WorldWideScience

Sample records for genes encoding human

  1. Organization of the gene encoding human lysosomal beta-galactosidase.

    Science.gov (United States)

    Morreau, H; Bonten, E; Zhou, X Y; D'Azzo, A

    1991-09-01

    Human beta-galactosidase precursor mRNA is alternatively spliced into an abundant 2.5-kb transcript and a minor 2.0-kb species. These templates direct the synthesis of the classic lysosomal beta-D-galactosidase enzyme and of a beta-galactosidase-related protein with no enzymatic activity. Mutations in the beta-galactosidase gene result in the lysosomal storage disorders GM1-gangliosidosis and Morquio B syndrome. To analyze the genetic lesions underlying these syndromes we have isolated the human beta-galactosidase gene and determined its organization. The gene spans greater than 62.5 kb and contains 16 exons. Promoter activity is located on a 236-bp Pst I fragment which works in a direction-independent manner. A second Pst I fragment of 851 bp located upstream from the first negatively regulates initiation of transcription. The promoter has characteristics of a housekeeping gene with GC-rich stretches and five potential SP1 transcription elements on two strands. We identified multiple cap sites of the mRNA, the major of which maps 53 bp upstream from the translation initiation codon. The portion of the human pre-mRNA undergoing alternative splicing is encoded by exons II-VII. Sequence analysis of equivalent mouse exons showed an identical genomic organization. However, translation of the corresponding differentially spliced murine transcript is interrupted in its reading frame. Thus, the mouse gene cannot encode a beta-galactosidase-related protein in a manner similar to the human counterpart. Differential expression of the murine beta-galactosidase transcript is observed in different mouse tissues.

  2. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    digested with SmaI and SspI and self-ligated to generate. pSAC86 which eliminated the SacI site present in the. Multiple Cloning Site (MCS). Plasmid pBH86 contains a modified version of the erg-3 gene in which the intronic. HindIII site was destroyed (Prakash et al 1999). pMOD86 contains the erg-3 gene of Neurospora in ...

  3. A study into genes encoding longevity in humans

    NARCIS (Netherlands)

    Kuningas, Maris

    2007-01-01

    The lifespan of an organism is determined by a complex network of environmental-, genetic- and stochastic factors. Each of these components contributes to the wide variability in lifespan between and within species. In recent years, it has been shown that 20-30 % of human lifespan is under genetic

  4. BAGE: a new gene encoding an antigen recognized on human melanomas by cytolytic T lymphocytes.

    Science.gov (United States)

    Boël, P; Wildmann, C; Sensi, M L; Brasseur, R; Renauld, J C; Coulie, P; Boon, T; van der Bruggen, P

    1995-02-01

    Several tumor antigens are recognized by autologous cytolytic T lymphocytes (CTL) on human melanoma MZ2-MEL. Some of them are encoded by genes MAGE-1 and MAGE-3, which are not expressed in normal tissues except in testis. Here, we report the identification of a new gene that codes for another of these antigens. This gene, named BAGE, codes for a putative protein of 43 aa and seems to belong to a family of several genes. The antigen recognized by the autologous CTL consists of BAGE-encoded peptide AARAVFLAL bound to an HLA-Cw 1601 molecule. Gene BAGE is expressed in 22% of melanomas, 30% of infiltrating bladder carcinomas, 10% of mammary carcinomas, 8% of head and neck squamous cell carcinomas, and 6% of non-small cell lung carcinomas. Like the MAGE genes, it is silent in normal tissues with the exception of testis. Because of its tumor-specific expression, the BAGE-encoded antigen may prove useful for cancer immunotherapy.

  5. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  6. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  7. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    NARCIS (Netherlands)

    Dijkman, Ronald; Jebbink, Maarten F.; Wilbrink, Berry; Pyrc, Krzysztof; Zaaijer, Hans L.; Minor, Philip D.; Franklin, Sally; Berkhout, Ben; Thiel, Volker; van der Hoek, Lia

    2006-01-01

    BACKGROUND: The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV) 229E. The prototype virus has a

  8. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  9. The gene encoding topoisomerase I from the human malaria parasite Plasmodium falciparum.

    Science.gov (United States)

    Tosh, K; Kilbey, B

    1995-09-22

    Part of the topoisomerase I (TopoI)-encoding gene from Plasmodium falciparum (Pf) was isolated by PCR from cDNA using oligodeoxyribonucleotides modelled on the highly conserved regions of sequence from other species. The entire TopoI gene was obtained by screening a Pf K1 HindIII-EcoRI genomic library in lambda NM1149 with a random-labeled heterologous probe from the Saccharomyces cerevisiae TopoI gene. DNA sequence analysis revealed an open reading frame of 2520 nt encoding a deduced protein of 839 amino acids (aa) with no detectable introns. The Pf TopoI aa sequence has about 40% identity with most eukaryotic TopoI homologues. The gene is located as a single copy on chromosome 5 and Northern analysis identified a transcript of 3.8 kb.

  10. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  11. Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

    International Nuclear Information System (INIS)

    Cirullo, R.E.; Dana, S.; Wasmuth, J.J.

    1983-01-01

    A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

  12. A Drosophila gene encoding a protein resembling the human β-amyloid protein precursor

    International Nuclear Information System (INIS)

    Rosen, D.R.; Martin-Morris, L.; Luo, L.; White, K.

    1989-01-01

    The authors have isolated genomic and cDNA clones for a Drosophila gene resembling the human β-amyloid precursor protein (APP). This gene produces a nervous system-enriched 6.5-kilobase transcript. Sequencing of cDNAs derived from the 6.5-kilobase transcript predicts an 886-amino acid polypeptide. This polypeptide contains a putative transmembrane domain and exhibits strong sequence similarity to cytoplasmic and extracellular regions of the human β-amyloid precursor protein. There is a high probability that this Drosophila gene corresponds to the essential Drosophila locus vnd, a gene required for embryonic nervous system development

  13. Genomic organization and chromosomal localization of the human and mouse genes encoding the {alpha} receptor component for ciliary neurotrophic factor

    Energy Technology Data Exchange (ETDEWEB)

    Valenzuela, D.M.; Rojas, E.; McClain, J. [Regeneron Pharmaceuticals, Inc., Tarrytown, NY (United States)] [and others

    1995-01-01

    Ciliary neurotrophic factor (CNTF) has recently been found to share receptor components with, and to be structurally related to, a family of broadly acting cytokines, including interleukin-6, leukemia inhibitory factor, and oncostatin M. However, the CNTF receptor complex also includes a CNTF-specific component known as CNTF receptor {alpha} (CNTFR{alpha}). Here we describe the molecular cloning of the human and mouse genes encoding CNTFR. We report that the human and mouse genes have an identical intron-exon structure that correlates well with the domain structure of CNTFR{alpha}. That is, the signal peptide and the immunoglobulin-like domain are each encoded by single exons, the cytokine receptor-like domain is distributed among 4 exons, and the C-terminal glycosyl phosphatidylinositol recognition domain in encoded by the final coding exon. The position of the introns within the cytokine receptor-like domain corresponds to those found in other members of the cytokine receptor superfamily. Confirming a recent study using radiation hybrids, we have also mapped the human CNTFR gene to chromosome band 9p13 and the mouse gene to a syntenic region of chromosome 4. 24 refs., 4 figs.

  14. Structure and chromosomal localization of the gene encoding the human myelin protein zero (MPZ)

    Energy Technology Data Exchange (ETDEWEB)

    Hayasaka, Kiyoshi; Himoro, Masato; Takada, Goro (Akita Univ. School of Medicine, Akita (Japan)); Wang, Yimin; Takata, Mizuho; Minoshima, Shinsei; Shimizu, Nobuyoshi; Miura, Masayuki; Uyemura, Keiichi (Keio Univ. School of Medicine, Tokyo (Japan))

    1993-09-01

    The authors describe the cloning, characterization, and chromosomal mapping of the human myelin protein zero (MPZ) gene (a structural protein of myelin and an adhesive glycoprotein of the immunoglobulin superfamily). The gene is about 7 kb long and consists of six exons corresponding of the functional domains. All exon-intron junction sequences conform to the GT/AG rule. The 5[prime]-flanking region of the gene has a TA-rich element (TATA-like box), two CAAT boxes, and a single defined transcription initiation site detected by the primer extension method. The gene for human MPZ was assigned to chromosome 1q22-q23 by spot blot hybridization of flow-sorted human chromosomes and fluorescence in situ hybridization. The localization of the MPZ gene coincides with the locus for Charcot-Marie-Tooth disease type 1B, determined by linkage analysis. 20 refs., 3 figs., 1 tab.

  15. Developmentally regulated expression of a human ''finger'' - containing gene encoded by the 5' half of the ret transforming gene

    Energy Technology Data Exchange (ETDEWEB)

    Takahashi, M.; Inaguma, Y.; Hiai, H.; Hirose, F.

    1988-04-01

    The authors isolated and sequenced a cDNA clone of the human gene encoded by the 5' half of the ret transforming gene. The nucleotide sequence indicates that it encodes a protein with ''finger'' structures which represent putative metal- and nucleic acid-binding domains. Transcriptions of this gene was detected at high levels in a variety of human and rodent tumor cell lines, mouse testis, and embryos. In addition, a unique transcript was observed in testis RNA. When the expression of the unique transcript was examined at different stages of spermatogenesis, a striking increase in mRNA levels accompanied progression from meiotic prophase pachytene spermatocytes to postmeiotic round spermatids. This finger-containing gene may thus function in male germ cell development.

  16. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent...... hybridization. The NCK locus is at chromosome region 3q21, a region involved in neoplasia-associated changes; the SHC cognate locus, SHC1, is at 1q21, and the GRB2 locus is at 17q22-qter telomeric to the HOXB and NGFR loci. Both SHC1 and GRB2 are in chromosome regions that may be duplicated in some tumor types....

  17. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    -human hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...... hybridization. The NCK locus is at chromosome region 3q21, a region involved in neoplasia-associated changes; the SHC cognate locus, SHC1, is at 1q21, and the GRB2 locus is at 17q22-qter telomeric to the HOXB and NGFR loci. Both SHC1 and GRB2 are in chromosome regions that may be duplicated in some tumor types.......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...

  18. Novel mutations in genes encoding subcortical maternal complex proteins may cause human embryonic developmental arrest.

    Science.gov (United States)

    Wang, Xueqian; Song, Di; Mykytenko, Dmytro; Kuang, Yanping; Lv, Qifeng; Li, Bin; Chen, Biaobang; Mao, Xiaoyan; Xu, Yao; Zukin, Valery; Mazur, Pavlo; Mu, Jian; Yan, Zheng; Zhou, Zhou; Li, Qiaoli; Liu, Suying; Jin, Li; He, Lin; Sang, Qing; Sun, Zhaogui; Dong, Xi; Wang, Lei

    2018-03-21

    Successful human reproduction initiates from normal gamete formation, fertilization and early embryonic development. Abnormalities in any of these steps will lead to infertility. Many infertile patients undergo several failures of IVF and intracytoplasmic sperm injection (ICSI) cycles, and embryonic developmental arrest is a common phenotype in cases of recurrent failure of IVF/ICSI attempts. However, the genetic basis for this phenotype is poorly understood. The subcortical maternal complex (SCMC) genes play important roles during embryonic development, and using whole-exome sequencing novel biallelic mutations in the SCMC genes TLE6, PADI6 and KHDC3L were identified in four patients with embryonic developmental arrest. A mutation in TLE6 was found in a patient with cleaved embryos that arrested on day 3 and failed to form blastocysts. Two patients with embryos that arrested at the cleavage stage had mutations in PADI6, and a mutation in KHDC3L was found in a patient with embryos arrested at the morula stage. No mutations were identified in these genes in an additional 80 patients. These findings provide further evidence for the important roles of TLE6, PADI6 and KHDC3L in embryonic development. This work lays the foundation for the genetic diagnosis of patients with recurrent IVF/ICSI failure. Copyright © 2018 Reproductive Healthcare Ltd. Published by Elsevier Ltd. All rights reserved.

  19. Murine and human b locus pigmentation genes encode a glycoprotein (gp75) with catalase activity

    International Nuclear Information System (INIS)

    Halaban, R.; Moellmann, G.

    1990-01-01

    Melanogenesis is regulated in large part by tyrosinase, and defective tyrosinase leads to albinism. The mechanisms for other pigmentation determinants (e.g., those operative in tyrosinase-positive albinism and in murine coat-color mutants) are not yet known. One murine pigmentation gene, the brown (b) locus, when mutated leads to a brown (b/b) or hypopigmentated (B lt /B lt ) coat versus the wild-type black (B/B). The authors show that the b locus codes for a glycoprotein with the activity of a catalase (catalase B). Only the c locus protein is a tyrosinase. Because peroxides may be by-products of melanogenic activity and hydrogen peroxide in particular is known to destroy melanin precursors and melanin, they conclude that pigmentation is controlled not only by tyrosinase but also by a hydroperoxidase. The studies indicate that catalase B is identical with gp75, a known human melanosomal glycoprotein; that the b mutation is in a heme-associated domain; and that the B lt mutation renders the protein susceptible to rapid proteolytic degradation

  20. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  1. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Directory of Open Access Journals (Sweden)

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  2. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  3. Gene encoding the human. beta. -hexosaminidase. beta. chain: Extensive homology of intron placement in the. alpha. - and. beta. -chain genes

    Energy Technology Data Exchange (ETDEWEB)

    Proia, R.L. (National Institute of Diabetes, Digestive and Kidney Diseases, Bethesda, MD (USA))

    1988-03-01

    Lysosomal {beta}-hexosaminidase is composed of two structurally similar chains, {alpha} and {beta}, that are the products of different genes. Mutations in either gene causing {beta}-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the {alpha} and {beta} chains, the {beta}-chain gene was isolated, and its organization was characterized. The {beta}-chain coding region is divided into 14 exons distributed over {approx}40 kilobases of DNA. Comparison with the {alpha}-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions. This extensive sharing of intron placement demonstrates that the {alpha} and {beta} chains evolved by way of the duplication of a common ancestor.

  4. Expression and human chromosomal localization to 17q25 of the growth-regulated gene encoding the mitochondrial ribosomal protein MRPL12

    Energy Technology Data Exchange (ETDEWEB)

    Marty, L.; Fort, P. [Institut de Genetique Moleculaire, Montpellier (France); Taviaux, S. [INSERM, Montpellier (France)

    1997-05-01

    Mitochondrial activity requires the expression of nuclear genes, whose products are part of multiproteic complexes leading to ATP production and delivery. We recently characterized a growth-activated mRNA encoding the human mitochondrial ribosomal MRPL12 protein, which is thought to act as a translational regulator of mitochondrial mRNAs. We show here that MRPL12 mRNA expression is enhanced in growth-stimulated cells as a result of transcriptional activation, a feature lost in transformed cell lines. MRPL12 mRNA is highly expressed in the colon, in which a reduction in mitochondrial activity was shown to be associated with tumor formation. The human MRPL12 protein is encoded by a unique gene located on chromosome 17 (q25-qter). As no predisposition to colon cancer linked to this chromosomal region was hitherto reported, the MRPL12 gene might be involved in the process of differentiation of colonic epithelial cells. 16 refs., 2 figs.

  5. The human homolog of S. cerevisiae CDC27, CDC27 Hs, is encoded by a highly conserved intronless gene present in multiple copies in the human genome

    Energy Technology Data Exchange (ETDEWEB)

    Devor, E.J.; Dill-Devor, R.M. [Univ. of Iowa College of Medicine, Iowa City (United States)

    1994-09-01

    We have obtained a number of unique sequences via PCR amplification of human genomic DNA using degenerate primers under low stringency (42{degrees}C). One of these, an 853 bp product, has been identified as a partial genomic sequence of the human homolog of the S. cerevisiae CDC27 gene, CDC27Hs (GenBank No. U00001). This gene, reported by Turgendreich et al. is also designated EST00556 from Adams et al. We have undertaken a more detailed examination of our sequence, MCP34N, and have found that: 1. the genomic sequence is nearly identical to CDC27Hs over its entire 853 bp length; 2. an MCP34N-specific PCR assay of several non-human primate species reveals amplification products in chimpanzee and gorilla genomes having greater than 90% sequence identity with CDC27Hs; and 3. an MCP34N-specific PCR assay of the BIOS hybrid cell line panel gives a discordancy pattern suggesting multiple loci. Based upon these data, we present the following initial characterization: 1. the complete MCP34N sequence identity with CDC27Hs indicates that the latter is encoded by an intronless gene; 2. CDC27Hs is highly conserved among higher primates; and 3. CDC27Hs is present in multiple copies in the human genome. These characteristics, taken together with those initially reported for CDC27Hs, suggest that this is an old gene that carries out an important but, as yet, unknown function in the human brain.

  6. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites......The Cd247 gene encodes for a transmembrane protein important for the expression and assembly of TCR/CD3 complex on the surface of T lymphocytes. Down-regulation of CD247 has functional consequences in systemic autoimmunity and has been shown to be associated with Type 1 Diabetes in NOD mouse......, supported by histone marks and ChIP-seq data, that specifically have features of an enhancer and a promoter, respectively. We also identified a putative long non-coding RNA from the characteristically long first intron of the Cd247 gene. The long non-coding RNA annotation is supported by manual annotations...

  7. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on the growth and radiotherapeutic sensitivity of human lymphoma cell lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wang Yongqing; Wu Jinchang

    2008-01-01

    Objective: To explore the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Methods: Human lymphoma cell lines Raji and Daudi were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTT. The p53 protein expression was detected by Western blotting, and p53 mRNA was detected by BT-PCB. Results: The MTT results showed that the inhibitory effect and radiosensitivity enhancement of rAd-p53 on human lymphoma cell lines were not obvious [Raji: (27.5±4.1)%; Daudi: (28.1±1.6)%]. The results of Western blotting and BT-PCB showed that extrinsic p53 protein and p53 mRNA were expressed to some degree, but not at high-level. In addition, the results didn't demonstrate obvious radiosensitivity enhancement. Conclusions: The role of inhibition and radiosensitivity enhancement of rAd-p53 was not significant on human lymphoma cell lines. (authors)

  8. Human cytomegalovirus resistance to deoxyribosylindole nucleosides maps to a transversion mutation in the terminase subunit-encoding gene UL89.

    Science.gov (United States)

    Gentry, Brian G; Phan, Quang; Hall, Ellie D; Breitenbach, Julie M; Borysko, Katherine Z; Kamil, Jeremy P; Townsend, Leroy B; Drach, John C

    2015-01-01

    Human cytomegalovirus (HCMV) infection can cause severe illnesses, including encephalopathy and mental retardation, in immunocompromised and immunologically immature patients. Current pharmacotherapies for treating systemic HCMV infections include ganciclovir, cidofovir, and foscarnet. However, long-term administration of these agents can result in serious adverse effects (myelosuppression and/or nephrotoxicity) and the development of viral strains with reduced susceptibility to drugs. The deoxyribosylindole (indole) nucleosides demonstrate a 20-fold greater activity in vitro (the drug concentration at which 50% of the number of plaques was reduced with the presence of drug compared to the number in the absence of drug [EC50] = 0.34 μM) than ganciclovir (EC50 = 7.4 μM) without any observed increase in cytotoxicity. Based on structural similarity to the benzimidazole nucleosides, we hypothesize that the indole nucleosides target the HCMV terminase, an enzyme responsible for packaging viral DNA into capsids and cleaving the DNA into genome-length units. To test this hypothesis, an indole nucleoside-resistant HCMV strain was isolated, the open reading frames of the genes that encode the viral terminase were sequenced, and a G766C mutation in exon 1 of UL89 was identified; this mutation resulted in an E256Q change in the amino acid sequence of the corresponding protein. An HCMV wild-type strain, engineered with this mutation to confirm resistance, demonstrated an 18-fold decrease in susceptibility to the indole nucleosides (EC50 = 3.1 ± 0.7 μM) compared to that of wild-type virus (EC50 = 0.17 ± 0.04 μM). Interestingly, this mutation did not confer resistance to the benzimidazole nucleosides (EC50 for wild-type HCMV = 0.25 ± 0.04 μM, EC50 for HCMV pUL89 E256Q = 0.23 ± 0.04 μM). We conclude, therefore, that the G766C mutation that results in the E256Q substitution is unique for indole nucleoside resistance and distinct from previously discovered substitutions

  9. Development of a set of multiplex PCRs for detection of genes encoding cell wall-associated proteins in Staphylococcus pseudintermedius isolates from dogs, humans and the environment.

    Science.gov (United States)

    Phumthanakorn, Nathita; Chanchaithong, Pattrarat; Prapasarakul, Nuvee

    2017-11-01

    Staphylococcus pseudintermedius commonly colonizes the skin of dogs, whilst nasal carriage may occur in humans who are in contact with dogs or the environment of veterinary hospitals. Genes encoding cell wall-associated (CWA) proteins have been described in Staphylococcus aureus but knowledge of their occurrence in S. pseudintermedius is still limited. The aim of the study was to develop a method to detect S. pseudintermedius surface protein genes (sps) encoding CWA proteins, and to examine the distribution of the genes in isolates from different sources. Four multiplex PCR assays (mPCR) were developed for detection of 18 sps genes, with 4-5 genes detected per mPCR. These were applied to 135 S. pseudintermedius isolates from carriage sites (n=35) and infected sites (n=35) in dogs, from the nasal cavity of humans (n=25), and from the environment of a veterinary hospital (n=40). The mPCRs were shown to detect all 18 known sps genes, and no discrepancies were found between uniplex and mPCR results. The mPCRs could detect at least 1pg/μl of DNA template. A total of 23 sps gene profiles were found among the 135 isolates, with diverse gene combinations. Only spsD, spsF, spsI, spsO, spsP, and spsQ were not detected in all isolates. spsP and spsQ were more frequently detected in the canine isolates from infected sites than from carriage sites. This finding suggests that these two genes may play a role in pathogenicity, whereas the presence of the 12 sps genes may contribute to adherence function at all surfaces where carriage occurs. Copyright © 2017 Elsevier B.V. All rights reserved.

  10. The gene encoding human glutathione synthetase (GSS) maps to the long arm of chromosome 20 at band 11.2

    Energy Technology Data Exchange (ETDEWEB)

    Webb, G.C.; Vaska, V.L.; Ford, J.H. [Queen Elizabeth Hospital, Woodville (Australia)] [and others

    1995-12-10

    Two forms of glutathione synthetase deficiency have been described. While one form is mild, causing hemolytic anemia, the other more severe form causes 5-oxoprolinuria with secondary neurological involvement. Despite the existence of two deficiency phenotypes, Southern blots hybridized with a glutathione synthetase cDNA suggest that there is a single glutathione synthetase gene in the human genome. Analysis of somatic cell hybrids showed the human glutathione synthetase gene (GSS) to be located on chromosome 20, and this assignment has been refined to subband 20q11.2 using in situ hybridization. 16 refs., 2 figs.

  11. Characterization of splice variants of the genes encoding human mitochondrial HMG-CoA lyase and HMG-CoA synthase, the main enzymes of the ketogenesis pathway.

    Science.gov (United States)

    Puisac, Beatriz; Ramos, Mónica; Arnedo, María; Menao, Sebastián; Gil-Rodríguez, María Concepción; Teresa-Rodrigo, María Esperanza; Pié, Angeles; de Karam, Juan Carlos; Wesselink, Jan-Jaap; Giménez, Ignacio; Ramos, Feliciano J; Casals, Nuria; Gómez-Puertas, Paulino; Hegardt, Fausto G; Pié, Juan

    2012-04-01

    The genes HMGCS2 and HMGCL encode the two main enzymes for ketone-body synthesis, mitochondrial HMG-CoA synthase and HMG-CoA lyase. Here, we identify and describe possible splice variants of these genes in human tissues. We detected an alternative transcript of HMGCS2 carrying a deletion of exon 4, and two alternative transcripts of HMGCL with deletions of exons 5 and 6, and exons 5, 6 and 7, respectively. All splice variants maintained the reading frame. However, Western blot studies and overexpression measurements in eukaryotic or prokaryotic cell models did not reveal HL or mHS protein variants. Both genes showed a similar distribution of the inactive variants in different tissues. Surprisingly, the highest percentages were found in tissues where almost no ketone bodies are synthesized: heart, skeletal muscle and brain. Our results suggest that alternative splicing might coordinately block the two main enzymes of ketogenesis in specific human tissues.

  12. Structure of the human gene encoding the associated microfibrillar protein (MFAP1) and localization to chromosome 15q15-q21

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others

    1994-09-15

    Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.

  13. NCYM, a Cis-antisense gene of MYCN, encodes a de novo evolved protein that inhibits GSK3β resulting in the stabilization of MYCN in human neuroblastomas.

    Directory of Open Access Journals (Sweden)

    Yusuke Suenaga

    2014-01-01

    Full Text Available The rearrangement of pre-existing genes has long been thought of as the major mode of new gene generation. Recently, de novo gene birth from non-genic DNA was found to be an alternative mechanism to generate novel protein-coding genes. However, its functional role in human disease remains largely unknown. Here we show that NCYM, a cis-antisense gene of the MYCN oncogene, initially thought to be a large non-coding RNA, encodes a de novo evolved protein regulating the pathogenesis of human cancers, particularly neuroblastoma. The NCYM gene is evolutionally conserved only in the taxonomic group containing humans and chimpanzees. In primary human neuroblastomas, NCYM is 100% co-amplified and co-expressed with MYCN, and NCYM mRNA expression is associated with poor clinical outcome. MYCN directly transactivates both NCYM and MYCN mRNA, whereas NCYM stabilizes MYCN protein by inhibiting the activity of GSK3β, a kinase that promotes MYCN degradation. In contrast to MYCN transgenic mice, neuroblastomas in MYCN/NCYM double transgenic mice were frequently accompanied by distant metastases, behavior reminiscent of human neuroblastomas with MYCN amplification. The NCYM protein also interacts with GSK3β, thereby stabilizing the MYCN protein in the tumors of the MYCN/NCYM double transgenic mice. Thus, these results suggest that GSK3β inhibition by NCYM stabilizes the MYCN protein both in vitro and in vivo. Furthermore, the survival of MYCN transgenic mice bearing neuroblastoma was improved by treatment with NVP-BEZ235, a dual PI3K/mTOR inhibitor shown to destabilize MYCN via GSK3β activation. In contrast, tumors caused in MYCN/NCYM double transgenic mice showed chemo-resistance to the drug. Collectively, our results show that NCYM is the first de novo evolved protein known to act as an oncopromoting factor in human cancer, and suggest that de novo evolved proteins may functionally characterize human disease.

  14. Recent positive selection has acted on genes encoding proteins with more interactions within the whole human interactome.

    Science.gov (United States)

    Luisi, Pierre; Alvarez-Ponce, David; Pybus, Marc; Fares, Mario A; Bertranpetit, Jaume; Laayouni, Hafid

    2015-04-02

    Genes vary in their likelihood to undergo adaptive evolution. The genomic factors that determine adaptability, however, remain poorly understood. Genes function in the context of molecular networks, with some occupying more important positions than others and thus being likely to be under stronger selective pressures. However, how positive selection distributes across the different parts of molecular networks is still not fully understood. Here, we inferred positive selection using comparative genomics and population genetics approaches through the comparison of 10 mammalian and 270 human genomes, respectively. In agreement with previous results, we found that genes with lower network centralities are more likely to evolve under positive selection (as inferred from divergence data). Surprisingly, polymorphism data yield results in the opposite direction than divergence data: Genes with higher centralities are more likely to have been targeted by recent positive selection during recent human evolution. Our results indicate that the relationship between centrality and the impact of adaptive evolution highly depends on the mode of positive selection and/or the evolutionary time-scale. © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Genomic organization and mapping of the gene (SLC25A19) encoding the human mitochondrial deoxynucleotide carrier (DNC).

    Science.gov (United States)

    Iacobazzi, V; Ventura, M; Fiermonte, G; Prezioso, G; Rocchi, M; Palmieri, F

    2001-01-01

    The deoxynucleotide carrier (DNC) transports deoxynucleotides into mitochondria and is therefore essential for mtDNA synthesis. The human DNC gene (SLC25A19) spans about 16.5 kb and consists of nine exons with the translation start site in exon 4. It is located on chromosome 17q25.3. Three transcripts, which differ in their 5' ends and are generated by alternative splicing, have been identified. Copyright 2001 S. Karger AG, Basel

  16. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    International Nuclear Information System (INIS)

    Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z.

    1990-01-01

    We have synthesized 32 P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies

  17. Identification of human rotavirus serotype by hybridization to polymerase chain reaction-generated probes derived from a hyperdivergent region of the gene encoding outer capsid protein VP7

    Energy Technology Data Exchange (ETDEWEB)

    Flores, J.; Sears, J.; Schael, I.P.; White, L.; Garcia, D.; Lanata, C.; Kapikian, A.Z. (National Institutes of Health, Bethesda, MD (USA))

    1990-08-01

    We have synthesized {sup 32}P-labeled hybridization probes from a hyperdivergent region (nucleotides 51 to 392) of the rotavirus gene encoding the VP7 glycoprotein by using the polymerase chain reaction method. Both RNA (after an initial reverse transcription step) and cloned cDNA from human rotavirus serotypes 1 through 4 could be used as templates to amplify this region. High-stringency hybridization of each of the four probes to rotavirus RNAs dotted on nylon membranes allowed the specific detection of corresponding sequences and thus permitted identification of the serotype of the strains dotted. The procedure was useful when applied to rotaviruses isolated from field studies.

  18. Human cyclophilin B: A second cyclophilin gene encodes a peptidyl-prolyl isomerase with a signal sequence

    International Nuclear Information System (INIS)

    Price, E.R.; Zydowsky, L.D.; Jin, Mingjie; Baker, C.H.; McKeon, F.D.; Walsh, C.T.

    1991-01-01

    The authors report the cloning and characterization of a cDNA encoding a second human cyclosporin A-binding protein (hCyPB). Homology analyses reveal that hCyPB is a member of the cyclophilin B (CyPB) family, which includes yeast CyPB, Drosophila nina A, and rat cyclophilin-like protein. This family is distinguished from the cyclophilin A (CyPA) family by the presence of endoplasmic reticulum (ER)-directed signal sequences. hCyPB has a hydrophobic leader sequence not found in hCyPA, and its first 25 amino acids are removed upon expression in Escherichia coli. Moreover, they show that hCyPB is a peptidyl-prolyl cis-trans isomerase which can be inhibited by cyclosporin A. These observations suggest that other members of the CyPB family will have similar enzymatic properties. Sequence comparisons of the CyPB proteins show a central, 165-amino acid peptidyl-prolyl isomerase and cyclosprorin A-binding domain, flanked by variable N-terminal and C-terminal domains. These two variable regions may impart compartmental specificity and regulation to this family of cyclophilin proteins containing the conserved core domain. Northern blot analyses show that hCyPB mRNA is expressed in the Jurkat T-cell line, consistent with its possible target role in cyclosporin A-mediated immunosuppression

  19. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  20. Characterization of the enhanced bone regenerative capacity of human periodontal ligament stem cells engineered to express the gene encoding bone morphogenetic protein 2.

    Science.gov (United States)

    Jung, Im-Hee; Lee, Si-Ho; Jun, Choong-Man; Oh, Namsik; Yun, Jeong-Ho

    2014-08-01

    Human periodontal ligament stem cells (hPDLSCs) are considered an appropriate cell source for therapeutic strategies. The aims of this study were to investigate the sustainability of bone morphogenetic protein 2 (BMP2) secretion and the bone regenerative capacity of hPDLSCs that had been genetically modified to express the gene encoding BMP2 (BMP2). hPDLSCs isolated from healthy third molars were transduced using replication-deficient recombinant adenovirus (rAd) encoding BMP2 (hPDLSCs/rAd-BMP2), and the cellular characteristics and osteogenic potentials of hPDLSCs/rAd-BMP2 were analyzed both in vitro and in vivo. hPDLSCs/rAd-BMP2 successfully secreted BMP2, formed colonies, and expressed immunophenotypes similar to their nontransduced counterparts. As to their osteogenic potential, hPDLSCs/rAd-BMP2 formed greater mineralized nodules and exhibited significantly higher levels of expression of BMP2 and the gene encoding alkaline phosphatase, and formed more and better quality bone than other hPDLSC-containing or recombinant human BMP2-treated groups, being localized at the initial site until 8 weeks. The findings of the present study demonstrate that hPDLSCs/rAd-BMP2 effectively promote osteogenesis not only in vitro but also in vivo. The findings also suggest that hPDLSCs can efficiently carry and deliver BMP2, and that hPDLSCs/rAd-BMP2 could be used in an attractive novel therapeutic approach for the regeneration of deteriorated bony defects.

  1. An intact SAM-dependent methyltransferase fold is encoded by the human endothelin-converting enzyme-2 gene

    Energy Technology Data Exchange (ETDEWEB)

    Tempel, W.; Wu, H.; Dombrovsky, L.; Zeng, H.; Loppnau, P.; Zhu, H.; Plotnikov, A.N.; Bochkarev, A.; (Toronto)

    2010-08-17

    A recent survey of protein expression patterns in patients with Alzheimer's disease (AD) has identified ece2 (chromosome: 3; Locations: 3q27.1) as the most significantly downregulated gene within the tested group. ece2 encodes endothelin-converting enzyme ECE2, a metalloprotease with a role in neuropeptide processing. Deficiency in the highly homologous ECE1 has earlier been linked to increased levels of AD-related {beta}-amyloid peptide in mice, consistent with a role for ECE in the degradation of that peptide. Initially, ECE2 was presumed to resemble ECE1, in that it comprises a single transmembrane region of {approx}20 residues flanked by a small amino-terminal cytosolic segment and a carboxy-terminal lumenar peptidase domain. The carboxy-terminal domain has significant sequence similarity to both neutral endopeptidase, for which an X-ray structure has been determined, and Kell blood group protein. After their initial discovery, multiple isoforms of ECE1 and ECE2 were discovered, generated by alternative splicing of multiple exons. The originally described ece2 transcript, RefSeq NM{_}174046, contains the amino-terminal cytosolic portion followed by the transmembrane region and peptidase domain (Fig. 1, isoform B). Another ece2 transcript, available from the Mammalian Gene Collection under MGC2408 (Fig. 1, isoform C), RefSeq accession NM{_}032331, is predicted to be translated into a 255 residue peptide with low but detectable sequence similarity to known S-adenosyl-L-methionine (SAM)-dependent methyltransferases (SAM-MTs), such as the hypothetical protein TT1324 from Thermus thermophilis, PDB code 2GS9, which shares 30% amino acid sequence identity with ECE2 over 138 residues of the sequence. Intriguingly, another 'elongated' ece2 transcript (Fig. 1, isoform A) (RefSeq NM{_}014693) contains an amino-terminal portion of the putative SAM-MT domain, the transmembrane domain, and the protease domain. This suggests the possibility for coexistence of

  2. Human renal carcinoma expresses two messages encoding a parathyroid hormone-like peptide: Evidence for the alternative splicing of a single-copy gene

    International Nuclear Information System (INIS)

    Thiede, M.A.; Strewler, G.J.; Nissenson, R.A.; Rosenblatt, M.; Rodan, G.A.

    1988-01-01

    A peptide secreted by tumors associated with the clinical syndrome of humoral hypercalcemia of malignancy was recently purified from human renal carcinoma cell line 786-0. The N-terminal amino acid sequence of this peptide has considerable similarity with those of parathyroid hormone (PTH) and of peptides isolated from human breast and lung carcinoma (cell line BEN). In this study the authors obtained the nucleotide sequence of a 1595-base cDNA complementary to mRNA encoding the PTH-like peptide produced by 786-0 cells. The cDNA contains an open reading frame encoding a leader sequence of 36 amino acids and a 139-residue peptide, in which 8 of the first 13 residues are identical to the N terminus of PTH. Through the first 828 bases the sequence of this cDNA is identical with one recently isolated from a BEN cell cDNA library; however, beginning with base 829 the sequences diverge, shortening the open reading frame by 2 amino acids. Differential RNA blot analysis revealed that 786-0 cells express two major PTH-like peptide mRNAs with different 3' untranslated sequences, one of which hybridizes with the presently described sequence and the other one with that reported for the BEN cell PTH-like peptide cDNA. Primer-extension analysis of 786-0 poly(A) + RNA together with Southern blot analysis of human DNA confirmed the presence of a single-copy gene coding for multiple mRNAs through alternate splicing. In addition, the 3' untranslated sequence of the cDNA described here has significant similarity to the c-myc protooncogene

  3. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  4. The TFG-TEC fusion gene created by the t(3;9) translocation in human extraskeletal myxoid chondrosarcomas encodes a more potent transcriptional activator than TEC.

    Science.gov (United States)

    Lim, Bobae; Jun, Hee Jung; Kim, Ah-young; Kim, Sol; Choi, JeeHyun; Kim, Jungho

    2012-08-01

    The t(3;9)(q11-q12;q22) translocation associated with human extraskeletal myxoid chondrosarcomas results in a chimeric molecule in which the N-terminal domain (NTD) of the TFG (TRK-fused gene) is fused to the TEC (Translocated in Extraskeletal Chondrosarcoma) gene. Little is known about the biological function of TFG-TEC. Because the NTDs of TFG-TEC and TEC are structurally different, and the TFG itself is a cytoplasmic protein, the functional consequences of this fusion in extraskeletal myxoid chondrosarcomas were examined. The results showed that the chimeric gene encoded a nuclear protein that bound DNA with the same sequence specificity as the parental TEC protein. Comparison of the transactivation properties of TFG-TEC and TEC indicated that the former has higher transactivation activity for a known target reporter containing TEC-binding sites. Additional reporter assays for TFG (NTD) showed that the TGF (NTD) of TFG-TEC induced a 12-fold increase in the activation of luciferase from a reporter plasmid containing GAL4 binding sites when fused to the DNA-binding domain of GAL4, indicating that the TFG (NTD) of the TFG-TEC protein has intrinsic transcriptional activation properties. Finally, deletion analysis of the functional domains of TFG (NTD) indicated that the PB1 (Phox and Bem1p) and SPYGQ-rich region of TFG (NTD) were capable of activating transcription and that full integrity of TFG (NTD) was necessary for full transactivation. These results suggest that the oncogenic effect of the t(3;9) translocation may be due to the TFG-TEC chimeric protein and that fusion of the TFG (NTD) to the TEC protein produces a gain-of-function chimeric product.

  5. RNAi suppressors encoded by pathogenic human viruses

    NARCIS (Netherlands)

    de Vries, Walter; Berkhout, Ben

    2008-01-01

    RNA silencing or RNAi interference (RNAi) serves as an innate antiviral mechanism in plants, fungi and animals. Human viruses, like plant viruses, encode suppressor proteins or RNAs that block or modulate the RNAi pathway. This review summarizes the mechanisms by which pathogenic human viruses

  6. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development...... of novel approaches to the control of this pathogen....

  7. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  8. Identification and validation of human papillomavirus encoded microRNAs.

    Directory of Open Access Journals (Sweden)

    Kui Qian

    Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.

  9. Gene encoding the human beta-hexosaminidase beta chain: extensive homology of intron placement in the alpha- and beta-chain genes.

    Science.gov (United States)

    Proia, R L

    1988-03-01

    Lysosomal beta-hexosaminidase (EC 3.2.1.52) is composed of two structurally similar chains, alpha and beta, that are the products of different genes. Mutations in either gene causing beta-hexosaminidase deficiency result in the lysosomal storage disease GM2-gangliosidosis. To enable the investigation of the molecular lesions in this disorder and to study the evolutionary relationship between the alpha and beta chains, the beta-chain gene was isolated, and its organization was characterized. The beta-chain coding region is divided into 14 exons distributed over approximately 40 kilobases of DNA. Comparison with the alpha-chain gene revealed that 12 of the 13 introns interrupt the coding regions at homologous positions. This extensive sharing of intron placement demonstrates that the alpha and beta chains evolved by way of the duplication of a common ancestor.

  10. Human Transcriptome and Chromatin Modifications: An ENCODE Perspective

    Directory of Open Access Journals (Sweden)

    Li Shen

    2013-06-01

    Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.

  11. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  12. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  13. The human HIP gene, overexpressed in primary liver cancer encodes for a C-type carbohydrate binding protein with lactose binding activity.

    Science.gov (United States)

    Christa, L; Felin, M; Morali, O; Simon, M T; Lasserre, C; Brechot, C; Sève, A P

    1994-01-03

    HIP was originally identified as a gene expression in primary liver cancers, and in normal tissues such as pancreas and small intestine. Based on gene data base homologies, the HIP protein should consist of a signal peptide linked to a single carbohydrate recognition domain. To test this hypothesis HIP and the putative carbohydrate recognition domain encoded by the last 138 C-terminal amino acids, were expressed as glutathione-S-transferase proteins (GST-HIP and GST-HIP-142, respectively). Both recombinant proteins were purified by a single affinity purification step from bacterial lysates and their ability to bind saccharides coupled to trisacryl GF 2000M were tested. Our results show that HIP and HIP-142 proteins bind to lactose, moreover the binding requires divalent cations. Thus the HIP protein is a lactose-binding lectin with the characteristics of a C-type carbohydrate recognition domain of 138 amino acids in the C-terminal region.

  14. Phylogenetic distribution and prevalence of genes encoding class I Integrons and CTX-M-15 extended-spectrum β-lactamases in Escherichia coli isolates from healthy humans in Chandigarh, India.

    Directory of Open Access Journals (Sweden)

    Chetna Dureja

    Full Text Available Escherichia coli is generally considered as a commensal inhabitant of gastrointestinal tract of humans and animals. The aim of this study was to gain insight on the distribution of phylotypes and presence of genes encoding integrons, extended β-lactamases and resistance to other antimicrobials in the commensal E. coli isolates from healthy adults in Chandigarh, India. PCR and DNA sequencing were used for phylogenetic classification, detections of integrase genes, gene cassettes within the integron and extended β-lactamases. The genetic structure of E. coli revealed a non-uniform distribution of isolates among the seven phylogenetic groups with significant representation of group A. Integron-encoded integrases were detected in 25 isolates with class 1 integron-encoded intI1 integrase being in the majority (22 isolates. The gene cassettes identified were those for trimethoprim, streptomycin, spectinomycin and streptothricin. The dfrA12-orfF-aadA2 was the most commonly found gene cassette in intI1 positive isolates. Phenotypic assay for screening the potential ESBL producers suggested 16 isolates to be ESBL producers. PCR detection using gene-specific primers showed that 15 out of these 16 ESBL-producing E. coli harboured the blaCTX-M-15 gene. Furthermore, molecular studies helped in characterizing the genes responsible for tetracycline, chloramphenicol and sulphonamides resistance. Collectively, our study outlines the intra-species phylogenetic structure and highlights the prevalence of class 1 integron and blaCTX-M-15 in commensal E. coli isolates of healthy adults in Chandigarh, India. Our findings further reinforce the relevance of commensal E. coli strains on the growing burden of antimicrobial resistance.

  15. A presumed DNA helicase, encoded by the excision repair gene ERCC-3 is involved in the human repair disorders xeroderma pigmentosum and Cockayne's syndrome.

    NARCIS (Netherlands)

    G. Weeda (Geert); R.C.A. van Ham; W. Vermeulen (Wim); D. Bootsma (Dirk); A.J. van der Eb; J.H.J. Hoeijmakers (Jan)

    1990-01-01

    textabstractThe human gene ERCC-3 specifically corrects the defect in an early step of the DNA excision repair pathway of UV-sensitive rodent mutants of complementation group 3. The predicted 782 animo acid ERCC-3 protein harbors putative nucleotide, chromatin, and helix-turn-helix DNA binding

  16. The chromosome 3p21.3-encoded gene, LIMD1, is a critical tumor suppressor involved in human lung cancer development.

    Science.gov (United States)

    Sharp, Tyson V; Al-Attar, Ahmad; Foxler, Daniel E; Ding, Li; de A Vallim, Thomas Q; Zhang, Yining; Nijmeh, Hala S; Webb, Thomas M; Nicholson, Andrew G; Zhang, Qunyuan; Kraja, Aldi; Spendlove, Ian; Osborne, John; Mardis, Elaine; Longmore, Gregory D

    2008-12-16

    Loss of heterozygosity (LOH) and homozygous deletions at chromosome 3p21.3 are common in both small and nonsmall cell lung cancers, indicating the likely presence of tumor suppressor genes (TSGs). Although genetic and epigenetic changes within this region have been identified, the functional significance of these changes has not been explored. Concurrent protein expression and genetic analyses of human lung tumors coupled with functional studies have not been done. Here, we show that expression of the 3p21.3 gene, LIMD1, is frequently down-regulated in human lung tumors. Loss of LIMD1 expression occurs through a combination of gene deletion, LOH, and epigenetic silencing of transcription without evidence for coding region mutations. Experimentally, LIMD1 is a bona fide TSG. Limd1(-/-) mice are predisposed to chemical-induced lung adenocarcinoma and genetic inactivation of Limd1 in mice heterozygous for oncogenic K-Ras(G12D) markedly increased tumor initiation, promotion, and mortality. Thus, we conclude that LIMD1 is a validated chromosome 3p21.3 tumor-suppressor gene involved in human lung cancer development. LIMD1 is a LIM domain containing adapter protein that localizes to E-cadherin cell-cell adhesive junctions, yet also translocates to the nucleus where it has been shown to function as an RB corepressor. As such, LIMD1 has the potential to communicate cell extrinsic or environmental cues with nuclear responses.

  17. Human AZU-1 gene, variants thereof and expressed gene products

    Science.gov (United States)

    Chen, Huei-Mei; Bissell, Mina

    2004-06-22

    A human AZU-1 gene, mutants, variants and fragments thereof. Protein products encoded by the AZU-1 gene and homologs encoded by the variants of AZU-1 gene acting as tumor suppressors or markers of malignancy progression and tumorigenicity reversion. Identification, isolation and characterization of AZU-1 and AZU-2 genes localized to a tumor suppressive locus at chromosome 10q26, highly expressed in nonmalignant and premalignant cells derived from a human breast tumor progression model. A recombinant full length protein sequences encoded by the AZU-1 gene and nucleotide sequences of AZU-1 and AZU-2 genes and variant and fragments thereof. Monoclonal or polyclonal antibodies specific to AZU-1, AZU-2 encoded protein and to AZU-1, or AZU-2 encoded protein homologs.

  18. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    International Nuclear Information System (INIS)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-01-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus

  19. Identification of the major structural and nonstructural proteins encoded by human parvovirus B19 and mapping of their genes by procaryotic expression of isolated genomic fragments

    Energy Technology Data Exchange (ETDEWEB)

    Cotmore, S.F.; McKie, V.C.; Anderson, L.J.; Astell, C.R.; Tattersall, P.

    1986-11-01

    Plasma from a child with homozygous sickle-cell disease, sampled during the early phase of an aplastic crisis, contained human parvovirus B19 virions. Plasma taken 10 days later (during the convalescent phase) contained both immunoglobulin M and immunoglobulin G antibodies directed against two viral polypeptides with apparent molecular weights for 83,000 and 58,000 which were present exclusively in the particulate fraction of the plasma taken during the acute phase. These two protein species comigrated at 110S on neutral sucrose velocity gradients with the B19 viral DNA and thus appear to constitute the viral capsid polypeptides. The B19 genome was molecularly cloned into a bacterial plasmid vector. Two expression constructs containing B19 sequences from different halves of the viral genome were obtained, which directed the synthesis, in bacteria, of segments of virally encoded protein. These polypeptide fragments were then purified and used to immunize rabbits. Antibodies against a protein sequence specified between nucleotides 2897 and 3749 recognized both the 83- and 58-kilodalton capsid polypeptides in aplastic plasma taken during the acute phase and detected similar proteins in the similar proteins in the tissues of a stillborn fetus which had been infected transplacentally with B19. Antibodies against a protein sequence encoded in the other half of the B19 genome (nucleotides 1072 through 2044) did not react specifically with any protein in plasma taken during the acute phase but recognized three nonstructural polypeptides of 71, 63, and 52 kilodaltons present in the liver and, at lower levels, in some other tissues of the transplacentally infected fetus.

  20. Copy number variation leads to considerable diversity for B but not A haplotypes of the human KIR genes encoding NK cell receptors.

    Science.gov (United States)

    Jiang, Wei; Johnson, Chris; Jayaraman, Jyothi; Simecek, Nikol; Noble, Janelle; Moffatt, Miriam F; Cookson, William O; Trowsdale, John; Traherne, James A

    2012-10-01

    The KIR complex appears to be evolving rapidly in humans, and more than 50 different haplotypes have been described, ranging from four to 14 KIR loci. Previously it has been suggested that most KIR haplotypes consist of framework genes, present in all individuals, which bracket a variable number of other genes. We used a new technique to type 793 families from the United Kingdom and United States for both the presence/absence of all individual KIR genes as well as copy number and found that KIR haplotypes are even more complex. It is striking that all KIR loci are subject to copy number variation (CNV), including the so-called framework genes, but CNV is much more frequent in KIR B haplotypes than KIR A haplotypes. These two basic KIR haplotype groups, A and B, appear to be following different evolutionary trajectories. Despite the great diversity, there are 11 common haplotypes, derived by reciprocal recombination near KIR2DL4, which collectively account for 94% of KIR haplotypes determined in Caucasian samples. These haplotypes could be derived from combinations of just three centromeic and two telomeric motifs, simplifying disease analysis for these haplotypes. The remaining 6% of haplotypes displayed novel examples of expansion and contraction of numbers of loci. Conventional KIR typing misses much of this additional complexity, with important implications for studying the genetics of disease association with KIR that can now be explored by CNV analysis.

  1. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  2. Isolation and characterization of the rat gene encoding glutamate dehydrogenase

    NARCIS (Netherlands)

    Das, A. T.; Arnberg, A. C.; Malingré, H.; Moerer, P.; Charles, R.; Moorman, A. F.; Lamers, W. H.

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  3. Occurrence of enterotoxin-encoding genes in Staphylococcus aureus causing mastitis in lactating goats

    Directory of Open Access Journals (Sweden)

    Daneelly H. Ferreira

    2014-07-01

    Full Text Available Staphylococcal enterotoxins are the leading cause of human food poisoning worldwide. Staphylococcus spp. are the main mastitis-causing agents in goats and frequently found in high counts in goat milk. This study aimed to investigate the occurrence of enterotoxin-encoding genes in Staphylococcus aureus associated with mastitis in lactating goats in Paraiba State, Brazil. Milk samples (n=2024 were collected from 393 farms. Staphylococcus aureus was isolated in 55 milk samples. Classical (sea, seb, sec, sed, see and novel (seg, seh, sei enterotoxin-encoding genes were investigated by means of polymerase chain reaction (PCR. From thirty-six tested isolates, enterotoxin-encoding genes were detected in 7 (19.5% S. aureus. The gene encoding enterotoxin C (seC was identified in six isolates, while seiwas observed in only one isolate. The genes sea, seb, sed, see, seg and seh were not observed amongst the S. aureus investigated in this study. In summary, S. aureus causing mastitis in goats can harbor enterotoxin-encoding genes and seC was the most frequent gene observed amongst the investigated isolates. This finding is important for surveillance purposes, since enterotoxin C should be investigated in human staphylococcal food poisoning outbreaks caused by consumption of goat milk and dairy products.

  4. Enterotoxin-encoding genes in Staphylococcus spp. from bulk goat milk.

    Science.gov (United States)

    Lyra, Daniele G; Sousa, Francisca G C; Borges, Maria F; Givisiez, Patrícia E N; Queiroga, Rita C R E; Souza, Evandro L; Gebreyes, Wondwossen A; Oliveira, Celso J B

    2013-02-01

    Although Staphylococcus aureus has been implicated as the main Staphylococcus species causing human food poisoning, recent studies have shown that coagulase-negative Staphylococcus could also harbor enterotoxin-encoding genes. Such organisms are often present in goat milk and are the most important mastitis-causing agents. Therefore, this study aimed to investigate the occurrence of enterotoxin-encoding genes among coagulase-positive (CoPS) and coagulase-negative (CoNS) staphylococci isolated from raw goat milk produced in the semi-arid region of Paraiba, the most important region for goat milk production in Brazil. Enterotoxin-encoding genes were screened in 74 staphylococci isolates (30 CoPS and 44 CoNS) by polymerase chain reaction targeting the genes sea, seb, sec, sed, see, seg, seh, and sei. Enterotoxin-encoding genes were found in nine (12.2%) isolates, and four different genes (sea, sec, seg, and sei) were identified amongst the isolates. The most frequent genes were seg and sei, which were often found simultaneously in 44.5% of the isolates. The gene sec was the most frequent among the classical genes, and sea was found only in one isolate. All CoPS isolates (n=7) harboring enterotoxigenic genes were identified as S. aureus. The two coagulase-negative isolates were S. haemolyticus and S. hominis subsp. hominis and they harbored sei and sec genes, respectively. A higher frequency of enterotoxin-encoding genes was observed amongst CoPS (23.3%) than CoNS (4.5%) isolates (pgoat milk should not be ignored because it has a higher occurrence in goat milk and enterotoxin-encoding genes were detected in some isolates.

  5. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  6. Immunoglobulin γ light-chain-related genes 14.1 and 16.1 are expressed in pre-B cells and may encode the human immunoglobulin ω light-chain protein

    International Nuclear Information System (INIS)

    Hollis, G.F.; Evans, R.J.; Stafford-Hollis, J.M.; Korsmeyer, S.J.; McKearn, J.P.

    1989-01-01

    Human pre-B cells, which produce immunoglobulin heavy chain but do not produce immunoglobulin light chain, are shown to contain a 1-kilobase transcript homologous to immunoglobulin λ light-chain genes. Detailed analysis of RNA and cDNA clones derived from these transcripts reveals that they originate from the distinct immunoglobulin λ-like genes 14.1/16.1. Sequence analysis of these clones reveals a long open reading frame, beginning with an ATG, capable of encoding a protein of 214 amino acids with an unprocessed molecular weight of 22,944. The C-terminal half of this predicted protein is highly homologous to immunoglobulin λ light-chain joining and constant region protein sequence, while the amino-terminal end does not share homology with variable regions. Antisera raised against a peptide whose sequence was predicted from the 14.1 cDNA sequence identifies a 22-kDa protein in human pre-B cells. Immunoprecipitation of immunoglobulin μ-chain from these pre-B cells with anti-immunoglobulin μ antibody coprecipitates a 22-kDa protein, which is a candidate for the human immunoglobulin ω light-chain protein and may be the protein product of the 14.1/16.1 genes

  7. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  8. CAG-encoded polyglutamine length polymorphism in the human genome

    Directory of Open Access Journals (Sweden)

    Hayden Michael R

    2007-05-01

    Full Text Available Abstract Background Expansion of polyglutamine-encoding CAG trinucleotide repeats has been identified as the pathogenic mutation in nine different genes associated with neurodegenerative disorders. The majority of individuals clinically diagnosed with spinocerebellar ataxia do not have mutations within known disease genes, and it is likely that additional ataxias or Huntington disease-like disorders will be found to be caused by this common mutational mechanism. We set out to determine the length distributions of CAG-polyglutamine tracts for the entire human genome in a set of healthy individuals in order to characterize the nature of polyglutamine repeat length variation across the human genome, to establish the background against which pathogenic repeat expansions can be detected, and to prioritize candidate genes for repeat expansion disorders. Results We found that repeats, including those in known disease genes, have unique distributions of glutamine tract lengths, as measured by fragment analysis of PCR-amplified repeat regions. This emphasizes the need to characterize each distribution and avoid making generalizations between loci. The best predictors of known disease genes were occurrence of a long CAG-tract uninterrupted by CAA codons in their reference genome sequence, and high glutamine tract length variance in the normal population. We used these parameters to identify eight priority candidate genes for polyglutamine expansion disorders. Twelve CAG-polyglutamine repeats were invariant and these can likely be excluded as candidates. We outline some confusion in the literature about this type of data, difficulties in comparing such data between publications, and its application to studies of disease prevalence in different populations. Analysis of Gene Ontology-based functions of CAG-polyglutamine-containing genes provided a visual framework for interpretation of these genes' functions. All nine known disease genes were involved in DNA

  9. Alipogene tiparvovec, an adeno-associated virus encoding the Ser(447)X variant of the human lipoprotein lipase gene for the treatment of patients with lipoprotein lipase deficiency.

    Science.gov (United States)

    Burnett, John R; Hooper, Amanda J

    2009-12-01

    Amsterdam Molecular Therapeutics BV is developing alipogene tiparvovec (Glybera, AMT-011, AAV1-LPLS447X), a Ser(447)X variant of the human lipoprotein lipase (LPL) gene (LPLSer(447)X) in an adeno-associated virus vector, as a potential intramuscular gene therapy for the treatment of LPL deficiency. Familial LPL deficiency is a rare, autosomal-recessive disorder of lipoprotein metabolism that is characterized by severe hypertriglyceridemia with episodes of abdominal pain, acute pancreatitis and eruptive cutaneous xanthomatosis. The lack of functional LPL in patients with LPL deficiency causes an accumulation of triglyceride (TG)-rich lipoproteins in the plasma. The LPLSer(447)X variant is associated with decreased levels of plasma TGs and increased HDL cholesterol concentrations compared with wild-type LPL. Preclinical studies evaluating alipogene tiparvovec in a mouse model of LPL deficiency demonstrated a long-term, dose-dependent correction of the lipid abnormalities. The first clinical trials in patients with LPL deficiency appear promising, with a significant decrease in the levels of plasma TGs observed in the first 3 months following the administration of alipogene tiparvovec, and an increase in local LPL activity and protein levels observed after 6 months. In addition, a decrease in pancreatitis frequency was observed during a 3-year follow-up period. At the time of publication, a phase II/III trial in patients with LPL deficiency, being conducted to further support the submission of an MAA to the EMEA for alipogene tiparvovec, was ongoing. The compound is also under investigation for the treatment of type V hyperlipoproteinemia, Syndrome X and non-alcoholic steatohepatitis.

  10. Gene cluster encoding cholate catabolism in Rhodococcus spp.

    Science.gov (United States)

    Mohn, William W; Wilbrink, Maarten H; Casabon, Israël; Stewart, Gordon R; Liu, Jie; van der Geize, Robert; Eltis, Lindsay D

    2012-12-01

    Bile acids are highly abundant steroids with important functions in vertebrate digestion. Their catabolism by bacteria is an important component of the carbon cycle, contributes to gut ecology, and has potential commercial applications. We found that Rhodococcus jostii RHA1 grows well on cholate, as well as on its conjugates, taurocholate and glycocholate. The transcriptome of RHA1 growing on cholate revealed 39 genes upregulated on cholate, occurring in a single gene cluster. Reverse transcriptase quantitative PCR confirmed that selected genes in the cluster were upregulated 10-fold on cholate versus on cholesterol. One of these genes, kshA3, encoding a putative 3-ketosteroid-9α-hydroxylase, was deleted and found essential for growth on cholate. Two coenzyme A (CoA) synthetases encoded in the cluster, CasG and CasI, were heterologously expressed. CasG was shown to transform cholate to cholyl-CoA, thus initiating side chain degradation. CasI was shown to form CoA derivatives of steroids with isopropanoyl side chains, likely occurring as degradation intermediates. Orthologous gene clusters were identified in all available Rhodococcus genomes, as well as that of Thermomonospora curvata. Moreover, Rhodococcus equi 103S, Rhodococcus ruber Chol-4 and Rhodococcus erythropolis SQ1 each grew on cholate. In contrast, several mycolic acid bacteria lacking the gene cluster were unable to grow on cholate. Our results demonstrate that the above-mentioned gene cluster encodes cholate catabolism and is distinct from a more widely occurring gene cluster encoding cholesterol catabolism.

  11. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    2016-10-26

    Oct 26, 2016 ... The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the.

  12. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  13. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    Cloning, expression and characterisation of a novel gene encoding a chemosensory protein from Bemisia tabaci Gennadius (Hemiptera: Aleyrodidae) ... The BtabCSP amino acid residues deduced from the respective full-length cDNA shares four conserved cysteine motifs with known CSPs from other insects. Homology ...

  14. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  15. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    Molecular cloning and characterization of a gene encoding RING zinc finger ankyrin protein from drought-tolerant Artemisia desertorum. XIUHONG YANG, CHAO SUN, YUANLEI HU and ZHONGPING LIN. *. College of Life Sciences, National Key Laboratory of Protein Engineering and Plant Genetic Engineering, Peking.

  16. Chlorella viruses contain genes encoding a complete polyamine biosynthetic pathway

    Science.gov (United States)

    Baumann, Sascha; Sander, Adrianne; Gurnon, James R.; Yanai-Balser, Giane; VanEtten, James L.; Piotrowski, Markus

    2007-01-01

    Two genes encoding the putative polyamine biosynthetic enzymes agmatine iminohydrolase (AIH) and N-carbamoylputrescine amidohydrolase (CPA) were cloned from the chloroviruses PBCV-1, NY-2A and MT325. They were expressed in Escherichia coli to form C-terminal (His)6-tagged proteins and the recombinant proteins were purified by Ni2+- binding affinity chromatography. The biochemical properties of the two enzymes are similar to AIH and CPA enzymes from Arabidopsis thaliana and Pseudomonas aeruginosa. Together with the previously known virus genes encoding ornithine/arginine decarboxlyase (ODC/ADC) and homospermidine synthase, the chloroviruses have genes that encode a complete set of functional enzymes that synthesize the rare polyamine homospermidine from arginine via agmatine, N-carbamoylputrescine and putrescine. The PBCV-1 aih and cpa genes are expressed early during virus infection together with the odc/adc gene, suggesting that biosynthesis of putrescine is important in early stages of viral replication. The aih and cpa genes are widespread in the chlorella viruses. PMID:17101165

  17. SlgA, encoded by the homolog of the human schizophrenia-associated gene PRODH, acts in clock neurons to regulate Drosophila aggression

    Directory of Open Access Journals (Sweden)

    Liesbeth Zwarts

    2017-06-01

    Full Text Available Mutations in the proline dehydrogenase gene PRODH are linked to behavioral alterations in schizophrenia and as part of DiGeorge and velo-cardio-facial syndromes, but the role of PRODH in their etiology remains unclear. Here, we establish a Drosophila model to study the role of PRODH in behavioral disorders. We determine the distribution of the Drosophila PRODH homolog slgA in the brain and show that knockdown and overexpression of human PRODH and slgA in the lateral neurons ventral (LNv lead to altered aggressive behavior. SlgA acts in an isoform-specific manner and is regulated by casein kinase II (CkII. Our data suggest that these effects are, at least partially, due to effects on mitochondrial function. We thus show that precise regulation of proline metabolism is essential to drive normal behavior and we identify Drosophila aggression as a model behavior relevant for the study of the mechanisms that are impaired in neuropsychiatric disorders.

  18. SlgA, encoded by the homolog of the human schizophrenia-associated genePRODH, acts in clock neurons to regulateDrosophilaaggression.

    Science.gov (United States)

    Zwarts, Liesbeth; Vulsteke, Veerle; Buhl, Edgar; Hodge, James J L; Callaerts, Patrick

    2017-06-01

    Mutations in the proline dehydrogenase gene PRODH are linked to behavioral alterations in schizophrenia and as part of DiGeorge and velo-cardio-facial syndromes, but the role of PRODH in their etiology remains unclear. Here, we establish a Drosophila model to study the role of PRODH in behavioral disorders. We determine the distribution of the Drosophila PRODH homolog slgA in the brain and show that knockdown and overexpression of human PRODH and slgA in the lateral neurons ventral (LNv) lead to altered aggressive behavior. SlgA acts in an isoform-specific manner and is regulated by casein kinase II (CkII). Our data suggest that these effects are, at least partially, due to effects on mitochondrial function. We thus show that precise regulation of proline metabolism is essential to drive normal behavior and we identify Drosophila aggression as a model behavior relevant for the study of the mechanisms that are impaired in neuropsychiatric disorders. © 2017. Published by The Company of Biologists Ltd.

  19. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    this antigen is a good candidate for development as a vaccine to prevent or control P. carinii infection. We have cloned and sequenced seven related but unique genes encoding the major surface glycoprotein of rat P. carinii. Partial amino acid sequencing confirmed the identity of these genes. Based on Southern...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  20. Identification and use of genes encoding amatoxin and phallotoxin

    Energy Technology Data Exchange (ETDEWEB)

    Hallen, Heather E.; Walton, Jonathan D.; Luo, Hong; Scott-Craig, John S.

    2016-12-13

    The present invention relates to compositions and methods comprising genes and peptides associated with cyclic peptide toxins and toxin production in mushrooms. In particular, the present invention relates to using genes and proteins from Amanita species encoding Amanita peptides, specifically relating to amatoxins and phallotoxins. In a preferred embodiment, the present invention also relates to methods for detecting Amanita peptide toxin genes for identifying Amanita peptide-producing mushrooms and for diagnosing suspected cases of mushroom poisoning. Further, the present inventions relate to providing kits for diagnosing and monitoring suspected cases of mushroom poisoning in patients.

  1. Pentocin KCA1: a novel circular bacteriocin gene encoded in the ...

    African Journals Online (AJOL)

    We isolated and carried out comprehensive genome sequence analysis of the first Lactobacillus pentosus KCA1 of human origin encoding genes for the biosynthesis of antimicrobial bacteriocin peptide. Due to the growing number of antimicrobial resistance, the need for developing alternatives to traditional antibiotics is ...

  2. TMC and EVER genes belong to a larger novel family, the TMC gene family encoding transmembrane proteins

    Directory of Open Access Journals (Sweden)

    Mutai Hideki

    2003-06-01

    Full Text Available Abstract Background Mutations in the transmembrane cochlear expressed gene 1 (TMC1 cause deafness in human and mouse. Mutations in two homologous genes, EVER1 and EVER2 increase the susceptibility to infection with certain human papillomaviruses resulting in high risk of skin carcinoma. Here we report that TMC1, EVER1 and EVER2 (now TMC6 and TMC8 belong to a larger novel gene family, which is named TMC for trans membrane channel-like gene family. Results Using a combination of iterative database searches and reverse transcriptase-polymerase chain reaction (RT-PCR experiments we assembled contigs for cDNA encoding human, murine, puffer fish, and invertebrate TMC proteins. TMC proteins of individual species can be grouped into three subfamilies A, B, and C. Vertebrates have eight TMC genes. The majority of murine TMC transcripts are expressed in most organs; some transcripts, however, in particular the three subfamily A members are rare and more restrictively expressed. Conclusion The eight vertebrate TMC genes are evolutionary conserved and encode proteins that form three subfamilies. Invertebrate TMC proteins can also be categorized into these three subfamilies. All TMC genes encode transmembrane proteins with intracellular amino- and carboxyl-termini and at least eight membrane-spanning domains. We speculate that the TMC proteins constitute a novel group of ion channels, transporters, or modifiers of such.

  3. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  4. Identification of a conserved cluster of skin-specific genes encoding secreted proteins.

    Science.gov (United States)

    Moffatt, Pierre; Salois, Patrick; St-Amant, Natalie; Gaumond, Marie-Hélène; Lanctôt, Christian

    2004-06-09

    Terminal differentiation of keratinocytes results in the formation of a cornified layer composed of cross-linked intracellular and extracellular material. Using a signal trap expression screening strategy, we have identified four cDNAs encoding secreted proteins potentially involved in this process. One of the cDNAs is identical to the short isoform of suprabasin, a recently described epidermis-specific protein, which is shown here to contain a functional secretory signal. The second cDNA, sk89, encodes a protein of 493 amino acids, rich in glycine and serine residues. The third cDNA encodes a C-terminal fragment of SK89 (amino acids 410-493). It comprises exons 13 to 18 of the sk89 locus but transcription starts at an isoform-specific exon encoding a distinct secretory signal. The fourth cDNA encodes keratinocyte differentiation-associated protein (KDAP), a precursor protein of 102 amino acids. Subcellular localization by immunofluorescence and detection of the tagged proteins by Western blotting confirmed that the four proteins are secreted. Northern analysis and in situ hybridization revealed that expression of the corresponding genes was restricted to the suprabasal keratinocytes of the epidermis. These genes encoding epidermis-specific secreted products are found in a conserved cluster on human chromosome 19q13.12 and on mouse chromosome 7A3.

  5. Developmentally distinct MYB genes encode functionally equivalent proteins in Arabidopsis.

    Science.gov (United States)

    Lee, M M; Schiefelbein, J

    2001-05-01

    The duplication and divergence of developmental control genes is thought to have driven morphological diversification during the evolution of multicellular organisms. To examine the molecular basis of this process, we analyzed the functional relationship between two paralogous MYB transcription factor genes, WEREWOLF (WER) and GLABROUS1 (GL1), in Arabidopsis. The WER and GL1 genes specify distinct cell types and exhibit non-overlapping expression patterns during Arabidopsis development. Nevertheless, reciprocal complementation experiments with a series of gene fusions showed that WER and GL1 encode functionally equivalent proteins, and their unique roles in plant development are entirely due to differences in their cis-regulatory sequences. Similar experiments with a distantly related MYB gene (MYB2) showed that its product cannot functionally substitute for WER or GL1. Furthermore, an analysis of the WER and GL1 proteins shows that conserved sequences correspond to specific functional domains. These results provide new insights into the evolution of the MYB gene family in Arabidopsis, and, more generally, they demonstrate that novel developmental gene function may arise solely by the modification of cis-regulatory sequences.

  6. Enhancement of antitumor activity by using a fully human gene encoding a single-chain fragmented antibody specific for carcinoembryonic antigen

    Directory of Open Access Journals (Sweden)

    Shibaguchi H

    2017-08-01

    Full Text Available Hirotomo Shibaguchi,1,* Naixiang Luo,1,* Naoto Shirasu,1,* Motomu Kuroki,2 Masahide Kuroki1 1Department of Biochemistry, Faculty of Medicine, Fukuoka University, Fukuoka, Japan; 2School of Nursing, Faculty of Medicine, Fukuoka University, Fukuoka, Japan *These authors equally contributed to this work Abstract: Human leukocyte antigen and/or costimulatory molecules are frequently lacking in metastatic tumor cells, and thus tumor cells are able to escape from the immune system. Although lymphocytes with a chimeric antigen receptor (CAR is a promising approach for overcoming this challenge in cancer immunotherapy, administration of modified T cells alone often demonstrates little efficacy in patients. Therefore, in order to enhance the antitumor activity of immune cells in the cancer microenvironment, we used lymphocytes expressing CAR in combination with a fusion protein of IL-2 that contained the single-chain fragmented antibody (scFv specific for the carcinoembryonic antigen. Among a series of CAR constructs, with or without a spacer and the intracellular domain of CD28, the CAR construct containing CD8α, CD28, and CD3ζ most effectively activated and expressed INF-γ in CAR-bearing T cells. Furthermore, in comparison with free IL-2, the combination of peripheral blood mononuclear cells expressing CAR and the fusion protein containing IL-2 significantly enhanced the antitumor activity against MKN-45 cells, a human gastric cancer cell line. In conclusion, this novel combination therapy of CAR and a fusion protein consisting of a functional cytokine and a fully human scFv may be a promising approach for adoptive cancer immunotherapy. Keywords: chimeric antigen receptor, fusion protein, human scFv, CEA, combination therapy

  7. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  8. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  9. Enhancement of antitumor activity by using a fully human gene encoding a single-chain fragmented antibody specific for carcinoembryonic antigen

    Science.gov (United States)

    Kuroki, Motomu; Kuroki, Masahide

    2017-01-01

    Human leukocyte antigen and/or costimulatory molecules are frequently lacking in metastatic tumor cells, and thus tumor cells are able to escape from the immune system. Although lymphocytes with a chimeric antigen receptor (CAR) is a promising approach for overcoming this challenge in cancer immunotherapy, administration of modified T cells alone often demonstrates little efficacy in patients. Therefore, in order to enhance the antitumor activity of immune cells in the cancer microenvironment, we used lymphocytes expressing CAR in combination with a fusion protein of IL-2 that contained the single-chain fragmented antibody (scFv) specific for the carcinoembryonic antigen. Among a series of CAR constructs, with or without a spacer and the intracellular domain of CD28, the CAR construct containing CD8α, CD28, and CD3ζ most effectively activated and expressed INF-γ in CAR-bearing T cells. Furthermore, in comparison with free IL-2, the combination of peripheral blood mononuclear cells expressing CAR and the fusion protein containing IL-2 significantly enhanced the antitumor activity against MKN-45 cells, a human gastric cancer cell line. In conclusion, this novel combination therapy of CAR and a fusion protein consisting of a functional cytokine and a fully human scFv may be a promising approach for adoptive cancer immunotherapy. PMID:28860806

  10. DNA methylation status of nuclear-encoded mitochondrial genes underlies the tissue-dependent mitochondrial functions

    Directory of Open Access Journals (Sweden)

    Takasugi Masaki

    2010-08-01

    Full Text Available Abstract Background Mitochondria are semi-autonomous, semi-self-replicating organelles harboring their own DNA (mitochondrial DNA, mtDNA, and their dysregulation is involved in the development of various diseases. While mtDNA does not generally undergo epigenetic modifications, almost all mitochondrial proteins are encoded by nuclear DNA. However, the epigenetic regulation of nuclear-encoded mitochondrial genes (nuclear mt genes has not been comprehensively analyzed. Results We analyzed the DNA methylation status of 899 nuclear mt genes in the liver, brain, and heart tissues of mouse, and identified 636 nuclear mt genes carrying tissue-dependent and differentially methylated regions (T-DMRs. These nuclar mt genes are involved in various mitochondrial functions and they also include genes related to human diseases. T-DMRs regulate the expression of nuclear mt genes. Nuclear mt genes with tissue-specific hypomethylated T-DMRs were characterized by enrichment of the target genes of specific transcription factors such as FOXA2 in the liver, and CEBPA and STAT1 in the brain. Conclusions A substantial proportion of nuclear mt genes contained T-DMRs, and the DNA methylation status of numerous T-DMRs should underlie tissue-dependent mitochondrial functions.

  11. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  12. A subset of group A-like var genes encodes the malaria parasite ligands for binding to human brain endothelial cells

    DEFF Research Database (Denmark)

    Claessens, Antoine; Adams, Yvonne; Ghumra, Ashfaq

    2012-01-01

    Cerebral malaria is the most deadly manifestation of infection with Plasmodium falciparum. The pathology of cerebral malaria is characterized by the accumulation of infected erythrocytes (IEs) in the microvasculature of the brain caused by parasite adhesins on the surface of IEs binding to human...... of these variants. The clinical in vivo relevance of the HBEC-selected parasites was supported by significantly higher surface recognition of HBEC-selected parasites compared with unselected parasites by antibodies from young African children suffering cerebral malaria (Mann-Whitney test, P = 0.......029) but not by antibodies from controls with uncomplicated malaria (Mann-Whitney test, P = 0.58). This work describes a binding phenotype for virulence-associated group A P. falciparum erythrocyte membrane protein 1 variants and identifies targets for interventions to treat or prevent cerebral malaria....

  13. Human Lacrimal Gland Gene Expression.

    Directory of Open Access Journals (Sweden)

    Vinay Kumar Aakalu

    Full Text Available The study of human lacrimal gland biology and development is limited. Lacrimal gland tissue is damaged or poorly functional in a number of disease states including dry eye disease. Development of cell based therapies for lacrimal gland diseases requires a better understanding of the gene expression and signaling pathways in lacrimal gland. Differential gene expression analysis between lacrimal gland and other embryologically similar tissues may be helpful in furthering our understanding of lacrimal gland development.We performed global gene expression analysis of human lacrimal gland tissue using Affymetrix ® gene expression arrays. Primary data from our laboratory was compared with datasets available in the NLM GEO database for other surface ectodermal tissues including salivary gland, skin, conjunctiva and corneal epithelium.The analysis revealed statistically significant difference in the gene expression of lacrimal gland tissue compared to other ectodermal tissues. The lacrimal gland specific, cell surface secretory protein encoding genes and critical signaling pathways which distinguish lacrimal gland from other ectodermal tissues are described.Differential gene expression in human lacrimal gland compared with other ectodermal tissue types revealed interesting patterns which may serve as the basis for future studies in directed differentiation among other areas.

  14. Variation in genes encoding eosinophil granule proteins in atopic dermatitis patients from Germany

    Directory of Open Access Journals (Sweden)

    Epplen Jörg T

    2008-11-01

    Full Text Available Abstract Background Atopic dermatitis (AD is believed to result from complex interactions between genetic and environmental factors. A main feature of AD as well as other allergic disorders is serum and tissue eosinophilia. Human eosinophils contain high amounts of cationic granule proteins, including eosinophil cationic protein (ECP, eosinophil-derived neurotoxin (EDN, eosinophil peroxidase (EPO and major basic protein (MBP. Recently, variation in genes encoding eosinophil granule proteins has been suggested to play a role in the pathogenesis of allergic disorders. We therefore genotyped selected single nucleotide polymorphisms within the ECP, EDN, EPO and MBP genes in a cohort of 361 German AD patients and 325 healthy controls. Results Genotype and allele frequencies did not differ between patients and controls for all polymorphisms investigated in this study. Haplotype analysis did not reveal any additional information. Conclusion We did not find evidence to support an influence of variation in genes encoding eosinophil granule proteins for AD pathogenesis in this German cohort.

  15. Enhanced anti-tumor effect of a gene gun-delivered DNA vaccine encoding the human papillomavirus type 16 oncoproteins genetically fused to the herpes simplex virus glycoprotein D

    Directory of Open Access Journals (Sweden)

    M.O. Diniz

    2011-05-01

    Full Text Available Anti-cancer DNA vaccines have attracted growing interest as a simple and non-invasive method for both the treatment and prevention of tumors induced by human papillomaviruses. Nonetheless, the low immunogenicity of parenterally administered vaccines, particularly regarding the activation of cytotoxic CD8+ T cell responses, suggests that further improvements in both vaccine composition and administration routes are still required. In the present study, we report the immune responses and anti-tumor effects of a DNA vaccine (pgD-E7E6E5 expressing three proteins (E7, E6, and E5 of the human papillomavirus type 16 genetically fused to the glycoprotein D of the human herpes simplex virus type 1, which was administered to mice by the intradermal (id route using a gene gun. A single id dose of pgD-E7E6E5 (2 µg/dose induced a strong activation of E7-specific interferon-γ (INF-γ-producing CD8+ T cells and full prophylactic anti-tumor effects in the vaccinated mice. Three vaccine doses inhibited tumor growth in 70% of the mice with established tumors. In addition, a single vaccine dose consisting of the co-administration of pgD-E7E6E5 and the vector encoding interleukin-12 or granulocyte-macrophage colony-stimulating factor further enhanced the therapeutic anti-tumor effects and conferred protection to 60 and 50% of the vaccinated mice, respectively. In conclusion, id administration of pgD-E7E6E5 significantly enhanced the immunogenicity and anti-tumor effects of the DNA vaccine, representing a promising administration route for future clinical trials.

  16. The insect metalloproteinase inhibitor gene of the lepidopteran Galleria mellonella encodes two distinct inhibitors.

    Science.gov (United States)

    Wedde, Marianne; Weise, Christoph; Nuck, Rolf; Altincicek, Boran; Vilcinskas, Andreas

    2007-01-01

    The insect metalloproteinase inhibitor (IMPI) from the greater wax moth, Galleria mellonella, represents the first and to date only specific inhibitor of microbial metalloproteinases reported from animals. Here, we report on the characterization including carbohydrate analysis of two recombinant constructs encoded by impi cDNA either upstream or downstream of the furin cleavage site identified. rIMPI-1, corresponding to native IMPI purified from hemolymph, is encoded by the N-terminal part of the impi sequence, whereas rIMPI-2 is encoded by its C-terminal part. rIMPI-1 is glycosylated at N48 with GlcNAc2Man3, showing fucosylation to different extents. Similarly, rIMPI-2 is glycosylated at N149 with GlcNAc2Man3, but is fully fucosylated. rIMPI-1 represents a promising template for the design of second-generation antibiotics owing to its specific activity against thermolysin-like metalloproteinases produced by human pathogenic bacteria such as Vibrio vulnificus. In contrast, rIMPI-2 does not inhibit bacterial metalloproteinases, but is moderately active against recombinant human matrix metalloproteinases (MMPs). Both microbial metalloproteinases and MMPs induce expression of the impi gene when injected into G. mellonella larvae. These findings provide evidence that the impi gene encodes two distinct inhibitors, one inhibiting microbial metalloproteinases and contributing to innate immunity, the other putatively mediating regulation of endogenous MMPs during metamorphosis.

  17. Genomewide analysis of NBS-encoding genes in kiwi fruit (Actinidia ...

    Indian Academy of Sciences (India)

    YINGJUN LI

    Identification of NBS-encodings and gene family classification of kiwi fruit. Kiwi fruit (A. chinensis) assembly and annotation ... There were three criteria to classify gene family. Both the coverage (aligned sequence/gene lengths) and iden- ... Number of identified NBS-encoding genes in kiwi fruit. Predicted protein domain.

  18. Human gene essentiality.

    Science.gov (United States)

    Bartha, István; di Iulio, Julia; Venter, J Craig; Telenti, Amalio

    2018-01-01

    A gene can be defined as essential when loss of its function compromises viability of the individual (for example, embryonic lethality) or results in profound loss of fitness. At the population level, identification of essential genes is accomplished by observing intolerance to loss-of-function variants. Several computational methods are available to score gene essentiality, and recent progress has been made in defining essentiality in the non-coding genome. Haploinsufficiency is emerging as a critical aspect of gene essentiality: approximately 3,000 human genes cannot tolerate loss of one of the two alleles. Genes identified as essential in human cell lines or knockout mice may be distinct from those in living humans. Reconciling these discrepancies in how we evaluate gene essentiality has applications in clinical genetics and may offer insights for drug development.

  19. Cloning human DNA repair genes

    International Nuclear Information System (INIS)

    Jeggo, P.A.; Carr, A.M.; Lehmann, A.R.

    1994-01-01

    Many human genes involved in the repair of UV damage have been cloned using different procedures and they have been of great value in assisting the understanding of the mechanism of nucleotide excision-repair. Genes involved in repair of ionizing radiation damage have proved more difficult to isolate. Positional cloning has localized the XRCC5 gene to a small region of chromosome 2q33-35, and a series of yeast artificial chromosomes covering this region have been isolated. Very recent work has shown that the XRCC5 gene encodes the 80 kDa subunit of the Ku DNA-binding protein. The Ku80 gene also maps to this region. Studies with fission yeast have shown that radiation sensitivity can result not only from defective DNA repair but also from abnormal cell cycle control following DNA damage. Several genes involved in this 'check-point' control in fission yeast have been isolated and characterized in detail. It is likely that a similar checkpoint control mechanism exists in human cells. (author)

  20. Co-transcriptional folding is encoded within RNA genes

    Directory of Open Access Journals (Sweden)

    Miklós István

    2004-08-01

    Full Text Available Abstract Background Most of the existing RNA structure prediction programs fold a completely synthesized RNA molecule. However, within the cell, RNA molecules emerge sequentially during the directed process of transcription. Dedicated experiments with individual RNA molecules have shown that RNA folds while it is being transcribed and that its correct folding can also depend on the proper speed of transcription. Methods The main aim of this work is to study if and how co-transcriptional folding is encoded within the primary and secondary structure of RNA genes. In order to achieve this, we study the known primary and secondary structures of a comprehensive data set of 361 RNA genes as well as a set of 48 RNA sequences that are known to differ from the originally transcribed sequence units. We detect co-transcriptional folding by defining two measures of directedness which quantify the extend of asymmetry between alternative helices that lie 5' and those that lie 3' of the known helices with which they compete. Results We show with statistical significance that co-transcriptional folding strongly influences RNA sequences in two ways: (1 alternative helices that would compete with the formation of the functional structure during co-transcriptional folding are suppressed and (2 the formation of transient structures which may serve as guidelines for the co-transcriptional folding pathway is encouraged. Conclusions These findings have a number of implications for RNA secondary structure prediction methods and the detection of RNA genes.

  1. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    Escherichia coli was isolated and identified by standard cultural and biochemical methods. Pathogenicity of environmental and human isolates was determined by amplification of genes associated with virulence of E. coli, using specific primers. Of a total of 228 water and river sediment samples screened, E. coli was ...

  2. Cloning of the mouse cDNA encoding DNA topoisomerase I and chromosomal location of the gene.

    Science.gov (United States)

    Koiwai, O; Yasui, Y; Sakai, Y; Watanabe, T; Ishii, K; Yanagihara, S; Andoh, T

    1993-03-30

    The mouse cDNA encoding DNA topoisomerase I (TopoI) was cloned and the nucleotide sequence of 3512 bp was determined. The cDNA clone contained an open reading frame encoding a protein of 767 amino acids (aa), which is 2 aa longer than its human counterpart. Overall aa sequence homology between the mouse and human, and between the mouse and yeast (Saccharomyces cerevisiae) sequences was 96% and 42%, respectively. The mouse TopI gene was mapped at position 54.5 on chromosome 2 from linkage analyses of a three-point cross test with Geg, Ada, and a as marker genes.

  3. Isolated gene encoding an enzyme with UDP-glucose pyrophosphorylase and phosphoglucomutase activities from Cyclotella cryptica

    Science.gov (United States)

    Jarvis, Eric E.; Roessler, Paul G.

    1999-01-01

    The present invention relates to a cloned gene which encodes an enzyme, the purified enzyme, and the applications and products resulting from the use of the gene and enzyme. The gene, isolated from Cyclotella cryptica, encodes a multifunctional enzyme that has both UDP-glucose pyrophosphorylase and phosphoglucomutase activities.

  4. Human proton/oligopeptide transporter (POT) genes

    DEFF Research Database (Denmark)

    Botka, C. W.; Wittig, T. W.; Graul, R. C.

    2000-01-01

    The proton-dependent oligopeptide transporters (POT) gene family currently consists of approximately 70 cloned cDNAs derived from diverse organisms. In mammals, two genes encoding peptide transporters, PepT1 and PepT2 have been cloned in several species including humans, in addition to a rat...... histidine/peptide transporter (rPHT1). Because the Candida elegans genome contains five putative POT genes, we searched the available protein and nucleic acid databases for additional mammalian/human POT genes, using iterative BLAST runs and the human expressed sequence tags (EST) database. The apparent...... and introns of the likely human orthologue (termed hPHT2). Northern analyses with EST clones indicated that hPHT1 is primarily expressed in skeletal muscle and spleen, whereas hPHT2 is found in spleen, placenta, lung, leukocytes, and heart. These results suggest considerable complexity of the human POT gene...

  5. Genomics of the human carnitine acyltransferase genes

    NARCIS (Netherlands)

    van der Leij, FR; Huijkman, NCA; Boomsma, C; Kuipers, JRG; Bartelds, B

    2000-01-01

    Five genes in the human genome are known to encode different active forms of related carnitine acyltransferases: CPT1A for liver-type carnitine palmitoyltransferase I, CPT1B for muscle-type carnitine palmitoyltransferase I, CPT2 for carnitine palmitoyltransferase II, CROT for carnitine

  6. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...

  7. Intonational speech prosody encoding in the human auditory cortex.

    Science.gov (United States)

    Tang, C; Hamilton, L S; Chang, E F

    2017-08-25

    Speakers of all human languages regularly use intonational pitch to convey linguistic meaning, such as to emphasize a particular word. Listeners extract pitch movements from speech and evaluate the shape of intonation contours independent of each speaker's pitch range. We used high-density electrocorticography to record neural population activity directly from the brain surface while participants listened to sentences that varied in intonational pitch contour, phonetic content, and speaker. Cortical activity at single electrodes over the human superior temporal gyrus selectively represented intonation contours. These electrodes were intermixed with, yet functionally distinct from, sites that encoded different information about phonetic features or speaker identity. Furthermore, the representation of intonation contours directly reflected the encoding of speaker-normalized relative pitch but not absolute pitch. Copyright © 2017 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  8. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  9. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  10. [ENCODE apophenia or a panglossian analysis of the human genome].

    Science.gov (United States)

    Casane, Didier; Fumey, Julien; Laurenti, Patrick

    2015-01-01

    In September 2012, a batch of more than 30 articles presenting the results of the ENCODE (Encyclopaedia of DNA Elements) project was released. Many of these articles appeared in Nature and Science, the two most prestigious interdisciplinary scientific journals. Since that time, hundreds of other articles dedicated to the further analyses of the Encode data have been published. The time of hundreds of scientists and hundreds of millions of dollars were not invested in vain since this project had led to an apparent paradigm shift: contrary to the classical view, 80% of the human genome is not junk DNA, but is functional. This hypothesis has been criticized by evolutionary biologists, sometimes eagerly, and detailed refutations have been published in specialized journals with impact factors far below those that published the main contribution of the Encode project to our understanding of genome architecture. In 2014, the Encode consortium released a new batch of articles that neither suggested that 80% of the genome is functional nor commented on the disappearance of their 2012 scientific breakthrough. Unfortunately, by that time many biologists had accepted the idea that 80% of the genome is functional, or at least, that this idea is a valid alternative to the long held evolutionary genetic view that it is not. In order to understand the dynamics of the genome, it is necessary to re-examine the basics of evolutionary genetics because, not only are they well established, they also will allow us to avoid the pitfall of a panglossian interpretation of Encode. Actually, the architecture of the genome and its dynamics are the product of trade-offs between various evolutionary forces, and many structural features are not related to functional properties. In other words, evolution does not produce the best of all worlds, not even the best of all possible worlds, but only one possible world. © 2015 médecine/sciences – Inserm.

  11. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  12. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa

    2010-01-01

    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  13. Human housekeeping genes, revisited.

    Science.gov (United States)

    Eisenberg, Eli; Levanon, Erez Y

    2013-10-01

    Housekeeping genes are involved in basic cell maintenance and, therefore, are expected to maintain constant expression levels in all cells and conditions. Identification of these genes facilitates exposure of the underlying cellular infrastructure and increases understanding of various structural genomic features. In addition, housekeeping genes are instrumental for calibration in many biotechnological applications and genomic studies. Advances in our ability to measure RNA expression have resulted in a gradual increase in the number of identified housekeeping genes. Here, we describe housekeeping gene detection in the era of massive parallel sequencing and RNA-seq. We emphasize the importance of expression at a constant level and provide a list of 3804 human genes that are expressed uniformly across a panel of tissues. Several exceptionally uniform genes are singled out for future experimental use, such as RT-PCR control genes. Finally, we discuss both ways in which current technology can meet some of past obstacles encountered, and several as yet unmet challenges. Copyright © 2013 Elsevier Ltd. All rights reserved.

  14. A human RNA polymerase II subunit is encoded by a recently generated multigene family

    Directory of Open Access Journals (Sweden)

    Mattei Marie-Geneviève

    2001-11-01

    Full Text Available Abstract Background The sequences encoding the yeast RNA polymerase II (RPB subunits are single copy genes. Results While those characterized so far for the human (h RPB are also unique, we show that hRPB subunit 11 (hRPB11 is encoded by a multigene family, mapping on chromosome 7 at loci p12, q11.23 and q22. We focused on two members of this family, hRPB11a and hRPB11b: the first encodes subunit hRPB11a, which represents the major RPB11 component of the mammalian RPB complex ; the second generates polypeptides hRPB11bα and hRPB11bβ through differential splicing of its transcript and shares homologies with components of the hPMS2L multigene family related to genes involved in mismatch-repair functions (MMR. Both hRPB11a and b genes are transcribed in all human tissues tested. Using an inter-species complementation assay, we show that only hRPB11bα is functional in yeast. In marked contrast, we found that the unique murine homolog of RPB11 gene maps on chromosome 5 (band G, and encodes a single polypeptide which is identical to subunit hRPB11a. Conclusions The type hRPB11b gene appears to result from recent genomic recombination events in the evolution of primates, involving sequence elements related to the MMR apparatus.

  15. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  16. Dynamic encoding of speech sequence probability in human temporal cortex.

    Science.gov (United States)

    Leonard, Matthew K; Bouchard, Kristofer E; Tang, Claire; Chang, Edward F

    2015-05-06

    Sensory processing involves identification of stimulus features, but also integration with the surrounding sensory and cognitive context. Previous work in animals and humans has shown fine-scale sensitivity to context in the form of learned knowledge about the statistics of the sensory environment, including relative probabilities of discrete units in a stream of sequential auditory input. These statistics are a defining characteristic of one of the most important sequential signals humans encounter: speech. For speech, extensive exposure to a language tunes listeners to the statistics of sound sequences. To address how speech sequence statistics are neurally encoded, we used high-resolution direct cortical recordings from human lateral superior temporal cortex as subjects listened to words and nonwords with varying transition probabilities between sound segments. In addition to their sensitivity to acoustic features (including contextual features, such as coarticulation), we found that neural responses dynamically encoded the language-level probability of both preceding and upcoming speech sounds. Transition probability first negatively modulated neural responses, followed by positive modulation of neural responses, consistent with coordinated predictive and retrospective recognition processes, respectively. Furthermore, transition probability encoding was different for real English words compared with nonwords, providing evidence for online interactions with high-order linguistic knowledge. These results demonstrate that sensory processing of deeply learned stimuli involves integrating physical stimulus features with their contextual sequential structure. Despite not being consciously aware of phoneme sequence statistics, listeners use this information to process spoken input and to link low-level acoustic representations with linguistic information about word identity and meaning. Copyright © 2015 the authors 0270-6474/15/357203-12$15.00/0.

  17. The Lethal Toxin from Australian Funnel-Web Spiders Is Encoded by an Intronless Gene

    Science.gov (United States)

    Pineda, Sandy Steffany; Wilson, David; Mattick, John S.; King, Glenn F.

    2012-01-01

    Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome. PMID:22928020

  18. The lethal toxin from Australian funnel-web spiders is encoded by an intronless gene.

    Directory of Open Access Journals (Sweden)

    Sandy Steffany Pineda

    Full Text Available Australian funnel-web spiders are generally considered the most dangerous spiders in the world, with envenomations from the Sydney funnel-web spider Atrax robustus resulting in at least 14 human fatalities prior to the introduction of an effective anti-venom in 1980. The clinical envenomation syndrome resulting from bites by Australian funnel-web spiders is due to a single 42-residue peptide known as δ-hexatoxin. This peptide delays the inactivation of voltage-gated sodium channels, which results in spontaneous repetitive firing and prolongation of action potentials, thereby causing massive neurotransmitter release from both somatic and autonomic nerve endings. Here we show that δ-hexatoxin from the Australian funnel-web spider Hadronyche versuta is produced from an intronless gene that encodes a prepropeptide that is post-translationally processed to yield the mature toxin. A limited sampling of genes encoding unrelated venom peptides from this spider indicated that they are all intronless. Thus, in distinct contrast to cone snails and scorpions, whose toxin genes contain introns, spiders may have developed a quite different genetic strategy for evolving their venom peptidome.

  19. Cis and trans interactions between genes encoding PAF1 complex and ESCRT machinery components in yeast.

    Science.gov (United States)

    Rodrigues, Joana; Lydall, David

    2018-03-22

    Saccharomyces cerevisiae is a commonly used model organism for understanding eukaryotic gene function. However, the close proximity between yeast genes can complicate the interpretation of yeast genetic data, particularly high-throughput data. In this study, we examined the interplay between genes encoding components of the PAF1 complex and VPS36, the gene located next to CDC73 on chromosome XII. The PAF1 complex (Cdc73, Paf1, Ctr9, Leo1, and Rtf1, in yeast) affects RNA levels by affecting transcription, histone modifications, and post-transcriptional RNA processing. The human PAF1 complex is linked to cancer, and in yeast, it has been reported to play a role in telomere biology. Vps36, part of the ESCRT-II complex, is involved in sorting proteins for vacuolar/lysosomal degradation. We document a complex set of genetic interactions, which include an adjacent gene effect between CDC73 and VPS36 and synthetic sickness between vps36Δ and cdc73Δ, paf1Δ, or ctr9Δ. Importantly, paf1Δ and ctr9Δ are synthetically lethal with deletions of other components of the ESCRT-II (SNF8 and VPS25), ESCRT-I (STP22), or ESCRT-III (SNF7) complexes. We found that RNA levels of VPS36, but not other ESCRT components, are positively regulated by all components of the PAF1 complex. Finally, we show that deletion of ESCRT components decreases the telomere length in the S288C yeast genetic background, but not in the W303 background. Together, our results outline complex interactions, in cis and in trans, between genes encoding PAF1 and ESCRT-II complex components that affect telomere function and cell viability in yeast.

  20. Potential transfer of extended spectrum β-lactamase encoding gene, blashv18 gene, between Klebsiella pneumoniae in raw foods.

    Science.gov (United States)

    Jung, Yangjin; Matthews, Karl R

    2016-12-01

    This study investigated the transfer frequency of the extended-spectrum β-lactamase-encoding gene (blaSHV18) among Klebsiella pneumoniae in tryptic soy broth (TSB), pasteurized milk, unpasteurized milk, alfalfa sprouts and chopped lettuce at defined temperatures. All transconjugants were characterized phenotypically and genotypically. KP04(ΔKM) and KP08(ΔKM) isolated from seed sprouts and KP342 were used as recipients in mating experiments with K. pneumoniae ATCC 700603 serving as the donor. In mating experiments, no transconjugants were detected at 4 °C in liquid media or chopped lettuce, but detected in all media tested at 15 °C, 24 °C, and 37 °C. At 24 °C, the transfer of blaSHV18 gene occurred more frequently in alfalfa sprouts (5.15E-04 transconjugants per recipient) and chopped lettuce (3.85E-05) than liquid media (1.08E-05). On chopped lettuce, transconjugants were not detected at day 1 post-mating at 15 °C, but observed on day 2 (1.43E-05). Transconjugants carried the blaSHV18 gene transferred from the donor and the virulence gene harbored by recipient. More importantly, a class 1 integrase gene and resistance to tetracycline, trimethoprim/sulfamethoxazole were co-transferred during mating. These quantitative results suggest that fresh produce exposed to temperature abuse may serve as a competent vehicle for the spread of gene encoding for antibiotic resistance, having a potential negative impact on human health. Copyright © 2016 Elsevier Ltd. All rights reserved.

  1. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  2. Lateral gene transfer of streptococcal ICE element RD2 (region of difference 2 encoding secreted proteins

    Directory of Open Access Journals (Sweden)

    Mereghetti Laurent

    2011-04-01

    Full Text Available Abstract Background The genome of serotype M28 group A Streptococcus (GAS strain MGAS6180 contains a novel genetic element named Region of Difference 2 (RD2 that encodes seven putative secreted extracellular proteins. RD2 is present in all serotype M28 strains and strains of several other GAS serotypes associated with female urogenital infections. We show here that the GAS RD2 element is present in strain MGAS6180 both as an integrative chromosomal form and a circular extrachromosomal element. RD2-like regions were identified in publicly available genome sequences of strains representing three of the five major group B streptococcal serotypes causing human disease. Ten RD2-encoded proteins have significant similarity to proteins involved in conjugative transfer of Streptococcus thermophilus integrative chromosomal elements (ICEs. Results We transferred RD2 from GAS strain MGAS6180 (serotype M28 to serotype M1 and M4 GAS strains by filter mating. The copy number of the RD2 element was rapidly and significantly increased following treatment of strain MGAS6180 with mitomycin C, a DNA damaging agent. Using a PCR-based method, we also identified RD2-like regions in multiple group C and G strains of Streptococcus dysgalactiae subsp.equisimilis cultured from invasive human infections. Conclusions Taken together, the data indicate that the RD2 element has disseminated by lateral gene transfer to genetically diverse strains of human-pathogenic streptococci.

  3. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  4. A brief review on the Human Encyclopedia of DNA Elements (ENCODE) project.

    Science.gov (United States)

    Qu, Hongzhu; Fang, Xiangdong

    2013-06-01

    The ENCyclopedia Of DNA Elements (ENCODE) project is an international research consortium that aims to identify all functional elements in the human genome sequence. The second phase of the project comprised 1640 datasets from 147 different cell types, yielding a set of 30 publications across several journals. These data revealed that 80.4% of the human genome displays some functionality in at least one cell type. Many of these regulatory elements are physically associated with one another and further form a network or three-dimensional conformation to affect gene expression. These elements are also related to sequence variants associated with diseases or traits. All these findings provide us new insights into the organization and regulation of genes and genome, and serve as an expansive resource for understanding human health and disease. Copyright © 2013. Production and hosting by Elsevier Ltd.

  5. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...

  6. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  7. Human Gene Therapy: Genes without Frontiers?

    Science.gov (United States)

    Simon, Eric J.

    2002-01-01

    Describes the latest advancements and setbacks in human gene therapy to provide reference material for biology teachers to use in their science classes. Focuses on basic concepts such as recombinant DNA technology, and provides examples of human gene therapy such as severe combined immunodeficiency syndrome, familial hypercholesterolemia, and…

  8. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  9. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-06-07

    Jun 7, 2010 ... synthase (crtB), phytoene desaturase (crtL) and lycopene cyclase. (crtY). It also retains a chloramphenicol resistance gene. Cells of E. coli containing this plasmid produce and accumulate β-carotene, resulting in yellow colonies. The plasmid, pTrc-ATIPI, retains an ampicillin resistance gene and an IPI gene ...

  10. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Peanut Ubiquitin gene (Luo et al. 2005) was used as the internal control. Expression data of the target gene was normalized with internal control using the 2. –ΔΔCT method (Livak and Schmittgen 2001). Lysophosphatidyl acyltransferase gene from Arachis hypogaea. 1031. J. Biosci. 37(6), December 2012 ...

  11. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  12. In silicio search for genes encoding peroxisomal proteins in Saccharomyces cerevisiae.

    Science.gov (United States)

    Kal, A J; Hettema, E H; van den Berg, M; Koerkamp, M G; van Ijlst, L; Distel, B; Tabak, H F

    2000-01-01

    The biogenesis of peroxisomes involves the synthesis of new proteins that after, completion of translation, are targeted to the organelle by virtue of peroxisomal targeting signals (PTS). Two types of PTSs have been well characterized for import of matrix proteins (PTS1 and PTS2). Induction of the genes encoding these matrix proteins takes place in oleate-containing medium and is mediated via an oleate response element (ORE) present in the region preceding these genes. The authors have searched the yeast genome for OREs preceding open reading frames (ORFs), and for ORFs that contain either a PTS1 or PTS2. Of the ORFs containing an ORE, as well as either a PTS1 or a PTS2, many were known to encode bona fide peroxisomal matrix proteins. In addition, candidate genes were identified as encoding putative new peroxisomal proteins. For one case, subcellular location studies validated the in silicio prediction. This gene encodes a new peroxisomal thioesterase.

  13. Effect of salt stress on genes encoding translation-associated proteins in Arabidopsis thaliana.

    Science.gov (United States)

    Omidbakhshfard, Mohammad Amin; Omranian, Nooshin; Ahmadi, Farajollah Shahriari; Nikoloski, Zoran; Mueller-Roeber, Bernd

    2012-09-01

    Salinity negatively affects plant growth and disturbs chloroplast integrity. Here, we aimed at identifying salt-responsive translation-related genes in Arabidopsis thaliana with an emphasis on those encoding plastid-located proteins. We used quantitative real-time PCR to test the expression of 170 genes after short-term salt stress (up to 24 h) and identified several genes affected by the stress including: PRPL11, encoding plastid ribosomal protein L11, ATAB2, encoding a chloroplast-located RNA-binding protein presumably functioning as an activator of translation, and PDF1B, encoding a peptide deformylase involved in N-formyl group removal from nascent proteins synthesized in chloroplasts. These genes were previously shown to have important functions in chloroplast biology and may therefore represent new targets for biotechnological optimization of salinity tolerance.

  14. Frequency encoded optical assessment of human retinal physiology

    Science.gov (United States)

    Leitgeb, Rainer A.; Michaely, Roland; Bachmann, Adrian; Lassner, Theo; Blatter, Cedric

    2008-02-01

    We demonstrate in-vivo functional imaging of the human retina with Fourier domain optical coherence tomography employing frequency encoding of an excitation pattern. The principle is based on projecting a modulated rectangular pattern across the foveal region and acquiring a time series of B-Scans at the same vertical position across the pattern. The idea is to modulate the excitation with a frequency that is distinct from the heartbeat and irregular motion artifacts. Fourier analysis of the time series at each transverse position in the B-scan series allows assessing the retinal response as change in the FDOCT reflectivity signal exactly at the pattern modulation frequency. We observe a change in retinal reflectivity within the region of the outer segment photoreceptor layer exactly at the pattern modulation frequency.

  15. A biallelic RFLP of the human. alpha. 2-C4 adrenergic receptor gene (ADRA2RL2) localized on the short arm of chromosome 4 and encoding the putative. alpha. 2B receptor is identified with Bsu 36 L using a 1. 5 kb probe (p ADRA2RL2)

    Energy Technology Data Exchange (ETDEWEB)

    Hoeche, M.R.; Berrettini, W.H. (Clinical Neurogenetics Branch, Bethesda, MD (USA)); Regan, J.W. (Duke Univ. Medical Center, Durham, NC (USA))

    1989-12-11

    A 1.5 kb Eco RI cDNA fragment representing the human alpha2-C4 adrenergic receptor (AR) gene encoding the putative alpha2B-AR, containing approximately 1270 bp of the coding and 240 bp of the 3{prime}flanking region, inserted into pSP65, was used as a probe (p ADRA2RL2). This clone was obtained by screening a human kidney lambda GT10 cDNA library with the 0.95 kb Pst I restriction fragment derived from the coding block of the gene for the human platelet alpha2-AR. Hybridization of human genomic DNA digested with Bsu 36 I identifies a two allele polymorphism with bands at 12 kb and 5.8 kb. 20 unrelated North American caucasian subjects were evaluated with frequencies of: A allele, 0.45; B allele, 0.55, heterozygosity (obs), 0.5. This alpha2-AR gene has been mapped in a separation effort in 59 CEPH reference pedigrees to the tip of the short arm of chromosome 4 just proximal to GB (4p 16.3) reported to be linked to the Huntingston's disease gene. Codominant inheritance was observed in seven families with two and three generations, respectively. The number of meioses scored was 95.

  16. Mitochondrial Genes of Dinoflagellates Are Transcribed by a Nuclear-Encoded Single-Subunit RNA Polymerase.

    Directory of Open Access Journals (Sweden)

    Chang Ying Teng

    Full Text Available Dinoflagellates are a large group of algae that contribute significantly to marine productivity and are essential photosynthetic symbionts of corals. Although these algae have fully-functioning mitochondria and chloroplasts, both their organelle genomes have been highly reduced and the genes fragmented and rearranged, with many aberrant transcripts. However, nothing is known about their RNA polymerases. We cloned and sequenced the gene for the nuclear-encoded mitochondrial polymerase (RpoTm of the dinoflagellate Heterocapsa triquetra and showed that the protein presequence targeted a GFP construct into yeast mitochondria. The gene belongs to a small gene family, which includes a variety of 3'-truncated copies that may have originated by retroposition. The catalytic C-terminal domain of the protein shares nine conserved sequence blocks with other single-subunit polymerases and is predicted to have the same fold as the human enzyme. However, the N-terminal (promoter binding/transcription initiation domain is not well-conserved. In conjunction with the degenerate nature of the mitochondrial genome, this suggests a requirement for novel accessory factors to ensure the accurate production of functional mRNAs.

  17. Distinct Patterns of Gene Gain and Loss: Diverse Evolutionary Modes of NBS-Encoding Genes in Three Solanaceae Crop Species.

    Science.gov (United States)

    Qian, Lan-Hua; Zhou, Guang-Can; Sun, Xiao-Qin; Lei, Zhao; Zhang, Yan-Mei; Xue, Jia-Yu; Hang, Yue-Yu

    2017-05-05

    Plant resistance conferred by nucleotide binding site (NBS)-encoding resistance genes plays a key role in the defense against various pathogens throughout the entire plant life cycle. However, comparative analyses for the systematic evaluation and determination of the evolutionary modes of NBS-encoding genes among Solanaceae species are rare. In this study, 447, 255, and 306 NBS-encoding genes were identified from the genomes of potato, tomato, and pepper, respectively. These genes usually clustered as tandem arrays on chromosomes; few existed as singletons. Phylogenetic analysis indicated that three subclasses [TNLs (TIR-NBS-LRR), CNLs (CC-NBS-LRR), and RNLs (RPW8-NBS-LRR)] each formed a monophyletic clade and were distinguished by unique exon/intron structures and amino acid motif sequences. By comparing phylogenetic and systematic relationships, we inferred that the NBS-encoding genes in the present genomes of potato, tomato, and pepper were derived from 150 CNL, 22 TNL, and 4 RNL ancestral genes, and underwent independent gene loss and duplication events after speciation. The NBS-encoding genes therefore exhibit diverse and dynamic evolutionary patterns in the three Solanaceae species, giving rise to the discrepant gene numbers observed today. Potato shows a "consistent expansion" pattern, tomato exhibits a pattern of "first expansion and then contraction," and pepper presents a "shrinking" pattern. The earlier expansion of CNLs in the common ancestor led to the dominance of this subclass in gene numbers. However, RNLs remained at low copy numbers due to their specific functions. Along the evolutionary process of NBS-encoding genes in Solanaceae, species-specific tandem duplications contributed the most to gene expansions. Copyright © 2017 Qian et al.

  18. Identification of toxin genes encoding Cyt proteins from standard ...

    African Journals Online (AJOL)

    Polymerase chain reaction-restriction fragment length polymorphism methods for identification of cyt subclasses from Bacillus thuringiensis were established. Eight of 68 standard and ten of 107 Argentine B. thuringiensis strains harbor at least one cyt gene. The combination of cyt1Aa/cyt2Ba genes was identified in four ...

  19. Characterization of a Soil Metagenome-Derived Gene Encoding Wax Ester Synthase.

    Science.gov (United States)

    Kim, Nam Hee; Park, Ji-Hye; Chung, Eunsook; So, Hyun-Ah; Lee, Myung Hwan; Kim, Jin-Cheol; Hwang, Eul Chul; Lee, Seon-Woo

    2016-02-01

    A soil metagenome contains the genomes of all microbes included in a soil sample, including those that cannot be cultured. In this study, soil metagenome libraries were searched for microbial genes exhibiting lipolytic activity and those involved in potential lipid metabolism that could yield valuable products in microorganisms. One of the subclones derived from the original fosmid clone, pELP120, was selected for further analysis. A subclone spanning a 3.3 kb DNA fragment was found to encode for lipase/esterase and contained an additional partial open reading frame encoding a wax ester synthase (WES) motif. Consequently, both pELP120 and the full length of the gene potentially encoding WES were sequenced. To determine if the wes gene encoded a functioning WES protein that produced wax esters, gas chromatography-mass spectroscopy was conducted using ethyl acetate extract from an Escherichia coli strain that expressed the wes gene and was grown with hexadecanol. The ethyl acetate extract from this E. coli strain did indeed produce wax ester compounds of various carbon-chain lengths. DNA sequence analysis of the full-length gene revealed that the gene cluster may be derived from a member of Proteobacteria, whereas the clone does not contain any clear phylogenetic markers. These results suggest that the wes gene discovered in this study encodes a functional protein in E. coli and produces wax esters through a heterologous expression system.

  20. Asthma and genes encoding components of the vitamin D pathway

    Directory of Open Access Journals (Sweden)

    Raby Benjamin A

    2009-10-01

    Full Text Available Abstract Background Genetic variants at the vitamin D receptor (VDR locus are associated with asthma and atopy. We hypothesized that polymorphisms in other genes of the vitamin D pathway are associated with asthma or atopy. Methods Eleven candidate genes were chosen for this study, five of which code for proteins in the vitamin D metabolism pathway (CYP27A1, CYP27B1, CYP2R1, CYP24A1, GC and six that are known to be transcriptionally regulated by vitamin D (IL10, IL1RL1, CD28, CD86, IL8, SKIIP. For each gene, we selected a maximally informative set of common SNPs (tagSNPs using the European-derived (CEU HapMap dataset. A total of 87 SNPs were genotyped in a French-Canadian family sample ascertained through asthmatic probands (388 nuclear families, 1064 individuals and evaluated using the Family Based Association Test (FBAT program. We then sought to replicate the positive findings in four independent samples: two from Western Canada, one from Australia and one from the USA (CAMP. Results A number of SNPs in the IL10, CYP24A1, CYP2R1, IL1RL1 and CD86 genes were modestly associated with asthma and atopy (p IL10 and VDR genes as well as in the IL10 and IL1RL1 genes were associated with asthma (p IL10 and CYP24A1 genes were again modestly associated with asthma and atopy (p IL10 and VDR was replicated in CAMP, but not in the other populations. Conclusion A number of genes involved in the vitamin D pathway demonstrate modest levels of association with asthma and atopy. Multilocus models testing genes in the same pathway are potentially more effective to evaluate the risk of asthma, but the effects are not uniform across populations.

  1. A Clostridioides difficile bacteriophage genome encodes functional binary toxin-associated genes.

    Science.gov (United States)

    Riedel, Thomas; Wittmann, Johannes; Bunk, Boyke; Schober, Isabel; Spröer, Cathrin; Gronow, Sabine; Overmann, Jörg

    2017-05-20

    Pathogenic clostridia typically produce toxins as virulence factors which cause severe diseases in both humans and animals. Whereas many clostridia like e.g., Clostridium perfringens, Clostridium botulinum or Clostridium tetani were shown to contain toxin-encoding plasmids, only toxin genes located on the chromosome were detected in Clostridioides difficile so far. In this study, we determined, annotated, and analyzed the complete genome of the bacteriophage phiSemix9P1 using single-molecule real-time sequencing technology (SMRT). To our knowledge, this represents the first C. difficile-associated bacteriophage genome that carries a complete functional binary toxin locus in its genome. Copyright © 2017 Elsevier B.V. All rights reserved.

  2. Molecular evolution of genes encoding ribonucleases in ruminant species.

    Science.gov (United States)

    Confalone, E; Beintema, J J; Sasso, M P; Carsana, A; Palmieri, M; Vento, M T; Furia, A

    1995-12-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that demonstrate the existence of the orthologues of the bovine pancreatic, seminal, and cerebral ribonucleases coding sequences in the genomes of giraffe and sheep. The "seminal" sequence is a pseudogene in both species. We also report an analysis of the transcriptional expression of ribonuclease genes in sheep tissues. The data presented support a model for positive selection acting on the molecular evolution of ruminant ribonuclease genes.

  3. Characterization of a gene encoding cellulase from uncultured soil bacteria.

    Science.gov (United States)

    Kim, Soo-Jin; Lee, Chang-Muk; Han, Bo-Ram; Kim, Min-Young; Yeo, Yun-Soo; Yoon, Sang-Hong; Koo, Bon-Sung; Jun, Hong-Ki

    2008-05-01

    To detect cellulases encoded by uncultured microorganisms, we constructed metagenomic libraries from Korean soil DNAs. Screenings of the libraries revealed a clone pCM2 that uses carboxymethyl cellulose (CMC) as a sole carbon source. Further analysis of the insert showed two consecutive ORFs (celM2 and xynM2) encoding proteins of 226 and 662 amino acids, respectively. A multiple sequence analysis with the deduced amino acid sequences of celM2 showed 36% sequence identity with cellulase from the Synechococcus sp., while xynM2 had 59% identity to endo-1,4-beta-xylanase A from Cellulomonas pachnodae. The highest enzymatic CMC hydrolysis was observable at pH 4.0 and 45 degrees C with recombinant CelM2 protein. Although the enzyme CelM2 additionally hydrolyzed avicel and xylan, no substrate hydrolysis was observed on oligosaccharides such as cellobiose, pNP-beta-cellobioside, pNP-beta-glucoside, and pNP-beta-xyloside. These results showed that CelM2 is a novel endo-type cellulase.

  4. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    families. The recombinant BtabCSP was successfully expressed in Escherichia coli cells. This is the first report on the existence of chemosensory protein-coding gene in whiteflies. It will help us to elucidate the molecular.

  5. Organization and control of genes encoding catabolic enzymes in Rhizobiaceae

    Energy Technology Data Exchange (ETDEWEB)

    Parke, D.; Ornston, L.N.

    1993-03-01

    Rhizobiaceae, a diverse bacterial group comprising rhizobia and agrobacteria, symbiotic partnership with plants form nitrogen-fixing nodules on plant roots or are plant pathogens. Phenolic compounds produced by plants serve as inducers of rhizobial nodulation genes and agrobacterial virulence genes reflect their capacity to utilize numerous aromatics, including phenolics, as a source of carbon and energy. In many microbes the aerobic degradation of numerous aromatic compounds to tricarboxylic acid cycle intermediates is achieved by the [beta]-ketoadipate pathway. Our initial studies focused on the organization and regulation of the ketoadipate pathway in Agrobacterium tumefaciens. We have cloned, identified and characterized a novel regulatory gene that modulates expression of an adjacent pca (protocatechuate) structural gene, pcaD. Regulation of pcaD is mediated by the regulatory gene, termed pcaQ, in concert with the intermediate [beta]-carboxy-cis,cis-muconate. [beta]-carboxy-cis,cismuconate is an unstable chemical, not marketed commercially, and it is unlikely to permeate Escherichia coli cells if supplied in media. Because of these factors, characterization of pcaQ in E. coli required an in vivo delivery system for [beta]-carboxycis,cis-muconate. This was accomplished by designing an E. coli strain that expressed an Acinetobacter calcoaceticus pcaA gene for conversion of protocatechuate to [beta]-carboxy-cis,cis-muconate.

  6. Comparative metagenomic analysis of plasmid encoded functions in the human gut microbiome

    Directory of Open Access Journals (Sweden)

    Marchesi Julian R

    2010-01-01

    Full Text Available Abstract Background Little is known regarding the pool of mobile genetic elements associated with the human gut microbiome. In this study we employed the culture independent TRACA system to isolate novel plasmids from the human gut microbiota, and a comparative metagenomic analysis to investigate the distribution and relative abundance of functions encoded by these plasmids in the human gut microbiome. Results Novel plasmids were acquired from the human gut microbiome, and homologous nucleotide sequences with high identity (>90% to two plasmids (pTRACA10 and pTRACA22 were identified in the multiple human gut microbiomes analysed here. However, no homologous nucleotide sequences to these plasmids were identified in the murine gut or environmental metagenomes. Functions encoded by the plasmids pTRACA10 and pTRACA22 were found to be more prevalent in the human gut microbiome when compared to microbial communities from other environments. Among the most prevalent functions identified was a putative RelBE toxin-antitoxin (TA addiction module, and subsequent analysis revealed that this was most closely related to putative TA modules from gut associated bacteria belonging to the Firmicutes. A broad phylogenetic distribution of RelE toxin genes was observed in gut associated bacterial species (Firmicutes, Bacteroidetes, Actinobacteria and Proteobacteria, but no RelE homologues were identified in gut associated archaeal species. We also provide indirect evidence for the horizontal transfer of these genes between bacterial species belonging to disparate phylogenetic divisions, namely Gram negative Proteobacteria and Gram positive species from the Firmicutes division. Conclusions The application of a culture independent system to capture novel plasmids from the human gut mobile metagenome, coupled with subsequent comparative metagenomic analysis, highlighted the unexpected prevalence of plasmid encoded functions in the gut microbial ecosystem. In

  7. GENCODE: the reference human genome annotation for The ENCODE Project.

    Science.gov (United States)

    Harrow, Jennifer; Frankish, Adam; Gonzalez, Jose M; Tapanari, Electra; Diekhans, Mark; Kokocinski, Felix; Aken, Bronwen L; Barrell, Daniel; Zadissa, Amonida; Searle, Stephen; Barnes, If; Bignell, Alexandra; Boychenko, Veronika; Hunt, Toby; Kay, Mike; Mukherjee, Gaurab; Rajan, Jeena; Despacio-Reyes, Gloria; Saunders, Gary; Steward, Charles; Harte, Rachel; Lin, Michael; Howald, Cédric; Tanzer, Andrea; Derrien, Thomas; Chrast, Jacqueline; Walters, Nathalie; Balasubramanian, Suganthi; Pei, Baikang; Tress, Michael; Rodriguez, Jose Manuel; Ezkurdia, Iakes; van Baren, Jeltje; Brent, Michael; Haussler, David; Kellis, Manolis; Valencia, Alfonso; Reymond, Alexandre; Gerstein, Mark; Guigó, Roderic; Hubbard, Tim J

    2012-09-01

    The GENCODE Consortium aims to identify all gene features in the human genome using a combination of computational analysis, manual annotation, and experimental validation. Since the first public release of this annotation data set, few new protein-coding loci have been added, yet the number of alternative splicing transcripts annotated has steadily increased. The GENCODE 7 release contains 20,687 protein-coding and 9640 long noncoding RNA loci and has 33,977 coding transcripts not represented in UCSC genes and RefSeq. It also has the most comprehensive annotation of long noncoding RNA (lncRNA) loci publicly available with the predominant transcript form consisting of two exons. We have examined the completeness of the transcript annotation and found that 35% of transcriptional start sites are supported by CAGE clusters and 62% of protein-coding genes have annotated polyA sites. Over one-third of GENCODE protein-coding genes are supported by peptide hits derived from mass spectrometry spectra submitted to Peptide Atlas. New models derived from the Illumina Body Map 2.0 RNA-seq data identify 3689 new loci not currently in GENCODE, of which 3127 consist of two exon models indicating that they are possibly unannotated long noncoding loci. GENCODE 7 is publicly available from gencodegenes.org and via the Ensembl and UCSC Genome Browsers.

  8. GENCODE: The reference human genome annotation for The ENCODE Project

    Science.gov (United States)

    Harrow, Jennifer; Frankish, Adam; Gonzalez, Jose M.; Tapanari, Electra; Diekhans, Mark; Kokocinski, Felix; Aken, Bronwen L.; Barrell, Daniel; Zadissa, Amonida; Searle, Stephen; Barnes, If; Bignell, Alexandra; Boychenko, Veronika; Hunt, Toby; Kay, Mike; Mukherjee, Gaurab; Rajan, Jeena; Despacio-Reyes, Gloria; Saunders, Gary; Steward, Charles; Harte, Rachel; Lin, Michael; Howald, Cédric; Tanzer, Andrea; Derrien, Thomas; Chrast, Jacqueline; Walters, Nathalie; Balasubramanian, Suganthi; Pei, Baikang; Tress, Michael; Rodriguez, Jose Manuel; Ezkurdia, Iakes; van Baren, Jeltje; Brent, Michael; Haussler, David; Kellis, Manolis; Valencia, Alfonso; Reymond, Alexandre; Gerstein, Mark; Guigó, Roderic; Hubbard, Tim J.

    2012-01-01

    The GENCODE Consortium aims to identify all gene features in the human genome using a combination of computational analysis, manual annotation, and experimental validation. Since the first public release of this annotation data set, few new protein-coding loci have been added, yet the number of alternative splicing transcripts annotated has steadily increased. The GENCODE 7 release contains 20,687 protein-coding and 9640 long noncoding RNA loci and has 33,977 coding transcripts not represented in UCSC genes and RefSeq. It also has the most comprehensive annotation of long noncoding RNA (lncRNA) loci publicly available with the predominant transcript form consisting of two exons. We have examined the completeness of the transcript annotation and found that 35% of transcriptional start sites are supported by CAGE clusters and 62% of protein-coding genes have annotated polyA sites. Over one-third of GENCODE protein-coding genes are supported by peptide hits derived from mass spectrometry spectra submitted to Peptide Atlas. New models derived from the Illumina Body Map 2.0 RNA-seq data identify 3689 new loci not currently in GENCODE, of which 3127 consist of two exon models indicating that they are possibly unannotated long noncoding loci. GENCODE 7 is publicly available from gencodegenes.org and via the Ensembl and UCSC Genome Browsers. PMID:22955987

  9. ISOLATION AND CHARACTERIZATION OF THE RAT GENE ENCODING GLUTAMATE-DEHYDROGENASE

    NARCIS (Netherlands)

    DAS, AT; ARNBERG, AC; MALINGRE, H; MOERER, P; CHARLES, R; MOORMAN, AFM; LAMERS, WH

    1993-01-01

    The concentration of glutamate dehydrogenase (GDH) varies strongly between different organs and between different regions within organs. To permit further studies on the regulation of GDH expression, we isolated and characterized the rat gene encoding the GDH protein. This gene contains 13 exons and

  10. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  11. Isolation and characterization of the rat glutamine synthetase-encoding gene

    NARCIS (Netherlands)

    van de Zande, L.; Labruyère, W. T.; Arnberg, A. C.; Wilson, R. H.; van den Bogaert, A. J.; Das, A. T.; van Oorschot, D. A.; Frijters, C.; Charles, R.; Moorman, A. F.

    1990-01-01

    From a rat genomic library in phage lambda Charon4A, a complete glutamine synthetase-encoding gene was isolated. The gene is 9.5-10 kb long, consists of seven exons, and codes for two mRNA species of 1375 nucleotides (nt) and 2787 nt, respectively. For both mRNAs, full-length cDNAs containing a

  12. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...... analysis established the subunit Mr as 43,500. Primer extension analysis indicated the presence of an adequate Pribnow box and suggested that the transcript contained a 110-base leader sequence. Strains harboring the gsk gene on multicopy plasmids overexpressed both guanosine and inosine kinase activities...

  13. Growth Characteristics of Methanomassiliicoccus luminyensis and Expression of Methyltransferase Encoding Genes

    Directory of Open Access Journals (Sweden)

    Lena Kröninger

    2017-01-01

    Full Text Available DNA sequence analysis of the human gut revealed the presence a seventh order of methanogens referred to as Methanomassiliicoccales. Methanomassiliicoccus luminyensis is the only member of this order that grows in pure culture. Here, we show that the organism has a doubling time of 1.8 d with methanol + H2 and a growth yield of 2.4 g dry weight/mol CH4. M. luminyensis also uses methylamines + H2 (monomethylamine, dimethylamine, and trimethylamine with doubling times of 2.1–2.3 d. Similar cell yields were obtained with equimolar concentrations of methanol and methylamines with respect to their methyl group contents. The transcript levels of genes encoding proteins involved in substrate utilization indicated increased amounts of mRNA from the mtaBC2 gene cluster in methanol-grown cells. When methylamines were used as substrates, mRNA of the mtb/mtt operon and of the mtmBC1 cluster were found in high abundance. The transcript level of mtaC2 was almost identical in methanol- and methylamine-grown cells, indicating that genes for methanol utilization were constitutively expressed in high amounts. The same observation was made with resting cells where methanol always yielded the highest CH4 production rate independently from the growth substrate. Hence, M. luminyensis is adapted to habitats that provide methanol + H2 as substrates.

  14. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... is provided by a competitively coamplified DNA standard constructed by point mutation PCR. A single base difference was introduced to achieve a suitable migration difference in TGGE between the original target DNA and the modified standard without altering the PCR amplification efficiency. This competitive...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  15. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  16. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  17. Molecular evolution of genes encoding ribonucleases in ruminant species

    NARCIS (Netherlands)

    Confalone, E; Beintema, JJ; Sasso, MP; Carsana, A; Palmieri, M; Vento, MT; Furia, A

    1995-01-01

    Phylogenetic analysis, based on the primary structures of mammalian pancreatic-type ribonucleases, indicated that gene duplication events, which occurred during the evolution of ancestral ruminants, gave rise to the three paralogous enzymes present in the bovine species. Herein we report data that

  18. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous impact on crop productivity. To survive under unfavourable conditions, plants have developed a variety of sophisticated strategies (Bray 1997; Thomashow. 1999). One of the fundamental properties of adaptive mechanisms is that a gene must be ...

  19. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  20. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    Jane

    2011-04-06

    Apr 6, 2011 ... This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from. Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for.

  1. Association between GH encoding gene polymorphism and semen ...

    African Journals Online (AJOL)

    The objective of this present study was to investigate relationships between the growth hormone gene restriction fragment length polymorphism (RFLP) and bull sperm characteristics. A total of 89 bulls from two semen evaluation stations were genotyped for the bovine growth hormone (bGH)-AluI polymorphism by ...

  2. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    detoxification enzymes (glutathione S-transferase, soluble epoxide hydrolase, catalase and superoxide dismutase). The second group contains protein factors involved in the regulation of signal transduction and gene expression, which probably function in stress responses such as protein kinases, transcription factors and ...

  3. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  4. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  5. Gene therapy for bladder pain with gene gun particle encoding pro-opiomelanocortin cDNA.

    Science.gov (United States)

    Chuang, Yao-Chi; Chou, A-K; Wu, P-C; Chiang, Po-Hui; Yu, T-J; Yang, L-C; Yoshimura, Naoki; Chancellor, Michael B

    2003-11-01

    Interstitial cystitis is a bladder hypersensitivity disease associated with bladder pain that has been a major challenge to understand and treat. We hypothesized that targeted and localized expression of endogenous opioid peptide in the bladder could be useful for the treatment of bladder pain. Pro-opiomelanocortin (POMC) is one of such precursor molecules. In this study we developed a gene gun method for the transfer of POMC cDNA in vivo and investigated its therapeutic effect on acetic acid induced bladder hyperactivity in rats. Human POMC cDNA was cloned into a modified pCMV plasmid and delivered into the bladder wall of adult female rats by direct injection or the gene gun. Three days after gene therapy continuous cystometrograms were performed using urethane anesthesia by filling the bladder (0.08 ml per minute) with saline, followed by 0.3% acetic acid. Bladder immunohistochemical testing was used to detect endorphin after POMC cDNA transfer. The intercontraction interval was decreased after intravesical instillation of acetic acid (73.1% or 68.1% decrease) in 2 control groups treated with saline or the gene gun without POMC cDNA, respectively. However, rats that received POMC cDNA via the gene gun showed a significantly decreased response (intercontraction interval 35% decreased) to acetic acid instillation, whereas this antinociceptive effect was not detected in the plasmid POMC cDNA direct injection group. This effect induced by POMC gene gun treatment was reversed by intramuscular naloxone (1 mg/kg), an opioid antagonist. Increased endorphin immunoreactivity with anti-endorphin antibodies was observed in the bladder of gene gun treated animals. The POMC gene can be transferred in the bladder using the gene gun and increased bladder expression of endorphin can suppress nociceptive responses induced by bladder irritation. Thus, POMC gene gun delivery may be useful for the treatment of interstitial cystitis and other types of visceral pain.

  6. Frequency and significance of the novel single nucleotide missense polymorphism Val109Asp in the human gene encoding omentin in Caucasian patients with type 2 diabetes mellitus or chronic inflammatory bowel diseases

    Directory of Open Access Journals (Sweden)

    Buechler Christa

    2007-02-01

    Full Text Available Background The omental adipose tissue is pathogenetically involved in both type 2 diabetes mellitus (T2D and chronic inflammatory bowel diseases (IBD such as Ulcerative colitis (UC and Crohn's Disease (CD. Thus, adipokines secreted from omental adipose tissue might play an important role in these diseases. Omentin represents a new adipokine expressed in and secreted by omental adipose tissue. Therefore, it was the aim to investigate the putative role of a newly described sequence missense variation in the human omentin gene. Methods The Val109Asp single nucleotide miss-sense polymorphism and the His86His polymorphism in exon-4 of the omentin gene were newly identified by random sequencing. Only the miss-sense polymorphism was investigated further. Genotyping was performed by restriction fragment length polymorphism (RFLP analysis of amplified DNA fragments. Three different cohorts of well-characterized individuals were included in the study. 114 patients suffering from T2D, 190 patients suffering from IBD (128 with CD and 62 with UC and 276 non-diabetic healthy controls without any history for IBD were analyzed. Results The following allelic frequencies were determined: controls: Val-allele: 0.26, Asp-allele: 0.74; T2D: Val-allele: 0.3, Asp-allele: 0.7; IBD: Val-allel: 0.31, Asp-allele: 0.69. UC and CD patients did not differ in regard to the allelic frequency. Similarly, controls, T2D patients and IBD patients did not show significant differences in genotype distribution among each other. Disease manifestation and pattern of infestation were not related to genotype subgroups, neither in CD nor in UC. Furthermore, there was no significant association between genotype subgroups and anthropometric or laboratory parameters in T2D patients. Conclusion Based on sequence comparisons and homology searches, the amino acid position 109 is conserved in the omentin gene of humans, mice and chimpanzee but is not completely conserved between other omentin

  7. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  8. The first gene in the Escherichia coli secA operon, gene X, encodes a nonessential secretory protein.

    OpenAIRE

    Rajapandi, T; Dolan, K M; Oliver, D B

    1991-01-01

    TnphoA insertions in the first gene of the Escherichia coli secA operon, gene X, were isolated and analyzed. Studies of the Gene X-PhoA fusion proteins showed that gene X encodes a secretory protein, since the fusion proteins possessed normal alkaline phosphatase activity and a substantial portion of this activity was found in the periplasm. In addition, the Gene X-PhoA fusion proteins were initially synthesized with a cleavable signal peptide. A gene X::TnphoA insertion was used to construct...

  9. Analysis of single nucleotide polymorphisms in uridine/cytidine kinase gene encoding metabolic enzyme of 3'-ethynylcytidine.

    Science.gov (United States)

    Hasegawa, Takako; Futagami, Michiko; Kim, Hey-Sook; Matsuda, Akira; Wataya, Yusuke

    2002-01-01

    We investigated single nucleotide polymorphisms (SNPs) in uck2 gene encoding metabolic enzyme of 3'-ethynylcytidine (ECyd) which were associated with drug response of ECyd, and the newly synthesized antitumor ribonucleoside analog. We analized that on exon-intron junction and exon region to affect the qualitative alteration of gene product directly in ECyd sensitive and resistant human cancer cell lines. As the results, cSNP and sSNP were detected in exon 4. In the promoter region, 3 SNPs were detected. Our data seem to be able to give an important knowledge, when ECyd is applied clinically.

  10. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  11. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  12. The Escherichia coli Serogroup O1 and O2 Lipopolysaccharides Are Encoded by Multiple O-antigen Gene Clusters

    Science.gov (United States)

    Delannoy, Sabine; Beutin, Lothar; Mariani-Kurkdjian, Patricia; Fleiss, Aubin; Bonacorsi, Stéphane; Fach, Patrick

    2017-01-01

    Escherichia coli strains belonging to serogroups O1 and O2 are frequently associated with human infections, especially extra-intestinal infections such as bloodstream infections or urinary tract infections. These strains can be associated with a large array of flagellar antigens. Because of their frequency and clinical importance, a reliable detection of E. coli O1 and O2 strains and also the frequently associated K1 capsule is important for diagnosis and source attribution of E. coli infections in humans and animals. By sequencing the O-antigen clusters of various O1 and O2 strains we showed that the serogroups O1 and O2 are encoded by different sets of O-antigen encoding genes and identified potentially new O-groups. We developed qPCR-assays to detect the various O1 and O2 variants and the K1-encoding gene. These qPCR assays proved to be 100% sensitive and 100% specific and could be valuable tools for the investigations of zoonotic and food-borne infection of humans with O1 and O2 extra-intestinal (ExPEC) or Shiga toxin-producing E. coli (STEC) strains. PMID:28224115

  13. The evolution of genes encoding for green fluorescent proteins: insights from cephalochordates (amphioxus)

    Science.gov (United States)

    Yue, Jia-Xing; Holland, Nicholas D.; Holland, Linda Z.; Deheyn, Dimitri D.

    2016-06-01

    Green Fluorescent Protein (GFP) was originally found in cnidarians, and later in copepods and cephalochordates (amphioxus) (Branchiostoma spp). Here, we looked for GFP-encoding genes in Asymmetron, an early-diverged cephalochordate lineage, and found two such genes closely related to some of the Branchiostoma GFPs. Dim fluorescence was found throughout the body in adults of Asymmetron lucayanum, and, as in Branchiostoma floridae, was especially intense in the ripe ovaries. Spectra of the fluorescence were similar between Asymmetron and Branchiostoma. Lineage-specific expansion of GFP-encoding genes in the genus Branchiostoma was observed, largely driven by tandem duplications. Despite such expansion, purifying selection has strongly shaped the evolution of GFP-encoding genes in cephalochordates, with apparent relaxation for highly duplicated clades. All cephalochordate GFP-encoding genes are quite different from those of copepods and cnidarians. Thus, the ancestral cephalochordates probably had GFP, but since GFP appears to be lacking in more early-diverged deuterostomes (echinoderms, hemichordates), it is uncertain whether the ancestral cephalochordates (i.e. the common ancestor of Asymmetron and Branchiostoma) acquired GFP by horizontal gene transfer (HGT) from copepods or cnidarians or inherited it from the common ancestor of copepods and deuterostomes, i.e. the ancestral bilaterians.

  14. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  15. Transient receptor potential (TRP gene superfamily encoding cation channels

    Directory of Open Access Journals (Sweden)

    Pan Zan

    2011-01-01

    Full Text Available Abstract Transient receptor potential (TRP non-selective cation channels constitute a superfamily, which contains 28 different genes. In mammals, this superfamily is divided into six subfamilies based on differences in amino acid sequence homology between the different gene products. Proteins within a subfamily aggregate to form heteromeric or homomeric tetrameric configurations. These different groupings have very variable permeability ratios for calcium versus sodium ions. TRP expression is widely distributed in neuronal tissues, as well as a host of other tissues, including epithelial and endothelial cells. They are activated by environmental stresses that include tissue injury, changes in temperature, pH and osmolarity, as well as volatile chemicals, cytokines and plant compounds. Their activation induces, via intracellular calcium signalling, a host of responses, including stimulation of cell proliferation, migration, regulatory volume behaviour and the release of a host of cytokines. Their activation is greatly potentiated by phospholipase C (PLC activation mediated by coupled GTP-binding proteins and tyrosine receptors. In addition to their importance in maintaining tissue homeostasis, some of these responses may involve various underlying diseases. Given the wealth of literature describing the multiple roles of TRP in physiology in a very wide range of different mammalian tissues, this review limits itself to the literature describing the multiple roles of TRP channels in different ocular tissues. Accordingly, their importance to the corneal, trabecular meshwork, lens, ciliary muscle, retinal, microglial and retinal pigment epithelial physiology and pathology is reviewed.

  16. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  17. Novel Genes Encoding Hexadecanoic Acid Δ6-Desaturase Activity in a Rhodococcus sp.

    Science.gov (United States)

    Araki, Hiroyuki; Hagihara, Hiroshi; Takigawa, Hirofumi; Tsujino, Yukiharu; Ozaki, Katsuya

    2016-11-01

    cis-6-Hexadecenoic acid, a major component of human sebaceous lipids, is involved in the defense mechanism against Staphylococcus aureus infection in healthy skin and closely related to atopic dermatitis. Previously, Koike et al. (Biosci Biotechnol Biochem 64:1064-1066, 2000) reported that a mutant strain of Rhodococcus sp. produced cis-6-hexadecenoate derivatives from palmitate alkyl esters. From the mutant Rhodococcus strain, we identified and sequenced two open reading frames present in an amplified 5.7-kb region; these open reading frames encoded tandemly repeated Δ6-desaturase-like genes, Rdes1 and Rdes2. A phylogenetic tree indicated that Rdes1 and Rdes2 were different from previously known Δ6-desaturase genes, and that they formed a new cluster. Rdes1 and Rdes2 were each introduced into vectors and then expressed separately in Escherichia coli, and the fatty acid composition of the transformed cells was analyzed by gas chromatography and mass spectrometry. The amount of cis-6-hexadecenoic acid was significantly higher in Rdes1- or Rdes2-transformed E. coli cells (twofold and threefold, respectively) than in vector-only control cells. These results showed that cis-6-hexadecenoic acid was produced in E. coli cells by the rhodococcal Δ6-desaturase-like proteins.

  18. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  19. Cloning and expression of full-length cDNA encoding human vitamin D receptor

    Energy Technology Data Exchange (ETDEWEB)

    Baker, A.R.; McDonnell, D.P.; Hughes, M.; Crisp, T.M.; Mangelsdorf, D.J.; Haussler, M.R.; Pike, J.W.; Shine, J.; O' Malley, B.W. (California Biotechnology Inc., Mountain View (USA))

    1988-05-01

    Complementary DNA clones encoding the human vitamin D receptor have been isolated from human intestine and T47D cell cDNA libraries. The nucleotide sequence of the 4605-base pair (bp) cDNA includes a noncoding leader sequence of 115 bp, a 1281-bp open reading frame, and 3209 bp of 3{prime} noncoding sequence. Two polyadenylylation signals, AATAAA, are present 25 and 70 bp upstream of the poly(A) tail, respectively. RNA blot hybridization indicates a single mRNA species of {approx} 4600 bp. Transfection of the cloned sequences into COS-1 cells results in the production of a single receptor species indistinguishable from the native receptor. Sequence comparisons demonstrate that the vitamin D receptor belongs to the steroid-receptor gene family and is closest in size and sequence to another member of this family, the thyroid hormone receptor.

  20. PREVALENCE OF TOXIN ENCODING GENES IN ESCHERICHIACOLI ISOLATES FROM URINARY TRACT INFECTIONS INSLOVENIA

    Directory of Open Access Journals (Sweden)

    Marjanca Starčič-Erjavec

    2008-06-01

    Full Text Available Methods 110 uropathogenic Escherichia coli strains (UPEC obtained from the Institute of Microbiology and Immunology of the Medical Faculty in Ljubljana were screened by PCR withprimers specific for the following toxin encoding genes: hlyA (haemolysin, cnf1 (cytotoxicnecrotising factor 1, usp (uropathogenic specific protein USP and ibeA (invasin. Dotblot hybridisation experiments were performed to validate the PCR assays.Results In 44% of the strains usp gene sequences were detected. The prevalence of hlyA and cnf1was 25% and 23%, respectively. Only 9% of the strains harbored ibeA. The majority of thetested toxin encoding genes was found in strains belonging to the B2 phylogenetic group.Conclusions The toxin encoding genes hlyA, cnf1 and usp were strongly co-associated. Further, we founda statistically significant co-association of ibeA and usp. The prevalence of the testedtoxin encoding genes in E. coli strains from urinary tract infections isolated in Slovenia iscomparable to those from studies in other geographic regions.

  1. The bovine T cell receptor alpha/delta locus contains over 400 V genes and encodes V genes without CDR2.

    Science.gov (United States)

    Reinink, Peter; Van Rhijn, Ildiko

    2009-07-01

    Alphabeta T cells and gammadelta T cells perform nonoverlapping immune functions. In mammalian species with a high percentage of very diverse gammadelta T cells, like ruminants and pigs, it is often assumed that alphabeta T cells are less diverse than gammadelta T cells. Based on the bovine genome, we have created a map of the bovine TRA/TRD locus and show that, in cattle, in addition to the anticipated >100 TRDV genes, there are also >300 TRAV or TRAV/DV genes. Among the V genes in the TRA/TRD locus, there are several genes that lack a CDR2 and are functionally rearranged and transcribed and, in some cases, have an extended CDR1. The number of bovine V genes is a multiple of the number in mice and humans and may encode T cell receptors that use a novel way of interacting with antigen.

  2. LEA (Late Embryogenesis Abundant proteins and their encoding genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Hincha Dirk K

    2008-03-01

    Full Text Available Abstract Background LEA (late embryogenesis abundant proteins have first been described about 25 years ago as accumulating late in plant seed development. They were later found in vegetative plant tissues following environmental stress and also in desiccation tolerant bacteria and invertebrates. Although they are widely assumed to play crucial roles in cellular dehydration tolerance, their physiological and biochemical functions are largely unknown. Results We present a genome-wide analysis of LEA proteins and their encoding genes in Arabidopsis thaliana. We identified 51 LEA protein encoding genes in the Arabidopsis genome that could be classified into nine distinct groups. Expression studies were performed on all genes at different developmental stages, in different plant organs and under different stress and hormone treatments using quantitative RT-PCR. We found evidence of expression for all 51 genes. There was only little overlap between genes expressed in vegetative tissues and in seeds and expression levels were generally higher in seeds. Most genes encoding LEA proteins had abscisic acid response (ABRE and/or low temperature response (LTRE elements in their promoters and many genes containing the respective promoter elements were induced by abscisic acid, cold or drought. We also found that 33% of all Arabidopsis LEA protein encoding genes are arranged in tandem repeats and that 43% are part of homeologous pairs. The majority of LEA proteins were predicted to be highly hydrophilic and natively unstructured, but some were predicted to be folded. Conclusion The analyses indicate a wide range of sequence diversity, intracellular localizations, and expression patterns. The high fraction of retained duplicate genes and the inferred functional diversification indicate that they confer an evolutionary advantage for an organism under varying stressful environmental conditions. This comprehensive analysis will be an important starting point for

  3. A Gene Selection Method for Microarray Data Based on Binary PSO Encoding Gene-to-Class Sensitivity Information.

    Science.gov (United States)

    Han, Fei; Yang, Chun; Wu, Ya-Qi; Zhu, Jian-Sheng; Ling, Qing-Hua; Song, Yu-Qing; Huang, De-Shuang

    2017-01-01

    Traditional gene selection methods for microarray data mainly considered the features' relevance by evaluating their utility for achieving accurate predication or exploiting data variance and distribution, and the selected genes were usually poorly explicable. To improve the interpretability of the selected genes as well as prediction accuracy, an improved gene selection method based on binary particle swarm optimization (BPSO) and prior information is proposed in this paper. In the proposed method, BPSO encoding gene-to-class sensitivity (GCS) information is used to perform gene selection. The gene-to-class sensitivity information, extracted from the samples by extreme learning machine (ELM), is encoded into the selection process in four aspects: initializing particles, updating the particles, modifying maximum velocity, and adopting mutation operation adaptively. Constrained by the gene-to-class sensitivity information, the new method can select functional gene subsets which are significantly sensitive to the samples' classes. With the few discriminative genes selected by the proposed method, ELM, K-nearest neighbor and support vector machine classifiers achieve much high prediction accuracy on five public microarray data, which in turn verifies the efficiency and effectiveness of the proposed gene selection method.

  4. The human tenascin-R gene.

    Science.gov (United States)

    Leprini, A; Gherzi, R; Siri, A; Querzé, G; Viti, F; Zardi, L

    1996-12-06

    The human tenascin-R gene encodes a multidomain protein belonging to the tenascin family, until now detected only in the central nervous system. During embryo development, tenascin-R is presumed to play a pivotal role in axonal path finding through its adhesive and repulsive properties. Recently, the primary structure of human tenascin-R has been elucidated (Carnemolla, B., Leprini, A., Borsi, L., Querzé, G., Urbini, S., and Zardi, L. (1996) J. Biol. Chem. 271, 8157-8160). As a further step to investigate the role of human tenascin-R, we defined the structure of its gene. The gene, which spans a region of chromosome 1 approximately 85 kilobases in length, consists of 21 exons, ranging in size from 90 to >670 base pairs. The sequence analysis of intron splice donor and acceptor sites revealed that the position of introns in human tenascin-R are precisely conserved in the other two tenascin family members, tenascin-C and tenascin-X. The determination of intronic sequences flanking the exon boundaries will allow investigation of whether mutations may be responsible for altered function of the gene product(s) leading to central nervous system development defects.

  5. DNA inversion within the apolipoproteins AI/CIII/AIV-encoding gene cluster of certain patients with premature atherosclerosis

    International Nuclear Information System (INIS)

    Karathanasis, S.K.; Ferris, E.; Haddad, I.A.

    1987-01-01

    The genes coding for apolipoproteins (apo) AI, CIII, and AIV, designated APOA1, APOC3, and APOA4, respectively, are closely linked and tandemly organized in the long arm of the human chromosome 11. A DNA rearrangement involving the genes encoding apoAI and apoCIII in certain patients with premature atherosclerosis has been associated with deficiency of both apoAI and apoCIII in the plasma of these patients. Structural characterization of the genes for apoAI and apoCIII in one of these patients indicates that this rearrangement consists of a DNA inversion containing portions of the 3' ends of the apoAI and apoCIII genes, including the DNA region between these genes. The breakpoints of this DNA inversion are located within the fourth exon of the apoAI gene and the first intron of the apoCIII gene. Thus, this DNA inversion results in reciprocal fusion of the apoAI and apoCIII gene transcriptional units. Expression of these gene fusions in cultured mammalian cells results in stable mRNA transcripts with sequences representing fusions of the apoAI and apoCIII mRNAs. These results indicate that absence of transcripts with correct apoAI and apoCIII mRNA sequences causes apoAI and apoCIII deficiency in the plasma of these patients and suggest that these apolipoproteins are involved in cholesterol homeostasis and protection against premature atherosclerosis

  6. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn AL; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-01-01

    Background Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing

  7. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis

    Directory of Open Access Journals (Sweden)

    St Clair Dina A

    2007-10-01

    Full Text Available Abstract Background Nucleotide binding site-leucine rich repeat (NBS-LRR-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. Results We analyzed the expression patterns of ~170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST representation, massively parallel signature sequencing (MPSS, microarray analysis, rapid amplification of cDNA ends (RACE PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH, a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for

  8. Global expression analysis of nucleotide binding site-leucine rich repeat-encoding and related genes in Arabidopsis.

    Science.gov (United States)

    Tan, Xiaoping; Meyers, Blake C; Kozik, Alexander; West, Marilyn A L; Morgante, Michele; St Clair, Dina A; Bent, Andrew F; Michelmore, Richard W

    2007-10-23

    Nucleotide binding site-leucine rich repeat (NBS-LRR)-encoding genes comprise the largest class of plant disease resistance genes. The 149 NBS-LRR-encoding genes and the 58 related genes that do not encode LRRs represent approximately 0.8% of all ORFs so far annotated in Arabidopsis ecotype Col-0. Despite their prevalence in the genome and functional importance, there was little information regarding expression of these genes. We analyzed the expression patterns of approximately 170 NBS-LRR-encoding and related genes in Arabidopsis Col-0 using multiple analytical approaches: expressed sequenced tag (EST) representation, massively parallel signature sequencing (MPSS), microarray analysis, rapid amplification of cDNA ends (RACE) PCR, and gene trap lines. Most of these genes were expressed at low levels with a variety of tissue specificities. Expression was detected by at least one approach for all but 10 of these genes. The expression of some but not the majority of NBS-LRR-encoding and related genes was affected by salicylic acid (SA) treatment; the response to SA varied among different accessions. An analysis of previously published microarray data indicated that ten NBS-LRR-encoding and related genes exhibited increased expression in wild-type Landsberg erecta (Ler) after flagellin treatment. Several of these ten genes also showed altered expression after SA treatment, consistent with the regulation of R gene expression during defense responses and overlap between the basal defense response and salicylic acid signaling pathways. Enhancer trap analysis indicated that neither jasmonic acid nor benzothiadiazole (BTH), a salicylic acid analog, induced detectable expression of the five NBS-LRR-encoding genes and one TIR-NBS-encoding gene tested; however, BTH did induce detectable expression of the other TIR-NBS-encoding gene analyzed. Evidence for alternative mRNA polyadenylation sites was observed for many of the tested genes. Evidence for alternative splicing was

  9. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    OpenAIRE

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-01-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposo...

  10. New Integron-Associated Gene Cassette Encoding a 3-N-Aminoglycoside Acetyltransferase

    OpenAIRE

    Levings, Renee S.; Partridge, Sally R.; Lightfoot, Diane; Hall, Ruth M.; Djordjevic, Steven P.

    2005-01-01

    A fifth gene cassette containing an aacC gene, aacCA5, was found in an aacCA5-aadA7 cassette array in a class 1 integron isolated from a multiply drug resistant Salmonella enterica serovar Kentucky strain. The AacC-A5 or AAC(3)-Ie acetyltransferase encoded by aacCA5 is related to other AAC(3)-I enzymes and confers resistance to gentamicin.

  11. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  12. Evidence of gene conversion in genes encoding the Gal/GalNac lectin complex of Entamoeba.

    Directory of Open Access Journals (Sweden)

    Gareth D Weedall

    2011-06-01

    Full Text Available The human gut parasite Entamoeba histolytica, uses a lectin complex on its cell surface to bind to mucin and to ligands on the intestinal epithelia. Binding to mucin is necessary for colonisation and binding to intestinal epithelia for invasion, therefore blocking this binding may protect against amoebiasis. Acquired protective immunity raised against the lectin complex should create a selection pressure to change the amino acid sequence of lectin genes in order to avoid future detection. We present evidence that gene conversion has occurred in lineages leading to E. histolytica strain HM1:IMSS and E. dispar strain SAW760. This evolutionary mechanism generates diversity and could contribute to immune evasion by the parasites.

  13. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    OpenAIRE

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.

  14. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  15. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    NARCIS (Netherlands)

    Choorapoikayil, S.; Kuiper, R.V.; de Bruin, A.; den Hertog, J.

    2012-01-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile.

  16. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available for the efficient hydrolytic kinetic resolution of epoxides, which serve as high-value intermediates in the fine chemicals and pharmaceutical industries. Degenerate primers, based on data from available EH-encoding gene sequences, in conjunction with inverse PCR...

  17. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Directory of Open Access Journals (Sweden)

    Francisco Muñoz-Martínez

    Full Text Available Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF. CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was

  18. Genes encoding Cher-TPR fusion proteins are predominantly found in gene clusters encoding chemosensory pathways with alternative cellular functions.

    Science.gov (United States)

    Muñoz-Martínez, Francisco; García-Fontana, Cristina; Rico-Jiménez, Miriam; Alfonso, Carlos; Krell, Tino

    2012-01-01

    Chemosensory pathways correspond to major signal transduction mechanisms and can be classified into the functional families flagellum-mediated taxis, type four pili-mediated taxis or pathways with alternative cellular functions (ACF). CheR methyltransferases are core enzymes in all of these families. CheR proteins fused to tetratricopeptide repeat (TPR) domains have been reported and we present an analysis of this uncharacterized family. We show that CheR-TPRs are widely distributed in GRAM-negative but almost absent from GRAM-positive bacteria. Most strains contain a single CheR-TPR and its abundance does not correlate with the number of chemoreceptors. The TPR domain fused to CheR is comparatively short and frequently composed of 2 repeats. The majority of CheR-TPR genes were found in gene clusters that harbor multidomain response regulators in which the REC domain is fused to different output domains like HK, GGDEF, EAL, HPT, AAA, PAS, GAF, additional REC, HTH, phosphatase or combinations thereof. The response regulator architectures coincide with those reported for the ACF family of pathways. Since the presence of multidomain response regulators is a distinctive feature of this pathway family, we conclude that CheR-TPR proteins form part of ACF type pathways. The diversity of response regulator output domains suggests that the ACF pathways form a superfamily which regroups many different regulatory mechanisms, in which all CheR-TPR proteins appear to participate. In the second part we characterize WspC of Pseudomonas putida, a representative example of CheR-TPR. The affinities of WspC-Pp for S-adenosylmethionine and S-adenosylhomocysteine were comparable to those of prototypal CheR, indicating that WspC-Pp activity is in analogy to prototypal CheRs controlled by product feed-back inhibition. The removal of the TPR domain did not impact significantly on the binding constants and consequently not on the product feed-back inhibition. WspC-Pp was found to be

  19. A novel protein encoded by the circular form of the SHPRH gene suppresses glioma tumorigenesis.

    Science.gov (United States)

    Zhang, Maolei; Huang, Nunu; Yang, Xuesong; Luo, Jingyan; Yan, Sheng; Xiao, Feizhe; Chen, Wenping; Gao, Xinya; Zhao, Kun; Zhou, Huangkai; Li, Ziqiang; Ming, Liu; Xie, Bo; Zhang, Nu

    2018-01-18

    Circular RNAs (circRNAs) are recognized as functional non-coding transcripts in eukaryotic cells. Recent evidence has indicated that even though circRNAs are generally expressed at low levels, they may be involved in many physiological or pathological processes, such as gene regulation, tissue development and carcinogenesis. Although the 'microRNA sponge' function is well characterized, most circRNAs do not contain perfect trapping sites for microRNAs, which suggests the possibility that circRNAs have functions that have not yet been defined. In this study, we show that a circRNA containing an open reading frame (ORF) driven by the internal ribosome entry site (IRES) can translate a functional protein. The circular form of the SNF2 histone linker PHD RING helicase (SHPRH) gene encodes a novel protein that we termed SHPRH-146aa. Circular SHPRH (circ-SHPRH) uses overlapping genetic codes to generate a 'UGA' stop codon, which results in the translation of the 17 kDa SHPRH-146aa. Both circ-SHPRH and SHPRH-146aa are abundantly expressed in normal human brains and are down-regulated in glioblastoma. The overexpression of SHPRH-146aa in U251 and U373 glioblastoma cells reduces their malignant behavior and tumorigenicity in vitro and in vivo. Mechanistically, SHPRH-146aa protects full-length SHPRH from degradation by the ubiquitin proteasome. Stabilized SHPRH sequentially ubiquitinates proliferating cell nuclear antigen (PCNA) as an E3 ligase, leading to inhibited cell proliferation and tumorigenicity. Our findings provide a novel perspective regarding circRNA function in physiological and pathological processes. Specifically, SHPRH-146aa generated from overlapping genetic codes of circ-SHPRH is a tumor suppressor in human glioblastoma.

  20. Retrotransposon-Encoded Reverse Transcriptase in the Genesis, Progression and Cellular Plasticity of Human Cancer

    International Nuclear Information System (INIS)

    Sinibaldi-Vallebona, Paola; Matteucci, Claudia; Spadafora, Corrado

    2011-01-01

    LINE-1 (Long Interspersed Nuclear Elements) and HERVs (Human Endogenous Retroviruses) are two families of autonomously replicating retrotransposons that together account for about 28% of the human genome. Genes harbored within LINE-1 and HERV retrotransposons, particularly those encoding the reverse transcriptase (RT) enzyme, are generally expressed at low levels in differentiated cells, but their expression is upregulated in transformed cells and embryonic tissues. Here we discuss a recently discovered RT-dependent mechanism that operates in tumorigenesis and reversibly modulates phenotypic and functional variations associated with tumor progression. Downregulation of active LINE-1 elements drastically reduces the tumorigenic potential of cancer cells, paralleled by reduced proliferation and increased differentiation. Pharmacological RT inhibitors (e.g., nevirapine and efavirenz) exert similar effects on tumorigenic cell lines, both in culture and in animal models. The HERV-K family play a distinct complementary role in stress-dependent transition of melanoma cells from an adherent, non-aggressive, to a non-adherent, highly malignant, growth phenotype. In synthesis, the retrotransposon-encoded RT is increasingly emerging as a key regulator of tumor progression and a promising target in a novel anti-cancer therapy

  1. Further characterization of a highly attenuated Yersinia pestis CO92 mutant deleted for the genes encoding Braun lipoprotein and plasminogen activator protease in murine alveolar and primary human macrophages.

    Science.gov (United States)

    van Lier, Christina J; Tiner, Bethany L; Chauhan, Sadhana; Motin, Vladimir L; Fitts, Eric C; Huante, Matthew B; Endsley, Janice J; Ponnusamy, Duraisamy; Sha, Jian; Chopra, Ashok K

    2015-03-01

    We recently characterized the Δlpp Δpla double in-frame deletion mutant of Yersinia pestis CO92 molecularly, biologically, and immunologically. While Braun lipoprotein (Lpp) activates toll-like receptor-2 to initiate an inflammatory cascade, plasminogen activator (Pla) protease facilitates bacterial dissemination in the host. The Δlpp Δpla double mutant was highly attenuated in evoking bubonic and pneumonic plague, was rapidly cleared from mouse organs, and generated humoral and cell-mediated immune responses to provide subsequent protection to mice against a lethal challenge dose of wild-type (WT) CO92. Here, we further characterized the Δlpp Δpla double mutant in two murine macrophage cell lines as well as in primary human monocyte-derived macrophages to gauge its potential as a live-attenuated vaccine candidate. We first demonstrated that the Δpla single and the Δlpp Δpla double mutant were unable to survive efficiently in murine and human macrophages, unlike WT CO92. We observed that the levels of Pla and its associated protease activity were not affected in the Δlpp single mutant, and, likewise, deletion of the pla gene from WT CO92 did not alter Lpp levels. Further, our study revealed that both Lpp and Pla contributed to the intracellular survival of WT CO92 via different mechanisms. Importantly, the ability of the Δlpp Δpla double mutant to be phagocytized by macrophages, to stimulate production of tumor necrosis factor-α and interleukin-6, and to activate the nitric oxide killing pathways of the host cells remained unaltered when compared to the WT CO92-infected macrophages. Finally, macrophages infected with either the WT CO92 or the Δlpp Δpla double mutant were equally efficient in their uptake of zymosan particles as determined by flow cytometric analysis. Overall, our data indicated that although the Δlpp Δpla double mutant of Y. pestis CO92 was highly attenuated, it retained the ability to elicit innate and subsequent acquired immune

  2. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  3. Genes, Environment, and Human Behavior.

    Science.gov (United States)

    Bloom, Mark V.; Cutter, Mary Ann; Davidson, Ronald; Dougherty, Michael J.; Drexler, Edward; Gelernter, Joel; McCullough, Laurence B.; McInerney, Joseph D.; Murray, Jeffrey C.; Vogler, George P.; Zola, John

    This curriculum module explores genes, environment, and human behavior. This book provides materials to teach about the nature and methods of studying human behavior, raise some of the ethical and public policy dilemmas emerging from the Human Genome Project, and provide professional development for teachers. An extensive Teacher Background…

  4. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  5. Human visual system automatically encodes sequential regularities of discrete events.

    Science.gov (United States)

    Kimura, Motohiro; Schröger, Erich; Czigler, István; Ohira, Hideki

    2010-06-01

    For our adaptive behavior in a dynamically changing environment, an essential task of the brain is to automatically encode sequential regularities inherent in the environment into a memory representation. Recent studies in neuroscience have suggested that sequential regularities embedded in discrete sensory events are automatically encoded into a memory representation at the level of the sensory system. This notion is largely supported by evidence from investigations using auditory mismatch negativity (auditory MMN), an event-related brain potential (ERP) correlate of an automatic memory-mismatch process in the auditory sensory system. However, it is still largely unclear whether or not this notion can be generalized to other sensory modalities. The purpose of the present study was to investigate the contribution of the visual sensory system to the automatic encoding of sequential regularities using visual mismatch negativity (visual MMN), an ERP correlate of an automatic memory-mismatch process in the visual sensory system. To this end, we conducted a sequential analysis of visual MMN in an oddball sequence consisting of infrequent deviant and frequent standard stimuli, and tested whether the underlying memory representation of visual MMN generation contains only a sensory memory trace of standard stimuli (trace-mismatch hypothesis) or whether it also contains sequential regularities extracted from the repetitive standard sequence (regularity-violation hypothesis). The results showed that visual MMN was elicited by first deviant (deviant stimuli following at least one standard stimulus), second deviant (deviant stimuli immediately following first deviant), and first standard (standard stimuli immediately following first deviant), but not by second standard (standard stimuli immediately following first standard). These results are consistent with the regularity-violation hypothesis, suggesting that the visual sensory system automatically encodes sequential

  6. Cloning of Lab Gene Encoding Bacteriocin From Pediococcus acidilactici Fil Into Escherichia coli DH5a

    OpenAIRE

    Margono, Sebastian; Wijaya, Agus; Rahayu, Endang S.

    2017-01-01

    Pediococcus acidilactici F11 is able to inhibit the growth of related species of enterobacteriaceae by secreting bacteriocin. Effort to increase bacteriocin production by transforming lab gene encoding bacteriocin from P. acidilactici Fl 1 into E. colt DH5a was carried out. Plasmid pPAF11 (encoding bacteriocin from P. acidilactici F11) and p13C19 as vector which were double-digested with Madill and BamHI, ligated, and transformed into E. colt DH5a. White colonies, as indicator of transformant...

  7. Campylobacter jejuni gene cj0511 encodes a serine peptidase essential for colonisation

    Directory of Open Access Journals (Sweden)

    A.V. Karlyshev

    2014-01-01

    Full Text Available According to MEROPS peptidase database, Campylobacter species encode 64 predicted peptidases. However, proteolytic properties of only a few of these proteins have been confirmed experimentally. In this study we identified and characterised a Campylobacter jejuni gene cj0511 encoding a novel peptidase. The proteolytic activity associated with this enzyme was demonstrated in cell lysates. Moreover, enzymatic studies conducted with a purified protein confirmed a prediction of it being a serine peptidase. Furthermore, cj0511 mutant was found to be severely attenuated in chicken colonisation model, suggesting a role of the Cj0511 protein in infection.

  8. Chromosomal localization of the human and mouse hyaluronan synthase genes

    Energy Technology Data Exchange (ETDEWEB)

    Spicer, A.P.; McDonald, J.A. [Mayo Clinic Scottsdale, AZ (United States); Seldin, M.F. [Univ. of California Davis, CA (United States)] [and others

    1997-05-01

    We have recently identified a new vertebrate gene family encoding putative hyaluronan (HA) synthases. Three highly conserved related genes have been identified, designated HAS1, HAS2, and HAS3 in humans and Has1, Has2, and Has3 in the mouse. All three genes encode predicted plasma membrane proteins with multiple transmembrane domains and approximately 25% amino acid sequence identity to the Streptococcus pyogenes HA synthase, HasA. Furthermore, expression of any one HAS gene in transfected mammalian cells leads to high levels of HA biosynthesis. We now report the chromosomal localization of the three HAS genes in human and in mouse. The genes localized to three different positions within both the human and the mouse genomes. HAS1 was localized to the human chromosome 19q13.3-q13.4 boundary and Has1 to mouse Chr 17. HAS2 was localized to human chromosome 8q24.12 and Has2 to mouse Chr 15. HAS3 was localized to human chromosome 16q22.1 and Has3 to mouse Chr 8. The map position for HAS1 reinforces the recently reported relationship between a small region of human chromosome 19q and proximal mouse chromosome 17. HAS2 mapped outside the predicted critical region delineated for the Langer-Giedion syndrome and can thus be excluded as a candidate gene for this genetic syndrome. 33 refs., 2 figs.

  9. A novel GDNF-inducible gene, BMZF3, encodes a transcriptional repressor associated with KAP-1

    International Nuclear Information System (INIS)

    Suzuki, Chikage; Murakumo, Yoshiki; Kawase, Yukari; Sato, Tomoko; Morinaga, Takatoshi; Fukuda, Naoyuki; Enomoto, Atsushi; Ichihara, Masatoshi; Takahashi, Masahide

    2008-01-01

    The Krueppel-associated box (KRAB)-containing zinc finger proteins (ZFPs) comprise the largest family of zinc finger transcription factors that function as transcriptional repressors. In the study of glial cell line-derived neurotrophic factor (GDNF)-RET signaling, we have identified bone marrow zinc finger 3 (BMZF3), encoding a KRAB-ZFP, as a GDNF-inducible gene by differential display analysis. The expression of BMZF3 transcripts in the human neuroblastoma cell line TGW increased 1 h after GDNF stimulation, as determined by Northern blotting and quantitative reverse-transcriptase polymerase chain reaction. The BMZF3 possesses transcriptional repressor activity in the KRAB domain. BMZF3 interacts with a co-repressor protein, KRAB-associated protein 1 (KAP-1), through the KRAB domain and siRNA-mediated knockdown of KAP-1 abolished the transcriptional repressor activity of BMZF3, indicating that KAP-1 is necessary for BMZF3 function. Furthermore, siRNA-mediated silencing of BMZF3 inhibited cell proliferation. These findings suggest that BMZF3 is a transcriptional repressor induced by GDNF that plays a role in cell proliferation

  10. Differential roles of two SARP-encoding regulatory genes during tylosin biosynthesis.

    Science.gov (United States)

    Bate, Neil; Stratigopoulos, George; Cundliffe, Eric

    2002-01-01

    The tylosin biosynthetic gene cluster of Streptomyces fradiae is remarkable in harbouring at least five regulatory genes, two of which (tylS and tylT) encode proteins of the Streptomyces antibiotic regulatory protein (SARP) family. The aim of the present work was to assess the respective contributions of TylS and TylT to tylosin production. A combination of targeted gene disruption, fermentation studies and gene expression analysis via reverse transcriptase-polymerase chain reaction (RT-PCR) suggests that tylS is essential for tylosin production and controls the expression of tylR (previously shown to be a global activator of the biosynthetic pathway) plus at least one other gene involved in polyketide metabolism or regulation thereof. This is the first demonstration of a SARP acting to control another regulatory gene during antibiotic biosynthesis. In contrast, tylT is not essential for tylosin production.

  11. Identification of Human Housekeeping Genes and Tissue-Selective Genes by Microarray Meta-Analysis

    Science.gov (United States)

    Chang, Cheng-Wei; Cheng, Wei-Chung; Chen, Chaang-Ray; Shu, Wun-Yi; Tsai, Min-Lung; Huang, Ching-Lung; Hsu, Ian C.

    2011-01-01

    Background Categorizing protein-encoding transcriptomes of normal tissues into housekeeping genes and tissue-selective genes is a fundamental step toward studies of genetic functions and genetic associations to tissue-specific diseases. Previous studies have been mainly based on a few data sets with limited samples in each tissue, which restrained the representativeness of their identified genes, and resulted in low consensus among them. Results This study compiled 1,431 samples in 43 normal human tissues from 104 microarray data sets. We developed a new method to improve gene expression assessment, and showed that more than ten samples are needed to robustly identify the protein-encoding transcriptome of a tissue. We identified 2,064 housekeeping genes and 2,293 tissue-selective genes, and analyzed gene lists by functional enrichment analysis. The housekeeping genes are mainly involved in fundamental cellular functions, and the tissue-selective genes are strikingly related to functions and diseases corresponding to tissue-origin. We also compared agreements and related functions among our housekeeping genes and those of previous studies, and pointed out some reasons for the low consensuses. Conclusions The results indicate that sufficient samples have improved the identification of protein-encoding transcriptome of a tissue. Comprehensive meta-analysis has proved the high quality of our identified HK and TS genes. These results could offer a useful resource for future research on functional and genomic features of HK and TS genes. PMID:21818400

  12. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...

  13. A genomic analysis of disease-resistance genes encoding nucleotide binding sites in Sorghum bicolor

    Directory of Open Access Journals (Sweden)

    Xiao Cheng

    2010-01-01

    Full Text Available A large set of candidate nucleotide-binding site (NBS-encoding genes related to disease resistance was identified in the sorghum (Sorghum bicolor genome. These resistance (R genes were characterized based on their structural diversity, physical chromosomal location and phylogenetic relationships. Based on their N-terminal motifs and leucine-rich repeats (LRR, 50 non-regular NBS genes and 224 regular NBS genes were identified in 274 candidate NBS genes. The regular NBS genes were classified into ten types: CNL, CN, CNLX, CNX, CNXL, CXN, NX, N, NL and NLX. The vast majority (97% of NBS genes occurred in gene clusters, indicating extensive gene duplication in the evolution of S. bicolor NBS genes. Analysis of the S. bicolor NBS phylogenetic tree revealed two major clades. Most NBS genes were located at the distal tip of the long arms of the ten sorghum chromosomes, a pattern significantly different from rice and Arabidopsis, the NBS genes of which have a random chromosomal distribution.

  14. Comparative genomics of the family Vibrionaceae reveals the wide distribution of genes encoding virulence-associated proteins

    Directory of Open Access Journals (Sweden)

    Cai Hong

    2010-06-01

    Full Text Available Abstract Background Species of the family Vibrionaceae are ubiquitous in marine environments. Several of these species are important pathogens of humans and marine species. Evidence indicates that genetic exchange plays an important role in the emergence of new pathogenic strains within this family. Data from the sequenced genomes of strains in this family could show how the genes encoded by all these strains, known as the pangenome, are distributed. Information about the core, accessory and panproteome of this family can show how, for example, genes encoding virulence-associated proteins are distributed and help us understand how virulence emerges. Results We deduced the complete set of orthologs for eleven strains from this family. The core proteome consists of 1,882 orthologous groups, which is 28% of the 6,629 orthologous groups in this family. There were 4,411 accessory orthologous groups (i.e., proteins that occurred in from 2 to 10 proteomes and 5,584 unique proteins (encoded once on only one of the eleven genomes. Proteins that have been associated with virulence in V. cholerae were widely distributed across the eleven genomes, but the majority was found only on the genomes of the two V. cholerae strains examined. Conclusions The proteomes are reflective of the differing evolutionary trajectories followed by different strains to similar phenotypes. The composition of the proteomes supports the notion that genetic exchange among species of the Vibrionaceae is widespread and that this exchange aids these species in adapting to their environments.

  15. Chromosomal localization of the gene for the human Theta class glutathione transferase (GSTT1)

    Energy Technology Data Exchange (ETDEWEB)

    Webb, G.; Vaska, V. [Queen Elizabeth Hospital, Adelaide (Australia); Goggan, M.; Board, P. [Australian National Univ., Canberra (Australia)

    1996-04-01

    Two loci encoding Theta class glutathione transferases (GSTs) have been identified in humans. In situ hybridization studies have localized the GSTT1 gene to 22q11.2. This is the same band to which we previously localized the GSTT2 gene. This finding confirms the trend for human GST genes to be found in class-specific clusters. 20 refs., 1 fig.

  16. Metagenomic Analysis of Apple Orchard Soil Reveals Antibiotic Resistance Genes Encoding Predicted Bifunctional Proteins▿

    Science.gov (United States)

    Donato, Justin J.; Moe, Luke A.; Converse, Brandon J.; Smart, Keith D.; Berklein, Flora C.; McManus, Patricia S.; Handelsman, Jo

    2010-01-01

    To gain insight into the diversity and origins of antibiotic resistance genes, we identified resistance genes in the soil in an apple orchard using functional metagenomics, which involves inserting large fragments of foreign DNA into Escherichia coli and assaying the resulting clones for expressed functions. Among 13 antibiotic-resistant clones, we found two genes that encode bifunctional proteins. One predicted bifunctional protein confers resistance to ceftazidime and contains a natural fusion between a predicted transcriptional regulator and a β-lactamase. Sequence analysis of the entire metagenomic clone encoding the predicted bifunctional β-lactamase revealed a gene potentially involved in chloramphenicol resistance as well as a predicted transposase. A second clone that encodes a predicted bifunctional protein confers resistance to kanamycin and contains an aminoglycoside acetyltransferase domain fused to a second acetyltransferase domain that, based on nucleotide sequence, was predicted not to be involved in antibiotic resistance. This is the first report of a transcriptional regulator fused to a β-lactamase and of an aminoglycoside acetyltransferase fused to an acetyltransferase not involved in antibiotic resistance. PMID:20453147

  17. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  18. A Blumeria graminis gene family encoding proteins with a C-terminal variable region with homologues in pathogenic fungi.

    Science.gov (United States)

    Grell, Morten N; Mouritzen, Peter; Giese, Henriette

    2003-06-05

    In a study aimed at characterising, at the molecular level, the obligate biotrophic fungus Blumeria graminis f. sp. hordei (Bgh), we have identified a novel group of genes, the Egh16H genes, and shown that two of these are up-regulated during primary infection of barley leaves. The genes have partial homology to a previously characterised Bgh gene family, Egh16. Egh16 and Egh16H are subfamilies of a larger multigene family with presently about 15 members identified in Bgh. Egh16H has about ten members, and we show that five of these are expressed as highly conserved mRNAs that are predicted to encode proteins with a C-terminal variable region. Egh16H has high homology to sequences in Magnaporthe grisea and other plant pathogenic fungi, as well as sequences of both the insect pathogen Metarhizium anisopliae and the human pathogen Aspergillus fumigatus. No close homologues of Egh16H were found in the non-pathogenic fungi Neurospora crassa and Aspergillus nidulans. We predict that Egh16H plays a general role in the interaction between pathogenic fungi and their hosts. At present, the large number of gene family members with C-terminal variation appears to be unique for Bgh, and the Egh16/Egh16H gene family is to our knowledge the largest gene family so far characterised in this fungus.

  19. Distribution of genes encoding aminoglycoside-modifying enzymes among clinical isolates of methicillin-resistant staphylococci.

    Science.gov (United States)

    Perumal, N; Murugesan, S; Krishnan, P

    2016-01-01

    The objective of this study was to determine the distribution of genes encoding aminoglycoside-modifying enzymes (AMEs) and staphylococcal cassette chromosome mec (SCCmec) elements among clinical isolates of methicillin-resistant staphylococci (MRS). Antibiotic susceptibility test was done using Kirby-Bauer disk diffusion method. The presence of SCCmec types and AME genes, namely, aac (6')-Ie-aph (2''), aph (3')-IIIa and ant (4')-Ia was determined using two different multiplex polymerase chain reaction. The most encountered AME genes were aac (6')-Ie-aph (2'') (55.4%) followed by aph (3')-IIIa (32.3%) and ant (4')-Ia gene (9%). SCCmec type I (34%) was predominant in this study. In conclusion, the aac (6')-Ie-aph (2'') was the most common AME gene and SCCmec type I was most predominant among the MRS isolates.

  20. Fasciola hepatica mucin-encoding gene: expression, variability and its potential relevance in host-parasite relationship.

    Science.gov (United States)

    Cancela, Martín; Santos, Guilherme B; Carmona, Carlos; Ferreira, Henrique B; Tort, José Francisco; Zaha, Arnaldo

    2015-12-01

    Fasciola hepatica is the causative agent of fasciolosis, a zoonosis with significant impact both in human and animal health. Understanding the basic processes of parasite biology, especially those related to interactions with its host, will contribute to control F. hepatica infections and hence liver pathology. Mucins have been described as important mediators for parasite establishment within its host, due to their key roles in immune evasion. In F. hepatica, mucin expression is upregulated in the mammalian invasive newly excysted juvenile (NEJ) stage in comparison with the adult stage. Here, we performed sequencing of mucin cDNAs prepared from NEJ RNA, resulting in six different cDNAs clusters. The differences are due to the presence of a tandem repeated sequence of 66 bp encoded by different exons. Two groups of apomucins one with three and the other with four repeats, with 459 and 393 bp respectively, were identified. These cDNAs have open reading frames encoding Ser-Thr enriched proteins with an N-terminal signal peptide, characteristic of apomucin backbone. We cloned a 4470 bp gene comprising eight exons and seven introns that encodes all the cDNA variants identified in NEJs. By real time polymerase chain reaction and high-resolution melting approaches of individual flukes we infer that fhemuc-1 is a single-copy gene, with at least two different alleles. Our data suggest that both gene polymorphism and alternative splicing might account for apomucin variability in the fhemuc-1 gene that is upregulated in NEJ invasive stage. The relevance of this variation in host-parasite interplay is discussed.

  1. MfLIP1, a gene encoding an extracellular lipase of the lipid-dependent fungus Malassezia furfur.

    Science.gov (United States)

    Brunke, Sascha; Hube, Bernhard

    2006-02-01

    Malassezia furfur is a dimorphic fungus and a member of the normal cutaneous microflora of humans. However, it is also a facultative pathogen, associated with a wide range of skin diseases. One unusual feature of M. furfur is an absolute dependency on externally provided lipids which the fungus hydrolyses by lipolytic activity to release fatty acids necessary for both growth and pathogenicity. In this study, the cloning and characterization of the first gene encoding a secreted lipase of M. furfur possibly associated with this activity are reported. The gene, MfLIP1, shows high sequence similarity to other known extracellular lipases, but is not a member of a lipase gene family in M. furfur. MfLIP1 consists of 1464 bp, encoding a protein with a molecular mass of 54.3 kDa, a conserved lipase motif and an N-terminal signal peptide of 26 aa. By using a genomic library, two other genes were identified flanking MfLIP1, one of them encoding a putative secreted catalase, the other a putative amine oxidase. The cDNA of MfLIP1 was expressed in Pichia pastoris and the biochemical properties of the recombinant lipase were analysed. MfLip1 is most active at 40 degrees C and the pH optimum was found to be 5.8. The lipase hydrolysed lipids, such as Tweens, frequently used as the source of fatty acids in M. furfur media, and had minor esterase activity. Furthermore, the lipase is inhibited by different bivalent metal ions. This is the first molecular description of a secreted lipase from M. furfur.

  2. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  3. Encoding of Auditory Temporal Gestalt in the Human Brain.

    Science.gov (United States)

    Notter, Michael P; Hanke, Michael; Murray, Micah M; Geiser, Eveline

    2018-01-20

    The perception of an acoustic rhythm is invariant to the absolute temporal intervals constituting a sound sequence. It is unknown where in the brain temporal Gestalt, the percept emerging from the relative temporal proximity between acoustic events, is encoded. Two different relative temporal patterns, each induced by three experimental conditions with different absolute temporal patterns as sensory basis, were presented to participants. A linear support vector machine classifier was trained to differentiate activation patterns in functional magnetic resonance imaging data to the 2 different percepts. Across the sensory constituents the classifier decoded which percept was perceived. A searchlight analysis localized activation patterns specific to the temporal Gestalt bilaterally to the temporoparietal junction, including the planum temporale and supramarginal gyrus, and unilaterally to the right inferior frontal gyrus (pars opercularis). We show that auditory areas not only process absolute temporal intervals, but also integrate them into percepts of Gestalt and that encoding of these percepts persists in high-level associative areas. The findings complement existing knowledge regarding the processing of absolute temporal patterns to the processing of relative temporal patterns relevant to the sequential binding of perceptual elements into Gestalt. © The Author 2018. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail: journals.permissions@oup.com.

  4. Human papillomavirus gene expression

    International Nuclear Information System (INIS)

    Chow, L.T.; Hirochika, H.; Nasseri, M.; Stoler, M.H.; Wolinsky, S.M.; Chin, M.T.; Hirochika, R.; Arvan, D.S.; Broker, T.R.

    1987-01-01

    To determine the role of tissue differentiation on expression of each of the papillomavirus mRNA species identified by electron microscopy, the authors prepared exon-specific RNA probes that could distinguish the alternatively spliced mRNA species. Radioactively labeled single-stranded RNA probes were generated from a dual promoter vector system and individually hybridized to adjacent serial sections of formalin-fixed, paraffin-embedded biopsies of condylomata. Autoradiography showed that each of the message species had a characteristic tissue distribution and relative abundance. The authors have characterized a portion of the regulatory network of the HPVs by showing that the E2 ORF encodes a trans-acting enhancer-stimulating protein, as it does in BPV-1 (Spalholz et al. 1985). The HPV-11 enhancer was mapped to a 150-bp tract near the 3' end of the URR. Portions of this region are duplicated in some aggressive strains of HPV-6 (Boshart and zur Hausen 1986; Rando et al. 1986). To test the possible biological relevance of these duplications, they cloned tandem arrays of the enhancer and demonstrated, using a chloramphenicol acetyltransferase (CAT) assay, that they led to dramatically increased transcription proportional to copy number. Using the CAT assays, the authors found that the E2 proteins of several papillomavirus types can cross-stimulate the enhancers of most other types. This suggests that prior infection of a tissue with one papillomavirus type may provide a helper effect for superinfection and might account fo the HPV-6/HPV-16 coinfections in condylomata that they have observed

  5. A multiplex PCR for detection of genes encoding exfoliative toxins from Staphylococcus hyicus

    DEFF Research Database (Denmark)

    Andresen, Lars Ole; Ahrens, Peter

    2004-01-01

    Aims: To develop a multiplex PCR for detection of genes encoding the exfoliative toxins ExhA, ExhB, ExhC and ExhD from Staphylococcus hyicus and to estimate the prevalence of exfoliative toxins among Staph. hyicus isolates from Danish pig herds with exudative epidermitis (EE). Methods and Results......: A multiplex PCR employing specific primers for each of the genes encoding four different exfoliative toxins was developed and evaluated using a collection of Staph. hyicus with known toxin type and a number of other staphylococcal species. A total of 314 Staph. hyicus isolates from pigs with EE were screened...... by multiplex PCR and the combined results of the present and previous investigations showed that ExhA, ExhB, ExhC and ExhD was found in 20, 33, 18 and 22%, respectively, of 60 cases of EE investigated. Conclusions: This study has provided a new tool for detection of toxigenic Staph. hyicus and a more...

  6. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  7. Sca1, a previously undescribed paralog from autotransporter protein-encoding genes in Rickettsia species

    Directory of Open Access Journals (Sweden)

    Raoult Didier

    2006-02-01

    Full Text Available Abstract Background Among the 17 genes encoding autotransporter proteins of the "surface cell antigen" (sca family in the currently sequenced Rickettsia genomes, ompA, sca5 (ompB and sca4 (gene D, have been extensively used for identification and phylogenetic purposes for Rickettsia species. However, none of these genes is present in all 20 currently validated Rickettsia species. Of the remaining 14 sca genes, sca1 is the only gene to be present in all nine sequenced Rickettsia genomes. To estimate whether the sca1 gene is present in all Rickettsia species and its usefulness as an identification and phylogenetic tool, we searched for sca1genes in the four published Rickettsia genomes and amplified and sequenced this gene in the remaining 16 validated Rickettsia species. Results Sca1 is the only one of the 17 rickettsial sca genes present in all 20 Rickettsia species. R. prowazekii and R. canadensis exhibit a split sca1 gene whereas the remaining species have a complete gene. Within the sca1 gene, we identified a 488-bp variable sequence fragment that can be amplified using a pair of conserved primers. Sequences of this fragment are specific for each Rickettsia species. The phylogenetic organization of Rickettsia species inferred from the comparison of sca1 sequences strengthens the classification based on the housekeeping gene gltA and is similar to those obtained from the analyses of ompA, sca5 and sca4, thus suggesting similar evolutionary constraints. We also observed that Sca1 protein sequences have evolved under a dual selection pressure: with the exception of typhus group rickettsiae, the amino-terminal part of the protein that encompasses the predicted passenger domain, has evolved under positive selection in rickettsiae. This suggests that the Sca1 protein interacts with the host. In contrast, the C-terminal portion containing the autotransporter domain has evolved under purifying selection. In addition, sca1 is transcribed in R. conorii

  8. fexA, a Novel Staphylococcus lentus Gene Encoding Resistance to Florfenicol and Chloramphenicol

    Science.gov (United States)

    Kehrenberg, Corinna; Schwarz, Stefan

    2004-01-01

    The Staphylococcus lentus plasmid pSCFS2 carries a novel florfenicol-chloramphenicol resistance gene, designated fexA, encoding a protein of 475 amino acids with 14 transmembrane domains. The FexA protein differs from all previously known proteins involved in the efflux of chloramphenicol and florfenicol. Induction of fexA expression by chloramphenicol and florfenicol occurs via translational attenuation.   PMID:14742219

  9. Sequencing the Gene Encoding Manganese-Dependent Superoxide Dismutase for Rapid Species Identification of Enterococci

    OpenAIRE

    Poyart, Claire; Quesnes, Gilles; Trieu-Cuot, Patrick

    2000-01-01

    Simple PCR and sequencing assays that utilize a single pair of degenerate primers were used to characterize a 438-bp-long DNA fragment internal (sodAint) to the sodA gene encoding the manganese-dependent superoxide dismutase in 19 enterococcal type strains (Enterococcus avium, Enterococcus casseliflavus, Enterococcus cecorum, Enterococcus columbae, Enterococcus dispar, Enterococcus durans, Enterococcus faecalis, Enterococcus faecium, Enterococcus flavescens, Enterococcus gallinarum, Enterococ...

  10. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  11. Cloning of the gene encoding the δ subunit of the human T-cell receptor reveals its physical organization within the α-subunit locus and its involvement in chromosome translocations in T-cell malignancy

    International Nuclear Information System (INIS)

    Isobe, M.; Russo, G.; Haluska, F.G.; Croce, C.M.

    1988-01-01

    By taking advantage of chromosomal walking techniques, the authors have obtained clones that encompass the T-cell receptor (TCR) δ-chain gene. They analyzed clones spanning the entire J α region extending 115 kilobases 5' of the TCR α-chain constant region and have shown that the TCR δ-chain gene is located over 80 kilobases 5' of C α . TCR δ-chain gene is rearranged in the γ/δ-expressing T-cell line Peer and is deleted in α/β-expressing T-cell lines. Sequence analysis of portions of this genomic region demonstrates its identity with previously described cDNA clones corresponding to the C δ and J δ segments. Furthermore, they have analyzed a t(8;14)-(q24;q11) chromosome translocation from a T-cell leukemia and have shown that the J δ segment is rearranged in cells deriving from this tumor and probably directly involved in the translocation. Thus, the newly clones TCR δ chain is implicated in the genesis of chromosome translocations in T-cell malignancies carrying cytogenetic abnormalities of band 14q11

  12. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  13. Gene losses during human origins.

    Directory of Open Access Journals (Sweden)

    Xiaoxia Wang

    2006-03-01

    Full Text Available Pseudogenization is a widespread phenomenon in genome evolution, and it has been proposed to serve as an engine of evolutionary change, especially during human origins (the "less-is-more" hypothesis. However, there has been no comprehensive analysis of human-specific pseudogenes. Furthermore, it is unclear whether pseudogenization itself can be selectively favored and thus play an active role in human evolution. Here we conduct a comparative genomic analysis and a literature survey to identify 80 nonprocessed pseudogenes that were inactivated in the human lineage after its separation from the chimpanzee lineage. Many functions are involved among these genes, with chemoreception and immune response being outstandingly overrepresented, suggesting potential species-specific features in these aspects of human physiology. To explore the possibility of adaptive pseudogenization, we focus on CASPASE12, a cysteinyl aspartate proteinase participating in inflammatory and innate immune response to endotoxins. We provide population genetic evidence that the nearly complete fixation of a null allele at CASPASE12 has been driven by positive selection, probably because the null allele confers protection from severe sepsis. We estimate that the selective advantage of the null allele is about 0.9% and the pseudogenization started shortly before the out-of-Africa migration of modern humans. Interestingly, two other genes related to sepsis were also pseudogenized in humans, possibly by selection. These adaptive gene losses might have occurred because of changes in our environment or genetic background that altered the threat from or response to sepsis. The identification and analysis of human-specific pseudogenes open the door for understanding the roles of gene losses in human origins, and the demonstration that gene loss itself can be adaptive supports and extends the "less-is-more" hypothesis.

  14. Enterotoxin-Encoding Genes in Staphylococcus spp. from Food Handlers in a University Restaurant.

    Science.gov (United States)

    da Silva, Sabina Dos Santos Paulino; Cidral, Thiago André; Soares, Maria José dos Santos; de Melo, Maria Celeste Nunes

    2015-11-01

    Food handlers carrying enterotoxin-producing Staphylococcus are a potential source of food poisoning. The aim of this study was to analyze genes encoding enterotoxins in coagulase-positive Staphylococcus (CoPS) and coagulase-negative Staphylococcus (CoNS) isolated from the anterior nostrils and hands of food handlers at a university restaurant in the city of Natal, Northeast Brazil. Thirty food handlers were screened for the study. The isolates were subjected to Gram staining, a bacitracin sensitivity test, mannitol fermentation, and catalase and coagulase tests. CoNS and CoPS strains were subsequently identified by a Vitek 2 System (BioMerieux, France) and various biochemical tests. Polymerase chain reaction was used to detect genes for enterotoxins A, B, C, D, E, G, H, and I (sea, seb, sec, sed, see, seg, seh, and sei) and a disc-diffusion method was used to determine susceptibility to several classes of antimicrobials. All food handlers presented staphylococci on their hands and/or noses. The study found 58 Staphylococcus spp., of which 20.7% were CoPS and 79.3% were CoNS. S. epidermidis was the most prevalent species. Twenty-nine staphylococci (50%) were positive for one or more enterotoxin genes, and the most prevalent genes were seg and sei, each with a frequency of 29.3%. Indeed, CoNS encoded a high percentage of enterotoxin genes (43.5%). However, S. aureus encoded even more enterotoxin genes (75%). Most isolates showed sensitivity to the antibiotics used for testing, except for penicillin (only 35% sensitive). The results from this study reinforce that coagulase-negative as well as coagulase-positive staphylococci isolated from food handlers are capable of genotypic enterotoxigenicity.

  15. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  16. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  17. Mutations in the gene encoding epsilon-sarcoglycan cause myoclonus-dystonia syndrome.

    Science.gov (United States)

    Zimprich, A; Grabowski, M; Asmus, F; Naumann, M; Berg, D; Bertram, M; Scheidtmann, K; Kern, P; Winkelmann, J; Müller-Myhsok, B; Riedel, L; Bauer, M; Müller, T; Castro, M; Meitinger, T; Strom, T M; Gasser, T

    2001-09-01

    The dystonias are a common clinically and genetically heterogeneous group of movement disorders. More than ten loci for inherited forms of dystonia have been mapped, but only three mutated genes have been identified so far. These are DYT1, encoding torsin A and mutant in the early-onset generalized form, GCH1 (formerly known as DYT5), encoding GTP-cyclohydrolase I and mutant in dominant dopa-responsive dystonia, and TH, encoding tyrosine hydroxylase and mutant in the recessive form of the disease. Myoclonus-dystonia syndrome (MDS; DYT11) is an autosomal dominant disorder characterized by bilateral, alcohol-sensitive myoclonic jerks involving mainly the arms and axial muscles. Dystonia, usually torticollis and/or writer's cramp, occurs in most but not all affected patients and may occasionally be the only symptom of the disease. In addition, patients often show prominent psychiatric abnormalities, including panic attacks and obsessive-compulsive behavior. In most MDS families, the disease is linked to a locus on chromosome 7q21 (refs. 11-13). Using a positional cloning approach, we have identified five different heterozygous loss-of-function mutations in the gene for epsilon-sarcoglycan (SGCE), which we mapped to a refined critical region of about 3.2 Mb. SGCE is expressed in all brain regions examined. Pedigree analysis shows a marked difference in penetrance depending on the parental origin of the disease allele. This is indicative of a maternal imprinting mechanism, which has been demonstrated in the mouse epsilon-sarcoglycan gene.

  18. Nuclear-encoded factors involved in post-transcriptional processing and modification of mitochondrial tRNAs in human disease

    Directory of Open Access Journals (Sweden)

    Christopher A Powell

    2015-03-01

    Full Text Available The human mitochondrial genome (mtDNA encodes twenty-two tRNAs (mt-tRNAs that are necessary for the intraorganellar translation of the thirteen mtDNA-encoded subunits of the mitochondrial respiratory chain complexes. Maturation of mt-tRNAs involves 5’ and 3’ nucleolytic excision from precursor RNAs, as well as extensive post-transcriptional modifications. Recent data suggest that over 7 % of all mt-tRNA residues in mammals undergo post-transcriptional modification, with over 30 different modified mt-tRNA positions so far described. These processing and modification steps are necessary for proper mt-tRNA function, and are performed by dedicated, nuclear-encoded enzymes. Recent growing evidence suggests that mutations in these nuclear genes, leading to incorrect maturation of mt-tRNAs, are a cause of human mitochondrial disease. Furthermore, mtDNA mutations in mt-tRNA genes, which may also affect mt-tRNA function, processing and modification, are also frequently associated with human disease. In theory, all pathogenic mt-tRNA variants should be expected to affect only a single process, which is mitochondrial translation, albeit to various extents. However, the clinical manifestations of mitochondrial disorders linked to mutations in mt-tRNAs are extremely heterogeneous, ranging from defects of a single tissue to complex multisystem disorders. This review focuses on the current knowledge of nuclear genes coding for proteins involved in mt-tRNA maturation that have been linked to human mitochondrial pathologies. We further discuss the possibility that tissue specific regulation of mt-tRNA modifying enzymes could play an important role in the clinical heterogeneity observed for mitochondrial diseases caused by mutations in mt-tRNA genes.

  19. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  20. The ispB gene encoding octaprenyl diphosphate synthase is essential for growth of Escherichia coli.

    OpenAIRE

    Okada, K; Minehira, M; Zhu, X; Suzuki, K; Nakagawa, T; Matsuda, H; Kawamukai, M

    1997-01-01

    The Escherichia coli ispB gene encoding octaprenyl diphosphate synthase is responsible for the synthesis of the side chain of isoprenoid quinones. We tried to construct an E. coli ispB-disrupted mutant but could not isolate the chromosomal ispB disrupted mutant unless the ispB gene or its homolog was supplied on a plasmid. The chromosomal ispB disruptants that harbored plasmids carrying the ispB homologs from Haemophilus influenzae and Synechocystis sp. strain PCC6803 produced mainly ubiquino...

  1. PRS1 is a key member of the gene family encoding phosphoribosylpyrophosphate synthetase in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Carter, Andrew T.; Beiche, Flora; Hove-Jensen, Bjarne

    1997-01-01

    In Saccharomyces cerevisiae the metabolite phosphoribosyl-pyrophosphate (PRPP) is required for purine, pyrimidine, tryptophan and histidine biosynthesis. Enzymes that can synthesize PRPP can be encoded by at least four genes. We have studied 5-phospho-ribosyl-1(α)-pyrophosphate synthetases (PRS......) genetically and biochemically. Each of the four genes, all of which are transcribed, has been disrupted in haploid yeast strains of each mating type and although all disruptants are able to grow on complete medium, differences in growth rate and enzyme activity suggest that disruption of PRS1 or PRS3 has...

  2. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  3. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  4. Defining the Role of Essential Genes in Human Disease

    Science.gov (United States)

    Robertson, David L.; Hentges, Kathryn E.

    2011-01-01

    A greater understanding of the causes of human disease can come from identifying characteristics that are specific to disease genes. However, a full understanding of the contribution of essential genes to human disease is lacking, due to the premise that these genes tend to cause developmental abnormalities rather than adult disease. We tested the hypothesis that human orthologs of mouse essential genes are associated with a variety of human diseases, rather than only those related to miscarriage and birth defects. We segregated human disease genes according to whether the knockout phenotype of their mouse ortholog was lethal or viable, defining those with orthologs producing lethal knockouts as essential disease genes. We show that the human orthologs of mouse essential genes are associated with a wide spectrum of diseases affecting diverse physiological systems. Notably, human disease genes with essential mouse orthologs are over-represented among disease genes associated with cancer, suggesting links between adult cellular abnormalities and developmental functions. The proteins encoded by essential genes are highly connected in protein-protein interaction networks, which we find correlates with an over-representation of nuclear proteins amongst essential disease genes. Disease genes associated with essential orthologs also are more likely than those with non-essential orthologs to contribute to disease through an autosomal dominant inheritance pattern, suggesting that these diseases may actually result from semi-dominant mutant alleles. Overall, we have described attributes found in disease genes according to the essentiality status of their mouse orthologs. These findings demonstrate that disease genes do occupy highly connected positions in protein-protein interaction networks, and that due to the complexity of disease-associated alleles, essential genes cannot be ignored as candidates for causing diverse human diseases. PMID:22096564

  5. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  6. Selection and characterization of forest soil metagenome genes encoding lipolytic enzymes.

    Science.gov (United States)

    Hong, Kyung Sik; Lim, He Kyoung; Chung, Eu Jin; Park, Eun Jin; Lee, Myung Hwan; Kim, Jin-Cheol; Choi, Gyung Ja; Cho, Kwang Yun; Lee, Seon-Woo

    2007-10-01

    A metagenome is a unique resource to search for novel microbial enzymes from the unculturable microorganisms in soil. A forest soil metagenomic library using a fosmid and soil microbial DNA from Gwangneung forest, Korea, was constructed in Escherichia coli and screened to select lipolytic genes. A total of seven unique lipolytic clones were selected by screening of the 31,000-member forest soil metagenome library based on tributyrin hydrolysis. The ORFs for lipolytic activity were subcloned in a high copy number plasmid by screening the secondary shortgun libraries from the seven clones. Since the lipolytic enzymes were well secreted in E. coli into the culture broth, the lipolytic activity of the subclones was confirmed by the hydrolysis of p-nitrophenyl butyrate using culture broth. Deduced amino acid sequence analysis of the identified ORFs for lipolytic activity revealed that 4 genes encode hormone-sensitive lipase (HSL) in lipase family IV. Phylogenetic analysis indicated that 4 proteins were clustered with HSL in the database and other metagenomic HSLs. The other 2 genes and 1 gene encode non-heme peroxidase-like enzymes of lipase family V and a GDSL family esterase/lipase in family II, respectively. The gene for the GDSL enzyme is the first description of the enzyme from metagenomic screening.

  7. Production of cyanophycin in Rhizopus oryzae through the expression of a cyanophycin synthetase encoding gene.

    Science.gov (United States)

    Meussen, Bas J; Weusthuis, Ruud A; Sanders, Johan P M; Graaff, Leo H de

    2012-02-01

    Cyanophycin or cyanophycin granule peptide is a protein that results from non-ribosomal protein synthesis in microorganisms such as cyanobacteria. The amino acids in cyanophycin can be used as a feedstock in the production of a wide range of chemicals such as acrylonitrile, polyacrylic acid, 1,4-butanediamine, and urea. In this study, an auxotrophic mutant (Rhizopus oryzae M16) of the filamentous fungus R. oryzae 99-880 was selected to express cyanophycin synthetase encoding genes. These genes originated from Synechocystis sp. strain PCC6803, Anabaena sp. strain PCC7120, and a codon optimized version of latter gene. The genes were under control of the pyruvate decarboxylase promoter and terminator elements of R. oryzae. Transformants were generated by the biolistic transformation method. In only two transformants both expressing the cyanophycin synthetase encoding gene from Synechocystis sp. strain PCC6803 was a specific enzyme activity detected of 1.5 mU/mg protein. In one of these transformants was both water-soluble and insoluble cyanophycin detected. The water-soluble fraction formed the major fraction and accounted for 0.5% of the dry weight. The water-insoluble CGP was produced in trace amounts. The amino acid composition of the water-soluble form was determined and constitutes of equimolar amounts of arginine and aspartic acid.

  8. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is only...... expressed in M cells and the gene product is responsible for the secretion of the mating pheromone. M-factor, a nonapeptide that is S-farnesylated and carboxy-methylated on its C-terminal cysteine residue. The predicted Mam1 protein is highly homologous to mammalian multiple drug-resistance proteins...... and to the Saccharomyces cerevisiae STE6 gene product, which mediates export of a-factor mating pheromone. We show that STE6 can also mediate secretion of M-factor in S. pombe....

  9. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  10. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis

    Directory of Open Access Journals (Sweden)

    González Mauricio

    2009-09-01

    Full Text Available Abstract Background Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Results Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Conclusion Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we

  11. Genes encoding novel secreted and transmembrane proteins are temporally and spatially regulated during Drosophila melanogaster embryogenesis.

    Science.gov (United States)

    Zúñiga, Alejandro; Hödar, Christian; Hanna, Patricia; Ibáñez, Freddy; Moreno, Pablo; Pulgar, Rodrigo; Pastenes, Luis; González, Mauricio; Cambiazo, Verónica

    2009-09-22

    Morphogenetic events that shape the Drosophila melanogaster embryo are tightly controlled by a genetic program in which specific sets of genes are up-regulated. We used a suppressive subtractive hybridization procedure to identify a group of developmentally regulated genes during early stages of D. melanogaster embryogenesis. We studied the spatiotemporal activity of these genes in five different intervals covering 12 stages of embryogenesis. Microarrays were constructed to confirm induction of expression and to determine the temporal profile of isolated subtracted cDNAs during embryo development. We identified a set of 118 genes whose expression levels increased significantly in at least one developmental interval compared with a reference interval. Of these genes, 53% had a phenotype and/or molecular function reported in the literature, whereas 47% were essentially uncharacterized. Clustering analysis revealed demarcated transcript groups with maximum gene activity at distinct developmental intervals. In situ hybridization assays were carried out on 23 uncharacterized genes, 15 of which proved to have spatiotemporally restricted expression patterns. Among these 15 uncharacterized genes, 13 were found to encode putative secreted and transmembrane proteins. For three of them we validated our protein sequence predictions by expressing their cDNAs in Drosophila S2R+ cells and analyzed the subcellular distribution of recombinant proteins. We then focused on the functional characterization of the gene CG6234. Inhibition of CG6234 by RNA interference resulted in morphological defects in embryos, suggesting the involvement of this gene in germ band retraction. Our data have yielded a list of developmentally regulated D. melanogaster genes and their expression profiles during embryogenesis and provide new information on the spatiotemporal expression patterns of several uncharacterized genes. In particular, we recovered a substantial number of unknown genes encoding

  12. Determining the Neural Substrate for Encoding a Memory of Human Pain and the Influence of Anxiety.

    Science.gov (United States)

    Tseng, Ming-Tsung; Kong, Yazhuo; Eippert, Falk; Tracey, Irene

    2017-12-06

    To convert a painful stimulus into a briefly maintainable construct when the painful stimulus is no longer accessible is essential to guide human behavior and avoid dangerous situations. Because of the aversive nature of pain, this encoding process might be influenced by emotional aspects and could thus vary across individuals, but we have yet to understand both the basic underlying neural mechanisms as well as potential interindividual differences. Using fMRI in combination with a delayed-discrimination task in healthy volunteers of both sexes, we discovered that brain regions involved in this working memory encoding process were dissociable according to whether the to-be-remembered stimulus was painful or not, with the medial thalamus and the rostral anterior cingulate cortex encoding painful and the primary somatosensory cortex encoding nonpainful stimuli. Encoding of painful stimuli furthermore significantly enhanced functional connectivity between the thalamus and medial prefrontal cortex (mPFC). With regards to emotional aspects influencing encoding processes, we observed that more anxious participants showed significant performance advantages when encoding painful stimuli. Importantly, only during the encoding of pain, the interindividual differences in anxiety were associated with the strength of coupling between medial thalamus and mPFC, which was furthermore related to activity in the amygdala. These results indicate not only that there is a distinct signature for the encoding of a painful experience in humans, but also that this encoding process involves a strong affective component. SIGNIFICANCE STATEMENT To convert the sensation of pain into a briefly maintainable construct is essential to guide human behavior and avoid dangerous situations. Although this working memory encoding process is implicitly contained in the majority of studies, the underlying neural mechanisms remain unclear. Using fMRI in a delayed-discrimination task, we found that the

  13. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  14. A DNMT3B alternatively spliced exon and encoded peptide are novel biomarkers of human pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Sailesh Gopalakrishna-Pillai

    Full Text Available A major obstacle in human stem cell research is the limited number of reagents capable of distinguishing pluripotent stem cells from partially differentiated or incompletely reprogrammed derivatives. Although human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs express numerous alternatively spliced transcripts, little attention has been directed at developing splice variant-encoded protein isoforms as reagents for stem cell research. In this study, several genes encoding proteins involved in important signaling pathways were screened to detect alternatively spliced transcripts that exhibited differential expression in pluripotent stem cells (PSCs relative to spontaneously differentiated cells (SDCs. Transcripts containing the alternatively spliced exon 10 of the de novo DNA methyltransferase gene, DNMT3B, were identified that are expressed in PSCs. To demonstrate the utility and superiority of splice variant specific reagents for stem cell research, a peptide encoded by DNMT3B exon 10 was used to generate an antibody, SG1. The SG1 antibody detects a single DNMT3B protein isoform that is expressed only in PSCs but not in SDCs. The SG1 antibody is also demonstrably superior to other antibodies at distinguishing PSCs from SDCs in mixed cultures containing both pluripotent stem cells and partially differentiated derivatives. The tightly controlled down regulation of DNMT3B exon 10 containing transcripts (and exon 10 encoded peptide upon spontaneous differentiation of PSCs suggests that this DNMT3B splice isoform is characteristic of the pluripotent state. Alternatively spliced exons, and the proteins they encode, represent a vast untapped reservoir of novel biomarkers that can be used to develop superior reagents for stem cell research and to gain further insight into mechanisms controlling stem cell pluripotency.

  15. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  16. A highly conserved NB-LRR encoding gene cluster effective against Setosphaeria turcica in sorghum

    Directory of Open Access Journals (Sweden)

    Martin Tom

    2011-11-01

    Full Text Available Abstract Background The fungal pathogen Setosphaeria turcica causes turcicum or northern leaf blight disease on maize, sorghum and related grasses. A prevalent foliar disease found worldwide where the two host crops, maize and sorghum are grown. The aim of the present study was to find genes controlling the host defense response to this devastating plant pathogen. A cDNA-AFLP approach was taken to identify candidate sequences, which functions were further validated via virus induced gene silencing (VIGS, and real-time PCR analysis. Phylogenetic analysis was performed to address evolutionary events. Results cDNA-AFLP analysis was run on susceptible and resistant sorghum and maize genotypes to identify resistance-related sequences. One CC-NB-LRR encoding gene GRMZM2G005347 was found among the up-regulated maize transcripts after fungal challenge. The new plant resistance gene was designated as St referring to S. turcica. Genome sequence comparison revealed that the CC-NB-LRR encoding St genes are located on chromosome 2 in maize, and on chromosome 5 in sorghum. The six St sorghum genes reside in three pairs in one locus. When the sorghum St genes were silenced via VIGS, the resistance was clearly compromised, an observation that was supported by real-time PCR. Database searches and phylogenetic analysis suggest that the St genes have a common ancestor present before the grass subfamily split 50-70 million years ago. Today, 6 genes are present in sorghum, 9 in rice and foxtail millet, respectively, 3 in maize and 4 in Brachypodium distachyon. The St gene homologs have all highly conserved sequences, and commonly reside as gene pairs in the grass genomes. Conclusions Resistance genes to S. turcica, with a CC-NB-LRR protein domain architecture, have been found in maize and sorghum. VIGS analysis revealed their importance in the surveillance to S. turcica in sorghum. The St genes are highly conserved in sorghum, rice, foxtail millet, maize and

  17. A multigene family encodes the human cytomegalovirus glycoprotein complex gcII (gp47-52 complex)

    International Nuclear Information System (INIS)

    Gretch, D.R.; Stinski, M.F.; Kari, B.; Gehrz, R.C.

    1988-01-01

    The HXLF (HindIII-X left reading frame) gene family is a group of five genes that share one or two regions of homology and are arranged in tandem within the short unique component of the human cytomegalovirus genome. These genes were cloned into an SP6 expression vector in both the sense and antisense orientations. An abundant 1.62-kilobase (kb) bicistronic mRNA, predicted to originate from HXLF1 and HXLF2, was detected in the cytoplasm of infected human fibroblast cells by Northern (RNA) blot analysis. Less abundant RNAs of 1.0 and 0.8 kb, predicted to originate from the HXLF5 and HXLF2 genes, respectively, were also detected. Monocistronic, bicistronic, and polycistronic RNAs synthesized in vitro by using SP6 polymerase were translated in rabbit reticulocyte lysates with or without canine pancreatic microsomal membranes. The HXLF1 or the HXLF1 and HXLF2 translation products were detected when the above mRNAs were used. The HXLF3, HXLF4, and HXLF5 gene products were not detected by in vitro translation of the SP6-derived polycistronic mRNA. The amino acid composition of gp47-52 purified from virion envelopes has the highest similarity to the predicted amino acid composition of the HXLF1 plus HXLF2 open reading frames, but it is more similar to HXLF2 than to HXLF1. The Northern blot results imply that gp47-52 is synthesized predominantly from the abundant 1.62-kb bicistronic mRNA encoded by the HXLF1 and HXLF2 genes. However, the glycoprotein could also be synthesized by the monocistronic 0.8-kb mRNA encoded by the HXLF2 gene as well as by the mRNAs predicted from the other HXLF genes

  18. Encoding the identity and location of objects in human LOC.

    Science.gov (United States)

    Cichy, Radoslaw Martin; Chen, Yi; Haynes, John-Dylan

    2011-02-01

    We are able to recognize objects independent of their location in the visual field. At the same time, we also keep track of the location of objects to orient ourselves and to interact with the environment. The lateral occipital complex (LOC) has been suggested as the prime cortical region for representation of object identity. However, the extent to which LOC also represents object location has remained debated. In this study we used high-resolution fMRI in combination with multivoxel pattern classification to investigate the cortical encoding of three object exemplars from four different categories presented in two different locations. This approach allowed us to study location-tolerant object information and object-tolerant location information in LOC, both at the level of categories and exemplars. We found evidence for both location-tolerant object information and object-tolerant location information in LOC at the level of categories and exemplars. Our results further highlight the mixing of identity and location information in the ventral visual pathway. Copyright © 2010 Elsevier Inc. All rights reserved.

  19. Comparing the evolutionary conservation between human essential genes, human orthologs of mouse essential genes and human housekeeping genes.

    Science.gov (United States)

    Lv, Wenhua; Zheng, Jiajia; Luan, Meiwei; Shi, Miao; Zhu, Hongjie; Zhang, Mingming; Lv, Hongchao; Shang, Zhenwei; Duan, Lian; Zhang, Ruijie; Jiang, Yongshuai

    2015-11-01

    Human housekeeping genes are often confused with essential human genes, and several studies regard both types of genes as having the same level of evolutionary conservation. However, this is not necessarily the case. To clarify this, we compared the differences between human housekeeping genes and essential human genes with respect to four aspects: the evolutionary rate (dN/dS), protein sequence identity, single-nucleotide polymorphism (SNP) density and level of linkage disequilibrium (LD). The results showed that housekeeping genes had lower evolutionary rates, higher sequence identities, lower SNP densities and higher levels of LD compared with essential genes. Together, these findings indicate that housekeeping and essential genes are two distinct types of genes, and that housekeeping genes have a higher level of evolutionary conservation. Therefore, we suggest that researchers should pay careful attention to the distinctions between housekeeping genes and essential genes. Moreover, it is still controversial whether we should substitute human orthologs of mouse essential genes for human essential genes. Therefore, we compared the evolutionary features between human orthologs of mouse essential genes and human housekeeping genes and we got inconsistent results in long-term and short-term evolutionary characteristics implying the irrationality of simply replacing human essential genes with human orthologs of mouse essential genes. © The Author 2015. Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  20. Identification of three novel superantigen-encoding genes in Streptococcus equi subsp. zooepidemicus, szeF, szeN, and szeP.

    Science.gov (United States)

    Paillot, Romain; Darby, Alistair C; Robinson, Carl; Wright, Nicola L; Steward, Karen F; Anderson, Emma; Webb, Katy; Holden, Matthew T G; Efstratiou, Androulla; Broughton, Karen; Jolley, Keith A; Priestnall, Simon L; Marotti Campi, Maria C; Hughes, Margaret A; Radford, Alan; Erles, Kerstin; Waller, Andrew S

    2010-11-01

    The acquisition of superantigen-encoding genes by Streptococcus pyogenes has been associated with increased morbidity and mortality in humans, and the gain of four superantigens by Streptococcus equi is linked to the evolution of this host-restricted pathogen from an ancestral strain of the opportunistic pathogen Streptococcus equi subsp. zooepidemicus. A recent study determined that the culture supernatants of several S. equi subsp. zooepidemicus strains possessed mitogenic activity but lacked known superantigen-encoding genes. Here, we report the identification and activities of three novel superantigen-encoding genes. The products of szeF, szeN, and szeP share 59%, 49%, and 34% amino acid sequence identity with SPEH, SPEM, and SPEL, respectively. Recombinant SzeF, SzeN, and SzeP stimulated the proliferation of equine peripheral blood mononuclear cells, and tumor necrosis factor alpha (TNF-α) and gamma interferon (IFN-γ) production, in vitro. Although none of these superantigen genes were encoded within functional prophage elements, szeN and szeP were located next to a prophage remnant, suggesting that they were acquired by horizontal transfer. Eighty-one of 165 diverse S. equi subsp. zooepidemicus strains screened, including 7 out of 15 isolates from cases of disease in humans, contained at least one of these new superantigen-encoding genes. The presence of szeN or szeP, but not szeF, was significantly associated with mitogenic activity in the S. equi subsp. zooepidemicus population (P equi subsp. zooepidemicus population is likely to have implications for veterinary and human disease.

  1. Identification of Three Novel Superantigen-Encoding Genes in Streptococcus equi subsp. zooepidemicus, szeF, szeN, and szeP▿ †

    Science.gov (United States)

    Paillot, Romain; Darby, Alistair C.; Robinson, Carl; Wright, Nicola L.; Steward, Karen F.; Anderson, Emma; Webb, Katy; Holden, Matthew T. G.; Efstratiou, Androulla; Broughton, Karen; Jolley, Keith A.; Priestnall, Simon L.; Marotti Campi, Maria C.; Hughes, Margaret A.; Radford, Alan; Erles, Kerstin; Waller, Andrew S.

    2010-01-01

    The acquisition of superantigen-encoding genes by Streptococcus pyogenes has been associated with increased morbidity and mortality in humans, and the gain of four superantigens by Streptococcus equi is linked to the evolution of this host-restricted pathogen from an ancestral strain of the opportunistic pathogen Streptococcus equi subsp. zooepidemicus. A recent study determined that the culture supernatants of several S. equi subsp. zooepidemicus strains possessed mitogenic activity but lacked known superantigen-encoding genes. Here, we report the identification and activities of three novel superantigen-encoding genes. The products of szeF, szeN, and szeP share 59%, 49%, and 34% amino acid sequence identity with SPEH, SPEM, and SPEL, respectively. Recombinant SzeF, SzeN, and SzeP stimulated the proliferation of equine peripheral blood mononuclear cells, and tumor necrosis factor alpha (TNF-α) and gamma interferon (IFN-γ) production, in vitro. Although none of these superantigen genes were encoded within functional prophage elements, szeN and szeP were located next to a prophage remnant, suggesting that they were acquired by horizontal transfer. Eighty-one of 165 diverse S. equi subsp. zooepidemicus strains screened, including 7 out of 15 isolates from cases of disease in humans, contained at least one of these new superantigen-encoding genes. The presence of szeN or szeP, but not szeF, was significantly associated with mitogenic activity in the S. equi subsp. zooepidemicus population (P equi subsp. zooepidemicus population is likely to have implications for veterinary and human disease. PMID:20713629

  2. Structure of the gene encoding the murine protein kinase CK2 beta subunit

    DEFF Research Database (Denmark)

    Boldyreff, B; Issinger, O G

    1995-01-01

    II restriction endonuclease, and several blocks of sequence in the 5' flanking region are conserved between mouse and human. Despite all of these common features, one of the most striking differences found concerns the human CK2 alpha subunit binding domain at position -170 to -239 of the human gene. This domain...

  3. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    Directory of Open Access Journals (Sweden)

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  4. Identification and characterization of a gene encoding for a nucleotidase from Phaseolus vulgaris.

    Science.gov (United States)

    Cabello-Díaz, Juan Miguel; Gálvez-Valdivieso, Gregorio; Caballo, Cristina; Lambert, Rocío; Quiles, Francisco Antonio; Pineda, Manuel; Piedras, Pedro

    2015-08-01

    Nucleotidases are phosphatases that catalyze the removal of phosphate from nucleotides, compounds with an important role in plant metabolism. A phosphatase enzyme, with high affinity for nucleotides monophosphate previously identified and purified in embryonic axes from French bean, has been analyzed by MALDI TOF/TOF and two internal peptides have been obtained. The information of these peptide sequences has been used to search in the genome database and only a candidate gene that encodes for the phosphatase was identified (PvNTD1). The putative protein contains the conserved domains (motif I-IV) for haloacid dehalogenase-like hydrolases superfamily. The residues involved in the catalytic activity are also conserved. A recombinant protein overexpressed in Escherichia coli has shown molybdate resistant phosphatase activity with nucleosides monophosphate as substrate, confirming that the identified gene encodes for the phosphatase with high affinity for nucleotides purified in French bean embryonic axes. The activity of the purified protein was inhibited by adenosine. The expression of PvNTD1 gene was induced at the specific moment of radicle protrusion in embryonic axes. The gene was also highly expressed in young leaves whereas the level of expression in mature tissues was minimal. Copyright © 2015 The Authors. Published by Elsevier GmbH.. All rights reserved.

  5. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  6. Large-scale analysis of NBS domain-encoding resistance gene analogs in Triticeae

    Directory of Open Access Journals (Sweden)

    Dhia Bouktila

    2014-09-01

    Full Text Available Proteins containing nucleotide binding sites (NBS encoded by plant resistance genes play an important role in the response of plants to a wide array of pathogens. In this paper, an in silico search was conducted in order to identify and characterize members of NBS-encoding gene family in the tribe of Triticeae. A final dataset of 199 sequences was obtained by four search methods. Motif analysis confirmed the general structural organization of the NBS domain in cereals, characterized by the presence of the six commonly conserved motifs: P-loop, RNBS-A, Kinase-2, Kinase-3a, RNBS-C and GLPL. We revealed the existence of 11 distinct distribution patterns of these motifs along the NBS domain. Four additional conserved motifs were shown to be significantly present in all 199 sequences. Phylogenetic analyses, based on genetic distance and parsimony, revealed a significant overlap between Triticeae sequences and Coiled coil-Nucleotide binding site-Leucine rich repeat (CNL-type functional genes from monocotyledons. Furthermore, several Triticeae sequences belonged to clades containing functional homologs from non Triticeae species, which has allowed for these sequences to be functionally assigned. The findings reported, in this study, will provide a strong groundwork for the isolation of candidate R-genes in Triticeae crops and the understanding of their evolution.

  7. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  8. A corm-specific gene encodes tarin, a major globulin of taro (Colocasia esculenta L. Schott).

    Science.gov (United States)

    Bezerra, I C; Castro, L A; Neshich, G; de Almeida, E R; de Sá, M F; Mello, L V; Monte-Neshich, D C

    1995-04-01

    A gene encoding a globulin from a major taro (Colocasia esculenta L. Schott) corm protein family, tarin (G1, ca. 28 kDa) was isolated from a lambda Charon 35 library, using a cDNA derived from a highly abundant corm-specific mRNA, as probe. The gene, named tar1, and the corresponding cDNA were characterized and compared. No introns were found. The major transcription start site was determined by primer extension analysis. The gene has an open reading frame (ORF) of 765 bp, and the deduced amino acid sequence indicated a precursor polypeptide of 255 residues that is post-translationally processed into two subunits of about 12.5 kDa each. The deduced protein is 45% homologous to curculin, a sweet-tasting protein found in the fruit pulp of Curculigo latifolia and 40% homologous to a mannose-binding lectin from Galanthus nivalis. Significant similarity was also found at the nucleic acid sequence level with genes encoding lectins from plant species of the Amaryllidaceae and Lilliaceae families.

  9. [Cloning and structure of gene encoded alpha-latrocrustoxin from the Black widow spider venom].

    Science.gov (United States)

    Danilevich, V N; Luk'ianov, S A; Grishin, E V

    1999-07-01

    The primary structure of the crusta gene encoding alpha-latrocrustoxin (alpha-LCT), a high molecular mass neurotoxin specific to crustaceans, was determined in the black widow spider Latrodectus mactans tredicimguttatus genome. The total length of the sequenced DNA was 4693 bp. The structural part of the black widow spider chromosome gene encoding alpha-LCT does not contain introns. The sequenced DNA contains a single extended open reading frame (4185 bp) and encodes a protein precursor of alpha-LCT, comprising 1395 aa. We assume the Met residue at position -10 relative to the N-terminal residue of Glu1 of the mature toxin to be the first one in the protein precursor. The calculated molecular mass of the precursor (156147 Da) exceeds that of the mature toxin by approximately 30 kDa. These data are in agreement with the notion that over the course of maturation the protein precursor undergoes double processing--cleavage of a decapeptide from the N-terminal part and of a approximately 200-aa fragment from the C-terminal part. alpha-LCT displayed a number of imperfect ankyrin-like repeats and areas of structural homology with earlier studied latrotoxins; the highest homology degree (62%) was revealed with alpha-latroinsectotoxin (alpha-LIT).

  10. The immune gene repertoire encoded in the purple sea urchin genome.

    Science.gov (United States)

    Hibino, Taku; Loza-Coll, Mariano; Messier, Cynthia; Majeske, Audrey J; Cohen, Avis H; Terwilliger, David P; Buckley, Katherine M; Brockton, Virginia; Nair, Sham V; Berney, Kevin; Fugmann, Sebastian D; Anderson, Michele K; Pancer, Zeev; Cameron, R Andrew; Smith, L Courtney; Rast, Jonathan P

    2006-12-01

    Echinoderms occupy a critical and largely unexplored phylogenetic vantage point from which to infer both the early evolution of bilaterian immunity and the underpinnings of the vertebrate adaptive immune system. Here we present an initial survey of the purple sea urchin genome for genes associated with immunity. An elaborate repertoire of potential immune receptors, regulators and effectors is present, including unprecedented expansions of innate pathogen recognition genes. These include a diverse array of 222 Toll-like receptor (TLR) genes and a coordinate expansion of directly associated signaling adaptors. Notably, a subset of sea urchin TLR genes encodes receptors with structural characteristics previously identified only in protostomes. A similarly expanded set of 203 NOD/NALP-like cytoplasmic recognition proteins is present. These genes have previously been identified only in vertebrates where they are represented in much lower numbers. Genes that mediate the alternative and lectin complement pathways are described, while gene homologues of the terminal pathway are not present. We have also identified several homologues of genes that function in jawed vertebrate adaptive immunity. The most striking of these is a gene cluster with similarity to the jawed vertebrate Recombination Activating Genes 1 and 2 (RAG1/2). Sea urchins are long-lived, complex organisms and these findings reveal an innate immune system of unprecedented complexity. Whether the presumably intense selective processes that molded these gene families also gave rise to novel immune mechanisms akin to adaptive systems remains to be seen. The genome sequence provides immediate opportunities to apply the advantages of the sea urchin model toward problems in developmental and evolutionary immunobiology.

  11. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  12. Phylogenetic and evolutionary analysis of NBS-encoding genes in Rosaceae fruit crops.

    Science.gov (United States)

    Xu, Qiang; Wen, Xiaopeng; Deng, Xiuxin

    2007-07-01

    Phylogenetic relationships of the nucleotide binding site (NBS)-encoding resistance gene homologues (RGHs) among 12 species in five genera of Rosaceae fruit crops were evaluated. A total of 228 Rosaceous RGHs were deeply separated into two distinct clades, designated as TIR (sequences within this clade containing a Toll Interleukin-1 Receptor domain) and NonTIR (sequences lacking a TIR domain). Most Rosaceous RGH genes were phylogenetically distinct from Arabidopsis, Rice or Pine genes, except for a few Rosaceous members which grouped closely with Arabidopsis genes. Within Rosaceae, sequences from multiple species were often phylogenetically clustered together, forming heterogenous groups, however, apple- and chestnut rose-specific groups really exist. Gene duplication followed by sequence divergence were proposed as the mode for the evolution of a large number of distantly or closely related RGH genes in Rosaceae, and this mode may play a role in the generation of new resistance specificity. Positively selected sites within NBS-coding region were detected and thus nucleotide variation within NBS domain may function in determining disease resistance specificity. This study also discusses the synteny of a genomic region that encompass powdery mildew resistance locus among Malus, Prunus and Rosa, which may have potential use for fruit tree disease breeding and important gene cloning.

  13. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  14. THE LRP GENE ENCODING A MAJOR VAULT PROTEIN ASSOCIATED WITH DRUG-RESISTANCE MAPS PROXIMAL TO MRP ON CHROMOSOME-16 - EVIDENCE THAT CHROMOSOME BREAKAGE PLAYS A KEY ROLE IN MRP OR LRP GENE AMPLIFICATION

    NARCIS (Netherlands)

    SLOVAK, ML; HO, JP; COLE, SPC; DEELEY, RG; GREENBERGER, L; DEVRIES, EGE; BROXTERMAN, HJ; SCHEFFER, GL; SCHEPER, RJ

    1995-01-01

    A cDNA encoding the novel drug resistance gene, LRP (originally termed lung resistance-related protein), was isolated from HT1080/DR4, a 220-fold doxorubicin-resistant human fibrosarcoma cell line which displays a multidrug resistance phenotype and overexpresses the multidrug resistance protein

  15. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  16. Isolation and sequence analysis of the gene encoding triose phosphate isomerase from Zygosaccharomyces bailii.

    Science.gov (United States)

    Merico, A; Rodrigues, F; Côrte-Real, M; Porro, D; Ranzi, B M; Compagno, C

    2001-06-30

    The ZbTPI1 gene encoding triose phosphate isomerase (TIM) was cloned from a Zygosaccharomyces bailii genomic library by complementation of the Saccharomyces cerevisiae tpi1 mutant strain. The nucleotide sequence of a 1.5 kb fragment showed an open reading frame (ORF) of 746 bp, encoding a protein of 248 amino acid residues. The deduced amino acid sequence shares a high degree of homology with TIMs from other yeast species, including some highly conserved regions. The analysis of the promoter sequence of the ZbTPI1 revealed the presence of putative motifs known to have regulatory functions in S. cerevisiae. The GenBank Accession No. of ZbTPI1 is AF325852. Copyright 2001 John Wiley & Sons, Ltd.

  17. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes.

    NARCIS (Netherlands)

    Jensen, A.; Magistrado, P.; Sharp, S.; Joergensen, L.; Lavstsen, T.; Chiucchiuini, A.; Salanti, A.; Vestergaard, L.S.; Lusingu, J.P.; Hermsen, R.; Sauerwein, R.W.; Christensen, J.; Nielsen, M.A.; Hviid, L.; Sutherland, C.J.; Staalsoe, T.; Theander, T.G.

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in

  18. Identification and characterization of the Vibrio anguillarum prtV gene encoding a new metalloprotease

    Science.gov (United States)

    Mo, Zhaolan; Guo, Dongsheng; Mao, Yunxiang; Ye, Xuhong; Zou, Yuxia; Xiao, Peng; Hao, Bin

    2010-01-01

    We cloned and sequenced a prtV-like gene from Vibrio anguillarum M3 strain. This prtV gene encodes a putative protein of 918 amino acids, and is highly homologous to the V. cholerae prtV gene. We found that a prtV insertion mutant strain displayed lower gelatinase activity on gelatin agar, lower protease activity against azocasein, and lower activity for four glycosidases. This prtV mutant strain also had increased activity for two esterases in its extracellular products, as analyzed by the API ZYM system. In addition, the prtV mutant strain exhibited decreased growth in turbot intestinal mucus and reduced hemolytic activity on turbot erythrocytes. Infection experiments showed that the LD50 of the prtV mutant strain increased by at least 1 log compared to the wild-type in turbot fish. We propose that prtV plays an important role in the pathogenesis of V. anguillarum.

  19. Genetic variability in the sable (Martes zibellina L.) with respect to genes encoding blood proteins

    Energy Technology Data Exchange (ETDEWEB)

    Kashtanov, S.N. [Vavilov Institute of General Genetics, Moscow (Russian Federation); Kazakova, T.I. [Afanas`ev Scientific Research Institute for Breeding of Fur-Bearing Animals, Moscow (Russian Federation)

    1995-02-01

    Electrophoresis of blood proteins was used to determine, for the first time, the level of genetic variability of certain loci in the sable (Martes zibellina L., Mustelidae). Variation of 23 blood proteins encoded by 25 genes was analyzed. Polymorphism was revealed in six genes. The level of heterozygosity was estimated at 0.069; the proportion of polymorphic loci was 24%. Data on the history of the sable population maintained at the farm, on geographical distribution of natural sable populations, and on the number of animals selected for reproduction in captivity is presented. The great number of animals studies and the extensive range of natural sable populations, on the basis of which the population maintained in captivity was obtained, suggest that the results of this work can be used for estimating the variability of the gene pool of sable as a species. 9 refs., 2 figs., 1 tab.

  20. Monogalactosyldiacylglycerol: An abundant galactosyllipid of Cirsium brevicaule A. GRAY leaves inhibits the expression of gene encoding fatty acid synthase.

    Science.gov (United States)

    Inafuku, Masashi; Takara, Kensaku; Taira, Naoyuki; Nugara, Ruwani N; Kamiyama, Yasuo; Oku, Hirosuke

    2016-05-15

    The leaves of Cirsium brevicaule A. GRAY (CL) significantly decreased hepatic lipid accumulation and the expression of fatty acid synthase gene (FASN) in mice. We aimed to purify and identify the active compound(s) from CL and determine the inhibitory mechanism of expression of FASN. We purified monogalactosyldiacylglycerol (MGDG) from extracts of CL (CL-MGDG) and showed that it was the active CL component through analyses of its effects on the expression of genes of human breast cancer cell line, SKBR-3. The content and fatty acid composition of CL-MGDG are distinctly different from those of other vegetable-derived MGDGs. Treatment of SKBR-3 cells with MGDG decreased the level of FASN mRNA as well as the levels of mRNA encoding other protein involved in lipogenesis. Further, MGDG treatments significantly inhibited luciferase activities of constructs containing liver X receptor response element in FASN promoter region without altering the levels of mRNA encoding transcription factors. MGDG and the FASN inhibitor C75 decreased the viabilities of SKBR-3 cells in a concentration-dependent manner. CL-MGDG more potently inhibited cell viability than a commercial MGDG preparation. CL represents a good source of glycoglycerolipids with potential as functional ingredients of food. Copyright © 2016 Elsevier GmbH. All rights reserved.

  1. A gene encoding phosphatidylethanolamine N-methyltransferase from Acetobacter aceti and some properties of its disruptant.

    Science.gov (United States)

    Hanada, T; Kashima, Y; Kosugi, A; Koizumi, Y; Yanagida, F; Udaka, S

    2001-12-01

    Phosphatidylcholine (PC) is a major component of membranes not only in eukaryotes, but also in several bacteria, including Acetobacter. To identify the PC biosynthetic pathway and its role in Acetobacter sp., we have studied Acetobacter aceti IFO3283, which is characterized by high ethanol oxidizing ability and high resistance to acetic acid. The pmt gene of A. aceti, encoding phosphatidylethanolamine N-methyltransferase (Pmt), which catalyzes methylation of phosphatidylethanolamine (PE) to PC, has been cloned and sequenced. One recombinant plasmid that complemented the PC biosynthesis was isolated from a gene library of the genomic DNA of A. aceti. The pmt gene encodes a polypeptide with molecular mass of either 25125, 26216, or 29052 for an about 27-kDa protein. The sequence of this gene showed significant similarity (44.3% identity in the similar sequence region) with the Rhodobacter sphaeroides pmtA gene which is involved in PE N-methylation. When the pmt gene was expressed in E. coli, which lacks PC, the Pmt activity and PC formation were clearly demonstrated. A. aceti strain harboring an interrupted pmt allele, pmt::Km, was constructed. The pmt disruption was confirmed by loss of Pmt and PC, and by Southern blot analyses. The null pmt mutant contained no PC, but tenfold more PE and twofold more phosphatidylglycerol (PG). The pmt disruptant did not show any dramatic effects on growth in basal medium supplemented with ethanol, but the disruption caused slow growth in basal medium supplemented with acetate. These results suggest that the lack of PC in the A. aceti membrane may be compensated by the increases of PE and PG by an unknown mechanism, and PC in A. aceti membrane is related to its acetic acid tolerance.

  2. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  3. Organization of the gene encoding common acute lymphoblastic leukemia antigen (neutral endopeptidase 24.11): multiple miniexons and separate 5' untranslated regions.

    OpenAIRE

    D'Adamio, L; Shipp, M A; Masteller, E L; Reinherz, E L

    1989-01-01

    The common acute lymphoblastic leukemia antigen (CALLA) is a 749-amino acid type II integral membrane protein that has been identified recently as the neutral endopeptidase 24.11 [NEP (EC 3.4.24.11)]. Herein, we characterize the organization of the human CALLA/NEP gene and show that it spans more than 80 kilobases (kb) and is composed of 24 exons. Exons 1 and 2 encode 5' untranslated sequences; exon 3 [170 base pairs (bp)] encodes the initiation codon and transmembrane and cytoplasmic domain;...

  4. The gene Sr33, an ortholog of barley Mla genes, encodes resistance to wheat stem rust race Ug99.

    Science.gov (United States)

    Periyannan, Sambasivam; Moore, John; Ayliffe, Michael; Bansal, Urmil; Wang, Xiaojing; Huang, Li; Deal, Karin; Luo, Mingcheng; Kong, Xiuying; Bariana, Harbans; Mago, Rohit; McIntosh, Robert; Dodds, Peter; Dvorak, Jan; Lagudah, Evans

    2013-08-16

    Wheat stem rust, caused by the fungus Puccinia graminis f. sp. tritici, afflicts bread wheat (Triticum aestivum). New virulent races collectively referred to as "Ug99" have emerged, which threaten global wheat production. The wheat gene Sr33, introgressed from the wild relative Aegilops tauschii into bread wheat, confers resistance to diverse stem rust races, including the Ug99 race group. We cloned Sr33, which encodes a coiled-coil, nucleotide-binding, leucine-rich repeat protein. Sr33 is orthologous to the barley (Hordeum vulgare) Mla mildew resistance genes that confer resistance to Blumeria graminis f. sp. hordei. The wheat Sr33 gene functions independently of RAR1, SGT1, and HSP90 chaperones. Haplotype analysis from diverse collections of Ae. tauschii placed the origin of Sr33 resistance near the southern coast of the Caspian Sea.

  5. Cloning and characterization of a gene encoding trehalose phosphorylase (TP) from Pleurotus sajor-caju.

    Science.gov (United States)

    Han, Sang-Eun; Kwon, Hawk-Bin; Lee, Seung-Bum; Yi, Bu-Young; Murayama, Ikuo; Kitamoto, Yutaka; Byun, Myung-Ok

    2003-08-01

    Complementary DNA for a gene encoding trehalose phosphorylase (TP) that reversibly catalyzes trehalose synthesis and degradation from alpha-glucose-1-phosphate (alpha-Glc-1-P) and glucose was cloned from Pleurotus sajor-caju. The cDNA of P. sajor-caju TP (designated PsTP, GenBank Accession No. AF149777) encodes a polypeptide of 751 amino acids with a deduced molecular mass of 83.7 kDa. The PsTP gene is expressed in mycelia, pilei, and stipes of fruiting bodies. Trehalose phosphorylase PsTP was purified from PsTP-transformed Escherichia coli. The enzyme catalyzes both the phosphorolysis of trehalose to produce alpha-Glc-1-P and glucose, and the synthesis of trehalose. The apparent K(m) values for trehalose and Pi in phosphorolytic reaction at pH 7.0 were 74.8 and 5.4 mM, respectively. The PsTP gene complemented Saccharomyces cerevisiae Deltatps1, Deltatps2 double-mutant cells, allowing their growth on glucose medium. Furthermore, yeast transformed with PsTP produced 2-2.5-fold more trehalose than non-transformants or cells transformed with empty vector only.

  6. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae.

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko; Yaoi, Katsuro

    2016-03-04

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-D-xylopyranose-(1 → 6)-D-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.

  7. Expression of Mitochondrial-Encoded Genes in Blood Differentiate Acute Renal Allograft Rejection

    Directory of Open Access Journals (Sweden)

    Silke Roedder

    2017-11-01

    Full Text Available Despite potent immunosuppression, clinical and biopsy confirmed acute renal allograft rejection (AR still occurs in 10–15% of recipients, ~30% of patients demonstrate subclinical rejection on biopsy, and ~50% of them can show molecular inflammation, all which increase the risk of chronic dysfunction and worsened allograft outcomes. Mitochondria represent intracellular endogenous triggers of inflammation, which can regulate immune cell differentiation, and expansion and cause antigen-independent graft injury, potentially enhancing the development of acute rejection. In the present study, we investigated the role of mitochondrial DNA encoded gene expression in biopsy matched peripheral blood (PB samples from kidney transplant recipients. Quantitative PCR was performed in 155 PB samples from 115 unique pediatric (<21 years and adult (>21 years renal allograft recipients at the point of AR (n = 61 and absence of rejection (n = 94 for the expression of 11 mitochondrial DNA encoded genes. We observed increased expression of all genes in adult recipients compared to pediatric recipients; separate analyses in both cohorts demonstrated increased expression during rejection, which also differentiated borderline rejection and showed an increasing pattern in serially collected samples (0–3 months prior to and post rejection. Our results provide new insights on the role of mitochondria during rejection and potentially indicate mitochondria as targets for novel immunosuppression.

  8. The Neurospora crassa colonial temperature-sensitive 3 (cot-3) gene encodes protein elongation factor 2.

    Science.gov (United States)

    Propheta, O; Vierula, J; Toporowski, P; Gorovits, R; Yarden, O

    2001-02-01

    At elevated temperatures, the Neurospora crassa mutant colonial, temperature-sensitive 3 (cot-3) forms compact, highly branched colonies. Growth of the cot-3 strain under these conditions also results in the loss of the lower molecular weight (LMW) isoform of the Ser/Thr protein kinase encoded by the unlinked cot-1 gene, whose function is also involved in hyphal elongation. The unique cot-3 gene has been cloned by complementation and shown to encode translation elongation factor 2 (EF-2). As expected for a gene with a general role in protein synthesis, cot-3 mRNA is abundantly expressed throughout all asexual phases of the N. crassa life cycle. The molecular basis of the cot-3 mutation was determined to be an ATT to AAT transversion, which causes an Ile to Asn substitution at residue 278. Treatment with fusidic acid (a specific inhibitor of EF-2) inhibits hyphal elongation and induces hyperbranching in a manner which mimics the cot-3 phenotype, and also leads to a decrease in the abundance of the LMW isoform of COT1. This supports our conclusion that the mutation in cot-3 which results in abnormal hyphal elongation/branching impairs EF-2 function and confirms that the abundance of a LMW isoform of COT1 kinase is dependent on the function of this general translation factor.

  9. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  10. The ROOT HAIRLESS 1 gene encodes a nuclear protein required for root hair initiation in Arabidopsis.

    Science.gov (United States)

    Schneider, K; Mathur, J; Boudonck, K; Wells, B; Dolan, L; Roberts, K

    1998-07-01

    The epidermis of Arabidopsis wild-type primary roots, in which some cells grow hairs and others remain hairless in a position-dependent manner, has become an established model system to study cell differentiation. Here we present a molecular analysis of the RHL1 (ROOT HAIRLESS 1) gene that, if mutated, prevents the formation of hairs on primary roots and causes a seedling lethal phenotype. We have cloned the RHL1 gene by use of a T-DNA-tagged mutant and found that it encodes a protein that appears to be plant specific. The predicted RHL1 gene product is a small hydrophilic protein (38.9 kD) containing putative nuclear localization signals and shows no significant homology to any known amino acid sequence. We demonstrate that a 78-amino-acid sequence at its amino terminus is capable of directing an RHL1-GFP fusion protein to the nucleus. The RHL1 transcript is present throughout the wild-type plant and in suspension culture cells, but in very low amounts, suggesting a regulatory function for the RHL1 protein. Structural evidence suggests a role for the RHL1 gene product in the nucleolus. We have examined the genetic relationship between RHL1 and GL2, an inhibitor of root hair initiation in non-hair cells. Our molecular and genetic data with double mutants, together with the expression analysis of a GL2 promoter-GUS reporter gene construct, indicate that the RHL1 gene acts independently of GL2.

  11. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  12. Phytochrome-regulated expression of the genes encoding the small GTP-binding proteins in peas.

    OpenAIRE

    Yoshida, K; Nagano, Y; Murai, N; Sasaki, Y

    1993-01-01

    We examined the effect of light on the mRNA levels of 11 genes (pra1-pra9A, pra9B, and pra9C) encoding the small GTP-binding proteins that belong to the ras superfamily in Pisum sativum. When the dark-grown seedlings were exposed to continuous white light for 24 hr, the levels of several pra mRNAs in the pea buds decreased: pra2 and pra3 mRNAs decreased markedly; pra4, pra6, and pra9A mRNAs decreased slightly; the other 6 pra mRNAs did not decrease. We studied the kinetics of mRNA accumulatio...

  13. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  14. Neural encoding of saltatory pneumotactile velocity in human glabrous hand.

    Directory of Open Access Journals (Sweden)

    Hyuntaek Oh

    Full Text Available Neurons in the somatosensory cortex are exquisitely sensitive to mechanical stimulation of the skin surface. The location, velocity, direction, and adaptation of tactile stimuli on the skin's surface are discriminable features of somatosensory processing, however the representation and processing of dynamic tactile arrays in the human somatosensory cortex are poorly understood. The principal aim of this study was to map the relation between dynamic saltatory pneumatic stimuli at discrete traverse velocities on the glabrous hand and the resultant pattern of evoked BOLD response in the human brain. Moreover, we hypothesized that the hand representation in contralateral Brodmann Area (BA 3b would show a significant dependence on stimulus velocity. Saltatory pneumatic pulses (60 ms duration, 9.5 ms rise/fall were repetitively sequenced through a 7-channel TAC-Cell array at traverse velocities of 5, 25, and 65 cm/s on the glabrous hand initiated at the tips of D2 (index finger and D3 (middle finger and sequenced towards the D1 (thumb. The resulting hemodynamic response was sampled during 3 functional MRI scans (BOLD in 20 neurotypical right-handed adults at 3T. Results from each subject were inserted to the one-way ANOVA within-subjects and one sample t-test to evaluate the group main effect of all three velocities stimuli and each of three different velocities, respectively. The stimulus evoked BOLD response revealed a dynamic representation of saltatory pneumotactile stimulus velocity in a network consisting of the contralateral primary hand somatosensory cortex (BA3b, associated primary motor cortex (BA4, posterior insula, and ipsilateral deep cerebellum. The spatial extent of this network was greatest at the 5 and 25 cm/s pneumotactile stimulus velocities.

  15. Encoding of physics concepts: concreteness and presentation modality reflected by human brain dynamics.

    Science.gov (United States)

    Lai, Kevin; She, Hsiao-Ching; Chen, Sheng-Chang; Chou, Wen-Chi; Huang, Li-Yu; Jung, Tzyy-Ping; Gramann, Klaus

    2012-01-01

    Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal) or concreteness (abstract vs. concrete) of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC) during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.

  16. Encoding of physics concepts: concreteness and presentation modality reflected by human brain dynamics.

    Directory of Open Access Journals (Sweden)

    Kevin Lai

    Full Text Available Previous research into working memory has focused on activations in different brain areas accompanying either different presentation modalities (verbal vs. non-verbal or concreteness (abstract vs. concrete of non-science concepts. Less research has been conducted investigating how scientific concepts are learned and further processed in working memory. To bridge this gap, the present study investigated human brain dynamics associated with encoding of physics concepts, taking both presentation modality and concreteness into account. Results of this study revealed greater theta and low-beta synchronization in the anterior cingulate cortex (ACC during encoding of concrete pictures as compared to the encoding of both high and low imageable words. In visual brain areas, greater theta activity accompanying stimulus onsets was observed for words as compared to pictures while stronger alpha suppression was observed in responses to pictures as compared to words. In general, the EEG oscillation patterns for encoding words of different levels of abstractness were comparable but differed significantly from encoding of pictures. These results provide insights into the effects of modality of presentation on human encoding of scientific concepts and thus might help in developing new ways to better teach scientific concepts in class.

  17. Expression Cloning of Recombinant Escherichia coli lacZ Genes Encoding Cytoplasmic and Nuclear β-galactosidase Variants.

    Science.gov (United States)

    Naderian, Homayoun; Rezvani, Zahra; Atlasi, Mohammad Ali; Nikzad, Hossein; Antoine, Af de Vries

    2011-07-01

    Nonviral vector can be an attractive alternative to gene delivery in experimental study. In spite of some advantages in comparison with the viral vectors, there are still some limitations for efficiency of gene delivery in nonviral vectors. To determine the effective expression, the recombinant Escherichia coli lacZ genes were cloned into the different variants of pcDNA3.1 and then the mammalian cells were transfected. The coding sequences of cytoplasmic and nuclear variants of lacZ gene were inserted downstream of the human cytomegalovirus immediate-early gene promoter of plasmid pcDNA3.1/myc-His C. The new cytoplasmic and nuclear constricts of E. coli β-galactosidase-coding sequences were introduced into HeLa cells with the aid of linear polyethylenimine and at 2 days post-transfection the cells were stained using 5-bromo-4-chloro-3-indolyl-β-D-galactopyranoside (X-gal). Restriction enzyme analyses revealed the proper insertion of E. coli β-galactosidase-coding sequences into the multiple cloning site of pcDNA3.1/myc-His C. The functionality of the resulting constructs designated pcDNA3.1-cyt.lacZ and pcDNA3.1-nls.lacZ(+) was confirmed by X-gal staining of HeLa cells transfected with these recombinant plasmids. While pcDNA3.1-cyt.lacZ directed the synthesis of cytoplasmically located β-galactosidase molecules, the β-galactosidase protein encoded by pcDNA3.1-nls.lacZ(+) was predominantly detected in the cell nucleus. The expression of cytoplasmic and nuclear variant of LacZ gene confirmed the ability of pcDNA3.1 as versatility nonviral vector for the experimental gene delivery study in mammalian cells.

  18. pEOC01: a plasmid from Pediococcus acidilactici which encodes an identical streptomycin resistance (aadE) gene to that found in Campylobacter jejuni.

    Science.gov (United States)

    O'Connor, E B; O'Sullivan, O; Stanton, C; Danielsen, M; Simpson, P J; Callanan, M J; Ross, R P; Hill, C

    2007-09-01

    The complete nucleotide sequence of pEOC01, a plasmid (11,661 bp) from Pediococcus acidilactici NCIMB 6990 encoding resistance to clindamycin, erythromycin, and streptomycin was determined. The plasmid, which also replicates in Lactococcus and Lactobacillus species contains 16 putative open reading frames (ORFs), including regions annotated to encode replication, plasmid maintenance and multidrug resistance functions. Based on an analysis the plasmid replicates via a theta replicating mechanism closely related to those of many larger Streptococcus and Enterococcus plasmids. Interestingly, genes homologous to a toxin/antitoxin plasmid maintenance system are present and are highly similar to the omega-epsilon-zeta operon of Streptococcus plasmids. The plasmid contains two putative antibiotic resistance homologs, an ermB gene encoding erythromycin and clindamycin resistance, and a streptomycin resistance gene, aadE. Of particular note is the aadE gene which holds 100% identity to an aadE gene found in Campylobacter jejuni plasmid but which probably originated from a Gram-positive source. This observation is significant in that it provides evidence for recent horizontal transfer of streptomycin resistance from a lactic acid bacterium to a Gram-negative intestinal pathogen and as such infers a role for such plasmids for dissemination of antibiotic resistance genes possibly in the human gut.

  19. Genes encoding chimeras of Neurospora crassa erg-3 and human ...

    Indian Academy of Sciences (India)

    Unknown

    glucose, harvested by vacuum filtration, lyophilized and ground with glass beads. The powdered mycelia were homogenized with water. Chloroform was added to the homogenate (4 ml per 1⋅6 ml homogenate), the mixture was vortexed and then 2 ml of 0⋅9% (w/v) aqueous KCl was added and vortexed. The aqueous and ...

  20. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  1. Molecular cloning and characterization of a glutathione S-transferase encoding gene from Opisthorchis viverrini.

    Science.gov (United States)

    Eursitthichai, Veerachai; Viyanant, Vithoon; Vichasri-Grams, Suksiri; Sobhon, Prasert; Tesana, Smarn; Upatham, Suchart Edward; Hofmann, Annemarie; Korge, Günter; Grams, Rudi

    2004-12-01

    An adult stage Opisthorchis viverrini cDNA library was constructed and screened for abundant transcripts. One of the isolated cDNAs was found by sequence comparison to encode a glutathione S-transferase (GST) and was further analyzed for RNA expression, encoded protein function, tissue distribution and cross-reactivity of the encoded protein with other trematode protein counterparts. The cDNA has a size of 893 bp and encodes a GST of 213 amino acids length (OV28GST). The most closely-related GST of OV28GST among those published for trematodes is a 28 kDa GST of Clonorchis sinensis as shown by multiple sequence alignment and phylogenetic analysis. Northern analysis of total RNA with a gene-specific probe revealed a 900 nucleotide OV28GST transcriptional product in the adult parasite. Through RNA in situ hybridization OV28GST RNA was detected in the parenchymal cells of adult parasites. This result was confirmed by immunolocalization of OV28GST with an antiserum generated in a mouse against bacterially-produced recombinant OV28GST. Both, purified recombinant and purified native OV28GST were resolved as 28 kDa proteins by SDS-PAGE. Using the anti-recOV28GST antiserum, no or only weak cross-reactivity was observed in an immunoblot of crude worm extracts against the GSTs of Schistosoma mansoni, S. japonicum, S. mekongi, Eurytrema spp. and Fasciola gigantica. The enzyme activity of the purified recombinant OV28GST was verified by a standard 1-chloro-2, 4-dinitrobenzene (CDNB) based activity assay. The present results of our molecular analysis of OV28GST should be helpful in the ongoing development of diagnostic applications for opisthorchiasis viverrini.

  2. Cloning and characterization of a delta-6 desaturase encoding gene from Nannochloropsis oculata

    Science.gov (United States)

    Ma, Xiaolei; Yu, Jianzhong; Zhu, Baohua; Pan, Kehou; Pan, Jin; Yang, Guanpin

    2011-03-01

    A gene ( NANOC-D6D) encoding a desaturase that removes two hydrogen atoms from fatty acids at delta 6 position was isolated from a cDNA library of Nannochloropsis oculata (Droop) D. J. Hibberd (Eustigmatophyceae). The unicellular marine microalga N. oculata synthesizes rich long chain polyunsaturated fatty acids (LCPUFAs), including eicosapentaenoic acid (20:5n-3, EPA). The deduced protein contains 474 amino acids that fold into 4 trans-membrane domains. The neighbor-joining phylogenetic tree indicates that NANOC-D6D is phylogenetically close to the delta-6 fatty acid desaturase of marine microalgae such as Glossomastix chrysoplasta, Thalassiosira pseudonana, and Phaeodactylum tricornutum. The gene was expressed in Saccharomyces cerevisiae INVScl to verify the substrate specificity of NANOC-D6D. Our results suggest that the recombinant NANOC-D6D simultaneously desaturates linoleic acid (LA) and α-linolenic acid (ALA).

  3. Identification and nucleotide sequence of a gene in equine herpesvirus 1 analogous to the herpes simplex virus gene encoding the major envelope glycoprotein gB.

    Science.gov (United States)

    Whalley, J M; Robertson, G R; Scott, N A; Hudson, G C; Bell, C W; Woodworth, L M

    1989-02-01

    A gene in equine herpesvirus 1 (EHV-1; equine abortion virus) equivalent to the gB glycoprotein gene of herpes simplex virus (HSV) has been identified by DNA hybridization and nucleotide sequencing. A 4.3 kbp EHV-1 PstI-ClaI sequence (0.40 to 0.43 map units) contained an open reading frame flanked by appropriate control elements and was capable of encoding a polypeptide of 980 amino acids. This had 50 to 60% identity over a 617 amino acid conserved region with the gB gene products of HSV and three other alphaherpesviruses, and 20 to 30% identity with those of human cytomegalovirus and Epstein-Barr virus. Analysis of the amino acid sequence predicts a long signal peptide, hydrophobic and hydrophilic domains and N-glycosylation sites, and has identified a probable internal proteolytic cleavage site. The EHV-1 gB open reading frame appears to be overlapped at its 5' end by 135 nucleotides of the 3' end of an upstream open reading frame the potential translation product of which has approximately 50% identity with HSV gene ICP 18.5 and VZV gene 30 products.

  4. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  5. Multidrug resistance in fungi: regulation of transporter-encoding gene expression.

    Science.gov (United States)

    Paul, Sanjoy; Moye-Rowley, W Scott

    2014-01-01

    A critical risk to the continued success of antifungal chemotherapy is the acquisition of resistance; a risk exacerbated by the few classes of effective antifungal drugs. Predictably, as the use of these drugs increases in the clinic, more resistant organisms can be isolated from patients. A particularly problematic form of drug resistance that routinely emerges in the major fungal pathogens is known as multidrug resistance. Multidrug resistance refers to the simultaneous acquisition of tolerance to a range of drugs via a limited or even single genetic change. This review will focus on recent progress in understanding pathways of multidrug resistance in fungi including those of most medical relevance. Analyses of multidrug resistance in Saccharomyces cerevisiae have provided the most detailed outline of multidrug resistance in a eukaryotic microorganism. Multidrug resistant isolates of S. cerevisiae typically result from changes in the activity of a pair of related transcription factors that in turn elicit overproduction of several target genes. Chief among these is the ATP-binding cassette (ABC)-encoding gene PDR5. Interestingly, in the medically important Candida species, very similar pathways are involved in acquisition of multidrug resistance. In both C. albicans and C. glabrata, changes in the activity of transcriptional activator proteins elicits overproduction of a protein closely related to S. cerevisiae Pdr5 called Cdr1. The major filamentous fungal pathogen, Aspergillus fumigatus, was previously thought to acquire resistance to azole compounds (the principal antifungal drug class) via alterations in the azole drug target-encoding gene cyp51A. More recent data indicate that pathways in addition to changes in the cyp51A gene are important determinants in A. fumigatus azole resistance. We will discuss findings that suggest azole resistance in A. fumigatus and Candida species may share more mechanistic similarities than previously thought.

  6. Genes encoding homologous antigens in taeniid cestode parasites: Implications for development of recombinant vaccines produced in Escherichia coli.

    Science.gov (United States)

    Gauci, Charles; Lightowlers, Marshall W

    2013-01-01

    Recombinant vaccine antigens are being evaluated for their ability to protect livestock animals against cysticercosis and related parasitic infections. Practical use of some of these vaccines is expected to reduce parasite transmission, leading to a reduction in the incidence of neurocysticercosis and hydatid disease in humans. We recently showed that an antigen (TSOL16), expressed in Escherichia coli, confers high levels of protection against Taenia solium cysticercosis in pigs, which provides a strategy for control of T. solium parasite transmission. Here, we discuss the characteristics of this antigen that may affect the utility of TSOL16 and related antigens for development as recombinant vaccines. We also report that genes encoding antigens closely related to TSOL16 from T. solium also occur in other related species of parasites. These highly homologous antigens have the potential to be used as vaccines and may provide protection against related species of Taenia that cause infection in other hosts.

  7. Cell type-specific transcriptional regulation of the gene encoding importin-α1

    International Nuclear Information System (INIS)

    Kamikawa, Yasunao; Yasuhara, Noriko; Yoneda, Yoshihiro

    2011-01-01

    Importin-α1 belongs to a receptor family that recognizes classical nuclear localization signals. Encoded by Kpna2, this receptor subtype is highly expressed in mouse embryonic stem (ES) cells. In this study, we identified a critical promoter region in Kpna2 and showed that the expression of this gene is differentially regulated in ES cells and NIH3T3 cells. Conserved CCAAT boxes are required for Kpna2 promoter activity in both ES and NIH3T3 cells. Interestingly, deletion of the region from nucleotide position - 251 to - 179 bp resulted in a drastic reduction in Kpna2 transcriptional activity only in ES cells. This region contains Krueppel-like factor (Klf) binding sequences and is responsible for transactivation of the gene by Klf2 and Klf4. Accordingly, endogenous Kpna2 mRNA levels decreased in response to depletion of Klf2 and Klf4 in ES cells. Our results suggest that Klf2 and Klf4 function redundantly to drive high level of Kpna2 expression in ES cells. -- Research Highlights: → We showed the cell type-specific transcriptional regulation of Kpna2 encoding importin-al. → NF-Y binds the CCAAT boxes to activate Kpna2 transcription in NIH3T3 cells. → Klf2 and Klf4 redundantly activate the expression of Kpna2 in ES cells.

  8. Cloning, sequencing and expression of the gene encoding the extracellular metalloprotease of Aeromonas caviae.

    Science.gov (United States)

    Kawakami, K; Toma, C; Honma, Y

    2000-01-01

    A gene (apk) encoding the extracellular protease of Aeromonas caviae Ae6 has been cloned and sequenced. For cloning the gene, the DNA genomic library was screened using skim milk LB agar. One clone harboring plasmid pKK3 was selected for sequencing. Nucleotide sequencing of the 3.5 kb region of pKK3 revealed a single open reading frame (ORF) of 1,785 bp encoding 595 amino acids. The deduced polypeptide contained a putative 16-amino acid signal peptide followed by a large propeptide. The N-terminal amino acid sequence of purified recombinant protein (APK) was consistent with the DNA sequence. This result suggested a mature protein of 412 amino acids with a molecular mass of 44 kDa. However, the molecular mass of purified recombinant APK revealed 34 kDa by SDS-PAGE, suggesting that further processing at the C-terminal region took place. The 2 motifs of zinc binding sites deduced are highly conserved in the APK as well as in other zinc metalloproteases including Vibrio proteolyticus neutral protease, Emp V from Vibrio vulnificus, HA/P from Vibrio cholerae, and Pseudomonas aeruginosa elastase. Proteolytic activity was inhibited by EDTA, Zincov, 1,10-phenanthroline and tetraethylenepentamine while unaffected by the other inhibitors tested. The protease showed maximum activity at pH 7.0 and was inactivated by heating at 80 C for 15 min. These results together suggest that APK belongs to the thermolysin family of metalloendopeptidases.

  9. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  10. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma

    Directory of Open Access Journals (Sweden)

    Suma Choorapoikayil

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena+/−ptenb−/− or ptena−/−ptenb+/− are viable and fertile. ptena+/−ptenb−/− fish develop tumors at a relatively high incidence (10.2% and most tumors developed close to the eye (26/30. Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena−/−ptenb+/− fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena+/−ptenb−/− and ptena−/−ptenb+/− fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena+/−ptenb−/− zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  11. Life without putrescine: disruption of the gene-encoding polyamine oxidase in Ustilago maydis odc mutants.

    Science.gov (United States)

    Valdés-Santiago, Laura; Guzmán-de-Peña, Doralinda; Ruiz-Herrera, José

    2010-11-01

    In previous communications the essential role of spermidine in Ustilago maydis was demonstrated by means of the disruption of the genes encoding ornithine decarboxylase (ODC) and spermidine synthase (SPE). However, the assignation of specific roles to each polyamine in different cellular functions was not possible because the spermidine added to satisfy the auxotrophic requirement of odc/spe double mutants is partly back converted into putrescine. In this study, we have approached this problem through the disruption of the gene-encoding polyamine oxidase (PAO), required for the conversion of spermidine into putrescine, and the construction of odc/pao double mutants that were unable to synthesize putrescine by either ornithine decarboxylation or retroconversion from spermidine. Phenotypic analysis of the mutants provided evidence that putrescine is only an intermediary in spermidine biosynthesis, and has no direct role in cell growth, dimorphic transition, or any other vital function of U. maydis. Nevertheless, our results show that putrescine may play a role in the protection of U. maydis against salt and osmotic stress, and possibly virulence. Evidence was also obtained that the retroconversion of spermidine into putrescine is not essential for U. maydis growth but may be important for its survival under natural conditions.

  12. Haploinsufficiency of the genes encoding the tumor suppressor Pten predisposes zebrafish to hemangiosarcoma.

    Science.gov (United States)

    Choorapoikayil, Suma; Kuiper, Raoul V; de Bruin, Alain; den Hertog, Jeroen

    2012-03-01

    PTEN is an essential tumor suppressor that antagonizes Akt/PKB signaling. The zebrafish genome encodes two Pten genes, ptena and ptenb. Here, we report that zebrafish mutants that retain a single wild-type copy of ptena or ptenb (ptena(+/-)ptenb(-/-) or ptena(-/-)ptenb(+/-)) are viable and fertile. ptena(+/-)ptenb(-/-) fish develop tumors at a relatively high incidence (10.2%) and most tumors developed close to the eye (26/30). Histopathologically, the tumor masses were associated with the retrobulbar vascular network and diagnosed as hemangiosarcomas. A single tumor was identified in 42 ptena(-/-)ptenb(+/-) fish and was also diagnosed as hemangiosarcoma. Immunohistochemistry indicated that the tumor cells in ptena(+/-)ptenb(-/-) and ptena(-/-)ptenb(+/-) fish proliferated rapidly and were of endothelial origin. Akt/PKB signaling was activated in the tumors, whereas Ptena was still detected in tumor tissue from ptena(+/-)ptenb(-/-) zebrafish. We conclude that haploinsufficiency of the genes encoding Pten predisposes to hemangiosarcoma in zebrafish.

  13. Human TCR-MHC coevolution after divergence from mice includes increased nontemplate-encoded CDR3 diversity.

    Science.gov (United States)

    Chen, Xiaojing; Poncette, Lucia; Blankenstein, Thomas

    2017-11-06

    For thymic selection and responses to pathogens, T cells interact through their αβ T cell receptor (TCR) with peptide-major histocompatibility complex (MHC) molecules on antigen-presenting cells. How the diverse TCRs interact with a multitude of MHC molecules is unresolved. It is also unclear how humans generate larger TCR repertoires than mice do. We compared the TCR repertoire of CD4 T cells selected from a single mouse or human MHC class II (MHC II) in mice containing the human TCR gene loci. Human MHC II yielded greater thymic output and a more diverse TCR repertoire. The complementarity determining region 3 (CDR3) length adjusted for different inherent V-segment affinities to MHC II. Humans evolved with greater nontemplate-encoded CDR3 diversity than did mice. Our data, which demonstrate human TCR-MHC coevolution after divergence from rodents, explain the greater T cell diversity in humans and suggest a mechanism for ensuring that any V-J gene combination can be selected by a single MHC II. © 2017 Chen et al.

  14. Functional screening of antibiotic resistance genes from human gut microbiota reveals a novel gene fusion.

    Science.gov (United States)

    Cheng, Gong; Hu, Yongfei; Yin, Yeshi; Yang, Xi; Xiang, Chunsheng; Wang, Baohong; Chen, Yanfei; Yang, Fengling; Lei, Fang; Wu, Na; Lu, Na; Li, Jing; Chen, Quanze; Li, Lanjuan; Zhu, Baoli

    2012-11-01

    The human gut microbiota has a high density of bacteria that are considered a reservoir for antibiotic resistance genes (ARGs). In this study, one fosmid metagenomic library generated from the gut microbiota of four healthy humans was used to screen for ARGs against seven antibiotics. Eight new ARGs were obtained: one against amoxicillin, six against d-cycloserine, and one against kanamycin. The new amoxicillin resistance gene encodes a protein with 53% identity to a class D β-lactamase from Riemerella anatipestifer RA-GD. The six new d-cycloserine resistance genes encode proteins with 73-81% identity to known d-alanine-d-alanine ligases. The new kanamycin resistance gene encodes a protein of 274 amino acids with an N-terminus (amino acids 1-189) that has 42% identity to the 6'-aminoglycoside acetyltransferase [AAC(6')] from Enterococcus hirae and a C-terminus (amino acids 190-274) with 35% identity to a hypothetical protein from Clostridiales sp. SSC/2. A functional study on the novel kanamycin resistance gene showed that only the N-terminus conferred kanamycin resistance. Our results showed that functional metagenomics is a useful tool for the identification of new ARGs. © 2012 Federation of European Microbiological Societies. Published by Blackwell Publishing Ltd. All rights reserved.

  15. Isolation and characterization of 17 different genes encoding putative endopolygalacturonase genes from Rhizopus oryzae

    Science.gov (United States)

    Polygalacturonase enzymes are a valuable aid in the retting of flax for production of linens and, more recently, production of biofuels from citrus wastes. In a search of the recently sequenced Rhizopus oryzae strain 99-880 genome database, 18 putative endopolygalacturonase genes were identified, w...

  16. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  17. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  18. Alternative mRNA splicing creates transcripts encoding soluble proteins from most LILR genes.

    Science.gov (United States)

    Jones, Des C; Roghanian, Ali; Brown, Damien P; Chang, Chiwen; Allen, Rachel L; Trowsdale, John; Young, Neil T

    2009-11-01

    Leucocyte Ig-like receptors (LILR) are a family of innate immune receptors expressed on myeloid and lymphoid cells that influence adaptive immune responses. We identified a common mechanism of alternative mRNA splicing, which generates transcripts that encode soluble protein isoforms of the majority of human LILR. These alternative splice variants lack transmembrane and cytoplasmic encoding regions, due to the transcription of a cryptic stop codon present in an intron 5' of the transmembrane encoding exon. The alternative LILR transcripts were detected in cell types that express their membrane-associated isoforms. Expression of the alternative LILRB1 transcript in transfected cells resulted in the release of a soluble approximately 65 Kd LILRB1 protein into culture supernatants. Soluble LILRB1 protein was also detected in the culture supernatants of monocyte-derived DC. In vitro assays suggested that soluble LILRB1 could block the interaction between membrane-associated LILRB1 and HLA-class I. Soluble LILRB1 may act as a dominant negative regulator of HLA-class I-mediated LILRB1 inhibition. Soluble isoforms of the other LILR may function in a comparable way.

  19. Developing a hippocampal neural prosthetic to facilitate human memory encoding and recall.

    Science.gov (United States)

    Hampson, Robert E; Song, Dong; Robinson, Brian S; Fetterhoff, Dustin; Dakos, Alexander S; Roeder, Brent M; She, Xiwei; Wicks, Robert T; Witcher, Mark R; Couture, Daniel E; Laxton, Adrian W; Munger-Clary, Heidi; Popli, Gautam; Sollman, Myriam J; Whitlow, Christopher T; Marmarelis, Vasilis Z; Berger, Theodore W; Deadwyler, Sam A

    2018-03-28

    We demonstrate here the first successful implementation in humans of a proof-of-concept system for restoring and improving memory function via facilitation of memory encoding using the patient's own hippocampal spatiotemporal neural codes for memory. Memory in humans is subject to disruption by drugs, disease and brain injury, yet previous attempts to restore or rescue memory function in humans typically involved only nonspecific, modulation of brain areas and neural systems related to memory retrieval. We have constructed a model of processes by which the hippocampus encodes memory items via spatiotemporal firing of neural ensembles that underlie the successful encoding of short-term memory. A nonlinear multi-input, multi-output (MIMO) model of hippocampal CA3 and CA1 neural firing is computed that predicts activation patterns of CA1 neurons during the encoding (sample) phase of a delayed match-to-sample (DMS) human short-term memory task. MIMO model-derived electrical stimulation delivered to the same CA1 locations during the sample phase of DMS trials facilitated short-term/working memory by 37% during the task. Longer term memory retention was also tested in the same human subjects with a delayed recognition (DR) task that utilized images from the DMS task, along with images that were not from the task. Across the subjects, the stimulated trials exhibited significant improvement (35%) in both short-term and long-term retention of visual information. These results demonstrate the facilitation of memory encoding which is an important feature for the construction of an implantable neural prosthetic to improve human memory.

  20. Adenovirus carrying gene encoding Haliotis discus discus sialic acid binding lectin induces cancer cell apoptosis.

    Science.gov (United States)

    Yang, Xinyan; Wu, Liqin; Duan, Xuemei; Cui, Lianzhen; Luo, Jingjing; Li, Gongchu

    2014-06-30

    Lectins exist widely in marine bioresources such as bacteria, algae, invertebrate animals and fishes. Some purified marine lectins have been found to elicit cytotoxicity to cancer cells. However, there are few reports describing the cytotoxic effect of marine lectins on cancer cells through virus-mediated gene delivery. We show here that a replication-deficient adenovirus-carrying gene encoding Haliotis discus discus sialic acid binding lectin (Ad.FLAG-HddSBL) suppressed cancer cell proliferation by inducing apoptosis, as compared to the control virus Ad.FLAG. A down-regulated level of anti-apoptosis factor Bcl-2 was suggested to be responsible for the apoptosis induced by Ad.FLAG-HddSBL infection. Further subcellular localization studies revealed that HddSBL distributed in cell membrane, ER, and the nucleus, but not in mitochondria and Golgi apparatus. In contrast, a previously reported mannose-binding lectin Pinellia pedatisecta agglutinin entered the nucleus as well, but did not distribute in inner membrane systems, suggesting differed intracellular sialylation and mannosylation, which may provide different targets for lectin binding. Further cancer-specific controlling of HddSBL expression and animal studies may help to provide insights into a novel way of anti-cancer marine lectin gene therapy. Lectins may provide a reservoir of anti-cancer genes.

  1. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  2. The Bradyrhizobium japonicum frcB Gene Encodes a Diheme Ferric Reductase ▿†

    Science.gov (United States)

    Small, Sandra K.; O'Brian, Mark R.

    2011-01-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria. PMID:21705608

  3. The Bradyrhizobium japonicum frcB gene encodes a diheme ferric reductase.

    Science.gov (United States)

    Small, Sandra K; O'Brian, Mark R

    2011-08-01

    Iron utilization by bacteria in aerobic environments involves uptake as a ferric chelate from the environment, followed by reduction to the ferrous form. Ferric iron reduction is poorly understood in most bacterial species. Here, we identified Bradyrhizobium japonicum frcB (bll3557) as a gene adjacent to, and coregulated with, the pyoR gene (blr3555) encoding the outer membrane receptor for transport of a ferric pyoverdine. FrcB is a membrane-bound, diheme protein, characteristic of eukaryotic ferric reductases. Heme was essential for FrcB stability, as were conserved histidine residues in the protein that likely coordinate the heme moieties. Expression of the frcB gene in Escherichia coli conferred ferric reductase activity on those cells. Furthermore, reduced heme in purified FrcB was oxidized by ferric iron in vitro. B. japonicum cells showed inducible ferric reductase activity in iron-limited cells that was diminished in an frcB mutant. Steady-state levels of frcB mRNA were strongly induced under iron-limiting conditions, but transcript levels were low and unresponsive to iron in an irr mutant lacking the global iron response transcriptional regulator Irr. Thus, Irr positively controls the frcB gene. FrcB belongs to a family of previously uncharacterized proteins found in many proteobacteria and some cyanobacteria. This suggests that membrane-bound, heme-containing ferric reductase proteins are not confined to eukaryotes but may be common in bacteria.

  4. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Directory of Open Access Journals (Sweden)

    Walaa Kamel Mousa

    2015-04-01

    Full Text Available The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produce a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous genes. We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters.

  5. Hypoxia-inducible genes encoding small EF-hand proteins in rice and tomato.

    Science.gov (United States)

    Otsuka, Chie; Minami, Ikuko; Oda, Kenji

    2010-01-01

    Rice has evolved metabolic and morphological adaptations to low-oxygen stress to grow in submerged paddy fields. To characterize the molecular components that mediate the response to hypoxia in rice, we identified low-oxygen stress early response genes by microarray analysis. Among the highly responsive genes, five genes, OsHREF1 to OsHREF5, shared strong homology. They encoded small proteins harboring two EF-hands, typical Ca(2+)-binding motifs. Homologous genes were found in many land plants, including SlHREF in tomato, which is also strongly induced by hypoxia. SlHREF induction was detected in both roots and shoots of tomato plants under hypoxia. With the exception of OsHREF5, OsHREF expression was unaffected by drought, salinity, cold, or osmotic stress. Fluorescent signals of green fluorescent protein-fused OsHREFs were detected in the cytosol and nucleus. Ruthenium red, an inhibitor of intracellular Ca(2+) release, repressed induction of OsHREF1-4 under hypoxia. The HREFs may be related to the Ca(2+) response to hypoxia.

  6. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  7. Molecular characterization of genes encoding cytosolic Hsp70s in the zygomycete fungus Rhizopus nigricans

    Science.gov (United States)

    Černila, Boštjan; Črešnar, Bronislava; Breskvar, Katja

    2003-01-01

    Previous studies have shown that some stressors, including steroid hormones 21-OH progesterone and testosterone, stimulate the accumulation of heat shock protein 70 (hsp70) messenger ribonucleic acid (mRNA) population in the zygomycete filamentous fungus Rhizopus nigricans. In this study we report the cloning of 3 R nigricans hsp70 genes (Rnhsp70-1, Rnhsp70-2, and Rnhsp70-3) encoding cytosolic Hsp70s. With a Southern blot experiment under high stringency conditions we did not detect any additional highly homologous copies of the cytosolic hsp70 genes in the R nigricans genome. Sequence analyses showed that all 3 genes contain introns within the open reading frame. The dynamics of the R nigricans molecular response to progesterone, 21-OH progesterone, and testosterone, as well as to heat shock, copper ions, hydrogen peroxide, and ethanol was studied by temporal analysis of Rnhsp70-1 and Rnhsp70-2 mRNA accumulation. Northern blot experiments revealed that the Rnhsp70-2 transcript level is not affected by testosterone, whereas mRNA levels of both genes are rapidly increased with all the other stressors studied. Moreover, the decrease of transcript levels is notably delayed in ethanol stress, and a difference is observed between the profiles of Rnhsp70-1 and Rnhsp70-2 transcripts during heat stress. PMID:15115284

  8. Polymorphisms in genes encoding the serotonin and dopamine pathways in two sisters with metachromatic leukodystrophy.

    Science.gov (United States)

    Kumperscak, H G; Dolzan, V; Videtic, A; Plesnicar, B K

    2008-01-01

    Metachromatic leukodystrophy (MLD) is a metabolic disease that has recently been investigated as a model for the study of psychosis. We report on two sisters with adult-type MLD who developed psychiatric symptomatology, but differed in their expression of psychotic and depressive symptoms. Association studies have indicated that polymorphisms in genes encoding the serotonin and dopamine transporters and receptors are related to the symptomatology of schizophrenia and/or depression; hence both sisters were genotyped for some of these candidate genes. The sisters shared dopamine receptor D(2) (DRD(2)) c.1047GG (p.311Ser/Ser) and c.-141Cins/ins polymorphisms, which are significantly associated with schizophrenia, but differed in the serotonin transporter gene-linked polymorphic region and serotonin receptor 1A (5-HT(1A)) c.-1019C to G polymorphisms, which may have increased the elder sister's susceptibility to depressive symptoms. Much bigger samples would be needed to gain enough statistical power to develop any hypotheses. This is the first report on genotyping MLD patients for candidate genes for psychiatric disorders, although MLD has been proposed as a model for schizophrenia.

  9. EXPRESSION OF B-XYLOSIDASE ENCODING GENE IN PHIS/ BACILLUS MEGATERIUM MS SYSTEM

    Directory of Open Access Journals (Sweden)

    sri sumarsih

    2011-01-01

    Full Text Available b-Xylosidase encoding gene from G. thermoleovorans IT-08 had been expressed in the pHIS1525/ B. megaterium MS941 system. The b-xylosidase gene (xyl was inserted into plasmid pHIS1525 and propagated in E. coli DH10b. The recombinant plasmid was transformed into B. megaterium MS941 by protoplast transformation. Transformants were selected by growing the recombinant cells on solid LB medium containing tetracycline (10 µg/ ml. The expression of the b-xylosidase gene was assayed by overlaid the recombinant B. megaterium MS941 cell with agar medium containing 0.2% ethylumbelliferyl-b-D-xyloside (MUX. This research showed that the b-xylosidase gene was succesfully sub-cloned in pHIS1525 system and expressed by the recombinant B. megaterium MS941. Theaddition of 0.5% xylose into the culture medium could increase the activity of recombinantactivity of recombinant of recombinantb-xylosidase by 2.74 fold. The recombinant B. megaterium MS941 secreted 75.56% of the expressed b-xylosidase into culture medium. The crude extract b-xylosidase showed the optimum activity at 50° C and pH 6. The recombinant b-xylosidase was purified from culture supernatant by affinity chromatographic method using agarose containing Ni-NTA (Nickel-Nitrilotriacetic acid. The pure b-xylosidase showed a specific activity of 10.06 Unit/mg protein and relative molecular weight ± 58 kDa.

  10. Non-interfering effects of active post-encoding tasks on episodic memory consolidation in humans

    NARCIS (Netherlands)

    Varma, S.; Takashima, A.; Krewinkel, S.C.; Kooten, M.E. van; Fu, L.; Medendorp, W.P.; Kessels, R.P.C.; Daselaar, S.M.

    2017-01-01

    So far, studies that investigated interference effects of post-learning processes on episodic memory consolidation in humans have only used tasks involving complex and meaningful information. Such tasks require reallocation of general or encoding-specific resources away from consolidation-relevant

  11. Nucleic acids encoding mosaic clade M human immunodeficiency virus type 1 (HIV-1) envelope immunogens

    Science.gov (United States)

    Korber, Bette T; Fischer, William; Liao, Hua-Xin; Haynes, Barton F; Letvin, Norman; Hahn, Beatrice H

    2015-04-21

    The present invention relates to nucleic acids encoding mosaic clade M HIV-1 Env polypeptides and to compositions and vectors comprising same. The nucleic acids of the invention are suitable for use in inducing an immune response to HIV-1 in a human.

  12. Regulatory elements in the promoter region of the rat gene encoding the acyl-CoA-binding protein

    DEFF Research Database (Denmark)

    Elholm, M; Bjerking, G; Knudsen, J

    1996-01-01

    Acyl-CoA-binding protein (ACBP) is an ubiquitously expressed 10-kDa protein which is present in high amounts in cells involved in solute transport or secretion. Rat ACBP is encoded by a gene containing the typical hallmarks of a housekeeping gene. Analysis of the promoter region of the rat ACBP g...

  13. Enhanced expression in tobacco of the gene encoding green fluorescent protein by modification of its codon usage

    NARCIS (Netherlands)

    Rouwendal, G.J.A.; Mendes, O.; Wolbert, E.J.H.; Boer, de A.D.

    1997-01-01

    The gene encoding green fluorescent protein (GFP) from Aequorea victoria was resynthesized to adapt its codon usage for expression in plants by increasing the frequency of codons with a C or a G in the third position from 32 to 60%. The strategy for constructing the synthetic gfp gene was based on

  14. Prevalence of genes encoding for members of the staphylococcal leukotoxin family among clinical isolates of Staphylococcus aureus

    NARCIS (Netherlands)

    von Eiff, Christof; Friedrich, Alexander W.; Peters, Georg; Becker, Karsten

    Well-characterized Staphylococcus aureus nasal and blood isolates (N = 429) were tested by polymerase chain reaction for the prevalence of genes that encode leukocidal toxins. The leukotoxin genes lukE+lukD were found at high prevalence, significantly more so in blood (82%) than in nasal isolates

  15. Cloning and Characterization of a Gene (mspA) Encoding the Major Sheath Protein of Treponema maltophilum ATCC 51939T

    Science.gov (United States)

    Heuner, Klaus; Choi, Bong-Kyu; Schade, Rüdiger; Moter, Annette; Otto, Albrecht; Göbel, Ulf B.

    1999-01-01

    The major sheath protein-encoding gene (mspA) of the oral spirochete Treponema maltophilum ATCC 51939T was cloned by screening a genomic library with an anti-outer membrane fraction antibody. The mspA gene encodes a precursor protein of 575 amino acids with a predicted molecular mass of 62.3 kDa, including a signal peptide of 19 amino acids. The native MspA formed a heat-modifiable, detergent- and trypsin-stable complex which is associated with the outer membrane. Hybridization with an mspA-specific probe showed no cross-reactivity with the msp gene from Treponema denticola. PMID:9922270

  16. A human torque teno virus encodes a microRNA that inhibits interferon signaling.

    Directory of Open Access Journals (Sweden)

    Rodney P Kincaid

    Full Text Available Torque teno viruses (TTVs are a group of viruses with small, circular DNA genomes. Members of this family are thought to ubiquitously infect humans, although causal disease associations are currently lacking. At present, there is no understanding of how infection with this diverse group of viruses is so prevalent. Using a combined computational and synthetic approach, we predict and identify miRNA-coding regions in diverse human TTVs and provide evidence for TTV miRNA production in vivo. The TTV miRNAs are transcribed by RNA polymerase II, processed by Drosha and Dicer, and are active in RISC. A TTV mutant defective for miRNA production replicates as well as wild type virus genome; demonstrating that the TTV miRNA is dispensable for genome replication in a cell culture model. We demonstrate that a recombinant TTV genome is capable of expressing an exogenous miRNA, indicating the potential utility of TTV as a small RNA vector. Gene expression profiling of host cells identifies N-myc (and STAT interactor (NMI as a target of a TTV miRNA. NMI transcripts are directly regulated through a binding site in the 3'UTR. SiRNA knockdown of NMI contributes to a decreased response to interferon signaling. Consistent with this, we show that a TTV miRNA mediates a decreased response to IFN and increased cellular proliferation in the presence of IFN. Thus, we add Annelloviridae to the growing list of virus families that encode miRNAs, and suggest that miRNA-mediated immune evasion can contribute to the pervasiveness associated with some of these viruses.

  17. Multidrug-Resistant Escherichia albertii: Co-occurrence of β-Lactamase and MCR-1 Encoding Genes

    Directory of Open Access Journals (Sweden)

    Qun Li

    2018-02-01

    Full Text Available Escherichia albertii is an emerging member of the Enterobacteriaceae causing human and animal enteric infections. Antimicrobial resistance among enteropathogens has been reported to be increasing in the past years. The purpose of this study was to investigate antibiotic resistance and resistance genes in E. albertii isolated from Zigong city, Sichuan province, China. The susceptibility to 21 antimicrobial agents was determined by Kirby–Bauer disk diffusion method. The highest prevalence was tetracycline resistance with a rate of 62.7%, followed by resistance to nalidixic acid and streptomycin with a rate of 56.9 and 51.0%, respectively. All isolates were sensitive or intermediate susceptible to imipenem, meropenem, amoxicillin–clavulanic acid, and levofloxacin. Among 51 E. albertii isolates, 15 were extended-spectrum β-lactamase-producing as confirmed by the double disk test. The main β-lactamase gene groups, i.e., blaTEM, blaSHV, and blaCTX-M, were detected in17, 20, and 22 isolates, respectively. Furthermore, four colistin-resistant isolates with minimum inhibitory concentrations of 8 mg/L were identified. The colistin-resistant isolates all harbored mcr-1 and blaCTX-M-55. Genome sequencing showed that E. albertii strain SP140150 carried mcr-1 and blaCTX-M-55 in two different plasmids. This study provided significant information regarding antibiotic resistance profiles and identified the co-occurrence of β-lactamase and MCR-1 encoding genes in E. albertii isolates.

  18. Gene Transfer and Molecular Cloning of the Human NGF Receptor

    Science.gov (United States)

    Chao, Moses V.; Bothwell, Mark A.; Ross, Alonzo H.; Koprowski, Hilary; Lanahan, Anthony A.; Buck, C. Randall; Sehgal, Amita

    1986-04-01

    Nerve growth factor (NGF) and its receptor are important in the development of cells derived from the neural crest. Mouse L cell transformants have been generated that stably express the human NGF receptor gene transfer with total human DNA. Affinity cross-linking, metabolic labeling and immunoprecipitation, and equilibrium binding with 125I-labeled NGF revealed that this NGF receptor had the same size and binding characteristics as the receptor from human melanoma cells and rat PC12 cells. The sequences encoding the NGF receptor were molecularly cloned using the human Alu repetitive sequence as a probe. A cosmid clone that contained the human NGF receptor gene allowed efficient transfection and expression of the receptor.

  19. Degradation of Benzene by Pseudomonas veronii 1YdBTEX2 and 1YB2 Is Catalyzed by Enzymes Encoded in Distinct Catabolism Gene Clusters.

    Science.gov (United States)

    de Lima-Morales, Daiana; Chaves-Moreno, Diego; Wos-Oxley, Melissa L; Jáuregui, Ruy; Vilchez-Vargas, Ramiro; Pieper, Dietmar H

    2016-01-01

    Pseudomonas veronii 1YdBTEX2, a benzene and toluene degrader, and Pseudomonas veronii 1YB2, a benzene degrader, have previously been shown to be key players in a benzene-contaminated site. These strains harbor unique catabolic pathways for the degradation of benzene comprising a gene cluster encoding an isopropylbenzene dioxygenase where genes encoding downstream enzymes were interrupted by stop codons. Extradiol dioxygenases were recruited from gene clusters comprising genes encoding a 2-hydroxymuconic semialdehyde dehydrogenase necessary for benzene degradation but typically absent from isopropylbenzene dioxygenase-encoding gene clusters. The benzene dihydrodiol dehydrogenase-encoding gene was not clustered with any other aromatic degradation genes, and the encoded protein was only distantly related to dehydrogenases of aromatic degradation pathways. The involvement of the different gene clusters in the degradation pathways was suggested by real-time quantitative reverse transcription PCR. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  20. The RFC2 gene encoding a subunit of replication factor C of Saccharomyces cerevisiae.

    OpenAIRE

    Noskov, V; Maki, S; Kawasaki, Y; Leem, S H; Ono, B; Araki, H; Pavlov, Y; Sugino, A

    1994-01-01

    Replication Factor C (RF-C) of Saccharomyces cerevisiae is a complex that consists of several different polypeptides ranging from 120- to 37 kDa (Yoder and Burgers, 1991; Fien and Stillman, 1992), similar to human RF-C. We have isolated a gene, RFC2, that appears to be a component of the yeast RF-C. The RFC2 gene is located on chromosome X of S. cerevisiae and is essential for cell growth. Disruption of the RFC2 gene led to a dumbbell-shaped terminal morphology, common to mutants having a def...

  1. Identification and functional analysis of the erh1(+ gene encoding enhancer of rudimentary homolog from the fission yeast Schizosaccharomyces pombe.

    Directory of Open Access Journals (Sweden)

    Marek K Krzyzanowski

    Full Text Available The ERH gene encodes a highly conserved small nuclear protein with a unique amino acid sequence and three-dimensional structure but unknown function. The gene is present in animals, plants, and protists but to date has only been found in few fungi. Here we report that ERH homologs are also present in all four species from the genus Schizosaccharomyces, S. pombe, S. octosporus, S. cryophilus, and S. japonicus, which, however, are an exception in this respect among Ascomycota and Basidiomycota. The ERH protein sequence is moderately conserved within the genus (58% identity between S. pombe and S.japonicus, but the intron-rich genes have almost identical intron-exon organizations in all four species. In S. pombe, erh1(+ is expressed at a roughly constant level during vegetative growth and adaptation to unfavorable conditions such as nutrient limitation and hyperosmotic stress caused by sorbitol. Erh1p localizes preferentially to the nucleus with the exception of the nucleolus, but is also present in the cytoplasm. Cells lacking erh1(+ have an aberrant cell morphology and a comma-like shape when cultured to the stationary phase, and exhibit a delayed recovery from this phase followed by slower growth. Loss of erh1(+ in an auxotrophic background results in enhanced arrest in the G1 phase following nutritional stress, and also leads to hypersensitivity to agents inducing hyperosmotic stress (sorbitol, inhibiting DNA replication (hydroxyurea, and destabilizing the plasma membrane (SDS; this hypersensitivity can be abolished by expression of S. pombe erh1(+ and, to a lesser extent, S. japonicus erh1(+ or human ERH. Erh1p fails to interact with the human Ciz1 and PDIP46/SKAR proteins, known molecular partners of human ERH. Our data suggest that in Schizosaccharomyces sp. erh1(+ is non-essential for normal growth and Erh1p could play a role in response to adverse environmental conditions and in cell cycle regulation.

  2. Isolation and characterization of the human parathyroid hormone-like peptide gene

    International Nuclear Information System (INIS)

    Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.

    1989-01-01

    A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors

  3. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  4. Molecular characterization of a novel mosaic tet(S/M) gene encoding tetracycline resistance in foodborne strains of Streptococcus bovis.

    Science.gov (United States)

    Barile, Simona; Devirgiliis, Chiara; Perozzi, Giuditta

    2012-09-01

    The presence of antibiotic-resistance (AR) genes in foodborne bacteria of enteric origin represents a relevant threat to human health in the case of opportunistic pathogens, which can reach the human gut through the food chain. Streptococcus bovis is a human opportunistic pathogen often associated with infections in immune-compromised or cancer patients, and it can also be detected in the environment, including fermented foods. We have focused on the molecular characterization of a tetracycline (Tet)-resistance gene present in 39 foodborne isolates of S. bovis phenotypically resistant to this drug. The gene was identified as a novel tet(S/M) fusion, encoding a mosaic protein composed of the N-terminal 33 amino acids of Tet(S), in-frame with the Tet(M) coding sequence. Heterologous expression of the mosaic gene was found to confer Tet resistance upon Escherichia coli recipients. Moreover, the tet(S/M) gene was found to be transcriptionally inducible by Tet under the endogenous tet(S) promoter in both S. bovis and E. coli. Nucleotide sequencing of the surrounding genomic region of 16.2 kb revealed large blocks of homology with the genomes of Streptococcus infantarius and Lactococcus lactis. A subregion of about 4 kb containing mosaic tet(S/M) was flanked by two copies of the IS1216 mobile element. PCR amplification with primers directed outwards from the tet(S/M) gene identified the presence of a 4.3 kb circular form corresponding to the intervening chromosomal region between the two IS1216 elements, but lacking a replication origin. The circular element shared extensive overall homology with a region of the multidrug-resistance plasmid pK214 from Lc. lactis, containing tet(S), as well as the IS1216 transposase-containing element and intervening non-coding sequences. Linear reconstruction of the insertion events likely to have occurred within this genomic region, inferred from sequence homology, provides further evidence of the chromosomal rearrangements that drive

  5. Demonstration of expression of a neuropeptide-encoding gene in crustacean hemocytes.

    Science.gov (United States)

    Wu, Su-Hua; Chen, Yan-Jhou; Huang, Shao-Yen; Tsai, Wei-Shiun; Wu, Hsin-Ju; Hsu, Tsan-Ting; Lee, Chi-Ying

    2012-04-01

    Crustacean hyperglycemic hormone (CHH) was originally identified in a neuroendocrine system-the X-organ/sinus gland complex. In this study, a cDNA (Prc-CHH) encoding CHH precursor was cloned from the hemocyte of the crayfish Procambarus clarkii. Analysis of tissues by a CHH-specific enzyme-linked immunosorbent assay (ELISA) confirmed the presence of CHH in hemocytes, the levels of which were much lower than those in the sinus gland, but 2 to 10 times higher than those in the thoracic and cerebral ganglia. Total hemocytes were separated by density gradient centrifugation into layers of hyaline cell (HC), semi-granular cell (SGC), and granular cell (GC). Analysis of extracts of each layer using ELISA revealed that CHH is present in GCs (202.8±86.7 fmol/mg protein) and SGCs (497.8±49.4 fmol/mg protein), but not in HCs. Finally, CHH stimulated the membrane-bound guanylyl cyclase (GC) activity of hemocytes in a dose-dependent manner. These data for the first time confirm that a crustacean neuropeptide-encoding gene is expressed in cells essential for immunity and its expression in hemocytes is cell type-specific. Effect of CHH on the membrane-bound GC activity of hemocyte suggests that hemocyte is a target site of CHH. Possible functions of the hemocyte-derived CHH are discussed. Copyright © 2012 Elsevier Inc. All rights reserved.

  6. The zebrafish moonshine gene encodes transcriptional intermediary factor 1gamma, an essential regulator of hematopoiesis.

    Directory of Open Access Journals (Sweden)

    David G Ransom

    2004-08-01

    Full Text Available Hematopoiesis is precisely orchestrated by lineage-specific DNA-binding proteins that regulate transcription in concert with coactivators and corepressors. Mutations in the zebrafish moonshine (mon gene specifically disrupt both embryonic and adult hematopoiesis, resulting in severe red blood cell aplasia. We report that mon encodes the zebrafish ortholog of mammalian transcriptional intermediary factor 1gamma (TIF1gamma (or TRIM33, a member of the TIF1 family of coactivators and corepressors. During development, hematopoietic progenitor cells in mon mutants fail to express normal levels of hematopoietic transcription factors, including gata1, and undergo apoptosis. Three different mon mutant alleles each encode premature stop codons, and enforced expression of wild-type tif1gamma mRNA rescues embryonic hematopoiesis in homozygous mon mutants. Surprisingly, a high level of zygotic tif1gamma mRNA expression delineates ventral mesoderm during hematopoietic stem cell and progenitor formation prior to gata1 expression. Transplantation studies reveal that tif1gamma functions in a cell-autonomous manner during the differentiation of erythroid precursors. Studies in murine erythroid cell lines demonstrate that Tif1gamma protein is localized within novel nuclear foci, and expression decreases during erythroid cell maturation. Our results establish a major role for this transcriptional intermediary factor in the differentiation of hematopoietic cells in vertebrates.

  7. Kallmann syndrome: mutations in the genes encoding prokineticin-2 and prokineticin receptor-2.

    Directory of Open Access Journals (Sweden)

    Catherine Dodé

    2006-10-01

    Full Text Available Kallmann syndrome combines anosmia, related to defective olfactory bulb morphogenesis, and hypogonadism due to gonadotropin-releasing hormone deficiency. Loss-of-function mutations in KAL1 and FGFR1 underlie the X chromosome-linked form and an autosomal dominant form of the disease, respectively. Mutations in these genes, however, only account for approximately 20% of all Kallmann syndrome cases. In a cohort of 192 patients we took a candidate gene strategy and identified ten and four different point mutations in the genes encoding the G protein-coupled prokineticin receptor-2 (PROKR2 and one of its ligands, prokineticin-2 (PROK2, respectively. The mutations in PROK2 were detected in the heterozygous state, whereas PROKR2 mutations were found in the heterozygous, homozygous, or compound heterozygous state. In addition, one of the patients heterozygous for a PROKR2 mutation was also carrying a missense mutation in KAL1, thus indicating a possible digenic inheritance of the disease in this individual. These findings reveal that insufficient prokineticin-signaling through PROKR2 leads to abnormal development of the olfactory system and reproductive axis in man. They also shed new light on the complex genetic transmission of Kallmann syndrome.

  8. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  9. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  10. Halloween genes encode P450 enzymes that mediate steroid hormone biosynthesis in Drosophila melanogaster.

    Science.gov (United States)

    Gilbert, Lawrence I

    2004-02-27

    Mutation of members of the Halloween gene family results in embryonic lethality. We have shown that two of these genes code for enzymes responsible for specific steps in the synthesis of ecdysone, a polyhydroxylated sterol that is the precursor of the major molting hormone of all arthropods, 20-hydroxyecdysone. These two mitochondrial P450 enzymes, coded for by disembodied (dib) (CYP302A1) and shadow (sad) (CYP315A1), are the C22 and C2 hydroxylases, respectively, as shown by transfection of the gene into S2 cells and subsequent biochemical analysis. These are the last two enzymes in the ecdysone biosynthetic pathway. A third enzyme, necessary for the critical conversion of ecdysone to 20-hydroxyecdysone, the 20-monooxygenase, is encoded by shade (shd) (CYP314A1). All three enzymes are mitochondrial although shade has motifs suggesting both mitochondrial and microsomal locations. By tagging these enzymes, their subcellular location has been confirmed by confocal microscopy. Shade is present in several tissues as expected while disembodied and shadow are restricted to the ring gland. The paradigm used should allow us to define the enzymes mediating the entire ecdysteroid biosynthetic pathway.

  11. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  12. Biodiversity of genes encoding anti-microbial traits within plant associated microbes

    Science.gov (United States)

    Mousa, Walaa K.; Raizada, Manish N.

    2015-01-01

    The plant is an attractive versatile home for diverse associated microbes. A subset of these microbes produces a diversity of anti-microbial natural products including polyketides, non-ribosomal peptides, terpenoids, heterocylic nitrogenous compounds, volatile compounds, bacteriocins, and lytic enzymes. In recent years, detailed molecular analysis has led to a better understanding of the underlying genetic mechanisms. New genomic and bioinformatic tools have permitted comparisons of orthologous genes between species, leading to predictions of the associated evolutionary mechanisms responsible for diversification at the genetic and corresponding biochemical levels. The purpose of this review is to describe the biodiversity of biosynthetic genes of plant-associated bacteria and fungi that encode selected examples of antimicrobial natural products. For each compound, the target pathogen and biochemical mode of action are described, in order to draw attention to the complexity of these phenomena. We review recent information of the underlying molecular diversity and draw lessons through comparative genomic analysis of the orthologous coding sequences (CDS). We conclude by discussing emerging themes and gaps, discuss the metabolic pathways in the context of the phylogeny and ecology of their microbial hosts, and discuss potential evolutionary mechanisms that led to the diversification of biosynthetic gene clusters. PMID:25914708

  13. A Mutation in the Tubulin-Encoding Gene Causes Complex Cortical Malformations and Unilateral Hypohidrosis

    Directory of Open Access Journals (Sweden)

    Shinobu Fukumura MD

    2016-08-01

    Full Text Available Recent studies have emphasized the association between tubulin gene mutations and developmental abnormalities of the cortex. In this study, the authors identified a mutation in the tubulin-encoding class III β-tubulin ( TUBB3 gene in a 4-year-old boy presenting with brain abnormalities and unilateral hypohidrosis. The patient showed a left internal strabismus, moderate developmental delay, and congenital hypohidrosis of the right side of the body. Magnetic resonance imaging disclosed gyral disorganization mainly in the left perisylvian region, dysmorphic and hypertrophic basal ganglia with fusion between the putamen and caudate nucleus without affecting the anterior limb of the internal capsule, and moderate hypoplasia of the right brain stem and cerebellum. Diffusion tensor imaging studies revealed disorganization of the pyramidal fibers. The amplitude of the sympathetic skin response was low in the right arm, which led to a diagnosis of focal autonomic neuropathy. Sequencing the TUBB3 gene revealed a de novo missense mutation, c.862G>A (p.E288K.

  14. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Science.gov (United States)

    Miao, Hongxia; Sun, Peiguang; Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  15. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  16. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    -of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited......The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  17. A flax-retting endopolygalacturonase-encoding gene from Rhizopus oryzae.

    Science.gov (United States)

    Xiao, Zhizhuang; Wang, Shaozhao; Bergeron, Hélène; Zhang, Jianchun; Lau, Peter C K

    2008-11-01

    A polygalacturonase from the filamentous fungus Rhizopus oryzae strain sb (NRRL 29086), previously shown to be effective in the retting of flax fibers, was shown by the analysis of its reaction products on polygalacturonic acid to be an endo-type. By zymogram analysis, the enzyme in the crude culture filtrate appeared as two active species of 37 and 40 kD. The endopolygalacturonase-encoding gene was cloned in Escherichia coli and its translated 383-amino acid sequence found to be identical to that of a presumed exopolygalacturonase found in R. oryzae strain YM9901 and 96% identical to a hypothetical protein (RO3G_04731.1) in the sequenced genome of R. oryzae strain 99-880. Phylogenetic analysis revealed the presence of an unique cluster of Rhizopus polygalacturonase sequences that are separate from other fungal polygalacturonases. Conservation of 12 cysteines appears to be a special feature of this family of Rhizopus polygalacturonase sequences.

  18. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters.

    Science.gov (United States)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven; Jørgensen, Morten Egevang; Olsen, Carl Erik; Andersen, Jonathan Sonne; Seynnaeve, David; Verhoye, Thalia; Fulawka, Rudy; Denolf, Peter; Halkier, Barbara Ann

    2017-04-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed glucosinolate content in other oilseed crops, such as Camelina sativa or Crambe abyssinica.

  19. Cloning, expression and characterization of a gene from earthworm Eisenia fetida encoding a blood-clot dissolving protein.

    Directory of Open Access Journals (Sweden)

    GangQiang Li

    Full Text Available A lumbrokinase gene encoding a blood-clot dissolving protein was cloned from earthworm (Eisenia fetida by RT-PCR amplification. The gene designated as CST1 (GenBank No. AY840996 was sequence analyzed. The cDNA consists of 888 bp with an open reading frame of 729 bp, which encodes 242 amino acid residues. Multiple sequence alignments revealed that CST1 shares similarities and conserved amino acids with other reported lumbrokinases. The amino acid sequence of CST1 exhibits structural features similar to those found in other serine proteases, including human tissue-type (tPA, urokinase (uPA, and vampire bat (DSPAα1 plasminogen activators. CST1 has a conserved catalytic triad, found in the active sites of protease enzymes, which are important residues involved in polypeptide catalysis. CST1 was expressed as inclusion bodies in Escherichia coli BL21(DE3. The molecular mass of recombinant CST1 (rCST was 25 kDa as estimated by SDS-PAGE, and further confirmed by Western Blot analysis. His-tagged rCST1 was purified and renatured using nickel-chelating resin with a recovery rate of 50% and a purity of 95%. The purified, renatured rCST1 showed fibrinolytic activity evaluated by both a fibrin plate and a blood clot lysis assay. rCST1 degraded fibrin on the fibrin plate. A significant percentage (65.7% of blood clot lysis was observed when blood clot was treated with 80 mg/mL of rCST1 in vitro. The antithrombotic activity of rCST1 was 912 units/mg calculated by comparison with the activity of a lumbrokinase standard. These findings indicate that rCST1 has potential as a potent blood-clot treatment. Therefore, the expression and purification of a single lumbrokinase represents an important improvement in the use of lumbrokinases.

  20. Genome-wide analysis reveals loci encoding anti-macrophage factors in the human pathogen Burkholderia pseudomallei K96243.

    Directory of Open Access Journals (Sweden)

    Andrea J Dowling

    2010-12-01

    Full Text Available Burkholderia pseudomallei is an important human pathogen whose infection biology is still poorly understood. The bacterium is endemic to tropical regions, including South East Asia and Northern Australia, where it causes melioidosis, a serious disease associated with both high mortality and antibiotic resistance. B. pseudomallei is a Gram-negative facultative intracellular pathogen that is able to replicate in macrophages. However despite the critical nature of its interaction with macrophages, few anti-macrophage factors have been characterized to date. Here we perform a genome-wide gain of function screen of B. pseudomallei strain K96243 to identify loci encoding factors with anti-macrophage activity. We identify a total of 113 such loci scattered across both chromosomes, with positive gene clusters encoding transporters and secretion systems, enzymes/toxins, secondary metabolite, biofilm, adhesion and signal response related factors. Further phenotypic analysis of four of these regions shows that the encoded factors cause striking cellular phenotypes relevant to infection biology, including apoptosis, formation of actin 'tails' and multi-nucleation within treated macrophages. The detailed analysis of the remaining host of loci will facilitate genetic dissection of the interaction of this important pathogen with host macrophages and thus further elucidate this critical part of its infection cycle.

  1. Ty3 GAG3 and POL3 genes encode the components of intracellular particles.

    Science.gov (United States)

    Hansen, L J; Chalker, D L; Orlinsky, K J; Sandmeyer, S B

    1992-03-01

    Ty3 is a Saccharomyces cerevisiae retrotransposon that integrates near the transcription initiation sites of polymerase III-transcribed genes. It is distinct from the copialike Ty1 and Ty2 retrotransposons of S. cerevisiae in both the sequences of encoded proteins and gene order. It is a member of the gypsylike family of retrotransposons which resemble animal retroviruses. This study was undertaken to investigate the nucleocapsid particle of a transpositionally active gypsylike retrotransposon. Characterization of extracts from cells in which Ty3 expression was induced showed the presence of Ty3 nucleoprotein complexes, or viruslike particles, that migrated on linear sucrose gradients with a size of 156S. These particles are composed of Ty3 RNA, full-length, linear DNA, and proteins. In this study, antibodies raised against peptides predicted from the Ty3 sequence were used to identify Ty3-encoded proteins. These include the capsid (26 kDa), nucleocapsid (9 kDa), and reverse transcriptase (55 kDa) proteins. Ty3 integrase proteins of 61 and 58 kDa were identified previously (L. J. Hansen and S. B. Sandmeyer, J. Virol. 64:2599-2607, 1990). Reverse transcriptase activity associated with the particles was measured by using exogenous and endogenous primer-templates. Immunofluorescence studies of cells overexpressing Ty3 revealed cytoplasmic clusters of immunoreactive proteins. Transmission electron microscopy showed that Ty3 viruslike particles are about 50 nm in diameter. Thus, despite the unusual position specificity of Ty3 upstream of tRNA-coding regions, aspects of the Ty3 life cycle are fundamentally similar to those of retroviruses.

  2. Flagellin Encoded in Gene-Based Vector Vaccines Is a Route-Dependent Immune Adjuvant.

    Directory of Open Access Journals (Sweden)

    Hamada F Rady

    Full Text Available Flagellin has been tested as a protein-based vaccine adjuvant, with the majority of studies focused on antibody responses. Here, we evaluated the adjuvant activity of flagellin for both cellular and humoral immune responses in BALB/c mice in the setting of gene-based immunization, and have made several novel observations. DNA vaccines and adenovirus (Ad vectors were engineered to encode mycobacterial protein Ag85B, with or without flagellin of Salmonella typhimurium (FliC. DNA-encoded flagellin given IM enhanced splenic CD4+ and CD8+ T cell responses to co-expressed vaccine antigen, including memory responses. Boosting either IM or intranasally with Ad vectors expressing Ag85B without flagellin led to durable enhancement of Ag85B-specific antibody and CD4+ and CD8+ T cell responses in both spleen and pulmonary tissues, correlating with significantly improved protection against challenge with pathogenic aerosolized M. tuberculosis. However, inclusion of flagellin in both DNA prime and Ad booster vaccines induced localized pulmonary inflammation and transient weight loss, with route-dependent effects on vaccine-induced T cell immunity. The latter included marked reductions in levels of mucosal CD4+ and CD8+ T cell responses following IM DNA/IN Ad mucosal prime-boosting, although antibody responses were not diminished. These findings indicate that flagellin has differential and route-dependent adjuvant activity when included as a component of systemic or mucosally-delivered gene-based prime-boost immunization. Clear adjuvant activity for both T and B cell responses was observed when flagellin was included in the DNA priming vaccine, but side effects occurred when given in an Ad boosting vector, particularly via the pulmonary route.

  3. Gene-based neonatal immune priming potentiates a mucosal adenoviral vaccine encoding mycobacterial Ag85B.

    Science.gov (United States)

    Dai, Guixiang; Rady, Hamada F; Huang, Weitao; Shellito, Judd E; Mason, Carol; Ramsay, Alistair J

    2016-12-07

    Tuberculosis remains a major public health hazard worldwide, with neonates and young infants potentially more susceptible to infection than adults. BCG, the only vaccine currently available, provides some protection against tuberculous meningitis in children but variable efficacy in adults, and is not safe to use in immune compromised individuals. A safe and effective vaccine that could be given early in life, and that could also potentiate subsequent booster immunization, would represent a significant advance. To test this proposition, we have generated gene-based vaccine vectors expressing Ag85B from Mycobacterium tuberculosis (Mtb) and designed experiments to test their immunogenicity and protective efficacy particularly when given in heterologous prime-boost combination, with the initial DNA vaccine component given soon after birth. Intradermal delivery of DNA vaccines elicited Th1-based immune responses against Ag85B in neonatal mice but did not protect them from subsequent aerosol challenge with virulent Mtb H37Rv. Recombinant adenovirus vectors encoding Ag85B, given via the intranasal route at six weeks of age, generated moderate immune responses and were poorly protective. However, neonatal DNA priming following by mucosal boosting with recombinant adenovirus generated strong immune responses, as evidenced by strong Ag85B-specific CD4+ and CD8+ T cell responses, both in the lung-associated lymph nodes and the spleen, by the quality of these responding cells (assessed by their capacity to secrete multiple antimicrobial factors), and by improved protection, as indicated by reduced bacterial burden in the lungs following pulmonary TB challenge. These results suggest that neonatal immunization with gene-based vaccines may create a favorable immunological environment that potentiates the pulmonary mucosal boosting effects of a subsequent heterologous vector vaccine encoding the same antigen. Our data indicate that immunization early in life with mycobacterial

  4. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...... and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. Results To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (Ch......IP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression...

  5. Cloning and functional characterization of the gene encoding the transcription factor Acel in the basidiomycete Phanerochaete chrysosporium

    Directory of Open Access Journals (Sweden)

    RUBÉN POLANCO

    2006-01-01

    Full Text Available In this report we describe the isolation and characterization of a gene encoding the transcription factor Acel (Activation protein of cup 1 Expression in the white rot fungus Phanerochaete chrysosporium. Pc-acel encodes a predicted protein of 633 amino acids containing the copper-fist DNA binding domain typically found in fungal transcription factors such as Acel, Macl and Haal from Saccharomyces cerevisiae. The Pc-acel gene is localized in Scaffold 5, between coordinates 220841 and 222983. A S. cerevisiae acel null mutant strain unable to grow in high-copper medium was fully complemented by transformation with the cDNA of Pc-acel. Moreover, Northern blot hybridization studies indicated that Pc-acel cDNA restores copper inducibility of the yeast cup 1 gene, which encodes the metal-binding protein metallothionein implicated in copper resistance. To our knowledge, this is first report describing an Acel transcription factor in basidiomycetes

  6. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  7. Human Cytomegalovirus Encoded Homologs of Cytokines, Chemokines and their Receptors: Roles in Immunomodulation

    Science.gov (United States)

    McSharry, Brian P.; Avdic, Selmir; Slobedman, Barry

    2012-01-01

    Human cytomegalovirus (HCMV), the largest human herpesvirus, infects a majority of the world’s population. Like all herpesviruses, following primary productive infection, HCMV establishes a life-long latent infection, from which it can reactivate years later to produce new, infectious virus. Despite the presence of a massive and sustained anti-HCMV immune response, productively infected individuals can shed virus for extended periods of time, and once latent infection is established, it is never cleared from the host. It has been proposed that HCMV must therefore encode functions which help to evade immune mediated clearance during productive virus replication and latency. Molecular mimicry is a strategy used by many viruses to subvert and regulate anti-viral immunity and HCMV has hijacked/developed a range of functions that imitate host encoded immunomodulatory proteins. This review will focus on the HCMV encoded homologs of cellular cytokines/chemokines and their receptors, with an emphasis on how these virus encoded homologs may facilitate viral evasion of immune clearance. PMID:23202490

  8. Human Cytomegalovirus Encoded Homologs of Cytokines, Chemokines and their Receptors: Roles in Immunomodulation

    Directory of Open Access Journals (Sweden)

    Brian P. McSharry

    2012-10-01

    Full Text Available Human cytomegalovirus (HCMV, the largest human herpesvirus, infects a majority of the world’s population. Like all herpesviruses, following primary productive infection, HCMV establishes a life-long latent infection, from which it can reactivate years later to produce new, infectious virus. Despite the presence of a massive and sustained anti-HCMV immune response, productively infected individuals can shed virus for extended periods of time, and once latent infection is established, it is never cleared from the host. It has been proposed that HCMV must therefore encode functions which help to evade immune mediated clearance during productive virus replication and latency. Molecular mimicry is a strategy used by many viruses to subvert and regulate anti-viral immunity and HCMV has hijacked/developed a range of functions that imitate host encoded immunomodulatory proteins. This review will focus on the HCMV encoded homologs of cellular cytokines/chemokines and their receptors, with an emphasis on how these virus encoded homologs may facilitate viral evasion of immune clearance.

  9. [Cloning of y3 gene encoding a tobacco mosaic virus inhibitor from Coprinus comatus and transformation to Nicotiana tabacum].

    Science.gov (United States)

    Wang, Xueren; He, Tao; Zhang, Gaina; Hao, Jianguo; Jia, Jingfen

    2010-02-01

    The protein Y3 was a TMV inhibitor which was encoded by y3 gene. The aim of this work was to clone the full length of y3 gene from Coprinus comatus and to reveal its inhibitory function to TMV in in vivo conditions. We amplified the unknown 5'- terminal cDNA sequence of y3 gene with 5'- Full RACE Core Set (TaKaRa), obtained the full length of this gene by RT-PCR, constructed the expression plasmid pCAMBIA1301-y3 via inserting gene y3 sequence, CaMV 35 S promoter, and NOS terminator at MCS and transformed it into Nicotiana tabacum via agrobacterium-mediation. The full length of y3 gene was 534 bps including one ORF encoding 130 amino acid residues (GenBank Accession No. GQ859168; EMBL FN546262). The cDNA sequence and its deduced amino acid sequence showed high similarity (94%) to the published fragment of y3 gene sequence. Northern blot analysis proved the transcription of y3 gene in transgenic tobacco plants. The transgenic plants inoculated with TMV expressed the inhibitory activity to TMV. We cloned the full length of y3 gene and obtained transgenic tobacco plants. The expression of y3 gene in transgenic plants improved the inhibitory activity to TMV. The cloning and expression analysis of y3 gene might provide background information for future studying of y3 gene.

  10. Mapping gene associations in human mitochondria using clinical disease phenotypes.

    Directory of Open Access Journals (Sweden)

    Curt Scharfe

    2009-04-01

    Full Text Available Nuclear genes encode most mitochondrial proteins, and their mutations cause diverse and debilitating clinical disorders. To date, 1,200 of these mitochondrial genes have been recorded, while no standardized catalog exists of the associated clinical phenotypes. Such a catalog would be useful to develop methods to analyze human phenotypic data, to determine genotype-phenotype relations among many genes and diseases, and to support the clinical diagnosis of mitochondrial disorders. Here we establish a clinical phenotype catalog of 174 mitochondrial disease genes and study associations of diseases and genes. Phenotypic features such as clinical signs and symptoms were manually annotated from full-text medical articles and classified based on the hierarchical MeSH ontology. This classification of phenotypic features of each gene allowed for the comparison of diseases between different genes. In turn, we were then able to measure the phenotypic associations of disease genes for which we calculated a quantitative value that is based on their shared phenotypic features. The results showed that genes sharing more similar phenotypes have a stronger tendency for functional interactions, proving the usefulness of phenotype similarity values in disease gene network analysis. We then constructed a functional network of mitochondrial genes and discovered a higher connectivity for non-disease than for disease genes, and a tendency of disease genes to interact with each other. Utilizing these differences, we propose 168 candidate genes that resemble the characteristic interaction patterns of mitochondrial disease genes. Through their network associations, the candidates are further prioritized for the study of specific disorders such as optic neuropathies and Parkinson disease. Most mitochondrial disease phenotypes involve several clinical categories including neurologic, metabolic, and gastrointestinal disorders, which might indicate the effects of gene defects

  11. Prevalence of Genes Encoding Outer Membrane Virulence Factors Among Fecal Escherichia coli Isolates

    Directory of Open Access Journals (Sweden)

    Ahmad Rashki

    2017-03-01

    Full Text Available Objective: Escherichia coli is commensal bacterium of human intestine. The gut is a common pool of E. coli isolates causing urinary tract infections (UTIs. Some of fecal E. coli (FeEC by the possession of certain virulence factors is able to cause diseases in human and other mammalian models. To evaluate the health threats coordinated with a given fecal source of E. coli strains, we determined the frequency of genes expressing virulence determinants in fecal E. coli isolates collected from human feces in Zabol, southeast of Iran. Methods: Escherichia coli isolates (n = 94 were separated from the feces of patients attending teaching hospitals, and screened for various virulence genes: fimH, his, hlyA, ompT, irp2, iucD, iroN, and cnf1 by using the multiplex polymerase chain reaction (PCR method. Results: The prevalence of virulence genes was as follows: adhesins (fimH, 98% and iha, 26%, alpha-hemolysins (hlyA, 10%, outer membrane protease (ompT, 67%, aerobactin (iucD, 67%, iron-repressible protein (irp2, 91% and salmochelin (iroN, 33% and cytotoxic necrotizing factor 1 (cnf1. According to the diversity of different virulence genes, the examined isolates exhibited 29 different patterns. Conclusion: Our results demonstrated that most of the assessed isolates harbored several virulence factors. Our findings propose possibility of human feces serving as a source for pathogenic organisms, supporting the notion that fecal materials of humans play a role in the epidemiological chain of extra-intestinal pathogenic E. coli. This is the first report of the frequency of virulence factors among E. coli isolates collected from human feces in Iran.

  12. [Identification of the gene encoding transglutaminase zymogen from Streptomyces hygroscopicus and its expression in Escherichia coli].

    Science.gov (United States)

    Ren, Zengliang; Zhang, Dongxu; Yu, Meiying; Zhao, Qingxin; Du, Guocheng; Chen, Jian; Wu, Jing

    2008-04-01

    We identified a microbial transglutaminase (MTGase) gene from Streptomyces hygroscopicus; cloned and expressed it in Escherichia coli. We also analyzed the active sites sequence of S. hygroscopicus MTGase through homologous sequence comparison. Wild-type microbial transglutaminase zymogen (pro-MTGase) was purified from liquid culture of S. hygroscopicus (CCTCC M203062). N-terminal amino acid sequence of this pro-MTGase was determined. According to the N-terminal sequence and the corresponding nucleotide sequence of MTGase from other three Streptomyces species, PCR primers of S. hygroscopicus pro-MTGase were designed and the completed gene of pro-MTGase was amplified and sequenced. The gene was sub-cloned into pET-20b(+) vector downstream pelB signal peptide to construct the expression vector pET/pro-MTG. The nucleotide sequence showed 92% homologue with that of S. platensis and S. caniferus. Rosetta (DE3) pLysS carrying the expression vector was induced with IPTG at 24 and expressed pro-MTGase as extracellular soluble protein. SDS-PAGE showed the expressed recombinant pro-MTGase was about 44 kDa, similar to the wild-type pro-MTGase purified from S. hgroscopicus. Recombinant pro-MTGase was activated with trypsin and the enzyme activity reached to 0.24U/mL. This is the first report of the gene encoding microbial pro-transglutaminase from S. hygroscopicus, and also this is the first report of expression extracellular soluble pro-MTGase in E. coli in our country.

  13. Patenting human genes: Chinese academic articles' portrayal of gene patents.

    Science.gov (United States)

    Du, Li

    2018-04-24

    The patenting of human genes has been the subject of debate for decades. While China has gradually come to play an important role in the global genomics-based testing and treatment market, little is known about Chinese scholars' perspectives on patent protection for human genes. A content analysis of academic literature was conducted to identify Chinese scholars' concerns regarding gene patents, including benefits and risks of patenting human genes, attitudes that researchers hold towards gene patenting, and any legal and policy recommendations offered for the gene patent regime in China. 57.2% of articles were written by law professors, but scholars from health sciences, liberal arts, and ethics also participated in discussions on gene patent issues. While discussions of benefits and risks were relatively balanced in the articles, 63.5% of the articles favored gene patenting in general and, of the articles (n = 41) that explored gene patents in the Chinese context, 90.2% supported patent protections for human genes in China. The patentability of human genes was discussed in 33 articles, and 75.8% of these articles reached the conclusion that human genes are patentable. Chinese scholars view the patent regime as an important legal tool to protect the interests of inventors and inventions as well as the genetic resources of China. As such, many scholars support a gene patent system in China. These attitudes towards gene patents remain unchanged following the court ruling in the Myriad case in 2013, but arguments have been raised about the scope of gene patents, in particular that the increasing numbers of gene patents may negatively impact public health in China.

  14. Human Cytomegalovirus-Encoded Receptor US28 Is Expressed in Renal Allografts and Facilitates Viral Spreading In Vitro

    NARCIS (Netherlands)

    Lollinga, Wouter T.; de Wit, Raymond H.; Rahbar, Afsar; Vasse, Gwenda F.; Davoudi, Belghis; Diepstra, Arjan; Riezebos-Brilman, Annelies; Harmsen, Martin C.; Hillebrands, Jan-Luuk; Soderberg-Naucler, Cecilia; van Son, Willem J.; Smit, Martine J.; Sanders, Jan-Stephan; van den Born, Jacob

    BACKGROUND: Renal transplantation is the preferred treatment for patients with end-stage renal disease. Human cytomegalovirus (HCMV) activation is associated with decreased renal graft function and survival. Human cytomegalovirus encodes several immune modulatory proteins, including the G

  15. The human HLA class II alpha chain gene DZ alpha is distinct from genes in the DP, DQ and DR subregions.

    OpenAIRE

    Trowsdale, J; Kelly, A

    1985-01-01

    A new human HLA class II alpha gene DZ alpha was sequenced. The structure and organisation of the gene was similar to other alpha chain genes except for a particularly small intron (95 bp) after the exon encoding the alpha 2 domain, and the position of the stop codon, which was on a different exon to that encoding the cytoplasmic portion of the molecule. Comparison of the DZ alpha sequence with other class II genes showed that the gene is about as distantly related to alpha chain genes in the...

  16. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ...

  17. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  18. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  19. The Drosophila homologue of vertebrate myogenic-determination genes encodes a transiently expressed nuclear protein marking primary myogenic cells.

    OpenAIRE

    Paterson, B M; Walldorf, U; Eldridge, J; Dübendorfer, A; Frasch, M; Gehring, W J

    1991-01-01

    We have isolated a cDNA clone, called Dmyd for Drosophila myogenic-determination gene, that encodes a protein with structural and functional characteristics similar to the members of the vertebrate MyoD family. Dmyd clone encodes a polypeptide of 332 amino acids with 82% identity to MyoD in the 41 amino acids of the putative helix-loop-helix region and 100% identity in the 13 amino acids of the basic domain proposed to contain the essential recognition code for muscle-specific gene activation...

  20. Saccharomyces cerevisiae gene ISW2 encodes a microtubule-interacting protein required for premeiotic DNA replication.

    Science.gov (United States)

    Trachtulcová, P; Janatová, I; Kohlwein, S D; Hasek, J

    2000-01-15

    A molecular genetic characterization of the ORF YOR304W (ISW2), identified in a screen of a yeast lambdagt11 library using a monoclonal antibody that reacts with a 210 kDa mammalian microtubule-interacting protein, is presented in this paper. The protein encoded by the ORF YOR304W is 50% identical to the Drosophila nucleosome remodelling factor ISWI and is therefore a new member of the SNF2 protein family and has been recently entered into SDG as ISW2. Although not essential for vegetative growth, we found that the ISW2 gene is required for early stages in sporulation. The isw2 homozygous deletant diploid strain was blocked in the G(1) phase of the cell cycle, unable to execute the premeiotic DNA replication and progress through the nuclear meiotic division cycle. ISW2 expression from a multicopy plasmid had the same effect as deletion, but ISW2 expression from a centromeric plasmid rescued the deletion phenotype. In vegetatively growing diploid cells, the Isw2 protein was preferentially found in the cytoplasm, co-localizing with microtubules. An accumulation of the Isw2 protein within the nucleus was observed in cells entering sporulation. Together with data published very recently by Tsukiyama et al. (1999), we propose a role for the Isw2 protein in facilitating chromatin accessibility for transcriptional factor(s) that positively regulate meiosis/sporulation-specific genes. Copyright 2000 John Wiley & Sons, Ltd.

  1. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  2. Little things make big things happen: A summary of micropeptide encoding genes

    Directory of Open Access Journals (Sweden)

    Jeroen Crappé

    2014-06-01

    Full Text Available Classical bioactive peptides are cleaved from larger precursor proteins and are targeted toward the secretory pathway by means of an N-terminal signaling sequence. In contrast, micropeptides encoded from small open reading frames, lack such signaling sequence and are immediately released in the cytoplasm after translation. Over the past few years many such non-canonical genes (including open reading frames, ORFs smaller than 100 AAs have been discovered and functionally characterized in different eukaryotic organisms. Furthermore, in silico approaches enabled the prediction of the existence of many more putatively coding small ORFs in the genomes of Sacharomyces cerevisiae, Arabidopsis thaliana, Drosophila melanogaster and Mus musculus. However, questions remain as to what the functional role of this new class of eukaryotic genes might be, and how widespread they are. In the future, approaches integrating in silico, conservation-based prediction and a combination of genomic, proteomic and functional validation methods will prove to be indispensable to answer these open questions.

  3. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  4. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  5. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  6. A highly selective CCR2 chemokine agonist encoded by human herpesvirus 6

    DEFF Research Database (Denmark)

    Lüttichau, Hans R; Clark-Lewis, Ian; Jensen, Peter Østrup

    2003-01-01

    calcium mobilization as efficiently as the endogenous chemokine ligand CCL2 through the CCR2 receptor, whereas the virally encoded chemokine did not affect any of the other 17 human chemokine receptors tested. Mutual cross-desensitization between CCL2 and vCCL4 was demonstrated in the CCR2-transfected...... cells. The affinity of vCCL4 for the CCR2 receptor was 79 nm as determined in competition binding against radioactively labeled CCL2. In the murine pre-B lymphocyte cell line L1.2 stably transfected with the CCR2 receptor, vCCL4 acted as a relatively low potency but highly efficacious chemoattractant...... being equally or more efficacious in causing cell migration than CCL2 and CCL7 and considerably more efficacious than CCL8 and CCL13. It is concluded that human herpesvirus 6 encodes a highly selective and efficacious CCR2 agonist, which will attract CCR2 expressing cells, for example macrophages...

  7. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  8. Cloning of cDNAs that encode human mast cell carboxypeptidase A, and comparison of the protein with mouse mast cell carboxypeptidase A and rat pancreatic carboxypeptidases

    International Nuclear Information System (INIS)

    Reynolds, D.S.; Gurley, D.S.; Stevens, R.L.; Austen, K.F.; Serafin, W.E.; Sugarbaker, D.J.

    1989-01-01

    Human skin and lung mast cells and rodent peritoneal cells contain a carboxypeptidase in their secretory granules. The authors have screened human lung cDNA libraries with a mouse mast cell carboxypeptidase A (MC-CPA) cDNA probe to isolate a near-full-length cDNA that encodes human MC-CPA. The 5' end of the human MC-CPA transcript was defined by direct mRNA sequencing and by isolation and partial sequencing of the human MC-CPA gene. Human MC-CPA is predicted to be translated as a 417 amino acid preproenzyme which includes a 15 amino acid signal peptide and a 94-amino acid activation peptide. The mature human MC-CPA enzyme has a predicted size of 36.1 kDa, a net positive charge of 16 at neutral pH, and 86% amino acid sequence identity with mouse MC-CPA. DNA blot analyses showed that human MC-CPA mRNA is transcribed from a single locus in the human genome. Comparison of the human MC-CPA with mouse MC-CPA and with three rat pancreatic carboxypeptidases shows that these enzymes are encoded by distinct but homologous genes

  9. Subsecond dopamine fluctuations in human striatum encode superposed error signals about actual and counterfactual reward.

    Science.gov (United States)

    Kishida, Kenneth T; Saez, Ignacio; Lohrenz, Terry; Witcher, Mark R; Laxton, Adrian W; Tatter, Stephen B; White, Jason P; Ellis, Thomas L; Phillips, Paul E M; Montague, P Read

    2016-01-05

    In the mammalian brain, dopamine is a critical neuromodulator whose actions underlie learning, decision-making, and behavioral control. Degeneration of dopamine neurons causes Parkinson's disease, whereas dysregulation of dopamine signaling is believed to contribute to psychiatric conditions such as schizophrenia, addiction, and depression. Experiments in animal models suggest the hypothesis that dopamine release in human striatum encodes reward prediction errors (RPEs) (the difference between actual and expected outcomes) during ongoing decision-making. Blood oxygen level-dependent (BOLD) imaging experiments in humans support the idea that RPEs are tracked in the striatum; however, BOLD measurements cannot be used to infer the action of any one specific neurotransmitter. We monitored dopamine levels with subsecond temporal resolution in humans (n = 17) with Parkinson's disease while they executed a sequential decision-making task. Participants placed bets and experienced monetary gains or losses. Dopamine fluctuations in the striatum fail to encode RPEs, as anticipated by a large body of work in model organisms. Instead, subsecond dopamine fluctuations encode an integration of RPEs with counterfactual prediction errors, the latter defined by how much better or worse the experienced outcome could have been. How dopamine fluctuations combine the actual and counterfactual is unknown. One possibility is that this process is the normal behavior of reward processing dopamine neurons, which previously had not been tested by experiments in animal models. Alternatively, this superposition of error terms may result from an additional yet-to-be-identified subclass of dopamine neurons.

  10. Subsecond dopamine fluctuations in human striatum encode superposed error signals about actual and counterfactual reward

    Science.gov (United States)

    Kishida, Kenneth T.; Saez, Ignacio; Lohrenz, Terry; Witcher, Mark R.; Laxton, Adrian W.; Tatter, Stephen B.; White, Jason P.; Ellis, Thomas L.; Phillips, Paul E. M.; Montague, P. Read

    2016-01-01

    In the mammalian brain, dopamine is a critical neuromodulator whose actions underlie learning, decision-making, and behavioral control. Degeneration of dopamine neurons causes Parkinson’s disease, whereas dysregulation of dopamine signaling is believed to contribute to psychiatric conditions such as schizophrenia, addiction, and depression. Experiments in animal models suggest the hypothesis that dopamine release in human striatum encodes reward prediction errors (RPEs) (the difference between actual and expected outcomes) during ongoing decision-making. Blood oxygen level-dependent (BOLD) imaging experiments in humans support the idea that RPEs are tracked in the striatum; however, BOLD measurements cannot be used to infer the action of any one specific neurotransmitter. We monitored dopamine levels with subsecond temporal resolution in humans (n = 17) with Parkinson’s disease while they executed a sequential decision-making task. Participants placed bets and experienced monetary gains or losses. Dopamine fluctuations in the striatum fail to encode RPEs, as anticipated by a large body of work in model organisms. Instead, subsecond dopamine fluctuations encode an integration of RPEs with counterfactual prediction errors, the latter defined by how much better or worse the experienced outcome could have been. How dopamine fluctuations combine the actual and counterfactual is unknown. One possibility is that this process is the normal behavior of reward processing dopamine neurons, which previously had not been tested by experiments in animal models. Alternatively, this superposition of error terms may result from an additional yet-to-be-identified subclass of dopamine neurons. PMID:26598677

  11. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  12. Genes of Mouse and Human

    Directory of Open Access Journals (Sweden)

    Rosa Calvello

    2013-01-01

    Full Text Available Conservation/mutation in the intronic initial and terminal hexanucleotides was studied in 26 orthologous cytokine receptor genes of Mouse and Human. Introns began and ended with the canonical dinucleotides GT and AG, respectively. Identical configurations were found in 57% of the 5′ hexanucleotides and 28% of the 3′ hexanucleotides. The actual conservation percentages of the individual variable nucleotides at each position in the hexanucleotides were determined, and the theoretical rates of conservation of groups of three nucleotides were calculated under the hypothesis of a mutual evolutionary independence of the neighboring nucleotides (random association. Analysis of the actual conservation of groups of variable nucleotides showed that, at 5′, GTGAGx was significantly more expressed and GTAAGx was significantly less expressed, as compared to the random association. At 3′, TTTxAG and xTGCAG were overexpressed as compared to a random association. Study of Mouse and Human transcript variants involving the splice sites showed that most variants were not inherited from the common ancestor but emerged during the process of speciation. In some variants the silencing of a terminal hexanucleotide determined skipping of the downstream exon; in other variants the constitutive splicing hexanucleotide was replaced by another potential, in-frame, splicing hexanucleotide, leading to alterations of exon lengths.

  13. Chromosomal localization of the human vesicular amine transporter genes

    Energy Technology Data Exchange (ETDEWEB)

    Peter, D.; Finn, P.; Liu, Y.; Roghani, A.; Edwards, R.H.; Klisak, I.; Kojis, T.; Heinzmann, C.; Sparkes, R.S. (UCLA School of Medicine, Los Angeles, CA (United States))

    1993-12-01

    The physiologic and behavioral effects of pharmacologic agents that interfere with the transport of monoamine neurotransmitters into vesicles suggest that vesicular amine transport may contribute to human neuropsychiatric disease. To determine whether an alteration in the genes that encode vesicular amine transport contributes to the inherited component of these disorders, the authors have isolated a human cDNA for the brain transporter and localized the human vesciular amine transporter genes. The human brain synaptic vesicle amine transporter (SVAT) shows unexpected conservation with rat SVAT in the regions that diverge extensively between rat SVAT and the rat adrenal chromaffin granule amine transporter (CGAT). Using the cloned sequences with a panel of mouse-human hybrids and in situ hybridization for regional localization, the adrenal CGAT gene (or VAT1) maps to human chromosome 8p21.3 and the brain SVAT gene (or VAT2) maps to chromosome 10q25. Both of these sites occur very close to if not within previously described deletions that produce severe but viable phenotypes. 26 refs., 3 figs., 1 tab.

  14. Two putative subunits of a peptide pump encoded in the human major histocompatability complex class 2 region

    International Nuclear Information System (INIS)

    Bahram, S.; Arnold, D.; Bresnahan, M.; Strominger, J.L.; Spies, T.

    1991-01-01

    The class 2 region of the human major histocompatibility complex (MHC) may encode several genes controlling the processing of endogenous antigen and the presentation of peptide epitopes by MHC class 1 molecules to cytotoxic T lymphocytes. A previously described peptide supply factor (PSF1) is a member of the multidrug-resistance family of transporters and may pump cytosolic peptides into the membrane-bound compartment where class 1 molecules assemble. A second transporter gene, PSF2, was identified 10 kilobases (kb) from PSF1, near the class 2 DOB gene. The complete sequences of PSF1 and PSF2 were determined from cDNA clones. The translation products are closely related in sequence and predicted secondary structure. Both contain a highly conserved ATP-binding fold and share 25% homology in a hydrophobic domain with a tentative number of eight membrane-spanning segments. Based on the principle dimeric organization of these two domains in other transporters, PSF1 and PSF2 may function as complementary subunits, independently as homodimers, or both. Taken together with previous genetic evidence, the coregulation of PSF1 and PSF2 by γ interferon and the to-some-degree coordinate transcription of these genes suggest a common role in peptide-loading of class 1 molecules, although a distinct function of PSF2 cannot be ruled out

  15. Silencing herpes simplex virus type 1 capsid protein encoding genes by siRNA: a promising antiviral therapeutic approach.

    Directory of Open Access Journals (Sweden)

    Fujun Jin

    Full Text Available Herpes simplex virus type 1 (HSV-1, a member of the herpesviridae, causes a variety of human viral diseases globally. Although a series of antiviral drugs are available for the treatment of infection and suppression of dissemination, HSV-1 remains highly prevalent worldwide. Therefore, the development of novel antiviral agents with different mechanisms of action is a matter of extreme urgency. During the proliferation of HSV-1, capsid assembly is essential for viral growth, and it is highly conserved in all HSV-1 strains. In this study, small interfering RNAs (siRNAs against the HSV-1 capsid protein were screened to explore the influence of silencing capsid expression on the replication of HSV-1. We designed and chemically synthesized siRNAs for the capsid gene and assessed their inhibitory effects on the expression of target mRNA and the total intracellular viral genome loads by quantitative real-time PCR, as well as on the replication of HSV-1 via plaque reduction assays and electron microscopy. Our results showed that siRNA was an effective approach to inhibit the expression of capsid protein encoding genes including UL18, UL19, UL26, UL26.5, UL35 and UL38 in vitro. Interference of capsid proteins VP23 (UL18 and VP5 (UL19 individually or jointly greatly affected the replication of clinically isolated acyclovir-resistant HSV-1 as well as HSV-1/F and HSV-2/333. Plaque numbers and intracellular virions were significantly reduced by simultaneous knockdown of UL18 and UL19. The total intracellular viral genome loads were also significantly decreased in the UL18 and UL19 knockdown groups compared with the viral control. In conclusion, interfering with UL18 and UL19 gene expression could inhibit HSV-1 replication efficiently in vitro. Our research offers new targets for an RNA interference-based therapeutic strategy against HSV-1.

  16. Silencing herpes simplex virus type 1 capsid protein encoding genes by siRNA: a promising antiviral therapeutic approach.

    Science.gov (United States)

    Jin, Fujun; Li, Shen; Zheng, Kai; Zhuo, Cuiqin; Ma, Kaiqi; Chen, Maoyun; Wang, Qiaoli; Zhang, Peizhuo; Fan, Jianglin; Ren, Zhe; Wang, Yifei

    2014-01-01

    Herpes simplex virus type 1 (HSV-1), a member of the herpesviridae, causes a variety of human viral diseases globally. Although a series of antiviral drugs are available for the treatment of infection and suppression of dissemination, HSV-1 remains highly prevalent worldwide. Therefore, the development of novel antiviral agents with different mechanisms of action is a matter of extreme urgency. During the proliferation of HSV-1, capsid assembly is essential for viral growth, and it is highly conserved in all HSV-1 strains. In this study, small interfering RNAs (siRNAs) against the HSV-1 capsid protein were screened to explore the influence of silencing capsid expression on the replication of HSV-1. We designed and chemically synthesized siRNAs for the capsid gene and assessed their inhibitory effects on the expression of target mRNA and the total intracellular viral genome loads by quantitative real-time PCR, as well as on the replication of HSV-1 via plaque reduction assays and electron microscopy. Our results showed that siRNA was an effective approach to inhibit the expression of capsid protein encoding genes including UL18, UL19, UL26, UL26.5, UL35 and UL38 in vitro. Interference of capsid proteins VP23 (UL18) and VP5 (UL19) individually or jointly greatly affected the replication of clinically isolated acyclovir-resistant HSV-1 as well as HSV-1/F and HSV-2/333. Plaque numbers and intracellular virions were significantly reduced by simultaneous knockdown of UL18 and UL19. The total intracellular viral genome loads were also significantly decreased in the UL18 and UL19 knockdown groups compared with the viral control. In conclusion, interfering with UL18 and UL19 gene expression could inhibit HSV-1 replication efficiently in vitro. Our research offers new targets for an RNA interference-based therapeutic strategy against HSV-1.

  17. Detection of the human endogenous retrovirus ERV3-encoded Env-protein in human tissues using antibody-based proteomics.

    Science.gov (United States)

    Fei, Chen; Atterby, Christina; Edqvist, Per-Henrik; Pontén, Fredrik; Zhang, Wei Wei; Larsson, Erik; Ryan, Frank P

    2014-01-01

    There is growing evidence to suggest that human endogenous retroviruses (HERVs) have contributed to human evolution, being expressed in development, normal physiology and disease. A key difficulty in the scientific evaluation of this potential viral contribution is the accurate demonstration of virally expressed protein in specific human cells and tissues. In this study, we have adopted the endogenous retrovirus, ERV3, as our test model in developing a reliable high-capacity methodology for the expression of such endogenous retrovirus-coded protein. Two affinity-purified polyclonal antibodies to ERV3 Env-encoded protein were generated to detect the corresponding protein expression pattern in specific human cells, tissues and organs. Sampling included normal tissues from 144 individuals ranging from childhood to old age. This included more than forty different tissues and organs and some 216 different cancer tissues representing the twenty commonest forms of human cancer. The Rudbeck Laboratory, Uppsala University and Uppsala University Hospital, Uppsala, Sweden. The potential expression at likely physiological level of the ERV3Env encoded protein in a wide range of human cells, tissues and organs. We found that ERV3 encoded Env protein is expressed at substantive levels in placenta, testis, adrenal gland, corpus luteum, Fallopian tubes, sebaceous glands, astrocytes, bronchial epithelium and the ducts of the salivary glands. Substantive expression was also seen in a variety of epithelial cells as well as cells known to undergo fusion in inflammation and in normal physiology, including fused macrophages, myocardium and striated muscle. This contrasted strongly with the low levels expressed in other tissues types. These findings suggest that this virus plays a significant role in human physiology and may also play a possible role in disease. This technique can now be extended to the study of other HERV genomes within the human chromosomes that may have contributed to

  18. Diversity of β-lactamase-encoding genes among Gram-negative isolates from water samples in Northern Portugal

    OpenAIRE

    Manageiro, Vera; Ferreira, Eugénia; Figueira, Vânia; Manaia, Célia M.; Caniça, Manuela

    2012-01-01

    Water has been recognized as a reservoir for antibiotic resistance genes (ARG), where the presence of mobile genetic elements, including plasmids, favors their dissemination. It is noteworthy that non- pathogenic environmental organisms, where plasmids encoding multiple ARG are prevalent, can provide resistance to most classes of antimicrobials including :-lactams, aminoglycosides, chloramphenicol, trimethoprim, streptomycin, fosfomycin, q...

  19. Differential regulation of mnp2, a new manganese peroxidase-encoding gene from the ligninolytic fungus Trametes versicolor PRL 572

    Science.gov (United States)

    Tomas Johansson; Per Olof Nyman; Daniel Cullen

    2002-01-01

    A peroxidase-encoding gene, mnp2, and its corresponding cDNA were characterized from the white-rot basidiomycete Trametes versicolor PRL 572. We used quantitative reverse transcriptase-mediated PCR to identify mnp2 transcripts in nutrient-limited stationary cultures. Although mnp2 lacks upstream metal response elements (MREs), addition of MnSO4 to cultures increased...

  20. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  1. Expression of the Immediate-Early Gene-Encoded Protein Egr-1 ("zif268") during in Vitro Classical Conditioning

    Science.gov (United States)

    Mokin, Maxim; Keifer, Joyce

    2005-01-01

    Expression of the immediate-early genes (IEGs) has been shown to be induced by activity-dependent synaptic plasticity or behavioral training and is thought to play an important role in long-term memory. In the present study, we examined the induction and expression of the IEG-encoded protein Egr-1 during an in vitro neural correlate of eyeblink…

  2. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  3. Minor abnormalities of testis development in mice lacking the gene encoding the MAPK signalling component, MAP3K1.

    Directory of Open Access Journals (Sweden)

    Nick Warr

    2011-05-01

    Full Text Available In mammals, the Y chromosome is a dominant male determinant, causing the bipotential gonad to develop as a testis. Recently, cases of familial and spontaneous 46,XY disorders of sex development (DSD have been attributed to mutations in the human gene encoding mitogen-activated protein kinase kinase kinase 1, MAP3K1, a component of the mitogen-activated protein kinase (MAPK signal transduction pathway. In individuals harbouring heterozygous mutations in MAP3K1, dysregulation of MAPK signalling was observed in lymphoblastoid cell lines, suggesting a causal role for these mutations in disrupting XY sexual development. Mice lacking the cognate gene, Map3k1, are viable and exhibit the eyes open at birth (EOB phenotype on a mixed genetic background, but on the C57BL/6J genetic background most mice die at around 14.5 dpc due to a failure of erythropoiesis in the fetal liver. However, no systematic examination of sexual development in Map3k1-deficient mice has been described, an omission that is especially relevant in the case of C57BL/6J, a genetic background that is sensitized to disruptions to testis determination. Here, we report that on a mixed genetic background mice lacking Map3k1 are fertile and exhibit no overt abnormalities of testis development. On C57BL/6J, significant non-viability is observed with very few animals surviving to adulthood. However, an examination of development in Map3k1-deficient XY embryos on this genetic background revealed no significant defects in testis determination, although minor abnormalities were observed, including an increase in gonadal length. Based on these observations, we conclude that MAP3K1 is not required for mouse testis determination. We discuss the significance of these data for the functional interpretation of sex-reversing MAP3K1 mutations in humans.

  4. Annotation and analysis of malic enzyme genes encoding for multiple isoforms in the fungus Mucor circinelloides CBS 277.49.

    Science.gov (United States)

    Vongsangnak, Wanwipa; Zhang, Yingtong; Chen, Wei; Ratledge, Colin; Song, Yuanda

    2012-05-01

    Based on the newly-released genomic data of Mucor circinelloides CBS 277.49, we have annotated five genes encoding for malic enzyme: all code for proteins that contain conserved domains/motifs for malic acid binding, NAD(+) binding and NAD(P)(+) binding. Phylogenetic analysis for malic enzyme genes showed that genes ID 78524 and 11639 share ~80% amino acid identity and are grouped in cluster 1; genes ID 182779, 186772 and 116127 share ~66% amino acid identity are grouped in cluster 2. Genes ID 78524, 11639 and 166127 produce proteins that are localized in the mitochondrion, while the products from genes 182779 and 186772 are localized in the cytosol. Based on the comparative analysis published previously by Song et al. (Microbiology 147:1507-1515, 2001), we propose that malic enzyme genes ID 78524, 166127, 182779, 186772, 11639, respectively, represent protein isoforms I, II, III/IV, V, and VI.

  5. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  6. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  7. The human VH3b gene subfamily is highly polymorphic

    Energy Technology Data Exchange (ETDEWEB)

    Adderson, E.E.; Carroll, W.L. (Univ. of Utah, Salt Lake City, UT (United States)); Azmi, F.H.; Wilson, P.M.; Shackelford, P.G. (Washington Univ., St. Louis, MO (United States))

    1993-07-15

    The authors have previously shown that human antibody (Ab) directed against the capsular polysaccharide of the important bacterial pathogen, Haemophilus influenzae type b (Hib) is encoded by a small group of VH3 gene family members. The majority of anti-Hib PS Ab use members of the smaller VH3b subfamily. To examine directly the available human VH3 repertoire, they have used PCR to amplify and clone candidate germ-line VH3b H chain V region genes from two unrelated subjects from whom anti-Hib polysaccharide mAb had been previously obtained. A single functional VH3b germ-line gene was obtained from one subject. This gene is identical throughout the coding region to the previously identified gene 9.1. Twelve distinct VH3b germ-line sequences, 87.6-99.8% homologous to one another, were obtained from the second subject. One of these genes, LSG1.1, is also identical to the 9.1 germ-line gene, and a second, LSG6.1 is identical to a previously reported cDNA, M85. These germ-line VH3b genes are 82.7-94.1% homologous to rearranged anti-Hib PS VH3b segments obtained from these subjects. These findings further demonstrate that considerable polymorphism of VH segments exists in the human population. Despite the presence of very highly homologous VH elements in the germ line, particular genes are highly conserved within the outbred human population. 52 refs., 4 figs.

  8. The life-extending gene Indy encodes an exchanger for Krebs-cycle intermediates.

    Science.gov (United States)

    Knauf, Felix; Mohebbi, Nilufar; Teichert, Carsten; Herold, Diana; Rogina, Blanka; Helfand, Stephen; Gollasch, Maik; Luft, Friedrich C; Aronson, Peter S

    2006-07-01

    A longevity gene called Indy (for 'I'm not dead yet'), with similarity to mammalian genes encoding sodium-dicarboxylate cotransporters, was identified in Drosophila melanogaster. Functional studies in Xenopus oocytes showed that INDY mediates the flux of dicarboxylates and citrate across the plasma membrane, but the specific transport mechanism mediated by INDY was not identified. To test whether INDY functions as an anion exchanger, we examined whether substrate efflux is stimulated by transportable substrates added to the external medium. Efflux of [14C]citrate from INDY-expressing oocytes was greatly accelerated by the addition of succinate to the external medium, indicating citrate-succinate exchange. The succinate-stimulated [14C]citrate efflux was sensitive to inhibition by DIDS (4,4'-di-isothiocyano-2,2'-disulphonic stilbene), as demonstrated previously for INDY-mediated succinate uptake. INDY-mediated efflux of [14C]citrate was also stimulated by external citrate and oxaloacetate, indicating citrate-citrate and citrate-oxaloacetate exchange. Similarly, efflux of [14C]succinate from INDY-expressing oocytes was stimulated by external citrate, alpha-oxoglutarate and fumarate, indicating succinate-citrate, succinate-alpha-oxoglutarate and succinate-fumarate exchange respectively. Conversely, when INDY-expressing Xenopus oocytes were loaded with succinate and citrate, [14C]succinate uptake was markedly stimulated, confirming succinate-succinate and succinate-citrate exchange. Exchange of internal anion for external citrate was markedly pH(o)-dependent, consistent with the concept that citrate is co-transported with a proton. Anion exchange was sodium-independent. We conclude that INDY functions as an exchanger of dicarboxylate and tricarboxylate Krebs-cycle intermediates. The effect of decreasing INDY activity, as in the long-lived Indy mutants, may be to alter energy metabolism in a manner that favours lifespan extension.

  9. Genes of Bacillus cereus and Bacillus anthracis encoding proteins of the exosporium.

    Science.gov (United States)

    Todd, Sarah J; Moir, Arthur J G; Johnson, Matt J; Moir, Anne

    2003-06-01

    The exosporium is the outermost layer of spores of Bacillus cereus and its close relatives Bacillus anthracis and Bacillus thuringiensis. For these pathogens, it represents the surface layer that makes initial contact with the host. To date, only the BclA glycoprotein has been described as a component of the exosporium; this paper defines 10 more tightly associated proteins from the exosporium of B. cereus ATCC 10876, identified by N-terminal sequencing of proteins from purified, washed exosporium. Likely coding sequences were identified from the incomplete genome sequence of B. anthracis or B. cereus ATCC 14579, and the precise corresponding sequence from B. cereus ATCC 10876 was defined by PCR and sequencing. Eight genes encode likely structural components (exsB, exsC, exsD, exsE, exsF, exsG, exsJ, and cotE). Several proteins of the exosporium are related to morphogenetic and outer spore coat proteins of B. subtilis, but most do not have homologues in B. subtilis. ExsE is processed from a larger precursor, and the CotE homologue appears to have been C-terminally truncated. ExsJ contains a domain of GXX collagen-like repeats, like the BclA exosporium protein of B. anthracis. Although most of the exosporium genes are scattered on the genome, bclA and exsF are clustered in a region flanking the rhamnose biosynthesis operon; rhamnose is part of the sugar moiety of spore glycoproteins. Two enzymes, alanine racemase and nucleoside hydrolase, are tightly adsorbed to the exosporium layer; they could metabolize small molecule germinants and may reduce the sensitivity of spores to these, limiting premature germination.

  10. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  11. Gene encoding erythrocyte binding ligand linked to blood stage multiplication rate phenotype in Plasmodium yoelii yoelii.

    Science.gov (United States)

    Pattaradilokrat, Sittiporn; Culleton, Richard L; Cheesman, Sandra J; Carter, Richard

    2009-04-28

    Variation in the multiplication rate of blood stage malaria parasites is often positively correlated with the severity of the disease they cause. The rodent malaria parasite Plasmodium yoelii yoelii has strains with marked differences in multiplication rate and pathogenicity in the blood. We have used genetic analysis by linkage group selection (LGS) to identify genes that determine differences in multiplication rate. Genetic crosses were generated between genetically unrelated, fast- (17XYM) and slowly multiplying (33XC) clones of P. y. yoelii. The uncloned progenies of these crosses were placed under multiplication rate selection in blood infections in mice. The selected progenies were screened for reduction in intensity of quantitative genetic markers of the slowly multiplying parent. A small number of strongly selected markers formed a linkage group on P. y. yoelii chromosome 13. Of these, that most strongly selected marked the gene encoding the P. yoelii erythrocyte binding ligand (pyebl), which has been independently identified by Otsuki and colleagues [Otsuki H, et al. (2009) Proc Natl Acad Sci USA 106:10.1073/pnas.0811313106] as a major determinant of virulence in these parasites. In an analysis of a previous genetic cross in P. y. yoelii, pyebl alleles of fast- and slowly multiplying parents segregated with the fast and slow multiplication rate phenotype in the cloned recombinant progeny, implying the involvement of the pyebl locus in determining the multiplication rate. Our genome-wide LGS analysis also indicated effects of at least 1 other locus on multiplication rate, as did the findings of Otsuki and colleagues on virulence in P. y. yoelii.

  12. Roughness Encoding in Human and Biomimetic Artificial Touch: Spatiotemporal Frequency Modulation and Structural Anisotropy of Fingerprints

    Directory of Open Access Journals (Sweden)

    Maria Chiara Carrozza

    2011-05-01

    Full Text Available The influence of fingerprints and their curvature in tactile sensing performance is investigated by comparative analysis of different design parameters in a biomimetic artificial fingertip, having straight or curved fingerprints. The strength in the encoding of the principal spatial period of ridged tactile stimuli (gratings is evaluated by indenting and sliding the surfaces at controlled normal contact force and tangential sliding velocity, as a function of fingertip rotation along the indentation axis. Curved fingerprints guaranteed higher directional isotropy than straight fingerprints in the encoding of the principal frequency resulting from the ratio between the sliding velocity and the spatial periodicity of the grating. In parallel, human microneurography experiments were performed and a selection of results is included in this work in order to support the significance of the biorobotic study with the artificial tactile system.

  13. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  14. Plasmodium falciparum var genes expressed in children with severe malaria encode CIDRα1 domains

    DEFF Research Database (Denmark)

    Jespersen, Jakob S.; Wang, Christian W.; Mkumbaye, Sixbert I.

    2016-01-01

    Most severe Plasmodium falciparum infections are experienced by young children. Severe symptoms are precipitated by vascular sequestration of parasites expressing a particular subset of the polymorphic P. falciparum erythrocyte membrane protein 1 (PfEMP1) adhesion molecules. Parasites binding hum...... the hypothesis that the CIDRα1-EPCR interaction is key to the pathogenesis of severe malaria and strengthen the rationale for pursuing a vaccine or adjunctive treatment aiming at inhibiting or reducing the damaging effects of this interaction....... endothelial protein C receptor (EPCR) through the CIDRα1 domain of certain PfEMP1 were recently associated with severe malaria in children. However, it has remained unclear to which extend the EPCR-binding CIDRα1 domains epitomize PfEMP1 expressed in severe malaria. Here, we characterized the near full......-length transcripts dominating the var transcriptome in children with severe malaria and found that the only common feature of the encoded PfEMP1 was CIDRα1 domains. Such genes were highly and dominantly expressed in both children with severe malarial anaemia and cerebral malaria. These observations support...

  15. Molecular cloning and characterization of two genes encoding dihydroflavonol-4-reductase from Populus trichocarpa.

    Directory of Open Access Journals (Sweden)

    Yan Huang

    Full Text Available Dihydroflavonol 4-reductase (DFR, EC 1.1.1.219 is a rate-limited enzyme in the biosynthesis of anthocyanins and condensed tannins (proanthocyanidins that catalyzes the reduction of dihydroflavonols to leucoanthocyanins. In this study, two full-length transcripts encoding for PtrDFR1 and PtrDFR2 were isolated from Populus trichocarpa. Sequence alignment of the two PtrDFRs with other known DFRs reveals the homology of these genes. The expression profile of PtrDFRs was investigated in various tissues of P. trichocarpa. To determine their functions, two PtrDFRs were overexpressed in tobacco (Nicotiana tabacum via Agrobacterium-mediated transformation. The associated color change in the flowers was observed in all 35S:PtrDFR1 lines, but not in 35S:PtrDFR2 lines. Compared to the wild-type control, a significantly higher accumulation of anthocyanins was detected in transgenic plants harboring the PtrDFR1. Furthermore, overexpressing PtrDFR1 in Chinese white poplar (P. tomentosa Carr. resulted in a higher accumulation of both anthocyanins and condensed tannins, whereas constitutively expressing PtrDFR2 only improved condensed tannin accumulation, indicating the potential regulation of condensed tannins by PtrDFR2 in the biosynthetic pathway in poplars.

  16. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  17. Effects of light fluence and wavelength on expression of the gene encoding cucumber hydroxypyruvate reductase.

    Science.gov (United States)

    Bertoni, G P; Becker, W M

    1993-01-01

    We have investigated the regulation of cucumber (Cucumis sativus) hydroxypyruvate reductase mRNA abundance in response to white-, red-, and far-red-light treatments. Following irradiation of dark-adapted cucumber seedlings with 15 min to 4 h of either white or red light and return to darkness, the mRNA level for the gene encoding hydroxypyruvate reductase (Hpr) in cotyledons peaks in the darkness 16 to 20 h later. The response of the Hpr mRNA level to total fluence of white light depends more directly on irradiation time than on fluence rate. In addition to this time-dependent component, a phytochrome-dependent component is involved in Hpr regulation in dark-adapted green cotyledons as shown by red-light induction and partial far-red-light reversibility. Parallel measurements of mRNA levels for the ribulose bisphosphate carboxylase/oxygenase small subunit and for the chlorophyll a/b-binding protein show that Hpr is the most responsive to short (about 60 min) white- and red-light treatments and that each mRNA has a characteristic pattern of accumulation in dark-adapted cotyledons in response to light. PMID:8022942

  18. [Cloning and analysis of three genes encoding type II CHH family neuropeptides from Fennropenaeus chinensis].

    Science.gov (United States)

    Wang, Zai-Zhao; Xiang, Jian-Hai

    2003-10-01

    On the basis of sequence similarity, the crustean hyperglycemic hormone (CHH) family peptides have been classified into two types of hormones: type I and type II. Molt-inhibiting hormone (MIH) is a neuropeptide member of type II CHH family. Molting in shrimp is controlled by MIH and ecdysone. By inhibiting the synthesis of ecdysone in the Y-organ, MIH indirectly suppresses the molting activity of shrimp. In this study, we reported the cloning and characterization of 3 gene fragments encoding type II CHH family neuropeptides of the shrimp Fennropenaeus chinensis. According to the complementary DNA sequence of the mult-inhibiting hormone of Fennropenaeus chinensis, 3 primers were designed and synthesized. MP1 and MP2 are sense primers, and MP3 is anti-sense primer. Polymerase chain reaction was performed using genomic DNA of Fennropenaeus chinensis as template. Three PCR products were obtained using primers MP1 and MP3. Their sizes are about 600 bp, 850 bp, 1050 bp, respectively. A 580 bp PCR product was obtained using primers MP2 and MP3. All the 4 PCR products were cloned into pMD18-T vector. The recombinant clones were sequenced using ABI 310 Genetic Analyzer. After sequencing, all the DNA sequences were searched in the GenBank by Blast program to find similar gene sequences. The searching results revealed 3 DNA fragment sequences were of high similarity with CHH family neuropeptide genes from various crustean species. The 3 DNA fragments were named as NP1, NP2, and NP3. Their sizes were 540 bp, 601 bp, and 826 bp, respectively. Using the mRNA sequences with the most similarity to the 3 sequence fragments as reference, the gene structure of the 3 DNA fragment sequences was analyzed. The exons of 3 sequence fragments were aligned with their similar sequences by Clustal W program. Both NP1 and NP2 consisted of 1 intron and 2 exons. NP3 consisted of 2 introns and 3 exons. Sequence analysis suggested that these 3 products belonged to sequence fragments of neuropeptide

  19. Cloning and functional analysis of human mTERFL encoding a novel mitochondrial transcription termination factor-like protein

    International Nuclear Information System (INIS)

    Chen Yao; Zhou Guangjin; Yu Min; He Yungang; Tang Wei; Lai Jianhua; He Jie; Liu Wanguo; Tan Deyong

    2005-01-01

    Serum plays an important role in the regulation of cell cycle and cell growth. To identify novel serum-inhibitory factors and study their roles in cell cycle regulation, we performed mRNA differential display analysis of U251 cells in the presence or absence of serum and cloned a novel gene encoding the human mitochondrial transcription termination factor-like protein (mTERFL). The full-length mTERFL cDNA has been isolated and the genomic structure determined. The mTERFL gene consists of three exons and encodes 385 amino acids with 52% sequence similarity to the human mitochondrial transcription termination factor (mTERF). However, mTERFL and mTERF have an opposite expression pattern in response to serum. The expression of mTERFL is dramatically inhibited by the addition of serum in serum-starved cells while the mTERF is rather induced. Northern blot analysis detected three mTERFL transcripts of 1.7, 3.2, and 3.5 kb. Besides the 3.2 kb transcript that is unique to skeletal muscle, other two transcripts express predominant in heart, liver, pancreas, and skeletal muscle. Expression of the GFP-mTERFL fusion protein in HeLa cells localized it to the mitochondria. Furthermore, ectopic expression of mTERFL suppresses cell growth and arrests cells in the G1 stage demonstrated by MTT and flow cytometry analysis. Collectively, our data suggest that mTERFL is a novel mTERF family member and a serum-inhibitory factor probably participating in the regulation of cell growth through the modulation of mitochondrial transcription

  20. Global changes in Staphylococcus aureus gene expression in human blood.

    Directory of Open Access Journals (Sweden)

    Natalia Malachowa

    2011-04-01

    Full Text Available Staphylococcus aureus is a leading cause of bloodstream infections worldwide. In the United States, many of these infections are caused by a strain known as USA300. Although progress has been made, our understanding of the S. aureus molecules that promote survival in human blood and ultimately facilitate metastases is incomplete. To that end, we analyzed the USA300 transcriptome during culture in human blood, human serum, and trypticase soy broth (TSB, a standard laboratory culture media. Notably, genes encoding several cytolytic toxins were up-regulated in human blood over time, and hlgA, hlgB, and hlgC (encoding gamma-hemolysin subunits HlgA, HlgB, and HlgC were among the most highly up-regulated genes at all time points. Compared to culture supernatants from a wild-type USA300 strain (LAC, those derived from an isogenic hlgABC-deletion strain (LACΔhlgABC had significantly reduced capacity to form pores in human neutrophils and ultimately cause neutrophil lysis. Moreover, LACΔhlgABC had modestly reduced ability to cause mortality in a mouse bacteremia model. On the other hand, wild-type and LACΔhlgABC strains caused virtually identical abscesses in a mouse skin infection model, and bacterial survival and neutrophil lysis after phagocytosis in vitro was similar between these strains. Comparison of the cytolytic capacity of culture supernatants from wild-type and isogenic deletion strains lacking hlgABC, lukS/F-PV (encoding PVL, and/or lukDE revealed functional redundancy among two-component leukotoxins in vitro. These findings, along with a requirement of specific growth conditions for leukotoxin expression, may explain the apparent limited contribution of any single two-component leukotoxin to USA300 immune evasion and virulence.

  1. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  2. The yeast ISN1 (YOR155c gene encodes a new type of IMP-specific 5'-nucleotidase

    Directory of Open Access Journals (Sweden)

    Schmitter Jean-Marie

    2003-05-01

    Full Text Available Abstract Background The purine salvage enzyme inosine 5'-monophosphate (IMP-specific 5'-nucleotidase catalyzes degradation of IMP to inosine. Although this enzymatic activity has been purified and characterized in Saccharomyces cerevisiae, the gene encoding IMP 5'-nucleotidase had not been identified. Results Mass spectrometry analysis of several peptides of this enzyme purified from yeast allowed identification of the corresponding gene as YOR155c, an open reading frame of unknown function, renamed ISN1. The deduced Isn1p sequence was clearly not homologous to 5'-nucleotidases from other species. However, significant similarities to Isn1p were found in proteins of unknown function from Neurospora crassa, Plasmodium falciparum and several yeast species. Knock-out of ISN1 resulted in the total loss of IMP-specific 5'-nucleotidase activity, thus confirming that the ISN1 gene indeed encodes the enzymatic activity purified from yeast. In vivo studies revealed that, when IMP is overproduced through constitutive activation of the IMP de novo synthesis pathway, ISN1 is required for excretion of inosine and hypoxanthine in the medium. Conclusion We have identified a new yeast gene, ISN1 (YOR155c, as encoding IMP-specific 5'-nucleotidase activity. The ISN1 gene defines a new type of 5'-nucleotidase which was demonstrated to be functional in vivo.

  3. Changes in mitochondrial DNA alter expression of nuclear encoded genes associated with tumorigenesis

    Energy Technology Data Exchange (ETDEWEB)

    Jandova, Jana; Janda, Jaroslav [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States); Sligh, James E, E-mail: jsligh@azcc.arizona.edu [Southern Arizona VA Healthcare System, Department of Medicine, Dermatology Division and Arizona Cancer Center, University of Arizona, 1515 N Campbell Avenue, Tucson, AZ 857 24 (United States)

    2012-10-15

    We previously reported the presence of a mtDNA mutation hotspot in UV-induced premalignant and malignant skin tumors in hairless mice. We have modeled this change (9821insA) in murine cybrid cells and demonstrated that this alteration in mtDNA associated with mtBALB haplotype can alter the biochemical characteristics of cybrids and subsequently can contribute to significant changes in their behavioral capabilities. This study shows that changes in mtDNA can produce differences in expression levels of specific nuclear-encoded genes, which are capable of triggering the phenotypes such as seen in malignant cells. From a potential list of differentially expressed genes discovered by microarray analysis, we selected MMP-9 and Col1a1 for further studies. Real-time PCR confirmed up-regulation of MMP-9 and down-regulation of Col1a1 in cybrids harboring the mtDNA associated with the skin tumors. These cybrids also showed significantly increased migration and invasion abilities compared to wild type. The non-specific MMP inhibitor, GM6001, was able to inhibit migratory and invasive abilities of the 9821insA cybrids confirming a critical role of MMPs in cellular motility. Nuclear factor-{kappa}B (NF-{kappa}B) is a key transcription factor for production of MMPs. An inhibitor of NF-{kappa}B activation, Bay 11-7082, was able to inhibit the expression of MMP-9 and ultimately decrease migration and invasion of mutant cybrids containing 9821insA. These studies confirm a role of NF-{kappa}B in the regulation of MMP-9 expression and through this regulation modulates the migratory and invasive capabilities of cybrids with mutant mtDNA. Enhanced migration and invasion abilities caused by up-regulated MMP-9 may contribute to the tumorigenic phenotypic characteristics of mutant cybrids. -- Highlights: Black-Right-Pointing-Pointer Cybrids are useful models to study the role of mtDNA changes in cancer development. Black-Right-Pointing-Pointer mtDNA changes affect the expression of nuclear

  4. Expression of the nucleus-encoded chloroplast division genes and proteins regulated by the algal cell cycle.

    Science.gov (United States)

    Miyagishima, Shin-Ya; Suzuki, Kenji; Okazaki, Kumiko; Kabeya, Yukihiro

    2012-10-01

    Chloroplasts have evolved from a cyanobacterial endosymbiont and their continuity has been maintained by chloroplast division, which is performed by the constriction of a ring-like division complex at the division site. It is believed that the synchronization of the endosymbiotic and host cell division events was a critical step in establishing a permanent endosymbiotic relationship, such as is commonly seen in existing algae. In the majority of algal species, chloroplasts divide once per specific period of the host cell division cycle. In order to understand both the regulation of the timing of chloroplast division in algal cells and how the system evolved, we examined the expression of chloroplast division genes and proteins in the cell cycle of algae containing chloroplasts of cyanobacterial primary endosymbiotic origin (glaucophyte, red, green, and streptophyte algae). The results show that the nucleus-encoded chloroplast division genes and proteins of both cyanobacterial and eukaryotic host origin are expressed specifically during the S phase, except for FtsZ in one graucophyte alga. In this glaucophyte alga, FtsZ is persistently expressed throughout the cell cycle, whereas the expression of the nucleus-encoded MinD and MinE as well as FtsZ ring formation are regulated by the phases of the cell cycle. In contrast to the nucleus-encoded division genes, it has been shown that the expression of chloroplast-encoded division genes is not regulated by the host cell cycle. The endosymbiotic gene transfer of minE and minD from the chloroplast to the nuclear genome occurred independently on multiple occasions in distinct lineages, whereas the expression of nucleus-encoded MIND and MINE is regulated by the cell cycle in all lineages examined in this study. These results suggest that the timing of chloroplast division in algal cell cycle is restricted by the cell cycle-regulated expression of some but not all of the chloroplast division genes. In addition, it is

  5. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  6. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  7. A human-specific de novo protein-coding gene associated with human brain functions.

    Directory of Open Access Journals (Sweden)

    Chuan-Yun Li

    2010-03-01

    Full Text Available To understand whether any human-specific new genes may be associated with human brain functions, we computationally screened the genetic vulnerable factors identified through Genome-Wide Association Studies and linkage analyses of nicotine addiction and found one human-specific de novo protein-coding gene, FLJ33706 (alternative gene symbol C20orf203. Cross-species analysis revealed interesting evolutionary paths of how this gene had originated from noncoding DNA sequences: insertion of repeat elements especially Alu contributed to the formation of the first coding exon and six standard splice junctions on the branch leading to humans and chimpanzees, and two subsequent substitutions in the human lineage escaped two stop codons and created an open reading frame of 194 amino acids. We experimentally verified FLJ33706's mRNA and protein expression in the brain. Real-Time PCR in multiple tissues demonstrated that FLJ33706 was most abundantly expressed in brain. Human polymorphism data suggested that FLJ33706 encodes a protein under purifying selection. A specifically designed antibody detected its protein expression across human cortex, cerebellum and midbrain. Immunohistochemistry study in normal human brain cortex revealed the localization of FLJ33706 protein in neurons. Elevated expressions of FLJ33706 were detected in Alzheimer's brain samples, suggesting the role of this novel gene in human-specific pathogenesis of Alzheimer's disease. FLJ33706 provided the strongest evidence so far that human-specific de novo genes can have protein-coding potential and differential protein expression, and be involved in human brain functions.

  8. Comparison of the gene encoding, and the predicted amino acid composition of, platelet membrane receptor subunit glycoprotein Ibα in members of the family Felidae.

    Science.gov (United States)

    Boudreaux, Mary K; Christopherson, Pete W; Blair, Cori

    2016-03-01

    There is minimal information regarding platelet receptors in the family Felidae. Comparative studies assist with identifying amino acids critical for protein structure and function. The purpose of the study was to compare the gene encoding, and the predicted amino acid composition of, platelet membrane receptor subunit GPIbα in Felidae family members. Genomic DNA samples isolated from whole blood of 13 domestic cats and 50 big cats representing 8 different species were subjected to PCR using primers designed to flank the coding region of GPIbα in overlapping fashion. PCR products were separated via electrophoresis on agarose gels, and extracted products were submitted for sequencing. DNA sequences were used to predict the length and amino acid composition of the protein. Varying protein lengths were predicted in Felidae family members which were primarily due to polymorphisms in the variable number of tandem repeats region encoding the macroglycopeptide region of GPIbα. Other areas of the gene and predicted amino acid compositions were fairly conserved when compared to human sequences and between Felidae family members. Various polymorphisms within GPIbα, including length variants encoding the macroglycopeptide region, were identified in members of the family Felidae. More studies are needed to determine if a correlation exists between various polymorphisms and predisposition for hemorrhage or thrombosis as suggested in people. © 2016 American Society for Veterinary Clinical Pathology.

  9. TMS interference with primacy and recency mechanisms reveals bimodal episodic encoding in the human brain.

    Science.gov (United States)

    Innocenti, Iglis; Cappa, Stefano F; Feurra, Matteo; Giovannelli, Fabio; Santarnecchi, Emiliano; Bianco, Giovanni; Cincotta, Massimo; Rossi, Simone

    2013-01-01

    A classic finding of the psychology of memory is the "serial position effect." Immediate free recall of a word list is more efficient for items presented early (primacy effect) or late (recency effect), with respect to those in the middle. In an event-related, randomized block design, we interfered with the encoding of unrelated words lists with brief trains of repetitive TMS (rTMS), applied coincidently with the acoustic presentation of each word to the left dorsolateral pFC, the left intraparietal lobe, and a control site (vertex). Interference of rTMS with encoding produced a clear-cut double dissociation on accuracy during immediate free recall. The primacy effect was selectively worsened by rTMS of the dorsolateral pFC, whereas recency was selectively worsened by rTMS of the intraparietal lobe. These results are in agreement with the double dissociation between short-term and long-term memory observed in neuropsychological patients and provide direct evidence of distinct cortical mechanisms of encoding in the human brain.

  10. Encoding of natural sounds at multiple spectral and temporal resolutions in the human auditory cortex.

    Directory of Open Access Journals (Sweden)

    Roberta Santoro

    2014-01-01

    Full Text Available Functional neuroimaging research provides detailed observations of the response patterns that natural sounds (e.g. human voices and speech, animal cries, environmental sounds evoke in the human brain. The computational and representational mechanisms underlying these observations, however, remain largely unknown. Here we combine high spatial resolution (3 and 7 Tesla functional magnetic resonance imaging (fMRI with computational modeling to reveal how natural sounds are represented in the human brain. We compare competing models of sound representations and select the model that most accurately predicts fMRI response patterns to natural sounds. Our results show that the cortical encoding of natural sounds entails the formation of multiple representations of sound spectrograms with different degrees of spectral and temporal resolution. The cortex derives these multi-resolution representations through frequency-specific neural processing channels and through the combined analysis of the spectral and temporal modulations in the spectrogram. Furthermore, our findings suggest that a spectral-temporal resolution trade-off may govern the modulation tuning of neuronal populations throughout the auditory cortex. Specifically, our fMRI results suggest that neuronal populations in posterior/dorsal auditory regions preferably encode coarse spectral information with high temporal precision. Vice-versa, neuronal populations in anterior/ventral auditory regions preferably encode fine-grained spectral information with low temporal precision. We propose that such a multi-resolution analysis may be crucially relevant for flexible and behaviorally-relevant sound processing and may constitute one of the computational underpinnings of functional specialization in auditory cortex.

  11. Ghrelin modulates encoding-related brain function without enhancing memory formation in humans.

    Science.gov (United States)

    Kunath, N; Müller, N C J; Tonon, M; Konrad, B N; Pawlowski, M; Kopczak, A; Elbau, I; Uhr, M; Kühn, S; Repantis, D; Ohla, K; Müller, T D; Fernández, G; Tschöp, M; Czisch, M; Steiger, A; Dresler, M

    2016-11-15

    Ghrelin regulates energy homeostasis in various species and enhances memory in rodent models. In humans, the role of ghrelin in cognitive processes has yet to be characterized. Here we show in a double-blind randomized crossover design that acute administration of ghrelin alters encoding-related brain activity, however does not enhance memory formation in humans. Twenty-one healthy young male participants had to memorize food- and non-food-related words presented on a background of a virtual navigational route while undergoing fMRI recordings. After acute ghrelin administration, we observed decreased post-encoding resting state fMRI connectivity between the caudate nucleus and the insula, amygdala, and orbitofrontal cortex. In addition, brain activity related to subsequent memory performance was modulated by ghrelin. On the next day, however, no differences were found in free word recall or cued location-word association recall between conditions; and ghrelin's effects on brain activity or functional connectivity were unrelated to memory performance. Further, ghrelin had no effect on a cognitive test battery comprising tests for working memory, fluid reasoning, creativity, mental speed, and attention. In conclusion, in contrast to studies with animal models, we did not find any evidence for the potential of ghrelin acting as a short-term cognitive enhancer in humans. Copyright © 2016 Elsevier Inc. All rights reserved.

  12. Chromosomal mapping of the human M6 genes

    Energy Technology Data Exchange (ETDEWEB)

    Olinsky, S.; Loop, B.T.; DeKosky, A. [Univ. of Pittsburgh, PA (United States)] [and others

    1996-05-01

    M6 is a neuronal membrane glycoprotein that may have an important role in neural development. This molecule was initially defined by a monoclonal antibody that affected the survival of cultured cerebellar neurons and the outgrowth of neurites. The nature of the antigen was discovered by expression cDNA cloning using this monoclonal antibody. Two distinct murine M6 cDNAs (designated M6a and M6b) whose deduced amino acid sequences were remarkably similar to that of the myelin proteolipid protein human cDNA and genomic clones encoding M6a and M6b and have characterized them by restriction mapping, Southern hybridization with cDNA probes, and sequence analysis. We have localized these genes within the human genome by FISH (fluorescence in situ hybridization). The human M6a gene is located at 4q34, and the M6b gene is located at Xp22.2 A number of human neurological disorders have been mapped to the Xp22 region, including Aicardi syndrome (MIM 304050), Rett syndrome (MIM 312750), X-linked Charcot-Marie-Tooth neuropathy (MIM 302801), and X-linked mental retardation syndromes (MRX1, MIM 309530). This raises the possibility that a defect in the M6b gene is responsible for one of these neurological disorders. 8 refs., 3 figs.

  13. Structured RNAs in the ENCODE selected regions of the human genome

    DEFF Research Database (Denmark)

    Washietl, Stefan; Pedersen, Jakob Skou; Korbel, Jan O

    2007-01-01

    Functional RNA structures play an important role both in the context of noncoding RNA transcripts as well as regulatory elements in mRNAs. Here we present a computational study to detect functional RNA structures within the ENCODE regions of the human genome. Since structural RNAs in general lack...... with the GENCODE annotation points to functional RNAs in all genomic contexts, with a slightly increased density in 3'-UTRs. While we estimate a significant false discovery rate of approximately 50%-70% many of the predictions can be further substantiated by additional criteria: 248 loci are predicted by both RNAz...

  14. Molecular and Biochemical Characterization of Two Xylanase-Encoding Genes from Cellulomonas pachnodae

    Science.gov (United States)

    Cazemier, Anne E.; Verdoes, Jan C.; van Ooyen, Albert J. J.; Op den Camp, Huub J. M.

    1999-01-01

    Two xylanase-encoding genes, named xyn11A and xyn10B, were isolated from a genomic library of Cellulomonas pachnodae by expression in Escherichia coli. The deduced polypeptide, Xyn11A, consists of 335 amino acids with a calculated molecular mass of 34,383 Da. Different domains could be identified in the Xyn11A protein on the basis of homology searches. Xyn11A contains a catalytic domain belonging to family 11 glycosyl hydrolases and a C-terminal xylan binding domain, which are separated from the catalytic domain by a typical linker sequence. Binding studies with native Xyn11A and a truncated derivative of Xyn11A, lacking the putative binding domain, confirmed the function of the two domains. The second xylanase, designated Xyn10B, consists of 1,183 amino acids with a calculated molecular mass of 124,136 Da. Xyn10B also appears to be a modular protein, but typical linker sequences that separate the different domains were not identified. It comprises a N-terminal signal peptide followed by a stretch of amino acids that shows homology to thermostabilizing domains. Downstream of the latter domain, a catalytic domain specific for family 10 glycosyl hydrolases was identified. A truncated derivative of Xyn10B bound tightly to Avicel, which was in accordance with the identified cellulose binding domain at the C terminus of Xyn10B on the basis of homology. C. pachnodae, a (hemi)cellulolytic bacterium that was isolated from the hindgut of herbivorous Pachnoda marginata larvae, secretes at least two xylanases in the culture fluid. Although both Xyn11A and Xyn10B had the highest homology to xylanases from Cellulomonas fimi, distinct differences in the molecular organizations of the xylanases from the two Cellulomonas species were identified. PMID:10473422

  15. Transcriptional regulation of the Rhodococcus rhodochrous J1 nitA gene encoding a nitrilase.

    Science.gov (United States)

    Komeda, H; Hori, Y; Kobayashi, M; Shimizu, S

    1996-01-01

    The 1.4-kb downstream region from a nitrilase gene (nitA) of an actinomycete Rhodococcus rhodochrous J1, which is industrially in use, was found to be required for the isovaleronitrile-dependent induction of nitrilase synthesis in experiments using a Rhodococcus-Escherichia coli shuttle vector pK4 in a Rhodococcus strain. Sequence analysis of the 1.4-kb region revealed the existence of an open reading frame (nitR) of 957 bp, which would encode a protein with a molecular mass of 35,100. Deletion of the central and 3'-terminal portion of nitR resulted in the complete loss of nitrilase activity, demonstrating that nitR codes for a transcriptional positive regulator in nitA expression. The deduced amino acid sequence of nitR showed similarity to a positive regulator family including XylS from Pseudomonas putida and AraC from E. coli. By Northern blot analysis, the 1.4-kb transcripts for nitA were detected in R. rhodochrous J1 cells cultured in the presence of isovaleronitrile, but not those cultured in the absence of isovaleronitrile. The transcriptional start site for nitA was mapped to a C residue located 26 bp upstream of its translational start site. Deletion analysis to define the nitA promoter region suggested the possible participation of an inverted repeat sequence, centered on base pair -52, in induction of nitA transcription. Images Fig. 2 Fig. 5 Fig. 6 PMID:8855219

  16. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  17. Cloning and expression of a novel, moderately thermostable xylanase-encoding gene (Cflxyn11A) from Cellulomonas flavigena.

    Science.gov (United States)

    Amaya-Delgado, Lorena; Mejía-Castillo, Teresa; Santiago-Hernández, Alejandro; Vega-Estrada, Jesús; Amelia, Farrés-G-S; Xoconostle-Cázares, Beatriz; Ruiz-Medrano, Roberto; Montes-Horcasitas, María Del Carmen; Hidalgo-Lara, María Eugenia

    2010-07-01

    The Cfl xyn11A gene, encoding the endo-1,4-beta-xylanase Cfl Xyn11A from Cellulomonas flavigena, was isolated from a genomic DNA library. The open reading frame of the Cfl xyn11A gene was 999 base pairs long and encoded a polypeptide (Cfl Xyn11A) of 332 amino acids with a calculated molecular mass of 35,110Da. The Cfl xyn11A gene was expressed in Escherichia coli and the recombinant enzyme, with an estimated molecular weight of 31kDa was purified and xylanase activity was measured. Cfl Xyn11A showed optimal activity at pH 6.5 and 55 degrees C. The enzyme demonstrated moderate thermal stability as Cfl Xyn11A maintained 50% of its activity when incubated at 55 degrees C for 1h or at 45 degrees C for 6h. This is the first report describing the cloning, expression and functional characterization of an endo-1,4-beta-xylanase-encoding gene from C. flavigena. Cfl Xyn11A may be suitable for industrial applications in the food and feed industries, or in the pre-treatment of lignocellulosic biomass required to improve the yields of fermentable sugars for bioethanol production. Copyright (c) 2010 Elsevier Ltd. All rights reserved.

  18. Genome organisation and expression profiling of ABC protein-encoding genes in Heterobasidion annosum s.l. complex.

    Science.gov (United States)

    Baral, Bikash; Kovalchuk, Andriy; Asiegbu, Fred O

    2016-03-01

    Members of Heterobasidion annosum species complex are widely regarded as the most destructive fungal pathogens of conifer trees in the boreal and temperate zones of Northern hemisphere. To invade and colonise their host trees, Heterobasidion fungi must overcome components of host chemical defence, including terpenoid oleoresin and phenolic compounds. ABC transporters may play an important role in this process participating in the export of toxic host metabolites and maintaining their intracellular concentration below the critical level. We have identified and phylogenetically classified Heterobasidion genes encoding ABC transporters and closely related ABC proteins. The number of ABC proteins in the Heterobasidion genome is one of the lowest among analysed species of Agaricomycotina. Using quantitative RT-PCR, we have analysed transcriptional response of Heterobasidion ABC transporter-encoding genes to monoterpenes as well as their expression profile during growth on pine wood in comparison to the growth on defined media. Several ABC transporters were up-regulated during growth on pine wood. The ABC-transporter encoding gene ABCG1.1 was induced both during growth of H. annosum on pine wood and upon exposure to monoterpenes. Our experimental data demonstrate the differential responses of Heterobasidion ABC genes to growth conditions and chemical stressors. The presented results suggest a potential role of Heterobasidion ABC-G transporters in the resistance to the components of conifer chemical defence. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  19. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria...... in nonimmune patients tend to express a restricted subset of VSA (VSA(SM)) that differs from VSA associated with uncomplicated malaria and asymptomatic infection (VSA(UM)). We compared var gene transcription in unselected P. falciparum clone 3D7 expressing VSA(UM) to in vitro-selected sublines expressing VSA......(SM) to identify PfEMP1 responsible for the VSA(SM) phenotype. Expression of VSA(SM) was accompanied by up-regulation of Group A var genes. The most prominently up-regulated Group A gene (PFD1235w/MAL7P1.1) was translated into a protein expressed on the infected RBC surface. The proteins encoded by Group A var...

  20. Genomic cloning and characterization of a PPA gene encoding a mannose-binding lectin from Pinellia pedatisecta.

    Science.gov (United States)

    Lin, Juan; Zhou, Xuanwei; Fei, Jiong; Liao, Zhihua; Jin, Wang; Sun, Xiaofen; Tang, Kexuan

    2006-04-01

    A gene encoding a mannose-binding lectin, Pinellia pedatisecta agglutinin (PPA), was isolated from leaves of Pinellia pedatisecta using genomic walker technology. The ppa contained an 1140-bp 5'-upstream region, a 771-bp open reading frame (ORF) and an 829-bp 3'-downstream region. The ORF encoded a precursor polypeptide of 256 amino acid residues with a 24-amino acid signal peptide. There were one putative TATA box and six possible CAAT boxes lying in the 5'-upstream region of ppa. The ppa showed significant similarity at the nucleic acid level with genes encoding mannose-binding lectins from other Araceae species such as Pinellia ternata, Arisaema hererophyllum, Colocasia esculenta and Arum maculatum. At the amino acid level, PPA also shared varying homology (ranging from 40% to 85%) with mannose-binding lectins from other plant species, such as those from Araceae, Alliaceae, Iridaceae, Lillaceae, Amaryllidaceae and Bromeliaceae. The cloning of the ppa gene not only provides a basis for further investigation of PPA's structure, expression and regulation mechanism, but also enables us to test its potential role in controlling pests and fungal diseases by transferring the gene into tobacco and rice in the future.

  1. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  2. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  3. A negative element involved in Kaposi's sarcoma-associated herpesvirus-encoded ORF11 gene expression

    Energy Technology Data Exchange (ETDEWEB)

    Chen, Lei [Los Alamos National Laboratory

    2009-01-01

    The ORF11 of the Kaposi's sarcoma-associated herpesvirus (KSHV) is a lytic viral gene with delayed-early expression kinetics. How the ORF11 gene expression is regulated in the KSHV lytic cascade is largely unknown. Here we report that the deletion of the KSHV viral IL-6 gene from the viral genome leads to deregulated ORF11 gene expression. The KSHV-encoded viral IL-6 protein was found not to be essentially involved in the regulation of ORF11, suggesting a potential transcriptional cis-regulation. A negative element was identified downstream of the ORF11 gene, which suppresses the ORF11 basal promoter activity in a position-independent manner.

  4. MAGE, BAGE and GAGE gene expression in human rhabdomyosarcomas.

    Science.gov (United States)

    Dalerba, P; Frascella, E; Macino, B; Mandruzzato, S; Zambon, A; Rosolen, A; Carli, M; Ninfo, V; Zanovello, P

    2001-07-01

    MAGE, BAGE and GAGE genes encode tumor-associated antigens that are presented by HLA class I molecules and recognized by CD8(+) cytolytic T lymphocytes. These antigens are currently regarded as promising targets for active, specific tumor immunotherapy because MAGE, BAGE and GAGE genes are expressed in many human cancers of different histotype and are silent in normal tissues, with the exception of spermatogonia and placental cells. MAGE, BAGE and GAGE gene expression has been extensively studied in different tumors of adults but is largely unknown in many forms of pediatric solid cancer. Using RT-PCR, we analyzed MAGE-1, MAGE-2, MAGE-3, MAGE-4, MAGE-6, BAGE, GAGE-1,-2 or -8 and GAGE-3,-4,-5,-6 or -7b gene expression in 31 samples of pediatric rhabdomyosarcoma, the most frequent form of malignant soft tissue tumor in children. MAGE genes were expressed in a substantial proportion of patients (MAGE-1, 38%; MAGE-2, 51%; MAGE-3, 35%; MAGE-4, 22%; MAGE-6, 35%), while expression of BAGE (6%); GAGE-1, GAGE-2 and GAGE-8 (9%); and GAGE-3, GAGE-4, GAGE-5, GAGE-6 and GAGE-7B (16%) was less frequent. Overall, 58% of tumors expressed at least 1 gene, and 35% expressed 3 or more genes simultaneously. Our data suggest that a subset of rhabdomyosarcoma patients could be eligible for active, specific immunotherapy directed against MAGE, BAGE and GAGE antigens. Copyright 2001 Wiley-Liss, Inc.

  5. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  6. Cloning and characterization of SmZF1, a gene encoding a Schistosoma mansoni zinc finger protein

    Directory of Open Access Journals (Sweden)

    Souza Paulo R Eleutério de

    2001-01-01

    Full Text Available The zinc finger motifs (Cys2His2 are found in several proteins playing a role in the regulation of transcripton. SmZF1, a Schistosoma mansoni gene encoding a zinc finger protein was initially isolated from an adult worm cDNA library, as a partial cDNA. The full sequence of the gene was obtained by subcloning and sequencing cDNA and genomic fragments. The collated gene sequence is 2181 nt and the complete cDNA sequence is 705 bp containing the full open reading frame of the gene. Analysis of the genome sequence revealed the presence of three introns interrupting the coding region. The open reading frame theoretically encodes a protein of 164 amino acids, with a calculated molecular mass of 18,667Da. The predicted protein contains three zinc finger motifs, usually present in transcription regulatory proteins. PCR amplification with specific primers for the gene allowed for the detection of the target in egg, cercariae, schistosomulum and adult worm cDNA libraries indicating the expression of the mRNA in these life cycle stages of S. mansoni. This pattern of expression suggests the gene plays a role in vital functions of different life cycle stages of the parasite. Future research will be directed to elucidate the functional role of SmZF1.

  7. Effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells

    Directory of Open Access Journals (Sweden)

    O. H. Minchenko

    2016-06-01

    Full Text Available We have studied the effect of hypoxia on the expression of nuclear genes encoding mitochondrial proteins in U87 glioma cells under the inhibition of IRE1 (inositol requiring enzyme-1, which controls cell proliferation and tumor growth as a central mediator of endoplasmic reticulum stress. It was shown that hypoxia down-regulated gene expression of malate dehydrogenase 2 (MDH2, malic enzyme 2 (ME2, mitochondrial aspartate aminotransferase (GOT2, and subunit B of succinate dehydrogenase (SDHB in control (transfected by empty vector glioma cells in a gene specific manner. At the same time, the expression level of mitochondrial NADP+-dependent isocitrate dehydrogenase 2 (IDH2 and subunit D of succinate dehydrogenase (SDHD genes in these cells does not significantly change in hypoxic conditions. It was also shown that the inhibition of ІRE1 signaling enzyme function in U87 glioma cells decreases the effect of hypoxia on the expression of ME2, GOT2, and SDHB genes and introduces the sensitivity of IDH2 gene to hypoxia. Furthermore, the expression of all studied genes depends on IRE1-mediated endoplasmic reticulum stress signaling in gene specific manner, because ІRE1 knockdown significantly decreases their expression in normoxic conditions, except for IDH2 gene, which expression level is strongly up-regulated. Therefore, changes in the expression level of nuclear genes encoding ME2, MDH2, IDH2, SDHB, SDHD, and GOT2 proteins possibly reflect metabolic reprogramming of mitochondria by hypoxia and IRE1-mediated endoplasmic reticulum stress signaling and correlate with suppression of glioma cell proliferation under inhibition of the IRE1 enzyme function.

  8. MC148 encoded by human molluscum contagiosum poxvirus is an antagonist for human but not murine CCR8

    DEFF Research Database (Denmark)

    Lüttichau, H R; Gerstoft, J; Schwartz, T W

    2001-01-01

    The viral CC chemokines MC148, encoded by the poxvirus molluscum contagiosum, and viral macrophage inflammatory protein (vMIP)-I and vMIP-II, encoded by human herpesvirus 8, were probed on the murine CC receptor (CCR) 8 in parallel with human CCR8. In calcium mobilization assays, vMIP-I acted...... as a high-affinity agonist, whereas vMIP-II acted as a low-affinity antagonist on the murine CCR8 as well as the human CCR8. MC148 was found to bind and block responses through the human CCR8 with high affinity, but surprisingly MC148 was unable to bind and block responses through the murine CCR8. Because...... MC148 is the only high-affinity antagonist known to target and be selective for CCR8, MC148 is a valuable tool to decipher the role played by CCR8 in the immune system. This study shows that MC148 could not be used in murine inflammatory models; however, it will be interesting to see whether it can...

  9. Pupillometry as a glimpse into the neurochemical basis of human memory encoding.

    Science.gov (United States)

    Hoffing, Russell Cohen; Seitz, Aaron R

    2015-04-01

    Neurochemical systems are well studied in animal learning; however, ethical issues limit methodologies to explore these systems in humans. Pupillometry provides a glimpse into the brain's neurochemical systems, where pupil dynamics in monkeys have been linked with locus coeruleus (LC) activity, which releases norepinephrine (NE) throughout the brain. Here, we use pupil dynamics as a surrogate measure of neurochemical activity to explore the hypothesis that NE is involved in modulating memory encoding. We examine this using a task-irrelevant learning paradigm in which learning is boosted for stimuli temporally paired with task targets. We show that participants better recognize images that are paired with task targets than distractors and, in correspondence, that pupil size changes more for target-paired than distractor-paired images. To further investigate the hypothesis that NE nonspecifically guides learning for stimuli that are present with its release, a second procedure was used that employed an unexpected sound to activate the LC-NE system and induce pupil-size changes; results indicated a corresponding increase in memorization of images paired with the unexpected sounds. Together, these results suggest a relationship between the LC-NE system, pupil-size changes, and human memory encoding.

  10. Expression of the Acc1 Gene-Encoded Acetyl-Coenzyme A Carboxylase in Developing Maize (Zea mays L.) Kernels.

    Science.gov (United States)

    Somers, D. A.; Keith, R. A.; Egli, M. A.; Marshall, L. C.; Gengenbach, B. G.; Gronwald, J. W.; Wyse, D. L.

    1993-01-01

    A mutation (Acc1-S2) in the structural gene for maize (Zea mays L.) acetyl-coenzyme A carboxylase (ACCase) that significantly reduces sethoxydim inhibition of leaf ACCase activity was used to investigate the gene-enzyme relationship regulating ACCase activity during oil deposition in developing kernels. Mutant embryo and endosperm ACCase activities were more than 600-fold less sensitive to sethoxydim inhibition than ACCase in wild-type kernel tissues. Moreover, in vitro cultured mutant kernels developed normally in the presence of sethoxydim concentrations that inhibited wild-type kernel development. The results indicate that the Acc1-encoded ACCase accounts for the majority of ACCase activity in developing maize kernels, suggesting that Acc1-encoded ACCase functions not only during membrane biogenesis in leaves but is also the predominant form of ACCase involved in storage lipid biosynthesis in maize embryos. PMID:12231761

  11. The habenula encodes negative motivational value associated with primary punishment in humans.

    Science.gov (United States)

    Lawson, Rebecca P; Seymour, Ben; Loh, Eleanor; Lutti, Antoine; Dolan, Raymond J; Dayan, Peter; Weiskopf, Nikolaus; Roiser, Jonathan P

    2014-08-12

    Learning what to approach, and what to avoid, involves assigning value to environmental cues that predict positive and negative events. Studies in animals indicate that the lateral habenula encodes the previously learned negative motivational value of stimuli. However, involvement of the habenula in dynamic trial-by-trial aversive learning has not been assessed, and the functional role of this structure in humans remains poorly characterized, in part, due to its small size. Using high-resolution functional neuroimaging and computational modeling of reinforcement learning, we demonstrate positive habenula responses to the dynamically changing values of cues signaling painful electric shocks, which predict behavioral suppression of responses to those cues across individuals. By contrast, negative habenula responses to monetary reward cue values predict behavioral invigoration. Our findings show that the habenula plays a key role in an online aversive learning system and in generating associated motivated behavior in humans.

  12. Variation in the Gene Encoding the Serotonin Transporter is Associated with a Measure of Sociopathy in Alcoholics

    OpenAIRE

    Herman, Aryeh I.; Conner, Tamlin S.; Anton, Raymond F.; Gelernter, Joel; Kranzler, Henry R.; Covault, Jonathan

    2011-01-01

    The present study examined the association between a measure of sociopathy and 5-HTTLPR genotype in a sample of individuals from Project MATCH, a multi-center alcohol treatment trial. 5-HTTLPR, an insertion/deletion polymorphism in SLC6A4, the gene encoding the serotonin transporter protein, results in functionally distinct long (L) and short (S) alleles. The S allele has been associated with a variety of psychiatric disorders and symptoms including alcohol dependence, but it is unknown wheth...

  13. Excretion of putrescine by the putrescine-ornithine antiporter encoded by the potE gene of Escherichia coli.

    OpenAIRE

    Kashiwagi, K; Miyamoto, S; Suzuki, F; Kobayashi, H; Igarashi, K

    1992-01-01

    Excretion of putrescine from Escherichia coli was assessed by measuring its uptake into inside-out membrane vesicles. The vesicles were prepared from wild-type E. coli or E. coli transformed with plasmids containing one of the three polyamine transport systems. The results indicate that excretion of putrescine is catalyzed by the putrescine transport protein, encoded by the potE gene located at 16 min on the E. coli chromosome. Loading of ornithine (or lysine) inside the vesicles was essentia...

  14. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Science.gov (United States)

    Alvarez, Rene; Seal, Bruce S

    2005-01-01

    Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

  15. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Directory of Open Access Journals (Sweden)

    Alvarez Rene

    2005-04-01

    Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

  16. ICGA-PSO-ELM approach for accurate multiclass cancer classification resulting in reduced gene sets in which genes encoding secreted proteins are highly represented.

    Science.gov (United States)

    Saraswathi, Saras; Sundaram, Suresh; Sundararajan, Narasimhan; Zimmermann, Michael; Nilsen-Hamilton, Marit

    2011-01-01

    A combination of Integer-Coded Genetic Algorithm (ICGA) and Particle Swarm Optimization (PSO), coupled with the neural-network-based Extreme Learning Machine (ELM), is used for gene selection and cancer classification. ICGA is used with PSO-ELM to select an optimal set of genes, which is then used to build a classifier to develop an algorithm (ICGA_PSO_ELM) that can handle sparse data and sample imbalance. We evaluate the performance of ICGA-PSO-ELM and compare our results with existing methods in the literature. An investigation into the functions of the selected genes, using a systems biology approach, revealed that many of the identified genes are involved in cell signaling and proliferation. An analysis of these gene sets shows a larger representation of genes that encode secreted proteins than found in randomly selected gene sets. Secreted proteins constitute a major means by which cells interact with their surroundings. Mounting biological evidence has identified the tumor microenvironment as a critical factor that determines tumor survival and growth. Thus, the genes identified by this study that encode secreted proteins might provide important insights to the nature of the critical biological features in the microenvironment of each tumor type that allow these cells to thrive and proliferate.

  17. A global evolutionary and metabolic analysis of human obesity gene risk variants.

    Science.gov (United States)

    Castillo, Joseph J; Hazlett, Zachary S; Orlando, Robert A; Garver, William S

    2017-09-05

    It is generally accepted that the selection of gene variants during human evolution optimized energy metabolism that now interacts with our obesogenic environment to increase the prevalence of obesity. The purpose of this study was to perform a global evolutionary and metabolic analysis of human obesity gene risk variants (110 human obesity genes with 127 nearest gene risk variants) identified using genome-wide association studies (GWAS) to enhance our knowledge of early and late genotypes. As a result of determining the mean frequency of these obesity gene risk variants in 13 available populations from around the world our results provide evidence for the early selection of ancestral risk variants (defined as selection before migration from Africa) and late selection of derived risk variants (defined as selection after migration from Africa). Our results also provide novel information for association of these obesity genes or encoded proteins with diverse metabolic pathways and other human diseases. The overall results indicate a significant differential evolutionary pattern for the selection of obesity gene ancestral and derived risk variants proposed to optimize energy metabolism in varying global environments and complex association with metabolic pathways and other human diseases. These results are consistent with obesity genes that encode proteins possessing a fundamental role in maintaining energy metabolism and survival during the course of human evolution. Copyright © 2017. Published by Elsevier B.V.

  18. Global gene expression during stringent response in Corynebacterium glutamicum in presence and absence of the rel gene encoding (pppGpp synthase

    Directory of Open Access Journals (Sweden)

    Kalinowski Jörn

    2006-09-01

    Full Text Available Background The stringent response is the initial reaction of microorganisms to nutritional stress. During stringent response the small nucleotides (pppGpp act as global regulators and reprogram bacterial transcription. In this work, the genetic network controlled by the stringent response was characterized in the amino acid-producing Corynebacterium glutamicum. Results The transcriptome of a C. glutamicum rel gene deletion mutant, unable to synthesize (pppGpp and to induce the stringent response, was compared with that of its rel-proficient parent strain by microarray analysis. A total of 357 genes were found to be transcribed differentially in the rel-deficient mutant strain. In a second experiment, the stringent response was induced by addition of DL-serine hydroxamate (SHX in early exponential growth phase. The time point of the maximal effect on transcription was determined by real-time RT-PCR using the histidine and serine biosynthetic genes. Transcription of all of these genes reached a maximum at 10 minutes after SHX addition. Microarray experiments were performed comparing the transcriptomes of SHX-induced cultures of the rel-proficient strain and the rel mutant. The differentially expressed genes were grouped into three classes. Class A comprises genes which are differentially regulated only in the presence of an intact rel gene. This class includes the non-essential sigma factor gene sigB which was upregulated and a large number of genes involved in nitrogen metabolism which were downregulated. Class B comprises genes which were differentially regulated in response to SHX in both strains, independent of the rel gene. A large number of genes encoding ribosomal proteins fall into this class, all being downregulated. Class C comprises genes which were differentially regulated in response to SHX only in the rel mutant. This class includes genes encoding putative stress proteins and global transcriptional regulators that might be

  19. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  20. A gene map of the human genome.

    Science.gov (United States)

    Schuler, G D; Boguski, M S; Stewart, E A; Stein, L D; Gyapay, G; Rice, K; White, R E; Rodriguez-Tomé, P; Aggarwal, A; Bajorek, E; Bentolila, S; Birren, B B; Butler, A; Castle, A B; Chiannilkulchai, N; Chu, A; Clee, C; Cowles, S; Day, P J; Dibling, T; Drouot, N; Dunham, I; Duprat, S; East, C; Edwards, C; Fan, J B; Fang, N; Fizames, C; Garrett, C; Green, L; Hadley, D; Harris, M; Harrison, P; Brady, S; Hicks, A; Holloway, E; Hui, L; Hussain, S; Louis-Dit-Sully, C; Ma, J; MacGilvery, A; Mader, C; Maratukulam, A; Matise, T C; McKusick, K B; Morissette, J; Mungall, A; Muselet, D; Nusbaum, H C; Page, D C; Peck, A; Perkins, S; Piercy, M; Qin, F; Quackenbush, J; Ranby, S; Reif, T; Rozen, S; Sanders, C; She, X; Silva, J; Slonim, D K; Soderlund, C; Sun, W L; Tabar, P; Thangarajah, T; Vega-Czarny, N; Vollrath, D; Voyticky, S; Wilmer, T; Wu, X; Adams, M D; Auffray, C; Walter, N A; Brandon, R; Dehejia, A; Goodfellow, P N; Houlgatte, R; Hudson, J R; Ide, S E; Iorio, K R; Lee, W Y; Seki, N; Nagase, T; Ishikawa, K; Nomura, N; Phillips, C; Polymeropoulos, M H; Sandusky, M; Schmitt, K; Berry, R; Swanson, K; Torres, R; Venter, J C; Sikela, J M; Beckmann, J S; Weissenbach, J; Myers, R M; Cox, D R; James, M R; Bentley, D; Deloukas, P; Lander, E S; Hudson, T J

    1996-10-25

    The human genome is thought to harbor 50,000 to 100,000 genes, of which about half have been sampled to date in the form of expressed sequence tags. An international consortium was organized to develop and map gene-based sequence tagged site markers on a set of two radiation hybrid panels and a yeast artificial chromosome library. More than 16,000 human genes have been mapped relative to a framework map that contains about 1000 polymorphic genetic markers. The gene map unifies the existing genetic and physical maps with the nucleotide and protein sequence databases in a fashion that should speed the discovery of genes underlying inherited human disease. The integrated resource is available through a site on the World Wide Web at http://www.ncbi.nlm.nih.gov/SCIENCE96/.

  1. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  2. Characterization of the mouse Dazap1 gene encoding an RNA-binding protein that interacts with infertility factors DAZ and DAZL

    Directory of Open Access Journals (Sweden)

    Salido Eduardo C

    2001-09-01

    Full Text Available Abstract Background DAZAP1 (DAZ Associated Protein 1 was originally identified by a yeast two-hybrid system through its interaction with a putative male infertility factor, DAZ (Deleted in Azoospermia. In vitro, DAZAP1 interacts with both the Y chromosome-encoded DAZ and an autosome-encoded DAZ-like protein, DAZL. DAZAP1 contains two RNA-binding domains (RBDs and a proline-rich C-terminal portion, and is expressed most abundantly in the testis. To understand the biological function of DAZAP1 and the significance of its interaction with DAZ and DAZL, we isolated and characterized the mouse Dazap1 gene, and studied its expression and the subcellular localization of its protein product. Results The human and mouse genes have similar genomic structures and map to syntenic chromosomal regions. The mouse and human DAZAP1 proteins share 98% identity and their sequences are highly similar to the Xenopus orthologue Prrp, especially in the RBDs. Dazap1 is expressed throughout testis development. Western blot detects a single 45 kD DAZAP1 protein that is most abundant in the testis. Although a majority of DAZAP1 is present in the cytoplasmic fraction, they are not associated with polyribosomes. Conclusions DAZAP1 is evolutionarily highly conserved. Its predominant expression in testes suggests a role in spermatogenesis. Its subcellular localization indicates that it is not directly involved in mRNA translation.

  3. Mutations in the gene encoding the synaptic scaffolding protein SHANK3 are associated with autism spectrum disorders

    Science.gov (United States)

    Durand, Christelle M.; Betancur, Catalina; Boeckers, Tobias M.; Bockmann, Juergen; Chaste, Pauline; Fauchereau, Fabien; Nygren, Gudrun; Rastam, Maria; Gillberg, I Carina; Anckarsäter, Henrik; Sponheim, Eili; Goubran-Botros, Hany; Delorme, Richard; Chabane, Nadia; Mouren-Simeoni, Marie-Christine; de Mas, Philippe; Bieth, Eric; Rogé, Bernadette; Héron, Delphine; Burglen, Lydie; Gillberg, Christopher; Leboyer, Marion; Bourgeron, Thomas

    2007-01-01

    SHANK3 (also known as ProSAP2) regulates the structural organization of dendritic spines and is a binding partner of neuroligins; genes encoding neuroligins are mutated in autism and Asperger syndrome. Here, we report that a mutation of a single copy of SHANK3 on chromosome 22q13 can result in language and/or social communication disorders. These mutations concern only a small number of individuals, but they shed light on one gene dosage-sensitive synaptic pathway that is involved in autism spectrum disorders. PMID:17173049

  4. Cloning and Expression of Genes for Dengue Virus Type-2 Encoded Antigens for Rapid Diagnosis and Vaccine Development

    Science.gov (United States)

    1986-11-26

    SIE cop AD nCloning and Expression of Genes for Dengue Virus ,4. CJ Type 2 Encoded Antigens for Rapid Diagnosis and Vaccine Development 0ANNUAL...pVVI and pVVI7 cDNA clones, synthetic peptides homologous to NS5 and NSI regions were synthesized. These peptides are being used at Walter Reed Army...NO. Frederick, MD 21701-5012 63750A 63750 D808 A i 031 11. TITLE (Include Serurity Classification) Cloning and Expression of Genes for Dengue Virus

  5. Molecular cloning and characterization of five genes encoding pentatricopeptide repeat proteins from Upland cotton (Gossypium hirsutum L.).

    Science.gov (United States)

    Yang, Luming; Zhu, Huayu; Guo, Wangzhen; Zhang, Tianzhen

    2010-02-01

    The pentatricopeptide repeat (PPR) protein family is one of the largest and most complex families in plants. These proteins contain multiple 35-amino acid repeats that are proposed to form a super helix capable of binding RNA. PPR proteins have been implicated in many crucial functions broadly involving organelle biogenesis and plant development. In this study, we identified many genes encoding PPR protein in Upland cotton through an extensive survey of the database of Gossypium hirsutum. Furthermore, we isolated five full-length cDNA of PPR genes from G. hirsutum 0-613-2R which were named GhPPR1-GhPPR5. Domain analysis revealed that the deduced amino acid sequences of GhPPR1-5 contained from 5 to 10 PPR motifs and those PPR proteins were divided into two different PPR subfamilies. GhPPR1-2 belonged to the PLS subfamily and GhPPR3-5 belonged to the P subfamily. Phylogenetic analysis of the five GhPPR proteins and 18 other plant PPR proteins also revealed that the same subfamily clustered together. All five GhPPR genes were differentially but constitutively expressed in roots, stems, leaves, pollens, and fibers based on the gene expression analysis by real-time quantitative RT-PCR. This study is the first report and analysis of genes encoding PPR proteins in cotton.

  6. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding activity. Digestion of the plant diet occurs mainly in the midgut and is facilitated by the peritrophic matrix (PM, an extracellular sac-like structure, which lines the midgut epithelium and creates different digestive compartments. The PM is attracting increasing attention to control lepidopteran pests by interfering with this vital function. To identify novel PM components and thus potential targets for insecticides, we performed an immunoscreening with anti-PM antibodies using an expression library representing the larval midgut transcriptome of the tobacco hornworm, Manduca sexta. We identified three cDNAs encoding valine-rich midgut proteins of M. sexta (MsVmps, which appear to be loosely associated with the PM. They are members of a lepidopteran-specific family of nine VMP genes, which are exclusively expressed in larval stages in M. sexta. Most of the MsVMP transcripts are detected in the posterior midgut, with the highest levels observed for MsVMP1. To obtain further insight into Vmp function, we expressed MsVMP1 in insect cells and purified the recombinant protein. Lectin staining and glycosidase treatment indicated that MsVmp1 is highly O-glycosylated. In line with results from qPCR, immunoblots revealed that MsVmp1 amounts are highest in feeding larvae, while MsVmp1 is undetectable in starving and molting larvae. Finally using immunocytochemistry, we demonstrated that MsVmp1 localizes to the cytosol of columnar cells, which secrete MsVmp1 into the ectoperitrophic space in feeding larvae. In starving and molting larvae, MsVmp1 is found in the gut lumen, suggesting that the PM has increased its permeability. The present study demonstrates that lepidopteran species including many agricultural pests have evolved a set of unique proteins that are not found in any other taxon and thus may reflect an important adaptation in the highly specialized lepidopteran

  7. Distribution of genes encoding resistance to streptogramin A and related compounds among staphylococci resistant to these antibiotics.

    Science.gov (United States)

    Allignet, J; Aubert, S; Morvan, A; el Solh, N

    1996-01-01

    The levels of resistance to pristinamycin (Pt) and to its major constituents, pristinamycin IIA and IB (PIIA and PIB, respectively; classified as streptogramins A and B, respectively) were determined for 126 staphylococcal isolates. The results suggest tentative susceptibility breakpoints of or = 4 micrograms of PIIA per ml were investigated for the presence of staphylococcal genes encoding resistance to PIIA (vga, vat, and vatB) and PIB (vgb). None of these genes was found in the 4 isolates inhibited by 4 micrograms of PIIA per ml or in 4 of the other 52 isolates tested. The remaining 48 isolates harbored plasmids carrying vatB and vga or combinations of genes (vga-vat-vgb or vga-vat). The absence of any known PIIA resistance gene from the four Staphylococcus aureus isolates inhibited by > or = 8 micrograms of PIIA per ml suggests that there is at least one PIIA resistance mechanism in staphylococci that has not yet been characterized. PMID:8913457

  8. Encoding of Touch Intensity But Not Pleasantness in Human Primary Somatosensory Cortex.

    Science.gov (United States)

    Case, Laura K; Laubacher, Claire M; Olausson, Håkan; Wang, Binquan; Spagnolo, Primavera A; Bushnell, M Catherine

    2016-05-25

    Growing interest in affective touch has delineated a neural network that bypasses primary somatosensory cortex (S1). Several recent studies, however, have cast doubt on the segregation of touch discrimination and affect, suggesting that S1 also encodes affective qualities. We used functional magnetic resonance imaging (fMRI) and repetitive transcranial magnetic stimulation (rTMS) to examine the role of S1 in processing touch intensity and pleasantness. Twenty-six healthy human adults rated brushing on the hand during fMRI. Intensity ratings significantly predicted activation in S1, whereas pleasantness ratings predicted activation only in the anterior cingulate cortex. Nineteen subjects also received inhibitory rTMS over right hemisphere S1 and the vertex (control). After S1 rTMS, but not after vertex rTMS, sensory discrimination was reduced and subjects with reduced sensory discrimination rated touch as more intense. In contrast, rTMS did not alter ratings of touch pleasantness. Our findings support divergent neural processing of touch intensity and pleasantness, with affective touch encoded outside of S1. Growing interest in affective touch has identified a neural network that bypasses primary somatosensory cortex (S1). Several recent studies, however, cast doubt on the separation of touch discrimination and affect. We used functional magnetic resonance imaging and repetitive transcranial magnetic stimulation to demonstrate the representation of touch discrimination and intensity in S1, but the representation of pleasantness in the anterior cingulate cortex, not S1. Our findings support divergent neural processing of touch intensity and pleasantness, with affective touch encoded outside of S1. Our study contributes to growing delineation of the affective touch system, a crucial step in understanding its dysregulation in numerous clinical conditions such as autism, eating disorders, depression, and chronic pain. Copyright © 2016 the authors 0270-6474/16/365850-11$15.00/0.

  9. Encoding of Touch Intensity But Not Pleasantness in Human Primary Somatosensory Cortex

    Science.gov (United States)

    Laubacher, Claire M.; Olausson, Håkan; Wang, Binquan; Spagnolo, Primavera A.; Bushnell, M. Catherine

    2016-01-01

    Growing interest in affective touch has delineated a neural network that bypasses primary somatosensory cortex (S1). Several recent studies, however, have cast doubt on the segregation of touch discrimination and affect, suggesting that S1 also encodes affective qualities. We used functional magnetic resonance imaging (fMRI) and repetitive transcranial magnetic stimulation (rTMS) to examine the role of S1 in processing touch intensity and pleasantness. Twenty-six healthy human adults rated brushing on the hand during fMRI. Intensity ratings significantly predicted activation in S1, whereas pleasantness ratings predicted activation only in the anterior cingulate cortex. Nineteen subjects also received inhibitory rTMS over right hemisphere S1 and the vertex (control). After S1 rTMS, but not after vertex rTMS, sensory discrimination was reduced and subjects with reduced sensory discrimination rated touch as more intense. In contrast, rTMS did not alter ratings of touch pleasantness. Our findings support divergent neural processing of touch intensity and pleasantness, with affective touch encoded outside of S1. SIGNIFICANCE STATEMENT Growing interest in affective touch has identified a neural network that bypasses primary somatosensory cortex (S1). Several recent studies, however, cast doubt on the separation of touch discrimination and affect. We used functional magnetic resonance imaging and repetitive transcranial magnetic stimulation to demonstrate the representation of touch discrimination and intensity in S1, but the representation of pleasantness in the anterior cingulate cortex, not S1. Our findings support divergent neural processing of touch intensity and pleasantness, with affective touch encoded outside of S1. Our study contributes to growing delineation of the affective touch system, a crucial step in understanding its dysregulation in numerous clinical conditions such as autism, eating disorders, depression, and chronic pain. PMID:27225773

  10. Germline V-genes sculpt the binding site of a family of antibodies neutralizing human cytomegalovirus

    Energy Technology Data Exchange (ETDEWEB)

    Thomson, Christy A.; Bryson, Steve; McLean, Gary R.; Creagh, A. Louise; Pai, Emil F.; Schrader, John W. (Toronto); (UBC)

    2008-10-17

    Immunoglobulin genes are generated somatically through specialized mechanisms resulting in a vast repertoire of antigen-binding sites. Despite the stochastic nature of these processes, the V-genes that encode most of the antigen-combining site are under positive evolutionary selection, raising the possibility that V-genes have been selected to encode key structural features of binding sites of protective antibodies against certain pathogens. Human, neutralizing antibodies to human cytomegalovirus that bind the AD-2S1 epitope on its gB envelope protein repeatedly use a pair of well-conserved, germline V-genes IGHV3-30 and IGKV3-11. Here, we present crystallographic, kinetic and thermodynamic analyses of the binding site of such an antibody and that of its primary immunoglobulin ancestor. These show that these germline V-genes encode key side chain contacts with the viral antigen and thereby dictate key structural features of the hypermutated, high-affinity neutralizing antibody. V-genes may thus encode an innate, protective immunological memory that targets vulnerable, invariant sites on multiple pathogens.

  11. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  12. Mutations of the Corynebacterium glutamicum NCgl1221 Gene, Encoding a Mechanosensitive Channel Homolog, Induce l-Glutamic Acid Production▿

    Science.gov (United States)

    Nakamura, Jun; Hirano, Seiko; Ito, Hisao; Wachi, Masaaki

    2007-01-01

    Corynebacterium glutamicum is a biotin auxotroph that secretes l-glutamic acid in response to biotin limitation; this process is employed in industrial l-glutamic acid production. Fatty acid ester surfactants and penicillin also induce l-glutamic acid secretion, even in the presence of biotin. However, the mechanism of l-glutamic acid secretion remains unclear. It was recently reported that disruption of odhA, encoding a subunit of the 2-oxoglutarate dehydrogenase complex, resulted in l-glutamic acid secretion without induction. In this study, we analyzed odhA disruptants and found that those which exhibited constitutive l-glutamic acid secretion carried additional mutations in the NCgl1221 gene, which encodes a mechanosensitive channel homolog. These NCgl1221 gene mutations lead to constitutive l-glutamic acid secretion even in the absence of odhA disruption and also render cells resistant to an l-glutamic acid analog, 4-fluoroglutamic acid. Disruption of the NCgl1221 gene essentially abolishes l-glutamic acid secretion, causing an increase in the intracellular l-glutamic acid pool under biotin-limiting conditions, while amplification of the wild-type NCgl1221 gene increased l-glutamate secretion, although only in response to induction. These results suggest that the NCgl1221 gene encodes an l-glutamic acid exporter. We propose that treatments that induce l-glutamic acid secretion alter membrane tension and trigger a structural transformation of the NCgl1221 protein, enabling it to export l-glutamic acid. PMID:17513583

  13. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  14. The p10 gene of Bombyx mori nucleopolyhedrosis virus encodes a ...

    Indian Academy of Sciences (India)

    In baculovirus-based high-level expression of cloned foreign genes, the viral very late gene promoters of polyhedrin (polh) and p10 are extensively exploited. Here we report the cloning and characterization of the p10 gene from a local isolate of Bombyx mori nucleopolyhedrosis virus (BmNPV). The gene harbours a 213-bp ...

  15. A synergy-based hand control is encoded in human motor cortical areas

    Science.gov (United States)

    Leo, Andrea; Handjaras, Giacomo; Bianchi, Matteo; Marino, Hamal; Gabiccini, Marco; Guidi, Andrea; Scilingo, Enzo Pasquale; Pietrini, Pietro; Bicchi, Antonio; Santello, Marco; Ricciardi, Emiliano

    2016-01-01

    How the human brain controls hand movements to carry out different tasks is still debated. The concept of synergy has been proposed to indicate functional modules that may simplify the control of hand postures by simultaneously recruiting sets of muscles and joints. However, whether and to what extent synergic hand postures are encoded as such at a cortical level remains unknown. Here, we combined kinematic, electromyography, and brain activity measures obtained by functional magnetic resonance imaging while subjects performed a variety of movements towards virtual objects. Hand postural information, encoded through kinematic synergies, were represented in cortical areas devoted to hand motor control and successfully discriminated individual grasping movements, significantly outperforming alternative somatotopic or muscle-based models. Importantly, hand postural synergies were predicted by neural activation patterns within primary motor cortex. These findings support a novel cortical organization for hand movement control and open potential applications for brain-computer interfaces and neuroprostheses. DOI: http://dx.doi.org/10.7554/eLife.13420.001 PMID:26880543

  16. Four phosphoproteins with common amino termini are encoded by human cytomegalovirus AD169

    International Nuclear Information System (INIS)

    Wright, D.A.; Staprans, S.I.; Spector, D.H.

    1988-01-01

    In this report, the authors identify the proteins encoded by the 2.2-kilobase class of early transcripts arising from a region of the strain AD169 human cytomegalovirus genome (map units 0.682 to 0.713) which contains cell-related sequences. These transcripts, encoded by adjacent EcoRI fragments R and d, have a complex spliced structure with 5' and 3' coterminal ends. Antiserum directed against a synthetic 11-amino-acid peptide corresponding to the predicted amino terminus of the proteins was generated and found to immunoprecipitate four-infected-cell proteins of 84, 50, 43, and 34 kilodaltons. These proteins were phosphorylated and were associated predominantly with the nuclei of infected cells. The 43-kilodalton protein was the most abundant of the four proteins, and its level of expression remained relatively constant throughout the infection. Expression of the other proteins increased as the infection progressed. Pulse-chase analysis failed to show a precursor-product relationship between any of the proteins. A comparison of the [ 35 S]methionine-labeled tryptic peptide maps of the four proteins from infected cells and an in vitro-generated polypeptide derived from the putative first exon showed that all four infected-cell proteins were of viral origin and contained a common amino-terminal region

  17. Cloning and characterization of human liver cDNA encoding a protein S precursor

    International Nuclear Information System (INIS)

    Hoskins, J.; Norman, D.K.; Beckmann, R.J.; Long, G.L.

    1987-01-01

    Human liver cDNA encoding a protein S precursor was isolated from two cDNA libraries by two different techniques. Based upon the frequency of positive clones, the abundance of mRNA for protein S is ≅ 0.01%. Blot hybridization of electrophoretically fractionated poly(A) + RNA revealed a major mRNA ≅ 4 kilobases long and two minor forms of ≅ 3.1 and ≅ 2.6 kilobases. One of the cDNA clones contains a segment encoding a 676 amino acid protein S precursor, as well as 108 and 1132 nucleotides of 5' and 3' noncoding sequence, respectively, plus a poly(A) region at the 3' end. The cDNAs are adenosine plus thymidine-rich (60%) except for the 5' noncoding region, where 78% of the nucleotides are guanosine or cytosine. The protein precursor consists of a 41 amino acid leader peptide followed by 635 amino acids corresponding to mature protein S. Comparison of the mature protein region with homologous vitamin K-dependent plasma proteins shows that it is composed of the following domains: an amino-terminal γ-carboxyglutamic acid-rich region of 37 amino acids; a 36 amino acid linker region rich in hydroxy amino acids; four epidermal growth factor-like segments, each ≅ 45 amino acids long; and a 387 amino acid carboxyl-terminal domain of unrecognized structure and unknown function

  18. Segregated encoding of reward-identity and stimulus-reward associations in human orbitofrontal cortex.

    Science.gov (United States)

    Klein-Flügge, Miriam Cornelia; Barron, Helen Catharine; Brodersen, Kay Henning; Dolan, Raymond J; Behrens, Timothy Edward John

    2013-02-13

    A dominant focus in studies of learning and decision-making is the neural coding of scalar reward value. This emphasis ignores the fact that choices are strongly shaped by a rich representation of potential rewards. Here, using fMRI adaptation, we demonstrate that responses in the human orbitofrontal cortex (OFC) encode a representation of the specific type of food reward predicted by a visual cue. By controlling for value across rewards and by linking each reward with two distinct stimuli, we could test for representations of reward-identity that were independent of associative information. Our results show reward-identity representations in a medial-caudal region of OFC, independent of the associated predictive stimulus. This contrasts with a more rostro-lateral OFC region encoding reward-identity representations tied to the predicate stimulus. This demonstration of adaptation in OFC to reward specific representations opens an avenue for investigation of more complex decision mechanisms that are not immediately accessible in standard analyses, which focus on correlates of average activity.

  19. The genes pme-1 and pme-2 encode two poly(ADP-ribose) polymerases in Caenorhabditis elegans.

    Science.gov (United States)

    Gagnon, Steve N; Hengartner, Michael O; Desnoyers, Serge

    2002-11-15

    Poly(ADP-ribose) polymerases (PARPs) are an expanding, well-conserved family of enzymes found in many metazoan species, including plants. The enzyme catalyses poly(ADP-ribosyl)ation, a post-translational modification that is important in DNA repair and programmed cell death. In the present study, we report the finding of an endogenous source of poly(ADP-ribosyl)ation in total extracts of the nematode Caenorhabditis elegans. Two cDNAs encoding highly similar proteins to human PARP-1 (huPARP-1) and huPARP-2 are described, and we propose to name the corresponding enzymes poly(ADP-ribose) metabolism enzyme 1 (PME-1) and PME-2 respectively. PME-1 (108 kDa) shares 31% identity with huPARP-1 and has an overall structure similar to other PARP-1 subfamily members. It contains sequences having considerable similarity to zinc-finger motifs I and II, as well as with the catalytic domain of huPARP-1. PME-2 (61 kDa) has structural similarities with the catalytic domain of PARPs in general and shares 24% identity with huPARP-2. Recombinant PME-1 and PME-2 display PARP activity, which may partially account for the similar activity found in the worm. A partial duplication of the pme-1 gene with pseudogene-like features was found in the nematode genome. Messenger RNA for pme-1 are 5'-tagged with splice leader 1, whereas those for pme - 2 are tagged with splice leader 2, suggesting an operon-like expression for pme - 2. The expression pattern of pme-1 and pme-2 is also developmentally regulated. Together, these results show that PARP-1 and -2 are conserved in evolution and must have important functions in multicellular organisms. We propose using C. elegans as a model to understand better the functions of these enzymes.

  20. The Drosophila gene brainiac encodes a glycosyltransferase putatively involved in glycosphingolipid synthesis

    DEFF Research Database (Denmark)

    Schwientek, Tilo; Keck, Birgit; Levery, Steven B

    2002-01-01

    of brainiac is less well understood. brainiac is a member of a large homologous mammalian beta3-glycosyltransferase family with diverse functions. Eleven distinct mammalian homologs have been demonstrated to encode functional enzymes forming beta1-3 glycosidic linkages with different UDP donor sugars...... and acceptor sugars. The putative mammalian homologs with highest sequence similarity to brainiac encode UDP-N-acetylglucosamine:beta1,3-N-acetylglucosaminyltransferases (beta3GlcNAc-transferases), and in the present study we show that brainiac also encodes a beta3GlcNAc-transferase that uses beta......-linked mannose as well as beta-linked galactose as acceptor sugars. The inner disaccharide core structures of glycosphingolipids in mammals (Galbeta1-4Glcbeta1-Cer) and insects (Manbeta1-4Glcbeta1-Cer) are different. Both disaccharide glycolipids served as substrates for brainiac, but glycolipids of insect cells...