Inhibition of TC-1 tumor progression by cotransfection of Saxatilin and IL-12 genes mediated by lipofection or electroporation.

Science.gov (United States)

Park, Y S; Kim, K S; Lee, Y K; Kim, J S; Baek, J Y; Huang, L

2009-01-01

Recently, a number of reports have demonstrated that coexpression of therapeutic genes having different anticancer mechanisms is a more effective strategy for anticancer gene therapy than single gene expression. Saxatilin, a novel disintegrin from snake venom, has recently been shown to have potent antiangiogenic functions, such as inhibition of platelet aggregation, bFGF-induced proliferation of HUVEC, and vitronectin-induced smooth muscle cell migration. IL-12 is a well-known immune modulator that promotes Thl-type antitumor immune responses and inhibits angiogenesis as well. The saxatilin and/or IL-12 genes were transfected intratumorally into C57BL/6 mice carrying TC-1 transformed mouse lung endothelial cells by either lipofection or electroporation. The plasmids encoding saxatilin and IL-12 were administered to tumor tissues via novel cationic liposomes consisting of dimyristyl-glutamyl-lysine (DMKE). On the other hand, expression of the genes was also induced by electroporation after naked pDNA injection to the tumor tissues. Lipofection of saxatilin and/or IL-12 genes appeared to be slightly more effective in inhibition of tumor growth than electroporation of the same genes. Cotransfection of saxatilin and IL-12 genes was clearly more effective than individual administration of either gene. This result implies that cotransfection of saxatilin and IL-12 genes represents an innovative modality for anticancer gene therapy.

The Evaluation of IL6 and ESR1 Gene Polymorphisms in Primary Dysmenorrhea.

Science.gov (United States)

Ozsoy, Asker Zeki; Karakus, Nevin; Yigit, Serbulent; Cakmak, Bulent; Nacar, Mehmet Can; Yılmaz Dogru, Hatice

2016-01-01

Primary dysmenorrhea is the most common gynecological complaint with painful menstrual cramps in pelvis without any pathology. It affects about half of menstruating women, and it causes significant disruption in quality of life. We investigated the association between IL6 gene promoter and ESR1 gene XbaI and PvuII polymorphisms and primary dysmenorrhea. In this case-control study, 152 unrelated young women with primary dysmenorrhea and 150 unrelated healthy age-matched controls participated. Genomic DNA was isolated and IL6 and ESR1 gene polymorphisms were genotyped using PCR-based RFLP assay. The distribution of genotype and allele frequencies of IL6 gene promoter and ESR1 gene XbaI polymorphisms were not statistically different between patients and controls (p > 0.05). However, the genotype and allele frequencies of ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls (p = 0.009 and p = 0.021, respectively). Statistically significant associations were also observed between age and married status of primary dysmenorrhea patients and ESR1 gene PvuII polymorphism (p = 0.044 and p = 0.023, respectively). In combined genotype analyses, AG at ESR1 XbaI and TC at ESR1 PvuII loci encoded a p-value of 0.027. Thus, individuals who are heterozygote at both loci have a lower risk of developing primary dysmenorrhea. Our study suggests no strong association between IL6 gene promoter and ESR1 gene XbaI polymorphisms and primary dysmenorrhea in Turkish women. However, ESR1 gene PvuII polymorphism showed statistically significant differences between primary dysmenorrhea patients and controls. The potential association between ESR1 gene PvuII polymorphism and age and married status of dysmenorrhea patients deserves further consideration.

[Cloning of VH and VL Gene of Human anti-IL1RAP McAb and Construction of Recombinant Chimeric Receptor].

Science.gov (United States)

Yin, Ling-Ling; Ruan, Su-Hong; Tian, Yu; Zhao, Kai; Xu, Kai Lin

2015-10-01

To clone the variable region genes of human anti-IL1RAP (IL-1 receptor accessory protein) monoclonal antibodies (McAb) and to construct IL1RAP chimeric antigen receptors (CARs). The VH and VL DNA of IL1RAP single chain antibodies were amplified by RACE and overlap extension PCR from total RNA extracted from 3H6E10 and 10D8A7 hybridoma and ligated into specific IL1RAP single-chain variable fragments (scFv). CD8α transmembrane domain, CD137 intracellular domain, TCR ζ chain, human CD8α signal peptide and scFv-anti-IL1RAP were cloned into plasmid LV-lac. Recombinant lentiviruses were generated by co-transfection of recombinant plasmid LV-lac, pMD2. G, and psPAX2 helper vectors into 293FT packing cells. The VH and VL genes of 2 human anti-IL1RAP McAb were acquired. The 3H6E10 VH and VL genes consisted of 402 bp and 393 bp encoding 134 and 131 aminoacid residues, respectively; 10D8A7 VH and VL genes consisted of 423 bp and 381 bp encoding 141 and 127 amine acid residues, respectively. Recombinant expression vertors LV-3H6E10 scFv-ICD and LV-10D8A7 scFv-ICD (ICD: CD8α transmembrane domain-CD137 intracellular domain-TCR ζ chain) were constructed. The target fragments were demonstrated by sequencing analysis. Recombinant plasmids were transfected into 293FT cells and lentiviral particles were acquired. Human anti-IL1RAP recombinant receptors are constructed successfully and lay a good foundation for the construction of IL1RAP-CAR killer T cell vaccine.

Interleukin 3 gene is located on human chromosome 5 and is deleted in myeloid leukemias with a deletion of 5q

International Nuclear Information System (INIS)

Le Beau, M.M.; Epstein, N.D.; O'Brien, S.J.; Nienhuis, A.W.; Yang, Y.C.; Clark, S.C.; Rowley, J.D.

1987-01-01

The gene IL-3 encodes interleukin 3, a hematopoietic colony-stimulating factor (CSF) that is capable of supporting the proliferation of a broad range of hematopoietic cell types. By using somatic cell hybrids and in situ chromosomal hybridization, the authors localized this gene to human chromosome 5 at bands q23-31, a chromosomal region that is frequently deleted [del(5q)] in patients with myeloid disorders. By in situ hybridization, IL-3 was found to be deleted in the 5q-chromosome of one patient with refractory anemia who had a del(5)(q15q33.3), of three patients with refractory anemia (two patients) or acute nonlymphocytic leukemia (ANLL) de novo who had a similar distal breakpoint [del(5)(q13q33.3)], and of a fifth patient, with therapy-related ANLL, who had a similar distal breakpoint in band q33[del(5)(q14q33.3)]. Southern blot analysis of somatic cell hybrids retaining the normal or the deleted chromosome 5 from two patients with the refractory anemia 5q- syndrome indicated that IL-3 sequences were absent from the hybrids retaining the deleted chromosome 5 but not from hybrids that had a cytologically normal chromosome 5. Thus, a small segment of chromosome 5 contains IL-3, GM-CSF, CSF-1, and FMS. The findings and earlier results indicating that GM-CSF, CSF-1, and FMS were deleted in the 5q- chromosome, suggest that loss of IL-3 or of other CSF genes may play an important role in the pathogenesis of hematologic disorders associated with a del(5q)

The role of interleukin-5 (IL-5 in vivo: studies with IL-5 deficient mice

Directory of Open Access Journals (Sweden)

Klaus I Matthaei

1997-12-01

Full Text Available Eosinophil recruitment is a characteristic feature of a number of pathological conditions and was the topic of the recent International Symposium on allergic inflammation, asthma, parasitic and infectious diseases (Rio de Janeiro, June 3-5, 1996. Since interleukin5 (IL5 is believed to regulate the growth, differentiation and activation of eosinophils (Coffman et al. 1989, Sanderson 1992, the role of eosinophils and IL5 are closely linked. Although IL5 specifically regulates eosinophilia in vivo and this is its most well established activity, it is becoming clear that IL5 also has other biological effects. The recent derivation of an IL5 deficient mouse (Kopf et al. 1996, provides a model for exploring not only the role of IL5 and eosinophils but also other novel activities of IL5. Of note is that although the IL5 deficient mice cannot elicit a pronounced eosinophilia in response to inflammatory stimulation following aeroallergen challenge or parasite infection they still produce basal levels of eosinophils that appear to be morphologically and functionally normal. However, the basal levels of eosinophils appear insufficient for normal host defence as IL5 deficiency has now been shown to compromise defence against several helminth infections. In addition, IL5 deficient mice appear to have functional deficiencies in B-1 B lymphocytes and in IgA production.

IL-1β-specific recruitment of GCN5 histone acetyltransferase induces the release of PAF1 from chromatin for the de-repression of inflammatory response genes.

Science.gov (United States)

Kim, Nari; Sun, Hwa-Young; Youn, Min-Young; Yoo, Joo-Yeon

2013-04-01

To determine the functional specificity of inflammation, it is critical to orchestrate the timely activation and repression of inflammatory responses. Here, we explored the PAF1 (RNA polymerase II associated factor)-mediated signal- and locus-specific repression of genes induced through the pro-inflammatory cytokine interleukin (IL)-1β. Using microarray analysis, we identified the PAF1 target genes whose expression was further enhanced by PAF1 knockdown in IL-1β-stimulated HepG2 hepatocarcinomas. PAF1 bound near the transcription start sites of target genes and dissociated on stimulation. In PAF1-deficient cells, more elongating RNA polymerase II and acetylated histones were observed, although IL-1β-mediated activation and recruitment of nuclear factor κB (NF-κB) were not altered. Under basal conditions, PAF1 blocked histone acetyltransferase general control non-depressible 5 (GCN5)-mediated acetylation on H3K9 and H4K5 residues. On IL-1β stimulation, activated GCN5 discharged PAF1 from chromatin, allowing productive transcription to occur. PAF1 bound to histones but not to acetylated histones, and the chromatin-binding domain of PAF1 was essential for target gene repression. Moreover, IL-1β-induced cell migration was similarly controlled through counteraction between PAF1 and GCN5. These results suggest that the IL-1β signal-specific exchange of PAF1 and GCN5 on the target locus limits inappropriate gene induction and facilitates the timely activation of inflammatory responses.

Cloning and characterization of two duplicated interleukin-17A/F2 genes in common carp (Cyprinus carpio L.): Transcripts expression and bioactivity of recombinant IL-17A/F2.

Science.gov (United States)

Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan

2016-04-01

Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

Extreme expansion of NBS-encoding genes in Rosaceae.

Science.gov (United States)

Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

2015-05-03

Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

[Effects of canine IL-2 and IL-7 genes on enhancing immunogenicity of canine parvovirus VP2 gene vaccine in mice].

Science.gov (United States)

Chen, Huihui; Zhong, Fei; Li, Xiujin; Wang, Lu; Sun, Yan; Neng, Changai; Zhang, Kao; Li, Wenyan; Wen, Jiexia

2012-11-04

To investigate the effects of canine interleukin-2 (cIL-2) and cIL-7 genes on enhancing the immunogenicity of canine parvovirus (CPV) VP2 DNA vaccine. The bicistronic vectors of cIL-2 and cIL-7 genes were constructed using the eukaryotic expression vector containing internal ribosome entry site (IRES). The cIL-2/ cIL-7 dicistronic vector plus previously constructed vectors, including CPV VP2 DNA vaccine vector, cIL-2 vector and cIL-7 vector, were used to co-immunize mice with different combinations, consisting of VP2 alone, VP2 + cIL-2, VP2 + cIL-7 and VP2 + cIL-2/cIL-7. The VP2-specific antibody levels in immunized mice were measured by ELISA at different time post-immunization. The proliferation indices and interferon-gamma expression were measured by lymphocyte proliferation assay and ELISA, respectively. The cIL-2/cIL-7 bicistronic vector was correct and could mediate cIL-2 and cIL-7 gene expression in eukaryotic cells. Immunization results revealed that the antibody titers and the neutralizing antibody levels of the mice co-immunized with VP2 + cIL-7/cIL-2 vectors were significantly higher than that with either VP2 + cIL-2 vectors or VP2 + cIL-7 vectors (P vaccine.

Analysis of IL-6, IL-10 and NF-κB Gene Polymorphisms in Aggressive and Chronic Periodontitis.

Science.gov (United States)

Toker, Hülya; Görgün, Emine Pirim; Korkmaz, Ertan Mahir

2017-06-01

Pro-inflammatory cytokines, interleukin-6 (IL-6), demonstrated to be suppressed by interleukin-10 (IL-10) are known to be regulated by the transcription factor nuclear factor-κB(NF-κB). The aim of this study was to ascertain the association between genetic polymorphism of these genes (IL-6(-174), IL-10(-597) and NF-κB1-94ins/del)) and chronic/aggressive periodontitis. Forty-five patients with chronic periodontitis (CP), 58 patients with aggressive periodontitis (AP) and 38 periodontally healthy subjects were included in this study. Genomic DNA was isolated from whole blood samples. The NF-κB, IL-6, and IL-10 polymorphisms were determined by the polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP) method. Among subjects for the ins/ins genotypes of NF-κB1 gene, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis group than in healthy controls (p=0.023). A statistically significant difference in genotyping frequencies between AP group and healthy controls was observed for the IL-6 gene. The AA genotype of IL-10 was overrepresented in CP and AP groups compared to healthy controls (OR=9.93, 95% CI: 2.11-46.7, OR=5.7, 95% CI: 1.22-26.89, respectively). Within the limits of this study, it can be concluded that the IL-10 (-597) AA genotype is associated with susceptibility to chronic/aggressive periodontitis and IL-6 (-174) GG genotypes and G allele seems to be associated with aggressive periodontitis. Clinical relevance: The results of the current study indicate that IL-6 and IL-10 genotypes seem to be associated with aggressive periodontitis. Also, the AA genotypes of IL-10 presented a higher frequency in chronic periodontitis subjects with carrying NF-κB1 ins/ins genotypes. Copyright© by the National Institute of Public Health, Prague 2017

Reg Gene Expression in Periosteum after Fracture and Its In Vitro Induction Triggered by IL-6

Directory of Open Access Journals (Sweden)

Yasuaki Tohma

2017-10-01

Full Text Available The periosteum is a thin membrane that surrounds the outer surface of bones and participates in fracture healing. However, the molecular signals that trigger/initiate the periosteal reaction are not well established. We fractured the rat femoral bone at the diaphysis and fixed it with an intramedullary inserted wire, and the expression of regenerating gene (Reg I, which encodes a tissue regeneration/growth factor, was analyzed. Neither bone/marrow nor muscle showed Reg I gene expression before or after the fracture. By contrast, the periosteum showed an elevated expression after the fracture, thereby confirming the localization of Reg I expression exclusively in the periosteum around the fractured areas. Expression of the Reg family increased after the fracture, followed by a decrease to basal levels by six weeks, when the fracture had almost healed. In vitro cultures of periosteal cells showed no Reg I expression, but the addition of IL-6 significantly induced Reg I gene expression. The addition of IL-6 also increased the cell number and reduced pro-apoptotic gene expression of Bim. The increased cell proliferation and reduction in Bim gene expression were abolished by transfection with Reg I siRNA, indicating that these IL-6-dependent effects require the Reg I gene expression. These results indicate the involvement of the IL-6/Reg pathway in the osteogenic response of the periosteum, which leads to fracture repair.

A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

Directory of Open Access Journals (Sweden)

Haga Christopher L

2007-09-01

Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

Cloning of human genes encoding novel G protein-coupled receptors

Energy Technology Data Exchange (ETDEWEB)

Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

1994-10-01

We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

Science.gov (United States)

Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

2016-01-01

Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

Association of polymorphic variants of IL-1β and IL-1RN genes in the development of Graves' disease in Kashmiri population (North India).

Science.gov (United States)

Shehjar, Faheem; Afroze, Dil; Misgar, Raiz A; Malik, Sajad A; Laway, Bashir A

2018-04-01

Graves' disease (GD) is a multigenic, organ specific autoimmune disorder with a strong genetic predisposition and IL-1β has been shown to be involved in its pathogenesis. The present study was aimed to determine the genetic associations between polymorphisms of IL-1β gene promoter region (-511 T>C) (rs16944), exon 5 (+3954 C>T) (rs1143634) and IL-1RN gene VNTR (rs2234663) polymorphism in patients with GD in ethnic Kashmiri population. A total of 135 Graves' disease patients and 150 healthy individuals were included in the study. PCR and PCR-based restriction analysis methods were done for IL-1RN VNTR and IL-1β gene polymorphisms respectively. We found statistically significant increased frequencies of the C/C + CT genotype (P = 0.001; odds ratio (OR) = 5.04, 95% confidence interval (CI) = 3.02-8.42) and the C allele (P = 0.001; OR = 3.10, 95% CI = 2.14-4.50) in IL-1β gene promoter polymorphism (rs16944) with GD patients compared to normal controls. Also in the exon 5 (rs1143634), a significant increase in frequency of the C/C homozygous genotype (P = 0.001; OR = 0.18, 95% CI = 0.11-0.30) and C allele (P = 0.001; OR = 0.31, 95% CI = 0.20-0.48) was observed in GD cases as against controls. For IL-1RN VNTR (rs2234663), we didn't observe any significant difference in the allelic and genotypic frequencies between cases and controls. Our findings suggest that both promoter and exon polymorphisms of IL-1β gene have a significant role in the risk of developing GD, whereas IL-1RN VNTR has no association with GD. Copyright © 2018. Published by Elsevier Inc.

Gene polymorphisms and febrile neutropenia in acute leukemia--no association with IL-4, CCR-5, IL-1RA, but the MBL-2, ACE, and TLR-4 are associated with the disease in Turkish patients: a preliminary study.

Science.gov (United States)

Pehlivan, Mustafa; Sahin, Handan Haydaroğlu; Ozdilli, Kurşat; Onay, Hüseyin; Ozcan, Ali; Ozkinay, Ferda; Pehlivan, Sacide

2014-07-01

The aim of this study was to investigate the mannose-binding lectin 2 (MBL-2), interleukin (IL)-4, Toll-like receptor 4 (TLR-4), angiotensin converting enzyme (ACE), chemokine receptor 5 (CCR-5), and IL-1 receptor antagonist (RA) gene polymorphisms (GPs) in acute leukemias (ALs) and to evaluate their roles in febrile neutropenia (FN) resulting from chemotherapy. The study included 60 AL patients hospitalized between the period of July 2001 and August 2006. Polymorphisms for the genes ACE(I/D), CCR-5, IL-1RA, MBL-2, TLR-4, and IL-4 were typed by polymerase chain reaction (PCR) and/or PCR-restriction fragment length polymerase. Genotype frequencies for these genes were compared in the patient and control groups. The relationships between the genotypes and the body distribution of infections, pathogens, the duration of neutropenia, and febrile episodes in AL patients were evaluated. No significant differences in either the genotype distribution or the allelic frequencies of TLR-4, IL-4, CCR-5, IL-1RN GPs were observed between patients and healthy controls. The AB/BB genotype (53.3%) in the MBL-2 gene was found to be significantly higher in the AL patients compared with control groups. There were correlations between the presence of MBL-2, TLR-4, and ACE polymorphisms and clinical parameters due to FN. Overall, bacteremia was more common in MBL BB and ACE DD. Gram-positive bacteremia was more common in ACE for ID versus DD genotype. Gram-negative bacteremia was more common for both the MBL-2 AB/BB genotype and TLR-4 AG genotype. Median durations of febrile episodes were significantly shorter in ACE DD and MBL AB/BB. Although TLR-4, ACE, and MBL-2 GPs have been extensively investigated in different clinical pictures, this is the first study to evaluate the role of these polymorphisms in the genetic etiopathogenesis of FN in patients with ALs. As a conclusion, TLR-4, ACE, and MBL-2 genes might play roles in the genetic etiopathogenesis of FN in patients with ALs.

Do gene polymorphism in IL-1β, TNF-α and IL-6 influence therapeutic response in patients with drug refractory epilepsy?

Science.gov (United States)

Tiwari, Prabhakar; Dwivedi, Rekha; Mansoori, Nasim; Alam, Rizwan; Chauhan, Ugam Kumari; Tripathi, Manjari; Mukhopadhyay, Asok Kumar

2012-09-01

Pro-inflammatory cytokines may play an important pathophysiological role in patients with epilepsy. To understand the role of genes encoding pro-inflammatory cytokines in epilepsy, this study aimed to evaluate the polymorphisms of the promoter regions of IL-1β-511C>T (rs16944), TNF-α-308G>A (rs1800629) and IL-6-174G>C (rs1800795) genes and to look into the interaction between these genes in influencing seizure susceptibility, seizure frequency and response to therapy. The comparative frequency of polymorphism was determined in rs16944, rs1800629 and rs1800795 using PCR-RFLP in a group of 120 persons with epilepsy (PWE) and 110 ethnically matched healthy subjects of comparable age and sex in the North Indian population. Alleles and genotypes of rs16944, rs1800629 and rs1800795 were not found to influence the odds ratio of having susceptibility to epilepsy. Also gene-gene interaction of possible nine combinations of these genes did not show any positive association with epilepsy. The genotype and allelic frequency of rs1800795 showed a significant association (prs16944 and rs1800629 were not found to have such effect. This study demonstrates that the rs16944, rs1800629 and rs1800795 polymorphism does not act as a strong susceptibility factor for epilepsy in North Indian population. The genotypic association of rs1800795 with seizure frequency and drug-refractory epilepsy raises the issue that a specific set of polymorphic genes can influence seizures and therapeutic response in epilepsy. Copyright © 2012 Elsevier B.V. All rights reserved.

Adenovirus-mediated interleukin-12 gene transfer combined with cytosine deaminase followed by 5-fluorocytosine treatment exerts potent antitumor activity in Renca tumor-bearing mice

International Nuclear Information System (INIS)

Hwang, Kyung-Sun; Cho, Won-Kyung; Yoo, Jinsang; Yun, Hwan-Jung; Kim, Samyong; Im, Dong-Soo

2005-01-01

Therapeutic gene transfer affords a clinically feasible and safe approach to cancer treatment but a more effective modality is needed to improve clinical outcomes. Combined transfer of therapeutic genes with different modes of actions may be a means to this end. Interleukin-12 (IL-12), a heterodimeric immunoregulatory cytokine composed of covalently linked p35 and p40 subunits, has antitumor activity in animal models. The enzyme/prodrug strategy using cytosine deaminase (CD) and 5-fluorocytosine (5-FC) has been used for cancer gene therapy. We have evaluated the antitumor effect of combining IL-12 with CD gene transfer in mice bearing renal cell carcinoma (Renca) tumors. Adenoviral vectors were constructed encoding one or both subunits of murine IL-12 (Ad.p35, Ad.p40 and Ad.IL-12) or cytosine deaminase (Ad.CD). The functionality of the IL-12 or CD gene products expressed from these vectors was validated by splenic interferon (IFN)-γ production or viability assays in cultured cells. Ad.p35 plus Ad.p40, or Ad.IL-12, with or without Ad.CD, were administered (single-dose) intratumorally to Renca tumor-bearing mice. The animals injected with Ad.CD also received 5-FC intraperitoneally. The antitumor effects were then evaluated by measuring tumor regression, mean animal survival time, splenic natural killer (NK) cell activity and IFN-γ production. The inhibition of tumor growth in mice treated with Ad.p35 plus Ad.p40 and Ad.CD, followed by injection of 5-FC, was significantly greater than that in mice treated with Ad.CD/5-FC, a mixture of Ad.p35 plus Ad.p40, or Ad.GFP (control). The combined gene transfer increased splenic NK cell activity and IFN-γ production by splenocytes. Ad.CD/5-FC treatment significantly increased the antitumor effect of Ad.IL-12 in terms of tumor growth inhibition and mean animal survival time. The results suggest that adenovirus-mediated IL-12 gene transfer combined with Ad.CD followed by 5-FC treatment may be useful for treating cancers

Efficacy of chimeric DNA vaccines encoding Eimeria tenella 5401 and chicken IFN-γ or IL-2 against coccidiosis in chickens.

Science.gov (United States)

Song, Xiaokai; Huang, Xinmei; Yan, Ruofeng; Xu, Lixin; Li, Xiangrui

2015-09-01

Chimeric DNA vaccines encoding Eimeria tenella (E. tenella) surface antigen 5401 were constructed and their efficacies against E. tenella challenge were studied. The open reading frame (ORF) of 5401 was cloned into the prokaryotic expression vector pGEX-4T2 to express the recombinant protein and the expressed recombinant protein was identified by Western blot. The ORF of 5401 and chicken cytokine gene IFN-γ or IL-2 were cloned into the eukaryotic expression vector pVAX1 consecutively to construct DNA vaccines pVAX-5401-IFN-γ, pVAX-5401-IL-2 and pVAX-5401. The expression of aim genes in vivo was detected by reverse transcription-polymerase chain reaction and Western blot. Fourteen-day-old chickens were inoculated twice at an interval of 7 days with 100 µg of plasmids pVAX-5401, pVAX-5401-IFN-γ and pVAX-5401-IL-2 or 200 µg of recombinant 5401 protein by leg intramuscular injection, respectively. Seven days after the second inoculation, all chickens except the unchallenged control group were challenged orally with 5 × 10(4) sporulated oocysts of E. tenella. Seven days after challenge, all chickens were weighted and slaughtered to determine the effects of immunization. The results showed the recombinant protein was about 90 kDa and reacted with antiserum against soluble sporozoites. The animal experiment showed that all the DNA vaccines pVAX-5401, pVAX-5401-IFN-γ or pVAX-5401-IL-2 and the recombinant 5401 protein could obviously alleviate body weight loss and cecal lesions as compared with non-vaccinated challenged control and empty vector pVAX1control. Furthermore, pVAX-5401-IFN-γ or pVAX-5401-IL-2 induced anti-coccidial index (ACI) of 180.01 or 177.24 which were significantly higher than that of pVAX-5401. The results suggested that 5401 was an effective candidate antigen for vaccine. This finding also suggested that chicken IFN-γ or IL-2 could effectively improve the efficacies of DNA vaccines against avian coccidiosis. Copyright © 2015 Elsevier

Polymorphisms in the TNFA and IL6 genes represent risk factors for autoimmune thyroid disease.

Directory of Open Access Journals (Sweden)

Cecília Durães

Full Text Available Autoimmune thyroid disease (AITD comprises diseases including Hashimoto's thyroiditis and Graves' disease, both characterized by reactivity to autoantigens causing, respectively, inflammatory destruction and autoimmune stimulation of the thyroid-stimulating hormone receptor. AITD is the most common thyroid disease and the leading form of autoimmune disease in women. Cytokines are key regulators of the immune and inflammatory responses; therefore, genetic variants at cytokine-encoding genes are potential risk factors for AITD.Polymorphisms in the IL6-174 G/C (rs1800795, TNFA-308 G/A (rs1800629, IL1B-511 C/T (rs16944, and IFNGR1-56 T/C (rs2234711 genes were assessed in a case-control study comprising 420 Hashimoto's thyroiditis patients, 111 Graves' disease patients and 735 unrelated controls from Portugal. Genetic variants were discriminated by real-time PCR using TaqMan SNP genotyping assays.A significant association was found between the allele A in TNFA-308 G/A and Hashimoto's thyroiditis, both in the dominant (OR = 1.82, CI = 1.37-2.43, p-value = 4.4×10(-5 and log-additive (OR = 1.64, CI = 1.28-2.10, p-value = 8.2×10(-5 models. The allele C in IL6-174 G/C is also associated with Hashimoto's thyroiditis, however, only retained significance after multiple testing correction in the log-additive model (OR = 1.28, CI = 1.06-1.54, p-value = 8.9×10(-3. The group with Graves' disease also registered a higher frequency of the allele A in TNFA-308 G/A compared with controls both in the dominant (OR = 1.85, CI = 1.19-2.87, p-value = 7.0×10(-3 and log-additive (OR = 1.69, CI = 1.17-2.44, p-value = 6.6×10(-3 models. The risk for Hashimoto's thyroiditis and Graves' disease increases with the number of risk alleles (OR for two risk alleles is, respectively, 2.27 and 2.59.This study reports significant associations of genetic variants in TNFA and IL6 with the risk for AITD, highlighting the

New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

DEFF Research Database (Denmark)

2010-01-01

dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

Analysis of the relationship between single nucleotide polymorphism of the CD209, IL-10, IL-28 and CCR5 D32 genes with the human predisposition to developing tick-borne encephalitis

Directory of Open Access Journals (Sweden)

Piotr Czupryna

2017-01-01

Full Text Available Introduction: It is known that in the pathogenesis of tick-borne encephalitis (TBE various molecules play a significant role. The most prominent factors include IL-10, IL-28B, CD-209 and CCR5. It is reasonable to search for genetic predispositions to the development of various clinical forms of TBE related to the genetic variation of IL-10, IL-28B, CD-209 and CCR5. In this study we aimed to search for the relationship between single nucleotide polymorphism in the promoter region of the CD209, IL-10, IL-28 and 32 base pair deletion in CCR5 coding region (Δ 32 with the human predisposition to development of various clinical presentations of TBE. We tried to assess the relation between the presence of particular alleles and genotypes with laboratory and clinical parameters. Material/Methods 59 patients with TBE and 57 people, bitten by a tick who never developed TBE (Polish cohort, were included in the study. To assess the distribution of single nucleotide polymorphisms, TaqMan SNP genotyping assays were used for IL10: rs1800872 and rs1800896, for CD 209 rs4804803 and rs2287886, rs12979860 for IL 28B SNPs according to the manufacturer’s protocol using real-time PCR technology on the StepOne thermal cycler. Results Comparison between TBE patients and CG showed that in SNP rs2287886 CD 209 AG heterozygotes were more frequent in the TBE group, while homozygotes GG were more frequent in the CG group. Conclusions SNP rs2287886 CD 209 AG heterozygotes predispose humans to develop TBE. Single nucleotide polymorphism in the promoter region of the CD209, IL-10, IL-28 and CCR5 D32 genes does not correlate with the severity of TBE.

Identification of a truncated splice variant of IL-18 receptor alpha in the human and rat, with evidence of wider evolutionary conservation

Directory of Open Access Journals (Sweden)

Chris S. Booker

2014-09-01

Full Text Available Interleukin-18 (IL-18 is a pro-inflammatory cytokine which stimulates activation of the nuclear factor kappa beta (NF-κB pathway via interaction with the IL-18 receptor. The receptor itself is formed from a dimer of two subunits, with the ligand-binding IL-18Rα subunit being encoded by the IL18R1 gene. A splice variant of murine IL18r1, which has been previously described, is formed by transcription of an unspliced intron (forming a ‘type II’ IL18r1 transcript and is predicted to encode a receptor with a truncated intracellular domain lacking the capacity to generate downstream signalling. In order to examine the relevance of this finding to human IL-18 function, we assessed the presence of a homologous transcript by reverse transcription-polymerase chain reaction (RT-PCR in the human and rat as another common laboratory animal. We present evidence for type II IL18R1 transcripts in both species. While the mouse and rat transcripts are predicted to encode a truncated receptor with a novel 5 amino acid C-terminal domain, the human sequence is predicted to encode a truncated protein with a novel 22 amino acid sequence bearing resemblance to the ‘Box 1’ motif of the Toll/interleukin-1 receptor (TIR domain, in a similar fashion to the inhibitory interleukin-1 receptor 2. Given that transcripts from these three species are all formed by inclusion of homologous unspliced intronic regions, an analysis of homologous introns across a wider array of 33 species with available IL18R1 gene records was performed, which suggests similar transcripts may encode truncated type II IL-18Rα subunits in other species. This splice variant may represent a conserved evolutionary mechanism for regulating IL-18 activity.

Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

International Nuclear Information System (INIS)

Chisholm, G.E.; Summers, W.C.

1986-01-01

The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

IL-10 down-regulates the expression of survival associated gene hspX of Mycobacterium tuberculosis in murine macrophage

Directory of Open Access Journals (Sweden)

Babban Jee

2017-07-01

Full Text Available Mycobacterium tuberculosis (MTB adopts a special survival strategy to overcome the killing mechanism(s of host immune system. Amongst the many known factors, small heat shock protein 16.3 (sHSP16.3 of MTB encoded by gene hspX has been reported to be critical for the survival of MTB. In the present study, the effect of recombinant murine interferon-gamma (rmIFN-γ and recombinant murine interleukin-10 (rmIL-10 on the expression of gene hspX of MTB in murine macrophage RAW264.7 has been investigated. By real-time RT-PCR, it was observed that three increasing concentrations (5, 25 and 50 ng/ml of rmIFN-γ significantly up-regulated the expression of hspX whereas similar concentrations of rmIL-10 (5, 25 and 50 ng/ml significantly down-regulated the hspX expression. This effect was not only dependent on the concentration of the stimulus but this was time-dependent as well. A contrasting pattern of hspX expression was observed against combinations of two different concentrations of rmIFN-γ and rmIL-10. The study results suggest that rIL-10 mediated down-regulation of hspX expression, in the presence of low concentration of rIFN-γ, could be used as an important strategy to decrease the dormancy of MTB in its host and thus making MTB susceptible to the standard anti-mycobacterial therapy used for treating tuberculosis. However, as these are only preliminary results in the murine cell line model, this hypothesis needs to be first validated in human cell lines and subsequently in animal models mimicking the latent infection using clinical isolates of MTB before considering the development of modified regimens for humans.

IRF5, PTPN22, CD28, IL2RA, KIF5A, BLK and TNFAIP3 genes polymorphisms and lupus susceptibility in a cohort from the Egypt Delta; relation to other ethnic groups.

Science.gov (United States)

Elghzaly, Ashraf A; Metwally, Shereen S; El-Chennawi, Farha A; Elgayaar, Maha A; Mosaad, Youssef M; El-Toraby, Ehab E; Hegab, Mohsen M; Ibrahim, Saleh M

2015-07-01

To replicate a single nucleotide polymorphism (SNP) of known genes for lupus (IRF5 rs10488631, PTPN22 rs2476601, BLK rs2736340 and TNFAIP3 rs5029939) and other autoimmune diseases (CD28 rs1980422, IL2RA rs2104286 and KIF5A rs1678542) on a newly studied Egyptian cohort to investigate the genetic disparity with different studied ethnic groups in relation to lupus susceptibility. 170 Egyptian patients from Egypt Delta with SLE and 241 matched healthy controls were genotyped by Taqman real time PCR for the selected SNPs. The results revealed significant association with IRF5 (p<0.0001) and PTPN22 (p=0.008) and insignificant association with KIF5A, CD28, IL2RA, BLK and TNFAIP3 genes. This study may provide an additional evidence for the association between IRF5 and PTPN22 and lupus susceptibility and may exclude it for CD28, IL2RA, and KIF5A. Copyright © 2015 American Society for Histocompatibility and Immunogenetics. Published by Elsevier Inc. All rights reserved.

IL-1RN gene polymorphism is associated with peri-implantitis

NARCIS (Netherlands)

Laine, Marja L.; Leonhardt, Asa; Roos-Jansaker, Ann-Marie; Salvador Pena, A.; van Winkelhoff, Arie Jan; Winkel, Edwin G.; Renvert, Stefan

Objectives: Interleukin (IL)-1 alpha, IL-1 beta and their natural specific inhibitor IL-1 receptor antagonist (IL-1ra) play a key role in the regulation of the inflammatory response in periodontal tissues. Polymorphisms in the IL-1 gene cluster have been associated with severe adult periodontitis.

The role of genetic variation across IL-1β, IL-2, IL-6, and BDNF in antipsychotic-induced weight gain.

Science.gov (United States)

Fonseka, Trehani M; Tiwari, Arun K; Gonçalves, Vanessa F; Lieberman, Jeffrey A; Meltzer, Herbert Y; Goldstein, Benjamin I; Kennedy, James L; Kennedy, Sidney H; Müller, Daniel J

2015-01-01

Antipsychotics with high weight gain-inducing propensities influence the expression of immune and neurotrophin genes, which have been independently related to obesity indices. Thus, we investigated whether variants in the genes encoding interleukin (IL)-1β, IL-2, and IL-6 and brain-derived neurotrophic factor (BDNF) Val66Met are associated with antipsychotic-induced weight gain (AIWG). Nineteen polymorphisms were genotyped using Taqman(®) assays in 188 schizophrenia patients on antipsychotic treatment for up to 14 weeks. Mean weight change (%) from baseline was compared across genotypic groups using analysis of covariance (ANCOVA). Epistatic effects between cytokine polymorphisms and BDNF Val66Met were tested using Model-Based Multifactor Dimensionality Reduction. In European patients, IL-1β rs16944*GA (P = 0.013, Pcorrected = 0.182), IL-1β rs1143634*G (P = 0.001, Pcorrected = 0.014), and BDNF Val66Met (Val/Val, P = 0.004, Pcorrected = 0.056) were associated with greater AIWG, as were IL-1β rs4849127*A (P = 0.049, Pcorrected = 0.784), and IL-1β rs16944*GA (P = 0.012, Pcorrected = 0.192) in African Americans. BDNF Val66Met interacted with both IL-1β rs13032029 (Val/Met+ TT, PPerm = 0.029), and IL-6 rs2069837 (Val/Val+ AA, PPerm = 0.021) in Europeans, in addition to IL-1β rs16944 (Val/Val+ GA, PPerm = 0.006) in African Americans. SNPs across IL-1β and BDNF Val66Met may influence AIWG. Replication of these findings in larger, independent samples is warranted.

Polymorphisms in the TNFA and IL6 Genes Represent Risk Factors for Autoimmune Thyroid Disease

Science.gov (United States)

Alvelos, Inês; Mendes, Adélia; Santos, Liliana R.; Machado, José Carlos; Melo, Miguel; Esteves, César; Neves, Celestino; Sobrinho-Simões, Manuel; Soares, Paula

2014-01-01

Background Autoimmune thyroid disease (AITD) comprises diseases including Hashimoto's thyroiditis and Graves' disease, both characterized by reactivity to autoantigens causing, respectively, inflammatory destruction and autoimmune stimulation of the thyroid-stimulating hormone receptor. AITD is the most common thyroid disease and the leading form of autoimmune disease in women. Cytokines are key regulators of the immune and inflammatory responses; therefore, genetic variants at cytokine-encoding genes are potential risk factors for AITD. Methods Polymorphisms in the IL6-174 G/C (rs1800795), TNFA-308 G/A (rs1800629), IL1B-511 C/T (rs16944), and IFNGR1-56 T/C (rs2234711) genes were assessed in a case-control study comprising 420 Hashimoto's thyroiditis patients, 111 Graves' disease patients and 735 unrelated controls from Portugal. Genetic variants were discriminated by real-time PCR using TaqMan SNP genotyping assays. Results A significant association was found between the allele A in TNFA-308 G/A and Hashimoto's thyroiditis, both in the dominant (OR = 1.82, CI = 1.37–2.43, p-value = 4.4×10−5) and log-additive (OR = 1.64, CI = 1.28–2.10, p-value = 8.2×10−5) models. The allele C in IL6-174 G/C is also associated with Hashimoto's thyroiditis, however, only retained significance after multiple testing correction in the log-additive model (OR = 1.28, CI = 1.06–1.54, p-value = 8.9×10−3). The group with Graves' disease also registered a higher frequency of the allele A in TNFA-308 G/A compared with controls both in the dominant (OR = 1.85, CI = 1.19–2.87, p-value = 7.0×10−3) and log-additive (OR = 1.69, CI = 1.17–2.44, p-value = 6.6×10−3) models. The risk for Hashimoto's thyroiditis and Graves' disease increases with the number of risk alleles (OR for two risk alleles is, respectively, 2.27 and 2.59). Conclusions This study reports significant associations of genetic variants in TNFA and

Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

Science.gov (United States)

Laing, E; Pretorius, I S

1993-05-01

A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

Science.gov (United States)

Grohmann, L; Brennicke, A; Schuster, W

1992-01-01

The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

Involvement of transcription factor encoded by the mouse mi locus (MITF) in apoptosis of cultured mast cells induced by removal of interleukin-3.

Science.gov (United States)

Tsujimura, T.; Hashimoto, K.; Morii, E.; Tunio, G. M.; Tsujino, K.; Kondo, T.; Kanakura, Y.; Kitamura, Y.

1997-01-01

Mast cells develop when spleen cells of mice are cultured in the medium containing interleukin (IL)-3. Cultured mast cells (CMCs) show apoptosis when they are incubated in the medium without IL-3. We obtained CMCs from tg/tg mice that did not express the transcription factor encoded by the mi gene (MITF) due to the integration of a transgene at its 5' flanking region. MITF is a member of the basic-helix-loop-helix-leucine zipper (bHLH-Zip) protein family of transcription factors. We investigated the effect of MITF on the apoptosis of CMCs after removal of IL-3. When cDNA encoding normal MITF ((+)-MITF) was introduced into tg/tg CMCs with the retroviral vector, the apoptosis of tg/tg CMCs was significantly accelerated. The mutant mi allele represents a deletion of an arginine at the basic domain of MITF. The apoptosis of tg/tg CMCs was not accelerated by the introduction of cDNA encoding mi-MITF. The overexpression of (+)-MITF was not prerequisite to the acceleration of the apoptosis, as the apoptotic process proceeded faster in +/+ CMCs than in mi/mi CMCs. The Ba/F3 lymphoid cell line is also dependent on IL-3, and Ba/F3 cells show apoptosis after removal of IL-3. The c-myc gene encodes another transcription factor of the bHLH-Zip family, and the overexpression of the c-myc gene accelerated the apoptosis of Ba/F3 cells. However, the overexpression of (+)-MITF did not accelerate the apoptosis of Ba/F3 cells. The (+)-MITF appeared to play some roles for the acceleration of the apoptosis specifically in the mast cell lineage. Images Figure 2 Figure 3 Figure 4 Figure 5 Figure 6 Figure 7 PMID:9327738

Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

DEFF Research Database (Denmark)

Krath, Britta N.; Hove-Jensen, Bjarne

1996-01-01

The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

Rapid duplication and loss of nbs-encoding genes in eurosids II

International Nuclear Information System (INIS)

Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

2015-01-01

Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

NARCIS (Netherlands)

Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

1983-01-01

The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

Relationship between XspI Site Polymorphisms of LDL-R Gene and Serum IL-2 and IL-10 in Patients with Hypercholesterolemia.

Science.gov (United States)

Zhang, Mingming; Lu, Yamin; Liu, Xin; Zhang, Xiaobin; Zhang, Cuigai; Gao, Wei; Tie, Yanqing

2016-11-01

Relationship has been identified in sporadic reports between polymorphisms and hypercholesterolemia. However, the relationship between inflammatory cytokines and polymorphism of low-density lipoprotein receptor (LDL-R) gene in hypercholesterolemia is unclear. This study aimed to explore the relationship and significance between polymorphisms of LDL-R gene and serum Interleukin-2 (IL-2), IL-10 in patients with hypercholesterolemia. PCR-RFLP and direct DNA sequencing assay were employed to determine polymorphism of LDL-R gene in 900 patients with hypercholesterolemia and 400 healthy cases. ELISA was applied to assay serum concentration of IL-2 and IL-10. Blood lipid indexes were tested in all cases. Compared with the healthy controls, level of IL-2 increased significantly, while IL-10 decreased significantly (P hypercholesterolemia. © 2016 Wiley Periodicals, Inc.

Molecular cloning and expression of the IL-10 gene from guinea pigs.

Science.gov (United States)

Dirisala, Vijaya R; Jeevan, Amminikutty; Bix, Gregory; Yoshimura, Teizo; McMurray, David N

2012-04-25

The Guinea pig (Cavia porcellus) is one of the most relevant small animals for modeling human tuberculosis (TB) in terms of susceptibility to low dose aerosol infection, the organization of granulomas, extrapulmonary dissemination and vaccine-induced protection. It is also considered to be a gold standard for a number of other infectious and non-infectious diseases; however, this animal model has a major disadvantage due to the lack of readily available immunological reagents. In the present study, we successfully cloned a cDNA for the critical Th2 cytokine, interleukin-10 (IL-10), from inbred Strain 2 guinea pigs using the DNA sequence information provided by the genome project. The complete open reading frame (ORF) consists of 537 base pairs which encodes a protein of 179 amino acids. This cDNA sequence exhibited 87% homology with human IL-10. Surprisingly, it showed only 84% homology with the previously published IL-10 sequence from the C4-deficient (C4D) guinea pig, leading us to clone IL-10 cDNA from the Hartley strain of guinea pig. The IL-10 gene from the Hartley strain showed 100% homology with the IL-10 sequence of Strain 2 guinea pigs. In order to validate the only published IL-10 sequence existing in Genbank reported from C4D guinea pigs, genomic DNA was isolated from tissues of C4D guinea pigs. Amplification with various sets of primers showed that the IL-10 sequence reported from C4D guinea pigs contained numerous errors. Hence the IL-10 sequence that is being reported by us replaces the earlier sequence making our IL-10 sequence to be the first one accurate from guinea pig. Recombinant guinea pig IL-10 proteins were subsequently expressed in both prokaryotic and eukaryotic cells, purified and were confirmed by N-terminal sequencing. Polyclonal anti-IL-10 antibodies were generated in rabbits using the recombinant IL-10 protein expressed in this study. Taken together, our results indicate that the DNA sequence information provided by the genome project

Polymorphic variations in IL-1β, IL-6 and IL-10 genes, their circulating serum levels and breast cancer risk in Indian women.

Science.gov (United States)

Pooja, Singh; Chaudhary, Preeti; Nayak, Lakshma V; Rajender, Singh; Saini, Karan Singh; Deol, Debashish; Kumar, Sandeep; Bid, Hemant Kumar; Konwar, Rituraj

2012-10-01

Cytokines are known as important regulators of the entire gamut of cancer from initiation, invasion and metastasis. This fact and plethora of gene polymorphism data prompted us to investigate cytokine gene polymorphisms in breast cancer (BC) patients. Selected polymorphisms in the IL-1β [-511 T>C (rs16944) and +3954 C>T (rs1143634)]; IL-6 [-174 G>C (rs1800795)]; IL-10 [-1082 A>G (rs1800896), -819 T>C (rs1800871) and -592 A>C (rs1800872)] genes were genotyped in 200 BC patients and 200 healthy volunteers in a case-control study using PCR-RFLP and direct DNA sequencing techniques. Peripheral cytokine levels were measured using ELISA. Allele and genotype data were analyzed for significance of differences between cases and controls using Chi-Square [χ(2)] test. Two sided P-values of less than 0.05 were considered to be statistically significant. Peripheral level of all three cytokines did not show any significant difference between cases and controls. Allele and genotype frequency of IL-1β [-511 T>C (rs16944)] did not show any difference between cases and controls. On the other hand mutant allele and genotype at IL-1β [+3954 C>T (rs1143634)] associated with increased risk of BC. This was also true for pre-menopausal cases and for mutant genotype in post-menopausal cases. Mutant allele and genotypes at IL-6 [-174 G>C (rs1800795)] appeared to be protective in nature such that controls had a higher frequency of both mutant alleles and genotypes. None of the three SNPs in IL-10 gene associated with risk of BC, except significant association of mutant allele and genotypes of -1082 A>G (rs1800896) polymorphism with postmenopausal BC. Mutant allele and genotype at IL-1β [+3954 C>T (rs1143634)] site associated with increased BC risk, while mutant allele and genotypes at IL-6 [-174 G>C (rs1800795)] polymorphism appeared to be protective. Also, there was significant association of mutant allele and genotypes of IL-10 [-1082 A>G (rs1800896)] with postmenopausal BC. None of

The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

Directory of Open Access Journals (Sweden)

LUCIA KUSUMAWATI

2013-09-01

Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

Science.gov (United States)

Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

2006-10-01

We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

A deep auto-encoder model for gene expression prediction.

Science.gov (United States)

Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

2017-11-17

Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

IL1RL1 gene variants and nasopharyngeal IL1RL-a levels are associated with severe RSV bronchiolitis: a multicenter cohort study.

Directory of Open Access Journals (Sweden)

Tina E Faber

Full Text Available Targets for intervention are required for respiratory syncytial virus (RSV bronchiolitis, a common disease during infancy for which no effective treatment exists. Clinical and genetic studies indicate that IL1RL1 plays an important role in the development and exacerbations of asthma. Human IL1RL1 encodes three isoforms, including soluble IL1RL1-a, that can influence IL33 signalling by modifying inflammatory responses to epithelial damage. We hypothesized that IL1RL1 gene variants and soluble IL1RL1-a are associated with severe RSV bronchiolitis.We studied the association between RSV and 3 selected IL1RL1 single-nucleotide polymorphisms rs1921622, rs11685480 or rs1420101 in 81 ventilated and 384 non-ventilated children under 1 year of age hospitalized with primary RSV bronchiolitis in comparison to 930 healthy controls. Severe RSV infection was defined by need for mechanical ventilation. Furthermore, we examined soluble IL1RL1-a concentration in nasopharyngeal aspirates from children hospitalized with primary RSV bronchiolitis. An association between SNP rs1921622 and disease severity was found at the allele and genotype level (p = 0.011 and p = 0.040, respectively. In hospitalized non-ventilated patients, RSV bronchiolitis was not associated with IL1RL1 genotypes. Median concentrations of soluble IL1RL1-a in nasopharyngeal aspirates were >20-fold higher in ventilated infants when compared to non-ventilated infants with RSV (median [and quartiles] 9,357 [936-15,528] pg/ml vs. 405 [112-1,193] pg/ml respectively; p<0.001.We found a genetic link between rs1921622 IL1RL1 polymorphism and disease severity in RSV bronchiolitis. The potential biological role of IL1RL1 in the pathogenesis of severe RSV bronchiolitis was further supported by high local concentrations of IL1RL1 in children with most severe disease. We speculate that IL1RL1a modifies epithelial damage mediated inflammatory responses during RSV bronchiolitis and thus may serve as a

A BCR/ABL-hIL-2 DNA Vaccine Enhances the Immune Responses in BALB/c Mice

Directory of Open Access Journals (Sweden)

Yanan Qin

2013-01-01

Full Text Available The use of a DNA vaccine encoding the BCR/ABL fusion gene is thought to be a promising approach for patients with chronic myeloid leukemia (CML to eradicate minimal residual disease after treatment with chemotherapy or targeted therapy. In this study, our strategy employs genetic technology to create a DNA vaccine encoding the BCR/ABL fusion and human interleukin-2 (hIL-2 genes. The successfully constructed plasmids BCR/ABL-pIRES-hIL-2, BCR/ABL-pIRES, and pIRES-hIL-2 were delivered intramuscularly to BALB/c mice at 14-day intervals for three cycles. The transcription and expression of the BCR/ABL and hIL-2 genes were found in the injected muscle tissues. The interferon-γ (IFN-γ serum levels were increased, and the splenic CD4+/CD8+ T cell ratio was significantly decreased in the BCR/ABL-pIRES-hIL-2-injected mice. Furthermore, specific antibodies against K562 cells could be detected by indirect immunofluorescence. These results indicate that a DNA vaccine containing BCR/ABL and hIL-2 together may elicit increased in vivo humoral and cellular immune responses in BALB/c mice.

Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

Science.gov (United States)

Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

2017-01-01

'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

Interleukin 1 β (IL-1B) and IL-1 antagonist receptor (IL-1RN) gene polymorphisms are associated with the genetic susceptibility and steroid dependence in patients with ulcerative colitis.

Science.gov (United States)

Yamamoto-Furusho, Jesús K; Santiago-Hernández, Jean J; Pérez-Hernández, Nonanzit; Ramírez-Fuentes, Silvestre; Fragoso, José Manuel; Vargas-Alarcón, Gilberto

2011-07-01

Ulcerative colitis (UC) is an inflammatory bowel disease of unknown etiology. Among cytokines induced in UC, interleukin 1 antagonist (IL-1ra) and interleukin 1 β (IL-1β) seems to have a central role because of its immunoregulatory and proinflammatory activities. To determine the association between IL-1RA and IL-1B gene polymorphisms and the clinical features of UC in the Mexican Mestizo population. Five polymorphisms in the IL-1 gene cluster members IL-1B (rs16944), IL1F10 (rs3811058), and IL-1RN (rs419598, rs315952, and rs315951) were genotyped by 5' exonuclease TaqMan genotyping assays in a group of 200 Mexican patients with UC and 248 ethnically matched unrelated healthy controls. We found a significant increased frequencies of IL-1RN6/1 TC (rs315952) and RN6/2 CC (rs315951) and decreased frequency of IL-1B-511 TC (rs16944) genotypes in UC patients as compared with healthy controls. In the subgroup analysis, we found a significant association between the RN6/2 GG (rs315951) and IL-1B-511 CC (rs16944) genotypes and the presence of steroid-dependence in UC patients (pC=00001, OR=15.6 and pC=0.008, OR=4.09, respectively). Patients with UC showed increased frequencies of IL-1RN "CTC" and "TCG" haplotypes when compared with healthy controls (P=0.019, OR=1.43 and P<10(-7), OR=2.63, respectively). Two haplotypes (TTG and CTG) showed decreased frequency in patients when compared with healthy controls (P=9×10(-7), OR=0.11 and P=8×10(-6), OR=0.11, respectively). IL-1 RN and IL-1B polymorphisms were associated with the genetic susceptibility to develop UC and might be associated with the presence of steroid-dependence in UC patients.

Co-administration of avian influenza virus H5 plasmid DNA with chicken IL-15 and IL-18 enhanced chickens immune responses.

Science.gov (United States)

Lim, Kian-Lam; Jazayeri, Seyed Davoud; Yeap, Swee Keong; Alitheen, Noorjahan Banu Mohamed; Bejo, Mohd Hair; Ideris, Aini; Omar, Abdul Rahman

2012-08-06

DNA vaccines offer several advantages over conventional vaccines in the development of effective vaccines against avian influenza virus (AIV). However, one of the limitations of the DNA vaccine in poultry is that it induces poor immune responses. In this study, chicken interleukin (IL) -15 and IL-18 were used as genetic adjuvants to improve the immune responses induced from the H5 DNA vaccination in chickens. The immunogenicity of the recombinant plasmid DNA was analyzed based on the antibody production, T cell responses and cytokine production, following inoculation in 1-day-old (Trial 1) and 14-day-old (Trial 2) specific-pathogen-free chickens. Hence, the purpose of the present study was to explore the role of chicken IL-15 and IL-18 as adjuvants following the vaccination of chickens with the H5 DNA vaccine. The overall HI antibody titer in chickens immunized with pDis/H5 + pDis/IL-15 was higher compared to chickens immunized with pDis/H5 (p chickens exhibited a shorter time to achieve the highest HI titer in comparison to the inoculation of the 1-day-old chickens. The cellular immunity was assessed by the flow cytometry analysis to enumerate CD4+ and CD8 + T cells in the peripheral blood. The chickens inoculated with pDis/H5 + pDis/IL-15 demonstrated the highest increase in CD4+ T cells population relative to the control chickens. However, this study revealed that pDis/H5 + pDis/IL-15 was not significant (P > 0.05) in inducing CD8+ T cells. Meanwhile, with the exception of Trial 1, the flow cytometry results for Trial 2 demonstrated that the pDis/H5 + pDis/IL-18 inoculated group was able to trigger a higher increase in CD4+ T cells than the pDis/H5 group (P 0.05) in modulating CD8+ T cells population in both trials. The pDis/H5 + pDis/IL-15 inoculated group showed the highest IL-15 gene expression in both trials compared to other inoculated groups (P chicken IL-15 and IL-18,with pDis/H5 + pDis/IL-15 being a better vaccine candidate

A preliminary study on the association of single nucleotide polymorphisms of interleukin 4 (IL4, IL13, IL4 receptor alpha (IL4Rα & Toll-like receptor 4 (TLR4 genes with asthma in Indian adults

Directory of Open Access Journals (Sweden)

Parisa Davoodi

2015-01-01

Full Text Available Background & objectives: Interleukin 4 (IL4 and IL13 genes are believed to be responsible for inflammation of the airways in asthmatics. These share a common receptor component called IL4Rα which is another potentially important candidate gene linked to asthma phenotypes. Another gene Toll-like receptor 4 (TLR4 might affect the incidence or progression of asthma through the expression of proinflammatory genes. Several single nucleotide polymorphisms (SNPs in IL4, IL13, IL4Rα and TLR4 have been reported to be linked to asthma or related phenotypes in several ethnic populations using linkage studies and association studies. However, the results have not been consistent. We investigated five SNPs (C-589T and C-33T of IL4, G+2044A of IL13, A+1902G of IL4Rα, and A+896G of TLR4 in patients with adult onset asthma to evaluate their role in manifestation and severity of asthma. Methods: Adult (>18 yr of age patients with asthma (n=100 and healthy controls (n=50 were included in the study. Genotyping was performed using sequenom MassARRAY technology. Results: The mutant alleles of the C-589T and C-33T SNPs in the promoter region of IL4 were present in 4 per cent patients with asthma but absent from the control group suggesting that the variations in IL4 may contribute to asthma occurrence. The SNPs of other genes were seen in both controls and patients. Interpretation & conclusions: The results suggest the possible association between the genetic distribution of C-589T and C-33T SNPs of IL4 with asthma in Indian adults.

Single administration of recombinant IL-6 restores the gene expression of lipogenic enzymes in liver of fasting IL-6-deficient mice

DEFF Research Database (Denmark)

Gavito, A L; Cabello, R; Suarez, J

2016-01-01

BACKGROUND AND PURPOSE: Lipogenesis is intimately controlled by hormones and cytokines as well as nutritional conditions. IL-6 participates in the regulation of fatty acid metabolism in the liver. We investigated the role of IL-6 in mediating fasting/re-feeding changes in the expression of hepatic...... lipogenic enzymes. EXPERIMENTAL APPROACH: Gene and protein expression of lipogenic enzymes were examined in livers of wild-type (WT) and IL-6-deficient (IL-6(-/-) ) mice during fasting and re-feeding conditions. Effects of exogenous IL-6 administration on gene expression of these enzymes were evaluated...

RNA-Seq Analysis of IL-1B and IL-36 Responses in Epidermal Keratinocytes Identifies a Shared MyD88-Dependent Gene Signature.

Science.gov (United States)

Swindell, William R; Beamer, Maria A; Sarkar, Mrinal K; Loftus, Shannon; Fullmer, Joseph; Xing, Xianying; Ward, Nicole L; Tsoi, Lam C; Kahlenberg, Michelle J; Liang, Yun; Gudjonsson, Johann E

2018-01-01

IL-36 cytokines have recently emerged as mediators of inflammation in autoimmune conditions including psoriasis vulgaris (PsV) and generalized pustular psoriasis (GPP). This study used RNA-seq to profile the transcriptome of primary epidermal keratinocytes (KCs) treated with IL-1B, IL-36A, IL-36B, or IL-36G. We identified some early IL-1B-specific responses (8 h posttreatment), but nearly all late IL-1B responses were replicated by IL-36 cytokines (24 h posttreatment). Type I and II interferon genes exhibited time-dependent response patterns, with early induction (8 h) followed by no response or repression (24 h). Altogether, we identified 225 differentially expressed genes (DEGs) with shared responses to all 4 cytokines at both time points (8 and 24 h). These involved upregulation of ligands ( IL1A, IL1B , and IL36G ) and activating proteases ( CTSS ) but also upregulation of inhibitors such as IL1RN and IL36RN . Shared IL-1B/IL-36 DEGs overlapped significantly with genes altered in PsV and GPP skin lesions, as well as genes near GWAS loci linked to autoimmune and autoinflammatory diseases (e.g., PsV, psoriatic arthritis, inflammatory bowel disease, and primary biliary cholangitis). Inactivation of MyD88 adapter protein using CRISPR/Cas9 completely abolished expression responses of such DEGs to IL-1B and IL-36G stimulation. These results provide a global view of IL-1B and IL-36 expression responses in epidermal KCs with fine-scale characterization of time-dependent and cytokine-specific response patterns. Our findings support an important role for IL-1B and IL-36 in autoimmune or autoinflammatory conditions and show that MyD88 adaptor protein mediates shared IL-1B/IL-36 responses.

Polymorphisms of ST2-IL18R1-IL18RAP gene cluster: a new risk for autoimmune thyroid diseases.

Science.gov (United States)

Wang, X; Zhu, Y F; Li, D M; Qin, Q; Wang, Q; Muhali, F S; Jiang, W J; Zhang, J A

2016-02-01

Interleukin 33 (IL33) / ST2 pathway and ST2-interlukin18 receptor1-interlukin18 receptor accessory protein (ST2-IL18R1-IL18RAP) gene cluster have been involved in many autoimmune diseases but few report in autoimmune thyroid diseases (AITD). In this study, we investigated whether polymorphisms of IL33, ST2, IL18R1, and IL18RAP are associated with Graves' disease (GD) and Hashimoto's thyroiditis (HT), two major forms of AITD, among a Chinese population. A total of 11 SNPs were explored in a case-control study including 417 patients with GD, 250 HT patients and 301 controls, including rs1929992, rs10975519, rs10208293, rs6543116, rs1041973, rs3732127, rs11465597, rs1035130, rs2293225, rs1035127, rs917997 of IL 33, ST2-IL18R1-IL18RAP gene cluster. Genotyping of these SNPs was performed using matrix-assisted laser desorption / ionization-time-of-flight mass spectrometer (MALDI-TOF-MS) platform from Sequenom. The frequencies of allele A and AA+AG genotype of rs6543116 (ST2) in HT patients were significantly increased compared with those of the controls (P = 0.029/0.021, OR = 1.31/1.62). And in another SNP rs917997, AA+AG genotype presented an increased frequency in HT subjects compared with controls (P = 0.046, OR = 1.53). Furthermore, the haplotype GAGCCCG from ST2-IL18R1-IL18RAP gene cluster (rs6543116, rs1041973, rs1035130, rs3732127, rs1035127, rs2293225, rs917997) was associated with increased susceptibility to GD with an OR of 2.03 (P = 0.022, 95% CI = 1.07-3.86). Some SNPs of ST2-IL18R1-IL18RAP gene cluster might increase the risk of susceptibility of HT and GD in Chinese Han population. © 2015 John Wiley & Sons Ltd.

Efficacy of In Vivo Electroporation-Mediated IL-10 Gene Delivery on Survival of Skin Flaps.

Science.gov (United States)

Seyed Jafari, S Morteza; Shafighi, Maziar; Beltraminelli, Helmut; Weber, Benedikt; Schmid, Ralph A; Geiser, Thomas; Gazdhar, Amiq; Hunger, Robert E

2018-04-01

Despite advances in understanding the underlying mechanisms of flap necrosis and improvement in surgical techniques, skin flap necrosis after reconstructive surgery remains a crucial issue. We investigated the efficacy of electroporation-mediated IL-10 gene transfer to random skin flap with an aim to accelerate wound healing and improve skin flap survival. Nine male Wistar rats (300-330 g) were divided in two groups (a) control group (n = 5), only surgery no gene transfer, and (b) experimental group, received electroporation-mediated IL-10 gene transfer 24 h before the surgery as prophylaxis (n = 4). Random skin flap (McFarlane) was performed in both groups. Planimetry, Laser Doppler imaging, and immunohistochemistry were used to evaluate the effect of IL-10 gene transfer between study groups at day 7. Electroporation-mediated IL-10 gene transfer decreased percentage of flap necrosis (p value = 0.0159) and increased cutaneous perfusion compared to the control group (p value = 0.0159). In addition, Spearman's rank correlation showed a significant negative correlation between percentage of flap necrosis and Laser Index (p value = 0.0083, r -0.83, respectively). Furthermore, significantly higher mean CD31 + vessel density was detected in the experimental group compared to the control group (p value = 0.0159). Additionally, semi-quantitative image analysis showed lower inflammatory cell count in experimental group compared to control group (p value = 0.0317). In vivo electroporation-mediated IL-10 gene transfer reduced necrosis, enhanced survival and vascularity in the ischemic skin flap.

Impact of genetic variants of IL-6, IL6R, LRP5, ESR1 and SP7 genes on bone mineral density in postmenopausal Mexican-Mestizo women with obesity.

Science.gov (United States)

Méndez, Juan Pablo; Rojano-Mejía, David; Coral-Vázquez, Ramón Mauricio; Coronel, Agustín; Pedraza, Javier; Casas, María José; Soriano, Ruth; García-García, Eduardo; Vilchis, Felipe; Canto, Patricia

2013-10-10

Since obesity and osteoporosis present a high genetic predisposition and polymorphisms of IL-6, IL6R, LRP5, ESR1 and SP7 may influence the risk of both diseases, the aim of this study was to analyze the possible association of polymorphisms in these genes, as well as their haplotypes, with BMD variations in postmenopausal Mexican-Mestizo women with grade 2 or grade 3 obesity. One hundred eighty unrelated postmenopausal women with grade 2 or grade 3 obesity were included. BMD was measured in total hip and lumbar spine by dual-energy X-ray absorptiometry. DNA was obtained from blood leukocytes. Rs1800795 of IL-6, rs2228145 of IL6R, rs3736228 of LRP5, rs9340799 (XbaI) and rs2234693 (PvuII), of ESR1, rs10876432 and rs2016266, of SP7 (and their haplotypes), were studied by real-time PCR allelic discrimination. Deviations from Hardy-Weinberg equilibrium were tested. Pairwise linkage disequilibrium between single nucleotide polymorphisms was calculated by direct correlation r(2), and haplotype analysis was conducted. Using WHO criteria, 54.5% had grade 2 obesity, and 45.5% had grade 3 obesity. Regarding DXA results, 11.1% women had osteoporosis, 41.7% had osteopenia, and 47.2% had normal BMD. Genotype and haplotype analysis showed no significant differences with BMD variations at the lumbar spine, total hip or femoral neck. We did not find a significant association between the polymorphisms analyzed or their haplotypes and BMD variations in postmenopausal women with obesity. The higher BMD observed in women with obesity could be the result of an adaptive response to the higher loading of the skeleton. © 2013 Elsevier B.V. All rights reserved.

5' Region of the human interleukin 4 gene: structure and potential regulatory elements

Energy Technology Data Exchange (ETDEWEB)

Eder, A; Krafft-Czepa, H; Krammer, P H

1988-01-25

The lymphokine Interleukin 4 (IL-4) is secreted by antigen or mitogen activated T lymphocytes. IL-4 stimulates activation and differentiation of B lymphocytes and growth of T lymphocytes and mast cells. The authors isolated the human IL-4 gene from a lambda EMBL3 genomic library. As a probe they used a synthetic oligonucleotide spanning position 40 to 79 of the published IL-4 cDNA sequence. The 5' promoter region contains several sequence elements which may have a cis-acting regulatory function for IL-4 gene expression. These elements include a TATA-box, three CCAAT-elements (two are on the non-coding strand) and an octamer motif. A comparison of the 5' flanking region of the human murine IL-4 gene (4) shows that the region between position -306 and +44 is highly conserved (83% homology).

Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

Science.gov (United States)

Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

2014-01-03

Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

Conditional IL-2 gene deletion: consequences for T cell proliferation

Directory of Open Access Journals (Sweden)

Kendall A Smith

2012-05-01

Full Text Available To explore the role of interleukin-2 (IL-2 in T cell proliferation, and to circumvent the IL-2 deficiency autoimmune syndrome of conventional il2 gene deletion, mice were created to allow conditional il2 gene deletion when treated with the estrogen analogue, tamoxifen (TAM as adults. Splenocytes from four different mouse strains, C57Bl/6 wild type (WT, conventional IL-2 (-/-, TAM-treated Cre recombinase negative (Cre-/IL2fl/fl, and Cre+/IL-2fl/fl (Cre+, were activated with anti-CD3 and anti-CD28, and monitored for CD4+ and CD8+ T cell lymphocyte blastogenesis, aerobic glycolysis, BrdU incorporation into newly synthesized DNA, and CFSE dye dilution to monitor cell division. IL-2 production was monitored by quantitative ELISA and multiple additional cytokines were monitored by protein-bead arrays. Splenocytes from conventional IL-2 (-/- and TAM-treated Cre+ mice resulted in undetectable IL-2 production, so that both strains were IL-2 deficient. As monitored by flow cytometry, activated CD4+ and CD8+ T cells from WT, Cre+ and Cre- mice all underwent blastogenesis, whereas far fewer cells from conventional IL-2 (-/- mice did so. By comparison, only cells from IL-2 sufficient WT and Cre- switched to aerobic glycolysis as evidenced by a drop in media pH. Blastogenesis was mirrored by BrdU incorporation and CFSE dye dilution by CD4+ and CD8+ T cells from WT, Cre+ and Cre- mice, which were all equivalent, while proliferation of cells from conventional IL-2 (-/- mice was compromised. Splenocytes from IL-2 deficient conventional IL-2 (-/- mice produced low or undetectable other γc-chain cytokines (IL-4, IL-7, IL-9, IL-13, IL-15, and IL-21, whereas production of these γc-chain cytokines from IL-2-deficient conditional IL-2 (-/- Cre+ mice were comparable with WT and Cre- mice. These results indicate that CD4+ and CD8+ T cell blastogenesis cannot be attributable to IL-2 alone, but a switch to aerobic glycolysis is attributable to IL-2, and proliferation

Association of interleukin 2 (IL-2), interleukin 6 (IL-6), and TNF-alpha (TNFα) gene polymorphisms with paranoid schizophrenia in a Polish population.

Science.gov (United States)

Paul-Samojedny, Monika; Owczarek, Aleksander; Kowalczyk, Małgorzata; Suchanek, Renata; Palacz, Marta; Kucia, Krzysztof; Fila-Daniłow, Anna; Borkowska, Paulina; Kowalski, Jan

2013-01-01

Numerous reports have brought attention to the potential role of cytokines in schizophrenia. The aim of the study was to determine whether polymorphisms of IL-2, IL-6, and TNFα genes are risk factors for development of paranoid schizophrenia in a Polish population. Promoter polymorphisms of IL-6 (rs1800795), TNFα (rs1800629), and IL-2 (rs2069762) genes in patients (N=115) and controls (N=135) were genotyped by PCR-RFLP and AS-PCR methods, respectively. Genotype TT and allele T for IL-2 polymorphism, and genotype AA and allele A for TNFα polymorphism were found to be significantly associated with paranoid schizophrenia. Similarly, haplotypes CTA and GTA increased the risk (4.4 times and 5.9 times, respectively) of schizophrenia. To reveal associations between Positive and Negative Symptom Scale subscales and age at onset of schizophrenia, the authors used a novel method called Grade Correspondence Analysis. This analysis revealed that patients with early age at onset have higher scores on the Negative and General subscales of PANSS, and, in that group of patients, haplotype CTA was the most represented. As far as is known, this analysis was used for the first time with reference to genetic data.

Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

Science.gov (United States)

Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

Association of duffy blood group gene polymorphisms with IL8 gene in chronic periodontitis.

Directory of Open Access Journals (Sweden)

Emília Ângela Sippert

Full Text Available The antigens of the Duffy blood group system (DARC act as a receptor for the interleukin IL-8. IL-8 plays an important role in the pathogenesis of chronic periodontitis due to its chemotactic properties on neutrophils. The aim of this study was to investigate a possible association of Duffy blood group gene polymorphisms with the -353T>A, -845T>C and -738T>A SNPs of the IL8 gene in chronic periodontitis. One hundred and twenty-four individuals with chronic periodontitis and 187 controls were enrolled. DNA was extracted using the salting-out method. The Duffy genotypes and IL8 gene promoter polymorphisms were investigated by PCR-RFLP. Statistical analyses were conducted using the Chi square test with Yates correction or Fisher's Exact Test, and the possibility of associations were evaluated by odds ratio with a 95% confidence interval. When analyzed separately, for the Duffy blood group system, differences in the genotype and allele frequencies were not observed between all the groups analyzed; and, in nonsmokers, the -845C allele (3.6% vs. 0.4%, -845TC genotype (7.3% vs. 0.7% and the CTA haplotype (3.6% vs. 0.4% were positively associated with chronic periodontitis. For the first time to our knowledge, the polymorphisms of erythroid DARC plus IL8 -353T>A SNPs were associated with chronic periodontitis in Brazilian individuals. In Afro-Brazilians patients, the FY*02N.01 with IL8 -353A SNP was associated with protection to chronic periodontitis.

Association of duffy blood group gene polymorphisms with IL8 gene in chronic periodontitis.

Science.gov (United States)

Sippert, Emília Ângela; de Oliveira e Silva, Cléverson; Visentainer, Jeane Eliete Laguila; Sell, Ana Maria

2013-01-01

The antigens of the Duffy blood group system (DARC) act as a receptor for the interleukin IL-8. IL-8 plays an important role in the pathogenesis of chronic periodontitis due to its chemotactic properties on neutrophils. The aim of this study was to investigate a possible association of Duffy blood group gene polymorphisms with the -353T>A, -845T>C and -738T>A SNPs of the IL8 gene in chronic periodontitis. One hundred and twenty-four individuals with chronic periodontitis and 187 controls were enrolled. DNA was extracted using the salting-out method. The Duffy genotypes and IL8 gene promoter polymorphisms were investigated by PCR-RFLP. Statistical analyses were conducted using the Chi square test with Yates correction or Fisher's Exact Test, and the possibility of associations were evaluated by odds ratio with a 95% confidence interval. When analyzed separately, for the Duffy blood group system, differences in the genotype and allele frequencies were not observed between all the groups analyzed; and, in nonsmokers, the -845C allele (3.6% vs. 0.4%), -845TC genotype (7.3% vs. 0.7%) and the CTA haplotype (3.6% vs. 0.4%) were positively associated with chronic periodontitis. For the first time to our knowledge, the polymorphisms of erythroid DARC plus IL8 -353T>A SNPs were associated with chronic periodontitis in Brazilian individuals. In Afro-Brazilians patients, the FY*02N.01 with IL8 -353A SNP was associated with protection to chronic periodontitis.

Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

International Nuclear Information System (INIS)

Nebohacova, M.

2000-01-01

Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

IL-20 gene expression is induced by IL-1beta through mitogen-activated protein kinase and NF-kappaB-dependent mechanisms

DEFF Research Database (Denmark)

Otkjaer, Kristian; Kragballe, Knud; Johansen, Claus

2007-01-01

IL-20 is a novel member of the IL-10 cytokine family with pleiotropic effects. Current knowledge of what triggers and regulates IL-20 gene expression is sparse. The aim of this study was to investigate the regulation of IL-20 expression in cultured normal human keratinocytes. The expression of IL...

Replication by the Epistasis Project of the interaction between the genes for IL-6 and IL-10 in the risk of Alzheimer's disease

Science.gov (United States)

Combarros, Onofre; van Duijn, Cornelia M; Hammond, Naomi; Belbin, Olivia; Arias-Vásquez, Alejandro; Cortina-Borja, Mario; Lehmann, Michael G; Aulchenko, Yurii S; Schuur, Maaike; Kölsch, Heike; Heun, Reinhard; Wilcock, Gordon K; Brown, Kristelle; Kehoe, Patrick G; Harrison, Rachel; Coto, Eliecer; Alvarez, Victoria; Deloukas, Panos; Mateo, Ignacio; Gwilliam, Rhian; Morgan, Kevin; Warden, Donald R; Smith, A David; Lehmann, Donald J

2009-01-01

Background Chronic inflammation is a characteristic of Alzheimer's disease (AD). An interaction associated with the risk of AD has been reported between polymorphisms in the regulatory regions of the genes for the pro-inflammatory cytokine, interleukin-6 (IL-6, gene: IL6), and the anti-inflammatory cytokine, interleukin-10 (IL-10, gene: IL10). Methods We examined this interaction in the Epistasis Project, a collaboration of 7 AD research groups, contributing DNA samples from 1,757 cases of AD and 6,295 controls. Results We replicated the interaction. For IL6 rs2069837 AA × IL10 rs1800871 CC, the synergy factor (SF) was 1.63 (95% confidence interval: 1.10–2.41, p = 0.01), controlling for centre, age, gender and apolipoprotein E ε4 (APOEε4) genotype. Our results are consistent between North Europe (SF = 1.7, p = 0.03) and North Spain (SF = 2.0, p = 0.09). Further replication may require a meta-analysis. However, association due to linkage disequilibrium with other polymorphisms in the regulatory regions of these genes cannot be excluded. Conclusion We suggest that dysregulation of both IL-6 and IL-10 in some elderly people, due in part to genetic variations in the two genes, contributes to the development of AD. Thus, inflammation facilitates the onset of sporadic AD. PMID:19698145

Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

Science.gov (United States)

Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

2018-03-01

Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

Science.gov (United States)

Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

2016-06-28

In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

Gene expression profiling of the Notch-AhR-IL22 axis at homeostasis and in response to tissue injury.

Science.gov (United States)

Weidenbusch, Marc; Rodler, Severin; Song, Shangqing; Romoli, Simone; Marschner, Julian A; Kraft, Franziska; Holderied, Alexander; Kumar, Santosh; Mulay, Shrikant R; Honarpisheh, Mohsen; Kumar Devarapu, Satish; Lech, Maciej; Anders, Hans-Joachim

2017-12-22

Notch and interleukin-22 (IL-22) signaling are known to regulate tissue homeostasis and respond to injury in humans and mice, and the induction of endogenous aryl hydrocarbon receptor (Ahr) ligands through Notch links the two pathways in a hierarchical fashion. However in adults, the species-, organ- and injury-specific gene expression of the Notch-AhR-IL22 axis components is unknown. We therefore performed gene expression profiling of DLL1, DLL3, DLL4, DLK1, DLK2, JAG1, JAG2, Notch1, Notch2, Notch3, Notch4, ADAM17/TNF-α ADAM metalloprotease converting enzyme (TACE), PSEN1, basigin (BSG)/CD147, RBP-J, HES1, HES5, HEY1, HEYL, AHR, ARNT, ARNT2, CYP1A1, CYP24A1, IL-22, IL22RA1, IL22RA2, IL10RB, and STAT3 under homeostatic conditions in ten mature murine and human organs. Additionally, the expression of these genes was assessed in murine models of acute sterile inflammation and progressive fibrosis. We show that there are organ-specific gene expression profiles of the Notch-AhR-IL22 axis in humans and mice. Although there is an overall interspecies congruency, specific differences between human and murine expression signatures do exist. In murine tissues with AHR/ARNT expression CYP1A1 and IL-22 were correlated with HES5 and HEYL expression, while in human tissues no such correlation was found. Notch and AhR signaling are involved in renal inflammation and fibrosis with specific gene expression changes in each model. Despite the presence of all Notch pathway molecules in the kidney and a model-specific induction of Notch ligands, IL-22 was only up-regulated in acute inflammation, but rapidly down-regulated during regeneration. This implies that for targeting injury responses, e.g. via IL-22, species-specific differences, injury type and time points have to be considered. © 2017 The Author(s).

Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

DEFF Research Database (Denmark)

Kovacs, J A; Powell, F; Edman, J C

1993-01-01

hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

Expression of prophage-encoded endolysins contributes to autolysis of Lactococcus lactis.

Science.gov (United States)

Visweswaran, Ganesh Ram R; Kurek, Dorota; Szeliga, Monika; Pastrana, Francisco Romero; Kuipers, Oscar P; Kok, Jan; Buist, Girbe

2017-02-01

Analysis of autolysis of derivatives of Lactococcus lactis subsp. cremoris MG1363 and subsp. lactis IL1403, both lacking the major autolysin AcmA, showed that L. lactis IL1403 still lysed during growth while L. lactis MG1363 did not. Zymographic analysis revealed that a peptidoglycan hydrolase activity of around 30 kDa is present in cell extracts of L. lactis IL1403 that could not be detected in strain MG1363. A comparison of all genes encoding putative peptidoglycan hydrolases of IL1403 and MG1363 led to the assumption that one or more of the 99 % homologous 27.9-kDa endolysins encoded by the prophages bIL285, bIL286 and bIL309 could account for the autolysis phenotype of IL1403. Induced expression of the endolysins from bIL285, bIL286 or bIL309 in L. lactis MG1363 resulted in detectable lysis or lytic activity. Prophage deletion and insertion derivatives of L. lactis IL1403 had a reduced cell lysis phenotype. RT-qPCR and zymogram analysis showed that each of these strains still expressed one or more of the three phage lysins. A homologous gene and an endolysin activity were also identified in the natural starter culture L. lactis subsp. cremoris strains E8, Wg2 and HP, and the lytic activity could be detected under growth conditions that were identical as those used for IL1403. The results presented here show that these endolysins of L. lactis are expressed during normal growth and contribute to autolysis without production of (lytic) phages. Screening for natural strains expressing homologous endolysins could help in the selection of strains with enhanced autolysis and, thus, cheese ripening properties.

Analysis of gene expression of myo1c and inpp5k genes involved in endometrial adenocarcinoma

International Nuclear Information System (INIS)

Koul, A.M.; Nadeem, A.; Baryalai, P.

2012-01-01

Abstract: Inpp5k gene encodes a protein which plays a very vital role in a number of metabolic pathways. It is very significant in the glucose metabolism where it regulates the signalling of the insulin pathway. But the full molecular details of the pathways regulated by Inpp5k encoded protein are not known. It is speculated that Inpp5k gene expression is altered in case of endometrial adenocarcinoma. Myolc gene encodes for a protein called Myosin-lc which acts an actin-based molecular motor in the cells. II has been studied that this gene down-regulates during endometrial adenocarcinoma and colorectal cancers. In this study the expression analysis of these two was carried out using multiplex PCR. An endogenous control was used for this PCR. ACTS gene served as the endogenous control because of it being a house keeping gene. It thus shows a universal expression in all cells. Thus in this study the gene expression of Inpp5k and Myulc genes was comparatively analysed with ACTS gene. The results that came out of this study showed an over-expression of Inpp5k gene and down-regulation of myolc gene with respect to ACTS gene in cancer cell lines as was indicated by the previous studies with these genes. Expression of both genes i.e. Inpp5k and Myolc was statistically compared between normal and cancerous cell lines and was found statistically significant at a value of P< O.O I in most of the cases. (author)

Analysis of IL-12 p40 subunit gene and IFN-γ G5644A polymorphisms in Idiopathic Pulmonary Fibrosis

Directory of Open Access Journals (Sweden)

Welsh Kenneth I

2003-06-01

Full Text Available Abstract Background Genes encoding cytokine mediators are prime candidates for genetic analysis in conditions with T-helper (Th cell disease driven imbalance. Idiopathic Pulmonary Fibrosis (IPF is a predominantly Th2 mediated disease associated with a paucity of interferon-gamma (IFN-γ. The paucity of IFN-γ may favor the development of progressive fibrosis in IPF. Interleukin-12 (IL-12 plays a key role in inducing IFN-γ production. The aim of the current study was to assess whether the 1188 (A/C 3'UTR single nucleotide polymorphism (SNP in the IL-12 p40 subunit gene which was recently found to be functional and the 5644 (G/A 3' UTR SNP of the IFN-γ gene were associated with susceptibility to IPF. Methods We investigated the allelic distribution in these loci in UK white Caucasoid subjects comprising 73 patients with IPF and 157 healthy controls. The SNPs were determined using the polymerase chain reaction in association with sequence-specific primers incorporating mismatches at the 3'-end. Results Our results showed that these polymorphisms were distributed similarly in the IPF and control groups Conclusion We conclude that these two potentially important candidate gene single nucleotide polymorphisms are not associated with susceptibility to IPF.

The Effect of IL-4 Gene Polymorphisms on Cytokine Production in Patients with Chronic Periodontitis and in Healthy Controls

Directory of Open Access Journals (Sweden)

Jirina Bartova

2014-01-01

Full Text Available Chronic periodontitis (CP is an inflammatory disease of the teeth-supporting tissues in which genetic predisposition, dental plaque bacteria, and immune mechanisms all play important roles. The aim of this study was to evaluate the occurrence of IL-4 gene polymorphisms in chronic periodontitis and to investigate the association between polymorphisms and cytokines production after bacterial stimulation. Sixty-two subjects (47 CP patients and 15 healthy controls with detected two polymorphisms in the IL-4 gene (-590C/T and intron 3 VNTR were examined. Production of cytokines (IL-1α, IL-1β, IL-4, IL-5, IL-6, IL-10, IL-17, TNFα, INFγ, and VEGF was studied after in vitro stimulation of isolated peripheral blood by mitogens (Pokeweed mitogen, Concanavalin A, dental plaque bacteria (Aggregatibacter actinomycetemcomitans, Tannerella forsythia, Porphyromonas gingivalis, and Prevotella intermedia, and Heat Shock Protein (HSP 70 by the Luminex multiplex cytokine analysis system. The results were correlated with IL-4 genotypes in patients with CP and healthy controls. The mononuclear cells isolated from peripheral blood of CP patients with selected IL-4 polymorphisms significantly altered the production of IFNγ, IL-10, IL-1β, IL-1α, TNFα, and IL-6 after stimulation by HSP 70 or selected bacteria (from P<0.001 to P<0.05. IL-4 gene polymorphisms may influence the function of mononuclear cells to produce not only interleukin-4 but also other cytokines, especially in patients with CP.

Fasting induces IL-1 resistance and free fatty acid-mediated up-regulation of IL-1R2 and IL-1RA

Directory of Open Access Journals (Sweden)

jenifer j joesting

2014-07-01

Full Text Available Objective: Weight loss is a near societal obsession and many diet programs use significant calorie restriction (CR including fasting/short term starvation to generate rapid effects. Fasting is also a well-recognized cause of immunosuppression especially within the innate immune system. In this study, we sought to determine if the IL-1 arm of the neuroimmune system was down-regulated by a 24 hr fast and how fasting might generate this effect. Design: Mice were allowed ad libitum access to food or had food withheld for 24 hrs. Expression of the endogenous IL-1 antagonists IL-1 receptor type 2 (IL-1R2 and IL-1 receptor antagonist (IL-1RA were determined as were sickness behaviors before and after IL-1 administration.Results: Fasting markedly increased gene expression of IL-1R2 (83-fold in adipose tissue, 9.5-fold in liver and IL-1RA (68-fold in liver. Fasted mice were protected from IL-1-induced weight loss, hypoglycemia, loss of locomotor and social anxiety. These protections were coupled to a large positive interaction of fasting and IL-1 on IL-1R2 gene expression in adipose tissue and liver (2.6-fold and 1.6-fold, respectively. Fasting not only increased IL-1RA and IL-1R2 protein 2.5-fold and 3.2-fold, respectively, in liver; but also increased IL-1R2 1.8-fold in adipose tissue. Fasting, in turn, triggered a 2.4-fold increase in plasma free-fatty acids (FFAs and a 2.1-fold increase in plasma corticosterone. Inhibition, of glucocorticoid action with mifepristone did not impact fasting-dependent IL-1R2 or IL-1RA gene expression. Administration of the FFA, palmitate, to mice increased liver IL-1R2 and IL-1RA gene expression by 14-fold and 11-fold, respectively. Conclusion: These findings indicate that fasting augments expression of endogenous IL-1 antagonists inducing IL-1 resistance. Fasting-induced increases in plasma FFAs appears to be a signal that drives immunosuppression during fasting/short term starvation.

Genome-wide identification of structural variants in genes encoding drug targets

DEFF Research Database (Denmark)

Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

2012-01-01

The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

IL-33 Enhanced the Proliferation and Constitutive Production of IL-13 and IL-5 by Fibrocytes

Directory of Open Access Journals (Sweden)

Hisako Hayashi

2014-01-01

Full Text Available Interleukin-33 appears to play important roles in the induction of allergic airway inflammation. However, whether IL-33 is involved in airway remodeling remains unclear. Because fibrocytes contribute to tissue remodeling in the setting of chronic inflammation, we examined the effects of IL-33 on fibrocyte functions. Fibrocytes were generated in vitro from peripheral blood mononuclear cells by culturing in the presence of platelet derived growth factors and the cells were stimulated with IL-33. IL-33 enhanced cell proliferation, α-SMA expression, and pro-MMP-9 activity by the fibrocytes without increasing endogenous transforming growth factor-β1 production. Fibrocytes constitutively expressed IL-13 and IL-5, and their production was augmented by stimulation with IL-33. Dexamethasone inhibited the functions of fibrocytes, but IL-33 made fibrocytes slightly refractory to the inhibitory effect of dexamethasone in terms of IL-13 production. Montelukast suppressed IL-13 production by nonstimulated fibrocytes but not those stimulated by IL-33. These findings suggest that IL-33 is involved in the airway remodeling process through its modulation of fibrocyte function independent of antigen stimulation. IL-33 might partially reduce the therapeutic effects of glucocorticoid and cysteinyl leukotriene receptor antagonist on fibrocyte-mediated Th2 responses.

The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

Directory of Open Access Journals (Sweden)

Paola Di Meglio

2011-02-01

Full Text Available IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A and common (G allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

The IL23R R381Q gene variant protects against immune-mediated diseases by impairing IL-23-induced Th17 effector response in humans.

Science.gov (United States)

Di Meglio, Paola; Di Cesare, Antonella; Laggner, Ute; Chu, Chung-Ching; Napolitano, Luca; Villanova, Federica; Tosi, Isabella; Capon, Francesca; Trembath, Richard C; Peris, Ketty; Nestle, Frank O

2011-02-22

IL-23 and Th17 cells are key players in tissue immunosurveillance and are implicated in human immune-mediated diseases. Genome-wide association studies have shown that the IL23R R381Q gene variant protects against psoriasis, Crohn's disease and ankylosing spondylitis. We investigated the immunological consequences of the protective IL23R R381Q gene variant in healthy donors. The IL23R R381Q gene variant had no major effect on Th17 cell differentiation as the frequency of circulating Th17 cells was similar in carriers of the IL23R protective (A) and common (G) allele. Accordingly, Th17 cells generated from A and G donors produced similar amounts of Th17 cytokines. However, IL-23-mediated Th17 cell effector function was impaired, as Th17 cells from A allele carriers had significantly reduced IL-23-induced IL-17A production and STAT3 phosphorylation compared to G allele carriers. Our functional analysis of a human disease-associated gene variant demonstrates that IL23R R381Q exerts its protective effects through selective attenuation of IL-23-induced Th17 cell effector function without interfering with Th17 differentiation, and highlights its importance in the protection against IL-23-induced tissue pathologies.

Maternal Genetic Variants of IL4/IL13 Pathway Genes on IgE With "Western or Eastern Environments/Lifestyles".

Science.gov (United States)

Zhang, Guicheng; Khoo, Siew-Kim; Mäkelä, Mika J; Candelaria, Pierre; Hayden, Catherine M; von Hertzen, Leena; Laatikainen, Tiina; Vartiainen, Erkki; Goldblatt, Jack; Haahtela, Tari; LeSouëf, Peter N

2014-07-01

We investigated maternal genetic effects of four IL-4/IL-13 pathway genes as well as their interactions with the "Western or Eastern lifestyles/environments" on IgE in Karelian children. This study included 609 children and their mothers. Total IgE levels in children and mothers were measured and 10 single nucleotide polymorphisms (SNPs) in IL-4, IL-4Ra, IL-13, and STAT6 were genotyped in mothers and their children. The maternal G allele of IL-13 130 (rs20541) was significantly (P=0.001) associated with decreased IgE in children in the Karelian population (Pooling Finnish and Russian children), as well as in Finnish (P=0.030) and Russian children (P=0.018). The IgE levels were significantly (P=0.001) higher in Russian children whose mothers were homozygous for the G allele of the IL-4Ra 50 (rs1805010) SNP than that in Russian children of mothers who were AG heterozygotes or AA homozygotes. After accounting for children's genotypes, we observed interactive effects on children's IgE for maternal IL-13 130 genotypes (P=0.014) and maternal IL-4Ra 50 genotypes (P=0.0003) with "Western or Eastern" lifestyles/environments. With the adjustment for multiple comparisons using a false discovery rate (FDR) of 0.05, the interactive effect of the maternal IL-4Ra50 SNP was significant. Maternal genetic variants in IL-4/IL-13 pathway genes, such as IL-13 130 and IL-4Ra50, influenced IgE levels in school children that were independent of the children's genetic effects. These effects differ in "Western or Eastern" environments.

Adenovirus-mediated IL-12 gene therapy in combination with radiotherapy for murine liver cancer

International Nuclear Information System (INIS)

Wei Daoyan; Dai Bingbing; Wang Zhonghe; Chen Shishu

2001-01-01

Objective: To investigate the synergistic antitumor effects of adenovirus-mediated IL-12 gene therapy in combination with radiotherapy in mice bearing liver cancer. Methods: Balb/c mice bearing liver cancer received the treatment at day 1 with tumor local irradiation (TLI) of 20 Gy or mask irradiation when tumor size reached 0.6-1.0 cm. Within 1 hour after irradiation, adenovirus containing IL-12 gene or PBS was intra-tumor injected once a week. Forty-eight hours after the second injection, IFN-γ levels in sera and the supernatant of cultured spleen cells were assayed by ELISA, CTL activity of spleen cells was measured by 3 H-TdR release assay, and phenotypes of tumor-infiltrating lymphocytes were analysed by immunohistochemical staining. Results: The growth of tumors in animals treated with a combination of IL-12 gene therapy and TLI was inhibited more significantly than those with either single treatment (P + and CD8 + lymphocyte infiltration and tumor-specific cytolytic activities, and the levels of IFN-γ in sera were higher in IL-12 gene therapy and IL-12 gene therapy combined with TLI groups. Conclusion: These results suggest that IL-12 gene therapy combined with radiotherapy is more effective than both single treatment modalities and can induce specific antitumor immuno-response greatly

Note of the methodological flaws in the paper entitled "Polymorphisms in IL-4/IL-13 pathway genes and glioma risk: an updated meta-analysis".

Science.gov (United States)

Wang, Ting-Ting; Li, Jin-Mei; Zhou, Dong

2016-01-01

With great interest, we read the paper "Polymorphisms in IL-4/IL-13 pathway genes and glioma risk: an updated meta-analysis" (by Chen PQ et al.) [1], which has reached important conclusions about the relationship between polymorphisms in interleukin (IL)-4/IL-13 pathway genes and glioma risk. Through quantitative analysis, the meta-analysis found no association between IL-4/IL-13 pathway genetic polymorphisms and glioma risk (Chen et al. in Tumor Biol 36:121-127, 2015). The meta-analysis is the most comprehensive study of polymorphisms in the IL-4/IL-13 pathway and glioma risk. Nevertheless, some deficiencies still exist in this meta-analysis that we would like to raise.

Polymorphism in the 5' upstream regulatory and 3' untranslated regions of the HLA-G gene in relation to soluble HLA-G and IL-10 expression

DEFF Research Database (Denmark)

Hviid, Thomas Vauvert F; Rizzo, Roberta; Melchiorri, Loredana

2006-01-01

The nonclassical human leukocyte antigen (HLA) class Ib gene HLA-G may be important for the induction and maintenance of immune tolerance between the mother and the semi-allogeneic fetus during pregnancy. Expression of HLA-G can influence cytokine and cytotoxic T-lymphocyte responses. Different HLA......-G peripheral blood mononuclear cells after lipopolysaccharide (LPS) stimulation. This study finds that polymorphism in the 5' upstream regulatory region (5'URR) of the HLA-G gene may also be implicated in differences in IL-10 secretion. However, this may also be due to linkage disequilibrium with the 14-bp...

PROMOTER POLYMORPHISM OF IL-1β GENE IN PATIENTS WITH A HISTORY OF ACUTE MYOCARDIAL INFARCTION

Directory of Open Access Journals (Sweden)

A. V. Shevchenko

2010-01-01

Full Text Available We have performed analysis of associations between IL-1β gene promoter polymorphism (-511C/T and -31 T/C variants, and conventional cardiovascular risk factors in the patients living in the West Siberia who had previously a history of myocardial infarction (MI. We are shown a strong linkage disequilibrium between IL-1β -31C/T (rs1143627, and IL-1β-511T/C (rs16944. Significant differences in frequency distributions of some compound genotypes were observed between healthy and patients with a history of MI. E.g., frequency of IL-1β-31CC/-511CT genotype was detected in 5.5 % of healthy population, while being absent among MI patients. A frequency of IL-1β (-31/-511 CC/CT genotype showed significant differences between MI patients under 55 years, as compared to healthy persons. Hence, the analyzed IL-1β promoter polymorphisms may be considered as an additional constitutional factor predisposing for vascular alterations.

Role of the IL-12/IL-35 balance in patients with Sjögren syndrome.

Science.gov (United States)

Fogel, Olivier; Rivière, Elodie; Seror, Raphaèle; Nocturne, Gaetane; Boudaoud, Saida; Ly, Bineta; Gottenberg, Jacques-Eric; Le Guern, Véronique; Dubost, Jean-Jacques; Nititham, Joanne; Taylor, Kimberly E; Chanson, Philippe; Dieudé, Philippe; Criswell, Lindsey A; Jagla, Bernd; Thai, Alice; Mingueneau, Michael; Mariette, Xavier; Miceli-Richard, Corinne

2017-09-12

An interferon signature is involved in the pathogenesis of primary Sjögren syndrome (pSS), but whether the signature is type 1 or type 2 remains controversial. Mouse models and genetic studies suggest the involvement of T H 1 and type 2 interferon pathways. Likewise, polymorphisms of the IL-12A gene (IL12A), which encodes for IL-12p35, have been associated with pSS. The IL-12p35 subunit is shared by 2 heterodimers: IL-12 and IL-35. We sought to confirm genetic association of the IL12A polymorphism and pSS and elucidate involvement of the IL-12/IL-35 balance in patients with pSS by using functional studies. The genetic study involved 673 patients with pSS from 2 French pSS cohorts and 585 healthy French control subjects. Functional studies were performed on sorted monocytes, irrespective of whether they were stimulated. IL12A mRNA expression and IL-12 and IL-35 protein levels were assessed by using quantitative RT-PCR and ELISA and a multiplex kit for IL-35 and IL-12, respectively. We confirmed association of the IL12A rs485497 polymorphism and pSS and found an increased serum protein level of IL-12p70 in patients with pSS carrying the risk allele (P = .016). Serum levels of IL-12p70 were greater in patients than control subjects (P = .0001), especially in patients with more active disease (P = .05); conversely, IL-35 levels were decreased in patients (P = .0001), especially in patients with more active disease (P = .05). In blood cellular subsets both IL12p35 and EBV-induced gene protein 3 (EBI3) mRNAs were detected only in B cells, with a trend toward a lower level among patients with pSS. Our findings emphasize involvement of the IL-12/IL-35 balance in the pathogenesis of pSS. Serum IL-35 levels were associated with low disease activity, in contrast with serum IL-12p70 levels, which were associated with more active disease. Copyright © 2017 American Academy of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.

[Plasma IL-18 levels are related to insulin and are modulated by IL-18 gene polymorphisms].

Science.gov (United States)

Martinez-Hervas, Sergio; Martínez-Barquero, Vanesa; Nuñez Savall, Ester; Lendínez, Verónica; Olivares, Laura; Benito, Esther; Real, Jose T; Chaves, F Javier; Ascaso, Juan F

2015-01-01

Atherosclerosis is an inflammatory chronic disease influenced by multiple factors. Different prospective studies have shown that plasmatic levels of inflammatory markers were related to atherosclerosis and cardiovascular disease. To evaluate whether plasmatic levels of interleukin 18 (IL-18) are modulated by SNPs (single nucleotide polymorphisms) of the IL 18 gene and its possible association with insulin levels and other cardiovascular risk factors. 746 individuals were studied for a period of two years by opportunistic selection in the metropolitan area of Valencia. Parameters of lipid and glucose metabolism were analyzed by standard methodology. IL-18 was measured by ELISA. Individuals with insulin resistance showed significant higher levels of IL-18. IL 18 was significantly correlated with insulin levels and other cardiovascular risk factors. The CC genotype of the rs1834481 SNP was significantly associated with lower levels of IL-18. However, the GG genotype of the rs7559479 was associated with significant higher levels of IL-18. IL-18 is associated with insulin resistance and other cardiovascular risk factors, being those levels genetically regulated. Copyright © 2015 Sociedad Española de Arteriosclerosis. Published by Elsevier España. All rights reserved.

Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

Science.gov (United States)

Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

2012-09-01

Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

Influence of the IL-1Ra gene polymorphism on in vivo synthesis of IL-1Ra and IL-1beta after live yellow fever vaccination.

Science.gov (United States)

Hacker, U T; Erhardt, S; Tschöp, K; Jelinek, T; Endres, S

2001-09-01

The inflammatory response in infectious and autoimmune diseases is regulated by the balance between pro- and anti-inflammatory cytokines. The IL-1 complex contains polymorphic genes coding for IL-1alpha, IL-1beta and IL-1Ra. The IL-1Ra (variable number of tanden repeat) VNTR polymorphism has been shown to influence the capacity to produce IL-1beta and IL-1Ra after in vitro stimulation. Allele 2 of this polymorphism is associated with a number of inflammatory diseases. To determine the impact of the IL-1Ra polymorphism on in vivo human cytokine synthesis, we used a yellow fever vaccination model for the induction of cytokine synthesis in healthy volunteers. Two different yellow fever vaccines were used. After administration of the RKI vaccine (34 volunteers), plasma TNF-alpha concentration increased from 13.4 +/- 0.9 pg/ml to 23.3 +/- 1.1 pg/ml (P < 0.001), and plasma IL-1Ra concentration increased from 308 +/- 25 pg/ml to 1019 +/- 111 pg/ml (P < 0.001), on day 2. Using Stamaril vaccine, no increase in the plasma concentrations of either TNF-alpha or IL-1Ra could be detected (n = 17). Only the RKI vaccine induced TNF-alpha synthesis after in vitro stimulation of MNC. Carriers of allele 2 of the IL-1Ra polymorphism had increased baseline concentrations of IL-1Ra (350 +/- 32 pg/ml) compared with non-carriers (222 +/- 18 pg/ml, P < 0.001), and decreased concentrations of IL-1beta (0.9 +/- 0.2 pg/ml for carriers versus 2.8 +/- 0.7 pg/ml for non-carriers, P = 0.017). After yellow fever vaccination (RKI vaccine), no significant differences in the increase of IL-1Ra plasma levels were detected between carriers and non-carriers of allele 2 of the IL-1Ra gene polymorphism. This is the first study to examine the influence of this genetic polymorphism on in vivo-induced human IL-1beta and IL-1Ra synthesis. Baseline concentrations of IL-1Ra and IL-1beta were significantly influenced by the IL-1Ra polymorphism. No influence of the IL-1Ra polymorphism on the in vivo

Association of Single Nucleotide Polymorphisms in the IL-18 Gene with Production of IL-18 Protein by Mononuclear Cells from Healthy Donors

Directory of Open Access Journals (Sweden)

Khripko Olga Pavlovna

2008-01-01

Full Text Available IL-18 has proinflammatory effects and participates in both innate and adaptive cellular and humoral immunity. A number of SNPs that influence IL-18 production are found in the gene promoter region. We investigated the association of SNPs in the IL-18 promoter at −607 and −137 with the level of IL-18 protein production by PBMC from healthy donors from Southwestern Siberia. The genetic distribution of these SNPs in the promoter site was established by PCR. IL-18 protein production was determined by ELISA. Our results showed that PBMC from donors carrying allele 137C have lower levels of both spontaneous and LPS-stimulated IL-18 production. In contrast, PBMC from donors carrying allele 607A showed significant increases in spontaneous and stimulated IL-18 production compared to wild type. Our study suggests that the SNPs −607 and −137 in the promoter region of the IL-18 gene influence the level of IL-18 protein production by PBMC from healthy donors in Southwestern Siberia.

Linkage of the gene that encodes the alpha 1 chain of type V collagen (COL5A1) to type II Ehlers-Danlos syndrome (EDS II).

Science.gov (United States)

Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B

1995-09-01

Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.

Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

Science.gov (United States)

Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

Science.gov (United States)

Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

2016-11-01

In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

Science.gov (United States)

Li, Shengjie; Bai, Junjie; Wang, Lin

2008-08-01

Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

Interactions between diet, lifestyle and IL10, IL1B, and PTGS2/COX-2 gene polymorphisms in relation to risk of colorectal cancer in a prospective Danish case-cohort study.

Directory of Open Access Journals (Sweden)

Vibeke Andersen

Full Text Available BACKGROUND & AIMS: Diet contributes to colorectal cancer development and may be potentially modified. We wanted to identify the biological mechanisms underlying colorectal carcinogenesis by assessment of diet-gene interactions. METHODS: The polymorphisms IL10 C-592A (rs1800872, C-rs3024505-T, IL1b C-3737T (rs4848306, G-1464C (rs1143623, T-31C (rs1143627 and PTGS2 (encoding COX-2 A-1195G (rs689466, G-765C (rs20417, and T8473C (rs5275 were assessed in relation to risk of colorectal cancer (CRC and interaction with diet (red meat, fish, fibre, cereals, fruit and vegetables and lifestyle (non-steroid-anti-inflammatory drug use and smoking status was assessed in a nested case-cohort study of nine hundred and seventy CRC cases and 1789 randomly selected participants from a prospective study of 57,053 persons. RESULTS: IL1b C-3737T, G-1464C and PTGS2 T8473C variant genotypes were associated with risk of CRC compared to the homozygous wildtype genotype (IRR=0.81, 95%CI: 0.68-0.97, p=0.02, and IRR=1.22, 95%CI: 1.04-1.44, p=0.02, IRR=0.75, 95%CI: 0.57-0.99, p=0.04, respectively. Interactions were found between diet and IL10 rs3024505 (P-value for interaction (P(int; meat=0.04, fish=0.007, fibre=0.0008, vegetables=0.0005, C-592A (P(int; fibre=0.025, IL1b C-3737T (Pint; vegetables=0.030, NSAID use=0.040 and PTGS2 genotypes G-765C (P(int; meat=0.006, fibre=0.0003, fruit 0.004, and T8473C (P(int; meat 0.049, fruit=0.03 and A-1195G (P(int; meat 0.038, fibre 0.040, fruit=0.059, vegetables=0.025, and current smoking=0.046. CONCLUSIONS: Genetically determined low COX-2 and high IL-1β activity were associated with increased risk of CRC in this northern Caucasian cohort. Furthermore, interactions were found between IL10, IL1b, and PTGS2 and diet and lifestyle factors in relation to CRC. The present study demonstrates that gene-environment interactions may identify genes and environmental factors involved in colorectal carcinogenesis.

OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

Directory of Open Access Journals (Sweden)

Alimuddin Alimuddin

2008-12-01

Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

Suppression of IL-6 Gene by shRNA Augments Gemcitabine Chemosensitization in Pancreatic Adenocarcinoma Cells

Directory of Open Access Journals (Sweden)

Hai-Bo Xing

2018-01-01

Full Text Available Pancreatic adenocarcinoma has an exceedingly poor prognosis, accounting for five-year survival of less than 5%. Presently, improving the efficacy of pancreatic adenocarcinoma treatment has been the focus of medical researchers worldwide. Recently, it has been suggested that deregulation of interleukin- (IL- 6 is caused by a key gene involved in the beginning and development of pancreatic adenocarcinoma. Herein, we investigated whether suppression of IL-6 could augment gemcitabine sensitivity in the PANC-1 cells. We found considerably higher expression of IL-6 in pancreatic adenocarcinoma tissues than that in the adjacent nontumorous tissues. Suppression of IL-6 by shRNA resulted in apoptosis as well as inhibition of cell proliferation and tumorigenicity. In addition, suppression of IL-6 remarkably promoted antitumor effect of gemcitabine, indicating that the combination of shRNA targeting IL-6 with gemcitabine may provide a potential clinical approach for pancreatic cancer therapy.

Expression of inflammation-related genes is altered in gastric tissue of patients with advanced stages of NAFLD.

Science.gov (United States)

Mehta, Rohini; Birerdinc, Aybike; Neupane, Arpan; Shamsaddini, Amirhossein; Afendy, Arian; Elariny, Hazem; Chandhoke, Vikas; Baranova, Ancha; Younossi, Zobair M

2013-01-01

Obesity is associated with chronic low-grade inflammation perpetuated by visceral adipose. Other organs, particularly stomach and intestine, may also overproduce proinflammatory molecules. We examined the gene expression patterns in gastric tissue of morbidly obese patients with nonalcoholic fatty liver disease (NAFLD) and compared the changes in gene expression in different histological forms of NAFLD. Stomach tissue samples from 20 morbidly obese NAFLD patients who were undergoing sleeve gastrectomy were profiled using qPCR for 84 genes encoding inflammatory cytokines, chemokines, their receptors, and other components of inflammatory cascades. Interleukin 8 receptor-beta (IL8RB) gene overexpression in gastric tissue was correlated with the presence of hepatic steatosis, hepatic fibrosis, and histologic diagnosis of nonalcoholic steatohepatitis (NASH). Expression levels of soluble interleukin 1 receptor antagonist (IL1RN) were correlated with the presence of NASH and hepatic fibrosis. mRNA levels of interleukin 8 (IL8), chemokine (C-C motif) ligand 4 (CCL4), and its receptor chemokine (C-C motif) receptor type 5 (CCR5) showed a significant increase in patients with advanced hepatic inflammation and were correlated with the severity of the hepatic inflammation. The results of our study suggest that changes in expression patterns for inflammatory molecule encoding genes within gastric tissue may contribute to the pathogenesis of obesity-related NAFLD.

Delivery of human NKG2D-IL-15 fusion gene by chitosan nanoparticles to enhance antitumor immunity

Energy Technology Data Exchange (ETDEWEB)

Yan, Chen; Jie, Leng; Yongqi, Wang [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Weiming, Xiao [Department of Gastroenterology, The Second Clinical Medical College, Yangzhou University, Yangzhou, 225009 (China); Juqun, Xi [Jiangsu Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Senile Diseases, Yangzhou, 225009 (China); Yanbing, Ding [Department of Gastroenterology, The Second Clinical Medical College, Yangzhou University, Yangzhou, 225009 (China); Li, Qian [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Xingyuan, Pan [Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou, 225009 (China); Mingchun, Ji [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Weijuan, Gong, E-mail: wjgong@yzu.edu.cn [Department of Immunology, School of Medicine, Yangzhou University, Yangzhou, 225009 (China); Department of Gastroenterology, The Second Clinical Medical College, Yangzhou University, Yangzhou, 225009 (China); Jiangsu Key Laboratory of Integrated Traditional Chinese and Western Medicine for Prevention and Treatment of Senile Diseases, Yangzhou, 225009 (China); Jiangsu Key Laboratory of Zoonosis, Yangzhou University, Yangzhou, 225009 (China); Jiangsu Co-Innovation Center for Prevention and Control of Important Animal Infectious Diseases and Zoonoses, Yangzhou, 225009 (China)

2015-07-31

Nanoparticles are becoming promising carriers for gene delivery because of their high capacity in gene loading and low cell cytotoxicity. In this study, a chitosan-based nanoparticle encapsulated within a recombinant pcDNA3.1-dsNKG2D-IL-15 plasmid was generated. The fused dsNKG2D-IL-15 gene fragment consisted of double extracellular domains of NKG2D with IL-15 gene at downstream. The average diameter of the gene nanoparticles ranged from 200 nm to 400 nm, with mean zeta potential value of 53.8 ± 6.56 mV. The nanoparticles which were loaded with the dsNKG2D-IL-15 gene were uptaken by tumor cells with low cytotoxicity. Tumor cells pre-transfected by gene nanopartilces stimulated NK and T cells in vitro. Intramuscular injection of gene nanoparticles suppressed tumor growth and prolonged survival of tumor-bearing mice through activation of NK and CD8{sup +} T cells. Thus, chitosan-based nanoparticle delivery of dsNKG2D-IL-15 gene vaccine can be potentially used for tumor therapy. - Highlights: • Generation of a nanoparticle for delivery of dsNKG2D-IL-15 gene. • Characterization of the gene nanoparticle. • Antitumor activity mediated by the gene nanoparticle.

Delivery of human NKG2D-IL-15 fusion gene by chitosan nanoparticles to enhance antitumor immunity

International Nuclear Information System (INIS)

Yan, Chen; Jie, Leng; Yongqi, Wang; Weiming, Xiao; Juqun, Xi; Yanbing, Ding; Li, Qian; Xingyuan, Pan; Mingchun, Ji; Weijuan, Gong

2015-01-01

Nanoparticles are becoming promising carriers for gene delivery because of their high capacity in gene loading and low cell cytotoxicity. In this study, a chitosan-based nanoparticle encapsulated within a recombinant pcDNA3.1-dsNKG2D-IL-15 plasmid was generated. The fused dsNKG2D-IL-15 gene fragment consisted of double extracellular domains of NKG2D with IL-15 gene at downstream. The average diameter of the gene nanoparticles ranged from 200 nm to 400 nm, with mean zeta potential value of 53.8 ± 6.56 mV. The nanoparticles which were loaded with the dsNKG2D-IL-15 gene were uptaken by tumor cells with low cytotoxicity. Tumor cells pre-transfected by gene nanopartilces stimulated NK and T cells in vitro. Intramuscular injection of gene nanoparticles suppressed tumor growth and prolonged survival of tumor-bearing mice through activation of NK and CD8 + T cells. Thus, chitosan-based nanoparticle delivery of dsNKG2D-IL-15 gene vaccine can be potentially used for tumor therapy. - Highlights: • Generation of a nanoparticle for delivery of dsNKG2D-IL-15 gene. • Characterization of the gene nanoparticle. • Antitumor activity mediated by the gene nanoparticle

[High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

Science.gov (United States)

Piscopo, Sara-Pier; Drouin, Guy

2014-05-01

Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.

Science.gov (United States)

Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya

2008-11-01

A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.

Influence of the IL6 Gene in Susceptibility to Systemic Sclerosis

NARCIS (Netherlands)

Cenit, M.C.; Simeon, C.P.; Vonk, M.C.; Callejas-Rubio, J.L.; Espinosa, G.; Carreira, P.; Blanco, F.J.; Narvaez, J.; Tolosa, C.; Roman-Ivorra, J.A.; Gomez-Garcia, I.; Garcia-Hernandez, F.J.; Gallego, M.; Garcia-Portales, R.; Egurbide, M.V.; Fonollosa, V.; Garcia de la Pena, P.; Lopez-Longo, F.J.; Gonzalez-Gay, M.A.; The Spanish Scleroderma, G.; Hesselstrand, R.; Riemekasten, G.; Witte, T.J.M. de; Voskuyl, A.E.; Schuerwegh, A.J.; Madhok, R.; Fonseca, C.; Denton, C.; Nordin, A.; Palm, O.; Laar, J.M. van; Hunzelmann, N.; Distler, J.H.; Kreuter, A.; Herrick, A.; Worthington, J.; Koeleman, B.P.; Radstake, T.R.D.J.; Martin, J.

2012-01-01

OBJECTIVE: Systemic sclerosis (SSc) is a genetically complex autoimmune disease; the genetic component has not been fully defined. Interleukin 6 (IL-6) plays a crucial role in immunity and fibrosis, both key aspects of SSc. We investigated the influence of IL6 gene in the susceptibility and

An Epstein-Barr Virus MicroRNA Blocks Interleukin-1 (IL-1) Signaling by Targeting IL-1 Receptor 1.

Science.gov (United States)

Skinner, Camille M; Ivanov, Nikita S; Barr, Sarah A; Chen, Yan; Skalsky, Rebecca L

2017-11-01

Epstein-Barr virus (EBV) encodes >44 viral microRNAs (miRNAs) that are differentially expressed throughout infection, can be detected in Epstein-Barr virus (EBV)-positive tumors, and manipulate several biological processes, including cell proliferation, apoptosis, and immune responses. Here, we show that EBV BHRF1-2 miRNAs block NF-κB activation following treatment with proinflammatory cytokines, specifically interleukin-1β (IL-1β). Analysis of EBV PAR-CLIP miRNA targetome data sets combined with pathway analysis revealed multiple BHRF1-2 miRNA targets involved in interleukin signaling pathways. By further analyzing changes in cellular gene expression patterns, we identified the IL-1 receptor 1 (IL1R1) as a direct target of miR-BHRF1-2-5p. Targeting the IL1R1 3' untranslated region (UTR) by EBV miR-BHRF1-2-5p was confirmed using 3'-UTR luciferase reporter assays and Western blot assays. Manipulation of EBV BHRF1-2 miRNA activity in latently infected B cells altered steady-state cytokine levels and disrupted IL-1β responsiveness. These studies demonstrate functionally relevant BHRF1-2 miRNA interactions during EBV infection, which is an important step in understanding their roles in pathogenesis. IMPORTANCE IL-1 signaling plays an important role in inflammation and early activation of host innate immune responses following virus infection. Here, we demonstrate that a viral miRNA downregulates the IL-1 receptor 1 during EBV infection, which consequently alters the responsiveness of cells to IL-1 stimuli and changes the cytokine expression levels within infected cell populations. We postulate that this viral miRNA activity not only disrupts IL-1 autocrine and paracrine signaling loops that can alert effector cells to sites of infection but also provides a survival advantage by dampening excessive inflammation that may be detrimental to the infected cell. Copyright © 2017 American Society for Microbiology.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

Association of IL-6 and MMP-3 gene polymorphisms with ...

Indian Academy of Sciences (India)

comprehensively and systematically performed this meta-analysis to detect whether the two gene polymorphisms are corre- .... control studies; (ii) 'failure to provide the genes' distribution details ..... biological activity of corresponding proteins such as IL-6 .... pathic scoliosis is related to inadequate calcium intake and weight.

Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

Science.gov (United States)

Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

2009-05-01

Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

Identification of an IL-1-induced gene expression pattern in AR+ PCa cells that mimics the molecular phenotype of AR- PCa cells.

Science.gov (United States)

Thomas-Jardin, Shayna E; Kanchwala, Mohammed S; Jacob, Joan; Merchant, Sana; Meade, Rachel K; Gahnim, Nagham M; Nawas, Afshan F; Xing, Chao; Delk, Nikki A

2018-06-01

In immunosurveillance, bone-derived immune cells infiltrate the tumor and secrete inflammatory cytokines to destroy cancer cells. However, cancer cells have evolved mechanisms to usurp inflammatory cytokines to promote tumor progression. In particular, the inflammatory cytokine, interleukin-1 (IL-1), is elevated in prostate cancer (PCa) patient tissue and serum, and promotes PCa bone metastasis. IL-1 also represses androgen receptor (AR) accumulation and activity in PCa cells, yet the cells remain viable and tumorigenic; suggesting that IL-1 may also contribute to AR-targeted therapy resistance. Furthermore, IL-1 and AR protein levels negatively correlate in PCa tumor cells. Taken together, we hypothesize that IL-1 reprograms AR positive (AR + ) PCa cells into AR negative (AR - ) PCa cells that co-opt IL-1 signaling to ensure AR-independent survival and tumor progression in the inflammatory tumor microenvironment. LNCaP and PC3 PCa cells were treated with IL-1β or HS-5 bone marrow stromal cell (BMSC) conditioned medium and analyzed by RNA sequencing and RT-QPCR. To verify genes identified by RNA sequencing, LNCaP, MDA-PCa-2b, PC3, and DU145 PCa cell lines were treated with the IL-1 family members, IL-1α or IL-1β, or exposed to HS-5 BMSC in the presence or absence of Interleukin-1 Receptor Antagonist (IL-1RA). Treated cells were analyzed by western blot and/or RT-QPCR. Comparative analysis of sequencing data from the AR + LNCaP PCa cell line versus the AR - PC3 PCa cell line reveals an IL-1-conferred gene suite in LNCaP cells that is constitutive in PC3 cells. Bioinformatics analysis of the IL-1 regulated gene suite revealed that inflammatory and immune response pathways are primarily elicited; likely facilitating PCa cell survival and tumorigenicity in an inflammatory tumor microenvironment. Our data supports that IL-1 reprograms AR + PCa cells to mimic AR - PCa gene expression patterns that favor AR-targeted treatment resistance and cell survival. © 2018 Wiley

Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

Science.gov (United States)

Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

2017-12-26

The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

IL-33 stimulates expression of the GPR84 (EX33) fatty acid receptor gene and of cytokine and chemokine genes in human adipocytes.

Science.gov (United States)

Zaibi, Mohamed S; Kępczyńska, Małgorzata A; Harikumar, Parvathy; Alomar, Suliman Y; Trayhurn, Paul

2018-05-15

Expression of GPCR fatty acid sensor/receptor genes in adipocytes is modulated by inflammatory mediators, particularly IL-1β. In this study we examined whether the IL-1 gene superfamily member, IL-33, also regulates expression of the fatty acid receptor genes in adipocytes. Human fat cells, differentiated from preadipocytes, were incubated with IL-33 at three different dose levels for 3 or 24 h and mRNA measured by qPCR. Treatment with IL-33 induced a dose-dependent increase in GPR84 mRNA at 3 h, the level with the highest dose being 13.7-fold greater than in controls. Stimulation of GPR84 expression was transitory; the mRNA level was not elevated at 24 h. In contrast to GPR84, IL-33 had no effect on GPR120 expression. IL-33 markedly stimulated expression of the IL1B, CCL2, IL6, CXCL2 and CSF3 genes, but there was no effect on ADIPOQ expression. The largest effect was on CSF3, the mRNA level of which increased 183-fold over controls at 3 h with the highest dose of IL-33; there was a parallel increase in the secretion of G-CSF protein into the medium. It is concluded that in human adipocytes IL-33, which is synthesised in adipose tissue, has a strong stimulatory effect on the expression of cytokine and chemokine genes, particularly CSF3, and on the expression of GPR84, a pro-inflammatory fatty acid receptor. Copyright © 2018 Elsevier Ltd. All rights reserved.

Differential baseline and response profile to IFN-γ gene transduction of IL-6/IL-6 receptor-α secretion discriminate primary tumors versus bone marrow metastases of nasopharyngeal carcinomas in culture

International Nuclear Information System (INIS)

Chou, Andy Shau-Bin; Wang, Hsin-Yi; Chen, Hung-Chang; Tsai, Ming-Hsiu; Chuang, Cheng-Keng; Liao, Shuen-Kuei

2009-01-01

Understanding of immunobiology of bone marrow metastases (designated BM-NPC) versus primary tumors (P-NPC) of the nasopharynx is far from complete. The aim of this study was to determine if there would be differences between cultured P-NPCs and BM-NPCs with respect to (i) constitutive IL-6 and the IL-6 receptor gp80 subunit (IL-6Rα) levels in the spent media of nontransduced cells, and (ii) IL-6 and IL-6Rα levels in the spent media of cells transduced with a retroviral vector containing the IFN-γ gene. A panel of NPC cell lines were transduced with the IFN-γ gene through a retroviral vector. Four clonal sublines were isolated via limiting dilution methods. Cytofluorometric analysis was performed for the detection of cell surface antigens of HLA class I, HLA class II and ICAM-1. ELISA was used to assay for IFN-γ, IL-6 and IL-6Rα in the spent media of cultured cell lines. Our results showed that in day 3 culture supernatants, low levels of soluble IL-6 were detected in 5/5 cultured tumors derived from P-NPCs, while much higher constitutive levels of IL-6 were detected in 3/3 metastasis-derived NPC cell lines including one originated from ascites; the difference was significant (p = 0.025). An inverse relationship was found between IL-6Rα and IL-6 in their release levels in cultured P-NPCs and metastasis-derived NPCs. In IFN-γ-transduced-P-NPCs, IL-6 production increased and yet IL-6Rα decreased substantially, as compared to nontransduced counterparts. At variance with P-NPC cells, the respective ongoing IL-6 and IL-6Rα release patterns of BM-NPC cells were not impeded as much following IFN-γ transduction. These observations were confirmed by extended kinetic studies with representative NPC cell lines and clonal sublines. The latter observation with the clonal sublines also indicates that selection for high IL-6 or low IL-6Rα producing subpopulations did not occur as a result of IFN-γ-transduction process. P-NPCs, which secreted constitutively only

IL-1 receptor antagonism and muscle gene expression in patients with type 2 diabetes

DEFF Research Database (Denmark)

Berchtold, L. A.; Larsen, C. M.; Vaag, A.

2009-01-01

). To investigate the effects of IL-1Ra in insulin-sensitive tissue, gene expression levels in skeletal muscle from type 2 diabetic patients treated with IL-1Ra were analysed. Methods. Gene expression profiles in vastus lateralis muscle biopsies from five obese patients (BMI>27) were determined before and after 13......RT-PCR, were significantly altered when comparing the number of transcripts before and after treatment for each individual. Conclusion. Treatment with IL-1Ra did not significantly affect gene expression levels in skeletal muscle in this limited and selected sample of obese patients with type 2 diabetes. Larger...

Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

Directory of Open Access Journals (Sweden)

Sher L Hendrickson

2010-09-01

Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

Science.gov (United States)

Jordan, I K; Sutter, B A; McClure, M A

2000-01-01

Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

Role of the IL-6 Gene in the Etiopathogenesis of Idiopathic Scoliosis

Directory of Open Access Journals (Sweden)

Svetla Nikolova

2015-01-01

Full Text Available Scoliotic human nuclei pulposi can respond to exogenous proinflammatory stimuli by secreting increased amounts of interleukin-6 (IL-6. The G/C polymorphism of the promoter region of IL-6 gene influences levels and functional activity of the IL-6 protein. We conducted a case-control study of eighty patients with idiopathic scoliosis (IS and one hundred sixty healthy unrelated gender-matched controls trying to investigate the association between IS and the IL-6 promoter polymorphism at -174 position (rs1800795 G/C in Bulgarian population. Molecular detection of the IL-6 genotypes was performed by amplification followed by restriction technology. The statistical analysis was performed by Pearson’s chi-squared test. Our case-control study revealed a statistically significant association between the IL-6 (-174 G/C functional polymorphism and susceptibility to IS. In addition, a significant association between the IL-6 (-174 G/C polymorphism and curve severity was detected. IL-6 gene could be considered as susceptibility and modifying factor of idiopathic scoliosis. The identification of molecular markers with diagnostic and prognostic value could be useful for early detection of children at risk for the development of scoliosis and for prognosis of the risk for a rapid deformity progression. That would facilitate the therapy decisions and early stage treatment of the patient with the least invasive procedures.

RNAi-based therapeutic nanostrategy: IL-8 gene silencing in pancreatic cancer cells using gold nanorods delivery vehicles

International Nuclear Information System (INIS)

Panwar, Nishtha; Yang, Chengbin; Yin, Feng; Chuan, Tjin Swee; Yong, Ken-Tye; Yoon, Ho Sup

2015-01-01

RNA interference (RNAi)-based gene silencing possesses great ability for therapeutic intervention in pancreatic cancer. Among various oncogene mutations, Interleukin-8 (IL-8) gene mutations are found to be overexpressed in many pancreatic cell lines. In this work, we demonstrate IL-8 gene silencing by employing an RNAi-based gene therapy approach and this is achieved by using gold nanorods (AuNRs) for efficient delivery of IL-8 small interfering RNA (siRNA) to the pancreatic cell lines of MiaPaCa-2 and Panc-1. Upon comparing to Panc-1 cells, we found that the dominant expression of the IL-8 gene in MiaPaCa-2 cells resulted in an aggressive behavior towards the processes of cell invasion and metastasis. We have hence investigated the suitability of using AuNRs as novel non-viral nanocarriers for the efficient uptake and delivery of IL-8 siRNA in realizing gene knockdown of both MiaPaCa-2 and Panc-1 cells. Flow cytometry and fluorescence imaging techniques have been applied to confirm transfection and release of IL-8 siRNA. The ratio of AuNRs and siRNA has been optimized and transfection efficiencies as high as 88.40 ± 2.14% have been achieved. Upon successful delivery of IL-8 siRNA into cancer cells, the effects of IL-8 gene knockdown are quantified in terms of gene expression, cell invasion, cell migration and cell apoptosis assays. Statistical comparative studies for both MiaPaCa-2 and Panc-1 cells are presented in this work. IL-8 gene silencing has been demonstrated with knockdown efficiencies of 81.02 ± 10.14% and 75.73 ± 6.41% in MiaPaCa-2 and Panc-1 cells, respectively. Our results are then compared with a commercial transfection reagent, Oligofectamine, serving as positive control. The gene knockdown results illustrate the potential role of AuNRs as non-viral gene delivery vehicles for RNAi-based targeted cancer therapy applications. (paper)

High dose of plasmid IL-15 inhibits immune responses in an influenza non-human primates immunogenicity model

International Nuclear Information System (INIS)

Yin Jiangmei; Dai Anlan; Laddy, Dominick J.; Yan Jian; Arango, Tatiana; Khan, Amir S.; Lewis, Mark G.; Andersen, Hanne; Kutzler, Michele A.; Draghia-Akli, Ruxandra; Weiner, David B.; Boyer, Jean D.

2009-01-01

Interleukin (IL)-15, is a cytokine that is important for the maintenance of long-lasting, high-avidity T cell response to invading pathogens and has, therefore, been used in vaccine and therapeutic platforms as an adjuvant. In addition to pure protein delivery, plasmids encoding the IL-15 gene have been utilized. However, it is critical to determine the appropriate dose to maximize the adjuvanting effects. We immunized rhesus macaques with different doses of IL-15 expressing plasmid in an influenza non-human primate immunogenicity model. We found that co-immunization of rhesus macaques with a Flu DNA-based vaccine and low doses of plasmid encoding macaque IL-15 enhanced the production of IFN-γ (0.5 mg) and the proliferation of CD4 + and CD8 + T cells, as well as T CM levels in proliferating CD8 + T cells (0.25 mg). Whereas, high doses of IL-15 (4 mg) decrease the production of IFN-γ and the proliferation of CD4 + and CD8 + T cells and T CM levels in the proliferating CD4 + and CD8 + T cells. In addition, the data of hemagglutination inhibition (HI) antibody titer suggest that although not significantly different, there appears to be a slight increase in antibodies at lower doses of IL-15. Importantly, however, the higher doses of IL-15 decrease the antibody levels significantly. This study demonstrates the importance of optimizing DNA-based cytokine adjuvants.

Frequency of distribution of inflammatory cytokines IL-1, IL-6 and TNF-alpha gene polymorphism in patients with obstructive sleep apnea.

Science.gov (United States)

Popko, K; Gorska, E; Potapinska, O; Wasik, M; Stoklosa, A; Plywaczewski, R; Winiarska, M; Gorecka, D; Sliwinski, P; Popko, M; Szwed, T; Demkow, U

2008-12-01

Obesity is one of the most commonly identified factors for the obstructive sleep apnea syndrome (OSAS). Adipose tissue is the source of many cytokines, among them there are IL-6, IL-1, and TNF-alpha. The level of inflammatory cytokines increases in people with OSAS and obesity. The aim of this study was to evaluate the distribution of genotypes in inflammatory cytokine genes in people with obesity-related OSAS. The examined group consisted of 102 person with obesity related-OSAS and 77 normal weight person without OSAS. Genotyping of DNA sequence variation was carried out by restriction enzyme (IL-1: Taq I, IL-6: Lwe I, TNF-alpha: Nco I) analysis of PCR amplified DNA. The study revealed a significant correlation between polymorphism located in the promoter region of inflammatory cytokine genes and obesity-related OSAS.

Ozone Enhances Diesel Exhaust Particles (DEP-Induced Interleukin-8 (IL-8 Gene Expression in Human Airway Epithelial Cells through Activation of Nuclear Factors- κB (NF-κB and IL-6 (NF-IL6

Directory of Open Access Journals (Sweden)

James Kelley

2005-12-01

Full Text Available Ozone, a highly reactive oxidant gas is a major component of photochemical smog. As an inhaled toxicant, ozone induces its adverse effects mainly on the lung. Inhalation of particulate matter has been reported to cause airway inflammation in humans and animals. Furthermore, epidemiological evidence has indicated that exposure to particulate matter (PM2.5-10, including diesel exhaust particles (DEP has been correlated with increased acute and chronic respiratory morbidity and exacerbation of asthma. Previously, exposure to ozone or particulate matter and their effect on the lung have been addressed as separate environmental problems. Ozone and particulate matter may be chemically coupled in the ambient air. In the present study we determined whether ozone exposure enhances DEP effect on interleukin-8 (IL-8 gene expression in human airway epithelial cells. We report that ozone exposure (0.5 ppm x 1 hr significantly increased DEP-induced IL-8 gene expression in A549 cells (117 ± 19 pg/ml, n = 6, p < 0.05 as compared to cultures treated with DEP (100 μg/ml x 4 hr alone (31 ± 3 pg/ml, n = 6, or cultures exposed to purified air (24 ± 6 pg/ml, n = 6. The increased DEP-induced IL-8 gene expression following ozone exposure was attributed to ozone-induced increase in the activity of the transcription factors NF-κB and NF-IL6. The results of the present study indicate that ozone exposure enhances the toxicity of DEP in human airway epithelial cells by augmenting IL-8 gene expression, a potent chemoattractant of neutrophils in the lung.

A highly divergent gene cluster in honey bees encodes a novel silk family.

Science.gov (United States)

Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

2006-11-01

The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

VNTR polymorphisms of the IL-4 and IL-1RN genes and their relationship with frailty syndrome in Mexican community-dwelling elderly.

Science.gov (United States)

Pérez-Suárez, Thalía Gabriela; Gutiérrez-Robledo, Luis Miguel; Ávila-Funes, José Alberto; Acosta, José Luis; Escamilla-Tilch, Mónica; Padilla-Gutiérrez, Jorge Ramón; Torres-Carrillo, Norma; Torres-Castro, Sara; López-Ortega, Mariana; Muñoz-Valle, José Francisco; Torres-Carrillo, Nora Magdalena

2016-10-01

Inflammation is a key event that is closely associated with the pathophysiology of frailty. The relationship of genetic polymorphisms into inflammatory cytokines with frailty remains poorly understood. The aim of this study was to investigate the association between VNTR polymorphisms of the IL-4 and IL-1RN genes with the risk of frailty. We included a sample of 630 community-dwelling elderly aged 70 and older. Both IL-4 and IL-1RN VNTR polymorphisms were genotyped by the polymerase chain reaction (PCR) method. Mean age was 77.7 years (SD = 6.0) and 52.5 % were women. The participants classified as frail were more likely to be older, had lower MMSE score (p VNTR polymorphism did not show significant differences between study groups (p > 0.05). However, we just observed a significant difference in the allelic frequencies for the A2 allele of the IL-1RN VNTR polymorphism between frail and nonfrail groups (OR 1.84, 95 % CI 1.08-3.12, p = 0.02). In addition, we analyzed the combined effect of the IL-4 and IL-1RN VNTR polymorphisms and their possible association with frailty, where the combined IL-4 (low) -IL-1Ra (high) genotype was identified as a marker of risk to frailty syndrome (OR 7.86, 95 % CI 1.83-33.69, p = 0.006). Our results suggest that both A2 allele and the combined IL-4 (low) -IL-1Ra (high) genotype might be genetic markers of susceptibility to frailty in Mexican elderly.

IL1 receptor antagonist gene IL1-RN variable number of tandem repeats polymorphism and cancer risk: a literature review and meta-analysis.

Directory of Open Access Journals (Sweden)

Ying Zhang

Full Text Available IL1 receptor antagonist (IL1RA and IL1beta (IL1β, members of the pro-inflammatory cytokine interleukin-1 (IL1 family, play a potential role against infection and in the pathogenesis of cancers. The variable number of tandem repeats (VNTR polymorphism in the second intron of the IL1 receptor antagonist gene (IL1-RN and a polymorphism in exon 5 of IL1B (IL1B+3954C>T, rs1143634 have been suggested in predisposition to cancer risk. However, studies have shown inconsistent results. To validate any association, a meta-analysis was performed with 14,854 cases and 19,337 controls from 71 published case-control studies for IL1-RN VNTR and 33 eligible studies contained 7,847 cases and 8917 controls for IL1B +3954. Odds ratios (ORs with 95% confidence intervals (CIs were calculated from comparisons to assess the strength of the association. There was significant association between the IL1-RN VNTR polymorphism and the risk of cancer for any overall comparison. Furthermore, cancer type stratification analysis revealed that there were significantly increased risks of gastric cancer, bladder cancer and other cancer groups. Infection status analysis indicated that the H. pylori or HBV/HCV infection and IL1-RN VNTR genotypes were independent factors for developing gastric or hepatocellular cancers. In addition, a borderline significant association was observed between IL1B+3954 polymorphism and the increased cancer risk. Although some modest bias could not be eliminated, this meta-analysis suggested that the IL1-RN VNTR polymorphisms may contribute to genetic susceptibility to gastric cancer. More studies are needed to further evaluate the role of the IL1B+3954 polymorphism in the etiology of cancer.

Three-Dimensional Conformal Radiotherapy in Prostate Cancer Patients: Rise in Interleukin 6 (IL-6) but not IL-2, IL-4, IL-5, Tumor Necrosis Factor-{alpha}, MIP-1-{alpha}, and LIF Levels

Energy Technology Data Exchange (ETDEWEB)

Oliveira Lopes, Carlos [Universidade do Vale do Paraiba, Centro de Oncologia Radioterapica do Vale do Paraiba, Universidade do Vale do Paraiba Instituto de Pesquisa e Desenvolvimento, Universidade do Vale do Paraiba, Sao Jose dos Campos, Sao Paulo (Brazil); Callera, Fernando, E-mail: fcallera@gmail.com [Centro de Hematologia Onco-hematologia e Transplantes de Medula Ossea do Vale do Paraiba, Sao Paulo (Brazil)

2012-03-15

Purpose: To investigate the effect of radiotherapy (RT) on serum levels of interleukin-2 (IL-2), IL-4, IL-5, IL-6, tumor necrosis factor alpha (TNF-{alpha}), macrophage inflammatory protein-1-alpha (MIP-1-{alpha}) and leukemia inhibitory factor (LIF) in patients with prostate cancer. Methods and Materials: Forty eight patients with prostate cancer received three-dimensional conformal blocking radiation therapy with a linear accelerator. IL-2, IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were measured by the related immunoassay kit 1 day before the beginning of RT and during RT at days 15 and 30. Results: The mean IL-2 values were elevated before and during the RT in contrast with those of IL-4, IL-5, IL-6, TNF-{alpha}, MIP-1-{alpha}, and LIF, which were within the normal range under the same conditions. Regarding markers IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF, comparisons among the three groups (before treatment and 15 and 30 days during RT) did not show significant differences. Although values were within the normal range, there was a significant rise in IL-6 levels at day 15 of RT (p = 0.0049) and a decline at day 30 to levels that were similar to those observed before RT. Conclusions: IL-6 appeared to peak after 15 days of RT before returning to pre-RT levels. In contrast, IL-2, IL-4, IL-5, TNF-{alpha}, MIP-1-{alpha}, and LIF levels were not sensitive to irradiation. The increased levels of IL-6 following RT without the concurrent elevation of other cytokines involved in the acute phase reaction did not suggest a classical inflammatory response to radiation exposure. Further studies should be designed to elucidate the role of IL-6 levels in patients with prostate cancer treated with RT.

IL-2 absorption affects IFN-gamma and IL-5, but not IL-4 producing memory T cells in double color cytokine ELISPOT assays.

Science.gov (United States)

Quast, Stefan; Zhang, Wenji; Shive, Carey; Kovalovski, Damian; Ott, Patrick A; Herzog, Bernhard A; Boehm, Bernhard O; Tary-Lehmann, Magdalena; Karulin, Alexey Y; Lehmann, Paul V

2005-09-01

Cytokine assays are gaining increasing importance for human immune monitoring because they reliably detect antigen-specific T cells in primary PBMC, even at low clonal sizes. Double color ELISPOT assays permit the simultaneous visualization of cells producing two different cytokines. Permitting the simultaneous assessment of type 1 and 2 immunity and due to the limited numbers of PBMC available from human study subjects, double color assays should be particularly attractive for clinical trials. Since the performance of double color assays has not yet been validated, we set out to compare them to single color measurements. Testing the recall antigen-induced cytokine response of PBMC, we found that double color assays regularly provided lower numbers of IFN-gamma and IL-5 spots than single color measurements when IL-2 detection was part of the double color assay. We showed that the inhibitory effect resulted from IL-2 absorption and could be overcome by either antibody free preactivation cultures or by inclusion of anti-CD28 antibody. In contrast, the simultaneous detection of IL-2 did not affect the numbers of IL-4 spots. Therefore, unlike IL-2/IL-4 and IFN-gamma/IL-5 assays, IL-2/IFN-gamma, and IL-2/IL-5 assays require compensation for the IL-2 capture to provide accurate numbers for the frequencies of cytokine producing memory T cells.

Cloning of Interleukin-10 from African Clawed Frog (Xenopus tropicalis, with the Finding of IL-19/20 Homologue in the IL-10 Locus

Directory of Open Access Journals (Sweden)

Zhitao Qi

2015-01-01

Full Text Available Interleukin-10 (IL-10 is a pleiotropic cytokine that plays an important role in immune system. In the present study, the IL-10 gene of African clawed frog (Xenopus tropicalis was first cloned, and its expression pattern and 3D structure were also analyzed. The frog IL-10 mRNA encoded 172 amino acids which possessed several conserved features found in IL-10s from other species, including five-exon/four-intron genomic structure, conserved four cysteine residues, IL-10 family motif, and six α-helices. Real-time PCR showed that frog IL-10 mRNA was ubiquitous expressed in all examined tissues, highly in some immune related tissues including kidney, spleen, and intestine and lowly in heart, stomach, and liver. The frog IL-10 mRNA was upregulated at 24 h after LPS stimulation, indicating that it plays a part in the host immune response to bacterial infection. Another IL, termed as IL-20, was identified from the frog IL-10 locus, which might be the homologue of mammalian IL-19/20 according to the analysis results of the phylogenetic tree and the sequence identities.

Mutations in LCA5, encoding the ciliary protein lebercilin, cause Leber congenital amaurosis.

NARCIS (Netherlands)

Hollander, A.I. den; Koenekoop, R.K.; Mohamed, M.D.; Arts, H.H.; Boldt, K.; Towns, K.V.; Sedmak, T.; Beer, M. de; Nagel-Wolfrum, K.; McKibbin, M.; Dharmaraj, S.; Lopez, I.; Ivings, L.; Williams, G.A.; Springell, K.; Woods, C.G.; Jafri, H.; Rashid, Y.; Strom, T.M.; Zwaag, B. van der; Gosens, I.; Kersten, F.F.J.; Wijk, E. van; Veltman, J.A.; Zonneveld, M.N.; Beersum, S.E.C. van; Maumenee, I.H.; Wolfrum, U.; Cheetham, M.E.; Ueffing, M.; Cremers, F.P.M.; Inglehearn, C.F.; Roepman, R.

2007-01-01

Leber congenital amaurosis (LCA) causes blindness or severe visual impairment at or within a few months of birth. Here we show, using homozygosity mapping, that the LCA5 gene on chromosome 6q14, which encodes the previously unknown ciliary protein lebercilin, is associated with this disease. We

Expression of Inflammation-Related Genes Is Altered in Gastric Tissue of Patients with Advanced Stages of NAFLD

Directory of Open Access Journals (Sweden)

Rohini Mehta

2013-01-01

Full Text Available Obesity is associated with chronic low-grade inflammation perpetuated by visceral adipose. Other organs, particularly stomach and intestine, may also overproduce proinflammatory molecules. We examined the gene expression patterns in gastric tissue of morbidly obese patients with nonalcoholic fatty liver disease (NAFLD and compared the changes in gene expression in different histological forms of NAFLD. Stomach tissue samples from 20 morbidly obese NAFLD patients who were undergoing sleeve gastrectomy were profiled using qPCR for 84 genes encoding inflammatory cytokines, chemokines, their receptors, and other components of inflammatory cascades. Interleukin 8 receptor-beta (IL8RB gene overexpression in gastric tissue was correlated with the presence of hepatic steatosis, hepatic fibrosis, and histologic diagnosis of nonalcoholic steatohepatitis (NASH. Expression levels of soluble interleukin 1 receptor antagonist (IL1RN were correlated with the presence of NASH and hepatic fibrosis. mRNA levels of interleukin 8 (IL8, chemokine (C-C motif ligand 4 (CCL4, and its receptor chemokine (C-C motif receptor type 5 (CCR5 showed a significant increase in patients with advanced hepatic inflammation and were correlated with the severity of the hepatic inflammation. The results of our study suggest that changes in expression patterns for inflammatory molecule encoding genes within gastric tissue may contribute to the pathogenesis of obesity-related NAFLD.

Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

DEFF Research Database (Denmark)

Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

1995-01-01

Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

Escherichia coli rpiA gene encoding ribose phosphate isomerase A

DEFF Research Database (Denmark)

Hove-Jensen, Bjarne; Maigaard, Marianne

1993-01-01

The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

Effects of deoxycycline induced lentivirus encoding FasL gene on ...

African Journals Online (AJOL)

Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.

Science.gov (United States)

Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya

2009-06-01

A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.

[Association of IL-1β-511T gene rs16944 polymorphism with febrile seizures].

Science.gov (United States)

Ren, Xiao-Tun; Sun, Su-Zhen; Liu, Fang; Wang, Xiao-Ming

2014-02-01

Despite substantial research efforts worldwide, the role of inflammatory cytokine IL-1β in the onset of febrile seizures (FS) remains controversial. The aim of this study was to assess the relationship between rs16944 polymorphism of the IL-1β-511T gene and occurrence of simple FS in a sample of Han children in northern China. The IL-1β-511T gene rs16944 was genotyped by SNaPshot SNP technique in 141 FS children and 130 healthy control subjects. The genotypic and allelic frequencies in the two groups were comparatively analyzed. There were no significant differences in genotypic and allelic frequencies of rs16944 polymorphism of the IL-1β-511T gene between FS patients and control subjects (P>0.05).When the clinical data on A/A, A/G and G/G genotypes of the rs16944 polymorphism in FS patients, there was statistically significant difference in age of first onset (χ(2)=19.491, Prs16944 polymorphism of the IL-1β-511T gene and the incidence of FS in Han children in Northern China. However, the differences in genotypes of this polymorphism might be associated with pathogenesis and prognosis of simple FS in the population studied.

HDAC inhibitors TSA and sodium butyrate enhanced the human IL-5 expression by altering histone acetylation status at its promoter region.

Science.gov (United States)

Han, Songyan; Lu, Jun; Zhang, Yu; Cheng, Cao; Li, Lin; Han, Liping; Huang, Baiqu

2007-02-15

The expression of IL-5 correlated tightly with the maturation and differentiation of eosinophils, and is considered as a cytokine responsible for allergic inflammation. We report here that inhibition of HDAC activity by Trichostatin A (TSA) and sodium butyrate (NaBu), the two specific HDAC inhibitors, resulted in the elevation of both endogenous and exogenous activity of IL-5 promoter. We demonstrated that both the mRNA expression and protein production of IL-5 were stimulated by TSA and NaBu treatments. ChIP assays showed that treatments of TSA and NaBu caused hyperacetylation of histones H3 and H4 on IL-5 promoter in Jurkat cells, which consequently promoted the exogenous luciferase activity driven by this promoter. Moreover, site-directed mutagenesis studies showed that the binding sites for transcription factors NFAT, GATA3 and YY1 on IL-5 promoter were critical for the effects of TSA and NaBu, suggesting that the transcriptional activation of IL-5 gene by these inhibitors was achieved by affecting HDAC function on IL-5 promoter via transcription factors. These data will contribute to elucidating the unique mechanism of IL-5 transcriptional control and to the therapy of allergic disorders related to IL-5.

The evaluation of angiotensin-converting enzyme (ACE) gene I/D and IL-4 gene intron 3 VNTR polymorphisms in coronary artery disease.

Science.gov (United States)

Basol, Nursah; Celik, Atac; Karakus, Nevin; Ozturk, Sibel Demir; Ozsoy, Sibel Demir; Yigit, Serbulent

2014-01-01

Genetic polymorphism is a strong risk factor for coronary artery disease (CAD). In the present study, our aim was to evaluate angiotensin-converting enzyme (ACE) gene I/D polymorphism and interleukin-4 (IL-4) gene Intron 3 variable number of tandem repeat (VNTR) polymorphism in CAD. One hundred and twenty-four CAD patients and one hundred and twenty-three controls were enrolled. Genomic DNA was isolated and genotyped using polymerase chain reaction (PCR) analyses. The risk associated with inheriting the combined genotypes for the two polymorphisms were evaluated and it was found that the individuals who were P2P2-homozygous at IL-4 gene intron 3 VNTR and DD-homozygous at ACE gene I/D have a higher risk of developing CAD. Although, there is no correlation between IL4 VNTR polymorphism and ACE gene polymorphism and CAD, there is a strong association between CAD and co-existence of IL-4 VNTR and ACE gene polymorphisms in the Turkish population. Copyright © 2014 International Institute of Anticancer Research (Dr. John G. Delinassios), All rights reserved.

Comparative study of polymorphism frequencies of the CYP2D6, CYP3A5, CYP2C8 and IL-10 genes in Mexican and Spanish women with breast cancer.

Science.gov (United States)

Alcazar-González, Gregorio Antonio; Calderón-Garcidueñas, Ana Laura; Garza-Rodríguez, María Lourdes; Rubio-Hernández, Gabriela; Escorza-Treviño, Sergio; Olano-Martin, Estibaliz; Cerda-Flores, Ricardo Martín; Castruita-Avila, Ana Lilia; González-Guerrero, Juan Francisco; le Brun, Stéphane; Simon-Buela, Laureano; Barrera-Saldaña, Hugo Alberto

2013-10-01

Pharmacogenetic studies in breast cancer (BC) may predict the efficacy of tamoxifen and the toxicity of paclitaxel and capecitabine. We determined the frequency of polymorphisms in the CYP2D6 gene associated with activation of tamoxifen, and those of the genes CYP2C8, CYP3A5 and DPYD associated with toxicity of paclitaxel and capecitabine. We also included a IL-10 gene polymorphism associated with advanced tumor stage at diagnosis. Genomic DNAs from 241 BC patients from northeast Mexico were genotyped using DNA microarray technology. For tamoxifen processing, CYP2D6 genotyping predicted that 90.8% of patients were normal metabolizers, 4.2% ultrarapid, 2.1% intermediate and 2.9% poor metabolizers. For paclitaxel and the CYP2C8 gene, 75.3% were normal, 23.4% intermediate and 1.3% poor metabolizers. Regarding the DPYD gene, only one patient was a poor metabolizer. For the IL-10 gene, 47.1% were poor metabolizers. These results contribute valuable information towards personalizing BC chemotherapy in Mexican women.

Increased expression of interleukin-6 (IL-6) gene transcript in relation to IL-6 promoter hypomethylation in gingival tissue from patients with chronic periodontitis.

Science.gov (United States)

Kobayashi, Tetsuo; Ishida, Kohei; Yoshie, Hiromasa

2016-09-01

DNA methylation of the cytokine genes may play a role in the pathogenesis of periodontitis. The aim of this study is to evaluate whether the alteration of interleukin-6 (IL-6) gene promoter methylation in the gingival tissue (GT) and peripheral blood (PB) is unique to chronic periodontitis (CP). DNA isolated from the GT and PB of 25 patients with (CP) and 20 healthy controls (H) was modified with sodium bisulfite and analyzed for IL-6 promoter methylation with direct sequencing. The levels of IL-6 mRNA and serum IL-6 protein were evaluated by a quantitative reverse transcription polymerase chain reaction and an enzyme-linked immunosorbent assay. The CP group showed that the overall methylation rates of IL-6 promoter that contained 19 cytosine-guanine dinucleotide (CpG) motifs were significantly decreased in GT in comparison to PB (p<0.001), which was significantly negatively correlated with the probing depth (p=0.003). The GT and PB of the H group displayed similar overall methylation rates. No significant difference was observed in the methylation rates at each CpG in GT in comparison to the PB in both groups. The levels of IL-6 mRNA in the GT and PB and serum IL-6 of the two groups were comparable. The ratio of IL-6 mRNA in the GT relative to the PB was significantly higher in the CP group than in the H group (p=0.03). The increased expression of IL-6 gene transcription may be related to IL-6 promoter hypomethylation in the GT from CP patients. Copyright © 2016 Elsevier Ltd. All rights reserved.

Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

Directory of Open Access Journals (Sweden)

Seabra Ana R

2010-08-01

Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

Science.gov (United States)

Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

2017-11-23

The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

Effects of TCDD on the expression of nuclear encoded mitochondrial genes

International Nuclear Information System (INIS)

Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

2010-01-01

Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

Role of ACE and IL-1β Gene Polymorphisms in Erythropoeitin Hyporesponsive Patients with Chronic Kidney Disease with Anemia.

Science.gov (United States)

Nand, N; Deshmukh, A R; Joshi, S; Sachdeva, M P; Sakthivel

2017-02-01

Hyporesponse to erythropoietin is a common problem seen in around 5-10% of patients. Recently the focus from these remediable factors has been shifted to the non-modifiable innate factors i.e polymorphism of ACE and IL-1B gene and studies have shown that DD genotype and IL-1B CC genotype have lower erythropoietin requirement. The aim of our study was to evaluate the role of ACE and IL-1B gene polymorphisms in erythropoietin hyporesponse in CKD patients with anemia. A total of 50 patients were selected. After taking pre-informed written consent, they were segregated into two groups, group A and B with 25 patients in each group. Group A included CKD stage III-IV patients and Group B included CKD stage V patients who were on regular maintenance. All patients were given erythroepoietin and response was monitored using erythropoietin resistance index (ERI). Genotyping of ACE and IL-1B genes were done and serum levels of ACE and IL-1B were measured. Mean values of ERI were compared between different genotype subgroups and analysed using binary regression analysis. The study group included 6 patients with diabetic nephropathy and out of these 4(66.6%) had DD genotype. On comparing the effect of ACE polymorphism on ERI levels it was seen that the mean ERI values in DD subgroup were significantly lower (16.97±5.35, 21.88±6.25, 22.69±8.35 at 1,3 and 5th month) as compared to ID (18.16±3.39, 24.17±3.66, 32.74±9.95 and II (20.73±5.17, 27.74±7.30, 41.08±13.83 U/Kg/g/dL). In the case of IL-1B the mean ERI values were lowest in the TT subgroup (16.46±4.45, 21.96±5.77,23.98±8.48) as compared to CC (19.49 ±5.62,25.46±7.07, 33.59±12.61) and CT (18.12±4.27,24.14±5.70, 31.89±13.83 U/Kg/g/dL). The mean serum values of ACE were in a decreasing trend i.e DD> ID> II (238.05 ± 52.46, 194.73±50.28 and 162.99±39.71 ng/ml, (p 0.05). D allele positively affected the serum ACE level but there was no association between IL-1B genotype and its levels. ACE gene polymorphism

CLINICAL SIGNIFICANCE OF 5αα-REDUCTASE AND ANDROGEN RECEPTOR GENE POLYMORPHISMS IN PROSTATE CANCER

Directory of Open Access Journals (Sweden)

O. B. Loran

2014-07-01

Full Text Available The development of prostate cancer is inseparably linked with the effect of androgens on the fundamental prostatic intracellular processes,such as proliferation, apoptosis, which is realized through a number of second messengers. Major of them are the AR gene encoding androgenreceptors and the SRD5A2 gene encoding 5α-reductase enzyme. This paper deals with the study of the role of these genes in prostate cancer.  

IL-1RA gene-transfected bone marrow-derived mesenchymal stem cells in APA microcapsules could alleviate rheumatoid arthritis.

Science.gov (United States)

Hu, Jianhua; Li, Hongjian; Chi, Guanhao; Yang, Zhao; Zhao, Yi; Liu, Wei; Zhang, Chao

2015-01-01

In order to investigate the encapsulation of interleukin 1 receptor antagonist (IL-RA) gene-modified mesenchymal stem cells (MSCs) in alginate-poly-L-lysine (APA) microcapsules for the persistent delivery of interleukin 1 receptor antagonist (IL-RA) to treat Rheumatoid arthritis (RA). We transfect mesenchymal stem cells with IL-RA gene, and quantify the IL-RA proteins released from the encapsulated cells followed by microencapsulation of recombinant mesenchymal stem cells, and thus observe the permeability of APA microcapsules and evaluate clinical effects after induction and treatment of collagen-induced arthritis (CIA). The concentration of IL-RA in the supernatant was determined by IL-RA ELISA kit by run in technical triplicates using samples from three separate mice. Encapsulated IL-RA gene-transfected cells were capable of constitutive delivery of IL-RA proteins for at least 30 days. Moreover, the APA microcapsules could inhibit the permeation of fluorescein isothiocyanate-conjuncted immunoglobulin G. Also, it has been found that the APA microcapsules can significantly attenuate collagen induced arthritis after delivering of APA microcapsules to rats. Our results demonstrated that the nonautologous IL-RA gene-transfected stem cells are of potential utility for RA therapy.

Growth and gene expression are predominantly controlled by distinct regions of the human IL-4 receptor.

Science.gov (United States)

Ryan, J J; McReynolds, L J; Keegan, A; Wang, L H; Garfein, E; Rothman, P; Nelms, K; Paul, W E

1996-02-01

IL-4 causes hematopoietic cells to proliferate and express a series of genes, including CD23. We examined whether IL-4-mediated growth, as measured by 4PS phosphorylation, and gene induction were similarly controlled. Studies of M12.4.1 cells expressing human IL-4R truncation mutants indicated that the region between amino acids 557-657 is necessary for full gene expression, which correlated with Stat6 DNA binding activity. This region was not required for 4PS phosphorylation. Tyrosine-to-phenylalanine mutations in the interval between amino acids 557-657 revealed that as long as one tyrosine remained unmutated, CD23 was fully induced. When all three tyrosines were mutated, the receptor was unable to induce CD23. The results indicate that growth regulation and gene expression are principally controlled by distinct regions of IL-4R.

Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

Science.gov (United States)

Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

1999-01-01

Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

Clinical significance of determination of changes of EPS IL-1β, IL-2, IL-10 and LDH5/LDH1 levels in patients with chronic prostatitis

International Nuclear Information System (INIS)

Chen Yongchang

2009-01-01

Objective: To investigate the clinical significance of the changes of expressed prostatic secretion IL-1β, IL-2, IL-10 and LDH5/LDH1 levels in patients with chronic prostatitis. Methods: Expressed prostatic secretion IL-1β, IL-2, IL-10 (with Radioimmunoassay) and LDH5/LDH1 (with cellulose acetate membrane electrophoresis) levels were determined in 32 patients with chronic prostatitis and 35 controls. These 32 patients were of 3 groups: 1)chronic bacterial prostatitis (CBP, n=10) 2) chronic pelvic pain syndrome IIIA (CPPS IIIA n=9) 3) CPPSIIIB n=13. Results: Expressed prostatic secretion levels of IL-1β, IL-2 and LDH5/LDH1 were significantly higher in patients with chronic bacterial prostatitis (CBP) groups than those in controls (all P 0.05). But the expressed prostatic secretion levels of IL-10 were still significantly lower in patients with chronic nonbacterial prostatitis, chronic pelvic pain syndrome(CPPSIIIB) groups than those in controls (all P<0.05). Conclusion: There were changes of expressed prostatic secretion IL-1β, IL-2, IL-10 and LDH5/LDH1 levels in patients with chronic prostatitis. Combined determination of the expressed prostatic secretion 4 markers levels is valuable for the diagnosis of chronic prostatitis and CPPSIII and for differentiation of CPPSIII types. (authors)

Association of IL-1beta gene polymorphism with cachexia from locally advanced gastric cancer

Energy Technology Data Exchange (ETDEWEB)

Zhang, Dianliang; Zheng, Hongmei; Zhou, Yanbing [Department of General Surgery, Affiliated Hospital of Qingdao University Medical College, Qingdao 266003 (China); Tang, Xingming; Yu, Baojun; Li, Jieshou [Research Institute of General Surgery, Jinlin Hospital, Nanjing University, Nanjing 210093 (China)

2007-03-14

IL-1beta has been implicated in inflammatory episode. In view of the inflammatory nature of cancer cachexia, we determined the predictive value of IL-1B-31 T/C, -511 C/T, +3954 C/T and IL-1RN VNTR gene polymorphisms on the occurrence of cachexia associated with locally advanced gastric cancer. The study included 214 patients and 230 healthy volunteers. Genomic DNA was prepared from peripheral blood leukocytes. Genotypes and allele frequencies were determined in patients and healthy controls using restriction fragment length polymorphism analysis of polymerase chain reaction products. The overall frequencies of IL-1B-31 T, -511 T, +3954 T and IL-1RN VNTR alleles in patients with locally advanced gastric cancer were all comparable with those in controls. No significant differences were found in the distribution of IL-1B-31 T, -511 T and IL-1RN VNTR between patients with cachexia and without. Patients with cachexia showed a significantly higher prevalence of IL-1B+3954 T allele than those without (P = 0.018). In a logistic regression analysis adjusted for actual weight, carcinoma location and stage, the IL-1B+3954 CT genotype was associated with an odds ratio of 2.512 (95% CI, 1.180 – 5.347) for cachexia. The IL-1B+3954 T allele is a major risk for cachexia from locally gastric cancer. Genetic factors studied are not likely to play an important role in the determination of susceptibility to locally advanced gastric cancer.

Association of IL-1beta gene polymorphism with cachexia from locally advanced gastric cancer

International Nuclear Information System (INIS)

Zhang, Dianliang; Zheng, Hongmei; Zhou, Yanbing; Tang, Xingming; Yu, Baojun; Li, Jieshou

2007-01-01

IL-1beta has been implicated in inflammatory episode. In view of the inflammatory nature of cancer cachexia, we determined the predictive value of IL-1B-31 T/C, -511 C/T, +3954 C/T and IL-1RN VNTR gene polymorphisms on the occurrence of cachexia associated with locally advanced gastric cancer. The study included 214 patients and 230 healthy volunteers. Genomic DNA was prepared from peripheral blood leukocytes. Genotypes and allele frequencies were determined in patients and healthy controls using restriction fragment length polymorphism analysis of polymerase chain reaction products. The overall frequencies of IL-1B-31 T, -511 T, +3954 T and IL-1RN VNTR alleles in patients with locally advanced gastric cancer were all comparable with those in controls. No significant differences were found in the distribution of IL-1B-31 T, -511 T and IL-1RN VNTR between patients with cachexia and without. Patients with cachexia showed a significantly higher prevalence of IL-1B+3954 T allele than those without (P = 0.018). In a logistic regression analysis adjusted for actual weight, carcinoma location and stage, the IL-1B+3954 CT genotype was associated with an odds ratio of 2.512 (95% CI, 1.180 – 5.347) for cachexia. The IL-1B+3954 T allele is a major risk for cachexia from locally gastric cancer. Genetic factors studied are not likely to play an important role in the determination of susceptibility to locally advanced gastric cancer

Inflammatory bowel disease: the role of inflammatory cytokine gene polymorphisms

Directory of Open Access Journals (Sweden)

Joanna Balding

2004-01-01

Full Text Available THE mechanisms responsible for development of inflammatory bowel disease (IBD have not been fully elucidated, although the main cause of disease pathology is attributed to up-regulated inflammatory processes. The aim of this study was to investigate frequencies of polymorphisms in genes encoding pro-inflammatory and anti-inflammatory markers in IBD patients and controls. We determined genotypes of patients with IBD (n=172 and healthy controls (n=389 for polymorphisms in genes encoding various cytokines (interleukin (IL-1β, IL-6, tumour necrosis factor (TNF, IL-10, IL-1 receptor antagonist. Association of these genotypes to disease incidence and pathophysiology was investigated. No strong association was found with occurrence of IBD. Variation was observed between the ulcerative colitis study group and the control population for the TNF-α-308 polymorphism (p=0.0135. There was also variation in the frequency of IL-6-174 and TNF-α-308 genotypes in the ulcerative colitis group compared with the Crohn's disease group (p=0.01. We concluded that polymorphisms in inflammatory genes are associated with variations in IBD phenotype and disease susceptibility. Whether the polymorphisms are directly involved in regulating cytokine production, and consequently pathophysiology of IBD, or serve merely as markers in linkage disequilibrium with susceptibility genes remains unclear.

Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

Science.gov (United States)

Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

2017-09-01

Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

Cloning, expression and characterisation of a novel gene encoding ...

African Journals Online (AJOL)

微软用户

2012-01-12

Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

Association of a four-locus gene model including IL13, IL4, FCER1B, and ADRB2 with the Asthma Predictive Index and atopy in Chinese Han children.

Science.gov (United States)

Bai, S; Hua, L; Wang, X; Liu, Q; Bao, Y

2018-05-11

Asthma is a complex and heterogeneous disease. We found that gene-gene interactions among IL13 rs20541, IL4 rs2243250, ADRB2 rs1042713, and FCER1B rs569108 in asthmatic children of Chinese Han nationality. This four-locus set constituted an optimal statistical interaction model. Objective: This study examined associations of the four-gene model consisting of IL13, IL4, FCER1B, and ADRB2 with the Asthma Predictive Index (API) and atopy in Chinese Han children. Four single-nucleotide polymorphisms (SNPs) in the four genes were genotyped in 385 preschool children with wheezing symptoms using matrix-assisted laser desorption ionization time-of-flight mass spectrometry. Student's t test and x2 tests were used for this analysis. : Significant correlations were found between the four-locus gene model and the stringent and loose API (both Pfour-locus gene model with atopy (Pfour-locus gene model consisting of L13 rs20541, IL4 rs2243250, ADRB2 rs1042713 and FCER1B rs569108 was associated with the API and atopy. These findings provide an evidence of the gene model for determining a high risk of developing asthma and atopy in Chinese Han children.

Inhibition of interleukin-6 expression by the V protein of parainfluenza virus 5

International Nuclear Information System (INIS)

Lin Yuan; Sun Minghao; Fuentes, Sandra M.; Keim, Celia D.; Rothermel, Terri; He Biao

2007-01-01

The V protein of parainfluenza virus 5 (PIV5) plays an important role in the evasion of host immune responses. The V protein blocks interferon (IFN) signaling in human cells by causing degradation of the STAT1 protein, a key component of IFN signaling, and blocks IFN-β production by preventing nuclear translocation of IRF3, a key transcription factor for activating IFN-β promoter. Interleukin-6 (IL-6), along with tumor necrosis factor (TNF)-α and IL-1β, is a major proinflammatory cytokine that plays important roles in clearing virus infection through inflammatory responses. Many viruses have developed strategies to block IL-6 expression. Wild-type PIV5 infection induces little, if any, expression of cytokines such as IL-6 or TNF-α, whereas infection by a mutant PIV5 lacking the conserved C-terminal cysteine rich domain (rPIV5VΔC) induced high levels of IL-6 expression. Examination of mRNA levels of IL-6 indicated that the transcription activation of IL-6 played an important role in the increased IL-6 expression. Co-infection with wild-type PIV5 prevented the activation of IL-6 transcription by rPIV5VΔC, and a plasmid encoding the full-length PIV5 V protein prevented the activation of IL-6 promoter-driven reporter gene expression by rPIV5VΔC, indicating that the V protein played a role in inhibiting IL-6 transcription. The activation of IL-6 was independent of IFN-β even though rPIV5VΔC-infected cells produced IFN-β. Using reporter gene assays and chromatin immunoprecipitation (ChIP), it was found that NF-κB played an important role in activating expression of IL-6. We have proposed a model of activating and inhibiting IL-6 transcription by PIV5

Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

Science.gov (United States)

Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

2014-03-05

The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

NARCIS (Netherlands)

Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

1996-01-01

Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

DEFF Research Database (Denmark)

Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

2000-01-01

establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

Differential Influence of Inositol Hexaphosphate on the Expression of Genes Encoding TGF-β Isoforms and Their Receptors in Intestinal Epithelial Cells Stimulated with Proinflammatory Agents

Directory of Open Access Journals (Sweden)

Małgorzata Kapral

2013-01-01

Full Text Available Transforming growth factor β (TGF-β is a multifunctional cytokine recognized as an important regulator of inflammatory responses. The effect of inositol hexaphosphate (IP6, a naturally occurring phytochemical, on the mRNA expression of TGF-β1, TGF-β2, TGF-β3 and TβRI, TβRII, and TβRIII receptors stimulated with bacterial lipopolysaccharides (Escherichia coli and Salmonella typhimurium and IL-1β in intestinal cells Caco-2 for 3 and 12 h was investigated. Real-time qRT-PCR was used to validate mRNAs level of examined genes. Bacterial endotoxin promoted differential expression of TGF-βs and their receptors in a time-dependent manner. IL-1β upregulated mRNA levels of all TGF-βs and receptors at both 3 h and 12 h. IP6 elicited the opposed to LPS effect by increasing downregulated transcription of the examined genes and suppressing the expression of TGF-β1 at 12 h. IP6 counteracted the stimulatory effect of IL-1β on TGF-β1 and receptors expression by decreasing their mRNA levels. IP6 enhanced LPS- and IL-1β-stimulated mRNA expression of TGF-β2 and -β3. Based on these studies it may be concluded that IP6 present in the intestinal milieu may exert immunoregulatory effects and chemopreventive activity on colonic epithelium under inflammatory conditions or during microbe-induced infection/inflammation by modulating the expression of genes encoding TGF-βs and their receptors at transcriptional level.

Education, tobacco smoking, alcohol consumption, and IL-2 and IL-6 gene polymorphisms in the survival of head and neck cancer

Directory of Open Access Journals (Sweden)

R.V.M. López

2011-10-01

Full Text Available The association of education, tobacco smoking, alcohol consumption, and interleukin-2 (IL-2 +114 and -384 and -6 (IL-6 -174 DNA polymorphisms with head and neck squamous cell carcinoma (HNSCC was investigated in a cohort study of 445 subjects. IL-2 and IL-6 genotypes were determined by real-time PCR. Cox regression was used to estimate hazard ratios (HR and 95% confidence intervals (95%CI of disease-specific survival according to anatomical sites of the head and neck. Mean age was 56 years and most patients were males (87.6%. Subjects with 5 or more years of schooling had better survival in larynx cancer. Smoking had no effect on HNSCC survival, but alcohol consumption had a statistically significant effect on larynx cancer. IL-2 gene +114 G/T (HR = 0.52; 95%CI = 0.15-1.81 and T/T (HR = 0.22; 95%CI = 0.02-3.19 genotypes were associated with better survival in hypopharynx cancer. IL-2 +114 G/T was a predictor of poor survival in oral cavity/oropharynx cancer and larynx cancer (HR = 1.32; 95%CI = 0.61-2.85. IL-2 -384 G/T was associated with better survival in oral cavity/oropharynx cancer (HR = 0.80; 95%CI = 0.45-1.42 and hypopharynx cancer (HR = 0.68; 95%CI = 0.21-2.20, but an inverse relationship was observed for larynx cancer. IL-6 -174 G/C was associated with better survival in hypopharynx cancer (HR = 0.68; 95%CI = 0.26-1.78 and larynx cancer (HR = 0.93; 95%CI = 0.42-2.07, and C/C reduced mortality in larynx cancer. In general, our results are similar to previous reports on the value of education, smoking, alcohol consumption, and IL-2 and IL-6 genetic polymorphisms for the prognosis of HNSCC, but the risks due to these variables are small and estimates imprecise.

Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

NARCIS (Netherlands)

Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

DEFF Research Database (Denmark)

Kristensen, Michael; Lok, Finn; Planchot, Véronique

1999-01-01

with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

IL-1 family members IL-18 and IL-33 upregulate the inflammatory potential of differentiated human Th1 and Th2 cultures

DEFF Research Database (Denmark)

Blom, Lars; Poulsen, Lars K.

2012-01-01

The IL-1 family members IL-1ß, IL-18, and IL-33 are potent cytokines in relationship to amplifying the CD4(+) T cell cytokine production. To evaluate their impact on in vitro-differentiated human Th1 and Th2 cultures, such cultures were established from naive T cells, purified from healthy blood...... donors, and reactivated in the presence of IL-1ß, IL-18, or IL-33. Interestingly, we observe modifying responses in Th1 and Th2 cultures induced by IL-18 or IL-33 but not by IL-1ß, both contributing to amplify production of IL-5, IL-13, and IFN-¿. IL-18 or IL-33 stimulation of Th1 cultures resulted...... in increased IFN-¿ and IL-13 production concurrent with reduced IL-10 gene transcription and secretion even though Th1 cultures, in contrast to IL-18Ra, had low ST2L expression. Furthermore, adding IL-18 to Th1 cultures promoted Tbet mRNA expression and production. Th2 cultures stimulated with IL-18 or IL-33...

CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

Directory of Open Access Journals (Sweden)

Tri Joko Raharjo

2011-12-01

Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

[Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

Science.gov (United States)

Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

2008-01-01

The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

Directory of Open Access Journals (Sweden)

Clarke Robert

2006-05-01

Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

Bacteriophage-encoded shiga toxin gene in atypical bacterial host

Directory of Open Access Journals (Sweden)

Casas Veronica

2011-07-01

Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

Gastric epithelial expression of IL-12 cytokine family in Helicobacter pylori infection in human: is it head or tail of the coin?

Directory of Open Access Journals (Sweden)

Fadi Al-Sammak

Full Text Available Recently, there has been a growing interest in an expanding group of cytokines known as "IL-12 family". The so far gained knowledge about these cytokines, as crucial playmakers in mucosal immunity, has not yet been sufficiently investigated in the context of Helicobacter pylori infection. All genes encoding the monomeric components of these cytokines and their corresponding receptors were examined in gastric epithelial cell lines (AGS and MKN-28 after being infected with 4 H. pylori strains: BCM-300, P1 wild-type, and P1-derived isogenic mutants lacking cytotoxin-associated gene A (cagA or virulence gene virB7 (multiplicity of infection=50. Both infected and uninfected samples were analyzed after 24h and 48h using real-time quantitative polymerase chain reaction (RT-qPCR. Gene expression analysis demonstrated a strong upregulation of IL23A (encodes p19 by infection, whereas IL23R, Epstein-Barr virus-induced gene 3 (EBI3, IL6ST, IL12A, and IL27RA were found to be expressed, but not regulated, or to a lesser extent. Transcripts of IL12RB2, IL12B, IL12RB1, and IL27A were not detected. Interestingly, P1 resulted in stronger alterations of expression than CagA mutant and BCM-300, particularly for IL23A (59.7-fold versus 32.4- and 6.7-fold, respectively in AGS after 48h, P<.05, whereas no changes were seen with VirB7 mutant. In a proof-of-principle experiment, we demonstrated epithelial-derived expression of IL-12, p19, and Ebi3 in gastric mucosa of gastritis patients using immunohistochemistry (IHC. Unlike IL-12 and Ebi3, increased immunostaining of p19 was observed in H. pylori gastritis. Herein, we highlight the potential role of gastric epithelial cells in mucosal immunity, not only because they are predominant cell type in mucosa and initial site of host-bacterial interaction, but also as a major contributor to molecules that are thought to be primarily expressed by immune cells so far. Of these molecules, p19 was the most relevant one to H

The role of IL6 and ESR1 gene polymorphisms as immunological factors of pregnancy maintenance

Directory of Open Access Journals (Sweden)

Kucherenko A. M.

2013-09-01

Full Text Available Aim. The study is aimed at the evaluation of the association of IL6 gene -174G/C polymorphism and ESR1 gene -397C/T polymorphism with recurrent pregnancy loss (RPL pathogenesis and at the investigation of the ESR1 gene -397C/T variant regulatory significance for the IL6 gene function. Methods. A case group of 75 women with RPL history and a control group of 106 unrelated healthy women, who have given birth to at least one child conceived in natural way, were genotyped by a PCR based restriction fragment length polymorphism assay. Results. There was no significant difference in IL6 -174G/C or ESR1 -397C/T genotype and allele frequencies between the case and control groups. Combined genotype distribution analysis showed significantly (p < 0.05 lower frequency of individuals homozygous for both IL6 -174G and ESR1 -397C alleles in case group (0.026 comparing to control (0.094. Conclusions. Genotype comprising IL6 -174G and ESR1 -397C alleles in homozygous state may be considered as a genetic marker of successful pregnancy maintenance during gestation early stages.

IL-7 splicing variant IL-7δ5 induces human breast cancer cell proliferation via activation of PI3K/Akt pathway

International Nuclear Information System (INIS)

Pan, Deshun; Liu, Bing; Jin, Xiaobao; Zhu, Jiayong

2012-01-01

Highlights: ► This study confirms the role of IL-7δ5 in breast cancer cell proliferation. ► IL-7δ5 promotes breast cancer cell proliferation and cell cycle progression. ► IL-7δ5 promotes cell proliferation via activation of PI3K/Akt pathway. -- Abstract: Various tumor cells express interleukin 7 (IL-7) and IL-7 variants. IL-7 has been confirmed to stimulate solid tumor cell proliferation. However, the effect of IL-7 variants on tumor cell proliferation remains unclear. In this study, we evaluated the role of IL-7δ5 (an IL-7 variant lacking exon 5) on proliferation and cell cycle progression of human MDA-MB-231 and MCF-7 breast cancer cells. The results showed that IL-7δ5 promoted cell proliferation and cell cycle progression from G1 phase to G2/M phase, associated with upregulation of cyclin D1 expression and the downregulation of p27 kip1 expression. Mechanistically, we found that IL-7δ5 induced the activation of Akt. Inhibition of PI3K/Akt pathway by LY294002 reversed the proliferation and cell cycle progression of MDA-MB-231 and MCF-7 cells induced by IL-7δ5. In conclusion, our findings demonstrate that IL-7δ5 variant induces human breast cancer cell proliferation and cell cycle progression via activation of PI3K/Akt pathway. Thus, IL-7δ5 may be a potential target for human breast cancer therapeutics intervention.

Identification and characterization of a gene encoding a putative ...

Indian Academy of Sciences (India)

2012-10-30

Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

Directory of Open Access Journals (Sweden)

Bryan D Moyer

Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

Science.gov (United States)

Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

2003-08-01

ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

IL-6 gene polymorphisms and sepsis in icu adult romanian patients: a prospective study

Directory of Open Access Journals (Sweden)

Georgescu Anca Meda

2017-03-01

Full Text Available Objectives: The goal of the study was to investigate the correlations between the interleukin-6 IL-6 -174 G/C and IL-6 -572 G/C gene polymorphisms and sepsis risk and severity in adult ICU patients.

Variable number of tandem repeat polymorphisms of the interleukin-1 receptor antagonist gene IL-1RN: a novel association with the athlete status

Directory of Open Access Journals (Sweden)

Ryckman Kelli K

2010-02-01

Full Text Available Abstract Background The interleukin-1 (IL-1 family of cytokines is involved in the inflammatory and repair reactions of skeletal muscle during and after exercise. Specifically, plasma levels of the IL-1 receptor antagonist (IL-1ra increase dramatically after intense exercise, and accumulating evidence points to an effect of genetic polymorphisms on athletic phenotypes. Therefore, the IL-1 family cytokine genes are plausible candidate genes for athleticism. We explored whether IL-1 polymorphisms are associated with athlete status in European subjects. Methods Genomic DNA was obtained from 205 (53 professional and 152 competitive non-professional Italian athletes and 458 non-athlete controls. Two diallelic polymorphisms in the IL-1β gene (IL-1B at -511 and +3954 positions, and a variable number tandem repeats (VNTR in intron 2 of the IL-1ra gene (IL-1RN were assessed. Results We found a 2-fold higher frequency of the IL-1RN 1/2 genotype in athletes compared to non-athlete controls (OR = 1.93, 95% CI = 1.37-2.74, 41.0% vs. 26.4%, and a lower frequency of the 1/1 genotype (OR = 0.55, 95% CI = 0.40-0.77, 43.9% vs. 58.5%. Frequency of the IL-1RN 2/2 genotype did not differ between groups. No significant differences between athletes and controls were found for either -511 or +3954 IL-1B polymorphisms. However, the haplotype (-511C-(+3954T-(VNTR2 was 3-fold more frequent in athletes than in non-athletes (OR = 3.02, 95% CI = 1.16-7.87. Interestingly, the IL-1RN 1/2 genotype was more frequent in professional than in non-professional athletes (OR = 1.92, 95% CI = 1.02-3.61, 52.8% vs. 36.8%. Conclusions Our study found that variants at the IL-1ra gene associate with athletic status. This confirms the crucial role that cytokine IL-1ra plays in human physical exercise. The VNTR IL-1RN polymorphism may have implications for muscle health, performance, and/or recovery capacities. Further studies are needed to assess these specific issues. As VNTR IL-1RN

Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

Science.gov (United States)

Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

2009-02-27

All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

IL2RA/CD25 Gene Polymorphisms: Uneven Association with Multiple Sclerosis (MS) and Type 1 Diabetes (T1D)

Science.gov (United States)

Alcina, Antonio; Fedetz, María; Ndagire, Dorothy; Fernández, Oscar; Leyva, Laura; Guerrero, Miguel; Abad-Grau, María M.; Arnal, Carmen; Delgado, Concepción; Lucas, Miguel; Izquierdo, Guillermo; Matesanz, Fuencisla

2009-01-01

Background IL-2 receptor (IL2R) alpha is the specific component of the high affinity IL2R system involved in the immune response and in the control of autoimmunity. Methods and Results Here we perform a replication and fine mapping of the IL2RA gene region analyzing 3 SNPs previously associated with multiple sclerosis (MS) and 5 SNPs associated with type 1 diabetes (T1D) in a collection of 798 MS patients and 927 matched Caucasian controls from the south of Spain. We observed association with MS in 6 of 8 SNPs. The rs1570538, at the 3′- UTR extreme of the gene, previously reported to have a weak association with MS, is replicated here (P = 0.032). The most associated T1D SNP (rs41295061) was not associated with MS in the present study. However, the rs35285258, belonging to another independent group of SNPs associated with T1D, showed the maximal association in this study but different risk allele. We replicated the association of only one (rs2104286) of the two IL2RA SNPs identified in the recently performed genome-wide association study of MS. Conclusions These findings confirm and extend the association of this gene with MS and reveal a genetic heterogeneity of the associated polymorphisms and risk alleles between MS and T1D suggesting different immunopathological roles of IL2RA in these two diseases. PMID:19125193

Transcriptional modulation of genes encoding nitrate reductase in ...

African Journals Online (AJOL)

The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

Association of of IL-1 receptor antagonist (IL-1RN) and interleukin-1β genes (IL-1β) polymorphisms with recurrent pregnancy loss in Iranian Azeri women.

Science.gov (United States)

Ali Rahmani, Seyyed; Paknejad, Zeynab; Mohammadkhanlou, Masoumeh; Daneshparvar, Marina

2017-12-27

Objective One of the most important problems in human reproduction is recurrent pregnancy loss (RPL). RPL is defined as three or more consecutive abortions in the first trimester of pregnancy. The association between the polymorphisms in the immunological factors and RPL was investigated. The aim of our study was to determine the association of interleukin receptor antagonist (IL-IRN) and interleukin-1β (IL-1β) polymorphisms with RPL in Iranian Azeri women. Materials and methods The study participants consisted of 100 women with RPL of Iranian Azeri origin. The control group comprised 100 age- and ethnically-matched healthy women of the same reproductive age. Genomic DNA was extracted from the whole blood and genotype determinations were performed using polymerase chain reaction (PCR) amplification followed by restriction fragment length polymorphism (RFLP) analysis. Results Our results showed no significant relationship between IL-1RN polymorphism and RPL. The homozygous state in -857 C/T variant was seen to be higher in RPL patients than in control subjects. Also frequency of wild type genotype was lower in RPL patients than in controls. However, this associations was not significant. Conclusion This study suggested that -511 C/T (rs16944) and -31 C/T (rs1143627) polymorphisms in IL-1β gene may not be involved in RPL in Iranian Azeri women. Also the promoter polymorphism of the IL-1RN gene may not play a role in the susceptibility to RPL.

TNF-α blockade induces IL-10 expression in human CD4+ T cells

Science.gov (United States)

Evans, Hayley G.; Roostalu, Urmas; Walter, Gina J.; Gullick, Nicola J.; Frederiksen, Klaus S.; Roberts, Ceri A.; Sumner, Jonathan; Baeten, Dominique L.; Gerwien, Jens G.; Cope, Andrew P.; Geissmann, Frederic; Kirkham, Bruce W.; Taams, Leonie S.

2014-02-01

IL-17+ CD4+ T (Th17) cells contribute to the pathogenesis of several human inflammatory diseases. Here we demonstrate that TNF inhibitor (TNFi) drugs induce the anti-inflammatory cytokine IL-10 in CD4+ T cells including IL-17+ CD4+ T cells. TNFi-mediated induction of IL-10 in IL-17+ CD4+ T cells is Treg-/Foxp3-independent, requires IL-10 and is overcome by IL-1β. TNFi-exposed IL-17+ CD4+ T cells are molecularly and functionally distinct, with a unique gene signature characterized by expression of IL10 and IKZF3 (encoding Aiolos). We show that Aiolos binds conserved regions in the IL10 locus in IL-17+ CD4+ T cells. Furthermore, IKZF3 and IL10 expression levels correlate in primary CD4+ T cells and Aiolos overexpression is sufficient to drive IL10 in these cells. Our data demonstrate that TNF-α blockade induces IL-10 in CD4+ T cells including Th17 cells and suggest a role for the transcription factor Aiolos in the regulation of IL-10 in CD4+ T cells.

A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

Directory of Open Access Journals (Sweden)

Jie Lei

2018-03-01

Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

Selection of the in vitro culture media influences mRNA expression of Hedgehog genes, Il-6, and important genes regarding reactive oxygen species in single murine preimplantation embryos.

Science.gov (United States)

Pfeifer, N; Baston-Büst, D M; Hirchenhain, J; Friebe-Hoffmann, U; Rein, D T; Krüssel, J S; Hess, A P

2012-01-01

The aim of this paper was to determine the influence of different in vitro culture media on mRNA expression of Hedgehog genes, il-6, and important genes regarding reactive oxygen species in single mouse embryos. Reverse transcription of single embryos either cultured in vitro from day 0.5 until 3.5 (COOK's Cleavage medium or Vitrolife's G-1 PLUS medium) or in vivo until day 3.5 post coitum. PCR was carried out for β-actin followed by nested-PCR for shh, ihh, il-6, nox, gpx4, gpx1, and prdx2. The number of murine blastocysts cultured in COOK medium which expressed il-6, gpx4, gpx1, and prdx2 mRNA differed significantly compared to the in vivo group. Except for nox, the mRNA profile of the Vitrolife media group embryos varied significantly from the in vivo ones regarding the number of blastocysts expressing the mRNA of shh, ihh, il-6, gpx4, gpx1 and prdx2. The present study shows that different in vitro culture media lead to different mRNA expression profiles during early development. Even the newly developed in vitro culture media are not able to mimic the female reproductive tract. The question of long-term consequences for children due to assisted reproduction techniques needs to be addressed in larger studies.

Selection of the In Vitro Culture Media Influences mRNA Expression of Hedgehog Genes, Il-6, and Important Genes regarding Reactive Oxygen Species in Single Murine Preimplantation Embryos

Science.gov (United States)

Pfeifer, N.; Baston-Büst, D. M.; Hirchenhain, J.; Friebe-Hoffmann, U.; Rein, D. T.; Krüssel, J. S.; Hess, A. P.

2012-01-01

Background. The aim of this paper was to determine the influence of different in vitro culture media on mRNA expression of Hedgehog genes, il-6, and important genes regarding reactive oxygen species in single mouse embryos. Methods. Reverse transcription of single embryos either cultured in vitro from day 0.5 until 3.5 (COOK's Cleavage medium or Vitrolife's G-1 PLUS medium) or in vivo until day 3.5 post coitum. PCR was carried out for β-actin followed by nested-PCR for shh, ihh, il-6, nox, gpx4, gpx1, and prdx2. Results. The number of murine blastocysts cultured in COOK medium which expressed il-6, gpx4, gpx1, and prdx2 mRNA differed significantly compared to the in vivo group. Except for nox, the mRNA profile of the Vitrolife media group embryos varied significantly from the in vivo ones regarding the number of blastocysts expressing the mRNA of shh, ihh, il-6, gpx4, gpx1 and prdx2. Conclusions. The present study shows that different in vitro culture media lead to different mRNA expression profiles during early development. Even the newly developed in vitro culture media are not able to mimic the female reproductive tract. The question of long-term consequences for children due to assisted reproduction techniques needs to be addressed in larger studies. PMID:22919324

Selection of the In Vitro Culture Media Influences mRNA Expression of Hedgehog Genes, Il-6, and Important Genes regarding Reactive Oxygen Species in Single Murine Preimplantation Embryos

Directory of Open Access Journals (Sweden)

N. Pfeifer

2012-01-01

Full Text Available Background. The aim of this paper was to determine the influence of different in vitro culture media on mRNA expression of Hedgehog genes, il-6, and important genes regarding reactive oxygen species in single mouse embryos. Methods. Reverse transcription of single embryos either cultured in vitro from day 0.5 until 3.5 (COOK’s Cleavage medium or Vitrolife’s G-1 PLUS medium or in vivo until day 3.5 post coitum. PCR was carried out for β-actin followed by nested-PCR for shh, ihh, il-6, nox, gpx4, gpx1, and prdx2. Results. The number of murine blastocysts cultured in COOK medium which expressed il-6, gpx4, gpx1, and prdx2 mRNA differed significantly compared to the in vivo group. Except for nox, the mRNA profile of the Vitrolife media group embryos varied significantly from the in vivo ones regarding the number of blastocysts expressing the mRNA of shh, ihh, il-6, gpx4, gpx1 and prdx2. Conclusions. The present study shows that different in vitro culture media lead to different mRNA expression profiles during early development. Even the newly developed in vitro culture media are not able to mimic the female reproductive tract. The question of long-term consequences for children due to assisted reproduction techniques needs to be addressed in larger studies.

IL17 factors are early regulators in the gut epithelium during inflammatory response to Vibrio in the sea urchin larva

Science.gov (United States)

Buckley, Katherine M; Ho, Eric Chun Hei; Hibino, Taku; Schrankel, Catherine S; Schuh, Nicholas W; Wang, Guizhi; Rast, Jonathan P

2017-01-01

IL17 cytokines are central mediators of mammalian immunity. In vertebrates, these factors derive from diverse cellular sources. Sea urchins share a molecular heritage with chordates that includes the IL17 system. Here, we characterize the role of epithelial expression of IL17 in the larval gut-associated immune response. The purple sea urchin genome encodes 10 IL17 subfamilies (35 genes) and 2 IL17 receptors. Most of these subfamilies are conserved throughout echinoderms. Two IL17 subfamilies are sequentially strongly upregulated and attenuated in the gut epithelium in response to bacterial disturbance. IL17R1 signal perturbation results in reduced expression of several response genes including an IL17 subtype, indicating a potential feedback. A third IL17 subfamily is activated in adult immune cells indicating that expression in immune cells and epithelia is divided among families. The larva provides a tractable model to investigate the regulation and consequences of gut epithelial IL17 expression across the organism. DOI: http://dx.doi.org/10.7554/eLife.23481.001 PMID:28447937

Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

Science.gov (United States)

Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

1993-01-01

Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

Reprogrammed chondrocytes engineered to produce IL-12 provide novel ex vivo immune-gene therapy for cancer.

Science.gov (United States)

Tada, Hiroyuki; Kishida, Tsunao; Fujiwara, Hitoshi; Kosuga, Toshiyuki; Konishi, Hirotaka; Komatsu, Shuhei; Shiozaki, Atsushi; Ichikawa, Daisuke; Okamoto, Kazuma; Otsuji, Eigo; Mazda, Osam

2017-03-01

The somatic cell reprogramming technology was applied to a novel and promising ex vivo immune-gene therapy strategy for cancer. To establish a novel ex vivo cytokine gene therapy of cancer using the somatic cell reprogramming procedures. Mouse fibroblasts were converted into chondrocytes and subsequently transduced with IL-12 gene. The resultant IL-12 induced chondrogenic cells were irradiated with x-ray and inoculated into mice bearing CT26 colon cancer. The irradiation at 20 Gy or higher totally eliminated the proliferative potential of the cells, while less significantly influencing the IL-12 production from the cells. An inoculation of the irradiated IL-12 induced chondrogenic cells significantly suppressed tumor by inducing tumor-specific cytotoxic T lymphocytes, enhancing natural killer tumoricidal activity and inhibiting tumor neoangiogenesis in the mice. The somatic cell reprogramming procedures may provide a novel and effective means to treat malignancies.

Benralizumab: a unique IL-5 inhibitor for severe asthma

Directory of Open Access Journals (Sweden)

Tan LD

2016-04-01

Full Text Available Laren D Tan,1 Jennifer M Bratt,2 Dorottya Godor,3 Samuel Louie,2 Nicholas J Kenyon2 1Division of Pulmonary and Critical Care Medicine, Department of Internal Medicine, School of Medicine, Loma Linda University, Loma Linda, CA, USA; 2Division of Pulmonary, Critical Care and Sleep Medicine, Department of Internal Medicine, School of Medicine, University of California Davis, Sacramento, CA, USA; 3School of Medicine, Semmelweis University, Budapest, Hungary Abstract: The presence of eosinophilic inflammation is a characteristic feature of chronic and acute inflammation in asthma. An estimated 5%–10% of the 300 million people worldwide who suffer from asthma have a severe form. Patients with eosinophilic airway inflammation represent approximately 40%–60% of this severe asthmatic population. This form of asthma is often uncontrolled, marked by refractoriness to standard therapy, and shows persistent airway eosinophilia despite glucocorticoid therapy. This paper reviews personalized novel therapies, more specifically benralizumab, a humanized anti-IL-5Rα antibody, while also being the first to provide an algorithm for potential candidates who may benefit from anti-IL-5Rα therapy. Keywords: asthma, eosinophils, asthma treatments, benralizumab, IL-5, IL-5Rα, MEDI-563

Johne's disease in cattle is associated with enhanced expression of genes encoding IL-5, GATA-3, tissue inhibitors of matrix metalloproteinases 1 and 2, and factors promoting apoptosis in peripheral blood mononuclear cells

DEFF Research Database (Denmark)

Coussens, P.M.; Pudrith, C.B.; Skovgaard, Kerstin

2005-01-01

remodeling deficiencies through higher expression of tissue inhibitor of matrix metalloproteinase (TIMP) 1 and TIMP2 RNA and lower expression of matrix metalloproteinase (MMP) 14 RNA than similar cells from healthy controls, and that cells within the PBMC population of M. paratuberculosis-infected cows...... upon by quantitative real-time PCR (Q-RT-PCR). Our results indicate that T cells within PBMCs from M. paratuberculosis-infected cows have adopted a predominant Th 2-like phenotype (enhanced expression of IL-5, GATA 3, and possibly IL-4 mRNA), that cells within infected cow PBMCs may exhibit tissue...

GENOTYPE DIFFERENCE OF –572 G>C AND -174 G>C IL-6 GENE POLYMORPHISM BETWEEN BALINESE POSTMENOPAUSAL WOMEN WITH OSTEOPOROSIS AND WITHOUT OSTEOPOROSIS

Directory of Open Access Journals (Sweden)

E Yulianto

2013-09-01

Full Text Available Background: Osteoporosis is a silent metabolic disease characterized by diminished bone mass and change in bone microstructure which cause increment of fracture risk. Until now, osteoporosis still becomes one of major health problems around the world. In Indonesia, the incidence of osteoporosisis 25%. Previous study have shown the relation between osteoporosis and IL-6 gene polymorphism at-572G>C and -174 G>C. There are some controversies about the correlation between thesepolymorphism and osteoporosis because of different result between each study. Genotype G polymorphism at -572 G>C of IL-6 gene has been correlated with lower Bone mineral density (BMD and Genotype G polymorphism at -174G>C of IL-6 gene has been correlated with higher BMD value.In Indonesia, there are still no study about the association between IL-6 gene polymorphism and osteoporosis. In the future this IL-6 gene polymorphism could be used as a genetic marker for osteoporosis in postmenopausal woman. The objective of this study is to determine the difference ofgenotype of -572G>C and -174G>C polymorphism of IL-6 gene and osteoporosis in Balinese postmenopausal women.Method: This research design is a case control study. Sample was obtained at orthopedic outpatient clinic of Sanglah General Hospital, Bali-Indonesia from June 2012 untilNovember 2012. The diagnosis of osteoporosis is described as BMD value with T score ≤ -2.5 SDusing DEXA. All sample’s peripheral blood are taken to be isolated for DNA and analyzed for IL-6 gene polymorphism at -572G>C and -174G>C using Real Time PCR. Data obtained was analyzed with chi square test using SPSS.Results: This research found 11 osteoporosis sample from total 52 with no difference sample characteristic between case and control (p > 0.05. Using Chi square test,There was a significant differences between genotype -572 G>C; IL-6 gene polymorphism in Balinese postmenopausal woman with osteoporosis and in Balinese

The pea branching RMS2 gene encodes the PsAFB4/5 auxin receptor and is involved in an auxin-strigolactone regulation loop.

Science.gov (United States)

Ligerot, Yasmine; de Saint Germain, Alexandre; Waldie, Tanya; Troadec, Christelle; Citerne, Sylvie; Kadakia, Nikita; Pillot, Jean-Paul; Prigge, Michael; Aubert, Grégoire; Bendahmane, Abdelhafid; Leyser, Ottoline; Estelle, Mark; Debellé, Frédéric; Rameau, Catherine

2017-12-01

Strigolactones (SLs) are well known for their role in repressing shoot branching. In pea, increased transcript levels of SL biosynthesis genes are observed in stems of highly branched SL deficient (ramosus1 (rms1) and rms5) and SL response (rms3 and rms4) mutants indicative of negative feedback control. In contrast, the highly branched rms2 mutant has reduced transcript levels of SL biosynthesis genes. Grafting studies and hormone quantification led to a model where RMS2 mediates a shoot-to-root feedback signal that regulates both SL biosynthesis gene transcript levels and xylem sap levels of cytokinin exported from roots. Here we cloned RMS2 using synteny with Medicago truncatula and demonstrated that it encodes a putative auxin receptor of the AFB4/5 clade. Phenotypes similar to rms2 were found in Arabidopsis afb4/5 mutants, including increased shoot branching, low expression of SL biosynthesis genes and high auxin levels in stems. Moreover, afb4/5 and rms2 display a specific resistance to the herbicide picloram. Yeast-two-hybrid experiments supported the hypothesis that the RMS2 protein functions as an auxin receptor. SL root feeding using hydroponics repressed auxin levels in stems and down-regulated transcript levels of auxin biosynthesis genes within one hour. This auxin down-regulation was also observed in plants treated with the polar auxin transport inhibitor NPA. Together these data suggest a homeostatic feedback loop in which auxin up-regulates SL synthesis in an RMS2-dependent manner and SL down-regulates auxin synthesis in an RMS3 and RMS4-dependent manner.

CFH Y402H polymorphism and the complement activation product C5a: effects on NF-κB activation and inflammasome gene regulation.

Science.gov (United States)

Cao, Sijia; Wang, Jay Ching Chieh; Gao, Jiangyuan; Wong, Matthew; To, Elliott; White, Valerie A; Cui, Jing Z; Matsubara, Joanne A

2016-05-01

The Y402H polymorphism in the complement factor H (CFH) gene is an important risk factor for age-related macular degeneration (AMD). Complement activation products and proinflammatory cytokines are associated with this polymorphism at the systemic level, but less is known of the associations in the outer retina of the genotyped eye. Here we investigate complement activation products and their role in nuclear factor (NF)-κB activation and gene expression of the NLRP3 inflammasome pathway. Postmortem donor eyes were genotyped for the CFH Y402H polymorphism and assessed for complement C3a, C5a, interleukin (IL)-18 and tumour necrosis factor (TNF)-α. ARPE19 cells were stimulated basolaterally with C5a or TNF-α in polarised cultures. NF-κB activation was assessed with a reporter cell line. Gene expression of inflammasome-related (NLRP3, caspase-1, IL-1β and IL-18) and classic inflammatory (IL-6 and IL-8) genes was studied. The distribution of inflammasome products, IL-1β and IL-18, was studied in postmortem donor eyes with AMD pathologies. Eyes with the homozygous at-risk variant demonstrated higher levels of C5a, IL-18 and TNF-α in Bruch's membrane and choroid. C5a promoted NF-κB activation and upregulation of IL-18 in polarised ARPE19. TNF-α promoted NF-κB activation and gene expression of caspase-1, IL-1β, IL-18, IL-6 and IL-8, but downregulated NLRP3. In eyes with geographic atrophy, strong immunoreactivity was observed for inflammasome products IL-1β and IL-18 compared with age-matched controls. The at-risk polymorphism of the CFH Y402H may contribute to AMD disease process through increased complement and NF-κB activation, and the upregulation of IL-18, a product of inflammasome activation. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://www.bmj.com/company/products-services/rights-and-licensing/

The analysis of correlation between IL-1B gene expression and genotyping in multiple sclerosis patients.

Science.gov (United States)

Heidary, Masoumeh; Rakhshi, Nahid; Pahlevan Kakhki, Majid; Behmanesh, Mehrdad; Sanati, Mohammad Hossein; Sanadgol, Nima; Kamaladini, Hossein; Nikravesh, Abbas

2014-08-15

IL-1B is released by monocytes, astrocytes and brain endothelial cells and seems to be involved in inflammatory reactions of the central nervous system (CNS) in multiple sclerosis (MS). This study aims to evaluate the expression level of IL-1B mRNA in peripheral blood mononuclear cells (PBMCs), genotype the rs16944 SNP and find out the role of this SNP on the expression level of IL-1B in MS patients. We found that the expression level of IL-1B in MS patients increased 3.336 times more than controls in PBMCs but the rs16944 SNP in the promoter region of IL-1B did not affect the expression level of this gene and there was not association of this SNP with MS in the examined population. Also, our data did not reveal any correlation between normalized expressions of IL-1B gene with age of participants, age of onset, and disease duration. Copyright © 2014 Elsevier B.V. All rights reserved.

Prevalence and sequence variations of the genes encoding the five antigens included in the novel 5CVMB vaccine covering group B meningococcal disease.

Science.gov (United States)

Jacobsson, Susanne; Hedberg, Sara Thulin; Mölling, Paula; Unemo, Magnus; Comanducci, Maurizio; Rappuoli, Rino; Olcén, Per

2009-03-04

During the recent years, projects are in progress for designing broad-range non-capsular-based meningococcal vaccines, covering also serogroup B isolates. We have examined three genes encoding antigens (NadA, GNA1030 and GNA2091) included in a novel vaccine, i.e. the 5 Component Vaccine against Meningococcus B (5CVMB), in terms of gene prevalence and sequence variations. These data were combined with the results from a similar study, examining the two additional antigens included in the 5CVMB (fHbp and GNA2132). nadA and fHbp v. 1 were present in 38% (n=36), respectively 71% (n=67) of the isolates, whereas gna2132, gna1030 and gna2091 were present in all the Neisseria meningitidis isolates tested (n=95). The level of amino acid conservation was relatively high in GNA1030 (93%), GNA2091 (92%), and within the main variants of NadA and fHbp. GNA2132 (54% of the amino acids conserved) appeared to be the most diversified antigen. Consequently, the theoretical coverage of the 5CVMB antigens and the feasibility to use these in a broad-range meningococcal vaccine is appealing.

RNAi-based silencing of genes encoding the vacuolar- ATPase ...

African Journals Online (AJOL)

2016-11-09

Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

Pharmacogenetics of efficacy and safety of HCV treatment in HCV-HIV coinfected patients: significant associations with IL28B and SOCS3 gene variants.

Directory of Open Access Journals (Sweden)

Francesc Vidal

Full Text Available This was a safety and efficacy pharmacogenetic study of a previously performed randomized trial which compared the effectiveness of treatment of hepatitis C virus infection with pegylated interferon alpha (pegIFNα 2a vs. 2b, both with ribavirin, for 48 weeks, in HCV-HIV coinfected patients.The study groups were made of 99 patients (efficacy pharmacogenetic substudy and of 114 patients (safety pharmacogenetic substudy. Polymorphisms in the following candidate genes IL28B, IL6, IL10, TNFα, IFNγ, CCL5, MxA, OAS1, SOCS3, CTLA4 and ITPA were assessed. Genotyping was carried out using Sequenom iPLEX-Gold, a single-base extension polymerase chain reaction. Efficacy end-points assessed were: rapid, early and sustained virological response (RVR, EVR and SVR, respectively. Safety end-points assessed were: anemia, neutropenia, thrombocytopenia, flu-like syndrome, gastrointestinal disturbances and depression. Chi square test, Student's T test, Mann-Whitney U test and logistic regression were used for statistic analyses.As efficacy is concerned, IL28B and CTLA4 gene polymorphisms were associated with RVR (p<0.05 for both comparisons. Nevertheless, only polymorphism in the IL28B gene was associated with SVR (p = 0.004. In the multivariate analysis, the only gene independently associated with SVR was IL28B (OR 2.61, 95%CI 1.2-5.6, p = 0.01. With respect to safety, there were no significant associations between flu-like syndrome or depression and the genetic variants studied. Gastrointestinal disturbances were associated with ITPA gene polymorphism (p = 0.04. Anemia was associated with OAS1 and CTLA4 gene polymorphisms (p = 0.049 and p = 0.045, respectively, neutropenia and thromobocytopenia were associated with SOCS3 gene polymorphism (p = 0.02 and p = 0.002, respectively. In the multivariate analysis, the associations of the SOCS3 gene polymorphism with neutropenia (OR 0.26, 95%CI 0.09-0.75, p = 0.01 and thrombocytopenia (OR

Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

OpenAIRE

Hays, Shan M; Swanson, Johanna; Selker, Eric U

2002-01-01

We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

RNAi-Based Identification of Gene-Specific Nuclear Cofactor Networks Regulating Interleukin-1 Target Genes

Directory of Open Access Journals (Sweden)

Johanna Meier-Soelch

2018-04-01

Full Text Available The potent proinflammatory cytokine interleukin (IL-1 triggers gene expression through the NF-κB signaling pathway. Here, we investigated the cofactor requirements of strongly regulated IL-1 target genes whose expression is impaired in p65 NF-κB-deficient murine embryonic fibroblasts. By two independent small-hairpin (shRNA screens, we examined 170 genes annotated to encode nuclear cofactors for their role in Cxcl2 mRNA expression and identified 22 factors that modulated basal or IL-1-inducible Cxcl2 levels. The functions of 16 of these factors were validated for Cxcl2 and further analyzed for their role in regulation of 10 additional IL-1 target genes by RT-qPCR. These data reveal that each inducible gene has its own (quantitative requirement of cofactors to maintain basal levels and to respond to IL-1. Twelve factors (Epc1, H2afz, Kdm2b, Kdm6a, Mbd3, Mta2, Phf21a, Ruvbl1, Sin3b, Suv420h1, Taf1, and Ube3a have not been previously implicated in inflammatory cytokine functions. Bioinformatics analysis indicates that they are components of complex nuclear protein networks that regulate chromatin functions and gene transcription. Collectively, these data suggest that downstream from the essential NF-κB signal each cytokine-inducible target gene has further subtle requirements for individual sets of nuclear cofactors that shape its transcriptional activation profile.

Influence of TYK2 in systemic sclerosis susceptibility : a new locus in the IL-12 pathway

NARCIS (Netherlands)

López-Isac, Elena; Campillo-Davo, Diana; Bossini-Castillo, Lara; Guerra, Sandra G; Assassi, Shervin; Simeón, Carmen Pilar; Carreira, Patricia; Ortego-Centeno, Norberto; García de la Peña, Paloma; Beretta, Lorenzo; Santaniello, Alessandro; Bellocchi, Chiara; Lunardi, Claudio; Moroncini, Gianluca; Gabrielli, Armando; Riemekasten, Gabriela; Witte, Torsten; Hunzelmann, Nicolas; Kreuter, Alexander; Distler, Jörg Hw; Voskuyl, Alexandre E; de Vries-Bouwstra, Jeska; Herrick, Ariane; Worthington, Jane; Denton, Christopher P; Fonseca, Carmen; Radstake, Timothy Rdj; Mayes, Maureen D; Martín, Javier

OBJECTIVES: TYK2 is a common genetic risk factor for several autoimmune diseases. This gene encodes a protein kinase involved in interleukin 12 (IL-12) pathway, which is a well-known player in the pathogenesis of systemic sclerosis (SSc). Therefore, we aimed to assess the possible role of this locus

Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

NARCIS (Netherlands)

Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

Environmental cycle of antibiotic resistance encoded genes: A systematic review

Directory of Open Access Journals (Sweden)

R. ghanbari

2017-12-01

Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

Directory of Open Access Journals (Sweden)

Bingzhi Chen

Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

Fungicidal activity of peptides encoded by immunoglobulin genes

OpenAIRE

Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

2017-01-01

Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

Melanoma differentiation associated gene-7/interleukin-24 (mda-7/IL-24): Novel gene therapeutic for metastatic melanoma

International Nuclear Information System (INIS)

Fisher, Paul B.; Sarkar, Devanand; Lebedeva, Irina V.; Emdad, Luni; Gupta, Pankaj; Sauane, Moira; Su Zaozhong; Grant, Steven; Dent, Paul; Curiel, David T.; Senzer, Neil; Nemunaitis, John

2007-01-01

A potentially less toxic approach for cancer therapy comprises induction of tumor cells to lose growth potential irreversibly and terminally differentiate. Combining this scheme termed 'differentiation therapy of cancer' with subtraction hybridization to human melanoma cells resulted in the cloning of melanoma differentiation associated (mda) genes displaying elevated expression as a consequence of induction of terminal differentiation. One originally novel gene, mda-7, was found to display elevated expression in normal melanocytes and nevi with progressive loss of expression as a consequence of melanoma development and progression to metastasis. Based on structure, biochemical properties and chromosomal location, mda-7 has now been reclassified as interleukin (IL)-24, a member of the expanding IL-10 family of cytokines. In vitro cell culture and in vivo animal studies indicate that mda-7/IL-24 selectively induces programmed cell death (apoptosis) in multiple human cancers (including melanomas), without harming normal cells, and promotes profound anti-tumor activity in nude mice containing human tumor xenografts. Based on these remarkable properties, a Phase I clinical trial was conducted to test the safety of administration of mda-7/IL-24 by a replication incompetent adenovirus (Ad.mda-7; INGN 241) in patients with advanced solid cancers including melanoma. mda-7/IL-24 was found to be safe and to promote significant clinical activity, particularly in the context of patients with metastatic melanoma. These results provide an impetus for further clinical studies and document a central paradigm of cancer therapy, namely translation of basic science from the 'bench to the bedside.'

The effects of IL-1β, IL-8, G-CSF and TNF-α as molecular adjuvant on the immune response to an E. tarda subunit vaccine in flounder (Paralichthys olivaceus).

Science.gov (United States)

Guo, Ming; Tang, Xiaoqian; Sheng, Xiuzhen; Xing, Jing; Zhan, Wenbin

2018-06-01

Cytokines play vital roles in mounting immune responses and activating host defense network. In this study, the expression plasmid pcDNA3.1 (pcN3) encoding four flounder (Paralichthys olivaceus) cytokines including IL-1β, TNF-α, IL-8 or G-CSF (pcIL-1β, pcTNF-α, pcIL-8 and pcG-CSF) were successfully constructed, and their adjuvant potential on an Edwardsiella tarda (E. tarda) subunit vaccine OmpV (rOmpV) were comparatively analyzed in vaccinated flounder model. Results revealed that flounder vaccinated with rOmpV plus pcIL-1β, pcIL-8 or pcG-CSF produced the relative percent survivals (RPS) of 71%, 65% and 49% respectively, which were higher than that in flounder vaccinated with rOmpV plus pcTNF-α (39%) or pcN3 (36%, the control group). Immunological analysis showed that: (1) except pcTNF-α, higher levels of anti-E. tarda serum antibodies and sIg + lymphocytes in spleen, head kidney and peripheral blood were significantly enhanced by pcIL-1β, pcIL-8 or pcG-CSF, however, pcIL-8 and pcIL-1β enhanced higher levels of sIg + lymphocytes and anti-E. tarda antibodies than pcG-CSF; (2) pcTNF-α could promote the up-regulation of genes participated in cellular immunity (MHCIα, IFN-γ, CD8α and CD8β), pcIL-1β could enhance the expression of genes related to humoral immunity (CD4-1, CD4-2, MHCIIα and IgM), and all the detected genes were augmented by pcIL-8 and pcG-CSF; Among the four cytokines, pcIL-8 and pcIL-1β could strengthen the highest levels of genes participated in cellular immunity and humoral immunity, respectively. These results demonstrated that pcIL-8 and pcIL-1β could enhance stronger cellular and/or humoral immunity induced by rOmpV than pcG-CSF and pcTNF-α, and evoked higher RPS against E. tarda challenge in flounder, which indicated that pcIL-8 and pcIL-1β are promising adjuvants of vaccines in controlling E. tarda infection. Copyright © 2018 Elsevier Ltd. All rights reserved.

Alterations in TNF- and IL-related gene expression in space-flown WI38 human fibroblasts

Science.gov (United States)

Semov, Alexandre; Semova, Nathalia; Lacelle, Chantale; Marcotte, Richard; Petroulakis, Emmanuel; Proestou, Gregory; Wang, Eugenia

2002-01-01

Spaceflight, just like aging, causes profound changes in musculoskeletal parameters, which result in decreased bone density and muscular weakness. As these conditions decrease our ability to conduct long-term manned space missions, and increase bone frailty in the elderly, the identification of genes responsible for the apparition of these physiological changes will be of great benefit. Thus, we developed and implemented a new microarray approach to investigate the changes in normal WI38 human fibroblast gene expression that arise as a consequence of space flight. Using our microarray, we identified changes in the level of expression of 10 genes, belonging to either the tumor necrosis factor- (TNF) or interleukin- (IL) related gene families in fibroblasts when WI38 cells exposed to microgravity during the STS-93 Space Shuttle mission were compared with ground controls. The genes included two ligands from the TNF superfamily, TWEAK and TNFSF15; two TNF receptor-associated proteins, NSMAF and PTPN13; three TNF-inducible genes, ABC50, PTX3, and SCYA13; TNF-alpha converting enzyme, IL-1 receptor antagonist, and IL-15 receptor alpha chain. Most of these are involved in either the regulation of bone density, and as such the development of spaceflight osteopenia, or in the development of proinflammatory status.

Dual AAV/IL-10 Plus STAT3 Anti-Inflammatory Gene Delivery Lowers Atherosclerosis in LDLR KO Mice, but without Increased Benefit

Directory of Open Access Journals (Sweden)

Maohua Cao

2012-01-01

Full Text Available Both IL-10 and STAT3 are in the same signal transduction pathway, with IL-10-bound IL10 receptor (R acting through STAT3 for anti-inflammatory effect. To investigate possible therapeutic synergism, we delivered both full-length wild-type human (h STAT3 and hIL-10 genes by separate adenoassociated virus type 8 (AAV8 tail vein injection into LDLR KO on HCD. Compared to control Neo gene-treated animals, individual hSTAT3 and hIL-10 delivery resulted in significant reduction in atherogenesis, as determined by larger aortic lumen size, thinner aortic wall thickness, and lower blood velocity (all statistically significant. However, dual hSTAT3/hIL-10 delivery offered no improvement in therapeutic effect. Plasma cholesterol levels in dual hSTAT3/hIL-10-treated animals were statistically higher compared to hIL-10 alone. While no advantage was seen in this case, we consider that the dual gene approach has intrinsic merit, but properly chosen partnered genes must be used.

IL-17A, IL-17RC polymorphisms and IL17 plasma levels in Tunisian patients with rheumatoid arthritis

Science.gov (United States)

Chahbi, Mayssa; Haouami, Youssra; Sfar, Imen; Abdelmoula, Leila; Ben Abdallah, Taieb; Gorgi, Yousr

2018-01-01

Background Interleukin-17 (IL-17), a cytokine mainly secreted by Th17 cells, seems to play a significant role in the pathogenesis of rheumatoid arthritis (RA). Functional genetic polymorphisms in IL-17 and its receptor genes can influence either qualitatively or quantitatively their functions. Therefore, we aimed to study the impact of IL17-A and IL17RC polymorphisms on plasma level of IL-17 and RA susceptibility and severity. Methods In this context, IL-17A*rs2275913 and IL-17RC*rs708567 polymorphisms were investigated together with the quantification of IL17 plasma level in 115 RA patients and 91 healthy control subjects matched in age, sex and ethnic origin. Results There were no statistically significant associations between IL-17A and IL-17RC studied polymorphisms and RA susceptibility. In contrast, IL-17A plasma levels were significantly higher in patients (55.07 pg/ml) comparatively to controls (4.75 pg/ml), p<10E-12. A ROC curve was used to evaluate the performance of plasma IL-17 in detecting RA. Given 100% specificity, the highest sensitivity of plasma IL-17A was 61.7% at a cut-off value of 18.25 pg/ml; p < 10E-21, CI = [0.849–0.939]. Analytic results showed that the IgM-rheumatoid factor and anti-CCP antibodies were significantly less frequent in patients with the IL-17RC*A/A genotype than those carrying *G/G and *G/A genotypes; p = 0.013 and p = 0.015, respectively. Otherwise, IL-17 plasma levels’ analysis showed a significant association with the activity of RA (DAS28≥5.1 = 74.71 pg/ml vs. DAS28<5.1 = 11.96 pg/ml), p<10E-6. Conclusion IL-17A*rs2275913 (G/A) and IL-17RC*rs708567 (G/A) polymorphisms did not seem to influence RA susceptibility in Tunisian population. This result agrees with those reported previously. Plasma IL-17A level seems to be predictive of severe RA occurrence. PMID:29584788

Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

CSIR Research Space (South Africa)

Labuschagne, M

2007-01-01

Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

Interleukin-10 (IL-10) pathway: genetic variants and outcomes of HIV-1 infection in African American adolescents.

Science.gov (United States)

Shrestha, Sadeep; Wiener, Howard W; Aissani, Brahim; Song, Wei; Shendre, Aditi; Wilson, Craig M; Kaslow, Richard A; Tang, Jianming

2010-10-14

Immunological and clinical outcomes can vary considerably at the individual and population levels during both treated and untreated HIV-1 infection. Cytokines encoded by the interleukin-10 gene (IL10) family have broad immunomodulatory function in viral persistence, and several SNPs in the IL10 promoter sequence have been reported to influence pathogenesis or acquisition of HIV-1 infection. We examined 104 informative SNPs in IL10, IL19, IL20, IL24, IL10RA and IL10RB among 250 HIV-1 seropositive and 106 high-risk seronegative African American adolescents in the REACH cohort. In subsequent evaluation of five different immunological and virological outcomes related to HIV-1 infection, 25 SNPs were associated with a single outcome and three were associated with two different outcomes. One SNP, rs2243191 in the IL19 open reading frame (Ser to Phe substitution) was associated with CD4(+) T-cell increase during treatment. Another SNP rs2244305 in IL10RB (in strong linkage disequilibrium with rs443498) was associated with an initial decrease in CD4(+) T-cell by 23 ± 9% and 29 ± 9% every 3 months (for AA and AG genotypes, respectively, compared with GG) during ART-free period. These associations were reversed during treatment, as CD4(+) T-cell increased by 31 ± 0.9% and 17 ± 8% every 3 months for AA and AG genotype, respectively. In African Americans, variants in IL10 and related genes might influence multiple outcomes of HIV-1 infection, especially immunological response to HAART. Fine mapping coupled with analysis of gene expression and function should help reveal the immunological importance of the IL10 gene family to HIV-1/AIDS.

IL-8 and MCP Gene Expression and Production by LPS-Stimulated Human Corneal Stromal Cells

Directory of Open Access Journals (Sweden)

Roni M. Shtein

2012-01-01

Full Text Available Purpose. To determine time course of effect of lipopolysaccharide (LPS on production of interleukin-8 (IL-8 and monocyte chemotactic protein (MCP by cultured human corneal stromal cells. Methods. Human corneal stromal cells were harvested from donor corneal specimens, and fourth to sixth passaged cells were used. Cell cultures were stimulated with LPS for 2, 4, 8, and 24 hours. Northern blot analysis of IL-8 and MCP gene expression and ELISA for IL-8 and MCP secretion were performed. ELISA results were analyzed for statistical significance using two-tailed Student's t-test. Results. Northern blot analysis demonstrated significantly increased IL-8 and MCP gene expression after 4 and 8 hours of exposure to LPS. ELISA for secreted IL-8 and MCP demonstrated statistically significant increases (P<0.05 after corneal stromal cell stimulation with LPS. Conclusions. This paper suggests that human corneal stromal cells may participate in corneal inflammation by secreting potent leukocyte chemotactic and activating proteins in a time-dependent manner when exposed to LPS.

Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

DEFF Research Database (Denmark)

Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

2018-01-01

The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

Science.gov (United States)

Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

2017-01-01

In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

In situ PCR detection and significance of IL-3 gene expression in irradiated hematopoietic cells of mouse bone marrow

International Nuclear Information System (INIS)

Peng Ruiyun; Wang Dewen; Xiong Chengqi; Gao Yabing; Li Yanping; Yang Hong; Cui Yufang

2000-01-01

Objective: To study the significance of endogenous interleukin 3(IL-3) gene expression in repair of irradiated mouse bone marrow. Methods: Seventy-eight LACA mice were subjected to total body irradiation with 60 Co γ-rays and were sacrificed within 4 weeks after irradiation. The bone marrow histopathological sections were stained with HE, and the expression of endogenous IL-3 gene was detected by means of immunocytochemistry,in situ hybridization(ISH) and in situ reverse transcription PCR(IS RT-PCR). Results: Obvious injury of bone marrow occurred after irradiation and then recovered within 4 weeks. IL-3 protein was obviously increased in the cytoplasm of recovering hematopoietic cells(HCs), especially on day 21 after irradiation, while its mRNA was poorly positive by ISH on days 10-21, especially day 15.IS RT-PCR showed that IL-3 mRNA was strongly positive in recovering HCs cytoplasm, especially on days 10 to 15. Conclusion: In situ RT-PCR can objectively reflect the regulation of IL-3 gene expression in bone marrow after irradiation, and the expression of endogenous IL-3 gene may play an important role in hematopoietic reconstruction of irradiated bone marrow

Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

Science.gov (United States)

Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

1991-02-15

The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

Polymorphisms in IL-1 gene cluster and its association with the risk of perinatal HIV transmission, in an Indian cohort.

Science.gov (United States)

Ahir, Swati; Chaudhari, Deepali; Chavan, Vijay; Samant-Mavani, Padmaja; Nanavati, Ruchi; Mehta, Preeti; Mania-Pramanik, Jayanti

2013-06-01

Host genetic diversity plays a very important role in protecting infants exposed to HIV-1 through their mothers. IL-1 family genes are key mediators of inflammatory responses and no studies are available on its association with perinatal HIV transmission. We aimed to evaluate if single nucleotide polymorphisms in IL-1 family genes are associated with perinatal HIV transmission. Infants of HIV positive women were genotyped for five polymorphic loci in IL1 gene cluster namely; IL1R1 (rs2234650), IL1A (rs1800587), IL1B (rs16944), IL1B (rs1143634), and IL1RN (rs315952) using polymerase chain reaction with sequence specific primers (PCR-SSP) method. Haplotype block structure was determined using Haploview and statistical analysis was done using PyPop. In this cohort based observational study significantly increased frequency of CT genotype in IL1R1 (rs2234650) was observed in positive vs. negative children (76.4% vs. 42.2%, p = 0.023), while CC genotype was significantly (p = 0.022) high in exposed uninfected children compared to infected ones (51.1% vs. 17.6%). These significances, however, did not stand the Bonferroni corrections. Haplotypic analysis demonstrated that the TCCCT haplotype was significantly associated (p = 0.002) with HIV transmission and remained significant even after Bonferroni correction. The children who had the protective CC genotype at IL1R1 (rs2234650) and were still positive had the TTC haplotype for IL1A (rs1800587):IL1B (rs1143634):IL1R1 (rs2234650). In contrast, 16 out of 19 (84.2%) children who had the CT genotype and were still negative had the protective CTC haplotype for IL1A (rs1800587):IL1B (rs16944):IL1B (rs1143634). IL1R1 (rs2234650) polymorphisms CT/CC along the specific haplotypes of the IL-1 gene family can be exploited as possible markers for prediction of perinatal HIV transmission. Copyright © 2013 Elsevier B.V. All rights reserved.

T cell subsets related with a sex difference in IL-5 production.

Science.gov (United States)

Okuyama, Kaori; Hamanaka, Yuka; Kawano, Tasuku; Ohkawara, Yuichi; Takayanagi, Motoaki; Kikuchi, Toshiaki; Ohno, Isao

2011-01-01

Before puberty, the prevalence and severity of asthma are higher in boys than in girls, but this pattern is reversed after puberty. The underlying mechanisms of these gender differences in asthma are not fully understood. Using murine models of allergic asthma, a sex difference in Th2 cytokine production has been suggested to contribute to the gender differences in asthma. Therefore, we determined which subsets of T cells are involved in the sex difference in Th2 cytokine production. Splenocytes from wild-type mice and CD4+ T cell-, CD8+ T cell-, and iNKT cell-deficient mice were stimulated with anti-CD3/CD28 antibodies for 3 days, and the concentrations of IL-4, IL-5, IL-13, and IFN-γ in the cultures were measured by ELISA. IL-5, but not IL-4 and IL-13, concentrations in culture derived from female wild-type mice were significantly higher than those in male wild-type mice. The sex difference in IL-5 concentrations was not observed in the cultures of splenocytes from CD4+ and CD8+ T cell-deficient mice. The disappearance of the sex differences in CD4+ and CD8+ T cell-deficient mice was attributable to a decrease in IL-5 concentration in female mice and an increase in IL-5 concentration in male mice. In iNKT cell-deficient mice, the sex difference was still observed. There was no significant difference between the sexes in any type of mice with respect to IFN-γ production. There was a sex difference in IL-5 production by splenocytes stimulated by TCR activation. The difference might be attributable to sex differences in CD4+ and CD8+ T cell functions. Copyright © 2011 S. Karger AG, Basel.

The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1998-01-01

The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

Interleukin-1 (IL-1 system gene expression in granulosa cells: kinetics during terminal preovulatory follicle maturation in the mare

Directory of Open Access Journals (Sweden)

Gérard Nadine

2003-05-01

Full Text Available Abstract Background A growing body of evidences suggests that the ovary is a site of inflammatory reactions, and thus, ovarian cells could represent sources and targets of the interleukin-1 (IL-1 system. The purpose of this study was to examine the IL-1 system gene expressions in equine granulosa cells, and to study the IL-1β content in follicular fluid during the follicle maturation. For this purpose, granulosa cells and follicular fluids were collected from the largest follicle at the early dominance stage (diameter 24 ± 3 mm or during the preovulatory maturation phase, at T0 h, T6 h, T12 h, T24 h and T34 h after induction of ovulation. Cells were analysed by RT-PCR and follicular fluids were studied by gel electrophoresis and immunoblotting. Results We demonstrated that interleukin-1β (IL-1β, interleukin-1 receptor 2 (IL-1R2 and interleukin-1 receptor antagonist (IL-1RA genes are expressed in equine granulosa cells. We observed that the IL-1β and IL-1RA mRNA content changed in granulosa cells during the terminal follicular maturation whereas IL-1R2 mRNA did not vary. In follicular fluid, IL-1β content fluctuated few hours after induction of ovulation. Conclusions The expression of IL-1β gene in granulosa cells and the follicular fluid IL-1β content seem to be regulated by gonadotropins suggesting that IL-1β could be an intermediate paracrine factor involved in ovulation.

Variants in LTA, TNF, IL1B and IL10 genes associated with the clinical course of sepsis.

Science.gov (United States)

Montoya-Ruiz, Carolina; Jaimes, Fabián A; Rugeles, Maria T; López, Juan Álvaro; Bedoya, Gabriel; Velilla, Paula A

2016-12-01

The aim of this study was to explore the association between some SNPs of the TNF, LTA, IL1B and IL10 genes with cytokine concentrations and clinical course in Colombian septic patients. We conducted a cross-sectional study to genotype 415 septic patients and 205 patients without sepsis for the SNPs -308(G/A) rs1800629 of TNF; +252 (G/A) rs909253 of LTA; -511(A/G) rs16944 and +3953(C/T) rs1143634 of IL1B; and -1082(A/G) rs1800896, -819(C/T) rs1800871 and -592(C/A) rs1800872 of IL10. The association of theses SNPs with the following parameters was evaluated: (1) the presence of sepsis; (2) severity and clinical outcomes; (3) APACHE II and SOFA scores; and (4) procalcitonin, C-reactive protein, tumor necrosis factor, lymphotoxin alpha, interleukin 1 beta and interleukin 10 plasma concentrations. We found an association between the SNP LTA +252 with the development of sepsis [OR 1.29 (1.00-1.68)]; the SNP IL10 -1082 with sepsis severity [OR 0.53 (0.29-0.97)]; the TNF -308 with mortality [OR 0.33 (0.12-0.95)]; and the IL10 -592 and IL10 -1082 with admission to the intensive care unit (ICU) [OR 3.36 (1.57-7.18)] and [OR 0.18 (0.04-0.86)], respectively. None of the SNPs were associated with cytokine levels, procalcitonin and C-reactive protein serum concentrations, nor with APACHE II and SOFA scores. Our results suggest that these genetic variants play an important role in the development of sepsis and its clinical course.

Treating insect-bite hypersensitivity in horses with active vaccination against IL-5.

Science.gov (United States)

Fettelschoss-Gabriel, Antonia; Fettelschoss, Victoria; Thoms, Franziska; Giese, Christoph; Daniel, Michelle; Olomski, Florian; Kamarachev, Jivko; Birkmann, Katharina; Bühler, Maya; Kummer, Martin; Zeltins, Andris; Marti, Eliane; Kündig, Thomas M; Bachmann, Martin F

2018-03-28

Insect-bite hypersensitivity is the most common allergic dermatitis in horses. Excoriated skin lesions are typical symptoms of this seasonal and refractory chronic disease. On a cellular level, the skin lesions are characterized by massive eosinophil infiltration caused by an underlying allergic response. To target these cells and treat disease, we developed a therapeutic vaccine against equine IL-5 (eIL-5), the master regulator of eosinophils. The vaccine consisted of eIL-5 covalently linked to a virus-like particle derived from cucumber mosaic virus containing the tetanus toxoid universal T-cell epitope tt830-843 (CMV TT ). Thirty-four Icelandic horses were recruited and immunized with 400 μg of eIL-5-CMV TT formulated in PBS without adjuvant (19 horses) or PBS alone (15 horses). The vaccine was well tolerated and did not reveal any safety concerns but was able to induce anti-eIL-5 autoantibody titers in 17 of 19 horses. This resulted in a statistically significant reduction in clinical lesion scores when compared with previous season levels, as well as levels in placebo-treated horses. Protection required a minimal threshold of anti-eIL-5 antibodies. Clinical improvement by disease scoring showed that 47% and 21% of vaccinated horses reached 50% and 75% improvement, respectively. In the placebo group no horse reached 75% improvement, and only 13% reached 50% improvement. Our therapeutic vaccine inducing autoantibodies against self IL-5 brings biologics to horses, is the first successful immunotherapeutic approach targeting a chronic disease in horses, and might facilitate development of a similar vaccine against IL-5 in human subjects. Copyright © 2018 The Authors. Published by Elsevier Inc. All rights reserved.

Mesenchymal stem cells are efficiently transduced with adenoviruses bearing type 35-derived fibers and the transduced cells with the IL-28A gene produces cytotoxicity to lung carcinoma cells co-cultured.

Science.gov (United States)

Suzuki, Takeo; Kawamura, Kiyoko; Li, Quanhai; Okamoto, Shinya; Tada, Yuji; Tatsumi, Koichiro; Shimada, Hideaki; Hiroshima, Kenzo; Yamaguchi, Naoto; Tagawa, Masatoshi

2014-09-25

Transduction of human mesenchymal stem cells (MSCs) with type 5 adenoviruses (Ad5) is limited in the efficacy because of the poor expression level of the coxsackie adenovirus receptor (CAR) molecules. We examined a possible improvement of Ad-mediated gene transfer in MSCs by substituting the fiber region of type 5 Ad with that of type 35 Ad. Expression levels of CAR and CD46 molecules, which are the major receptors for type 5 and type 35 Ad, respectively, were assayed with flow cytometry. We constructed vectors expressing the green fluorescent protein gene with Ad5 or modified Ad5 bearing the type 35 fiber region (AdF35), and examined the infectivity to MSCs with flow cytometry. We investigated anti-tumor effects of MSCs transduced with interleukin (IL)-28A gene on human lung carcinoma cells with a colorimetric assay. Expression of IL-28A receptors was tested with the polymerase chain reaction. A promoter activity of transcriptional regulatory regions in MSCs was determined with a luciferase assay and a tumor growth-promoting ability of MSCs was tested with co-injection of human tumor cells in nude mice. MSCs expressed CD46 but scarcely CAR molecules, and subsequently were transduced with AdF35 but not with Ad5. Growth of MSCs transduced with the IL-28A gene remained the same as that of untransduced cells since MSCs were negative for the IL-28A receptors. The IL-28A-transduced MSCs however suppressed growth of lung carcinoma cells co-cultured, whereas MSCs transduced with AdF35 expressing the β-galactosidase gene did not. A regulatory region of the cyclooygenase-2 gene possessed transcriptional activities greater than other tumor promoters but less than the cytomegalovirus promoter, and MSCs themselves did not support tumor growth in vivo. AdF35 is a suitable vector to transduce MSCs that are resistant to Ad5-mediated gene transfer. MSCs infected with AdF35 that activate an exogenous gene by the cytomegalovirus promoter can be a vehicle to deliver the gene product

Association analysis of the IL-1 gene cluster polymorphisms with aggressive and chronic periodontitis in the Algerian population.

Science.gov (United States)

Boukortt, Kawther Nourelhouda; Saidi-Ouahrani, Nadjia; Boukerzaza, Boubaker; Ouhaibi-Djellouli, Hadjira; Hachmaoui, Khalida; Benaissa, Fatima Zohra; Taleb, Leila; Drabla-Ouahrani, Hayet; Deba, Tahria; Ouledhamou, Sid Ahmed; Mehtar, Nadhera; Boudjema, Abdellah

2015-10-01

There is strong evidence that genetic as well as environmental factors affect the development of periodontitis. Various studies suggest that genetic polymorphisms of the interleukin-1 (IL-1) genes are associated with an increased risk of developing the pathogenesis. The aim of the present study was to investigate the possible relationship between two polymorphisms of IL-1 gene cluster IL-1B (C+3954T) (rs1143634) and IL-1A (C-889T) (rs1800587) SNPs and the aggressive and chronic periodontitis risk in a case control study in Algerian population. 279 subjects were recruited and received a periodontal examination: 128 healthy controls and 151 cases. From cases, 91 patients were having a chronic disease whereas 60 subjects with aggressive form. All these subjects were genotyped for IL-1A (C-889T) and IL-1B (C+3954T) polymorphisms using TaqMan real time PCR technology. Frequencies of IL-1 alleles, genotypes and the haplotypes were also examined. Significant differences were found in the carriage rate of both minor alleles of the IL-1A (C-889T) and IL-1B (C+3954T) polymorphisms of aggressive periodontitis cases compared with healthy controls (OR [95%CI]=1.61 [1.03-2.49], p=0.03), (OR [95%CI]=1.69 [1.09-2.63], p=0.01), respectively. The result did not reach significance with the chronic form. The studied polymorphisms of the IL-1 genes appear to be associated with susceptibility to aggressive periodontitis (AgP) in the Algerian population. Copyright © 2015 Elsevier Ltd. All rights reserved.

The association between Interleukin (IL)-4 gene intron 3 VNTR polymorphism and alopecia areata (AA) in Turkish population.

Science.gov (United States)

Kalkan, Göknur; Karakus, Nevin; Baş, Yalçın; Takçı, Zennure; Ozuğuz, Pınar; Ateş, Omer; Yigit, Serbulent

2013-09-25

Alopecia areata (AA) is hypothesized to be an organ-specific autoimmune disease of hair follicles mediated by T cells. As immunological and genetic factors have been implicated in the pathogenesis of AA, the purpose of the present study was to investigate possible associations between the functional Interleukin (IL)-4 gene intron 3 VNTR polymorphism and AA susceptibility and disease progression in Turkish population. The study group consisted of 116 unrelated patients with AA and 125 unrelated healthy controls. Genomic DNA was isolated and IL-4 gene 70 bp VNTR polymorphism determined by using polymerase chain reaction (PCR) with specific primers. No association was observed between AA patients and controls according to genotype distribution (p=0.051). The allele distribution of IL-4 gene intron 3 VNTR polymorphism was statistically different between AA patients and control group (p=0.026). The frequency of P1 allele in patients was significantly higher than that in the control group. When the P2P2 genotype was compared with P1P2+P1P1 genotypes, a statistically significant difference was observed between patients and controls (p=0.036). Intron 3 VNTR polymorphism in the IL-4 gene was found to be associated with AA susceptibility in Turkish population. The results suggest that IL-4 VNTR polymorphism in the intron 3 region may be a risk factor for the development of AA among Turkish population. This is the first to report that intron 3 VNTR polymorphism in the IL-4 gene is associated with AA susceptibility. © 2013.

Associations of vascular endothelial growth factor (VEGF gene and cytokine (IL-1B, IL-4, IL-6, IL-10, TNFA genes combinations with type 2 diabetes mellitus in women

Directory of Open Access Journals (Sweden)

Vladimir Iosifovich Konenkov

2012-09-01

Full Text Available Aim. To study the association between vascular endothelial growth factor (VEGF and cytokine (IL1B, IL4, IL6, IL10 and TNFAgene polymorphism combinations with type 2 diabetes mellitus (T2DM in women. Materials and methods. 374 Caucasian women without carbohydrate metabolism disorders from 23 to 68 years of age and 212 womenwith T2DM from 28 to 69 years of age were included in the study. The combinations of polymorphism А-2578С, С+936Т in VEGFgene with polymorphism in IL1B С-31Т, IL4 С-590Т, IL6 G-174C, IL10 A-592C and А-1082G, TNFA А-238G, A-308G and A-863Cwere studied. Results. Analysis revealed 52 combined genetic variations with different rate of occurrence between diabetic and control groups(р

Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

Science.gov (United States)

Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

2017-10-01

Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

MicroRNA-181a-5p Impedes IL-17-Induced Nonsmall Cell Lung Cancer Proliferation and Migration through Targeting VCAM-1

Directory of Open Access Journals (Sweden)

Yang Cao

2017-05-01

Full Text Available Aim: The contribution of the inflammatory mediator interleukin-17 (IL-17 in nonsmall cell lung cancer (NSCLC malignancy has been reported in the literature. MicroRNA-181a-5p (miR-181a-5p acts as a tumor suppressor which can regulate target gene at the posttranscriptional level. Our study aimed to investigate the interaction between IL-17 and miR-181a-5p in NSCLC. Methods: 35 patients with NSCLC and 24 COPD controls were selected and examined in our study. In vitro, H226 and H460 cell lines were exposed to different doses (20, 40, 60, and 80 ng/mL of IL-17 to examine the effect of IL-17 on miR-181a-5p and vascular cell adhesion molecule 1 (VCAM-1 expression. MiR-181 mimic and miR-181a-5p inhibitor were transfected to explore the regulation of VCAM-1 as well as tumor cell proliferation and migration. Results: miR-181a-5p expression was downregulated, and IL-17 and VCAM-1 expression was upregulated in NSCLC tissues. Furthermore, IL-17 decreased miR-181a-5p expression but increased VCAM-1 expression in H226 and H460 cells. MiR-181 regulated VCAM-1 expression through binding to 3’-UTR sequence. MiR-181 attenuated tumor cell proliferation and migration. IL-17 modulated miR-181a-5p expression through activating NF-κB but not Stat3. Conclusion: Taken together, our data show the regulation of VCAM-1 expression by miR-181a-5p under IL-17 exposure, predicting a potential way for counteracting cancer metastasis.

Association of the polymorphisms of the IL-1B, IL-1RN, IL-10 and p53 genes with risk of gastric cancer in a population of high risk of Costa Rica

International Nuclear Information System (INIS)

Alpizar Alpizar, Wagner

2004-01-01

Factors that increase the risk to develop gastric cancer are studied: associated factors to diet, nitrous compounds endogenous formation, genetic predisposition, infection by Helicobacter pylori and polymorphic mixes pickles in the cut out gen of p53 tumour. Also it describes like Helicobacter pylori causes inflammation and its magnitude depends of the reaction mechanisms of the innkeeper in answer to the pathogen. The study aim was to determined the association of polymorphisms of the IL-1B, IL-IRN, IL-10 and p53 genes with the gastric cancer and gastric harms in a population of high risk in Costa Rica. Blood samples of 58 patients diagnosed with gastric cancer were analysed, 99 people with no suspicions of gastric cancer according to the diagnosis by x-Ray (contrast double gastroduodenal series), 41 patients histologically classified as I and II groups in a accordance with the Japanese classification. The analyses was carried out from DNA extracted of leucocytes. Association of the polymorphisms IL-1B-31, IL-1B-511, IL-10-592, IL-10-819 and IL-10-1082 were not found with risk to develop gastric cancer in the studied population. For IL-IB+3954, it was determined that the people with the heterozygote genotype for the T allele present more risk to develop gastric cancer (OR 3.7; IC 95% 1.34-10.2; p=0.007). For the polymorphism of IL-IRN gene it was observed that heterozygote genotype carrier people for the allele 2, present more risk to develop the illness (OR 2.94; IC 1.09-7.93; p=0.03). The allele frequencies that have been related with increase of the pro inflammatory answer are higher in the total population studied here than in other populations. According with the got results it will be necessary to carry out studies with more size of sample, with representative samples of the Costa Rican population and with samples of regions of low and high risk. (author) [es

Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

DEFF Research Database (Denmark)

Martinussen, Jan; Hammer, Karin

1994-01-01

Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

Horse cDNA clones encoding two MHC class I genes

Energy Technology Data Exchange (ETDEWEB)

Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

1994-12-31

Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

Divergent mechanisms underlie Smad4-mediated positive regulation of the three genes encoding the basement membrane component laminin-332 (laminin-5)

International Nuclear Information System (INIS)

Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard

2008-01-01

Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the

Effect of Bacillus thuringiensis parasporal toxin on stimulating of IL-2 and IL-5 cytokines production

Directory of Open Access Journals (Sweden)

Marzieh Soleimany

2018-03-01

Full Text Available Introduction:Bacillus thuringiensis, is a Gram-positive spore-forming bacterium that produces crystalline parasporal protein (Cry during sporulation. Some of these Cry toxins do not show cytotoxicity against insects but they are capable to kill some human and animal cancer cells. The aim of this study was to verify whether cytocidal parasporal of B thuringiensis strains have immunostimulatory activity on human peripheral blood mononuclear cells (PBMNC and to evaluate the ability of IL-2 and IL-5 production. Materials and methods: B. thuringiensis toxin with cytocidal activity was isolated and treated with proteinase K. PBMNC was cultured and treated with activated crystal proteins. We evaluated the ability of different cytokines production with Flow Cytometry. Results: In this study, immune stimulatory toxins Cry1 were distinguished. This toxin can stimulate production of cytokines IL-2 and stop production of IL-5. Discussion and conclusion: According to anti-cancer effect of B. thuringiensis toxins and also immune stimulatory effect, with more research these toxins can be introduced as immunotherapy drug in cancer treatment.

Association of gene variants in TLR4 and IL-6 genes with Perthes disease

Directory of Open Access Journals (Sweden)

Srzentić Sanja

2014-01-01

Full Text Available Introduction. Perthes disease is idiopathic avascular osteonecrosis of the hip in children, with unknown etiology. Inflammation is present during development of Perthes disease and it is known that this process influences bone remodeling. Objective. Since genetic studies related to inflammation have not been performed in Perthes disease so far, the aim of this study was to analyze the association of frequencies of genetic variants of immune response genes, toll-like receptor 4 (TLR4 and interleukin-6 (IL-6, with this disease. Methods. The study cohort consisted of 37 patients with Perthes disease and 50 healthy controls. Polymorphisms of well described inflammatory mediators: TLR4 (Asp299Gly, Thr399Ile and IL-6 (G-174C, G- 597A were determined by polymerase chain reaction restriction fragment length polymorphism method. Results. IL-6 G-174C and G-597A polymorphisms were in complete linkage disequilibrium. A statistically significant increase of heterozygote subjects for IL-6 G-174C/G-597A was found in controls in comparison to Perthes patient group (p=0.047, OR=2.49, 95% CI=1.00-6.21. Also, the patient group for IL-6 G-174C/G- 597A polymorphisms was not in Hardy-Weinberg equilibrium. No statistically significant differences were found between patient and control groups for TLR4 analyzed polymorphisms. A stratified analysis by the age at disease onset also did not reveal any significant difference for all analyzed polymorphisms. Conclusion. Our study revealed that heterozygote subjects for the IL-6 G-174C/G-597A polymorphisms were significantly overrepresented in the control group than in the Perthes patient group. Consequently, we concluded that children who are heterozygous for these polymorphisms have a lower chance of developing Perthes disease than carriers of both homozygote genotypes. [Projekat Ministarstva nauke Republike Srbije, br. III41004

Potentiation of electrochemotherapy by intramuscular IL-12 gene electrotransfer in murine sarcoma and carcinoma with different immunogenicity

International Nuclear Information System (INIS)

Sedlar, Ales; Dolinsek, Tanja; Markelc, Bostjan; Prosen, Lara; Kranjc, Simona; Bosnjak, Masa; Blagus, Tanja; Cemazar, Maja; Sersa, Gregor

2012-01-01

Electrochemotherapy provides good local tumor control but requires adjuvant treatment for increased local response and action on distant metastasis. In relation to this, intramuscular interleukin-12 (IL-12) gene electro-transfer, which provides systemic shedding of IL-12, was combined with local electrochemotherapy with cisplatin. Furthermore, the dependence on tumor immunogenicity and immunocompetence of the host on combined treatment response was evaluated. Sensitivity of SA-1 sarcoma and TS/A carcinoma cells to electrochemotherapy with cisplatin was tested in vitro. In vivo, intratumoral electrochemotherapy with cisplatin (day 1) was combined with a single (day 0) or multiple (days 0, 2, 4) intramuscular murine IL-12 (mIL-12) gene electrotransfer. The antitumor effectiveness of combined treatment was evaluated on immunogenic murine SA-1 sarcoma in A/J mice and moderately immunogenic murine TS/A carcinoma, in immunocompetent BALB/c and immunodeficient SCID mice. Electrochemotherapy in vitro resulted in a similar IC 50 values for both sarcoma and carcinoma cell lines. However, in vivo electrochemotherapy was more effective in the treatment of sarcoma, the more immunogenic of the tumors, resulting in a higher log cell kill, longer specific tumor growth delay, and also 17% tumor cures compared to carcinoma where no tumor cures were observed. Adjuvant intramuscular mIL-12 gene electrotransfer increased the log cell kill in both tumor models, potentiating the specific tumor growth delay by a factor of 1.8-2 and increasing tumor cure rate by approximately 20%. In sarcoma tumors, the potentiation of the response by intramuscular mIL-12 gene electrotransfer was dose-dependent and also resulted in a faster onset of tumor cures. Comparison of the carcinoma response to the combined treatment modality in immunocompetent and immunodeficient mice demonstrated that the immune system is needed both for increased cell kill and for attaining tumor cures. Based on the comparison of

Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

International Nuclear Information System (INIS)

Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

1988-01-01

This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

IL-33 circulating serum levels are increased in patients with non-segmental generalized vitiligo.

Science.gov (United States)

Vaccaro, Mario; Cicero, Francesca; Mannucci, Carmen; Calapai, Gioacchino; Spatari, Giovanna; Barbuzza, Olga; Cannavò, Serafinella P; Gangemi, Sebastiano

2016-09-01

IL-33 is a recently identified cytokine, encoded by the IL-33 gene, which is a member of the IL-1 family that drives the production of T-helper-2 (Th-2)-associated cytokines. Serum levels of IL-33 have been reported to be up-regulated in various T-helper (Th)-1/Th-17-mediated diseases, such as psoriasis, rheumatoid arthritis, and inflammatory bowel. To investigate whether cytokine imbalance plays a role in the pathogenesis of vitiligo, we performed a case-control association study by enzyme-linked immunosorbent assay of IL-33 in our patients. IL-33 serum levels were measured by a quantitative enzyme immunoassay technique in patients with non-segmental generalized vitiligo and compared with those of healthy controls. IL-33 serum levels in patients with vitiligo were significantly increased than those in healthy controls. There was a positive correlation of IL-33 serum levels with extension of vitiligo and disease activity. This study suggests a possible systemic role of IL-33 in the pathogenesis of vitiligo. Inhibiting IL-33 activity might be a novel therapeutic strategy in the treatment of autoimmune inflammatory disease, like vitiligo.

Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

Directory of Open Access Journals (Sweden)

Řičicová Markéta

2010-04-01

Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

Isolation and characterization of cbbL and cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase large and small subunits in Nitrosomonas sp. strain ENI-11.

Science.gov (United States)

Hirota, Ryuichi; Kato, Junichi; Morita, Hiromu; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

2002-03-01

The cbbL and cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) large and small subunits in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11 were cloned and sequenced. The deduced gene products, CbbL and CbbS, had 93 and 87% identity with Thiobacillus intermedius CbbL and Nitrobacter winogradskyi CbbS, respectively. Expression of cbbL and cbbS in Escherichia coli led to the detection of RubisCO activity in the presence of 0.1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG). To our knowledge, this is the first paper to report the genes involved in the carbon fixation reaction in chemolithotrophic ammonia-oxidizing bacteria.

Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

International Nuclear Information System (INIS)

Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

1988-01-01

Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

Relationship between IL-10 gene -819C/T polymorphism and the ...

African Journals Online (AJOL)

Background: The -819C/T polymorphism in interleukin 10 (IL-10) gene has been reported to be associated with inflammatory bowel disease (IBD) ,but the previous results are conflicting. Materials and methods: The present study aimed at investigating the association between this polymorphism and risk of IBD using a ...

The secreted form of the p40 subunit of interleukin (IL)-12 inhibits IL-23 functions and abrogates IL-23-mediated antitumour effects

Science.gov (United States)

Shimozato, Osamu; Ugai, Shin-ichi; Chiyo, Masako; Takenobu, Hisanori; Nagakawa, Hiroyasu; Wada, Akihiko; Kawamura, Kiyoko; Yamamoto, Hiroshi; Tagawa, Masatoshi

2006-01-01

Interleukin (IL)-23 is a heterodimeric cytokine consisting of a novel p19 molecule and the p40 subunit of IL-12. Since secreted p40 can act as an antagonist for IL-12, we investigated whether p40 also inhibited IL-23-mediated immunological functions. p40 did not induce interferon (IFN)-γ or IL-17 production from splenocytes but impaired IL-23-induced cytokine production by competitive binding to the IL-23 receptors. Furthermore, a mixed population of murine colon carcinoma Colon 26 cells transduced with the p40 gene and those transduced with the IL-23 gene developed tumours in syngenic mice, whereas the IL-23-expressing Colon 26 cells were completely rejected. p40 also suppressed IFN-γ production of antigen-stimulated splenocytes and IL-23-mediated cytotoxic T-lymphocyte activities in the mice that rejected Colon 26 cells expressing IL-23. p40 can thereby antagonize IL-23 and is a possible therapeutic agent for suppression of IL-23 functions. PMID:16423037

Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

Science.gov (United States)

Auerbach, Raymond K; Chen, Bin; Butte, Atul J

2013-08-01

Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

DEFF Research Database (Denmark)

Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

1995-01-01

The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

Influence of IL-1 gene polymorphism on the periodontal microbiota of HIV-infected Brazilian individuals

OpenAIRE

Gonçalves, Lucio de Souza; Ferreira, Sônia Maria Soares; Souza, Celso Oliveira; Colombo, Ana Paula Vieira

2009-01-01

This study investigated the association of IL-1A (+4845) and IL-1B (+3954) gene polymorphism with the subgingival microbiota and periodontal status of HIV-infected Brazilian individuals on highly active antiretroviral therapy (HAART). One hundred and five subjects were included in the study, distributed into 2 HIV groups [29 chronic periodontitis (CP+) and 30 periodontally healthy (H+)]; and 2 non-HIV groups (29 CP- and 17 H- patients). IL-1A and B were genotyped by PCR and restriction enzyme...

IL-22R Ligands IL-20, IL-22, and IL-24 Promote Wound Healing in Diabetic db/db Mice.

Science.gov (United States)

Kolumam, Ganesh; Wu, Xiumin; Lee, Wyne P; Hackney, Jason A; Zavala-Solorio, Jose; Gandham, Vineela; Danilenko, Dimitry M; Arora, Puneet; Wang, Xiaoting; Ouyang, Wenjun

2017-01-01

Diabetic foot ulcers (DFU) are one of the major complications in type II diabetes patients and can result in amputation and morbidity. Although multiple approaches are used clinically to help wound closure, many patients still lack adequate treatment. Here we show that IL-20 subfamily cytokines are upregulated during normal wound healing. While there is a redundant role for each individual cytokine in this subfamily in wound healing, mice deficient in IL-22R, the common receptor chain for IL-20, IL-22, and IL-24, display a significant delay in wound healing. Furthermore, IL-20, IL-22 and IL-24 are all able to promote wound healing in type II diabetic db/db mice. Mechanistically, when compared to other growth factors such as VEGF and PDGF that accelerate wound healing in this model, IL-22 uniquely induced genes involved in reepithelialization, tissue remodeling and innate host defense mechanisms from wounded skin. Interestingly, IL-22 treatment showed superior efficacy compared to PDGF or VEGF in an infectious diabetic wound model. Taken together, our data suggest that IL-20 subfamily cytokines, particularly IL-20, IL-22, and IL-24, might provide therapeutic benefit for patients with DFU.

rs1004819 is the main disease-associated IL23R variant in German Crohn's disease patients: combined analysis of IL23R, CARD15, and OCTN1/2 variants.

Directory of Open Access Journals (Sweden)

Jürgen Glas

Full Text Available BACKGROUND: The IL23R gene has been identified as a susceptibility gene for inflammatory bowel disease (IBD in the North American population. The aim of our study was to test this association in a large German IBD cohort and to elucidate potential interactions with other IBD genes as well as phenotypic consequences of IL23R variants. METHODS: Genomic DNA from 2670 Caucasian individuals including 833 patients with Crohn's disease (CD, 456 patients with ulcerative colitis (UC, and 1381 healthy unrelated controls was analyzed for 10 IL23R SNPs. Genotyping included the NOD2 variants p.Arg702Trp, p.Gly908Arg, and p.Leu1007fsX1008 and polymorphisms in SLC22A4/OCTN1 (1672 C-->T and SLC22A5/OCTN2 (-207 G-->C. RESULTS: All IL23R gene variants analyzed displayed highly significant associations with CD. The strongest association was found for the SNP rs1004819 [P = 1.92x10(-11; OR 1.56; 95 % CI (1.37-1.78]. 93.2% of the rs1004819 TT homozygous carriers as compared to 78% of CC wildtype carriers had ileal involvement [P = 0.004; OR 4.24; CI (1.46-12.34]. The coding SNP rs11209026 (p.Arg381Gln was protective for CD [P = 8.04x10(-8; OR 0.43; CI (0.31-0.59]. Similar, but weaker associations were found in UC. There was no evidence for epistasis between the IL23R gene and the CD susceptibility genes CARD15 and SLC22A4/5. CONCLUSION: IL23R is an IBD susceptibility gene, but has no epistatic interaction with CARD15 and SLC22A4/5. rs1004819 is the major IL23R variant associated with CD in the German population, while the p.Arg381Gln IL23R variant is a protective marker for CD and UC.

Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

Directory of Open Access Journals (Sweden)

Abbas Ali Imani Fooladi

2014-02-01

Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

Analysis of TNF-a and IL-10 gene polymorphisms in Zimbabwean ...

African Journals Online (AJOL)

Single nucleotide polymorphisms within the cytokine genes, TNF-α (-308 G/A), and IL-10 (-1082 A /G and -819 T/C) associated with protection and susceptibility to parasitic infections were examined in samples from school aged children in the Eastern district of Zimbabwe. Whole blood specimens were obtained from 491 ...

The emergence of the IL-36 cytokine family as novel targets for inflammatory diseases.

Science.gov (United States)

Walsh, Patrick T; Fallon, Padraic G

2018-04-01

The recently discovered interleukin (IL)-36 family of cytokines form part of the broader IL-1 family and are emerging as important mediators of inflammatory disease. The IL-36 subfamily consists of three ligands-IL-36α, IL-36β, and IL-36γ-and the natural antagonist IL-36Ra. The cytokines exert their effects through a specific IL-36 receptor consisting of IL-36R and IL-1RAcP chains. IL-36 cytokines can direct both innate and adaptive immune responses by acting on parenchymal, stromal, and specific immune cell subsets. In humans, inactivating mutations in the gene encoding the IL-36R antagonist, which lead to unregulated IL-36R signaling, lead to an autoinflammatory condition termed deficiency of the IL-36R antagonist, which primarily manifests as a severe form of pustular psoriasis. While such discoveries have prompted deeper mechanistic studies highlighting the important role of IL-36 cytokines in psoriatic skin inflammation, it is now evident that IL-36 cytokines can also play important roles in inflammatory disorders in other organs, such as the gastrointestinal tract and the lungs. Given these emerging roles, strategies to specifically target the expression and activity of the IL-36 family have the potential to uncover novel therapeutic approaches aimed at treating inflammatory diseases in humans. © 2016 New York Academy of Sciences.

Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

OpenAIRE

Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

2005-01-01

We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

Directory of Open Access Journals (Sweden)

Leontina GURGU

2012-12-01

Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

DEFF Research Database (Denmark)

Kjaerulff, S; Davey, William John; Nielsen, O

1994-01-01

We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

Development of glyphosate-resistant alfalfa (Medicago sativa L.) upon transformation with the GR79Ms gene encoding 5-enolpyruvylshikimate-3-phosphate synthase.

Science.gov (United States)

Yi, Dengxia; Ma, Lin; Lin, Min; Li, Cong

2018-07-01

The glyphosate-resistant gene, GR79Ms, was successfully introduced into the genome of alfalfa. The transgenic events may serve as novel germplasm resources in alfalfa breeding. Weed competition can reduce the alfalfa yield, generating new alfalfa germplasm with herbicide resistance is essential. To obtain transgenic alfalfa lines with glyphosate resistance, a new synthetic glyphosate-resistant gene GR79Ms encoding 5-enolpyruvylshikimate-3-phosphate synthase (EPSPS) was introduced into alfalfa germplasm by Agrobacterium tumefaciens-mediated transformation. In total, 67 transformants were obtained. PCR and Southern blot analyses confirmed that GR79Ms was successfully inserted into the genome of alfalfa. Reverse transcription-PCR and western blot analyses further demonstrated the expression of GR79Ms and its product, GR79Ms EPSPS. Moreover, two homozygous transgenic lines were developed in the T 2 generation by means of molecular-assisted selection. Herbicide tolerance spray tests showed that the transgenic plants T 0 -GR1, T 0 -GR2, T 0 -GR3 and two homozygous lines were able to tolerate fourfold higher commercial usage of glyphosate than non-transgenic plants.

Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes

Directory of Open Access Journals (Sweden)

Nandagopal Murugan

2018-02-01

Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.

Detailed analysis of putative genes encoding small proteins in legume genomes

Directory of Open Access Journals (Sweden)

Gabriel eGuillén

2013-06-01

Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

Cytokine genes polymorphisms of TNF, IFN-y and IL-12 as potential predictors in the onset of cervical disease associated with HR HPV infections

Directory of Open Access Journals (Sweden)

Tasić Dijana

2015-01-01

Full Text Available Cervical cancer highly correlates with infection caused by highly oncogenic types of human papillomavirus (high risk HPV, HR HPV, which is one of the most common sexually transmitted pathogens and is a key factor in the development of cervical disease. However, malignant transformation of cells and tumor development are multifactorial and result from the interaction of a large number of factors such as virus genotype and its oncogenic potential, the state of the infected cells, the immune response of the host, as well as many cofactors such as smoking, oral contraceptives, multiparity, early beginning of sexual life, promiscuity, poor socio-economic conditions, poor diet, etc. Recently, an increasing number of studies have focused on examining the role of genetic basis of the pathogenesis and evolution of HR HPV cervical disease. It is known that genes polymorphisms that encode proteins involved in the functioning of Th1 and Th17 cell response may be associated with better or worse prognosis of cervical disease in women with persistent HR HPV infection. Therefore, the single nucleotide polymorphisms (SNP of the genes encoding TNF, IFN-y and IL-12 can be considered as putative biomarkers that may have predictive value for the development of the HR HPV cervical carcinoma.

Promoter Variation and Expression Levels of Inflammatory Genes IL1A, IL1B, IL6 and TNF in Blood of Spinocerebellar Ataxia Type 3 (SCA3) Patients.

Science.gov (United States)

Raposo, Mafalda; Bettencourt, Conceição; Ramos, Amanda; Kazachkova, Nadiya; Vasconcelos, João; Kay, Teresa; Bruges-Armas, Jácome; Lima, Manuela

2017-03-01

Age at onset in spinocerebellar ataxia type 3 (SCA3/MJD) is incompletely explained by the size of the CAG tract at the ATXN3 gene, implying the existence of genetic modifiers. A role of inflammation in SCA3 has been postulated, involving altered cytokines levels; promoter variants leading to alterations in cytokines expression could influence onset. Using blood from 86 SCA3 patients and 106 controls, this work aimed to analyse promoter variation of four cytokines (IL1A, IL1B, IL6 and TNF) and to investigate the association between variants detected and their transcript levels, evaluated by quantitative PCR. Moreover, the effect of APOE isoforms, known to modulate cytokines, was investigated. Correlations between cytokine variants and onset were tested; the cumulative modifier effects of cytokines and APOE were analysed. Patients carrying the IL6*C allele had a significant earlier onset (4 years in average) than patients carrying the G allele, in agreement with lower mRNA levels produced by IL6*C carriers. The presence of APOE*ɛ2 allele seems to anticipate onset in average 10 years in patients carrying the IL6*C allele; a larger number of patients will be needed to confirm this result. These results highlight the pertinence of conducting further research on the role of cytokines as SCA3 modulators, pointing to the presence of shared mechanisms involving IL6 and APOE.

Characterization of interleukin-8 receptors in non-human primates

Energy Technology Data Exchange (ETDEWEB)

Alvarez, V.; Coto, E.; Gonzalez-Roces, S.; Lopez-Larrea, C. [Hospital Central de Asturias, Oviedo (Spain)] [and others

1996-09-01

Interleukin-8 is a chemokine with a potent neutrophil chemoatractant activity. In humans, two different cDNAs encoding human IL8 receptors designated IL8RA and IL8RB have been cloned. IL8RA binds IL8, while IL8RB binds IL8 as well as other {alpha}-chemokines. Both human IL8Rs are encoded by two genes physically linked on chromosome 2. The IL8RA and IL8RB genes have open reading frames (ORF) lacking introns. By direct sequencing of the polymerase chain reaction products, we sequenced the IL8R genes of cell lines from four non-human primates: chimpanzee, gorilla, orangutan, and macaca. The IL8RB encodes an ORF in the four non-human primates, showing 95%-99% similarity to the human IL8RB sequence. The IL8RA homologue in gorilla and chimpanzee consisted of two ORF 98%-99% identical to the human sequence. The macaca and orangutan IL8RA homologues are pseudogenes: a 2 base pair insertion generated a sequence with several stop codons. In addition, we describe the physical linkage of these genes in the four non-human primates and discuss the evolutionary implications of these findings. 25 refs., 5 figs., 3 tabs.

Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

Science.gov (United States)

Furlan, João Pedro Rueda; Stehling, Eliana Guedes

2018-01-10

β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

Science.gov (United States)

Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

2016-06-01

In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

TNF, IL6, and IL1B Polymorphisms Are Associated with Severe Influenza A (H1N1) Virus Infection in the Mexican Population

Science.gov (United States)

García-Ramírez, Román Alejandro; Ramírez-Venegas, Alejandra; Quintana-Carrillo, Roger; Camarena, Ángel Eduardo; Falfán-Valencia, Ramcés; Mejía-Aranguré, Juan Manuel

2015-01-01

Background Hypercytokinemia is the main immunopathological mechanism contributing to a more severe clinical course in influenza A (H1N1) virus infections. Most patients infected with the influenza A (H1N1) pdm09 virus had increased systemic levels of pro-inflammatory cytokines; including interleukin IL-6, IL-8, and tumor necrosis factor-alpha (TNF-α). We propose that single-nucleotide polymorphisms (SNPs) in the promoter regions of pro-inflammatory genes are associated with the severity of influenza A (H1N1) pdm09 virus infection. Methods 145 patients with influenza A (H1N1) (pA/H1N1), 133 patients with influenza-like illness (ILI), and 360 asymptomatic healthy contacts (AHCs) were included. Eleven SNPs were genotyped in six genes (TNF, LT, IL1B, IL6, CCL1, and IL8) using real-time PCR; the ancestral genotype was used for comparison. Genotypes were correlated with 27 clinical severity variables. Ten cytokines (GM-CSF, TNF-α, IL-2, IL-1β, IL-6, IL-8, IFN-γ, IL-10, IL-5, and IL-4) were measured on a Luminex 100. Results The IL6 rs1818879 (GA) heterozygous genotype was associated with severe influenza A (H1N1) virus infection (odds ratio [OR] = 5.94, 95% confidence interval [CI] 3.05–11.56), and two IL1B SNPs, rs16944 AG and rs3136558 TC, were associated with a decreased risk of infection (OR = 0.52 and OR = 0.51, respectively). Genetic susceptibility was determined (pA/H1N1 vs. AHC): the LTA rs909253 TC heterozygous genotype conferred greater risk (OR = 1.9), and a similar association was observed with the IL1B rs3136558 CC genotype (OR = 1.89). Additionally, severely ill patients were compared with moderately ill patients. The TNF-238 GA genotype was associated with an increased risk of disease severity (OR = 16.06, p = 0.007). Compared with ILIs, patients with severe pA/H1N1 infections exhibited increased serum IL-5 (p <0.001) and IL-6 (p  =  0.007) levels. Conclusions The TNF gene was associated with disease severity, whereas IL1B and IL6 SNPs were

TNF, IL6, and IL1B Polymorphisms Are Associated with Severe Influenza A (H1N1 Virus Infection in the Mexican Population.

Directory of Open Access Journals (Sweden)

Román Alejandro García-Ramírez

Full Text Available Hypercytokinemia is the main immunopathological mechanism contributing to a more severe clinical course in influenza A (H1N1 virus infections. Most patients infected with the influenza A (H1N1 pdm09 virus had increased systemic levels of pro-inflammatory cytokines; including interleukin IL-6, IL-8, and tumor necrosis factor-alpha (TNF-α. We propose that single-nucleotide polymorphisms (SNPs in the promoter regions of pro-inflammatory genes are associated with the severity of influenza A (H1N1 pdm09 virus infection.145 patients with influenza A (H1N1 (pA/H1N1, 133 patients with influenza-like illness (ILI, and 360 asymptomatic healthy contacts (AHCs were included. Eleven SNPs were genotyped in six genes (TNF, LT, IL1B, IL6, CCL1, and IL8 using real-time PCR; the ancestral genotype was used for comparison. Genotypes were correlated with 27 clinical severity variables. Ten cytokines (GM-CSF, TNF-α, IL-2, IL-1β, IL-6, IL-8, IFN-γ, IL-10, IL-5, and IL-4 were measured on a Luminex 100.The IL6 rs1818879 (GA heterozygous genotype was associated with severe influenza A (H1N1 virus infection (odds ratio [OR] = 5.94, 95% confidence interval [CI] 3.05-11.56, and two IL1B SNPs, rs16944 AG and rs3136558 TC, were associated with a decreased risk of infection (OR = 0.52 and OR = 0.51, respectively. Genetic susceptibility was determined (pA/H1N1 vs. AHC: the LTA rs909253 TC heterozygous genotype conferred greater risk (OR = 1.9, and a similar association was observed with the IL1B rs3136558 CC genotype (OR = 1.89. Additionally, severely ill patients were compared with moderately ill patients. The TNF-238 GA genotype was associated with an increased risk of disease severity (OR = 16.06, p = 0.007. Compared with ILIs, patients with severe pA/H1N1 infections exhibited increased serum IL-5 (p <0.001 and IL-6 (p  =  0.007 levels.The TNF gene was associated with disease severity, whereas IL1B and IL6 SNPs were associated with influenza A (H1N1 virus

The impact of IL28B genotype on the gene expression profile of patients with chronic hepatitis C treated with pegylated interferon alpha and ribavirin

Directory of Open Access Journals (Sweden)

Younossi Zobair M

2012-02-01

Full Text Available Abstract Background Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Methods Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56 and was correlated with IL28B genotype (IL28B C/C or non-C/C over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP. Pathways were ranked based on number of gene involved separately per each study cohort. Results The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. Conclusions IL28B CC genotype patients with CH-C show a sustained treatment-induced gene

The impact of IL28B genotype on the gene expression profile of patients with chronic hepatitis C treated with pegylated interferon alpha and ribavirin.

Science.gov (United States)

Younossi, Zobair M; Birerdinc, Aybike; Estep, Mike; Stepanova, Maria; Afendy, Arian; Baranova, Ancha

2012-02-07

Recent studies of CH-C patients have demonstrated a strong association between IL28B CC genotype and sustained virologic response (SVR) after PEG-IFN/RBV treatment. We aimed to assess whether IL28B alleles rs12979860 genotype influences gene expression in response to PEG-IFN/RBV in CH-C patients. Clinical data and gene expression data were available for 56 patients treated with PEG-IFN/RBV. Whole blood was used to determine IL28B genotypes. Differential expression of 153 human genes was assessed for each treatment time point (Days: 0, 1, 7, 28, 56) and was correlated with IL28B genotype (IL28B C/C or non-C/C) over the course of the PEG-IFN/RBV treatment. Genes with statistically significant changes in their expression at each time point were used as an input for pathway analysis using KEGG Pathway Painter (KPP). Pathways were ranked based on number of gene involved separately per each study cohort. The most striking difference between the response patterns of patients with IL28B C/C and T* genotypes during treatment, across all pathways, is a sustained pattern of treatment-induced gene expression in patients carrying IL28B C/C. In the case of IL28B T* genotype, pre-activation of genes, the lack of sustained pattern of gene expression or a combination of both were observed. This observation could potentially provide an explanation for the lower rate of SVR observed in these patients. Additionally, when the lists of IL28B genotype-specific genes which were differentially expressed in patients without SVR were compared at their baseline, IRF2 and SOCS1 genes were down-regulated regardless of patients' IL28B genotype. Furthermore, our data suggest that CH-C patients who do not have the SOCS1 gene silenced have a better chance of achieving SVR. Our observations suggest that the action of SOCS1 is independent of IL28B genotype. IL28B CC genotype patients with CH-C show a sustained treatment-induced gene expression profile which is not seen in non-CC genotype patients

Elucidation of IL-1/TGF-beta interactions in mouse chondrocyte cell line by genome-wide gene expression

DEFF Research Database (Denmark)

Takahashi, N; Rieneck, K; van der Kraan, P M

2005-01-01

To elucidate the antagonism between interleukin-1 (IL-1) and transforming growth factor-beta (TGF-beta) at the gene expression level, as IL-1 and TGF-beta are postulated to be critical mediators of cartilage degeneration/protection in rheumatic diseases....

The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

International Nuclear Information System (INIS)

Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

2007-01-01

The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

Recombinant human growth-regulated oncogene-alpha induces T lymphocyte chemotaxis. A process regulated via IL-8 receptors by IFN-gamma, TNF-alpha, IL-4, IL-10, and IL-13

DEFF Research Database (Denmark)

Jinquan, T; Frydenberg, Jane; Mukaida, N

1995-01-01

receptors on the cells. This process can be augmented by IFN-gamma and TNF-alpha, and inhibited by IL-4, IL-10, and IL-13. In addition, we also document that on T lymphocytes there exist IL-8 receptors that can be up-regulated by IFN-gamma, TNF-alpha, and IL-2. Our results demonstrate that rhGRO-alpha gene...

Increased levels of CCR7(lo)PD-1(hi) CXCR5+ CD4+ T cells, and associated factors Bcl-6, CXCR5, IL-21 and IL-6 contribute to repeated implantation failure.

Science.gov (United States)

Gong, Qiaoqiao; Zhu, Yuejie; Pang, Nannan; Ai, Haiquan; Gong, Xiaoyun; La, Xiaolin; Ding, Jianbing

2017-12-01

In vitro fertilization-embryo transfer (IVF-ET) can be used by infertile couples to assist with reproduction; however, failure of the embryo to implant into the endometrial lining results in failure of the IVF treatment. The present study investigated the expression of chemokine receptor 7 (CCR7)(lo) programmed death-1(PD-1)(hi) chemokine receptor type 5 (CXCR5) + cluster of differentiation 4 (CD4) + T cells and associated factors in patients with repeated implantation failure (RIF). A total of 30 females with RIF and 30 healthy females were enrolled in the current study. Flow cytometry was used to detect the proportion of CCR7(lo)PD-1(hi) CXCR5 + CD4 + T cells in the peripheral blood. Cytokine bead arrays were performed to detect the levels of interleukin (IL)-6, -4 and -2 in the serum. ELISAs were used to detect the level of IL-21 in the serum. Quantitative real time polymerase chain reaction analysis and immunohistochemistry were used to investigate the expression of B-cell lymphoma 6 (Bcl-6), chemokine receptor type 5 (CXCR5) and IL-21 in the endometrium. The results revealed that the percentage of CCR7(lo)PD-1(hi) CXCR5 + CD4 + T cells was increased in the RIF group compared with the control group during the mid luteal phase. The mRNA and protein levels of Bcl-6, IL-21 and CXCR5 in the endometrium and the concentrations of IL-21 and IL-6 in the serum were significantly increased in the RIF group; however, no significant difference was observed between the two groups in regards to the expression of IL-4 and IL-2. Furthermore, a significant positive correlation was identified between the percentage of CCR7(lo)PD-1(hi) CXCR5 + CD4 + T cells and IL-21 and IL-6 levels. The expression of IL-21 also had a positive correlation with Bcl-6 and CXCR5 expression in the RIF group. These results suggest that increased levels of CCR7(lo)PD-1(hi) CXCR5 + CD4 + T cells and associated factors contribute to RIF and could therefore be a potential therapeutic target.

Stimulation with Concanavalin-A Induces IL-17 Production by Canine Peripheral T Cells

Directory of Open Access Journals (Sweden)

Michelle G. Ritt

2015-04-01

Full Text Available The characteristics of canine IL-17-producing cells are incompletely understood. Expression of mRNA encoding orthologs of IL-17 and the IL-17 receptor has been documented in tissues from dogs with arthritis, inflammatory bowel disease, and lymphoma; however, no associations have been found between IL-17 gene expression and disease phenotype in these conditions. Robust assessment of the role of IL-17-producing cells in dogs will require measuring the frequency of these cells in health and disease in balance with other lymphocyte subsets. The aim of this study was to confirm that the T-cell IL-17 response in dogs is evolutionarily conserved. Canine peripheral blood mononuclear cells were stimulated with Concanavalin A with or without polarizing cytokines. We used a canine specific IL-17 ELISA and flow cytometry to identify IL-17-producing T cells. Accumulation of intracellular IL-17 was observed in stimulated CD4 and CD8 T cells. The addition of pro-inflammatory cytokines appeared to enhance polarization of canine CD4 T cells to the Th17 phenotype. Conversely, the addition of IL-2 in the presence of TGF-β resulted in expansion of Treg cells. We conclude that canine IL-17-producing cells behave similarly to those from humans and mice when stimulated with mitogens and polarized with pro-inflammatory or immune regulatory cytokines.

A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

Science.gov (United States)

Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

2015-07-01

The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

Increased midgestational IFN-γ, IL-4 and IL-5 in women bearing a child with autism: A case-control study

Directory of Open Access Journals (Sweden)

Goines Paula E

2011-08-01

Full Text Available Abstract Background Immune anomalies have been documented in individuals with autism spectrum disorders (ASDs and their family members. It is unknown whether the maternal immune profile during pregnancy is associated with the risk of bearing a child with ASD or other neurodevelopmental disorders. Methods Using Luminex technology, levels of 17 cytokines and chemokines were measured in banked serum collected from women at 15 to 19 weeks of gestation who gave birth to a child ultimately diagnosed with (1 ASD (n = 84, (2 a developmental delay (DD but not autism (n = 49 or (3 no known developmental disability (general population (GP; n = 159. ASD and DD risk associated with maternal cytokine and chemokine levels was estimated by using multivariable logistic regression analysis. Results Elevated concentrations of IFN-γ, IL-4 and IL-5 in midgestation maternal serum were significantly associated with a 50% increased risk of ASD, regardless of ASD onset type and the presence of intellectual disability. By contrast, elevated concentrations of IL-2, IL-4 and IL-6 were significantly associated with an increased risk of DD without autism. Conclusion The profile of elevated serum IFN-γ, IL-4 and IL-5 was more common in women who gave birth to a child subsequently diagnosed with ASD. An alternative profile of increased IL-2, IL-4 and IL-6 was more common for women who gave birth to a child subsequently diagnosed with DD without autism. Further investigation is needed to characterize the relationship between these divergent maternal immunological phenotypes and to evaluate their effect on neurodevelopment.

Molecular characterization of ferulate 5-hydroxylase gene from kenaf (Hibiscus cannabinus L.)

Science.gov (United States)

The purpose of this research was to clone and characterize the expression pattern of a kenaf (Hibiscus cannabinus L.) F5H gene that encodes ferulate 5-hydroxylase in the phenylpropanoid pathway. Kenaf is well known as a fast growing dicotyledonous plant, which makes it a valuable biomass plant. The ...

Interactions between Diet, Lifestyle and IL10, IL1B, and PTGS2/COX-2 Gene Polymorphisms in Relation to Risk of Colorectal Cancer in a Prospective Danish Case-Cohort Study

DEFF Research Database (Denmark)

Andersen, Vibeke; Holst, René; Kopp, Tine Iskov

2013-01-01

Genetically determined low COX-2 and high IL-1β activity were associated with increased risk of CRC in this northern Caucasian cohort. Furthermore, interactions were found between IL10, IL1b, and PTGS2 and diet and lifestyle factors in relation to CRC. The present study demonstrates that gene...

Reducing small intestinal permeability attenuates colitis in the IL10 gene-deficient mouse

Science.gov (United States)

Arrieta, M C; Madsen, K; Doyle, J; Meddings, J

2008-01-01

Background: Defects in the small intestinal epithelial barrier have been associated with inflammatory bowel disease but their role in the causation of disease is still a matter of debate. In some models of disease increased permeability appears to be a very early event. The interleukin 10 (IL10) gene-deficient mouse spontaneously develops colitis after 12 weeks of age. These mice have been shown to have increased small intestinal permeability that appears early in life. Furthermore, the development of colitis is dependent upon luminal agents, as animals do not develop disease if raised under germ-free conditions. Aims: To determine if the elevated small bowel permeability can be prevented, and if by doing so colonic disease is prevented or attenuated. Methods: IL10 gene-deficient (IL10−/−) mice) were treated with AT-1001 (a zonulin peptide inhibitor), a small peptide previously demonstrated to reduce small intestinal permeability. Small intestinal permeability was measured, in vivo, weekly from 4 to 17 weeks of age. Colonic disease was assessed at 8 weeks in Ussing chambers, and at 17 weeks of age inflammatory cytokines and myeloperoxidase were measured in the colon. Colonic permeability and histology were also endpoints. Results: Treated animals showed a marked reduction in small intestinal permeability. Average area under the lactulose/mannitol time curve: 5.36 (SE 0.08) in controls vs 3.97 (SE 0.07) in the high-dose AT-1001 group, p<0.05. At 8 weeks of age there was a significant reduction of colonic mucosal permeability and increased electrical resistance. By 17 weeks of age, secretion of tumour necrosis factor α (TNFα) from a colonic explant was significantly lower in the treated group (25.33 (SE 4.30) pg/mg vs 106.93 (SE 17.51) pg/ml in controls, p<0.01). All other markers also demonstrated a clear reduction of colitis in the treated animals. Additional experiments were performed which demonstrated that AT-1001 was functionally active only in the small

Adrenomedullin Regulates IL-1β Gene Expression in F4/80+ Macrophages during Synovial Inflammation

Science.gov (United States)

Takano, Shotaro; Miyagi, Masayuki; Inoue, Gen; Aikawa, Jun; Iwabuchi, Kazuya; Takaso, Masashi

2017-01-01

Adrenomedullin (AM) plays an important role in the regulation of inflammatory processes; however, the role and expression of AM in synovial inflammation have not been determined. To investigate the expression and role of AM in inflamed synovial tissue (ST), the gene expression profiles of AM in the ST, including synovial macrophages and fibroblasts, of a murine patellar surgical dislocation model were characterized. In addition, the effects of interleukin- (IL-) 1β and AM in cultured synovial cells were also examined. CD11c+ macrophages were found to be elevated in ST of the surgically dislocated patella. Higher gene expression of CD11c, IL-1β, AM, receptor activity-modifying proteins 2 (RAMP2), and 3 (RAMP3) was also observed in ST obtained from the dislocated side. AM expression was also significantly increased in synovial fibroblasts and macrophages in response to IL-1β treatment. Synovial macrophages also highly expressed RAMP3 compared to fibroblasts and this expression was further stimulated by exogenously added IL-1β. Further, the treatment of the F4/80-positive cell fraction obtained from ST with AM inhibited IL-1β expression. Taken together, these findings demonstrated that AM was produced by synovial fibroblasts and macrophages in inflamed ST and that increased levels of AM may exert anti-inflammatory effects on synovial macrophages. PMID:28299347

Gene variation in IL-7 receptor (IL-7R)α affects IL-7R response in CD4+ T cells in HIV-infected individuals

DEFF Research Database (Denmark)

Hartling, Hans Jakob; Ryder, Lars P.; Ullum, Henrik

2017-01-01

Optimal CD4+ T cell recovery after initiating combination antiretroviral treatment (cART) in HIV infection reduces risk of morbidity and mortality. T-allele homozygosity (‘TT’) in the single nucleotide polymorphism, rs6897932(C/T), in the IL-7 receptor α (IL-7RA) is associated with faster CD4+ T...... cell recovery after cART initiation compared to C-allele homozygosity in rs6897932 (‘CC’). However, underlying mechanisms are unknown. We aimed to examine potential mechanisms explaining the association between rs6897932 and CD4+ T cell recovery. Ten ‘TT’ and 10 ‘CC’ HIV-infected individuals matched...... on gender, age, and nadir and current CD4+ T cell counts were included in a cross-sectional study. ‘TT’ individuals had higher proportion of CD4+ T cells expressing pSTAT5 compared to ‘CC’ individuals after stimulating with IL-7, especially when co-stimulated with soluble IL7-RA (sIL-7RA). Furthermore, ‘TT...

Inhibition by TNF-alpha and IL-4 of cationic lipid mediated gene transfer in cystic fibrosis tracheal gland cells.

Science.gov (United States)

Bastonero, Sonia; Gargouri, Myriem; Ortiou, Sandrine; Guéant, Jean-Louis; Merten, Marc D

2005-11-01

In vivo, tracheal gland serous cells highly express the cystic fibrosis transmembrane conductance regulator (cftr) gene. This gene is mutated in the lethal monogenic disease cystic fibrosis (CF). Clinical trials in which the human CFTR cDNA was delivered to the respiratory epithelia of CF patients have resulted in weak and transient gene expression. As CF is characterized by mucus inspissation, airway infection, and severe inflammation, we tested the hypothesis that inflammation and especially two cytokines involved in the Th1/Th2 inflammatory response, interleukin 4 (IL-4) and TNFalpha, could inhibit gene transfer efficiency using a model of human CF tracheal gland cells (CF-KM4) and Lipofectamine reagent as a transfection reagent. The specific secretory defects of CF-KM4 cells were corrected by Lipofectamine-mediated human CFTR gene transfer. However, this was altered when cells were pre-treated with IL-4 and TNFalpha. Inhibition of luciferase reporter gene expression by IL-4 and TNFalpha pre-treated CF-KM4 cells was measured by activity and real-time RT-PCR. Both cytokines induced similar and synergistic inhibition of transgene expression and activity. This cytokine-mediated inhibition could be prevented by anti-inflammatory agents such as glucocorticoids but not by non-steroidal (NSAI) agents. This data suggests that an inflammatory context generated by IL-4 and TNFalpha can inhibit human CFTR gene transfer in CF tracheal gland cells and that glucocorticoids may have a protecting action. Copyright (c) 2005 John Wiley & Sons, Ltd.

Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

Science.gov (United States)

Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

2016-01-01

Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

IL-5 promotes induction of antigen-specific CD4+CD25+ T regulatory cells that suppress autoimmunity.

Science.gov (United States)

Tran, Giang T; Hodgkinson, Suzanne J; Carter, Nicole M; Verma, Nirupama D; Plain, Karren M; Boyd, Rochelle; Robinson, Catherine M; Nomura, Masaru; Killingsworth, Murray; Hall, Bruce M

2012-05-10

Immune responses to foreign and self-Ags can be controlled by regulatory T cells (Tregs) expressing CD4 and IL-2Rα chain (CD25). Defects in Tregs lead to autoimmunity, whereas induction of Ag-specific CD4+CD25+ Tregs restores tolerance. Ag-specific CD4+CD25+ FOXP3+Tregs activated by the T helper type 2 (Th2) cytokine, IL-4, and specific alloantigen promote allograft tolerance. These Tregs expressed the specific IL-5Rα and in the presence of IL-5 proliferate to specific but not third-party Ag. These findings suggest that recombinant IL-5 (rIL-5) therapy may promote Ag-specific Tregs to mediate tolerance. This study showed normal CD4+CD25+ Tregs cultured with IL-4 and an autoantigen expressed Il-5rα. Treatment of experimental autoimmune neuritis with rIL-5 markedly reduced clinical paralysis, weight loss, demyelination, and infiltration of CD4+ (Th1 and Th17) CD8+ T cells and macrophages in nerves. Clinical improvement was associated with expansion of CD4+CD25+FOXP3+ Tregs that expressed Il-5rα and proliferated only to specific autoantigen that was enhanced by rIL-5. Depletion of CD25+ Tregs or blocking of IL-4 abolished the benefits of rIL-5. Thus, rIL-5 promoted Ag-specific Tregs, activated by autoantigen and IL-4, to control autoimmunity. These findings may explain how Th2 responses, especially to parasitic infestation, induce immune tolerance. rIL-5 therapy may be able to induce Ag-specific tolerance in autoimmunity.

Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

Science.gov (United States)

Yusuf, Y.; Hidayati, W.

2018-01-01

The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

Comparative analysis of the lambda-interferons IL-28A and IL-29 regarding their transcriptome and their antiviral properties against hepatitis C virus.

Directory of Open Access Journals (Sweden)

Julia Diegelmann

Full Text Available BACKGROUND: Specific differences in signaling and antiviral properties between the different Lambda-interferons, a novel group of interferons composed of IL-28A, IL-28B and IL-29, are currently unknown. This is the first study comparatively investigating the transcriptome and the antiviral properties of the Lambda-interferons IL-28A and IL-29. METHODOLOGY/PRINCIPAL FINDINGS: Expression studies were performed by microarray analysis, quantitative PCR (qPCR, reporter gene assays and immunoluminometric assays. Signaling was analyzed by Western blot. HCV replication was measured in Huh-7 cells expressing subgenomic HCV replicon. All hepatic cell lines investigated as well as primary hepatocytes expressed both IFN-λ receptor subunits IL-10R2 and IFN-λR1. Both, IL-28A and IL-29 activated STAT1 signaling. As revealed by microarray analysis, similar genes were induced by both cytokines in Huh-7 cells (IL-28A: 117 genes; IL-29: 111 genes, many of them playing a role in antiviral immunity. However, only IL-28A was able to significantly down-regulate gene expression (n = 272 down-regulated genes. Both cytokines significantly decreased HCV replication in Huh-7 cells. In comparison to liver biopsies of patients with non-viral liver disease, liver biopsies of patients with HCV showed significantly increased mRNA expression of IL-28A and IL-29. Moreover, IL-28A serum protein levels were elevated in HCV patients. In a murine model of viral hepatitis, IL-28 expression was significantly increased. CONCLUSIONS/SIGNIFICANCE: IL-28A and IL-29 are up-regulated in HCV patients and are similarly effective in inducing antiviral genes and inhibiting HCV replication. In contrast to IL-29, IL-28A is a potent gene repressor. Both IFN-λs may have therapeutic potential in the treatment of chronic HCV.

Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

Directory of Open Access Journals (Sweden)

Yannick Pauchet

Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

Genetic variation in IL-16 miRNA target site and time to prostate cancer diagnosis in African American men

Science.gov (United States)

Hughes, Lucinda; Ruth, Karen; Rebbeck, Timothy R.; Giri, Veda N.

2013-01-01

Background Men with a family history of prostate cancer and African American men are at high risk for prostate cancer and in need of personalized risk estimates to inform screening decisions. This study evaluated genetic variants in genes encoding microRNA (miRNA) binding sites for informing of time to prostate cancer diagnosis among ethnically-diverse, high-risk men undergoing prostate cancer screening. Methods The Prostate Cancer Risk Assessment Program (PRAP) is a longitudinal screening program for high-risk men. Eligibility includes men ages 35-69 with a family history of prostate cancer or African descent. Participants with ≥ 1 follow-up visit were included in the analyses (n=477). Genetic variants in regions encoding miRNA binding sites in four target genes (ALOX15, IL-16, IL-18, and RAF1) previously implicated in prostate cancer development were evaluated. Genotyping methods included Taqman® SNP Genotyping Assay (Applied Biosystems) or pyrosequencing. Cox models were used to assess time to prostate cancer diagnosis by risk genotype. Results Among 256 African Americans with ≥ one follow-up visit, the TT genotype at rs1131445 in IL-16 was significantly associated with earlier time to prostate cancer diagnosis vs. the CC/CT genotypes (p=0.013), with a suggestive association after correction for false-discovery (p=0.065). Hazard ratio after controlling for age and PSA for TT vs. CC/CT among African Americans was 3.0 (95% CI 1.26-7.12). No association to time to diagnosis was detected among Caucasians by IL-16 genotype. No association to time to prostate cancer diagnosis was found for the other miRNA target genotypes. Conclusions Genetic variation in IL-16 encoding miRNA target site may be informative of time to prostate cancer diagnosis among African American men enrolled in prostate cancer risk assessment, which may inform individualized prostate cancer screening strategies in the future. PMID:24061634

Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

Science.gov (United States)

Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

1994-09-01

The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

Influence of correlation between HLA-G polymorphism and Interleukin-6 (IL6) gene expression on the risk of schizophrenia.

Science.gov (United States)

Shivakumar, Venkataram; Debnath, Monojit; Venugopal, Deepthi; Rajasekaran, Ashwini; Kalmady, Sunil V; Subbanna, Manjula; Narayanaswamy, Janardhanan C; Amaresha, Anekal C; Venkatasubramanian, Ganesan

2018-07-01

Converging evidence suggests important implications of immuno-inflammatory pathway in the risk and progression of schizophrenia. Prenatal infection resulting in maternal immune activation and developmental neuroinflammation reportedly increases the risk of schizophrenia in the offspring by generating pro-inflammatory cytokines including IL-6. However, it is not known how prenatal infection can induce immuno-inflammatory responses despite the presence of immuno-inhibitory Human Leukocyte Antigen-G (HLA-G) molecules. To address this, the present study was aimed at examining the correlation between 14 bp Insertion/Deletion (INDEL) polymorphism of HLA-G and IL-6 gene expression in schizophrenia patients. The 14 bp INDEL polymorphism was studied by PCR amplification/direct sequencing and IL-6 gene expression was quantified by using real-time RT-PCR in 56 schizophrenia patients and 99 healthy controls. We observed significantly low IL6 gene expression in the peripheral mononuclear cells (PBMCs) of schizophrenia patients (t = 3.8, p = .004) compared to the controls. In addition, schizophrenia patients carrying Del/Del genotype of HLA-G 14 bp INDEL exhibited significantly lower IL6 gene expression (t = 3.1; p = .004) than the Del/Ins as well as Ins/Ins carriers. Our findings suggest that presence of "high-expressor" HLA-G 14 bp Del/Del genotype in schizophrenia patients could attenuate IL-6 mediated inflammation in schizophrenia. Based on these findings it can be assumed that HLA-G and cytokine interactions might play an important role in the immunological underpinnings of schizophrenia. Copyright © 2017 Elsevier Ltd. All rights reserved.

Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

Science.gov (United States)

van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

1992-01-01

Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

Features of progression of chronic hepatitis C in children with different variants of polymorphism of the gene IL-28B

Directory of Open Access Journals (Sweden)

Berezenko V.S.

2016-03-01

Full Text Available Purpose. To study the features of the progression of chronic hepatitis C in children with different variants of polymorphism of the gene IL-28B. Materials and methods. The study involved 57 children aged 3–18 years with CHC. All patients were involved in clinical, laboratory and instrumental examination. The stage of fibrosis was assessed morphologicallyon a scale METAVIR, by the calculation method — Fibro Test, on APRI index, and by the concentration of hyaluronic acid (HA, transforming growth factor TGF- β1 in serum usingIFA. The SNP genotypes of rs8099917 and rs12979860 lociin IL-28B were determinedby the method of the polymer chain reaction (PCR. A statistical analysis of the data was conducted. Resume. Most of the patients were children with chronic hepatitis C who had genotype CT at rs12979860 locus of the gene IL-28B (54% and the TT geno-type at rs8099917 locus (60%. It was found that fibrogenesis in the liver of patients with chronic hepatitis C depends on the polymorphism of the gene IL-28B. Unfavorable genotypevariants for the development of liver fibrosis are: TT (rs12979860, CT (rs12979860 and TG/GG (rs8099917. Variants CC (rs12979860 and TT (rs8099917 have a beneficial effect on the course of chronic hepatitis C, including patients with a lower stage of fibrosis. To determine the risk of progression of chronic hepatitis C it may be sufficient to determine the polymorphism of rs12979860locusin the gene IL-28B. Conclusions.The polymorphism variants CC (rs12979860 and TT (rs8099917of the gene IL-28Bare more favorable (lower severity of fibrosis in the progression of chronic hepatitis C in children. Variant TT (rs12979860 in the polymorphism of the gene IL-28B is associated with the progression of hepatitis — faster development of liver fibrosis.

The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

Energy Technology Data Exchange (ETDEWEB)

Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

1990-01-01

Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

Genetic polymorphisms of the IL6 and NOD2 genes are risk factors for inflammatory reactions in leprosy.

Science.gov (United States)

Sales-Marques, Carolinne; Cardoso, Cynthia Chester; Alvarado-Arnez, Lucia Elena; Illaramendi, Ximena; Sales, Anna Maria; Hacker, Mariana de Andréa; Barbosa, Mayara Garcia de Mattos; Nery, José Augusto da Costa; Pinheiro, Roberta Olmo; Sarno, Euzenir Nunes; Pacheco, Antonio Guilherme; Moraes, Milton Ozório

2017-07-01

The pathways that trigger exacerbated immune reactions in leprosy could be determined by genetic variations. Here, in a prospective approach, both genetic and non-genetic variables influencing the amount of time before the development of reactional episodes were studied using Kaplan-Meier survival curves, and the genetic effect was estimated by the Cox proportional-hazards regression model. In a sample including 447 leprosy patients, we confirmed that gender (male), and high bacillary clinical forms are risk factors for leprosy reactions. From the 15 single nucleotide polymorphisms (SNPs) at the 8 candidate genes genotyped (TNF/LTA, IFNG, IL10, TLR1, NOD2, SOD2, and IL6) we observed statistically different survival curves for rs751271 at the NOD2 and rs2069845 at the IL6 genes (log-rank p-values = 0.002 and 0.023, respectively), suggesting an influence on the amount of time before developing leprosy reactions. Cox models showed associations between the SNPs rs751271 at NOD2 and rs2069845 at IL6 with leprosy reactions (HRGT = 0.45, p = 0.002; HRAG = 1.88, p = 0.0008, respectively). Finally, IL-6 and IFN-γ levels were confirmed as high, while IL-10 titers were low in the sera of reactional patients. Rs751271-GT genotype-bearing individuals correlated (p = 0.05) with lower levels of IL-6 in sera samples, corroborating the genetic results. Although the experimental size may be considered a limitation of the study, the findings confirm the association of classical variables such as sex and clinical forms with leprosy, demonstrating the consistency of the results. From the results, we conclude that SNPs at the NOD2 and IL6 genes are associated with leprosy reactions as an outcome. NOD2 also has a clear functional pro-inflammatory link that is coherent with the exacerbated responses observed in these patients.

Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

Science.gov (United States)

Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

2013-12-01

The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

Cloning, sequence determination, and expression of the genes encoding the subunits of the nickel-containing 8-hydroxy-5-deazaflavin reducing hydrogenase from Methanobacterium thermoautotrophicum ΔH

International Nuclear Information System (INIS)

Alex, L.A.; Reeve, J.N.; Orme-Johnson, W.H.; Walsh, C.T.

1990-01-01

The genes frhA (1,217 bp), frhB (845 bp), and frhG (710 bp) encoding the three known subunits, α, β, and γ, of the 8-hydroxy-5-deazaflavin (F 420 ) reducing hydrogenase (FRH) from the thermophilic methanogen Methanobacterium thermoautotrophicum ΔH have been cloned, sequenced, and shown to be tightly linked, indicative of a single transcriptional unit. The DNA sequence contains a fourth open reading frame, designated frhD (476 bp), encoding a polypeptide (δ) that does not copurify with the active enzyme. Expression of the frh gene cluster in Escherichia coli shows that four polypeptides are synthesized. When analyzed by SDS-PAGE, the proteins migrate with mobilities consistent with their calculated molecular weights. In order to understand the mechanism of H 2 oxidation by this enzyme, localization of redox cofactors (Ni, Fe/S, FAD) to specific subunits and information on their structure is needed. This has been hindered due to the refractory nature of the enzyme to denaturation methods needed in order to obtain individual subunits with cofactors intact. In this paper they discuss the possible localization of the redox cofactors as implicated from the DNA-derived protein sequences of the subunits. The amino acid sequences of the subunits of the FRH are compared with those of other Ni-containing hydrogenases, including the methyl viologen reducing hydrogenase (MVH) of M. thermoautotrophicum ΔH

Abscisic acid affects transcription of chloroplast genes via protein phosphatase 2C-dependent activation of nuclear genes: repression by guanosine-3'-5'-bisdiphosphate and activation by sigma factor 5.

Science.gov (United States)

Yamburenko, Maria V; Zubo, Yan O; Börner, Thomas

2015-06-01

Abscisic acid (ABA) represses the transcriptional activity of chloroplast genes (determined by run-on assays), with the exception of psbD and a few other genes in wild-type Arabidopsis seedlings and mature rosette leaves. Abscisic acid does not influence chloroplast transcription in the mutant lines abi1-1 and abi2-1 with constitutive protein phosphatase 2C (PP2C) activity, suggesting that ABA affects chloroplast gene activity by binding to the pyrabactin resistance (PYR)/PYR1-like or regulatory component of ABA receptor protein family (PYR/PYL/RCAR) and signaling via PP2Cs and sucrose non-fermenting protein-related kinases 2 (SnRK2s). Further we show by quantitative PCR that ABA enhances the transcript levels of RSH2, RSH3, PTF1 and SIG5. RelA/SpoT homolog 2 (RSH2) and RSH3 are known to synthesize guanosine-3'-5'-bisdiphosphate (ppGpp), an inhibitor of the plastid-gene-encoded chloroplast RNA polymerase. We propose, therefore, that ABA leads to an inhibition of chloroplast gene expression via stimulation of ppGpp synthesis. On the other hand, sigma factor 5 (SIG5) and plastid transcription factor 1 (PTF1) are known to be necessary for the transcription of psbD from a specific light- and stress-induced promoter (the blue light responsive promoter, BLRP). We demonstrate that ABA activates the psbD gene by stimulation of transcription initiation at BLRP. Taken together, our data suggest that ABA affects the transcription of chloroplast genes by a PP2C-dependent activation of nuclear genes encoding proteins involved in chloroplast transcription. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

Directory of Open Access Journals (Sweden)

Mignon A Keaton

2011-03-01

Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

Analysis of MxA, IL-4, and IRF-1 genes in Filipino patients with subacute sclerosing panencephalitis.

Science.gov (United States)

Pipo-Deveza, J R; Kusuhara, K; Silao, C L T; Lukban, M B; Salonga, A M; Sanchez, B C; Kira, R; Takemoto, M; Torisu, H; Hara, T

2006-08-01

Subacute sclerosing panencephalitis (SSPE) is a chronic and debilitating disease of the central nervous system caused by a latent measles virus infection. Three candidate genes, MxA, IL-4, and IRF-1 genes were shown to be associated with SSPE in Japanese patients. These genes have been suggested to play a role in the establishment of persistent viral infection in the central nervous system. Sixty Filipino SSPE patients and 120 healthy control subjects were included in the study. Single nucleotide polymorphisms at promoter regions ( IL-4-590C/T and MXA-88G/T) were screened using PCR-RFLP method. Genotyping was done for GT repeat polymorphism within intron 7 of IRF-1. The TT genotype of MXA, as well as the CT genotype of IL-4, were seen a little more frequently among the SSPE patients as compared to the control subjects. The values though, did not reach statistical significance. IRF-1 analysis did not differ between the two groups. Our study failed to demonstrate a significant association between IL-4, MXA, or IRF-1, and SSPE in the Filipino population. Our results might be explained by a greater contribution of environmental factors such as the socio-economic and nutritional factors in the susceptibility of Filipinos to SSPE other than genetic factors.

Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

NARCIS (Netherlands)

Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

2008-01-01

Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

Risk of cervical cancer associated with allergies and polymorphisms in genes in the chromosome 5 cytokine cluster.

Science.gov (United States)

Johnson, Lisa G; Schwartz, Stephen M; Malkki, Mari; Du, Qin; Petersdorf, Effie W; Galloway, Denise A; Madeleine, Margaret M

2011-01-01

Human papillomavirus is the acknowledged cause of cervical cancer. We hypothesized that allergies, characterized by hyperimmune reaction to common allergens and which have been associated with various cancers, may be related to cervical cancer, and that genetic variation in cytokine genes related to allergies might impact cervical cancer risk. We investigated the risk of invasive squamous cell cervical cancer (SCC) associated with self-reported allergies and with variation in allergy-related cytokine genes using data from a case-control study (561 cases, 1,258 controls) conducted in Washington State. Logistic regression models yielded odds ratios (OR) and 95% CI. Pollen allergy, the most commonly reported allergy, was associated with reduced SCC risk (OR: 0.6; 95% CI: 0.5-0.8). Of 60 tagging single-nucleotide polymorphisms covering eight genes (CSF2, IL3, IL4, IL13, CSF2RB, IL4R, IL13RA1, IL13RA2), several were related to pollen allergies among controls: IL4R rs3024647 (dominant OR: 1.5; 95% CI: 1.0-2.3; P = 0.04), CSF2RB rs16997517 (dominant OR: 2.2; 95% CI: 1.0-4.7; P = 0.04), and IL13 rs1800925 (per-allele OR: 1.7; 95% CI: 1.3-2.4; P = 0.0007). Two variants were inversely associated with SCC risk: IL4R rs3024656 (per-allele OR: 0.8; 95% CI: 0.6-1.0; P = 0.03) and CSF2RB rs16997517 (dominant OR: 0.4; 95% CI: 0.2-0.9; P = 0.04). Pollen allergies were related to reduced SCC risk. CSF2RB rs16997517 was directly related to pollen allergies in controls and to reduced SCC risk. If other studies confirm these results, the mechanism behind allergy-associated immune response associated with SCC risk may be worth exploring in the context of therapeutic or prophylactic vaccines. ©2011 AACR.

Evaluation of 6 candidate genes on chromosome 11q23 for coeliac disease susceptibility: a case control study

Directory of Open Access Journals (Sweden)

Close Eimear

2010-05-01

Full Text Available Abstract Background Recent whole genome analysis and follow-up studies have identified many new risk variants for coeliac disease (CD, gluten intolerance. The majority of newly associated regions encode candidate genes with a clear functional role in T-cell regulation. Furthermore, the newly discovered risk loci, together with the well established HLA locus, account for less than 50% of the heritability of CD, suggesting that numerous additional loci remain undiscovered. Linkage studies have identified some well-replicated risk regions, most notably chromosome 5q31 and 11q23. Methods We have evaluated six candidate genes in one of these regions (11q23, namely CD3E, CD3D, CD3G, IL10RA, THY1 and IL18, as risk factors for CD using a 2-phase candidate gene approach directed at chromosome 11q. 377 CD cases and 349 ethnically matched controls were used in the initial screening, followed by an extended sample of 171 additional coeliac cases and 536 additional controls. Results Promotor SNPs (-607, -137 in the IL18 gene, which has shown association with several autoimmune diseases, initially suggested association with CD (P IL18-137/-607 also supported this effect, primarily due to one relatively rare haplotype IL18-607C/-137C (P Conclusion Haplotypes of the IL18 promotor region may contribute to CD risk, consistent with this cytokine's role in maintaining inflammation in active CD.

Expression of genes associated with immunity in the endometrium of cattle with disparate postpartum uterine disease and fertility

Directory of Open Access Journals (Sweden)

Herath Shan

2009-05-01

Full Text Available Abstract Background Contamination of the uterine lumen with bacteria is ubiquitous in cattle after parturition. Some animals develop endometritis and have reduced fertility but others have no uterine disease and readily conceive. The present study tested the hypothesis that postpartum cattle that develop persistent endometritis and infertility are unable to limit the inflammatory response to uterine bacterial infection. Methods Endometrial biopsies were collected several times during the postpartum period from animals that were subsequently infertile with persistent endometritis (n = 4 or had no clinical disease and conceived to first insemination (n = 4. Quantitative PCR was used to determine the expression of candidate genes in the endometrial biopsies, including the Toll-like receptor (TLR 1 to 10 family of innate immune receptors, inflammatory mediators and their cognate receptors. Selected proteins were examined by immunohistochemistry. Results The expression of genes encoding pro-inflammatory mediators such as interleukins (IL1A, IL1B and IL6, and nitric oxide synthase 2 (NOS2 were higher during the first week post partum than subsequently. During the first week post partum, there was higher gene expression in infertile than fertile animals of TLR4, the receptor for bacterial lipopolysaccharide, and the pro-inflammatory cytokines IL1A and IL1B, and their receptor IL1R2. The expression of genes encoding other Toll-like receptors, transforming growth factor beta receptor 1 (TGFBR1 or prostaglandin E2 receptors (PTGER2 and PTGER4 did not differ significantly between the animal groups. Gene expression did not differ significantly between infertile and fertile animals after the first week postpartum. However, there were higher ratios of IL1A or IL1B mRNA to the anti-inflammatory cytokine IL10, during the first week post partum in the infertile than fertile animals, and the protein products of these genes were mainly localised to the epithelium

Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

Science.gov (United States)

Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

1992-01-01

A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

IL12RB2 gene is associated with the age of type 1 diabetes onset in Croatian family Trios.

Directory of Open Access Journals (Sweden)

Marina Pehlić

Full Text Available BACKGROUND: Common complex diseases are influenced by both genetic and environmental factors. Many genetic factors overlap between various autoimmune diseases. The aim of the present study is to determine whether four genetic variants known to be risk variants for several autoimmune diseases could be associated with an increased susceptibility to type 1 diabetes mellitus. METHODS AND FINDINGS: We genotyped four genetic variants (rs2358817, rs1049550, rs6679356, rs9865818 within VTCN1, ANXA11, IL12RB2 and LPP genes respectively, in 265 T1DM family trios in Croatian population. We did not detect association of these polymorphisms with T1DM. However, quantitative transmission disequilibrium test (QTDT, orthogonal model revealed a significant association between the age of onset of T1DM and IL12RB2 rs6679356 variant. An earlier onset of T1DM was associated with the rs6679356 minor dominant allele C (p = 0.005. The association remained significant even after the Bonferroni correction for multiple testing and permutation. CONCLUSIONS: Variants originally associated with juvenile idiopathic arthritis (VTCN1 gene, sarcoidosis (ANXA11 gene, primary biliary cirrhosis (IL12RB2 gene and celiac disease (LPP gene were not associated with type 1 diabetes in our dataset. Nevertheless, association of IL12RB2 rs6679356 polymorphism with the age of T1DM onset suggests that this gene plays a role in defining the time of disease onset.

Complement component C5a Promotes Expression of IL-22 and IL-17 from Human T cells and its Implication in Age-related Macular Degeneration

Directory of Open Access Journals (Sweden)

Klein Michael L

2011-07-01

Full Text Available Abstract Background Age related macular degeneration (AMD is the leading cause of irreversible blindness in elderly populations worldwide. Inflammation, among many factors, has been suggested to play an important role in AMD pathogenesis. Recent studies have demonstrated a strong genetic association between AMD and complement factor H (CFH, the down-regulatory factor of complement activation. Elevated levels of complement activating molecules including complement component 5a (C5a have been found in the serum of AMD patients. Our aim is to study whether C5a can impact human T cells and its implication in AMD. Methods Human peripheral blood mononuclear cells (PBMCs were isolated from the blood of exudative form of AMD patients using a Ficoll gradient centrifugation protocol. Intracellular staining and enzyme-linked immunosorbent assays were used to measure protein expression. Apoptotic cells were detected by staining of cells with the annexin-V and TUNEL technology and analyzed by a FACS Caliber flow cytometer. SNP genotyping was analyzed by TaqMan genotyping assay using the Real-time PCR system 7500. Results We show that C5a promotes interleukin (IL-22 and IL-17 expression by human CD4+ T cells. This effect is dependent on B7, IL-1β and IL-6 expression from monocytes. We have also found that C5a could protect human CD4+ cells from undergoing apoptosis. Importantly, consistent with a role of C5a in promoting IL-22 and IL-17 expression, significant elevation in IL-22 and IL-17 levels was found in AMD patients as compared to non-AMD controls. Conclusions Our results support the notion that C5a may be one of the factors contributing to the elevated serum IL-22 and IL-17 levels in AMD patients. The possible involvement of IL-22 and IL-17 in the inflammation that contributes to AMD may herald a new approach to treat AMD.

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

Directory of Open Access Journals (Sweden)

Wang Yu

2011-04-01

Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15

Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1.

Science.gov (United States)

Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang

2011-04-06

In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and

[Association between polymorphism in DVWA and IL-1beta and Kashin-Beck disease].

Science.gov (United States)

Y U, Min; Guo, Xiong; Gao, Xiao-Yun; Lai, Jiang-Hua; Tu, Qian-Qian

2010-07-01

To investigate the association between IL-1beta and DVWA gene and Kashin-Beck disease (KBD). Peripheral genomic DNA were extracted from 105 patients with KBD and 98 healthy controls. PCR-RFLP were performed to detect SNP loci of IL-1beta gene and DVWA gene. The patients with KBD had significantly higher frequency of rs16944 (IL-1beta) locus (chi2 = 24.28, P rs16944 (chi2 = 5.683, P = 0.0171) than the healthy controls. There were no significant differences in genotype frequencies,single allele frequencies and haplotypes in rs4685241 and rs1143627 between the patients with KBD and the healthy controls. rs16944 (IL-1beta) is associated with KBD.

Infectivity enhanced adenoviral-mediated mda-7/IL-24 gene therapy for ovarian carcinoma

NARCIS (Netherlands)

Leath, CA; Kataram, M; Bhagavatula, P; Gopalkrishnan, RV; Dent, P; Fisher, PB; Pereboev, A; Carey, D; Lebedeva, [No Value; Haisma, HJ; Alvarez, RD; Curiel, DT; Mahasreshti, PJ

Objective. Melanoma differentiation associated gene-7 [mda-7/interleukin (IL)-24] has been identified as a novel anti-cancer agent, which specifically induces apoptosis in cancer cells but not in normal epithelial, endothelial and fibroblast cells. The objective of this study was to evaluate the

Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.