build. We also identified two WC1 cDNA sequences from other cattle that did not correspond to sequences in the Btau_3.1 build. Their absence in the Btau_3.1 build may have reflected gaps in the genome assembly or polymorphisms among animals. Since the response of γδ T cells to bacterial challenge is determined by WC1 gene expression, it was critical to understand whether individual cattle or breeds differ in the number of WC1 genes or display polymorphisms. Results Real-time quantitative PCR using DNA from the animal whose genome was sequenced (“Dominette” and sixteen other animals representing ten breeds of cattle, showed that the number of genes coding for WC1 co-receptors is thirteen. The complete coding sequences of those thirteen WC1 genes is presented, including the correction of an error in the WC1-2 gene due to mis-assembly in the Btau_3.1 build. All other cDNA sequences were found to agree with the previous annotation of complete or partial WC1 genes. PCR amplification and sequencing of the most variable N-terminal SRCR domain (domain 1 which has the SRCR “a” pattern of each of the thirteen WC1 genes showed that the sequences are highly conserved among individuals and breeds. Of 160 sequences of domain 1 from three breeds of cattle, no additional sequences beyond the thirteen described WC1 genes were found. Analysis of the complete WC1 cDNA sequences indicated that the thirteen WC1 genes code for three distinct WC1 molecular forms. Conclusion The bovine WC1 multi-gene family is composed of thirteen genes coding for three structural forms whose
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
Rapid evolution of the sequences and gene repertoires of secreted proteins in bacteria.
Directory of Open Access Journals (Sweden)
Teresa Nogueira
Full Text Available Proteins secreted to the extracellular environment or to the periphery of the cell envelope, the secretome, play essential roles in foraging, antagonistic and mutualistic interactions. We hypothesize that arms races, genetic conflicts and varying selective pressures should lead to the rapid change of sequences and gene repertoires of the secretome. The analysis of 42 bacterial pan-genomes shows that secreted, and especially extracellular proteins, are predominantly encoded in the accessory genome, i.e. among genes not ubiquitous within the clade. Genes encoding outer membrane proteins might engage more frequently in intra-chromosomal gene conversion because they are more often in multi-genic families. The gene sequences encoding the secretome evolve faster than the rest of the genome and in particular at non-synonymous positions. Cell wall proteins in Firmicutes evolve particularly fast when compared with outer membrane proteins of Proteobacteria. Virulence factors are over-represented in the secretome, notably in outer membrane proteins, but cell localization explains more of the variance in substitution rates and gene repertoires than sequence homology to known virulence factors. Accordingly, the repertoires and sequences of the genes encoding the secretome change fast in the clades of obligatory and facultative pathogens and also in the clades of mutualists and free-living bacteria. Our study shows that cell localization shapes genome evolution. In agreement with our hypothesis, the repertoires and the sequences of genes encoding secreted proteins evolve fast. The particularly rapid change of extracellular proteins suggests that these public goods are key players in bacterial adaptation.
Evaluation of methylation pattern in promoter region of E-cadherin ...
African Journals Online (AJOL)
The epithelial cadherin gene (CDH1) has been identified as a tumor suppressor gene located within the 16q22.1 region. The CDH1 gene encodes a transmembrane glycoprotein involved in cell to cell adhesion and loss of CDH1 expression contributes to increased proliferation, invasion and metastasis in breast carcinoma.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
Directory of Open Access Journals (Sweden)
Vargas-Alarcon Gilberto
2012-02-01
Full Text Available Abstract Background A consistent line of investigation suggests that autonomic nervous system dysfunction may explain the multi-system features of fibromyalgia (FM; and that FM is a sympathetically maintained neuropathic pain syndrome. Dorsal root ganglia (DRG are key sympathetic-nociceptive short-circuit sites. Sodium channels located in DRG (particularly Nav1.7 act as molecular gatekeepers for pain detection. Nav1.7 is encoded in gene SCN9A of chromosome 2q24.3 and is predominantly expressed in the DRG pain-sensing neurons and sympathetic ganglia neurons. Several SCN9A sodium channelopathies have been recognized as the cause of rare painful dysautonomic syndromes such as paroxysmal extreme pain disorder and primary erythromelalgia. The aim of this study was to search for an association between fibromyalgia and several SCN9A sodium channels gene polymorphisms. Methods We studied 73 Mexican women suffering from FM and 48 age-matched women who considered themselves healthy. All participants filled out the Fibromyalgia Impact Questionnaire (FIQ. Genomic DNA from whole blood containing EDTA was extracted by standard techniques. The following SCN9A single-nucleotide polymorphisms (SNP were determined by 5' exonuclease TaqMan assays: rs4371369; rs4387806; rs4453709; rs4597545; rs6746030; rs6754031; rs7607967; rs12620053; rs12994338; and rs13017637. Results The frequency of the rs6754031 polymorphism was significantly different in both groups (P = 0.036 mostly due to an absence of the GG genotype in controls. Interestingly; patients with this rs6754031 GG genotype had higher FIQ scores (median = 80; percentile 25/75 = 69/88 than patients with the GT genotype (median = 63; percentile 25/75 = 58/73; P = 0.002 and the TT genotype (median = 71; percentile 25/75 = 64/77; P = 0.001. Conclusion In this ethnic group; a disabling form of FM is associated to a particular SCN9A sodium channel gene variant. These preliminary results raise the possibility that
Fields, Randall R.; Zhou, Guimei; Huang, Dali; Davis, Jack R.; Möller, Claes; Jacobson, Samuel G.; Kimberling, William J.; Sumegi, Janos
2002-01-01
Usher syndrome type III is an autosomal recessive disorder characterized by progressive sensorineural hearing loss, vestibular dysfunction, and retinitis pigmentosa. The disease gene was localized to 3q25 and recently was identified by positional cloning. In the present study, we have revised the structure of the USH3 gene, including a new translation start site, 5′ untranslated region, and a transcript encoding a 232–amino acid protein. The mature form of the protein is predicted to contain three transmembrane domains and 204 residues. We have found four new disease-causing mutations, including one that appears to be relatively common in the Ashkenazi Jewish population. We have also identified mouse (chromosome 3) and rat (chromosome 2) orthologues, as well as two human paralogues on chromosomes 4 and 10. PMID:12145752
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
Hoorn, Van der R.A.L.; Roth, R.; Wit, De P.J.G.M.
2001-01-01
The tomato resistance genes Cf-4 and Cf-9 confer specific, hypersensitive response-associated recognition of Cladosporium carrying the avirulence genes Avr4 and Avr9, respectively. Cf-4 and Cf-9 encode type I transmembrane proteins with extracellular leucine-rich repeats (LRRs). Compared with Cf-9,
Transmembrane amyloid-related proteins in CSF as potential biomarkers for Alzheimer’s disease
Directory of Open Access Journals (Sweden)
Inmaculada eLopez-Font
2015-06-01
Full Text Available In the continuing search for new cerebrospinal fluid (CSF biomarkers for Alzheimer’s disease (AD, reasonable candidates are the secretase enzymes involved in the processing of the amyloid precursor protein (APP, as well as the large proteolytic cleavage fragments sAPPα and sAPPβ. The enzymatic activities of some of these secretases, such as BACE1 and TACE, have been investigated as potential AD biomarkers, and it has been assumed that these activities present in human CSF result from the soluble truncated forms of the membrane-bound enzymes. However, we and others recently identified soluble forms of BACE1 and APP in CSF containing the intracellular domains, as well as the multi-pass transmembrane presenilin-1 (PS1 and other subunits of γ-secretase. We also review recent findings that suggest that most of these soluble transmembrane proteins could display self-association properties based on hydrophobic and/or ionic interactions leading to the formation of heteromeric complexes. The oligomerization state of these potential new biomarkers needs to be taken into consideration for assessing their real potential as CSF biomarkers for AD by adequate molecular tools.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Directory of Open Access Journals (Sweden)
Oghenetega J. Avwioroko
2018-07-01
Full Text Available In this investigation, a gene (CDF_Amyl encoding extracellular α-amylase in Aspergillus niger strain CSA35 associated with cassava spoilage was amplified using specific primers and characterized in silico. The gene had a partial nucleotide sequence of 968 bp and encoded a protein of 222 aa residues with a molecular weight and isoelectric point of 25.13 kDa and 4.17, respectively. Its catalytic site was located in the active site domain. BLASTp analysis showed that the protein primary sequence of the α-amylase gene had 98% and 99% homologies with the α-amylase of A. niger and A. oryzae RIB40, respectively. The gene is more closely related to α-amylase genes from fungi than to bacterial, plant, or animal α-amylase genes. Restriction mapping of the gene showed it can be digested with restriction enzymes like NcoI, PstI, SmaI, and BcLI among others but not with EcoRI and EcoRV. Its protein product had a hydrophobicity score of − 0.43 but no transmembrane helix. The CDF_Amyl protein was subcellularly localized in the secretory pathway, an indication of its release into extracellular space after secretion. Also, the 3D structure of the CDF-Amyl protein was barrel-shaped with domains characteristic of α-amylases. The encoded α-amylase Vmax is 6.90 U/mg protein and Km is 6.70 mg/ml. It was concluded that the unique characteristics of the CDF_Amyl gene and its deduced protein could find applications in biotechnological, food and pharmaceutical industries where cloning and further modification of this gene would be required for product development and improvement.
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
Energy Technology Data Exchange (ETDEWEB)
Sarkan, M; Mikusova, K; Kordulakova, J [Univerzita Komenskeho v Bratislave, Prirodovedecka fakulta, Katedra biochemie, 84215 Bratislava (Slovakia)
2012-04-25
The bacterium Mycobacterium tuberculosis - the originator of tuberculosis in humans - is characterized by a complex cell wall, which is responsible for a high bacteria resistant to adverse external environmental conditions, as well as to the common antibiotics. The structure of the cell wall components and enzymes involved into its biosynthesis are relatively well described, but there is no information on the transfer of intermediate products of its biosynthetic across the plasmatic membrane. Orthologues of genes rv1459c-rv1458c-rv1457c-rv1456c of M. tuberculosis are in the same configuration in genomes of all previously sequenced mycobacterial strains. Rv1459c gene encodes a probable glycosyltransferases and genes rv1458c, rv1457c rv1456c code nucleotide binding and transmembrane subunits of expected ABC transporter. In our work we focused on the study of the function of expected ABC transporter Rv1458c-Rv1457c-Rv1456c, through analysis of phenotypes of strains M. Smegmatis. They have orthologues of genes encoding the transmembrane subunits of this transporter suspended by fragment encoding resistance to kanamycin. (authors)
Directory of Open Access Journals (Sweden)
Suomeng Dong
Full Text Available Root and stem rot disease of soybean is caused by the oomycete Phytophthora sojae. The avirulence (Avr genes of P. sojae control race-cultivar compatibility. In this study, we identify the P. sojae Avr3c gene and show that it encodes a predicted RXLR effector protein of 220 amino acids. Sequence and transcriptional data were compared for predicted RXLR effectors occurring in the vicinity of Avr4/6, as genetic linkage of Avr3c and Avr4/6 was previously suggested. Mapping of DNA markers in a F(2 population was performed to determine whether selected RXLR effector genes co-segregate with the Avr3c phenotype. The results pointed to one RXLR candidate gene as likely to encode Avr3c. This was verified by testing selected genes by a co-bombardment assay on soybean plants with Rps3c, thus demonstrating functionality and confirming the identity of Avr3c. The Avr3c gene together with eight other predicted genes are part of a repetitive segment of 33.7 kb. Three near-identical copies of this segment occur in a tandem array. In P. sojae strain P6497, two identical copies of Avr3c occur within the repeated segments whereas the third copy of this RXLR effector has diverged in sequence. The Avr3c gene is expressed during the early stages of infection in all P. sojae strains examined. Virulent alleles of Avr3c that differ in amino acid sequence were identified in other strains of P. sojae. Gain of virulence was acquired through mutation and subsequent sequence exchanges between the two copies of Avr3c. The results illustrate the importance of segmental duplications and RXLR effector evolution in the control of race-cultivar compatibility in the P. sojae and soybean interaction.
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Inferring species trees from incongruent multi-copy gene trees using the Robinson-Foulds distance
2013-01-01
Background Constructing species trees from multi-copy gene trees remains a challenging problem in phylogenetics. One difficulty is that the underlying genes can be incongruent due to evolutionary processes such as gene duplication and loss, deep coalescence, or lateral gene transfer. Gene tree estimation errors may further exacerbate the difficulties of species tree estimation. Results We present a new approach for inferring species trees from incongruent multi-copy gene trees that is based on a generalization of the Robinson-Foulds (RF) distance measure to multi-labeled trees (mul-trees). We prove that it is NP-hard to compute the RF distance between two mul-trees; however, it is easy to calculate this distance between a mul-tree and a singly-labeled species tree. Motivated by this, we formulate the RF problem for mul-trees (MulRF) as follows: Given a collection of multi-copy gene trees, find a singly-labeled species tree that minimizes the total RF distance from the input mul-trees. We develop and implement a fast SPR-based heuristic algorithm for the NP-hard MulRF problem. We compare the performance of the MulRF method (available at http://genome.cs.iastate.edu/CBL/MulRF/) with several gene tree parsimony approaches using gene tree simulations that incorporate gene tree error, gene duplications and losses, and/or lateral transfer. The MulRF method produces more accurate species trees than gene tree parsimony approaches. We also demonstrate that the MulRF method infers in minutes a credible plant species tree from a collection of nearly 2,000 gene trees. Conclusions Our new phylogenetic inference method, based on a generalized RF distance, makes it possible to quickly estimate species trees from large genomic data sets. Since the MulRF method, unlike gene tree parsimony, is based on a generic tree distance measure, it is appealing for analyses of genomic data sets, in which many processes such as deep coalescence, recombination, gene duplication and losses as
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Proteins containing the UBA domain are able to bind to multi-ubiquitin chains
DEFF Research Database (Denmark)
Wilkinson, C R; Seeger, M; Hartmann-Petersen, R
2001-01-01
The UBA domain is a motif found in a variety of proteins, some of which are associated with the ubiquitin-proteasome system. We describe the isolation of a fission-yeast gene, mud1+, which encodes a UBA domain containing protein that is able to bind multi-ubiquitin chains. We show that the UBA do...
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
Morera, Francisco J.; Alioua, Abderrahmane; Kundu, Pallob; Salazar, Marcelo; Gonzalez, Carlos; Martinez, Agustin D.; Stefani, Enrico; Toro, Ligia; Latorre, Ramon
2012-01-01
The BK channel is one of the most broadly expressed ion channels in mammals. In many tissues, the BK channel pore-forming α-subunit is associated to an auxiliary β-subunit that modulates the voltage- and Ca2+-dependent activation of the channel. Structural components present in β-subunits that are important for the physical association with the α-subunit are yet unknown. Here, we show through co-immunoprecipitation that the intracellular C-terminus, the second transmembrane domain (TM2) and the extracellular loop of the β2-subunit are dispensable for association with the α-subunit pointing transmembrane domain 1 (TM1) as responsible for the interaction. Indeed, the TOXCAT assay for transmembrane protein–protein interactions demonstrated for the first time that TM1 of the β2-subunit physically binds to the transmembrane S1 domain of the α-subunit. PMID:22710124
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Directory of Open Access Journals (Sweden)
Shiteshu Shrimal
Full Text Available Entamoeba histolytica transmembrane kinases (EhTMKs can be grouped into six distinct families on the basis of motifs and sequences. Analysis of the E. histolytica genome revealed the presence of 35 EhTMKB1 members on the basis of sequence identity (>or=95%. Only six homologs were full length containing an extracellular domain, a transmembrane segment and an intracellular kinase domain. Reverse transcription followed by polymerase chain reaction (RT-PCR of the kinase domain was used to generate a library of expressed sequences. Sequencing of randomly picked clones from this library revealed that about 95% of the clones were identical with a single member, EhTMKB1-9, in proliferating cells. On serum starvation, the relative number of EhTMKB1-9 derived sequences decreased with concomitant increase in the sequences derived from another member, EhTMKB1-18. The change in their relative expression was quantified by real time PCR. Northern analysis and RNase protection assay were used to study the temporal nature of EhTMKB1-9 expression after serum replenishment of starved cells. The results showed that the expression of EhTMKB1-9 was sinusoidal. Specific transcriptional induction of EhTMKB1-9 upon serum replenishment was further confirmed by reporter gene (luciferase expression and the upstream sequence responsible for serum responsiveness was identified. EhTMKB1-9 is one of the first examples of an inducible gene in Entamoeba. The protein encoded by this member was functionally characterized. The recombinant kinase domain of EhTMKB1-9 displayed protein kinase activity. It is likely to have dual specificity as judged from its sensitivity to different kinase inhibitors. Immuno-localization showed EhTMKB1-9 to be a surface protein which decreased on serum starvation and got relocalized on serum replenishment. Cell lines expressing either EhTMKB1-9 without kinase domain, or EhTMKB1-9 antisense RNA, showed decreased cellular proliferation and target cell
Buonocore, Linda; Blight, Keril J.; Rice, Charles M.; Rose, John K.
2002-01-01
We generated recombinant vesicular stomatitis viruses (VSV) expressing genes encoding hybrid proteins consisting of the extracellular domains of hepatitis C virus (HCV) glycoproteins fused at different positions to the transmembrane and cytoplasmic domains of the VSV G glycoprotein (E1G and E2G). We show that these chimeric proteins are transported to the cell surface and incorporated into VSV virions efficiently. We also generated VSV recombinants in which the gene encoding the VSV G protein...
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Mahmoud Shekari khaniani1, 2 Aziz Khorrami1, 2 Mandana ...
Indian Academy of Sciences (India)
Navya
2 Department of Medical Genetics, School of Medicine, Tabriz University of ... deficiency they are classified into 10 major types (Mundy et al. 2004) ... The gene encodes a hydrophobic protein containing 357 amino acids and 9 transmembrane.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Research Advances in CKLFSF-like MARVEL Transmembrane Domain Containing Member 3.
Hu, Feng-zhan; Sheng, Zheng-zuo; Qin, Cai-peng; Xu, Tao
2016-06-10
CKLF-like MARVEL transmembrane domain containing member/chemokine-like factor super family member (CKLFSF/CMTM) is a novel tumor suppressor gene. CMTM3 is broadly expressed in normal human tissues and evolutionary conserved,especially in testis,spleen,and some cells of peripheral blood mononuclear cells. However,its expression is undetectable or down-regulated in most carcinoma cell lines and tissues. Restoration of CMTM3 may inhibit the proliferation,migration,and invasion of carcinoma cells. Although the exact mechanism of its anti-tumor activity remains unclear,CKLFSF3/CMTM3 is closely connected with immune system and associated with sex during tumorigenesis. The study advances of CKLFSF3/CMTM3 are elaborated in this review as CMTM3 may be a new target in the gene therapies for tumors,especially genitourinary tumors,while further studies on CMTM3 and its anti-tumor mechanisms are warranted.
Directory of Open Access Journals (Sweden)
Kazuhisa Honma
Full Text Available Mouse artificial chromosome (MAC vectors have several advantages as gene delivery vectors, such as stable and independent maintenance in host cells without integration, transferability from donor cells to recipient cells via microcell-mediated chromosome transfer (MMCT, and the potential for loading a megabase-sized DNA fragment. Previously, a MAC containing a multi-integrase platform (MI-MAC was developed to facilitate the transfer of multiple genes into desired cells. Although the MI system can theoretically hold five gene-loading vectors (GLVs, there are a limited number of drugs available for the selection of multiple-GLV integration. To overcome this issue, we attempted to knock out and reuse drug resistance genes (DRGs using the CRISPR-Cas9 system. In this study, we developed new methods for multiple-GLV integration. As a proof of concept, we introduced five GLVs in the MI-MAC by these methods, in which each GLV contained a gene encoding a fluorescent or luminescent protein (EGFP, mCherry, BFP, Eluc, and Cluc. Genes of interest (GOI on the MI-MAC were expressed stably and functionally without silencing in the host cells. Furthermore, the MI-MAC carrying five GLVs was transferred to other cells by MMCT, and the resultant recipient cells exhibited all five fluorescence/luminescence signals. Thus, the MI-MAC was successfully used as a multiple-GLV integration vector using the CRISPR-Cas9 system. The MI-MAC employing these methods may resolve bottlenecks in developing multiple-gene humanized models, multiple-gene monitoring models, disease models, reprogramming, and inducible gene expression systems.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Directory of Open Access Journals (Sweden)
M. Ananda Chitra
2015-07-01
Full Text Available Background: Staphylococcus pseudintermedius (SP is the major pathogenic species of dogs involved in a wide variety of skin and soft tissue infections. The accessory gene regulator (agr locus of Staphylococcus aureus has been extensively studied, and it influences the expression of many virulence genes. It encodes a two-component signal transduction system that leads to down-regulation of surface proteins and up-regulation of secreted proteins during in vitro growth of S. aureus. The objective of this study was to detect and sequence analyzing the AgrA, B, and D of SP isolated from canine skin infections. Materials and Methods: In this study, we have isolated and identified SP from canine pyoderma and otitis cases by polymerase chain reaction (PCR and confirmed by PCR-restriction fragment length polymorphism. Primers for SP agrA and agrBD genes were designed using online primer designing software and BLAST searched for its specificity. Amplification of the agr genes was carried out for 53 isolates of SP by PCR and sequencing of agrA, B, and D were carried out for five isolates and analyzed using DNAstar and Mega5.2 software. Results: A total of 53 (59% SP isolates were obtained from 90 samples. 15 isolates (28% were confirmed to be methicillinresistant SP (MRSP with the detection of the mecA gene. Accessory gene regulator A, B, and D genes were detected in all the SP isolates. Complete nucleotide sequences of the above three genes for five isolates were submitted to GenBank, and their accession numbers are from KJ133557 to KJ133571. AgrA amino acid sequence analysis showed that it is mainly made of alpha-helices and is hydrophilic in nature. AgrB is a transmembrane protein, and AgrD encodes the precursor of the autoinducing peptide (AIP. Sequencing of the agrD gene revealed that the 5 canine SP strains tested could be divided into three Agr specificity groups (RIPTSTGFF, KIPTSTGFF, and RIPISTGFF based on the putative AIP produced by each strain
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Litman Gary W
2008-06-01
Full Text Available Abstract Background Novel immune-type receptor (NITR genes are members of diversified multigene families that are found in bony fish and encode type I transmembrane proteins containing one or two extracellular immunoglobulin (Ig domains. The majority of NITRs can be classified as inhibitory receptors that possess cytoplasmic immunoreceptor tyrosine-based inhibition motifs (ITIMs. A much smaller number of NITRs can be classified as activating receptors by the lack of cytoplasmic ITIMs and presence of a positively charged residue within their transmembrane domain, which permits partnering with an activating adaptor protein. Results Forty-four NITR genes in medaka (Oryzias latipes are located in three gene clusters on chromosomes 10, 18 and 21 and can be organized into 24 families including inhibitory and activating forms. The particularly large dataset acquired in medaka makes direct comparison possible to another complete dataset acquired in zebrafish in which NITRs are localized in two clusters on different chromosomes. The two largest medaka NITR gene clusters share conserved synteny with the two zebrafish NITR gene clusters. Shared synteny between NITRs and CD8A/CD8B is limited but consistent with a potential common ancestry. Conclusion Comprehensive phylogenetic analyses between the complete datasets of NITRs from medaka and zebrafish indicate multiple species-specific expansions of different families of NITRs. The patterns of sequence variation among gene family members are consistent with recent birth-and-death events. Similar effects have been observed with mammalian immunoglobulin (Ig, T cell antigen receptor (TCR and killer cell immunoglobulin-like receptor (KIR genes. NITRs likely diverged along an independent pathway from that of the somatically rearranging antigen binding receptors but have undergone parallel evolution of V family diversity.
[HER2 gene amplification assay: is CISH an alternative to FISH?].
Denoux, Yves; Arnould, Laurent; Fiche, Maryse; Lannes, B; Couturier, Jérôme; Vincent-Salomon, Anne; Penault-Llorca, Frédérique; Antoine, M; Balaton, A; Baranzelli, M C; Becette, V; Bellocq, J P; Bibeau, F; Ettore, F; Fridman, V; Gnassia, J P; Jacquemier, J; MacGrogan, G; Mathieu, M C; Migeon, C; Rigaud, C; Roger, P; Sigal-Zafrani, B; Simony-Lafontaine, J; Trassard, M; Treilleux, I; Verriele, V; Voigt, J J
2003-12-01
The HER2 proto-oncogene encodes a transmembrane protein, which is considered to function as a growth factor receptor. Overexpression of this protein found by immunohistochemistry in about 20% of infiltrating breast carcinomas, has a predictive value of response to treatment by trastuzumab, an anti-HER2 humanized monoclonal antibody. Search for HER2 gene amplification is necessary to adapt the immunohistochemical technique quality and also in the cases of delicate analysis or weak overexpression. It is usually carried out by Fluorescence In Situ Hybridization (FISH). A more recent hybridization technique, named CISH because of its chromogenic revelation is an alternative method, which gives highly correlated results with FISH. We present details of this technique, which may be more familiar for the pathologists than FISH, because reading analysis is similar to that of immunohistochemical staining.
Directory of Open Access Journals (Sweden)
Yufei Xue
Full Text Available Omega-3 fatty acid desaturase (ω-3 FAD, D15D is a key enzyme for α-linolenic acid (ALA biosynthesis. Both chia (Salvia hispanica and perilla (Perilla frutescens contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A tailing sites, and 7 introns. The 5'UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5'UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops.
Xue, Yufei; Chen, Baojun; Win, Aung Naing; Fu, Chun; Lian, Jianping; Liu, Xue; Wang, Rui; Zhang, Xingcui
2018-01-01
Omega-3 fatty acid desaturase (ω-3 FAD, D15D) is a key enzyme for α-linolenic acid (ALA) biosynthesis. Both chia (Salvia hispanica) and perilla (Perilla frutescens) contain high levels of ALA in seeds. In this study, the ω-3 FAD gene family was systematically and comparatively cloned from chia and perilla. Perilla FAD3, FAD7, FAD8 and chia FAD7 are encoded by single-copy (but heterozygous) genes, while chia FAD3 is encoded by 2 distinct genes. Only 1 chia FAD8 sequence was isolated. In these genes, there are 1 to 6 transcription start sites, 1 to 8 poly(A) tailing sites, and 7 introns. The 5’UTRs of PfFAD8a/b contain 1 to 2 purine-stretches and 2 pyrimidine-stretches. An alternative splice variant of ShFAD7a/b comprises a 5’UTR intron. Their encoded proteins harbor an FA_desaturase conserved domain together with 4 trans-membrane helices and 3 histidine boxes. Phylogenetic analysis validated their identity of dicot microsomal or plastidial ω-3 FAD proteins, and revealed some important evolutionary features of plant ω-3 FAD genes such as convergent evolution across different phylums, single-copy status in algae, and duplication events in certain taxa. The qRT-PCR assay showed that the ω-3 FAD genes of two species were expressed at different levels in various organs, and they also responded to multiple stress treatments. The functionality of the ShFAD3 and PfFAD3 enzymes was confirmed by yeast expression. The systemic molecular and functional features of the ω-3 FAD gene family from chia and perilla revealed in this study will facilitate their use in future studies on genetic improvement of ALA traits in oilseed crops. PMID:29351555
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Functional characterisation of three zinc transporters in Thlaspi caerulescens
Talukdar, S.
2007-01-01
Heavy metal hyperaccumulation in plants is a poorly understood phenomenon. Transmembrane metal transporters are assumed to play a key role in this process. In the research described in this thesis, genes encoding Zn transporters of Thlaspi
PDBTM: Protein Data Bank of transmembrane proteins after 8 years.
Kozma, Dániel; Simon, István; Tusnády, Gábor E
2013-01-01
The PDBTM database (available at http://pdbtm.enzim.hu), the first comprehensive and up-to-date transmembrane protein selection of the Protein Data Bank, was launched in 2004. The database was created and has been continuously updated by the TMDET algorithm that is able to distinguish between transmembrane and non-transmembrane proteins using their 3D atomic coordinates only. The TMDET algorithm can locate the spatial positions of transmembrane proteins in lipid bilayer as well. During the last 8 years not only the size of the PDBTM database has been steadily growing from ∼400 to 1700 entries but also new structural elements have been identified, in addition to the well-known α-helical bundle and β-barrel structures. Numerous 'exotic' transmembrane protein structures have been solved since the first release, which has made it necessary to define these new structural elements, such as membrane loops or interfacial helices in the database. This article reports the new features of the PDBTM database that have been added since its first release, and our current efforts to keep the database up-to-date and easy to use so that it may continue to serve as a fundamental resource for the scientific community.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Furlong, Michael; Seong, Jae Young
2017-01-01
Seven transmembrane receptors (7TMRs), also known as G protein-coupled receptors, are popular targets of drug development, particularly 7TMR systems that are activated by peptide ligands. Although many pharmaceutical drugs have been discovered via conventional bulk analysis techniques the increasing availability of structural and evolutionary data are facilitating change to rational, targeted drug design. This article discusses the appeal of neuropeptide-7TMR systems as drug targets and provides an overview of concepts in the evolution of vertebrate genomes and gene families. Subsequently, methods that use evolutionary concepts and comparative analysis techniques to aid in gene discovery, gene function identification, and novel drug design are provided along with case study examples.
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
DEFF Research Database (Denmark)
Nagasawa, T; Zhang, Q; Raghunath, P N
2006-01-01
To understand better T-cell lymphomagenesis, we examined promoter CpG methylation and mRNA expression of closely related genes encoding p16, p15, and p14 tumor suppressor genes in cultured malignant T-cells that were derived from cutaneous, adult type, and anaplastic lymphoma kinase (ALK)-express...
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes
Jarvi, S.I.; Goto, R.M.; Gee, G.F.; Briles, W.E.; Miller, M.M.
1999-01-01
We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbgl and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of '-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.
Identification, inheritance, and linkage of B-G-like and MHC class I genes in cranes.
Jarvi, S I; Goto, R M; Gee, G F; Briles, W E; Miller, M M
1999-01-01
We identified B-G-like genes in the whooping and Florida sandhill cranes and linked them to the major histocompatibility complex (MHC). We evaluated the inheritance of B-G-like genes in families of whooping and Florida sandhill cranes using restriction fragment patterns (RFPs). Two B-G-like genes, designated wcbg1 and wcbg2, were located within 8 kb of one another. The fully sequenced wcbg2 gene encodes a B-G IgV-like domain, an additional Ig-like domain, a transmembrane domain, and a single heptad domain typical of alpha-helical coiled coils. Patterns of restriction fragments in DNA from the whooping crane and from a number of other species indicate that the B-G-like gene families of cranes are large with diverse sequences. Segregation of RFPs in families of Florida sandhill cranes provide evidence for genetic polymorphism in the B-G-like genes. The restriction fragments generally segregated in concert with MHC haplotypes assigned by serological typing and by single stranded conformational polymorphism (SSCP) assays based in the second exon of the crane MHC class I genes. This study supports the concept of a long-term association of polymorphic B-G-like genes with the MHC. It also establishes SSCP as a means for evaluating MHC genetic variability in cranes.
Yang, H; Egan, J M; Rodgers, B D; Bernier, M; Montrose-Rafizadeh, C
1999-06-01
To identify novel seven transmembrane domain proteins from 3T3-L1 adipocytes, we used PCR to amplify 3T3-L1 adipocyte complementary DNA (cDNA) with primers homologous to the N- and C-termini of pancreatic glucagon-like peptide-1 (GLP-1) receptor. We screened a cDNA library prepared from fully differentiated 3T3-L1 adipocytes using a 500-bp cDNA PCR product probe. Herein describes the isolation and characterization of a 1.6-kb cDNA clone that encodes a novel 298-amino acid protein that we termed TPRA40 (transmembrane domain protein of 40 kDa regulated in adipocytes). TPRA40 has seven putative transmembrane domains and shows little homology with the known GLP-1 receptor or with other G protein-coupled receptors. The levels of TPRA40 mRNA and protein were higher in 3T3-L1 adipocytes than in 3T3-L1 fibroblasts. TPRA40 is present in a number of mouse and human tissues. Interestingly, TPRA40 mRNA levels were significantly increased by 2- to 3-fold in epididymal fat of 24-month-old mice vs. young controls as well as in db/db and ob/ob mice vs. nondiabetic control littermates. No difference in TPRA40 mRNA levels was observed in brain, heart, skeletal muscle, liver, or kidney. Furthermore, no difference in TPRA40 expression was detected in brown fat of ob/ob mice when compared with age-matched controls. Taken together, these data suggest that TPRA40 represents a novel membrane-associated protein whose expression in white adipose tissue is altered with aging and type 2 diabetes.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Ma, R C; Oliveira, M M
2000-07-01
A cDNA for an S-like RNase (RNase PD2) has been isolated from a pistil cDNA library of Prunus dulcis cv. Ferragnés. The cDNA encodes an acidic protein of 226 amino acid residues with a molecular weight of 25 kDa. A potential N-glycosylation site is present at the N-terminus in RNase PD2. A signal peptide of 23 amino acid residues and a transmembrane domain are predicted. The two active-site histidines present in enzymes of the T2/S RNase superfamily were detected in RNase PD2. Its amino acid sequence shows 71.2% similarity to RNSI of Arabidopsis and RNase T2 of chickpea, respectively. Northern blotting and RT-PCR analyses indicate that PD2 is expressed predominantly in petals, pistils of open flowers and leaves of the almond tree. Analyses of shoots cultured in vitro suggested that the expression of RNase PD2 is associated with phosphate starvation. Southern analysis detected two sequences related to RNase PD2 in the P. dulcis genome. RFLP analysis showed that S-like RNase genes are polymorphic in different almond cultivars. The PD2 gene sequence was amplified by PCR and two introns were shown to interrupt the coding region. Based on sequence analysis, we have defined three classes of S-like RNase genes, with the PD2 RNase gene representing a distinct class. The significance of the structural divergence of S-like RNase genes is further discussed.
Macaulay, Iain C; Tijssen, Marloes R; Thijssen-Timmer, Daphne C; Gusnanto, Arief; Steward, Michael; Burns, Philippa; Langford, Cordelia F; Ellis, Peter D; Dudbridge, Frank; Zwaginga, Jaap-Jan; Watkins, Nicholas A; van der Schoot, C Ellen; Ouwehand, Willem H
2007-04-15
To identify previously unknown platelet receptors we compared the transcriptomes of in vitro differentiated megakaryocytes (MKs) and erythroblasts (EBs). RNA was obtained from purified, biologically paired MK and EB cultures and compared using cDNA microarrays. Bioinformatical analysis of MK-up-regulated genes identified 151 transcripts encoding transmembrane domain-containing proteins. Although many of these were known platelet genes, a number of previously unidentified or poorly characterized transcripts were also detected. Many of these transcripts, including G6b, G6f, LRRC32, LAT2, and the G protein-coupled receptor SUCNR1, encode proteins with structural features or functions that suggest they may be involved in the modulation of platelet function. Immunoblotting on platelets confirmed the presence of the encoded proteins, and flow cytometric analysis confirmed the expression of G6b, G6f, and LRRC32 on the surface of platelets. Through comparative analysis of expression in platelets and other blood cells we demonstrated that G6b, G6f, and LRRC32 are restricted to the platelet lineage, whereas LAT2 and SUCNR1 were also detected in other blood cells. The identification of the succinate receptor SUCNR1 in platelets is of particular interest, because physiologically relevant concentrations of succinate were shown to potentiate the effect of low doses of a variety of platelet agonists.
Virus-Encoded 7 Transmembrane Receptors
DEFF Research Database (Denmark)
Mølleskov-Jensen, Ann-Sofie; Oliveira, MarthaTrindade; Farrell, Helen Elizabeth
2015-01-01
families. Divergence of functional properties between the viral 7TMR and their cellular counterparts is likely, therefore, to reflect adaptation supporting various aspects of the viral lifecycle with concomitant effects upon viral pathogenesis. Consistent with their long evolutionary history, the v7TMRs...
Modeling structure of G protein-coupled receptors in huan genome
Zhang, Yang
2016-01-01
G protein-coupled receptors (or GPCRs) are integral transmembrane proteins responsible to various cellular signal transductions. Human GPCR proteins are encoded by 5% of human genes but account for the targets of 40% of the FDA approved drugs. Due
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
Multi-Homologous Recombination-Based Gene Manipulation in the Rice Pathogen Fusarium fujikuroi
Directory of Open Access Journals (Sweden)
In Sun Hwang
2016-06-01
Full Text Available Gene disruption by homologous recombination is widely used to investigate and analyze the function of genes in Fusarium fujikuroi, a fungus that causes bakanae disease and root rot symptoms in rice. To generate gene deletion constructs, the use of conventional cloning methods, which rely on restriction enzymes and ligases, has had limited success due to a lack of unique restriction enzyme sites. Although strategies that avoid the use of restriction enzymes have been employed to overcome this issue, these methods require complicated PCR steps or are frequently inefficient. Here, we introduce a cloning system that utilizes multi-fragment assembly by In-Fusion to generate a gene disruption construct. This method utilizes DNA fragment fusion and requires only one PCR step and one reaction for construction. Using this strategy, a gene disruption construct for Fusarium cyclin C1 (FCC1 , which is associated with fumonisin B1 biosynthesis, was successfully created and used for fungal transformation. In vivo and in vitro experiments using confirmed fcc1 mutants suggest that fumonisin production is closely related to disease symptoms exhibited by F. fujikuroi strain B14. Taken together, this multi-fragment assembly method represents a simpler and a more convenient process for targeted gene disruption in fungi.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Tong, Jingfeng; Meng, Lu; Wang, Xinwei; Liu, Lixia; Lyu, Liangdong; Wang, Chuan; Li, Yang; Gao, Qian; Yang, Chen; Niu, Chen
2016-01-01
Lipids have been identified as important carbon sources for Mycobacterium tuberculosis (Mtb) to utilize in vivo. Thus gluconeogenesis bears a key role for Mtb to survive and replicate in host. A rate-limiting enzyme of gluconeogenesis, fructose 1, 6-bisphosphatase (FBPase) is encoded by the gene glpX. The functions of glpX were studied in M. marinum, a closely related species to Mtb. The glpX deletion strain (ΔglpX) displayed altered gluconeogenesis, attenuated virulence, and altered bacterial proliferation. Metabolic profiles indicate an accumulation of the FBPase substrate, fructose 1, 6-bisphosphate (FBP) and altered gluconeogenic flux when ΔglpX is cultivated in a gluconeogenic carbon substrate, acetate. In both macrophages and zebrafish, the proliferation of ΔglpX was halted, resulting in dramatically attenuated virulence. Intracellular ΔglpX exhibited an elongated morphology, which was also observed when ΔglpX was grown in a gluconeogenic carbon source. This elongated morphology is also supported by the observation of unseparated multi-nucleoid cell, indicating that a complete mycobacterial division in vivo is correlated with intact gluconeogenesis. Together, our results indicate that glpX has essential functions in gluconeogenesis, and plays an indispensable role in bacterial proliferation in vivo and virulence of M. marinum.
Dichotomous noise models of gene switches
Energy Technology Data Exchange (ETDEWEB)
Potoyan, Davit A., E-mail: potoyan@rice.edu; Wolynes, Peter G., E-mail: pwolynes@rice.edu [Department of Chemistry and Center for Theoretical Biological Physics, Rice University, Houston, Texas 77005 (United States)
2015-11-21
Molecular noise in gene regulatory networks has two intrinsic components, one part being due to fluctuations caused by the birth and death of protein or mRNA molecules which are often present in small numbers and the other part arising from gene state switching, a single molecule event. Stochastic dynamics of gene regulatory circuits appears to be largely responsible for bifurcations into a set of multi-attractor states that encode different cell phenotypes. The interplay of dichotomous single molecule gene noise with the nonlinear architecture of genetic networks generates rich and complex phenomena. In this paper, we elaborate on an approximate framework that leads to simple hybrid multi-scale schemes well suited for the quantitative exploration of the steady state properties of large-scale cellular genetic circuits. Through a path sum based analysis of trajectory statistics, we elucidate the connection of these hybrid schemes to the underlying master equation and provide a rigorous justification for using dichotomous noise based models to study genetic networks. Numerical simulations of circuit models reveal that the contribution of the genetic noise of single molecule origin to the total noise is significant for a wide range of kinetic regimes.
In vivo expression of the lacY gene in two segments leads to functional lac permease
International Nuclear Information System (INIS)
Bibi, E.; Kaback, H.R.
1990-01-01
The lacY gene of Escherichia coli was cut into two approximately equal-size fragments with Afl II and subcloned individually or together under separate lac operator/promoters in plasmid pT7-5. Under these conditions, lac permease is expressed in two portions: (i) the N-terminal portion (the N terminus, the first six putative transmembrane helices, and most of putative loop 7) and (ii) the C-terminal portion (the last six putative transmembrane helices and the C terminus). Cells harboring pT7-5 encoding both fragments transport lactose at about 30% the rate of cells expressing intact permease to a comparable steady-state level of accumulation. In contrast, cells expressing either half of the permease independently do not transport lactose. As judged by [ 35 S]methionine labeling and immunoblotting, intact permease in completely absent from the membrane of cells expressing lacY fragments either individually or together. Thus, transport activity must result from an association between independently synthesized pieces of lac permease. When the gene fragments are expressed individually, the N-terminal portion of the permease is observed inconsistently, and the C-terminal portion is not observed. When the gene fragments are expressed together, polypeptides identified as the N- and C-terminal moieties of the permease are found in the membrane. It is concluded that the N- or C-terminal halves of lac permease are proteolyzed when synthesized independently and that association between the two complementing polypeptides leads to a more stable, catalytically active complex
Glycine Perturbs Local and Global Conformational Flexibility of a Transmembrane Helix
DEFF Research Database (Denmark)
Högel, Philipp; Götz, Alexander; Kuhne, Felix
2018-01-01
Flexible transmembrane helices frequently support the conformational transitions between different functional states of membrane proteins. While proline is well known to distort and destabilize transmembrane helices, the role of glycine is still debated. Here, we systematically investigated the e...
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Directory of Open Access Journals (Sweden)
Taras Gout
2012-01-01
Full Text Available The CFTR gene is unique within the ATP-binding cassette (ABC protein family, predominantly of transporters, by coding a chloride channel. The gating mechanism of ABC proteins has been characterized by the ATP Switch model in terms cycles of dimer formation and dissociation linked to ATP binding and hydrolysis, respectively. It would be of interest to assess the extent that Cystic Fibrosis Transmembrane Conductance Regulator (CFTR, a functional channel, fits the ATP Switch model for ABC transporters. Additional transporter mechanisms, namely those of Pgp and HlyB, are discussed for perspective. Literature search of databases selected key references in comparing and contrasting the gating mechanism. CFTR is a functional chloride channel facilitating transmembrane anion flow down electrochemical gradients. A dysfunctional CFTR protein results in cystic fibrosis, a fatal pleiotropic disease currently managed symptomatically. Understanding the gating mechanism will help target drug development aimed at alleviating and curing the disease.
Directory of Open Access Journals (Sweden)
Marcella D Cervantes
Full Text Available The unicellular eukaryote Tetrahymena thermophila has seven mating types. Cells can mate only when they recognize cells of a different mating type as non-self. As a ciliate, Tetrahymena separates its germline and soma into two nuclei. During growth the somatic nucleus is responsible for all gene transcription while the germline nucleus remains silent. During mating, a new somatic nucleus is differentiated from a germline nucleus and mating type is decided by a stochastic process. We report here that the somatic mating type locus contains a pair of genes arranged head-to-head. Each gene encodes a mating type-specific segment and a transmembrane domain that is shared by all mating types. Somatic gene knockouts showed both genes are required for efficient non-self recognition and successful mating, as assessed by pair formation and progeny production. The germline mating type locus consists of a tandem array of incomplete gene pairs representing each potential mating type. During mating, a complete new gene pair is assembled at the somatic mating type locus; the incomplete genes of one gene pair are completed by joining to gene segments at each end of germline array. All other germline gene pairs are deleted in the process. These programmed DNA rearrangements make this a fascinating system of mating type determination.
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
Johnson, R G; Pfister, D; Carty, S E; Scarpa, A
1979-11-10
The effect of the transmembrane proton gradient (delta pH) and potential gradient (delta psi) upon the rate and extent of amine accumulation was investigated in chromaffin ghosts. The chromaffin ghosts were formed by hypo-osmotic lysis of isolated bovine chromaffin granules and extensive dialysis in order to remove intragranular binding components and dissipate the endogenous electrochemical gradients. Upon ATP addition to suspensions of chromaffin ghosts, a transmembrane proton gradient alone, a transmembrane gradient alone, or both, could be established, depending upon the compositions of the media in which the ghosts were formed and resuspended. When chloride was present in the medium, addition of ATP resulted in the generation of a transmembrane proton gradient, acidic inside of 1 pH unit (measured by [14C]methylamine distribution), and no transmembrane potential (measured by [14C]-thiocyanate distribution). When ATP was added to chromaffin ghosts suspended in a medium in which chloride was substituted by isethionate, a transmembrane potential, inside positive, of 45 mV and no transmembrane proton gradient, was measured. In each medium, the addition of agents known to affect proton or potential gradients, respectively, exerted a predictable mechanism of action. Accumulation of [14C]epinephrine or [14C]5-hydroxytryptamine was over 1 order of magnitude greater in the presence of the transmembrane proton gradient or the transmembrane potential than in the absence of any gradient and, moreover, was related to the magnitude of the proton or potential gradient in a dose-dependent manner. When ghosts were added to a medium containing chloride and isethionate, both a delta pH and delta psi could be generated upon addition of ATP. In this preparation, the maximal rate of amine accumulation was observed. The results indicate that amine accumulation into chromaffin ghosts can occur in the presence of either a transmembrane proton gradient, or a transmembrane potential
Manda, Prashanti; McCarthy, Fiona; Bridges, Susan M
2013-10-01
The Gene Ontology (GO), a set of three sub-ontologies, is one of the most popular bio-ontologies used for describing gene product characteristics. GO annotation data containing terms from multiple sub-ontologies and at different levels in the ontologies is an important source of implicit relationships between terms from the three sub-ontologies. Data mining techniques such as association rule mining that are tailored to mine from multiple ontologies at multiple levels of abstraction are required for effective knowledge discovery from GO annotation data. We present a data mining approach, Multi-ontology data mining at All Levels (MOAL) that uses the structure and relationships of the GO to mine multi-ontology multi-level association rules. We introduce two interestingness measures: Multi-ontology Support (MOSupport) and Multi-ontology Confidence (MOConfidence) customized to evaluate multi-ontology multi-level association rules. We also describe a variety of post-processing strategies for pruning uninteresting rules. We use publicly available GO annotation data to demonstrate our methods with respect to two applications (1) the discovery of co-annotation suggestions and (2) the discovery of new cross-ontology relationships. Copyright © 2013 The Authors. Published by Elsevier Inc. All rights reserved.
Directory of Open Access Journals (Sweden)
Jun Chen
2017-12-01
Full Text Available Cellular receptor-mediated signaling pathways play critical roles during the initial immune response to Human Cytomegalovirus (HCMV infection. However, the involvement of type-I transmembrane glycoprotein CD147/EMMPRIN (extracellular matrix metalloproteinase inducer in the antiviral response to HCMV infection is still unknown. Here, we demonstrated the specific knockdown of CD147 significantly decreased HCMV-induced activation of NF-κB and Interferon-beta (IFN-β, which contribute to the cellular antiviral responses. Next, we confirmed that HCMV-encoded miR-US25-1-5p could target the 3′ UTR (Untranslated Region of CD147 mRNA, and thus facilitate HCMV lytic propagation at a low multiplicity of infection (MOI. The expression and secretion of Cyclophilin A (sCyPA, as a ligand for CD147 and a proinflammatory cytokine, were up-regulated in response to HCMV stimuli. Finally, we confirmed that CD147 mediated HCMV-triggered antiviral signaling via the sCyPA-CD147-ERK (extracellular regulated protein kinases/NF-κB axis signaling pathway. These findings reveal an important HCMV mechanism for evading antiviral innate immunity through its encoded microRNA by targeting transmembrane glycoprotein CD147, and a potential cause of HCMV inflammatory disorders due to the secretion of proinflammatory cytokine CyPA.
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
Directory of Open Access Journals (Sweden)
Wei Liu
2017-07-01
Full Text Available Azorhizobium caulinodans ORS571 is a motile soil bacterium that interacts symbiotically with legume host Sesbania rostrata, forming nitrogen-fixing root and stem nodules. Bacterial chemotaxis plays an important role in establishing this symbiotic relationship. To determine the contribution of chemotaxis to symbiosis in A. caulinodans ORS571-S. rostrata, we characterized the function of TlpA1 (transducer-like protein in A. caulinodans, a chemoreceptor predicted by SMART (Simple Modular Architecture Research Tool, containing two N-terminal transmembrane regions. The tlpA1 gene is located immediately upstream of the unique che gene cluster and is transcriptionally co-oriented. We found that a ΔtlpA1 mutant is severely impaired for chemotaxis to various organic acids, glycerol and proline. Furthermore, biofilm forming ability of the strain carrying the mutation is reduced under certain growth conditions. Interestingly, competitive colonization ability on S. rostrata root surfaces is impaired in the ΔtlpA1 mutant, suggesting that chemotaxis of the A. caulinodans ORS571 contributes to root colonization. We also found that TlpA1 promotes competitive nodulation not only on roots but also on stems of S. rostrata. Taken together, our data strongly suggest that TlpA1 is a transmembrane chemoreceptor involved in A. caulinodans-S. rostrata symbiosis.
Mutations in the Gene PRRT2 Cause Paroxysmal Kinesigenic Dyskinesia with Infantile Convulsions
Directory of Open Access Journals (Sweden)
Hsien-Yang Lee
2012-01-01
Full Text Available Paroxysmal kinesigenic dyskinesia with infantile convulsions (PKD/IC is an episodic movement disorder with autosomal-dominant inheritance and high penetrance, but the causative genetic mutation is unknown. We have now identified four truncating mutations involving the gene PRRT2 in the vast majority (24/25 of well-characterized families with PKD/IC. PRRT2 truncating mutations were also detected in 28 of 78 additional families. PRRT2 encodes a proline-rich transmembrane protein of unknown function that has been reported to interact with the t-SNARE, SNAP25. PRRT2 localizes to axons but not to dendritic processes in primary neuronal culture, and mutants associated with PKD/IC lead to dramatically reduced PRRT2 levels, leading ultimately to neuronal hyperexcitability that manifests in vivo as PKD/IC.
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Ancestral Variations of the PCDHG Gene Cluster Predispose to Dyslexia in a Multiplex Family
Directory of Open Access Journals (Sweden)
Teesta Naskar
2018-02-01
Full Text Available Dyslexia is a heritable neurodevelopmental disorder characterized by difficulties in reading and writing. In this study, we describe the identification of a set of 17 polymorphisms located across 1.9 Mb region on chromosome 5q31.3, encompassing genes of the PCDHG cluster, TAF7, PCDH1 and ARHGAP26, dominantly inherited with dyslexia in a multi-incident family. Strikingly, the non-risk form of seven variations of the PCDHG cluster, are preponderant in the human lineage, while risk alleles are ancestral and conserved across Neanderthals to non-human primates. Four of these seven ancestral variations (c.460A > C [p.Ile154Leu], c.541G > A [p.Ala181Thr], c.2036G > C [p.Arg679Pro] and c.2059A > G [p.Lys687Glu] result in amino acid alterations. p.Ile154Leu and p.Ala181Thr are present at EC2: EC3 interacting interface of γA3-PCDH and γA4-PCDH respectively might affect trans-homophilic interaction and hence neuronal connectivity. p.Arg679Pro and p.Lys687Glu are present within the linker region connecting trans-membrane to extracellular domain. Sequence analysis indicated the importance of p.Ile154, p.Arg679 and p.Lys687 in maintaining class specificity. Thus the observed association of PCDHG genes encoding neural adhesion proteins reinforces the hypothesis of aberrant neuronal connectivity in the pathophysiology of dyslexia. Additionally, the striking conservation of the identified variants indicates a role of PCDHG in the evolution of highly specialized cognitive skills critical to reading.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Multi-kilobase homozygous targeted gene replacement in human induced pluripotent stem cells.
Byrne, Susan M; Ortiz, Luis; Mali, Prashant; Aach, John; Church, George M
2015-02-18
Sequence-specific nucleases such as TALEN and the CRISPR/Cas9 system have so far been used to disrupt, correct or insert transgenes at precise locations in mammalian genomes. We demonstrate efficient 'knock-in' targeted replacement of multi-kilobase genes in human induced pluripotent stem cells (iPSC). Using a model system replacing endogenous human genes with their mouse counterpart, we performed a comprehensive study of targeting vector design parameters for homologous recombination. A 2.7 kilobase (kb) homozygous gene replacement was achieved in up to 11% of iPSC without selection. The optimal homology arm length was around 2 kb, with homology length being especially critical on the arm not adjacent to the cut site. Homologous sequence inside the cut sites was detrimental to targeting efficiency, consistent with a synthesis-dependent strand annealing (SDSA) mechanism. Using two nuclease sites, we observed a high degree of gene excisions and inversions, which sometimes occurred more frequently than indel mutations. While homozygous deletions of 86 kb were achieved with up to 8% frequency, deletion frequencies were not solely a function of nuclease activity and deletion size. Our results analyzing the optimal parameters for targeting vector design will inform future gene targeting efforts involving multi-kilobase gene segments, particularly in human iPSC. © The Author(s) 2014. Published by Oxford University Press on behalf of Nucleic Acids Research.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Chimeras taking shape: Potential functions of proteins encoded by chimeric RNA transcripts
Frenkel-Morgenstern, Milana; Lacroix, Vincent; Ezkurdia, Iakes; Levin, Yishai; Gabashvili, Alexandra; Prilusky, Jaime; del Pozo, Angela; Tress, Michael; Johnson, Rory; Guigo, Roderic; Valencia, Alfonso
2012-01-01
Chimeric RNAs comprise exons from two or more different genes and have the potential to encode novel proteins that alter cellular phenotypes. To date, numerous putative chimeric transcripts have been identified among the ESTs isolated from several organisms and using high throughput RNA sequencing. The few corresponding protein products that have been characterized mostly result from chromosomal translocations and are associated with cancer. Here, we systematically establish that some of the putative chimeric transcripts are genuinely expressed in human cells. Using high throughput RNA sequencing, mass spectrometry experimental data, and functional annotation, we studied 7424 putative human chimeric RNAs. We confirmed the expression of 175 chimeric RNAs in 16 human tissues, with an abundance varying from 0.06 to 17 RPKM (Reads Per Kilobase per Million mapped reads). We show that these chimeric RNAs are significantly more tissue-specific than non-chimeric transcripts. Moreover, we present evidence that chimeras tend to incorporate highly expressed genes. Despite the low expression level of most chimeric RNAs, we show that 12 novel chimeras are translated into proteins detectable in multiple shotgun mass spectrometry experiments. Furthermore, we confirm the expression of three novel chimeric proteins using targeted mass spectrometry. Finally, based on our functional annotation of exon organization and preserved domains, we discuss the potential features of chimeric proteins with illustrative examples and suggest that chimeras significantly exploit signal peptides and transmembrane domains, which can alter the cellular localization of cognate proteins. Taken together, these findings establish that some chimeric RNAs are translated into potentially functional proteins in humans. PMID:22588898
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
Krumpochova, P; Sapthu, S.; Brouwers, J.F.H.M.; de Haas, M.; de Vos, R.; Borst, P.; van de Wetering, K.
2013-01-01
ABSTRACT The ATP-binding cassette (ABC) genes encode the largest family of transmembrane proteins. ABC transporters translocate a wide variety of substrates across membranes, but their physiological function is often incompletely understood. We describe a new method to study the substrate spectrum
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Transmembrane helical interactions in the CFTR channel pore.
Directory of Open Access Journals (Sweden)
Jhuma Das
2017-06-01
Full Text Available Mutations in the Cystic Fibrosis Transmembrane Conductance Regulator (CFTR gene affect CFTR protein biogenesis or its function as a chloride channel, resulting in dysregulation of epithelial fluid transport in the lung, pancreas and other organs in cystic fibrosis (CF. Development of pharmaceutical strategies to treat CF requires understanding of the mechanisms underlying channel function. However, incomplete 3D structural information on the unique ABC ion channel, CFTR, hinders elucidation of its functional mechanism and correction of cystic fibrosis causing mutants. Several CFTR homology models have been developed using bacterial ABC transporters as templates but these have low sequence similarity to CFTR and are not ion channels. Here, we refine an earlier model in an outward (OWF and develop an inward (IWF facing model employing an integrated experimental-molecular dynamics simulation (200 ns approach. Our IWF structure agrees well with a recently solved cryo-EM structure of a CFTR IWF state. We utilize cysteine cross-linking to verify positions and orientations of residues within trans-membrane helices (TMHs of the OWF conformation and to reconstruct a physiologically relevant pore structure. Comparison of pore profiles of the two conformations reveal a radius sufficient to permit passage of hydrated Cl- ions in the OWF but not the IWF model. To identify structural determinants that distinguish the two conformations and possible rearrangements of TMHs within them responsible for channel gating, we perform cross-linking by bifunctional reagents of multiple predicted pairs of cysteines in TMH 6 and 12 and 6 and 9. To determine whether the effects of cross-linking on gating observed are the result of switching of the channel from open to close state, we also treat the same residue pairs with monofunctional reagents in separate experiments. Both types of reagents prevent ion currents indicating that pore blockage is primarily responsible.
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Performance study of large area encoding readout MRPC
Chen, X. L.; Wang, Y.; Chen, G.; Han, D.; Wang, X.; Zeng, M.; Zeng, Z.; Zhao, Z.; Guo, B.
2018-02-01
Muon tomography system built by the 2-D readout high spatial resolution Multi-gap Resistive Plate Chamber (MRPC) detector is a project of Tsinghua University. An encoding readout method based on the fine-fine configuration has been used to minimize the number of the readout electronic channels resulting in reducing the complexity and the cost of the system. In this paper, we provide a systematic comparison of the MRPC detector performance with and without fine-fine encoding readout. Our results suggest that the application of the fine-fine encoding readout leads us to achieve a detecting system with slightly worse spatial resolution but dramatically reduce the number of electronic channels.
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
He, Xian-hui; Xu, Li-hui; Liu, Yi
2005-04-01
To investigate the expression and regulation of PD-1 ligand 1 (PD-L1) in peripheral blood mononuclear cells (PBMC). The cDNA encoding human PD-L1 precursor was cloned from the total RNA extracted from the resting and phorbol dibutyrate plus ionomycin- or phytohemagglutinin-activated PBMC, by reverse transcription polymerase chain reaction (RT-PCR), and independent clones were sequenced and analyzed. The expression and subcellular localization were examined in transiently transfected cells. The PD-L1 gene expression in different PBMC was also analyzed by RT-PCR. A novel human PD-L1 splice variant was identified from the activated PBMC. It was generated by splicing out exon? encoding an immunoglobulin variable domain (Igv)-like domain but retaining all other exons without a frame-shift. Consequently, the putative translated protein contained all other domains including the transmembrane region except for the Igv-like domain. Furthermore, the conventional isoform was expressed on the plasma surface whereas the novel isoform showed a pattern of intracellular membrane distribution in transiently transfected K562 cells. In addition, the expression pattern of the PD-L1 splice variant was variable in different individuals and in different cellular status. PD-L1 expression may be regulated at the posttranscriptional level through alternative splicing, and modulation of the PD-L1 isoform expression may influence the outcome of specific immune responses in the peripheral tissues.
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
A novel podoplanin-GFPCre mouse strain for gene deletion in lymphatic endothelial cells.
Gil, Hyea Jin; Ma, Wanshu; Oliver, Guillermo
2018-04-01
The lymphatic vascular system is a one-direction network of thin-walled capillaries and larger vessels covered by a continuous layer of endothelial cells responsible for maintaining fluid homeostasis. Some of the main functions of the lymphatic vasculature are to drain fluid from the extracellular spaces and return it back to the blood circulation, lipid absorption from the intestinal tract, and transport of immune cells to lymphoid organs. A number of genes controlling the development of the mammalian lymphatic vasculature have been identified in the last few years, and their functional roles started to be characterized using gene inactivation approaches in mice. Unfortunately, only few mouse Cre strains relatively specific for lymphatic endothelial cells (LECs) are currently available. In this article, we report the generation of a novel Podoplanin (Pdpn) GFPCre transgenic mouse strain using its 5' regulatory region. Pdpn encodes a transmembrane mucin-type O-glycoprotein that is expressed on the surface of embryonic and postnatal LECs, in addition to few other cell types. Our detailed characterization of this novel strain indicates that it will be a valuable additional genetic tool for the analysis of gene function in LECs. © 2018 Wiley Periodicals, Inc.
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.
2003-01-01
The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
DEFF Research Database (Denmark)
Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven
2017-01-01
The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...
Membrane shape modulates transmembrane protein distribution.
Aimon, Sophie; Callan-Jones, Andrew; Berthaud, Alice; Pinot, Mathieu; Toombes, Gilman E S; Bassereau, Patricia
2014-01-27
Although membrane shape varies greatly throughout the cell, the contribution of membrane curvature to transmembrane protein targeting is unknown because of the numerous sorting mechanisms that take place concurrently in cells. To isolate the effect of membrane shape, we used cell-sized giant unilamellar vesicles (GUVs) containing either the potassium channel KvAP or the water channel AQP0 to form membrane nanotubes with controlled radii. Whereas the AQP0 concentrations in flat and curved membranes were indistinguishable, KvAP was enriched in the tubes, with greater enrichment in more highly curved membranes. Fluorescence recovery after photobleaching measurements showed that both proteins could freely diffuse through the neck between the tube and GUV, and the effect of each protein on membrane shape and stiffness was characterized using a thermodynamic sorting model. This study establishes the importance of membrane shape for targeting transmembrane proteins and provides a method for determining the effective shape and flexibility of membrane proteins. Copyright © 2014 Elsevier Inc. All rights reserved.
Two Pathways to Stimulus Encoding in Category Learning?
Davis, Tyler; Love, Bradley C.; Maddox, W. Todd
2008-01-01
Category learning theorists tacitly assume that stimuli are encoded by a single pathway. Motivated by theories of object recognition, we evaluate a dual-pathway account of stimulus encoding. The part-based pathway establishes mappings between sensory input and symbols that encode discrete stimulus features, whereas the image-based pathway applies holistic templates to sensory input. Our experiments use rule-plus-exception structures in which one exception item in each category violates a salient regularity and must be distinguished from other items. In Experiment 1, we find that discrete representations are crucial for recognition of exceptions following brief training. Experiments 2 and 3 involve multi-session training regimens designed to encourage either part or image-based encoding. We find that both pathways are able to support exception encoding, but have unique characteristics. We speculate that one advantage of the part-based pathway is the ability to generalize across domains, whereas the image-based pathway provides faster and more effortless recognition. PMID:19460948
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
Fused Regression for Multi-source Gene Regulatory Network Inference.
Directory of Open Access Journals (Sweden)
Kari Y Lam
2016-12-01
Full Text Available Understanding gene regulatory networks is critical to understanding cellular differentiation and response to external stimuli. Methods for global network inference have been developed and applied to a variety of species. Most approaches consider the problem of network inference independently in each species, despite evidence that gene regulation can be conserved even in distantly related species. Further, network inference is often confined to single data-types (single platforms and single cell types. We introduce a method for multi-source network inference that allows simultaneous estimation of gene regulatory networks in multiple species or biological processes through the introduction of priors based on known gene relationships such as orthology incorporated using fused regression. This approach improves network inference performance even when orthology mapping and conservation are incomplete. We refine this method by presenting an algorithm that extracts the true conserved subnetwork from a larger set of potentially conserved interactions and demonstrate the utility of our method in cross species network inference. Last, we demonstrate our method's utility in learning from data collected on different experimental platforms.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.
A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Tsang-A-Sjoe, M. W. P.; Bultink, I. E. M.; Korswagen, L. A.; van der Horst, A. [=Anneke; Rensink, I.; de Boer, M.; Hamann, D.; Voskuyl, A. E.; Wouters, D.
2017-01-01
Genetic variation of the genes encoding complement component C4 is strongly associated with systemic lupus erythematosus (SLE), a chronic multi-organ auto-immune disease. This study examined C4 and its isotypes on a genetic, protein, and functional level in 140 SLE patients and 104 healthy controls.
Directory of Open Access Journals (Sweden)
Catherine E Grueber
Full Text Available Toll-like receptors (TLRs are an ancient family of genes encoding transmembrane proteins that bind pathogen-specific molecules and initiate both innate and adaptive aspects of the immune response. Our goal was to determine whether these genes show sufficient genetic diversity in a bottlenecked population to be a useful addition or alternative to the more commonly employed major histocompatibility complex (MHC genotyping in a conservation genetics context. We amplified all known avian TLR genes in a severely bottlenecked population of New Zealand's Stewart Island robin (Petroica australis rakiura, for which reduced microsatellite diversity was previously observed. We genotyped 17-24 birds from a reintroduced island population (including the 12 founders for nine genes, seven of which were polymorphic. We observed a total of 24 single-nucleotide polymorphisms overall, 15 of which were non-synonymous, representing up to five amino-acid variants at a locus. One locus (TLR1LB showed evidence of past directional selection. Results also confirmed a passerine duplication of TLR7. The levels of TLR diversity that we observe are sufficient to justify their further use in addressing conservation genetic questions, even in bottlenecked populations.
Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.
Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe
2016-11-15
Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
DEFF Research Database (Denmark)
Plantard, Laure; Huber, Marcel; Macari, Francoise
2003-01-01
Connexins are homologous four-transmembrane-domain proteins and major components of gap junctions. We recently identified mutations in either GJB3 or GJB4 genes, encoding respectively connexin 31 (Cx31) or 30.3 (Cx30.3), as causally involved in erythrokeratodermia variabilis (EKV), a mostly autos...
Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael
2009-08-01
Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.
Genome-Wide Identification and Expression Analysis of the UGlcAE Gene Family in Tomato
Directory of Open Access Journals (Sweden)
Xing Ding
2018-05-01
Full Text Available The UGlcAE has the capability of interconverting UDP-d-galacturonic acid and UDP-d-glucuronic acid, and UDP-d-galacturonic acid is an activated precursor for the synthesis of pectins in plants. In this study, we identified nine UGlcAE protein-encoding genes in tomato. The nine UGlcAE genes that were distributed on eight chromosomes in tomato, and the corresponding proteins contained one or two trans-membrane domains. The phylogenetic analysis showed that SlUGlcAE genes could be divided into seven groups, designated UGlcAE1 to UGlcAE6, of which the UGlcAE2 were classified into two groups. Expression profile analysis revealed that the SlUGlcAE genes display diverse expression patterns in various tomato tissues. Selective pressure analysis indicated that all of the amino acid sites of SlUGlcAE proteins are undergoing purifying selection. Fifteen stress-, hormone-, and development-related elements were identified in the upstream regions (0.5 kb of these SlUGlcAE genes. Furthermore, we investigated the expression patterns of SlUGlcAE genes in response to three hormones (indole-3-acetic acid (IAA, gibberellin (GA, and salicylic acid (SA. We detected firmness, pectin contents, and expression levels of UGlcAE family genes during the development of tomato fruit. Here, we systematically summarize the general characteristics of the SlUGlcAE genes in tomato, which could provide a basis for further function studies of tomato UGlcAE genes.
Zhong, Sheng; Navaratnam, Dhasakumar; Santos-Sacchi, Joseph
2014-01-01
Chloride is the major anion in cells, with many diseases arising from disordered Cl- regulation. For the non-invasive investigation of Cl- flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl- sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl- under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl- measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events. In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP), has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5), and shown for the first time physiological (mM) chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function. Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP) results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH.
Directory of Open Access Journals (Sweden)
Sheng Zhong
Full Text Available Chloride is the major anion in cells, with many diseases arising from disordered Cl- regulation. For the non-invasive investigation of Cl- flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl- sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl- under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl- measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events.In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP, has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5, and shown for the first time physiological (mM chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function.Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH.
Directory of Open Access Journals (Sweden)
Kohlbacher Oliver
2009-09-01
Full Text Available Abstract Background Knowledge of subcellular localization of proteins is crucial to proteomics, drug target discovery and systems biology since localization and biological function are highly correlated. In recent years, numerous computational prediction methods have been developed. Nevertheless, there is still a need for prediction methods that show more robustness and higher accuracy. Results We extended our previous MultiLoc predictor by incorporating phylogenetic profiles and Gene Ontology terms. Two different datasets were used for training the system, resulting in two versions of this high-accuracy prediction method. One version is specialized for globular proteins and predicts up to five localizations, whereas a second version covers all eleven main eukaryotic subcellular localizations. In a benchmark study with five localizations, MultiLoc2 performs considerably better than other methods for animal and plant proteins and comparably for fungal proteins. Furthermore, MultiLoc2 performs clearly better when using a second dataset that extends the benchmark study to all eleven main eukaryotic subcellular localizations. Conclusion MultiLoc2 is an extensive high-performance subcellular protein localization prediction system. By incorporating phylogenetic profiles and Gene Ontology terms MultiLoc2 yields higher accuracies compared to its previous version. Moreover, it outperforms other prediction systems in two benchmarks studies. MultiLoc2 is available as user-friendly and free web-service, available at: http://www-bs.informatik.uni-tuebingen.de/Services/MultiLoc2.
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
DEFF Research Database (Denmark)
Nielsen, Lecia Møller; Olesen, Anne Estrup; Sato, Hiroe
2016-01-01
The genetic influence on sensitivity to noxious stimuli (pain sensitivity) remains controversial and needs further investigation. In the present study, the possible influence of polymorphisms in three opioid receptor (OPRM, OPRD and OPRK) genes and the catechol-O-methyltransferase (COMT) gene...... on pain sensitivity in healthy participants was investigated. Catechol-O-methyltransferase has an indirect effect on the mu opioid receptor by changing its activity through an altered endogenous ligand effect. Blood samples for genetic analysis were withdrawn in a multi-modal and multi-tissue experimental......, electrical and thermal visceral stimulations. A cold pressor test was also conducted. DNA was available from 38 of 40 participants. Compared to non-carriers of the COMT rs4680A allele, carriers reported higher bone pressure pain tolerance threshold (i.e. less pain) by up to 23.8% (p
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz
2016-11-28
Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .
Directory of Open Access Journals (Sweden)
Stahl Stefanie
2002-02-01
Full Text Available Abstract Background Mucolipidosis type IV (MLIV is an autosomal recessive lysosomal storage disorder characterized by severe neurologic and ophthalmologic abnormalities. Recently the MLIV gene, MCOLN1, has been identified as a new member of the transient receptor potential (TRP cation channel superfamily. Here we report the cloning and characterization of the mouse homologue, Mcoln1, and report a novel splice variant that is not seen in humans. Results The human and mouse genes display a high degree of synteny. Mcoln1 shows 91% amino acid and 86% nucleotide identity to MCOLN1. Also, Mcoln1 maps to chromosome 8 and contains an open reading frame of 580 amino acids, with a transcript length of approximately 2 kb encoded by 14 exons, similar to its human counterpart. The transcript that results from murine specific alternative splicing encodes a 611 amino acid protein that differs at the c-terminus. Conclusions Mcoln1 is highly similar to MCOLN1, especially in the transmembrane domains and ion pore region. Also, the late endosomal/lysosomal targeting signal is conserved, supporting the hypothesis that the protein is localized to these vesicle membranes. To date, there are very few reports describing species-specific splice variants. While identification of Mcoln1 is crucial to the development of mouse models for MLIV, the fact that there are two transcripts in mice suggests an additional or alternate function of the gene that may complicate phenotypic assessment.
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J
2018-06-07
Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate
Characterization of two unusual guanylyl cyclases from Dictyostelium
Roelofs, Jeroen; Haastert, Peter J.M. van
2002-01-01
Guanylyl cyclase A (GCA) and soluble guanylyl cyclase (sGC) encode GCs in Dictyostelium and have a topology similar to 12-transmembrane and soluble adenylyl cyclase, respectively. We demonstrate that all detectable GC activity is lost in a cell line in which both genes have been inactivated. Cell
Molecular analysis of glycogen storage disease type Ia in Iranian ...
Indian Academy of Sciences (India)
SHEKARI KHANIANI MAHMOUD1,2
The gene encodes a hydrophobic pro- tein containing 357 amino acids and nine transmembrane domains ... terolamia, hypertriglyceridamia, hyperuricaemia and lactic acidamia (Janecke et al. 2001; Emino˘glu et al. .... Triglyceride serum uric acid values were higher in all the four patients, and they also suffered from severe ...
Bassler, B L; Wright, M; Silverman, M R
1994-07-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.
Xu, J; Johnson, R C
1995-06-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.
DEFF Research Database (Denmark)
Sicheritz-Pontén, Thomas; Noel, CJ; Diaz, N
2010-01-01
Trichomonas vaginalis is the most common non-viral human sexually transmitted pathogen and importantly, contributes to facilitating the spread of HIV. Yet very little is known about its surface and secreted proteins mediating interactions with, and permitting the invasion and colonisation of...... potential extracellular proteins for the pathogen. A broad range of microorganisms encoding BspA-like proteins was identified and these are mainly known to live on mucosal surfaces, among these T. vaginalis is endowed with the largest gene family. Over 180 TvBspA proteins with inferred transmembrane domains...... were characterized by a considerable structural diversity between their TpLRR and other types of repetitive sequences and two subfamilies possessed distinct classic sorting signal motifs for endocytosis. One TvBspA subfamily also shared a glycine-rich protein domain with proteins from Clostridium...
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Puranik, Swati; Bahadur, Ranjit Prasad; Srivastava, Prem S; Prasad, Manoj
2011-10-01
The plant-specific NAC (NAM, ATAF, and CUC) transcription factors have diverse role in development and stress regulation. A transcript encoding NAC protein, termed SiNAC was identified from a salt stress subtractive cDNA library of S. italica seedling (Puranik et al., J Plant Physiol 168:280-287, 2011). This single/low copy gene containing four exons and four introns within the genomic-sequence encoded a protein of 462 amino acids. Structural analysis revealed that highly divergent C terminus contains a transmembrane domain. The NAC domain consisted of a twisted antiparallel beta-sheet packing against N terminal alpha helix on one side and a shorter helix on the other side. The domain was predicted to homodimerize and control DNA-binding specificity. The physicochemical features of the SiNAC homodimer interface justified the dimeric form of the predicted model. A 1539 bp fragment upstream to the start codon of SiNAC gene was cloned and in silico analysis revealed several putative cis-acting regulatory elements within the promoter sequence. Transactivation analysis indicated that SiNAC activated expression of reporter gene and the activation domain lied at the C terminal. The SiNAC:GFP was detected in the nucleus and cytoplasm while SiNAC ΔC(1-158):GFP was nuclear localized in onion epidermal cells. SiNAC transcripts mostly accumulated in young spikes and were strongly induced by dehydration, salinity, ethephon, and methyl jasmonate. These results suggest that SiNAC encodes a membrane associated NAC-domain protein that may function as a transcriptional activator in response to stress and developmental regulation in plants.
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas
2006-06-07
Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
DEFF Research Database (Denmark)
Edvardsen, K; Chen, W; Rucklidge, G
1993-01-01
proteinases, and proteinase inhibitors all participate in the construction, maintenance, and remodeling of extracellular matrix by cells. The neural cell-adhesion molecule (NCAM)-negative rat glioma cell line BT4Cn secretes substantial amounts of metalloproteinases, as compared with its NCAM-positive mother......During embryogenesis interactions between cells and extracellular matrix play a central role in the modulation of cell motility, growth, and differentiation. Modulation of matrix structure is therefore crucial during development; extracellular matrix ligands, their receptors, extracellular...... cell line BT4C. We have transfected the BT4Cn cell line with cDNAs encoding the human NCAM-B and -C isoforms. We report here that the expression of transmembrane NCAM-B, but not of glycosyl-phosphatidylinositol-linked NCAM-C, induces a down-regulation of 92-kDa gelatinase (matrix metalloproteinase 9...
Nanfang, Li; Yanying, Guo; Hongmei, Wang; Zhitao, Yan; Juhong, Zhang; Ling, Zhou; Wenli, Luo
2010-08-01
Metabolic syndrome (MetS) is linked with visceral obesity and is associated with a clustering of abnormalities (including impaired glucose tolerance, insulin resistance, dyslipidemia and hypertension). Six transmembrane epithelial antigen of prostate 4 (STEAP4) was associated with human obesity. STEAP4 gene represents a strong biological and positional candidate for a susceptibility factor for MetS. Uygur Chinese is a relatively isolated population with a relatively homogeneous environment and a high prevalence of MetS. We undertook this study to investigate the relationship between STEAP4 gene variations and MetS in a Uygur general population. The functional regions of STEAP4 gene were sequenced in Uygur patients with MetS. Four representative variations, rs1981529, rs34741656, rs8122 and 6031T/G (unsuccessfully genotyped), selected with a r² cutoff of 0.8 and minor allele frequency of >5%, were genotyped in 858 MetS and 687 non-MetS controls. Fourteen novel and six known single nucleotide polymorphisms (SNPs) including 2 nonsynonymous SNPs in the STEAP4 gene were identified. SNPs rs8122 and rs1981529 were significantly associated with MetS phenotype in females [additive p = 0.032 and p = 0.011; ORs (95% CI) adjusted for age 0.772 (0.625-0.954) and 0.740 (0.582-0.941), respectively]. Two common haplotypes 1 (rs8122/rs1981529/rs34741656, G-A-G) and 2 (A-G-G) had significantly higher (permutation p = 0.044) and lower (permutation p = 0.009) frequency in MetS than that in controls in females. Multiple linear regression analysis revealed a significant association of the SNPs rs8122 and rs1981529 with HDL-c level in MetS cases (p = 0.001 and 0.024) and in a combined sample (p = 0.004 and 0.009). STEAP4 genetic variations are likely to be associated with metabolic syndrome in a female Uygur general population. Copyright © 2010 IMSS. Published by Elsevier Inc. All rights reserved.
The implications of alternative splicing in the ENCODE protein complement
DEFF Research Database (Denmark)
Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam
2007-01-01
suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...
Liu, Ying; Jiang, Yu-xin; Li, Chao-pin
2011-12-01
To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.
Multi-level trellis coded modulation and multi-stage decoding
Costello, Daniel J., Jr.; Wu, Jiantian; Lin, Shu
1990-01-01
Several constructions for multi-level trellis codes are presented and many codes with better performance than previously known codes are found. These codes provide a flexible trade-off between coding gain, decoding complexity, and decoding delay. New multi-level trellis coded modulation schemes using generalized set partitioning methods are developed for Quadrature Amplitude Modulation (QAM) and Phase Shift Keying (PSK) signal sets. New rotationally invariant multi-level trellis codes which can be combined with differential encoding to resolve phase ambiguity are presented.
Zhong, Sheng; Navaratnam, Dhasakumar; Santos-Sacchi, Joseph
2014-01-01
Background Chloride is the major anion in cells, with many diseases arising from disordered Cl− regulation. For the non-invasive investigation of Cl− flux, YFP-H148Q and its derivatives chameleon and Cl-Sensor previously were introduced as genetically encoded chloride indicators. Neither the Cl− sensitivity nor the pH-susceptibility of these modifications to YFP is optimal for precise measurements of Cl− under physiological conditions. Furthermore, the relatively poor photostability of YFP derivatives hinders their application for dynamic and quantitative Cl− measurements. Dynamic and accurate measurement of physiological concentrations of chloride would significantly affect our ability to study effects of chloride on cellular events. Methodology/Principal Findings In this study, we developed a series of YFP derivatives to remove pH interference, increase photostability and enhance chloride sensitivity. The final product, EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP), has a chloride Kd of 14 mM and pKa of 5.9. The bleach time constant of 175 seconds is over 15-fold greater than wild-type EYFP. We have used the sensor fused to the transmembrane protein prestin (gerbil prestin, SLC26a5), and shown for the first time physiological (mM) chloride flux in HEK cells expressing this protein. This modified fluorescent protein will facilitate investigations of dynamics of chloride ions and their mediation of cell function. Conclusions Modifications to YFP (EYFP-F46L/Q69K/H148Q/I152L/V163S/S175G/S205V/A206K (monomeric Cl-YFP) results in a photostable fluorescent protein that allows measurement of physiological changes in chloride concentration while remaining minimally affected by changes in pH. PMID:24901231
Directory of Open Access Journals (Sweden)
Linh Nguyen
2016-12-01
Full Text Available Background: Selected gene mutations are routinely used to guide the selection of cancer drugs for a given patient tumour. Large pharmacogenomic data sets were introduced to discover more of these single-gene markers of drug sensitivity. Very recently, machine learning regression has been used to investigate how well cancer cell line sensitivity to drugs is predicted depending on the type of molecular profile. The latter has revealed that gene expression data is the most predictive profile in the pan-cancer setting. However, no study to date has exploited GDSC data to systematically compare the performance of machine learning models based on multi-gene expression data against that of widely-used single-gene markers based on genomics data. Methods: Here we present this systematic comparison using Random Forest (RF classifiers exploiting the expression levels of 13,321 genes and an average of 501 tested cell lines per drug. To account for time-dependent batch effects in IC50 measurements, we employ independent test sets generated with more recent GDSC data than that used to train the predictors and show that this is a more realistic validation than K-fold cross-validation. Results and Discussion: Across 127 GDSC drugs, our results show that the single-gene markers unveiled by the MANOVA analysis tend to achieve higher precision than these RF-based multi-gene models, at the cost of generally having a poor recall (i.e. correctly detecting only a small part of the cell lines sensitive to the drug. Regarding overall classification performance, about two thirds of the drugs are better predicted by multi-gene RF classifiers. Among the drugs with the most predictive of these models, we found pyrimethamine, sunitinib and 17-AAG. Conclusions: We now know that this type of models can predict in vitro tumour response to these drugs. These models can thus be further investigated on in vivo tumour models.
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Martínez-Gil, Luis; Sánchez-Navarro, Jesús A; Cruz, Antonio; Pallás, Vicente; Pérez-Gil, Jesús; Mingarro, Ismael
2009-06-01
The cell-to-cell transport of plant viruses depends on one or more virus-encoded movement proteins (MPs). Some MPs are integral membrane proteins that interact with the membrane of the endoplasmic reticulum, but a detailed understanding of the interaction between MPs and biological membranes has been lacking. The cell-to-cell movement of the Prunus necrotic ringspot virus (PNRSV) is facilitated by a single MP of the 30K superfamily. Here, using a myriad of biochemical and biophysical approaches, we show that the PNRSV MP contains only one hydrophobic region (HR) that interacts with the membrane interface, as opposed to being a transmembrane protein. We also show that a proline residue located in the middle of the HR constrains the structural conformation of this region at the membrane interface, and its replacement precludes virus movement.
Diehl, David L; LaPara, Timothy M
2010-12-01
The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.
Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A
1996-07-15
The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.
Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan
2018-06-01
Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.
The novel Candida albicans transporter Dur31 Is a multi-stage pathogenicity factor.
Directory of Open Access Journals (Sweden)
François L Mayer
Full Text Available Candida albicans is the most frequent cause of oral fungal infections. However, the exact pathogenicity mechanisms that this fungus employs are largely unknown and many of the genes expressed during oral infection are uncharacterized. In this study we sought to functionally characterize 12 previously unknown function genes associated with oral candidiasis. We generated homozygous knockout mutants for all 12 genes and analyzed their interaction with human oral epithelium in vitro. Eleven mutants caused significantly less epithelial damage and, of these, deletion of orf19.6656 (DUR31 elicited the strongest reduction in pathogenicity. Interestingly, DUR31 was not only involved in oral epithelial damage, but in multiple stages of candidiasis, including surviving attack by human neutrophils, endothelial damage and virulence in vivo. In silico analysis indicated that DUR31 encodes a sodium/substrate symporter with 13 transmembrane domains and no human homologue. We provide evidence that Dur31 transports histatin 5. This is one of the very first examples of microbial driven import of this highly cytotoxic antimicrobial peptide. Also, in contrast to wild type C. albicans, dur31Δ/Δ was unable to actively increase local environmental pH, suggesting that Dur31 lies in the extracellular alkalinization hyphal auto-induction pathway; and, indeed, DUR31 was required for morphogenesis. In agreement with this observation, dur31Δ/Δ was unable to assimilate the polyamine spermidine.
The Novel Candida albicans Transporter Dur31 Is a Multi-Stage Pathogenicity Factor
Mayer, François L.; Wilson, Duncan; Jacobsen, Ilse D.; Miramón, Pedro; Große, Katharina; Hube, Bernhard
2012-01-01
Candida albicans is the most frequent cause of oral fungal infections. However, the exact pathogenicity mechanisms that this fungus employs are largely unknown and many of the genes expressed during oral infection are uncharacterized. In this study we sought to functionally characterize 12 previously unknown function genes associated with oral candidiasis. We generated homozygous knockout mutants for all 12 genes and analyzed their interaction with human oral epithelium in vitro. Eleven mutants caused significantly less epithelial damage and, of these, deletion of orf19.6656 (DUR31) elicited the strongest reduction in pathogenicity. Interestingly, DUR31 was not only involved in oral epithelial damage, but in multiple stages of candidiasis, including surviving attack by human neutrophils, endothelial damage and virulence in vivo. In silico analysis indicated that DUR31 encodes a sodium/substrate symporter with 13 transmembrane domains and no human homologue. We provide evidence that Dur31 transports histatin 5. This is one of the very first examples of microbial driven import of this highly cytotoxic antimicrobial peptide. Also, in contrast to wild type C. albicans, dur31Δ/Δ was unable to actively increase local environmental pH, suggesting that Dur31 lies in the extracellular alkalinization hyphal auto-induction pathway; and, indeed, DUR31 was required for morphogenesis. In agreement with this observation, dur31Δ/Δ was unable to assimilate the polyamine spermidine. PMID:22438810