WorldWideScience

Sample records for genes encoding defense

  1. The defense-responsive genes showing enhanced and repressed expression after pathogen infection in rice (Oryza sativa L.)

    Institute of Scientific and Technical Information of China (English)

    ZHOU; Bin(周斌); PENG; Kaiman(彭开蔓); CHU; Zhaohui(储昭晖); WANG; Shiping(王石平); ZHANG; Qifa(张启发)

    2002-01-01

    Despite large numbers of studies about defense response, processes involved in the resistance of plants to incompatible pathogens are still largely uncharacterized. The objective of this study was to identify genes involved in defense response by cDNA array analysis and to gain knowledge about the functions of the genes involved in defense response. Approximately 20000 rice cDNA clones were arrayed on nylon filters. RNA samples isolated from different rice lines after infection with incompatible strains or isolates of Xanthomonas oryzae pv. oryzae or Pyricularia grisea, respectively, were used to synthesize cDNA as probes for screening the cDNA arrays. A total of 100 differentially expressed unique sequences were identified from 5 pathogen-host combinations. Fifty-three sequences were detected as showing enhanced expression and 47 sequences were detected as showing repressed expression after pathogen infection. Sequence analysis revealed that most of the 100 sequences had various degrees of homology with genes in databases which encode or putatively encode transcription regulating proteins, translation regulating proteins, transport proteins, kinases, metabolic enzymes, and proteins involved in other functions. Most of the genes have not been previously reported as being involved in the disease resistance response in rice. The results from cDNA arrays, reverse transcription-polymerase chain reaction, and RNA gel blot analysis suggest that activation or repression of most of these genes might occur commonly in the defense response.

  2. Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

    KAUST Repository

    Lee, H.

    2010-02-26

    Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

  3. Use of the Plant Defense Protein Osmotin To Identify Fusarium oxysporum Genes That Control Cell Wall Properties

    KAUST Repository

    Lee, H.; Damsz, B.; Woloshuk, C. P.; Bressan, R. A.; Narasimhan, Meena L.

    2010-01-01

    Fusarium oxysporum is the causative agent of fungal wilt disease in a variety of crops. The capacity of a fungal pathogen such as F. oxysporum f. sp. nicotianae to establish infection on its tobacco (Nicotiana tabacum) host depends in part on its capacity to evade the toxicity of tobacco defense proteins, such as osmotin. Fusarium genes that control resistance to osmotin would therefore reflect coevolutionary pressures and include genes that control mutual recognition, avoidance, and detoxification. We identified FOR (Fusarium Osmotin Resistance) genes on the basis of their ability to confer osmotin resistance to an osmotin-sensitive strain of Saccharomyces cerevisiae. FOR1 encodes a putative cell wall glycoprotein. FOR2 encodes the structural gene for glutamine:fructose-6-phosphate amidotransferase, the first and rate-limiting step in the biosynthesis of hexosamine and cell wall chitin. FOR3 encodes a homolog of SSD1, which controls cell wall composition, longevity, and virulence in S. cerevisiae. A for3 null mutation increased osmotin sensitivity of conidia and hyphae of F. oxysporum f. sp. nicotianae and also reduced cell wall β-1,3-glucan content. Together our findings show that conserved fungal genes that determine cell wall properties play a crucial role in regulating fungal susceptibility to the plant defense protein osmotin.

  4. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  5. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  6. Inducible defenses stay up late: temporal patterns of immune gene expression in Tenebrio molitor.

    Science.gov (United States)

    Johnston, Paul R; Makarova, Olga; Rolff, Jens

    2013-12-06

    The course of microbial infection in insects is shaped by a two-stage process of immune defense. Constitutive defenses, such as engulfment and melanization, act immediately and are followed by inducible defenses, archetypically the production of antimicrobial peptides, which eliminate or suppress the remaining microbes. By applying RNAseq across a 7-day time course, we sought to characterize the long-lasting immune response to bacterial challenge in the mealworm beetle Tenebrio molitor, a model for the biochemistry of insect immunity and persistent bacterial infection. By annotating a hybrid de novo assembly of RNAseq data, we were able to identify putative orthologs for the majority of components of the conserved insect immune system. Compared with Tribolium castaneum, the most closely related species with a reference genome sequence and a manually curated immune system annotation, the T. molitor immune gene count was lower, with lineage-specific expansions of genes encoding serine proteases and their countervailing inhibitors accounting for the majority of the deficit. Quantitative mapping of RNAseq reads to the reference assembly showed that expression of genes with predicted functions in cellular immunity, wound healing, melanization, and the production of reactive oxygen species was transiently induced immediately after immune challenge. In contrast, expression of genes encoding antimicrobial peptides or components of the Toll signaling pathway and iron sequestration response remained elevated for at least 7 days. Numerous genes involved in metabolism and nutrient storage were repressed, indicating a possible cost of immune induction. Strikingly, the expression of almost all antibacterial peptides followed the same pattern of long-lasting induction, regardless of their spectra of activity, signaling possible interactive roles in vivo. Copyright © 2014 Johnston et al.

  7. Defense islands in bacterial and archaeal genomes and prediction of novel defense systems.

    Science.gov (United States)

    Makarova, Kira S; Wolf, Yuri I; Snir, Sagi; Koonin, Eugene V

    2011-11-01

    The arms race between cellular life forms and viruses is a major driving force of evolution. A substantial fraction of bacterial and archaeal genomes is dedicated to antivirus defense. We analyzed the distribution of defense genes and typical mobilome components (such as viral and transposon genes) in bacterial and archaeal genomes and demonstrated statistically significant clustering of antivirus defense systems and mobile genes and elements in genomic islands. The defense islands are enriched in putative operons and contain numerous overrepresented gene families. A detailed sequence analysis of the proteins encoded by genes in these families shows that many of them are diverged variants of known defense system components, whereas others show features, such as characteristic operonic organization, that are suggestive of novel defense systems. Thus, genomic islands provide abundant material for the experimental study of bacterial and archaeal antivirus defense. Except for the CRISPR-Cas systems, different classes of defense systems, in particular toxin-antitoxin and restriction-modification systems, show nonrandom clustering in defense islands. It remains unclear to what extent these associations reflect functional cooperation between different defense systems and to what extent the islands are genomic "sinks" that accumulate diverse nonessential genes, particularly those acquired via horizontal gene transfer. The characteristics of defense islands resemble those of mobilome islands. Defense and mobilome genes are nonrandomly associated in islands, suggesting nonadaptive evolution of the islands via a preferential attachment-like mechanism underpinned by the addictive properties of defense systems such as toxins-antitoxins and an important role of horizontal mobility in the evolution of these islands.

  8. MicroRNA-Mediated Gene Silencing in Plant Defense and Viral Counter-Defense

    Directory of Open Access Journals (Sweden)

    Sheng-Rui Liu

    2017-09-01

    Full Text Available MicroRNAs (miRNAs are non-coding RNAs of approximately 20–24 nucleotides in length that serve as central regulators of eukaryotic gene expression by targeting mRNAs for cleavage or translational repression. In plants, miRNAs are associated with numerous regulatory pathways in growth and development processes, and defensive responses in plant–pathogen interactions. Recently, significant progress has been made in understanding miRNA-mediated gene silencing and how viruses counter this defense mechanism. Here, we summarize the current knowledge and recent advances in understanding the roles of miRNAs involved in the plant defense against viruses and viral counter-defense. We also document the application of miRNAs in plant antiviral defense. This review discusses the current understanding of the mechanisms of miRNA-mediated gene silencing and provides insights on the never-ending arms race between plants and viruses.

  9. Defense Islands in Bacterial and Archaeal Genomes and Prediction of Novel Defense Systems ▿†‡

    Science.gov (United States)

    Makarova, Kira S.; Wolf, Yuri I.; Snir, Sagi; Koonin, Eugene V.

    2011-01-01

    The arms race between cellular life forms and viruses is a major driving force of evolution. A substantial fraction of bacterial and archaeal genomes is dedicated to antivirus defense. We analyzed the distribution of defense genes and typical mobilome components (such as viral and transposon genes) in bacterial and archaeal genomes and demonstrated statistically significant clustering of antivirus defense systems and mobile genes and elements in genomic islands. The defense islands are enriched in putative operons and contain numerous overrepresented gene families. A detailed sequence analysis of the proteins encoded by genes in these families shows that many of them are diverged variants of known defense system components, whereas others show features, such as characteristic operonic organization, that are suggestive of novel defense systems. Thus, genomic islands provide abundant material for the experimental study of bacterial and archaeal antivirus defense. Except for the CRISPR-Cas systems, different classes of defense systems, in particular toxin-antitoxin and restriction-modification systems, show nonrandom clustering in defense islands. It remains unclear to what extent these associations reflect functional cooperation between different defense systems and to what extent the islands are genomic “sinks” that accumulate diverse nonessential genes, particularly those acquired via horizontal gene transfer. The characteristics of defense islands resemble those of mobilome islands. Defense and mobilome genes are nonrandomly associated in islands, suggesting nonadaptive evolution of the islands via a preferential attachment-like mechanism underpinned by the addictive properties of defense systems such as toxins-antitoxins and an important role of horizontal mobility in the evolution of these islands. PMID:21908672

  10. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  11. Defense gene expression in root galls induced by Nacobbus aberrans in CM334 chilli plants

    Directory of Open Access Journals (Sweden)

    Villar-Luna E.

    2015-02-01

    Full Text Available Capsicum annuum L. CM334 is susceptible to Nacobbus aberrans but highly resistant to Phy-tophthora capsici. Resistance to P. capsici is associated with the over-expression of various defense genes such as those encoding pathogenesis-related proteins. The transcriptional alterations of defense-related genes were determined in galls induced by N. aberrans (Na in CM334 chili roots. Transcripts accumulation of WRKY-a, WRKY1, POX (peroxidase, PR-1 (pathogenesis-related protein 1, and EAS (5-epiaristolochene synthase was estimated by qRT-PCR, and they were compared with those recorded in the incompatible CM334- P. capsici (Pc interaction. The levels of all studied genes were significantly (P s 0.05 lower (WRKY1, POX and PR-1 or down-regulated (WRKY-a and EAS in the presence of N. aberrans; in contrast, in the incompatible interaction, all genes were significantly up-regulated. The alterations induced by N. aberrans could be necessary to ensure the successful completion of its life cycle in CM334 chili roots.

  12. Overexpression of stress-related genes in Cuscuta campestris in response to host defense reactions

    Directory of Open Access Journals (Sweden)

    Hamed Rezaei

    2017-07-01

    Full Text Available Herb dodder ( Cuscuta spp. is one of the most important parasitic plants that can severely affect crop yields in the world. So far, interactions of this parasitic plant with hosts were not investigated adequately. Here, we conducted a differential expression analyzes and identified a number of genes that were differentially expressed in haustorium tissue compared with the stem of Cuscuta campestris growing on Alfalfa. We obtained 439 cDNA fragments from haustoria (parasite-host connection zone and stems (25 cm away from connections zones using the cDNA-AFLP (Amplified Fragment Length Polymorphism method with eight different primer combinations. Of 439 transcript-derived fragments (TDFs that were detected, 145 fragments were identified as differentially expressed genes. Five TDF sequences were similar to known functional genes involved in signal transduction, metabolism, respiration, and stress responses. Genes encoding DEAD-box ATP-dependent RNA helicase, potential heme-binding protein, lysine-specific demethylase 5A were selected for qRT-PCR. The qRT-PCR analyzes confirmed the results obtained using cDNA-AFLP. Our findings shed light on the elicitation of dodder defense responses in the connection zone to overcome plant defense reactions.

  13. Antioxidant defense gene analysis in Brassica oleracea and Trifolium repens exposed to Cd and/or Pb.

    Science.gov (United States)

    Bernard, F; Dumez, S; Brulle, F; Lemière, S; Platel, A; Nesslany, F; Cuny, D; Deram, A; Vandenbulcke, F

    2016-02-01

    This study focused on the expression analysis of antioxidant defense genes in Brassica oleracea and in Trifolium repens. Plants were exposed for 3, 10, and 56 days in microcosms to a field-collected suburban soil spiked by low concentrations of cadmium and/or lead. In both species, metal accumulations and expression levels of genes encoding proteins involved and/or related to antioxidant defense systems (glutathione transferases, peroxidases, catalases, metallothioneins) were quantified in leaves in order to better understand the detoxification processes involved following exposure to metals. It appeared that strongest gene expression variations in T. repens were observed when plants are exposed to Cd (metallothionein and ascorbate peroxidase upregulations) whereas strongest variations in B. oleracea were observed in case of Cd/Pb co-exposures (metallothionein, glutathione transferase, and peroxidase upregulations). Results also suggest that there is a benefit to use complementary species in order to better apprehend the biological effects in ecotoxicology.

  14. DMBT1 encodes a protein involved in the immune defense and in epithelial differentiation and is highly unstable in cancer

    DEFF Research Database (Denmark)

    Mollenhauer, J; Herbertz, S; Holmskov, U

    2000-01-01

    in the respiratory immune defense. Immunohistochemical analyses revealed that DMBT1 is produced by both tumor-associated macrophages and tumor cells and that it is deregulated in glioblastoma multiforme in comparison to normal brain tissue. Our data further suggest that the proteins CRP-ductin and hensin, both...... of which have been implicated in epithelial differentiation, are the DMBT1 orthologs in mice and rabbits, respectively. These findings and the spatial and temporal distribution of DMBT1 in fetal and adult epithelia suggest that DMBT1 further plays a role in epithelial development. Rearrangements of DMBT1......, DMBT1 is a gene that is highly unstable in cancer and encodes for a protein with at least two different functions, one in the immune defense and a second one in epithelial differentiation....

  15. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  16. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  17. Light-dependent expression of flg22-induced defense genes in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Satoshi eSano

    2014-10-01

    Full Text Available Chloroplasts have been reported to generate retrograde immune signals that activate defense gene expression in the nucleus. However, the roles of light and photosynthesis in plant immunity remain largely elusive. In this study, we evaluated the effects of light on the expression of defense genes induced by flg22, a peptide derived from bacterial flagellins which acts as a potent elicitor in plants. Whole-transcriptome analysis of flg22-treated Arabidopsis thaliana seedlings under light and dark conditions for 30 min revealed that a number of (30% genes strongly induced by flg22 (>4.0 require light for their rapid expression, whereas flg22-repressed genes include a significant number of genes that are down-regulated by light. Furthermore, light is responsible for the flg22-induced accumulation of salicylic acid, indicating that light is indispensable for basal defense responses in plants. To elucidate the role of photosynthesis in defense, we further examined flg22-induced defense gene expression in the presence of specific inhibitors of photosynthetic electron transport: 3-(3,4-dichlorophenyl-1,1-dimethylurea (DCMU and 2,5-dibromo-3-methyl-6-isopropyl-benzoquinone (DBMIB. Light-dependent expression of defense genes was largely suppressed by DBMIB, but only partially suppressed by DCMU. These findings suggest that photosynthetic electron flow plays a role in controling the light-dependent expression of flg22-inducible defense genes.

  18. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  19. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  20. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  1. Coronavirus gene 7 counteracts host defenses and modulates virus virulence.

    Directory of Open Access Journals (Sweden)

    Jazmina L G Cruz

    2011-06-01

    Full Text Available Transmissible gastroenteritis virus (TGEV genome contains three accessory genes: 3a, 3b and 7. Gene 7 is only present in members of coronavirus genus a1, and encodes a hydrophobic protein of 78 aa. To study gene 7 function, a recombinant TGEV virus lacking gene 7 was engineered (rTGEV-Δ7. Both the mutant and the parental (rTGEV-wt viruses showed the same growth and viral RNA accumulation kinetics in tissue cultures. Nevertheless, cells infected with rTGEV-Δ7 virus showed an increased cytopathic effect caused by an enhanced apoptosis mediated by caspase activation. Macromolecular synthesis analysis showed that rTGEV-Δ7 virus infection led to host translational shut-off and increased cellular RNA degradation compared with rTGEV-wt infection. An increase of eukaryotic translation initiation factor 2 (eIF2α phosphorylation and an enhanced nuclease, most likely RNase L, activity were observed in rTGEV-Δ7 virus infected cells. These results suggested that the removal of gene 7 promoted an intensified dsRNA-activated host antiviral response. In protein 7 a conserved sequence motif that potentially mediates binding to protein phosphatase 1 catalytic subunit (PP1c, a key regulator of the cell antiviral defenses, was identified. We postulated that TGEV protein 7 may counteract host antiviral response by its association with PP1c. In fact, pull-down assays demonstrated the interaction between TGEV protein 7, but not a protein 7 mutant lacking PP1c binding motif, with PP1. Moreover, the interaction between protein 7 and PP1 was required, during the infection, for eIF2α dephosphorylation and inhibition of cell RNA degradation. Inoculation of newborn piglets with rTGEV-Δ7 and rTGEV-wt viruses showed that rTGEV-Δ7 virus presented accelerated growth kinetics and pathology compared with the parental virus. Overall, the results indicated that gene 7 counteracted host cell defenses, and modified TGEV persistence increasing TGEV survival. Therefore, the

  2. Misexpression of AtTX12 encoding a Toll/interleukin-1 receptor domain induces growth defects and expression of defense-related genes partially independently of EDS1 in Arabidopsis.

    Science.gov (United States)

    Song, Sang-Kee

    2016-12-01

    In this study, a tissue-specific GAL4/UAS activation tagging system was used for the characterization of genes which could induce lethality when ubiquitously expressed. A dominant mutant exhibiting stunted growth was isolated and named defective root development 1-D (drd1-D). The T-DNA tag was located within the promoter region of AtTX12, which is predicted to encode a truncated nucleotide-binding leucinerich repeat (NLR) protein, containing a Toll/interleukin-1 receptor (TIR) domain. The transcript levels of AtTX12 and defense-related genes were elevated in drd1-D, and the misexpression of AtTX12 recapitulated the drd1-D phenotypes. In the presence of ENHANCED DISEASE SUSCEPTIBILITY 1 (EDS1), a key transducer of signals triggered by TIR-type NLRs, a low-level of AtTX12 misexpression induced strong defective phenotypes including seedling lethality whereas, in the absence of EDS1, a high-level of AtTX12 misexpression induced weak growth defects like dwarfism, suggesting that AtTX12 might function mainly in an EDS1-dependent and partially in an EDS1-independent manner. [BMB Reports 2016; 49(12): 693-698].

  3. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  4. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  5. A young root-specific gene (ArMY2) from horseradish encoding a MYR II myrosinase with kinetic preference for the root-specific glucosinolate gluconasturtiin.

    Science.gov (United States)

    Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang

    2014-03-01

    The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.

  6. Roles of small RNAs in soybean defense against Phytophthora sojae infection.

    Science.gov (United States)

    Wong, James; Gao, Lei; Yang, Yang; Zhai, Jixian; Arikit, Siwaret; Yu, Yu; Duan, Shuyi; Chan, Vicky; Xiong, Qin; Yan, Jun; Li, Shengben; Liu, Renyi; Wang, Yuanchao; Tang, Guiliang; Meyers, Blake C; Chen, Xuemei; Ma, Wenbo

    2014-09-01

    The genus Phytophthora consists of many notorious pathogens of crops and forestry trees. At present, battling Phytophthora diseases is challenging due to a lack of understanding of their pathogenesis. We investigated the role of small RNAs in regulating soybean defense in response to infection by Phytophthora sojae, the second most destructive pathogen of soybean. Small RNAs, including microRNAs (miRNAs) and small interfering RNAs (siRNAs), are universal regulators that repress target gene expression in eukaryotes. We identified known and novel small RNAs that differentially accumulated during P. sojae infection in soybean roots. Among them, miR393 and miR166 were induced by heat-inactivated P. sojae hyphae, indicating that they may be involved in soybean basal defense. Indeed, knocking down the level of mature miR393 led to enhanced susceptibility of soybean to P. sojae; furthermore, the expression of isoflavonoid biosynthetic genes was drastically reduced in miR393 knockdown roots. These data suggest that miR393 promotes soybean defense against P. sojae. In addition to miRNAs, P. sojae infection also resulted in increased accumulation of phased siRNAs (phasiRNAs) that are predominantly generated from canonical resistance genes encoding nucleotide binding-leucine rich repeat proteins and genes encoding pentatricopeptide repeat-containing proteins. This work identifies specific miRNAs and phasiRNAs that regulate defense-associated genes in soybean during Phytophthora infection. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  7. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  8. Overexpression of NtPR-Q Up-Regulates Multiple Defense-Related Genes in Nicotiana tabacum and Enhances Plant Resistance to Ralstonia solanacearum

    Directory of Open Access Journals (Sweden)

    Yuanman Tang

    2017-11-01

    Full Text Available Various classes of plant pathogenesis-related proteins have been identified in the past several decades. PR-Q, a member of the PR3 family encoding chitinases, has played an important role in regulating plant resistance and preventing pathogen infection. In this paper, we functionally characterized NtPR-Q in tobacco plants and found that the overexpression of NtPR-Q in tobacco Yunyan87 resulted in higher resistance to Ralstonia solanacearum inoculation. Surprisingly, overexpression of NtPR-Q led to the activation of many defense-related genes, such as salicylic acid (SA-responsive genes NtPR1a/c, NtPR2 and NtCHN50, JA-responsive gene NtPR1b and ET production-associated genes NtACC Oxidase and NtEFE26. Consistent with the role of NtPR-Q in multiple stress responses, NtPR-Q transcripts were induced by the exogenous hormones SA, ethylene and methyl jasmonate, which could enhance the resistance of tobacco to R. solanacearum. Collectively, our results suggested that NtPR-Q overexpression led to the up-regulation of defense-related genes and enhanced plant resistance to R. solanacearum infection.

  9. RNA-Seq analysis of Citrus reticulata in the early stages of Xylella fastidiosa infection reveals auxin-related genes as a defense response.

    Science.gov (United States)

    Rodrigues, Carolina M; de Souza, Alessandra A; Takita, Marco A; Kishi, Luciano T; Machado, Marcos A

    2013-10-03

    Citrus variegated chlorosis (CVC), caused by Xylella fastidiosa, is one the most important citrus diseases, and affects all varieties of sweet orange (Citrus sinensis L. Osb). On the other hand, among the Citrus genus there are different sources of resistance against X. fastidiosa. For these species identifying these defense genes could be an important step towards obtaining sweet orange resistant varieties through breeding or genetic engineering. To assess these genes we made use of mandarin (C. reticulata Blanco) that is known to be resistant to CVC and shares agronomical characteristics with sweet orange. Thus, we investigated the gene expression in Ponkan mandarin at one day after infection with X. fastidiosa, using RNA-seq. A set of genes considered key elements in the resistance was used to confirm its regulation in mandarin compared with the susceptible sweet orange. Gene expression analysis of mock inoculated and infected tissues of Ponkan mandarin identified 667 transcripts repressed and 724 significantly induced in the later. Among the induced transcripts, we identified genes encoding proteins similar to Pattern Recognition Receptors. Furthermore, many genes involved in secondary metabolism, biosynthesis and cell wall modification were upregulated as well as in synthesis of abscisic acid, jasmonic acid and auxin. This work demonstrated that the defense response to the perception of bacteria involves cell wall modification and activation of hormone pathways, which probably lead to the induction of other defense-related genes. We also hypothesized the induction of auxin-related genes indicates that resistant plants initially recognize X. fastidiosa as a necrotrophic pathogen.

  10. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  11. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  12. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  13. [Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

    Science.gov (United States)

    Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

    2014-01-01

    In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

  14. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  15. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  16. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  17. Jasmonate is essential for insect defense in Arabidopsis.

    Science.gov (United States)

    McConn, M; Creelman, R A; Bell, E; Mullet, J E; Browse, J

    1997-05-13

    The signaling pathways that allow plants to mount defenses against chewing insects are known to be complex. To investigate the role of jasmonate in wound signaling in Arabidopsis and to test whether parallel or redundant pathways exist for insect defense, we have studied a mutant (fad3-2 fad7-2 fad8) that is deficient in the jasmonate precursor linolenic acid. Mutant plants contained negligible levels of jasmonate and showed extremely high mortality ( approximately 80%) from attack by larvae of a common saprophagous fungal gnat, Bradysia impatiens (Diptera: Sciaridae), even though neighboring wild-type plants were largely unaffected. Application of exogenous methyl jasmonate substantially protected the mutant plants and reduced mortality to approximately 12%. These experiments precisely define the role of jasmonate as being essential for the induction of biologically effective defense in this plant-insect interaction. The transcripts of three wound-responsive genes were shown not to be induced by wounding of mutant plants but the same transcripts could be induced by application of methyl jasmonate. By contrast, measurements of transcript levels for a gene encoding glutathione S-transferase demonstrated that wound induction of this gene is independent of jasmonate synthesis. These results indicate that the mutant will be a good genetic model for testing the practical effectiveness of candidate defense genes.

  18. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  19. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  20. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  1. Elongator Plays a Positive Role in Exogenous NAD-Induced Defense Responses in Arabidopsis.

    Science.gov (United States)

    An, Chuanfu; Ding, Yezhang; Zhang, Xudong; Wang, Chenggang; Mou, Zhonglin

    2016-05-01

    Extracellular NAD is emerging as an important signal molecule in animal cells, but its role in plants has not been well-established. Although it has been shown that exogenous NAD(+) activates defense responses in Arabidopsis, components in the exogenous NAD(+)-activated defense pathway remain to be fully discovered. In a genetic screen for mutants insensitive to exogenous NAD(+) (ien), we isolated a mutant named ien2. Map-based cloning revealed that IEN2 encodes ELONGATA3 (ELO3)/AtELP3, a subunit of the Arabidopsis Elongator complex, which functions in multiple biological processes, including histone modification, DNA (de)methylation, and transfer RNA modification. Mutations in the ELO3/AtELP3 gene compromise exogenous NAD(+)-induced expression of pathogenesis-related (PR) genes and resistance to the bacterial pathogen Pseudomonas syringae pv. maculicola ES4326, and transgenic expression of the coding region of ELO3/AtELP3 in elo3/Atelp3 restores NAD(+) responsiveness to the mutant plants, demonstrating that ELO3/AtELP3 is required for exogenous NAD(+)-induced defense responses. Furthermore, mutations in genes encoding the other five Arabidopsis Elongator subunits (ELO2/AtELP1, AtELP2, ELO1/AtELP4, AtELP5, and AtELP6) also compromise exogenous NAD(+)-induced PR gene expression and resistance to P. syringae pv. maculicola ES4326. These results indicate that the Elongator complex functions as a whole in exogenous NAD(+)-activated defense signaling in Arabidopsis.

  2. Prolonged Adaptive Evolution of a Defensive Gene in the Solanaceae.

    Science.gov (United States)

    Rausher, Mark D; Huang, Jie

    2016-01-01

    Although plants and their natural enemies may coevolve for prolonged periods, little is known about how long individual plant defensive genes are involved in the coevolutionary process. We address this issue by examining patterns of selection on the defensive gene threonine deaminase (TD). Tomato (Solanum lycopersicum) has two copies of this gene. One performs the canonical housekeeping function in amino acid metabolism of catalyzing the first reaction in the conversion of threonine to isoleucine. The second copy functions as an antinutritive defense against lepidopteran herbivores by depleting threonine in the insect gut. Wild tobacco (Nicotiana attenuata) also contains a defensive copy. We show that a single copy of TD underwent two or three duplications near the base of the Solanaceae. One copy retains the housekeeping function, whereas a second copy evolved defensive functions. Positive selection occurred on the branch of the TD2 gene tree subtending the common ancestor of the Nicotianoideae and Solanoideae. It also occurred within the Solanoideae clade but not within the Nicotianoideae clade. Finally, it occurred on most branches leading from the common ancestor to S. lycopersicum. Based on recent calibrations of the Solanaceae phylogeny, TD2 experienced adaptive substitutions for a period of 30-50 My. We suggest that the most likely explanation for this result is fluctuating herbivore abundances: When herbivores are rare, relaxed selection increases the likelihood that slightly disadvantageous mutations will be fixed by drift; when herbivores are common, increased selection causes the evolution of compensatory adaptive mutations. Alternative explanations are also discussed. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  3. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  4. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  5. The novel and taxonomically restricted Ah24 gene from grain amaranth (Amaranthus hypochondriacus has a dual role in development and defense

    Directory of Open Access Journals (Sweden)

    Julio Armando Massange-Sanchez

    2015-08-01

    Full Text Available Grain amaranths tolerate stress and produce highly nutritious seeds. We have identified several (abiotic stress-responsive genes of unknown function in Amaranthus hypochondriacus, including the so-called Ah24 gene. Ah24 was expressed in young or developing tissues; it was also strongly induced by mechanical damage, insect herbivory and methyl jasmonate and in meristems and newly emerging leaves of severely defoliated plants. Interestingly, an in silico analysis of its 1304 bp promoter region showed a predominance of regulatory boxes involved in development, but not in defense. The Ah24 cDNA encodes a predicted cytosolic protein of 164 amino acids, the localization of which was confirmed by confocal microscopy. Additional in silico analysis identified several other Ah24 homologs, present almost exclusively in plants belonging to the Caryophyllales. The possible function of this gene in planta was examined in transgenic Ah24 overexpressing Arabidopsis thaliana and Nicotiana tabacum plants. Transformed Arabidopsis showed enhanced vegetative growth and increased leaf number with no penalty in one fitness component, such as seed yield, in experimental conditions. Transgenic tobacco plants, which grew and reproduced normally, had increased insect herbivory resistance. Modified vegetative growth in transgenic Arabidopsis coincided with significant changes in the expression of genes controlling phytohormone synthesis or signaling, whereas increased resistance to insect herbivory in transgenic tobacco coincided with higher jasmonic acid and proteinase inhibitor activity levels, plus the accumulation of nicotine and several other putative defense-related metabolites. It is proposed that the primary role of the Ah24 gene in A. hypochondriacus is to contribute to a rapid recovery post-wounding or defoliation, although its participation in defense against insect herbivory is also plausible.

  6. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  7. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  8. The arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes

    KAUST Repository

    Meier, Stuart; Ruzvidzo, Oziniel; Morse, Monique; Donaldson, Lara; Kwezi, Lusisizwe; Gehring, Christoph A

    2010-01-01

    Background: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3?,5?-cyclic monophosphate (cGMP), has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC) enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. Principal Findings: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10) as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently coexpressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. Conclusions: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP. © 2010 Meier et al.

  9. The arabidopsis wall associated kinase-like 10 gene encodes a functional guanylyl cyclase and is co-expressed with pathogen defense related genes

    KAUST Repository

    Meier, Stuart

    2010-01-26

    Background: Second messengers have a key role in linking environmental stimuli to physiological responses. One such messenger, guanosine 3?,5?-cyclic monophosphate (cGMP), has long been known to be an essential signaling molecule in many different physiological processes in higher plants, including biotic stress responses. To date, however, the guanylyl cyclase (GC) enzymes that catalyze the formation of cGMP from GTP have largely remained elusive in higher plants. Principal Findings: We have identified an Arabidopsis receptor type wall associated kinase-like molecule (AtWAKL10) as a candidate GC and provide experimental evidence to show that the intracellular domain of AtWAKL10431-700 can generate cGMP in vitro. Further, we also demonstrate that the molecule has kinase activity indicating that AtWAKL10 is a twin-domain catalytic protein. A co-expression and stimulus-specific expression analysis revealed that AtWAKL10 is consistently coexpressed with well characterized pathogen defense related genes and along with these genes is induced early and sharply in response to a range of pathogens and their elicitors. Conclusions: We demonstrate that AtWAKL10 is a twin-domain, kinase-GC signaling molecule that may function in biotic stress responses that are critically dependent on the second messenger cGMP. © 2010 Meier et al.

  10. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  11. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  12. A PR-4 gene identified from Malus domestica is involved in the defense responses against Botryosphaeria dothidea.

    Science.gov (United States)

    Bai, Suhua; Dong, Chaohua; Li, Baohua; Dai, Hongyi

    2013-01-01

    Pathogenesis-related protein-4 (PR-4) family is a group of proteins with a Barwin domain in C-terminus and generally thought to be involved in plant defense responses. However, their detailed roles are poorly understood in defense of apple plant against pathogenic infection. In the present study, a new PR-4 gene (designated as MdPR-4) was identified from Malus domestica, and its roles in defense responses of apple were investigated. The open reading frame of MdPR-4 gene is of 447 bp encoding a protein of 148 amino acids with a Barwin domain in C-terminus and a signal peptide of 26 amino acids in N-terminus. Sequence and structural analysis indicated that MdPR-4 protein belongs to class II of PR-4 family. The high-level expression of MdPR-4 was observed in flowers and leaves as revealed by quantitative real time PCR. The temporal expression analysis demonstrated that MdPR-4 expression could be up-regulated by Botryosphaeria dothidea infection and salicylic acid (SA) or methyl jasmonate (MeJA) treatment, but suppressed by diethyldithiocarbamic acid (DIECA). In vitro assays, recombinant MdPR-4 protein exhibited ribonuclease activity specific for single strand RNA and significant inhibition to hyphal growth of three apple pathogenic fungi B. dothidea, Valsa ceratosperma and Glomerella cingulata. Moreover, the inhibition was reduced by the presence of 5'-ADP. Taken all together, the results indicate that MdPR-4 protein is involved in the defense responses of apple against pathogenic attack by directly inhibiting hyphal growth, and the inhibition is correlated with its ribonuclease activity, where as MdPR-4 expression is regulated by both SA and JA signaling pathway. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  13. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  14. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  15. Exploring the Caste-Specific Multi-Layer Defense Mechanism of Formosan Subterranean Termites, Coptotermes formosanus Shiraki

    Directory of Open Access Journals (Sweden)

    Abid Hussain

    2017-12-01

    Full Text Available The survival and foraging of Coptotermes formosanus Shiraki in a microbe-rich environment reflect the adaptation of an extraordinary, sophisticated defense mechanism by the nest-mates. We aimed to explore the host pathogen interaction by studying caste-specific volatile chemistry and genes encoding the antioxidant defense of winged imagoes, nymphs, soldiers and workers of Formosan subterranean termites. Qualitative analyses of C. formosanus Shiraki performed by HS-SPME/GC-MS showed considerable variations in the chemical composition of volatile organic compounds (VOCs and their proportions among all the castes. Winged imagoes produced the most important compounds such as naphthalene and n-hexanoic acid. The antifungal activity of these compounds along with nonanal, n-pentadecane, n-tetradecane, n-heptadecane and methyl octanoate against the conidial suspensions of Metarhizium anisopliae and Beauveria bassiana isolates enable us to suggest that the failure of natural fungal infection in the nest is due to the antiseptic environment of the nest, which is mainly controlled by the VOCs of nest-mates. In addition, conidial germination of M. anisopliae and B. bassiana isolates evaluated on the cuticle of each caste showed significant variations among isolates and different castes. Our results showed that the conidia of M. anisopliae 02049 exhibited the highest germination on the cuticle of all the inoculated castes. Moreover, we recorded the lowest germination of the conidia of B. bassiana 200436. Caste-specific germination variations enabled us to report for the first time that the cuticle of winged imagoes was found to be the most resistant cuticle. The analysis of the transcriptome of C. formosanus Shiraki revealed the identification of 17 genes directly involved in antioxidant defense. Expression patterns of the identified antioxidant genes by quantitative real-time PCR (qPCR revealed the significantly highest upregulation of CAT, GST, PRXSL, Cu

  16. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  17. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  18. A Benzothiadiazole Primes Parsley Cells for Augmented Elicitation of Defense Responses

    Science.gov (United States)

    Katz, Vera A.; Thulke, Oliver U.; Conrath, Uwe

    1998-01-01

    Systemic acquired resistance is an important component of the disease-resistance arsenal of plants, and is associated with an enhanced potency for activating local defense responses upon pathogen attack. Here we demonstrate that pretreatment with benzothiadiazole (BTH), a synthetic activator of acquired resistance in plants, augmented the sensitivity for low-dose elicitation of coumarin phytoalexin secretion by cultured parsley (Petroselinum crispum L.) cells. Enhanced coumarin secretion was associated with potentiated activation of genes encoding Phe ammonia-lyase (PAL). The augmentation of PAL gene induction was proportional to the length of pretreatment with BTH, indicating time-dependent priming of the cells. In contrast to the PAL genes, those for anionic peroxidase were directly induced by BTH in the absence of elicitor, thus confirming a dual role for BTH in the activation of plant defenses. Strikingly, the ability of various chemicals to enhance plant disease resistance correlated with their capability to potentiate parsley PAL gene elicitation, emphasizing an important role for defense response potentiation in acquired plant disease resistance. PMID:9701589

  19. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  20. Massive activation of archaeal defense genes during viral infection.

    Science.gov (United States)

    Quax, Tessa E F; Voet, Marleen; Sismeiro, Odile; Dillies, Marie-Agnes; Jagla, Bernd; Coppée, Jean-Yves; Sezonov, Guennadi; Forterre, Patrick; van der Oost, John; Lavigne, Rob; Prangishvili, David

    2013-08-01

    Archaeal viruses display unusually high genetic and morphological diversity. Studies of these viruses proved to be instrumental for the expansion of knowledge on viral diversity and evolution. The Sulfolobus islandicus rod-shaped virus 2 (SIRV2) is a model to study virus-host interactions in Archaea. It is a lytic virus that exploits a unique egress mechanism based on the formation of remarkable pyramidal structures on the host cell envelope. Using whole-transcriptome sequencing, we present here a global map defining host and viral gene expression during the infection cycle of SIRV2 in its hyperthermophilic host S. islandicus LAL14/1. This information was used, in combination with a yeast two-hybrid analysis of SIRV2 protein interactions, to advance current understanding of viral gene functions. As a consequence of SIRV2 infection, transcription of more than one-third of S. islandicus genes was differentially regulated. While expression of genes involved in cell division decreased, those genes playing a role in antiviral defense were activated on a large scale. Expression of genes belonging to toxin-antitoxin and clustered regularly interspaced short palindromic repeat (CRISPR)-Cas systems was specifically pronounced. The observed different degree of activation of various CRISPR-Cas systems highlights the specialized functions they perform. The information on individual gene expression and activation of antiviral defense systems is expected to aid future studies aimed at detailed understanding of the functions and interplay of these systems in vivo.

  1. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  2. A rice gene of de novo origin negatively regulates pathogen-induced defense response.

    Directory of Open Access Journals (Sweden)

    Wenfei Xiao

    Full Text Available How defense genes originated with the evolution of their specific pathogen-responsive traits remains an important problem. It is generally known that a form of duplication can generate new genes, suggesting that a new gene usually evolves from an ancestral gene. However, we show that a new defense gene in plants may evolve by de novo origination, resulting in sophisticated disease-resistant functions in rice. Analyses of gene evolution showed that this new gene, OsDR10, had homologs only in the closest relative, Leersia genus, but not other subfamilies of the grass family; therefore, it is a rice tribe-specific gene that may have originated de novo in the tribe. We further show that this gene may evolve a highly conservative rice-specific function that contributes to the regulation difference between rice and other plant species in response to pathogen infections. Biologic analyses including gene silencing, pathologic analysis, and mutant characterization by transformation showed that the OsDR10-suppressed plants enhanced resistance to a broad spectrum of Xanthomonas oryzae pv. oryzae strains, which cause bacterial blight disease. This enhanced disease resistance was accompanied by increased accumulation of endogenous salicylic acid (SA and suppressed accumulation of endogenous jasmonic acid (JA as well as modified expression of a subset of defense-responsive genes functioning both upstream and downstream of SA and JA. These data and analyses provide fresh insights into the new biologic and evolutionary processes of a de novo gene recruited rapidly.

  3. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  4. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  5. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  6. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  7. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  8. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  9. Chromosome-level genome map provides insights into diverse defense mechanisms in the medicinal fungus Ganoderma sinense

    Science.gov (United States)

    Zhu, Yingjie; Xu, Jiang; Sun, Chao; Zhou, Shiguo; Xu, Haibin; Nelson, David R.; Qian, Jun; Song, Jingyuan; Luo, Hongmei; Xiang, Li; Li, Ying; Xu, Zhichao; Ji, Aijia; Wang, Lizhi; Lu, Shanfa; Hayward, Alice; Sun, Wei; Li, Xiwen; Schwartz, David C.; Wang, Yitao; Chen, Shilin

    2015-01-01

    Fungi have evolved powerful genomic and chemical defense systems to protect themselves against genetic destabilization and other organisms. However, the precise molecular basis involved in fungal defense remain largely unknown in Basidiomycetes. Here the complete genome sequence, as well as DNA methylation patterns and small RNA transcriptomes, was analyzed to provide a holistic overview of secondary metabolism and defense processes in the model medicinal fungus, Ganoderma sinense. We reported the 48.96 Mb genome sequence of G. sinense, consisting of 12 chromosomes and encoding 15,688 genes. More than thirty gene clusters involved in the biosynthesis of secondary metabolites, as well as a large array of genes responsible for their transport and regulation were highlighted. In addition, components of genome defense mechanisms, namely repeat-induced point mutation (RIP), DNA methylation and small RNA-mediated gene silencing, were revealed in G. sinense. Systematic bioinformatic investigation of the genome and methylome suggested that RIP and DNA methylation combinatorially maintain G. sinense genome stability by inactivating invasive genetic material and transposable elements. The elucidation of the G. sinense genome and epigenome provides an unparalleled opportunity to advance our understanding of secondary metabolism and fungal defense mechanisms. PMID:26046933

  10. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  11. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  12. An elm EST database for identifying leaf beetle egg-induced defense genes

    Directory of Open Access Journals (Sweden)

    Büchel Kerstin

    2012-06-01

    Full Text Available Abstract Background Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor, egg laying by the elm leaf beetle ( Xanthogaleruca luteola activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Results Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i untreated control elms, and elms treated with (ii egg laying and feeding by elm leaf beetles, (iii feeding, (iv artificial transfer of egg clutches, and (v methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs were identified which clustered into 52,823 unique transcripts (Unitrans and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction

  13. An elm EST database for identifying leaf beetle egg-induced defense genes.

    Science.gov (United States)

    Büchel, Kerstin; McDowell, Eric; Nelson, Will; Descour, Anne; Gershenzon, Jonathan; Hilker, Monika; Soderlund, Carol; Gang, David R; Fenning, Trevor; Meiners, Torsten

    2012-06-15

    Plants can defend themselves against herbivorous insects prior to the onset of larval feeding by responding to the eggs laid on their leaves. In the European field elm (Ulmus minor), egg laying by the elm leaf beetle ( Xanthogaleruca luteola) activates the emission of volatiles that attract specialised egg parasitoids, which in turn kill the eggs. Little is known about the transcriptional changes that insect eggs trigger in plants and how such indirect defense mechanisms are orchestrated in the context of other biological processes. Here we present the first large scale study of egg-induced changes in the transcriptional profile of a tree. Five cDNA libraries were generated from leaves of (i) untreated control elms, and elms treated with (ii) egg laying and feeding by elm leaf beetles, (iii) feeding, (iv) artificial transfer of egg clutches, and (v) methyl jasmonate. A total of 361,196 ESTs expressed sequence tags (ESTs) were identified which clustered into 52,823 unique transcripts (Unitrans) and were stored in a database with a public web interface. Among the analyzed Unitrans, 73% could be annotated by homology to known genes in the UniProt (Plant) database, particularly to those from Vitis, Ricinus, Populus and Arabidopsis. Comparative in silico analysis among the different treatments revealed differences in Gene Ontology term abundances. Defense- and stress-related gene transcripts were present in high abundance in leaves after herbivore egg laying, but transcripts involved in photosynthesis showed decreased abundance. Many pathogen-related genes and genes involved in phytohormone signaling were expressed, indicative of jasmonic acid biosynthesis and activation of jasmonic acid responsive genes. Cross-comparisons between different libraries based on expression profiles allowed the identification of genes with a potential relevance in egg-induced defenses, as well as other biological processes, including signal transduction, transport and primary metabolism

  14. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  15. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  16. Epigenetic silencing of host cell defense genes enhances intracellular survival of the rickettsial pathogen Anaplasma phagocytophilum.

    Directory of Open Access Journals (Sweden)

    Jose C Garcia-Garcia

    2009-06-01

    Full Text Available Intracellular bacteria have evolved mechanisms that promote survival within hostile host environments, often resulting in functional dysregulation and disease. Using the Anaplasma phagocytophilum-infected granulocyte model, we establish a link between host chromatin modifications, defense gene transcription and intracellular bacterial infection. Infection of THP-1 cells with A. phagocytophilum led to silencing of host defense gene expression. Histone deacetylase 1 (HDAC1 expression, activity and binding to the defense gene promoters significantly increased during infection, which resulted in decreased histone H3 acetylation in infected cells. HDAC1 overexpression enhanced infection, whereas pharmacologic and siRNA HDAC1 inhibition significantly decreased bacterial load. HDAC2 does not seem to be involved, since HDAC2 silencing by siRNA had no effect on A. phagocytophilum intracellular propagation. These data indicate that HDAC up-regulation and epigenetic silencing of host cell defense genes is required for A. phagocytophilum infection. Bacterial epigenetic regulation of host cell gene transcription could be a general mechanism that enhances intracellular pathogen survival while altering cell function and promoting disease.

  17. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  18. Mutations in fetal genes involved in innate immunity and host defense against microbes increase risk of preterm premature rupture of membranes (PPROM).

    Science.gov (United States)

    Modi, Bhavi P; Teves, Maria E; Pearson, Laurel N; Parikh, Hardik I; Haymond-Thornburg, Hannah; Tucker, John L; Chaemsaithong, Piya; Gomez-Lopez, Nardhy; York, Timothy P; Romero, Roberto; Strauss, Jerome F

    2017-11-01

    Twin studies have revealed a significant contribution of the fetal genome to risk of preterm birth. Preterm premature rupture of membranes (PPROM) is the leading identifiable cause of preterm delivery. Infection and inflammation of the fetal membranes is commonly found associated with PPROM. We carried out whole exome sequencing (WES) of genomic DNA from neonates born of African-American mothers whose pregnancies were complicated by PPROM (76) or were normal term pregnancies (N = 43) to identify mutations in 35 candidate genes involved in innate immunity and host defenses against microbes. Targeted genotyping of mutations in the candidates discovered by WES was conducted on an additional 188 PPROM cases and 175 controls. We identified rare heterozygous nonsense and frameshift mutations in several of the candidate genes, including CARD6, CARD8, DEFB1, FUT2, MBL2, NLP10, NLRP12, and NOD2. We discovered that some mutations (CARD6, DEFB1, FUT2, MBL2, NLRP10, NOD2) were present only in PPROM cases. We conclude that rare damaging mutations in innate immunity and host defense genes, the majority being heterozygous, are more frequent in neonates born of pregnancies complicated by PPROM. These findings suggest that the risk of preterm birth in African-Americans may be conferred by mutations in multiple genes encoding proteins involved in dampening the innate immune response or protecting the host against microbial infection and microbial products. © 2017 The Authors. Molecular Genetics & Genomic Medicine published by Wiley Periodicals, Inc.

  19. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  20. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  1. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  2. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  3. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  4. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  5. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  6. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  7. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  8. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  9. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  10. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  11. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  12. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  13. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  14. Arabidopsis flower specific defense gene expression patterns affect resistance to pathogens

    KAUST Repository

    Ederli, Luisa

    2015-02-20

    We investigated whether the Arabidopsis flower evolved protective measures to increase reproductive success. Firstly, analyses of available transcriptome data show that the most highly expressed transcripts in the closed sepal (stage 12) are enriched in genes with roles in responses to chemical stimuli and cellular metabolic processes. At stage 15, there is enrichment in transcripts with a role in responses to biotic stimuli. Comparative analyses between the sepal and petal in the open flower mark an over-representation of transcripts with a role in responses to stress and catalytic activity. Secondly, the content of the biotic defense-associated phytohormone salicylic acid (SA) in sepals and petals is significantly higher than in leaves. To understand whether the high levels of stress responsive transcripts and the higher SA content affect defense, wild-type plants (Col-0) and transgenic plants defective in SA accumulation (nahG) were challenged with the biotrophic fungus Golovinomyces cichoracearum, the causal agent of powdery mildew, and the necrotrophic fungus Botrytis cinerea. NahG leaves were more sensitive than those of Col-0, suggesting that in leaves SA has a role in the defense against biotrophs. In contrast, sepals and petals of both genotypes were resistant to G. cichoracearum, indicating that in the flower, resistance to the biotrophic pathogen is not critically dependent on SA, but likely dependent on the up-regulation of stress-responsive genes. Since sepals and petals of both genotypes are equally susceptible to B. cinerea, we conclude that neither stress-response genes nor increased SA accumulation offers protection against the necrotrophic pathogen. These results are interpreted in the light of the distinctive role of the flower and we propose that in the early stages, the sepal may act as a chemical defense barrier of the developing reproductive structures against biotrophic pathogens.

  15. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  16. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  17. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  18. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  19. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  20. MFS Transporters and GABA Metabolism Are Involved in the Self-Defense Against DON in Fusarium graminearum

    Directory of Open Access Journals (Sweden)

    Qinhu Wang

    2018-04-01

    Full Text Available Trichothecene mycotoxins, such as deoxynivalenol (DON produced by the fungal pathogen, Fusarium graminearum, are not only important for plant infection but are also harmful to human and animal health. Trichothecene targets the ribosomal protein Rpl3 that is conserved in eukaryotes. Hence, a self-defense mechanism must exist in DON-producing fungi. It is reported that TRI (trichothecene biosynthesis 101 and TRI12 are two genes responsible for self-defense against trichothecene toxins in Fusarium. In this study, however, we found that simultaneous disruption of TRI101 and TRI12 has no obvious influence on DON resistance upon exogenous DON treatment in F. graminearum, suggesting that other mechanisms may be involved in self-defense. By using RNA-seq, we identified 253 genes specifically induced in DON-treated cultures compared with samples from cultures treated or untreated with cycloheximide, a commonly used inhibitor of eukaryotic protein synthesis. We found that transporter genes are significantly enriched in this group of DON-induced genes. Of those genes, 15 encode major facilitator superfamily transporters likely involved in mycotoxin efflux. Significantly, we found that genes involved in the metabolism of gamma-aminobutyric acid (GABA, a known inducer of DON production in F. graminearum, are significantly enriched among the DON-induced genes. The GABA biosynthesis gene PROLINE UTILIZATION 2-2 (PUT2-2 is downregulated, while GABA degradation genes are upregulated at least twofold upon treatment with DON, resulting in decreased levels of GABA. Taken together, our results suggest that transporters influencing DON efflux are important for self-defense and that GABA mediates the balance of DON production and self-defense in F. graminearum.

  1. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  2. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  3. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  4. The wheat resistance gene Lr34 results in the constitutive induction of multiple defense pathways in transgenic barley.

    Science.gov (United States)

    Chauhan, Harsh; Boni, Rainer; Bucher, Rahel; Kuhn, Benjamin; Buchmann, Gabriele; Sucher, Justine; Selter, Liselotte L; Hensel, Goetz; Kumlehn, Jochen; Bigler, Laurent; Glauser, Gaëtan; Wicker, Thomas; Krattinger, Simon G; Keller, Beat

    2015-10-01

    The wheat gene Lr34 encodes an ABCG-type transporter which provides durable resistance against multiple pathogens. Lr34 is functional as a transgene in barley, but its mode of action has remained largely unknown both in wheat and barley. Here we studied gene expression in uninfected barley lines transgenic for Lr34. Genes from multiple defense pathways contributing to basal and inducible disease resistance were constitutively active in seedlings and mature leaves. In addition, the hormones jasmonic acid and salicylic acid were induced to high levels, and increased levels of lignin as well as hordatines were observed. These results demonstrate a strong, constitutive re-programming of metabolism by Lr34. The resistant Lr34 allele (Lr34res) encodes a protein that differs by two amino acid polymorphisms from the susceptible Lr34sus allele. The deletion of a single phenylalanine residue in Lr34sus was sufficient to induce the characteristic Lr34-based responses. Combination of Lr34res and Lr34sus in the same plant resulted in a reduction of Lr34res expression by 8- to 20-fold when the low-expressing Lr34res line BG8 was used as a parent. Crosses with the high-expressing Lr34res line BG9 resulted in an increase of Lr34sus expression by 13- to 16-fold in progenies that inherited both alleles. These results indicate an interaction of the two Lr34 alleles on the transcriptional level. Reduction of Lr34res expression in BG8 crosses reduced the negative pleiotropic effects of Lr34res on barley growth and vigor without compromising disease resistance, suggesting that transgenic combination of Lr34res and Lr34sus can result in agronomically useful resistance. © 2015 The Authors The Plant Journal © 2015 John Wiley & Sons Ltd.

  5. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  6. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  7. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  8. Physcomitrella patens Activates Defense Responses against the Pathogen Colletotrichum gloeosporioides

    Directory of Open Access Journals (Sweden)

    Guillermo Reboledo

    2015-09-01

    Full Text Available The moss Physcomitrella patens is a suitable model plant to analyze the activation of defense mechanisms after pathogen assault. In this study, we show that Colletotrichum gloeosporioides isolated from symptomatic citrus fruit infects P. patens and cause disease symptoms evidenced by browning and maceration of tissues. After C. gloeosporioides infection, P. patens reinforces the cell wall by the incorporation of phenolic compounds and induces the expression of a Dirigent-protein-like encoding gene that could lead to the formation of lignin-like polymers. C. gloeosporioides-inoculated protonemal cells show cytoplasmic collapse, browning of chloroplasts and modifications of the cell wall. Chloroplasts relocate in cells of infected tissues toward the initially infected C. gloeosporioides cells. P. patens also induces the expression of the defense genes PAL and CHS after fungal colonization. P. patens reporter lines harboring the auxin-inducible promoter from soybean (GmGH3 fused to β-glucuronidase revealed an auxin response in protonemal tissues, cauloids and leaves of C. gloeosporioides-infected moss tissues, indicating the activation of auxin signaling. Thus, P. patens is an interesting plant to gain insight into defense mechanisms that have evolved in primitive land plants to cope with microbial pathogens.

  9. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  10. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  11. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  12. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  13. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  14. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  15. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  16. Cyclic lipopeptides from Bacillus subtilis ABS-S14 elicit defense-related gene expression in citrus fruit

    Science.gov (United States)

    Effects of cyclic lipopeptides obtained from B. subtilis ABS-S14 on eliciting defense-related gene transcription and activity of defense-related enzymes glucanase (GLU), chitinase (CHI), peroxidase (POX) and lipoxygenase (LOX) in Citrus sinensis cv. Valencia fruit were determined. The maximum level ...

  17. Overexpression of the mulberry latex gene MaMLX-Q1 enhances defense against Plutella xylostella in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Liu Yan

    2017-01-01

    Full Text Available Purified mulberry latex chitinase (MLX has a role in defense against some lepidopteran insects. In this study, a full length chitinase gene, MaMLX-Q1, of 1405 bp with a 1140 bp open reading frame, was obtained from mulberry leaves by the degenerate primers and rapid amplification of cDNA ends polymerase chain reaction (RACE-PCR procedure. The gene encoded a mature protein with the predicted molecular mass of 39.38 kDa and an isoelectric point (pI of 6.43; it contained two chitin-binding domains and a hydrolase family 19 chitinase domain. Sequence alignment and phylogenetic analysis grouped it in the class I chitinase protein group. Heterogeneous expression of this MaMLX-Q1 in Arabidopsis showed non-visible alterations in growth phenotype, except for the higher transcriptional expression of MaMLX-Q1 when compared to that of wild-type Arabidopsis. This ectopic MaMLX-Q1 exhibited toxicity to the growth and development of Plutella xylostella larvae, causing significantly lower weight gain and higher mortality. These results indicate an application of MaMLX-Q1 as an insecticide for plant protection.

  18. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  19. Gene expression analysis of molecular mechanisms of defense induced in Medicago truncatula parasitized by Orobanche crenata.

    Science.gov (United States)

    Die, José Vicente; González Verdejo, Clara I; Dita, Miguel A; Nadal, Salvador; Román, Belén

    2009-07-01

    The infection of Medicago truncatula Gaertn. roots with the obligate parasite Orobanche crenata Forsk. is a useful model for studying the molecular events involved in the legumes-parasite interaction. In order to gain insight into the identification of gene-regulatory elements involved in the resistance mechanism, the temporal expression pattern of ten defense-related genes was carried out using real-time quantitative reverse-transcription polymerase chain reaction assays. The induction of all of the analyzed transcripts significantly increased over a range from 2- to 321-fold higher than the control depending on the gene and time point. The transcriptional changes observed in response to O. crenata infection suggest that resistance could rely on both, the induction of general defense-related genes and more specific responses.

  20. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  1. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  2. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  3. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  4. Discovery of defense- and neuropeptides in social ants by genome-mining.

    Directory of Open Access Journals (Sweden)

    Christian W Gruber

    Full Text Available Natural peptides of great number and diversity occur in all organisms, but analyzing their peptidome is often difficult. With natural product drug discovery in mind, we devised a genome-mining approach to identify defense- and neuropeptides in the genomes of social ants from Atta cephalotes (leaf-cutter ant, Camponotus floridanus (carpenter ant and Harpegnathos saltator (basal genus. Numerous peptide-encoding genes of defense peptides, in particular defensins, and neuropeptides or regulatory peptide hormones, such as allatostatins and tachykinins, were identified and analyzed. Most interestingly we annotated genes that encode oxytocin/vasopressin-related peptides (inotocins and their putative receptors. This is the first piece of evidence for the existence of this nonapeptide hormone system in ants (Formicidae and supports recent findings in Tribolium castaneum (red flour beetle and Nasonia vitripennis (parasitoid wasp, and therefore its confinement to some basal holometabolous insects. By contrast, the absence of the inotocin hormone system in Apis mellifera (honeybee, another closely-related member of the eusocial Hymenoptera clade, establishes the basis for future studies on the molecular evolution and physiological function of oxytocin/vasopressin-related peptides (vasotocin nonapeptide family and their receptors in social insects. Particularly the identification of ant inotocin and defensin peptide sequences will provide a basis for future pharmacological characterization in the quest for potent and selective lead compounds of therapeutic value.

  5. Gene therapy and its implications in Periodontics

    Science.gov (United States)

    Mahale, Swapna; Dani, Nitin; Ansari, Shumaila S.; Kale, Triveni

    2009-01-01

    Gene therapy is a field of Biomedicine. With the advent of gene therapy in dentistry, significant progress has been made in the control of periodontal diseases and reconstruction of dento-alveolar apparatus. Implementation in periodontics include: -As a mode of tissue engineering with three approaches: cell, protein-based and gene delivery approach. -Genetic approach to Biofilm Antibiotic Resistance. Future strategies of gene therapy in preventing periodontal diseases: -Enhances host defense mechanism against infection by transfecting host cells with an antimicrobial peptide protein-encoding gene. -Periodontal vaccination. Gene therapy is one of the recent entrants and its applications in the field of periodontics are reviewed in general here. PMID:20376232

  6. Interacting signal pathways control defense gene expression in Arabidopsis in response to cell wall-degrading enzymes from Erwinia carotovora.

    Science.gov (United States)

    Norman-Setterblad, C; Vidal, S; Palva, E T

    2000-04-01

    We have characterized the role of salicylic acid (SA)-independent defense signaling in Arabidopsis thaliana in response to the plant pathogen Erwinia carotovora subsp. carotovora. Use of pathway-specific target genes as well as signal mutants allowed us to elucidate the role and interactions of ethylene, jasmonic acid (JA), and SA signal pathways in this response. Gene expression studies suggest a central role for both ethylene and JA pathways in the regulation of defense gene expression triggered by the pathogen or by plant cell wall-degrading enzymes (CF) secreted by the pathogen. Our results suggest that ethylene and JA act in concert in this regulation. In addition, CF triggers another, strictly JA-mediated response inhibited by ethylene and SA. SA does not appear to have a major role in activating defense gene expression in response to CF. However, SA may have a dual role in controlling CF-induced gene expression, by enhancing the expression of genes synergistically induced by ethylene and JA and repressing genes induced by JA alone.

  7. Transcriptome analysis of trichothecene-induced gene expression in barley.

    Science.gov (United States)

    Boddu, Jayanand; Cho, Seungho; Muehlbauer, Gary J

    2007-11-01

    Fusarium head blight, caused primarily by Fusarium graminearum, is a major disease problem on barley (Hordeum vulgare L.). Trichothecene mycotoxins produced by the fungus during infection increase the aggressiveness of the fungus and promote infection in wheat (Triticum aestivum L.). Loss-of-function mutations in the TRI5 gene in F. graminearum result in the inability to synthesize trichothecenes and in reduced virulence on wheat. We examined the impact of pathogen-derived trichothecenes on virulence and the transcriptional differences in barley spikes infected with a trichothecene-producing wild-type strain and a loss-of-function tri5 trichothecene nonproducing mutant. Disease severity, fungal biomass, and floret necrosis and bleaching were reduced in spikes inoculated with the tri5 mutant strain compared with the wild-type strain, indicating that the inability to synthesize trichothecenes results in reduced virulence in barley. We detected 63 transcripts that were induced during trichothecene accumulation, including genes encoding putative trichothecene detoxification and transport proteins, ubiquitination-related proteins, programmed cell death-related proteins, transcription factors, and cytochrome P450s. We also detected 414 gene transcripts that were designated as basal defense response genes largely independent of trichothecene accumulation. Our results show that barley exhibits a specific response to trichothecene accumulation that can be separated from the basal defense response. We propose that barley responds to trichothecene accumulation by inducing at least two general responses. One response is the induction of genes encoding trichothecene detoxification and transport activities that may reduce the impact of trichothecenes. The other response is to induce genes encoding proteins associated with ubiquitination and cell death which may promote successful establishment of the disease.

  8. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  9. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  10. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  11. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  12. Transcriptome Analysis Reveals Candidate Genes involved in Blister Blight defense in Tea (Camellia sinensis (L) Kuntze)

    Science.gov (United States)

    Jayaswall, Kuldip; Mahajan, Pallavi; Singh, Gagandeep; Parmar, Rajni; Seth, Romit; Raina, Aparnashree; Swarnkar, Mohit Kumar; Singh, Anil Kumar; Shankar, Ravi; Sharma, Ram Kumar

    2016-07-01

    To unravel the molecular mechanism of defense against blister blight (BB) disease caused by an obligate biotrophic fungus, Exobasidium vexans, transcriptome of BB interaction with resistance and susceptible tea genotypes was analysed through RNA-seq using Illumina GAIIx at four different stages during ~20-day disease cycle. Approximately 69 million high quality reads were assembled de novo, yielding 37,790 unique transcripts with more than 55% being functionally annotated. Differentially expressed, 149 defense related transcripts/genes, namely defense related enzymes, resistance genes, multidrug resistant transporters, transcription factors, retrotransposons, metacaspases and chaperons were observed in RG, suggesting their role in defending against BB. Being present in the major hub, putative master regulators among these candidates were identified from predetermined protein-protein interaction network of Arabidopsis thaliana. Further, confirmation of abundant expression of well-known RPM1, RPS2 and RPP13 in quantitative Real Time PCR indicates salicylic acid and jasmonic acid, possibly induce synthesis of antimicrobial compounds, required to overcome the virulence of E. vexans. Compendiously, the current study provides a comprehensive gene expression and insights into the molecular mechanism of tea defense against BB to serve as a resource for unravelling the possible regulatory mechanism of immunity against various biotic stresses in tea and other crops.

  13. Characterization of a Beta vulgaris PGIP defense gene promoter in transgenic plants

    Science.gov (United States)

    Polygalacturonase-inhibiting protein (BvPGIP) genes were cloned from a sugar beet breeding line F1016 with increased tolerance to the sugar beet root maggot. Polygalacturonase-inhibiting proteins are cell wall leucine-rich repeat (LRR) proteins with crucial roles in development, pathogen defense an...

  14. Maternal programming of defensive responses through sustained effects on gene expression.

    Science.gov (United States)

    Zhang, Tie-Yuan; Bagot, Rose; Parent, Carine; Nesbitt, Cathy; Bredy, Timothy W; Caldji, Christian; Fish, Eric; Anisman, Hymie; Szyf, Moshe; Meaney, Michael J

    2006-07-01

    There are profound maternal effects on individual differences in defensive responses and reproductive strategies in species ranging literally from plants to insects to birds. Maternal effects commonly reflect the quality of the environment and are most likely mediated by the quality of the maternal provision (egg, propagule, etc.), which in turn determines growth rates and adult phenotype. In this paper we review data from the rat that suggest comparable forms of maternal effects on defensive responses stress, which are mediated by the effects of variations in maternal behavior on gene expression. Under conditions of environmental adversity maternal effects enhance the capacity for defensive responses in the offspring. In mammals, these effects appear to 'program' emotional, cognitive and endocrine systems towards increased sensitivity to adversity. In environments with an increased level of adversity, such effects can be considered adaptive, enhancing the probability of offspring survival to sexual maturity; the cost is that of an increased risk for multiple forms of pathology in later life.

  15. Application of disease-associated differentially expressed genes – Mining for functional candidate genes for mastitis resistance in cattle

    Directory of Open Access Journals (Sweden)

    Schwerin Manfred

    2003-06-01

    Full Text Available Abstract In this study the mRNA differential display method was applied to identify mastitis-associated expressed DNA sequences based on different expression patterns in mammary gland samples of non-infected and infected udder quarters of a cow. In total, 704 different cDNA bands were displayed in both udder samples. Five hundred-and-thirty two bands, (75.6% were differentially displayed. Ninety prominent cDNA bands were isolated, re-amplified, cloned and sequenced resulting in 87 different sequences. Amongst the 19 expressed sequence tags showing a similarity with previously described genes, the majority of these sequences exhibited homology to protein kinase encoding genes (26.3%, to genes involved in the regulation of gene expression (26.3%, to growth and differentiation factor encoding genes (21.0% and to immune response or inflammation marker encoding genes (21.0%. These sequences were shown to have mastitis-associated expression in the udder samples of animals with and without clinical mastitis by quantitative RT-PCR. They were mapped physically using a bovine-hamster somatic cell hybrid panel and a 5000 rad bovine whole genome radiation hybrid panel. According to their localization in QTL regions based on an established integrated marker/gene-map and their disease-associated expression, four genes (AHCY, PRKDC, HNRPU, OSTF1 were suggested as potentially involved in mastitis defense.

  16. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  17. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  18. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  19. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  20. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  1. Cigarette smoke modulates expression of human rhinovirus-induced airway epithelial host defense genes.

    Directory of Open Access Journals (Sweden)

    David Proud

    Full Text Available Human rhinovirus (HRV infections trigger acute exacerbations of chronic obstructive pulmonary disease (COPD and asthma. The human airway epithelial cell is the primary site of HRV infection and responds to infection with altered expression of multiple genes, the products of which could regulate the outcome to infection. Cigarette smoking aggravates asthma symptoms, and is also the predominant risk factor for the development and progression of COPD. We, therefore, examined whether cigarette smoke extract (CSE modulates viral responses by altering HRV-induced epithelial gene expression. Primary cultures of human bronchial epithelial cells were exposed to medium alone, CSE alone, purified HRV-16 alone or to HRV-16+ CSE. After 24 h, supernatants were collected and total cellular RNA was isolated. Gene array analysis was performed to examine mRNA expression. Additional experiments, using real-time RT-PCR, ELISA and/or western blotting, validated altered expression of selected gene products. CSE and HRV-16 each induced groups of genes that were largely independent of each other. When compared to gene expression in response to CSE alone, cells treated with HRV+CSE showed no obvious differences in CSE-induced gene expression. By contrast, compared to gene induction in response to HRV-16 alone, cells exposed to HRV+CSE showed marked suppression of expression of a number of HRV-induced genes associated with various functions, including antiviral defenses, inflammation, viral signaling and airway remodeling. These changes were not associated with altered expression of type I or type III interferons. Thus, CSE alters epithelial responses to HRV infection in a manner that may negatively impact antiviral and host defense outcomes.

  2. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  3. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  4. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  5. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  6. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  7. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  8. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  9. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  10. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  12. Ascorbate oxidase-dependent changes in the redox state of the apoplast modulate gene transcript accumulation leading to modified hormone signaling and orchestration of defense processes in tobacco.

    Science.gov (United States)

    Pignocchi, Cristina; Kiddle, Guy; Hernández, Iker; Foster, Simon J; Asensi, Amparo; Taybi, Tahar; Barnes, Jeremy; Foyer, Christine H

    2006-06-01

    The role of the redox state of the apoplast in hormone responses, signaling cascades, and gene expression was studied in transgenic tobacco (Nicotiana tabacum) plants with modified cell wall-localized ascorbate oxidase (AO). High AO activity specifically decreased the ascorbic acid (AA) content of the apoplast and altered plant growth responses triggered by hormones. Auxin stimulated shoot growth only when the apoplastic AA pool was reduced in wild-type or AO antisense lines. Oxidation of apoplastic AA in AO sense lines was associated with loss of the auxin response, higher mitogen-activated protein kinase activities, and susceptibility to a virulent strain of the pathogen Pseudomonas syringae. The total leaf glutathione pool, the ratio of reduced glutathione to glutathione disulfide, and glutathione reductase activities were similar in the leaves of all lines. However, AO sense leaves exhibited significantly lower dehydroascorbate reductase and ascorbate peroxidase activities than wild-type and antisense leaves. The abundance of mRNAs encoding antioxidant enzymes was similar in all lines. However, the day/night rhythms in the abundance of transcripts encoding the three catalase isoforms were changed in response to the AA content of the apoplast. Other transcripts influenced by AO included photorespiratory genes and a plasma membrane Ca(2+) channel-associated gene. We conclude that the redox state of the apoplast modulates plant growth and defense responses by regulating signal transduction cascades and gene expression patterns. Hence, AO activity, which modulates the redox state of the apoplastic AA pool, strongly influences the responses of plant cells to external and internal stimuli.

  13. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  14. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  15. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  16. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  17. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  18. Silverleaf whitefly induces salicylic acid defenses and suppresses effectual jasmonic acid defenses.

    Science.gov (United States)

    Zarate, Sonia I; Kempema, Louisa A; Walling, Linda L

    2007-02-01

    The basal defenses important in curtailing the development of the phloem-feeding silverleaf whitefly (Bemisia tabaci type B; SLWF) on Arabidopsis (Arabidopsis thaliana) were investigated. Sentinel defense gene RNAs were monitored in SLWF-infested and control plants. Salicylic acid (SA)-responsive gene transcripts accumulated locally (PR1, BGL2, PR5, SID2, EDS5, PAD4) and systemically (PR1, BGL2, PR5) during SLWF nymph feeding. In contrast, jasmonic acid (JA)- and ethylene-dependent RNAs (PDF1.2, VSP1, HEL, THI2.1, FAD3, ERS1, ERF1) were repressed or not modulated in SLWF-infested leaves. To test for a role of SA and JA pathways in basal defense, SLWF development on mutant and transgenic lines that constitutively activate or impair defense pathways was determined. By monitoring the percentage of SLWF nymphs in each instar, we show that mutants that activate SA defenses (cim10) or impair JA defenses (coi1) accelerated SLWF nymphal development. Reciprocally, mutants that activate JA defenses (cev1) or impair SA defenses (npr1, NahG) slowed SLWF nymphal development. Furthermore, when npr1 plants, which do not activate downstream SA defenses, were treated with methyl jasmonate, a dramatic delay in nymph development was observed. Collectively, these results showed that SLWF-repressed, JA-regulated defenses were associated with basal defense to the SLWF.

  19. Mining whole genomes and transcriptomes of Jatropha (Jatropha curcas) and Castor bean (Ricinus communis) for NBS-LRR genes and defense response associated transcription factors.

    Science.gov (United States)

    Sood, Archit; Jaiswal, Varun; Chanumolu, Sree Krishna; Malhotra, Nikhil; Pal, Tarun; Chauhan, Rajinder Singh

    2014-11-01

    Jatropha (Jatropha curcas L.) and Castor bean (Ricinus communis) are oilseed crops of family Euphorbiaceae with the potential of producing high quality biodiesel and having industrial value. Both the bioenergy plants are becoming susceptible to various biotic stresses directly affecting the oil quality and content. No report exists as of today on analysis of Nucleotide Binding Site-Leucine Rich Repeat (NBS-LRR) gene repertoire and defense response transcription factors in both the plant species. In silico analysis of whole genomes and transcriptomes identified 47 new NBS-LRR genes in both the species and 122 and 318 defense response related transcription factors in Jatropha and Castor bean, respectively. The identified NBS-LRR genes and defense response transcription factors were mapped onto the respective genomes. Common and unique NBS-LRR genes and defense related transcription factors were identified in both the plant species. All NBS-LRR genes in both the species were characterized into Toll/interleukin-1 receptor NBS-LRRs (TNLs) and coiled-coil NBS-LRRs (CNLs), position on contigs, gene clusters and motifs and domains distribution. Transcript abundance or expression values were measured for all NBS-LRR genes and defense response transcription factors, suggesting their functional role. The current study provides a repertoire of NBS-LRR genes and transcription factors which can be used in not only dissecting the molecular basis of disease resistance phenotype but also in developing disease resistant genotypes in Jatropha and Castor bean through transgenic or molecular breeding approaches.

  20. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  1. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  2. Molecular characterization of the porcine deleted in malignant brain tumors 1 gene (DMBT1)

    DEFF Research Database (Denmark)

    Haase, Bianca; Humphray, Sean J; Lyer, Stefan

    2006-01-01

    The human gene deleted in malignant brain tumors 1 (DMBT1) is considered to play a role in tumorigenesis and pathogen defense. It encodes a protein with multiple scavenger receptor cysteine-rich (SRCR) domains, which are involved in recognition and binding of a broad spectrum of bacterial pathogens...

  3. Light Influences How the Fungal Toxin Deoxynivalenol Affects Plant Cell Death and Defense Responses

    Directory of Open Access Journals (Sweden)

    Khairul I. Ansari

    2014-02-01

    Full Text Available The Fusarium mycotoxin deoxynivalenol (DON can cause cell death in wheat (Triticum aestivum, but can also reduce the level of cell death caused by heat shock in Arabidopsis (Arabidopsis thaliana cell cultures. We show that 10 μg mL−1 DON does not cause cell death in Arabidopsis cell cultures, and its ability to retard heat-induced cell death is light dependent. Under dark conditions, it actually promoted heat-induced cell death. Wheat cultivars differ in their ability to resist this toxin, and we investigated if the ability of wheat to mount defense responses was light dependent. We found no evidence that light affected the transcription of defense genes in DON-treated roots of seedlings of two wheat cultivars, namely cultivar CM82036 that is resistant to DON-induced bleaching of spikelet tissue and cultivar Remus that is not. However, DON treatment of roots led to genotype-dependent and light-enhanced defense transcript accumulation in coleoptiles. Wheat transcripts encoding a phenylalanine ammonia lyase (PAL gene (previously associated with Fusarium resistance, non-expressor of pathogenesis-related genes-1 (NPR1 and a class III plant peroxidase (POX were DON-upregulated in coleoptiles of wheat cultivar CM82036 but not of cultivar Remus, and DON-upregulation of these transcripts in cultivar CM82036 was light enhanced. Light and genotype-dependent differences in the DON/DON derivative content of coleoptiles were also observed. These results, coupled with previous findings regarding the effect of DON on plants, show that light either directly or indirectly influences the plant defense responses to DON.

  4. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  5. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  6. A Novel Meloidogyne incognita Effector Misp12 Suppresses Plant Defense Response at Latter Stages of Nematode Parasitism

    Science.gov (United States)

    Xie, Jialian; Li, Shaojun; Mo, Chenmi; Wang, Gaofeng; Xiao, Xueqiong; Xiao, Yannong

    2016-01-01

    Secreted effectors in plant root-knot nematodes (RKNs, or Meloidogyne spp.) play key roles in their parasite processes. Currently identified effectors mainly focus on the early stage of the nematode parasitism. There are only a few reports describing effectors that function in the latter stage. In this study, we identified a potential RKN effector gene, Misp12, that functioned during the latter stage of parasitism. Misp12 was unique in the Meloidogyne spp., and highly conserved in Meloidogyne incognita. It encoded a secretory protein that specifically expressed in the dorsal esophageal gland, and highly up-regulated during the female stages. Transient expression of Misp12-GUS-GFP in onion epidermal cell showed that Misp12 was localized in cytoplast. In addition, in planta RNA interference targeting Misp12 suppressed the expression of Misp12 in nematodes and attenuated parasitic ability of M. incognita. Furthermore, up-regulation of jasmonic acid (JA) and salicylic acid (SA) pathway defense-related genes in the virus-induced silencing of Misp12 plants, and down-regulation of SA pathway defense-related genes in Misp12-expressing plants indicated the gene might be associated with the suppression of the plant defense response. These results demonstrated that the novel nematode effector Misp12 played a critical role at latter parasitism of M. incognita. PMID:27446188

  7. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  8. The nuclear immune receptor RPS4 is required for RRS1SLH1-dependent constitutive defense activation in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Kee Hoon Sohn

    2014-10-01

    Full Text Available Plant nucleotide-binding leucine-rich repeat (NB-LRR disease resistance (R proteins recognize specific "avirulent" pathogen effectors and activate immune responses. NB-LRR proteins structurally and functionally resemble mammalian Nod-like receptors (NLRs. How NB-LRR and NLR proteins activate defense is poorly understood. The divergently transcribed Arabidopsis R genes, RPS4 (resistance to Pseudomonas syringae 4 and RRS1 (resistance to Ralstonia solanacearum 1, function together to confer recognition of Pseudomonas AvrRps4 and Ralstonia PopP2. RRS1 is the only known recessive NB-LRR R gene and encodes a WRKY DNA binding domain, prompting suggestions that it acts downstream of RPS4 for transcriptional activation of defense genes. We define here the early RRS1-dependent transcriptional changes upon delivery of PopP2 via Pseudomonas type III secretion. The Arabidopsis slh1 (sensitive to low humidity 1 mutant encodes an RRS1 allele (RRS1SLH1 with a single amino acid (leucine insertion in the WRKY DNA-binding domain. Its poor growth due to constitutive defense activation is rescued at higher temperature. Transcription profiling data indicate that RRS1SLH1-mediated defense activation overlaps substantially with AvrRps4- and PopP2-regulated responses. To better understand the genetic basis of RPS4/RRS1-dependent immunity, we performed a genetic screen to identify suppressor of slh1 immunity (sushi mutants. We show that many sushi mutants carry mutations in RPS4, suggesting that RPS4 acts downstream or in a complex with RRS1. Interestingly, several mutations were identified in a domain C-terminal to the RPS4 LRR domain. Using an Agrobacterium-mediated transient assay system, we demonstrate that the P-loop motif of RPS4 but not of RRS1SLH1 is required for RRS1SLH1 function. We also recapitulate the dominant suppression of RRS1SLH1 defense activation by wild type RRS1 and show this suppression requires an intact RRS1 P-loop. These analyses of RRS1SLH1 shed

  9. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  10. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  11. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  12. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  13. NAD1 Controls Defense-Like Responses in Medicago truncatula Symbiotic Nitrogen Fixing Nodules Following Rhizobial Colonization in a BacA-Independent Manner

    Science.gov (United States)

    Domonkos, Ágota; Kovács, Szilárd; Gombár, Anikó; Kiss, Ernő; Horváth, Beatrix; Kováts, Gyöngyi Z.; Farkas, Attila; Tóth, Mónika T.; Ayaydin, Ferhan; Bóka, Károly; Fodor, Lili; Endre, Gabriella; Kaló, Péter

    2017-01-01

    Legumes form endosymbiotic interaction with host compatible rhizobia, resulting in the development of nitrogen-fixing root nodules. Within symbiotic nodules, rhizobia are intracellularly accommodated in plant-derived membrane compartments, termed symbiosomes. In mature nodule, the massively colonized cells tolerate the existence of rhizobia without manifestation of visible defense responses, indicating the suppression of plant immunity in the nodule in the favur of the symbiotic partner. Medicago truncatula DNF2 (defective in nitrogen fixation 2) and NAD1 (nodules with activated defense 1) genes are essential for the control of plant defense during the colonization of the nitrogen-fixing nodule and are required for bacteroid persistence. The previously identified nodule-specific NAD1 gene encodes a protein of unknown function. Herein, we present the analysis of novel NAD1 mutant alleles to better understand the function of NAD1 in the repression of immune responses in symbiotic nodules. By exploiting the advantage of plant double and rhizobial mutants defective in establishing nitrogen-fixing symbiotic interaction, we show that NAD1 functions following the release of rhizobia from the infection threads and colonization of nodule cells. The suppression of plant defense is self-dependent of the differentiation status of the rhizobia. The corresponding phenotype of nad1 and dnf2 mutants and the similarity in the induction of defense-associated genes in both mutants suggest that NAD1 and DNF2 operate close together in the same pathway controlling defense responses in symbiotic nodules. PMID:29240711

  14. NAD1 Controls Defense-Like Responses in Medicago truncatula Symbiotic Nitrogen Fixing Nodules Following Rhizobial Colonization in a BacA-Independent Manner

    Directory of Open Access Journals (Sweden)

    Ágota Domonkos

    2017-12-01

    Full Text Available Legumes form endosymbiotic interaction with host compatible rhizobia, resulting in the development of nitrogen-fixing root nodules. Within symbiotic nodules, rhizobia are intracellularly accommodated in plant-derived membrane compartments, termed symbiosomes. In mature nodule, the massively colonized cells tolerate the existence of rhizobia without manifestation of visible defense responses, indicating the suppression of plant immunity in the nodule in the favur of the symbiotic partner. Medicago truncatula DNF2 (defective in nitrogen fixation 2 and NAD1 (nodules with activated defense 1 genes are essential for the control of plant defense during the colonization of the nitrogen-fixing nodule and are required for bacteroid persistence. The previously identified nodule-specific NAD1 gene encodes a protein of unknown function. Herein, we present the analysis of novel NAD1 mutant alleles to better understand the function of NAD1 in the repression of immune responses in symbiotic nodules. By exploiting the advantage of plant double and rhizobial mutants defective in establishing nitrogen-fixing symbiotic interaction, we show that NAD1 functions following the release of rhizobia from the infection threads and colonization of nodule cells. The suppression of plant defense is self-dependent of the differentiation status of the rhizobia. The corresponding phenotype of nad1 and dnf2 mutants and the similarity in the induction of defense-associated genes in both mutants suggest that NAD1 and DNF2 operate close together in the same pathway controlling defense responses in symbiotic nodules.

  15. NAD1 Controls Defense-Like Responses in Medicago truncatula Symbiotic Nitrogen Fixing Nodules Following Rhizobial Colonization in a BacA-Independent Manner.

    Science.gov (United States)

    Domonkos, Ágota; Kovács, Szilárd; Gombár, Anikó; Kiss, Ernő; Horváth, Beatrix; Kováts, Gyöngyi Z; Farkas, Attila; Tóth, Mónika T; Ayaydin, Ferhan; Bóka, Károly; Fodor, Lili; Ratet, Pascal; Kereszt, Attila; Endre, Gabriella; Kaló, Péter

    2017-12-14

    Legumes form endosymbiotic interaction with host compatible rhizobia, resulting in the development of nitrogen-fixing root nodules. Within symbiotic nodules, rhizobia are intracellularly accommodated in plant-derived membrane compartments, termed symbiosomes. In mature nodule, the massively colonized cells tolerate the existence of rhizobia without manifestation of visible defense responses, indicating the suppression of plant immunity in the nodule in the favur of the symbiotic partner. Medicago truncatula DNF2 (defective in nitrogen fixation 2) and NAD1 (nodules with activated defense 1) genes are essential for the control of plant defense during the colonization of the nitrogen-fixing nodule and are required for bacteroid persistence. The previously identified nodule-specific NAD1 gene encodes a protein of unknown function. Herein, we present the analysis of novel NAD1 mutant alleles to better understand the function of NAD1 in the repression of immune responses in symbiotic nodules. By exploiting the advantage of plant double and rhizobial mutants defective in establishing nitrogen-fixing symbiotic interaction, we show that NAD1 functions following the release of rhizobia from the infection threads and colonization of nodule cells. The suppression of plant defense is self-dependent of the differentiation status of the rhizobia. The corresponding phenotype of nad1 and dnf2 mutants and the similarity in the induction of defense-associated genes in both mutants suggest that NAD1 and DNF2 operate close together in the same pathway controlling defense responses in symbiotic nodules.

  16. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  17. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  18. Genome Wide Association Mapping in Arabidopsis thaliana Identifies Novel Genes Involved in Linking Allyl Glucosinolate to Altered Biomass and Defense.

    Science.gov (United States)

    Francisco, Marta; Joseph, Bindu; Caligagan, Hart; Li, Baohua; Corwin, Jason A; Lin, Catherine; Kerwin, Rachel E; Burow, Meike; Kliebenstein, Daniel J

    2016-01-01

    A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS) have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL), may provide direct feedback regulation, linking defense metabolism outputs to the growth, and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s) that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 μM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  19. Genome wide association mapping in Arabidopsis thaliana identifies novel genes involved in linking allyl glucosinolate to altered biomass and defense

    Directory of Open Access Journals (Sweden)

    Marta Francisco

    2016-07-01

    Full Text Available A key limitation in modern biology is the ability to rapidly identify genes underlying newly identified complex phenotypes. Genome wide association studies (GWAS have become an increasingly important approach for dissecting natural variation by associating phenotypes with genotypes at a genome wide level. Recent work is showing that the Arabidopsis thaliana defense metabolite, allyl glucosinolate (GSL, may provide direct feedback regulation, linking defense metabolism outputs to the growth and defense responses of the plant. However, there is still a need to identify genes that underlie this process. To start developing a deeper understanding of the mechanism(s that modulate the ability of exogenous allyl GSL to alter growth and defense, we measured changes in plant biomass and defense metabolites in a collection of natural 96 A. thaliana accessions fed with 50 µM of allyl GSL. Exogenous allyl GSL was introduced exclusively to the roots and the compound transported to the leaf leading to a wide range of heritable effects upon plant biomass and endogenous GSL accumulation. Using natural variation we conducted GWAS to identify a number of new genes which potentially control allyl responses in various plant processes. This is one of the first instances in which this approach has been successfully utilized to begin dissecting a novel phenotype to the underlying molecular/polygenic basis.

  20. Forager bees (Apis mellifera) highly express immune and detoxification genes in tissues associated with nectar processing.

    Science.gov (United States)

    Vannette, Rachel L; Mohamed, Abbas; Johnson, Brian R

    2015-11-09

    Pollinators, including honey bees, routinely encounter potentially harmful microorganisms and phytochemicals during foraging. However, the mechanisms by which honey bees manage these potential threats are poorly understood. In this study, we examine the expression of antimicrobial, immune and detoxification genes in Apis mellifera and compare between forager and nurse bees using tissue-specific RNA-seq and qPCR. Our analysis revealed extensive tissue-specific expression of antimicrobial, immune signaling, and detoxification genes. Variation in gene expression between worker stages was pronounced in the mandibular and hypopharyngeal gland (HPG), where foragers were enriched in transcripts that encode antimicrobial peptides (AMPs) and immune response. Additionally, forager HPGs and mandibular glands were enriched in transcripts encoding detoxification enzymes, including some associated with xenobiotic metabolism. Using qPCR on an independent dataset, we verified differential expression of three AMP and three P450 genes between foragers and nurses. High expression of AMP genes in nectar-processing tissues suggests that these peptides may contribute to antimicrobial properties of honey or to honey bee defense against environmentally-acquired microorganisms. Together, these results suggest that worker role and tissue-specific expression of AMPs, and immune and detoxification enzymes may contribute to defense against microorganisms and xenobiotic compounds acquired while foraging.

  1. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  2. ATL9, a RING zinc finger protein with E3 ubiquitin ligase activity implicated in chitin- and NADPH oxidase-mediated defense responses.

    Directory of Open Access Journals (Sweden)

    Marta Berrocal-Lobo

    2010-12-01

    Full Text Available Pathogen associated molecular patterns (PAMPs are signals detected by plants that activate basal defenses. One of these PAMPs is chitin, a carbohydrate present in the cell walls of fungi and in insect exoskeletons. Previous work has shown that chitin treatment of Arabidopsis thaliana induced defense-related genes in the absence of a pathogen and that the response was independent of the salicylic acid (SA, jasmonic acid (JA and ethylene (ET signaling pathways. One of these genes is ATL9 ( = ATL2G, which encodes a RING zinc-finger like protein. In the current work we demonstrate that ATL9 has E3 ubiquitin ligase activity and is localized to the endoplasmic reticulum. The expression pattern of ATL9 is positively correlated with basal defense responses against Golovinomyces cichoracearum, a biotrophic fungal pathogen. The basal levels of expression and the induction of ATL9 by chitin, in wild type plants, depends on the activity of NADPH oxidases suggesting that chitin-mediated defense response is NADPH oxidase dependent. Although ATL9 expression is not induced by treatment with known defense hormones (SA, JA or ET, full expression in response to chitin is compromised slightly in mutants where ET- or SA-dependent signaling is suppressed. Microarray analysis of the atl9 mutant revealed candidate genes that appear to act downstream of ATL9 in chitin-mediated defenses. These results hint at the complexity of chitin-mediated signaling and the potential interplay between elicitor-mediated signaling, signaling via known defense pathways and the oxidative burst.

  3. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  4. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  5. Jasmonic acid carboxyl methyltransferase regulates development and herbivory-induced defense response in rice.

    Science.gov (United States)

    Qi, Jinfeng; Li, Jiancai; Han, Xiu; Li, Ran; Wu, Jianqiang; Yu, Haixin; Hu, Lingfei; Xiao, Yutao; Lu, Jing; Lou, Yonggen

    2016-06-01

    Jasmonic acid (JA) and related metabolites play a key role in plant defense and growth. JA carboxyl methyltransferase (JMT) may be involved in plant defense and development by methylating JA to methyl jasmonate (MeJA) and thus influencing the concentrations of JA and related metabolites. However, no JMT gene has been well characterized in monocotyledon defense and development at the molecular level. After we cloned a rice JMT gene, OsJMT1, whose encoding protein was localized in the cytosol, we found that the recombinant OsJMT1 protein catalyzed JA to MeJA. OsJMT1 is up-regulated in response to infestation with the brown planthopper (BPH; Nilaparvata lugens). Plants in which OsJMT1 had been overexpressed (oe-JMT plants) showed reduced height and yield. These oe-JMT plants also exhibited increased MeJA levels but reduced levels of herbivore-induced JA and jasmonoyl-isoleucine (JA-Ile). The oe-JMT plants were more attractive to BPH female adults but showed increased resistance to BPH nymphs, probably owing to the different responses of BPH female adults and nymphs to the changes in levels of H2 O2 and MeJA in oe-JMT plants. These results indicate that OsJMT1, by altering levels of JA and related metabolites, plays a role in regulating plant development and herbivore-induced defense responses in rice. © 2015 Institute of Botany, Chinese Academy of Sciences.

  6. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  7. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  8. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  9. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  10. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  11. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  12. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  13. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  14. Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

    Science.gov (United States)

    Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

    2005-01-01

    Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

  15. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  16. Balancing Selection at the Tomato RCR3 Guardee Gene Family Maintains Variation in Strength of Pathogen Defense

    Science.gov (United States)

    Hörger, Anja C.; Ilyas, Muhammad; Stephan, Wolfgang; Tellier, Aurélien; van der Hoorn, Renier A. L.; Rose, Laura E.

    2012-01-01

    Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors) and host resistance genes such as the major histocompatibility complex (MHC) in mammals or resistance (R) genes in plants. In plant–pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the “Guard-Hypothesis,” R proteins (the “guards”) can sense modification of target molecules in the host (the “guardees”) by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3) and its guard (Cf-2). We conclude that, in addition to coevolution at the “guardee-effector” interface for pathogen recognition, natural selection acts on the “guard-guardee” interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto

  17. Balancing selection at the tomato RCR3 Guardee gene family maintains variation in strength of pathogen defense.

    Directory of Open Access Journals (Sweden)

    Anja C Hörger

    Full Text Available Coevolution between hosts and pathogens is thought to occur between interacting molecules of both species. This results in the maintenance of genetic diversity at pathogen antigens (or so-called effectors and host resistance genes such as the major histocompatibility complex (MHC in mammals or resistance (R genes in plants. In plant-pathogen interactions, the current paradigm posits that a specific defense response is activated upon recognition of pathogen effectors via interaction with their corresponding R proteins. According to the "Guard-Hypothesis," R proteins (the "guards" can sense modification of target molecules in the host (the "guardees" by pathogen effectors and subsequently trigger the defense response. Multiple studies have reported high genetic diversity at R genes maintained by balancing selection. In contrast, little is known about the evolutionary mechanisms shaping the guardee, which may be subject to contrasting evolutionary forces. Here we show that the evolution of the guardee RCR3 is characterized by gene duplication, frequent gene conversion, and balancing selection in the wild tomato species Solanum peruvianum. Investigating the functional characteristics of 54 natural variants through in vitro and in planta assays, we detected differences in recognition of the pathogen effector through interaction with the guardee, as well as substantial variation in the strength of the defense response. This variation is maintained by balancing selection at each copy of the RCR3 gene. Our analyses pinpoint three amino acid polymorphisms with key functional consequences for the coevolution between the guardee (RCR3 and its guard (Cf-2. We conclude that, in addition to coevolution at the "guardee-effector" interface for pathogen recognition, natural selection acts on the "guard-guardee" interface. Guardee evolution may be governed by a counterbalance between improved activation in the presence and prevention of auto-immune responses in

  18. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  19. Glutathione S-transferase genes and the risk of type 2 diabetes mellitus: Role of sexual dimorphism, gene-gene and gene-smoking interactions in disease susceptibility.

    Science.gov (United States)

    Azarova, Iuliia; Bushueva, Olga; Konoplya, Alexander; Polonikov, Alexey

    2018-05-01

    Compromised defense against reactive oxygen species (ROS) is considered important in the pathogenesis of type 2 diabetes mellitus (T2DM); therefore, genes encoding antioxidant defense enzymes may contribute to disease susceptibility. This study investigated whether polymorphisms in genes encoding glutathione S-transferase M1 (GSTM1), T1 (GSTT1), and P1 (GSTP1) jointly contribute to the risk of T2DM. In all, 1120 unrelated Russian subjects (600 T2DM patients, 520 age- and sex-matched healthy subjects), were recruited to the study. Genotyping was performed by multiplex polymerase chain reaction (PCR; del/del polymorphisms of GSTM1 and GSTT1) and TaqMan-based PCR (polymorphisms I105V and A114V of GSTP1). Plasma ROS and glutathione levels in study subjects were analyzed by fluorometric and colorimetric assays, respectively. Genotype del/del GSTT1 was significantly associated with the risk of T2DM (odds ratio [OR] 1.60, 95% confidence interval [CI] 1.17-2.21, P = 0.003). Gender-stratified analysis showed that the deletion genotypes of GSTM1 (OR 1.99, 95% CI 1.30-3.05; P = 0.0002, Q = 0.016) and GSTT1 (OR 2.23, 95% CI 1.22-4.09; P = 0.008, Q = 0.0216), as well as genotype 114A/V of GSTP1 (OR 2.85, 95% CI 1.44-5.62; P = 0.005, Q = 0.02) were associated with an increased risk of T2DM exclusively in males. Three genotype combinations (i.e. GSTM1+ × GSTT1+, GSTM1+ × GSTP1 114A/A and GSTT1+ × GSTP1 114A/A) showed significant associations with a decreased risk of T2DM in males. This study demonstrates, for the first time, that genes encoding glutathione S-transferases jointly contribute to the risk of T2DM, and that their effects on disease susceptibility are gender specific. © 2017 Ruijin Hospital, Shanghai Jiaotong University School of Medicine and John Wiley & Sons Australia, Ltd.

  20. Molecular Dynamics Simulation and Statistics Analysis Reveals the Defense Response Mechanism in Plants

    Science.gov (United States)

    Liu, Zhichao; Zhao, Yunjie; Zeng, Chen; Computational Biophysics Lab Team

    As the main protein of the bacterial flagella, flagellin plays an important role in perception and defense response. The newly discovered locus, FLS2, is ubiquitously expressed. FLS2 encodes a putative receptor kinase and shares many homologies with some plant resistance genes and even with some components of immune system of mammals and insects. In Arabidopsis, FLS2 perception is achieved by the recognition of epitope flg22, which induces FLS2 heteromerization with BAK1 and finally the plant immunity. Here we use both analytical methods such as Direct Coupling Analysis (DCA) and Molecular Dynamics (MD) Simulations to get a better understanding of the defense mechanism of FLS2. This may facilitate a redesign of flg22 or de-novo design for desired specificity and potency to extend the immune properties of FLS2 to other important crops and vegetables.

  1. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  2. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  3. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  4. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  5. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  6. Heterologous Expression of the Cotton NBS-LRR Gene GbaNA1 Enhances Verticillium Wilt Resistance in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Nan-Yang Li

    2018-02-01

    Full Text Available Verticillium wilt caused by Verticillium dahliae results in severe losses in cotton, and is economically the most destructive disease of this crop. Improving genetic resistance is the cleanest and least expensive option to manage Verticillium wilt. Previously, we identified the island cotton NBS-LRR-encoding gene GbaNA1 that confers resistance to the highly virulent V. dahliae isolate Vd991. In this study, we expressed cotton GbaNA1 in the heterologous system of Arabidopsis thaliana and investigated the defense response mediated by GbaNA1 following inoculations with V. dahliae. Heterologous expression of GbaNA1 conferred Verticillium wilt resistance in A. thaliana. Moreover, overexpression of GbaNA1 enabled recovery of the resistance phenotype of A. thaliana mutants that had lost the function of GbaNA1 ortholog gene. Investigations of the defense response in A. thaliana showed that the reactive oxygen species (ROS production and the expression of genes associated with the ethylene signaling pathway were enhanced significantly following overexpression of GbaNA1. Intriguingly, overexpression of the GbaNA1 ortholog from Gossypium hirsutum (GhNA1 in A. thaliana did not induce the defense response of ROS production due to the premature termination of GhNA1, which lacks the encoded NB-ARC and LRR motifs. GbaNA1 therefore confers Verticillium wilt resistance in A. thaliana by the activation of ROS production and ethylene signaling. These results demonstrate the functional conservation of the NBS-LRR-encoding GbaNA1 in a heterologous system, and the mechanism of this resistance, both of which may prove valuable in incorporating GbaNA1-mediated resistance into other plant species.

  7. Influence of Rhizoctonia solani and Trichoderma spp. in growth of bean (Phaseolus vulgaris L.) and in the induction of plant defense-related genes

    Science.gov (United States)

    Mayo, Sara; Gutiérrez, Santiago; Malmierca, Monica G.; Lorenzana, Alicia; Campelo, M. Piedad; Hermosa, Rosa; Casquero, Pedro A.

    2015-01-01

    Many Trichoderma species are well-known for their ability to promote plant growth and defense. We study how the interaction of bean plants with R. solani and/or Trichoderma affect the plants growth and the level of expression of defense-related genes. Trichoderma isolates were evaluated in vitro for their potential to antagonize R. solani. Bioassays were performed in climatic chambers and development of the plants was evaluated. The effect of Trichoderma treatment and/or R. solani infection on the expression of bean defense-related genes was analyzed by real-time PCR and the production of ergosterol and squalene was quantified. In vitro growth inhibition of R. solani was between 86 and 58%. In in vivo assays, the bean plants treated with Trichoderma harzianum T019 always had an increased size respect to control and the plants treated with this isolate did not decrease their size in presence of R. solani. The interaction of plants with R. solani and/or Trichoderma affects the level of expression of seven defense-related genes. Squalene and ergosterol production differences were found among the Trichoderma isolates, T019 showing the highest values for both compounds. T. harzianum T019 shows a positive effect on the level of resistance of bean plants to R. solani. This strain induces the expression of plant defense-related genes and produces a higher level of ergosterol, indicating its ability to grow at a higher rate in the soil, which would explain its positive effects on plant growth and defense in the presence of the pathogen. PMID:26442006

  8. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  9. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  10. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  11. Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

    Science.gov (United States)

    Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

    2009-01-01

    There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

  12. Silverleaf Whitefly Induces Salicylic Acid Defenses and Suppresses Effectual Jasmonic Acid Defenses1[W][OA

    Science.gov (United States)

    Zarate, Sonia I.; Kempema, Louisa A.; Walling, Linda L.

    2007-01-01

    The basal defenses important in curtailing the development of the phloem-feeding silverleaf whitefly (Bemisia tabaci type B; SLWF) on Arabidopsis (Arabidopsis thaliana) were investigated. Sentinel defense gene RNAs were monitored in SLWF-infested and control plants. Salicylic acid (SA)-responsive gene transcripts accumulated locally (PR1, BGL2, PR5, SID2, EDS5, PAD4) and systemically (PR1, BGL2, PR5) during SLWF nymph feeding. In contrast, jasmonic acid (JA)- and ethylene-dependent RNAs (PDF1.2, VSP1, HEL, THI2.1, FAD3, ERS1, ERF1) were repressed or not modulated in SLWF-infested leaves. To test for a role of SA and JA pathways in basal defense, SLWF development on mutant and transgenic lines that constitutively activate or impair defense pathways was determined. By monitoring the percentage of SLWF nymphs in each instar, we show that mutants that activate SA defenses (cim10) or impair JA defenses (coi1) accelerated SLWF nymphal development. Reciprocally, mutants that activate JA defenses (cev1) or impair SA defenses (npr1, NahG) slowed SLWF nymphal development. Furthermore, when npr1 plants, which do not activate downstream SA defenses, were treated with methyl jasmonate, a dramatic delay in nymph development was observed. Collectively, these results showed that SLWF-repressed, JA-regulated defenses were associated with basal defense to the SLWF. PMID:17189328

  13. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  14. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  15. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  16. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  17. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  18. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  19. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  20. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  1. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  2. Coincidence in map positions between pathogen-induced defense-responsive genes and quantitative resistance loci in rice

    Institute of Scientific and Technical Information of China (English)

    熊敏; 王石平; 张启发

    2002-01-01

    Quantitative disease resistance conferred by quantitative trait loci (QTLs) is presumably of wider spectrum and durable. Forty-four cDNA clones, representing 44 defense-responsive genes, were fine mapped to 56 loci distributed on 9 of the 12 rice chromosomes. The locations of 32 loci detected by 27 cDNA clones were associated with previously identified resistance QTLs for different rice diseases, including blast, bacterial blight, sheath blight and yellow mottle virus. The loci detected by the same multiple-copy cDNA clones were frequently located on similar locations of different chromosomes. Some of the multiple loci detected by the same clones were all associated with resistance QTLs. These results suggest that some of the genes may be important components in regulation of defense responses against pathogen invasion and they may be the candidates for studying the mechanism of quantitative disease resistance in rice.

  3. [Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

    Science.gov (United States)

    Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

    2008-01-01

    The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

  4. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  5. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  6. APOBEC3G: a Double Agent in Defense

    OpenAIRE

    Smith, Harold C.

    2011-01-01

    APOBEC3G (A3G) is an effective cellular host defense factor under experimental conditions in which a functional form of the HIV-encoded protein Vif cannot be expressed. Wild type Vif targets A3G for proteasomal degradation and along with it, any host defense advantage A3G might provide is severely diminished or lost. Recent evidence cast doubt on the potency of A3G in host defense and suggested that it could, under some circumstances, promote the emergence of more virulent HIV strains. In thi...

  7. Natural genetic variation in Arabidopsis thaliana defense metabolism genes modulates field fitness.

    Science.gov (United States)

    Kerwin, Rachel; Feusier, Julie; Corwin, Jason; Rubin, Matthew; Lin, Catherine; Muok, Alise; Larson, Brandon; Li, Baohua; Joseph, Bindu; Francisco, Marta; Copeland, Daniel; Weinig, Cynthia; Kliebenstein, Daniel J

    2015-04-13

    Natural populations persist in complex environments, where biotic stressors, such as pathogen and insect communities, fluctuate temporally and spatially. These shifting biotic pressures generate heterogeneous selective forces that can maintain standing natural variation within a species. To directly test if genes containing causal variation for the Arabidopsis thaliana defensive compounds, glucosinolates (GSL) control field fitness and are therefore subject to natural selection, we conducted a multi-year field trial using lines that vary in only specific causal genes. Interestingly, we found that variation in these naturally polymorphic GSL genes affected fitness in each of our environments but the pattern fluctuated such that highly fit genotypes in one trial displayed lower fitness in another and that no GSL genotype or genotypes consistently out-performed the others. This was true both across locations and within the same location across years. These results indicate that environmental heterogeneity may contribute to the maintenance of GSL variation observed within Arabidopsis thaliana.

  8. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  9. Mimic Phosphorylation of a βC1 Protein Encoded by TYLCCNB Impairs Its Functions as a Viral Suppressor of RNA Silencing and a Symptom Determinant.

    Science.gov (United States)

    Zhong, Xueting; Wang, Zhan Qi; Xiao, Ruyuan; Cao, Linge; Wang, Yaqin; Xie, Yan; Zhou, Xueping

    2017-08-15

    Phosphorylation of the βC1 protein encoded by the betasatellite of tomato yellow leaf curl China virus (TYLCCNB-βC1) by SNF1-related protein kinase 1 (SnRK1) plays a critical role in defense of host plants against geminivirus infection in Nicotiana benthamiana However, how phosphorylation of TYLCCNB-βC1 impacts its pathogenic functions during viral infection remains elusive. In this study, we identified two additional tyrosine residues in TYLCCNB-βC1 that are phosphorylated by SnRK1. The effects of TYLCCNB-βC1 phosphorylation on its functions as a viral suppressor of RNA silencing (VSR) and a symptom determinant were investigated via phosphorylation mimic mutants in N. benthamiana plants. Mutations that mimic phosphorylation of TYLCCNB-βC1 at tyrosine 5 and tyrosine 110 attenuated disease symptoms during viral infection. The phosphorylation mimics weakened the ability of TYLCCNB-βC1 to reverse transcriptional gene silencing and to suppress posttranscriptional gene silencing and abolished its interaction with N. benthamiana ASYMMETRIC LEAVES 1 in N. benthamiana leaves. The mimic phosphorylation of TYLCCNB-βC1 had no impact on its protein stability, subcellular localization, or self-association. Our data establish an inhibitory effect of phosphorylation of TYLCCNB-βC1 on its pathogenic functions as a VSR and a symptom determinant and provide a mechanistic explanation of how SnRK1 functions as a host defense factor. IMPORTANCE Tomato yellow leaf curl China virus (TYLCCNV), which causes a severe yellow leaf curl disease in China, is a monopartite geminivirus associated with the betasatellite (TYLCCNB). TYLCCNB encodes a single pathogenicity protein, βC1 (TYLCCNB-βC1), which functions as both a viral suppressor of RNA silencing (VSR) and a symptom determinant. Here, we show that mimicking phosphorylation of TYLCCNB-βC1 weakens its ability to reverse transcriptional gene silencing, to suppress posttranscriptional gene silencing, and to interact with N

  10. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  11. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  12. Structural and transcriptional characterization of a novel member of the soybean urease gene family.

    Science.gov (United States)

    Wiebke-Strohm, Beatriz; Ligabue-Braun, Rodrigo; Rechenmacher, Ciliana; De Oliveira-Busatto, Luisa Abruzzi; Carlini, Célia Regina; Bodanese-Zanettini, Maria Helena

    2016-04-01

    In plants, ureases have been related to urea degradation, to defense against pathogenic fungi and phytophagous insects, and to the soybean-Bradyrhizobium japonicum symbiosis. Two urease isoforms have been described for soybean: the embryo-specific, encoded by Eu1 gene, and the ubiquitous urease, encoded by Eu4. A third urease-encoding locus exists in the completed soybean genome. The gene was designated Eu5 and the putative product of its ORF as SBU-III. Phylogenetic analysis shows that 41 plant, moss and algal ureases have diverged from a common ancestor protein, but ureases from monocots, eudicots and ancient species have evolved independently. Genomes of ancient organisms present a single urease-encoding gene and urease-encoding gene duplication has occurred independently along the evolution of some eudicot species. SBU-III has a shorter amino acid sequence, since many gaps are found when compared to other sequences. A mutation in a highly conserved amino acid residue suggests absence of ureolytic activity, but the overall protein architecture remains very similar to the other ureases. The expression profile of urease-encoding genes in different organs and developmental stages was determined by RT-qPCR. Eu5 transcripts were detected in seeds one day after dormancy break, roots of young plants and embryos of developing seeds. Eu1 and Eu4 transcripts were found in all analyzed organs, but Eu4 expression was more prominent in seeds one day after dormancy break whereas Eu1 predominated in developing seeds. The evidence suggests that SBU-III may not be involved in nitrogen availability to plants, but it could be involved in other biological role(s). Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  13. The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

    Science.gov (United States)

    Santiago, Margarita; Gardner, Richard C

    2015-07-01

    Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

  14. Overexpression of SAMDC1 gene in Arabidopsis thaliana increases expression of defense-related genes as well as resistance to Pseudomonas syringae and Hyaloperonospora arabidopsidis

    Directory of Open Access Journals (Sweden)

    Francisco eMarco

    2014-03-01

    Full Text Available It has been previously described that elevation of endogenous spermine levels in Arabidopsis could be achieved by transgenic overexpression of S-Adenosylmethionine decarboxylase (SAMDC or Spermine synthase (SPMS. In both cases, spermine accumulation had an impact on the plant transcriptome, with up-regulation of a set of genes enriched in functional categories involved in defense-related processes against both biotic and abiotic stresses. In this work, the response of SAMDC1-overexpressing plants against bacterial and oomycete pathogens has been tested. The expression of several pathogen defense-related genes was induced in these plants as well as in wild type plants exposed to an exogenous supply of spermine. SAMDC1-overexpressing plants showed an increased tolerance to infection by Pseudomonas syringae and by Hyaloperonospora arabidopsidis. Both results add more evidence to the hypothesis that spermine plays a key role in plant resistance to biotic stress.

  15. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  16. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  17. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  18. Transcriptomics of the rice blast fungus Magnaporthe oryzae in response to the bacterial antagonist Lysobacter enzymogenes reveals candidate fungal defense response genes.

    Directory of Open Access Journals (Sweden)

    Sandra M Mathioni

    Full Text Available Plants and animals have evolved a first line of defense response to pathogens called innate or basal immunity. While basal defenses in these organisms are well studied, there is almost a complete lack of understanding of such systems in fungal species, and more specifically, how they are able to detect and mount a defense response upon pathogen attack. Hence, the goal of the present study was to understand how fungi respond to biotic stress by assessing the transcriptional profile of the rice blast pathogen, Magnaporthe oryzae, when challenged with the bacterial antagonist Lysobacter enzymogenes. Based on microscopic observations of interactions between M. oryzae and wild-type L. enzymogenes strain C3, we selected early and intermediate stages represented by time-points of 3 and 9 hours post-inoculation, respectively, to evaluate the fungal transcriptome using RNA-seq. For comparative purposes, we also challenged the fungus with L. enzymogenes mutant strain DCA, previously demonstrated to be devoid of antifungal activity. A comparison of transcriptional data from fungal interactions with the wild-type bacterial strain C3 and the mutant strain DCA revealed 463 fungal genes that were down-regulated during attack by C3; of these genes, 100 were also found to be up-regulated during the interaction with DCA. Functional categorization of genes in this suite included those with roles in carbohydrate metabolism, cellular transport and stress response. One gene in this suite belongs to the CFEM-domain class of fungal proteins. Another CFEM class protein called PTH11 has been previously characterized, and we found that a deletion in this gene caused advanced lesion development by C3 compared to its growth on the wild-type fungus. We discuss the characterization of this suite of 100 genes with respect to their role in the fungal defense response.

  19. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  20. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  1. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  2. Involvement of Trichoderma harzianum Epl-1 Protein in the Regulation of Botrytis Virulence- and Tomato Defense-Related Genes.

    Science.gov (United States)

    Gomes, Eriston V; Ulhoa, Cirano J; Cardoza, Rosa E; Silva, Roberto N; Gutiérrez, Santiago

    2017-01-01

    Several Trichoderma spp. are well known for their ability to: (i) act as important biocontrol agents against phytopathogenic fungi; (ii) function as biofertilizers; (iii) increase the tolerance of plants to biotic and abiotic stresses; and (iv) induce plant defense responses via the production and secretion of elicitor molecules. In this study, we analyzed the gene-regulation effects of Trichoderma harzianum Epl-1 protein during the interactions of mutant Δ epl-1 or wild-type T. harzianum strains with: (a) the phytopathogen Botrytis cinerea and (b) with tomato plants, on short (24 h hydroponic cultures) and long periods (4-weeks old plants) after Trichoderma inoculation. Our results indicate that T. harzianum Epl-1 protein affects the in vitro expression of B. cinerea virulence genes, especially those involved in the botrydial biosynthesis ( BcBOT genes), during the mycoparasitism interaction. The tomato defense-related genes were also affected, indicating that Epl-1 is involved in the elicitation of the salicylic acid pathway. Moreover, Epl-1 also regulates the priming effect in host tomato plants and contributes to enhance the interaction with the host tomato plant during the early stage of root colonization.

  3. Involvement of Trichoderma harzianum Epl-1 Protein in the Regulation of Botrytis Virulence- and Tomato Defense-Related Genes

    Directory of Open Access Journals (Sweden)

    Eriston V. Gomes

    2017-05-01

    Full Text Available Several Trichoderma spp. are well known for their ability to: (i act as important biocontrol agents against phytopathogenic fungi; (ii function as biofertilizers; (iii increase the tolerance of plants to biotic and abiotic stresses; and (iv induce plant defense responses via the production and secretion of elicitor molecules. In this study, we analyzed the gene-regulation effects of Trichoderma harzianum Epl-1 protein during the interactions of mutant Δepl-1 or wild-type T. harzianum strains with: (a the phytopathogen Botrytis cinerea and (b with tomato plants, on short (24 h hydroponic cultures and long periods (4-weeks old plants after Trichoderma inoculation. Our results indicate that T. harzianum Epl-1 protein affects the in vitro expression of B. cinerea virulence genes, especially those involved in the botrydial biosynthesis (BcBOT genes, during the mycoparasitism interaction. The tomato defense-related genes were also affected, indicating that Epl-1 is involved in the elicitation of the salicylic acid pathway. Moreover, Epl-1 also regulates the priming effect in host tomato plants and contributes to enhance the interaction with the host tomato plant during the early stage of root colonization.

  4. Effects of Argonaute on Gene Expression in Thermus thermophilus.

    Directory of Open Access Journals (Sweden)

    Daan C Swarts

    Full Text Available Eukaryotic Argonaute proteins mediate RNA-guided RNA interference, allowing both regulation of host gene expression and defense against invading mobile genetic elements. Recently, it has become evident that prokaryotic Argonaute homologs mediate DNA-guided DNA interference, and play a role in host defense. Argonaute of the bacterium Thermus thermophilus (TtAgo targets invading plasmid DNA during and after transformation. Using small interfering DNA guides, TtAgo can cleave single and double stranded DNAs. Although TtAgo additionally has been demonstrated to cleave RNA targets complementary to its DNA guide in vitro, RNA targeting by TtAgo has not been demonstrated in vivo.To investigate if TtAgo also has the potential to control RNA levels, we analyzed RNA-seq data derived from cultures of four T. thermophilus strain HB27 variants: wild type, TtAgo knockout (Δago, and either strain transformed with a plasmid. Additionally we determined the effect of TtAgo on expression of plasmid-encoded RNA and plasmid DNA levels.In the absence of exogenous DNA (plasmid, TtAgo presence or absence had no effect on gene expression levels. When plasmid DNA is present, TtAgo reduces plasmid DNA levels 4-fold, and a corresponding reduction of plasmid gene transcript levels was observed. We therefore conclude that TtAgo interferes with plasmid DNA, but not with plasmid-encoded RNA. Interestingly, TtAgo presence stimulates expression of specific endogenous genes, but only when exogenous plasmid DNA was present. Specifically, the presence of TtAgo directly or indirectly stimulates expression of CRISPR loci and associated genes, some of which are involved in CRISPR adaptation. This suggests that TtAgo-mediated interference with plasmid DNA stimulates CRISPR adaptation.

  5. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  6. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  7. Expression Study of Banana Pathogenic Resistance Genes

    Directory of Open Access Journals (Sweden)

    Fenny M. Dwivany

    2016-10-01

    Full Text Available Banana is one of the world's most important trade commodities. However, infection of banana pathogenic fungi (Fusarium oxysporum race 4 is one of the major causes of decreasing production in Indonesia. Genetic engineering has become an alternative way to control this problem by isolating genes that involved in plant defense mechanism against pathogens. Two of the important genes are API5 and ChiI1, each gene encodes apoptosis inhibitory protein and chitinase enzymes. The purpose of this study was to study the expression of API5 and ChiI1 genes as candidate pathogenic resistance genes. The amplified fragments were then cloned, sequenced, and confirmed with in silico studies. Based on sequence analysis, it is showed that partial API5 gene has putative transactivation domain and ChiI1 has 9 chitinase family GH19 protein motifs. Data obtained from this study will contribute in banana genetic improvement.

  8. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  9. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  10. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  11. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  12. The Two Translationally Controlled Tumor Protein Genes, CsTCTP1 and CsTCTP2, Are Negative Modulators in the Cucumis sativus Defense Response to Sphaerotheca fuliginea

    Directory of Open Access Journals (Sweden)

    Xiangnan Meng

    2018-04-01

    Full Text Available Pathogen stress often significantly decreases cucumber production. However, knowledge regarding the molecular mechanism and signals of cucumber disease resistance is far from complete. Here, we report two translationally controlled tumor protein genes, CsTCTP1 and CsTCTP2, that are both negative modulators in the Cucumis sativus defense response to Sphaerotheca fuliginea. Subcellular localization analysis showed that CsTCTP1 and CsTCTP2 were both localized in the cytoplasm. Expression analysis indicated that the transcript levels of CsTCTP1 and CsTCTP2 were linked to the degree of cucumber resistance to S. fuliginea. Transient overexpression of either CsTCTP1 or CsTCTP2 in cucumber cotyledons impaired resistance to S. fuliginea, whereas silencing of either CsTCTP1 or CsTCTP2 enhanced cucumber resistance to S. fuliginea. The relationship of several defense-related genes and ABA and target of rapamycin (TOR signaling pathway-related genes to the overexpressing and silencing of CsTCTP1/CsTCTP2 in non-infested cucumber plants was investigated. The results indicated that CsTCTP1 participates in the defense response to S. fuliginea by regulating the expression of certain defense-associated genes and/or ABA signaling pathway-associated genes, and CsTCTP2 participates through regulating the expression of TOR signaling pathway-associated genes. Our findings will guide enhancing the resistance of cucumber to powdery mildew.

  13. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  14. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  15. Ionotropic glutamate receptors mediate inducible defense in the water flea Daphnia pulex.

    Directory of Open Access Journals (Sweden)

    Hitoshi Miyakawa

    Full Text Available Phenotypic plasticity is the ability held in many organisms to produce different phenotypes with a given genome in response to environmental stimuli, such as temperature, nutrition and various biological interactions. It seems likely that environmental signals induce a variety of mechanistic responses that influence ontogenetic processes. Inducible defenses, in which prey animals alter their morphology, behavior and/or other traits to help protect against direct or latent predation threats, are among the most striking examples of phenotypic plasticity. The freshwater microcrustacean Daphnia pulex forms tooth-like defensive structures, "neckteeth," in response to chemical cues or signals, referred to as "kairomones," in this case released from phantom midge larvae, a predator of D. pulex. To identify factors involved in the reception and/or transmission of a kairomone, we used microarray analysis to identify genes up-regulated following a short period of exposure to the midge kairomone. In addition to identifying differentially expressed genes of unknown function, we also found significant up-regulation of genes encoding ionotropic glutamate receptors, which are known to be involved in neurotransmission in many animal species. Specific antagonists of these receptors strongly inhibit the formation of neckteeth in D. pulex, although agonists did not induce neckteeth by themselves, indicating that ionotropic glutamate receptors are necessary but not sufficient for early steps of neckteeth formation in D. pulex. Moreover, using co-exposure of D. pulex to antagonists and juvenile hormone (JH, which physiologically mediates neckteeth formation, we found evidence suggesting that the inhibitory effect of antagonists is not due to direct inhibition of JH synthesis/secretion. Our findings not only provide a candidate molecule required for the inducible defense response in D. pulex, but also will contribute to the understanding of complex mechanisms

  16. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Directory of Open Access Journals (Sweden)

    Preeti Arya

    Full Text Available Nucleotide binding site leucine-rich repeats (NBS-LRR disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR and coiled coil (CC (1 ∶ 1 was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  17. Genome-wide identification and expression analysis of NBS-encoding genes in Malus x domestica and expansion of NBS genes family in Rosaceae.

    Science.gov (United States)

    Arya, Preeti; Kumar, Gulshan; Acharya, Vishal; Singh, Anil K

    2014-01-01

    Nucleotide binding site leucine-rich repeats (NBS-LRR) disease resistance proteins play an important role in plant defense against pathogen attack. A number of recent studies have been carried out to identify and characterize NBS-LRR gene families in many important plant species. In this study, we identified NBS-LRR gene family comprising of 1015 NBS-LRRs using highly stringent computational methods. These NBS-LRRs were characterized on the basis of conserved protein motifs, gene duplication events, chromosomal locations, phylogenetic relationships and digital gene expression analysis. Surprisingly, equal distribution of Toll/interleukin-1 receptor (TIR) and coiled coil (CC) (1 ∶ 1) was detected in apple while the unequal distribution was reported in majority of all other known plant genome studies. Prediction of gene duplication events intriguingly revealed that not only tandem duplication but also segmental duplication may equally be responsible for the expansion of the apple NBS-LRR gene family. Gene expression profiling using expressed sequence tags database of apple and quantitative real-time PCR (qRT-PCR) revealed the expression of these genes in wide range of tissues and disease conditions, respectively. Taken together, this study will provide a blueprint for future efforts towards improvement of disease resistance in apple.

  18. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  19. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  20. Natural genetic variation in Arabidopsis thaliana defense metabolism genes modulates field fitness

    Science.gov (United States)

    Kerwin, Rachel; Feusier, Julie; Corwin, Jason; Rubin, Matthew; Lin, Catherine; Muok, Alise; Larson, Brandon; Li, Baohua; Joseph, Bindu; Francisco, Marta; Copeland, Daniel; Weinig, Cynthia; Kliebenstein, Daniel J

    2015-01-01

    Natural populations persist in complex environments, where biotic stressors, such as pathogen and insect communities, fluctuate temporally and spatially. These shifting biotic pressures generate heterogeneous selective forces that can maintain standing natural variation within a species. To directly test if genes containing causal variation for the Arabidopsis thaliana defensive compounds, glucosinolates (GSL) control field fitness and are therefore subject to natural selection, we conducted a multi-year field trial using lines that vary in only specific causal genes. Interestingly, we found that variation in these naturally polymorphic GSL genes affected fitness in each of our environments but the pattern fluctuated such that highly fit genotypes in one trial displayed lower fitness in another and that no GSL genotype or genotypes consistently out-performed the others. This was true both across locations and within the same location across years. These results indicate that environmental heterogeneity may contribute to the maintenance of GSL variation observed within Arabidopsis thaliana. DOI: http://dx.doi.org/10.7554/eLife.05604.001 PMID:25867014

  1. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  2. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  3. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  4. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  5. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  6. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  7. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  8. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  9. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  10. Involvement of Trichoderma trichothecenes in the biocontrol activity and in the induction of plant defense related genes

    Science.gov (United States)

    Trichoderma species produce trichothecenes, most notably trichodermin and harzianum A (HA), by a biosynthetic pathway in which several of the involved proteins have significant differences in functionality, compared to their Fusarium orthologues. In addition, the genes encoding these proteins show a...

  11. Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots

    Science.gov (United States)

    2014-01-01

    Background Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) and derivatives are critical to the defense response against necrotrophic pathogens. Several reports demonstrate that SA limits nematode reproduction. Results Here we translate knowledge gained from studies using Arabidopsis to soybean. The ability of thirty-one Arabidopsis genes encoding important components of SA and JA synthesis and signaling in conferring resistance to soybean cyst nematode (SCN: Heterodera glycines) are investigated. We demonstrate that overexpression of three of thirty-one Arabidoposis genes in transgenic soybean roots of composite plants decreased the number of cysts formed by SCN to less than 50% of those found on control roots, namely AtNPR1(33%), AtTGA2 (38%), and AtPR-5 (38%). Three additional Arabidopsis genes decreased the number of SCN cysts by 40% or more: AtACBP3 (53% of the control value), AtACD2 (55%), and AtCM-3 (57%). Other genes having less or no effect included AtEDS5 (77%), AtNDR1 (82%), AtEDS1 (107%), and AtPR-1 (80%), as compared to control. Overexpression of AtDND1 greatly increased susceptibility as indicated by a large increase in the number of SCN cysts (175% of control). Conclusions Knowledge of the pathogen defense system gained from studies of the model system, Arabidopsis, can be directly translated to soybean through direct overexpression of Arabidopsis genes. When the genes, AtNPR1, AtGA2, and AtPR-5, encoding specific components involved in SA regulation, synthesis, and signaling, are overexpressed in soybean roots, resistance to SCN is enhanced. This demonstrates functional compatibility of some Arabidopsis genes with soybean and identifies genes that may be used to engineer resistance to nematodes. PMID:24739302

  12. Arabidopsis genes, AtNPR1, AtTGA2 and AtPR-5, confer partial resistance to soybean cyst nematode (Heterodera glycines) when overexpressed in transgenic soybean roots.

    Science.gov (United States)

    Matthews, Benjamin F; Beard, Hunter; Brewer, Eric; Kabir, Sara; MacDonald, Margaret H; Youssef, Reham M

    2014-04-16

    Extensive studies using the model system Arabidopsis thaliana to elucidate plant defense signaling and pathway networks indicate that salicylic acid (SA) is the key hormone triggering the plant defense response against biotrophic and hemi-biotrophic pathogens, while jasmonic acid (JA) and derivatives are critical to the defense response against necrotrophic pathogens. Several reports demonstrate that SA limits nematode reproduction. Here we translate knowledge gained from studies using Arabidopsis to soybean. The ability of thirty-one Arabidopsis genes encoding important components of SA and JA synthesis and signaling in conferring resistance to soybean cyst nematode (SCN: Heterodera glycines) are investigated. We demonstrate that overexpression of three of thirty-one Arabidoposis genes in transgenic soybean roots of composite plants decreased the number of cysts formed by SCN to less than 50% of those found on control roots, namely AtNPR1(33%), AtTGA2 (38%), and AtPR-5 (38%). Three additional Arabidopsis genes decreased the number of SCN cysts by 40% or more: AtACBP3 (53% of the control value), AtACD2 (55%), and AtCM-3 (57%). Other genes having less or no effect included AtEDS5 (77%), AtNDR1 (82%), AtEDS1 (107%), and AtPR-1 (80%), as compared to control. Overexpression of AtDND1 greatly increased susceptibility as indicated by a large increase in the number of SCN cysts (175% of control). Knowledge of the pathogen defense system gained from studies of the model system, Arabidopsis, can be directly translated to soybean through direct overexpression of Arabidopsis genes. When the genes, AtNPR1, AtGA2, and AtPR-5, encoding specific components involved in SA regulation, synthesis, and signaling, are overexpressed in soybean roots, resistance to SCN is enhanced. This demonstrates functional compatibility of some Arabidopsis genes with soybean and identifies genes that may be used to engineer resistance to nematodes.

  13. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  14. IBR5 Modulates Temperature-Dependent, R Protein CHS3-Mediated Defense Responses in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Jingyan Liu

    2015-10-01

    Full Text Available Plant responses to low temperature are tightly associated with defense responses. We previously characterized the chilling-sensitive mutant chs3-1 resulting from the activation of the Toll and interleukin 1 receptor-nucleotide binding-leucine-rich repeat (TIR-NB-LRR-type resistance (R protein harboring a C-terminal LIM (Lin-11, Isl-1 and Mec-3 domains domain. Here we report the identification of a suppressor of chs3, ibr5-7 (indole-3-butyric acid response 5, which largely suppresses chilling-activated defense responses. IBR5 encodes a putative dual-specificity protein phosphatase. The accumulation of CHS3 protein at chilling temperatures is inhibited by the IBR5 mutation. Moreover, chs3-conferred defense phenotypes were synergistically suppressed by mutations in HSP90 and IBR5. Further analysis showed that IBR5, with holdase activity, physically associates with CHS3, HSP90 and SGT1b (Suppressor of the G2 allele of skp1 to form a complex that protects CHS3. In addition to the positive role of IBR5 in regulating CHS3, IBR5 is also involved in defense responses mediated by R genes, including SNC1 (Suppressor of npr1-1, Constitutive 1, RPS4 (Resistance to P. syringae 4 and RPM1 (Resistance to Pseudomonas syringae pv. maculicola 1. Thus, the results of the present study reveal a role for IBR5 in the regulation of multiple R protein-mediated defense responses.

  15. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  16. Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

    Directory of Open Access Journals (Sweden)

    DEWI FITRIANI

    2010-06-01

    Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

  17. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  18. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  19. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  20. The C-terminal sequence of several human serine proteases encodes host defense functions.

    Science.gov (United States)

    Kasetty, Gopinath; Papareddy, Praveen; Kalle, Martina; Rydengård, Victoria; Walse, Björn; Svensson, Bo; Mörgelin, Matthias; Malmsten, Martin; Schmidtchen, Artur

    2011-01-01

    Serine proteases of the S1 family have maintained a common structure over an evolutionary span of more than one billion years, and evolved a variety of substrate specificities and diverse biological roles, involving digestion and degradation, blood clotting, fibrinolysis and epithelial homeostasis. We here show that a wide range of C-terminal peptide sequences of serine proteases, particularly from the coagulation and kallikrein systems, share characteristics common with classical antimicrobial peptides of innate immunity. Under physiological conditions, these peptides exert antimicrobial effects as well as immunomodulatory functions by inhibiting macrophage responses to bacterial lipopolysaccharide. In mice, selected peptides are protective against lipopolysaccharide-induced shock. Moreover, these S1-derived host defense peptides exhibit helical structures upon binding to lipopolysaccharide and also permeabilize liposomes. The results uncover new and fundamental aspects on host defense functions of serine proteases present particularly in blood and epithelia, and provide tools for the identification of host defense molecules of therapeutic interest. Copyright © 2011 S. Karger AG, Basel.

  1. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

    OpenAIRE

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-01-01

    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  2. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  3. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    OpenAIRE

    Xu, J; Johnson, R C

    1995-01-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

  4. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  5. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  6. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  7. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  8. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  9. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  10. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  11. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  12. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  13. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  14. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  15. Cloning and expression of three thaumatin-like protein genes from Polyporus umbellatus

    Directory of Open Access Journals (Sweden)

    Mengmeng Liu

    2017-05-01

    Full Text Available Genes encoding thaumatin-like protein (TLPs are frequently found in fungal genomes. However, information on TLP genes in Polyporus umbellatus is still limited. In this study, three TLP genes were cloned from P. umbellatus. The full-length coding sequence of PuTLP1, PuTLP2 and PuTLP3 were 768, 759 and 561 bp long, respectively, encoding for 256, 253 and 187 amino acids. Phylogenetic trees showed that P. umbellatus PuTLP1, PuTLP2 and PuTLP3 were clustered with sequences from Gloeophyllum trabeum, Trametes versicolor and Stereum hirsutum, respectively. The expression patterns of the three TLP genes were higher in P. umbellatus with Armillaria mellea infection than in the sclerotia without A. mellea. Furthermore, over-expression of three PuTLPs were carried out in Escherichia coli BL21 (DE3 strain, and high quality proteins were obtained using Ni-NTA resin that can be used for preparation of specific antibodies. These results suggest that PuTLP1, PuTLP2 and PuTLP3 in P. umbellatus may be involved in the defense response to A. mellea infections.

  16. Trichodiene Production in a Trichoderma harzianum erg1-Silenced Strain Provides Evidence of the Importance of the Sterol Biosynthetic Pathway in Inducing Plant Defense-Related Gene Expression.

    Science.gov (United States)

    Malmierca, M G; McCormick, S P; Cardoza, R E; Monte, E; Alexander, N J; Gutiérrez, S

    2015-11-01

    Trichoderma species are often used as biocontrol agents against plant-pathogenic fungi. A complex molecular interaction occurs among the biocontrol agent, the antagonistic fungus, and the plant. Terpenes and sterols produced by the biocontrol fungus have been found to affect gene expression in both the antagonistic fungus and the plant. The terpene trichodiene (TD) elicits the expression of genes related to tomato defense and to Botrytis virulence. We show here that TD itself is able to induce the expression of Botrytis genes involved in the synthesis of botrydial (BOT) and also induces terpene gene expression in Trichoderma spp. The terpene ergosterol, in addition to its role as a structural component of the fungal cell membranes, acts as an elicitor of defense response in plants. In the present work, using a transformant of T. harzianum, which is silenced in the erg1 gene and accumulates high levels of squalene, we show that this ergosterol precursor also acts as an important elicitor molecule of tomato defense-related genes and induces Botrytis genes involved in BOT biosynthesis, in both cases, in a concentration-dependent manner. Our data emphasize the importance of a balance of squalene and ergosterol in fungal interactions as well as in the biocontrol activity of Trichoderma spp.

  17. Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

    Science.gov (United States)

    Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

    2016-01-01

    Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

  18. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  19. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  20. Impact of agricultural management on bacterial laccase-encoding genes with possible implications for soil carbon storage in semi-arid Mediterranean olive farming

    Directory of Open Access Journals (Sweden)

    Beatriz Moreno

    2016-07-01

    Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from

  1. Whole genome expression array profiling highlights differences in mucosal defense genes in Barrett's esophagus and esophageal adenocarcinoma.

    Directory of Open Access Journals (Sweden)

    Derek J Nancarrow

    Full Text Available Esophageal adenocarcinoma (EAC has become a major concern in Western countries due to rapid rises in incidence coupled with very poor survival rates. One of the key risk factors for the development of this cancer is the presence of Barrett's esophagus (BE, which is believed to form in response to repeated gastro-esophageal reflux. In this study we performed comparative, genome-wide expression profiling (using Illumina whole-genome Beadarrays on total RNA extracted from esophageal biopsy tissues from individuals with EAC, BE (in the absence of EAC and those with normal squamous epithelium. We combined these data with publically accessible raw data from three similar studies to investigate key gene and ontology differences between these three tissue states. The results support the deduction that BE is a tissue with enhanced glycoprotein synthesis machinery (DPP4, ATP2A3, AGR2 designed to provide strong mucosal defenses aimed at resisting gastro-esophageal reflux. EAC exhibits the enhanced extracellular matrix remodeling (collagens, IGFBP7, PLAU effects expected in an aggressive form of cancer, as well as evidence of reduced expression of genes associated with mucosal (MUC6, CA2, TFF1 and xenobiotic (AKR1C2, AKR1B10 defenses. When our results are compared to previous whole-genome expression profiling studies keratin, mucin, annexin and trefoil factor gene groups are the most frequently represented differentially expressed gene families. Eleven genes identified here are also represented in at least 3 other profiling studies. We used these genes to discriminate between squamous epithelium, BE and EAC within the two largest cohorts using a support vector machine leave one out cross validation (LOOCV analysis. While this method was satisfactory for discriminating squamous epithelium and BE, it demonstrates the need for more detailed investigations into profiling changes between BE and EAC.

  2. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  3. A primary survey on bryophyte species reveals two novel classes of nucleotide-binding site (NBS genes.

    Directory of Open Access Journals (Sweden)

    Jia-Yu Xue

    Full Text Available Due to their potential roles in pathogen defense, genes encoding nucleotide-binding site (NBS domain have been particularly surveyed in many angiosperm genomes. Two typical classes were found: one is the TIR-NBS-LRR (TNL class and the other is the CC-NBS-LRR (CNL class. It is seldom known, however, what kind of NBS-encoding genes are mainly present in other plant groups, especially the most ancient groups of land plants, that is, bryophytes. To fill this gap of knowledge, in this study, we mainly focused on two bryophyte species: the moss Physcomitrella patens and the liverwort Marchantia polymorpha, to survey their NBS-encoding genes. Surprisingly, two novel classes of NBS-encoding genes were discovered. The first novel class is identified from the P. patens genome and a typical member of this class has a protein kinase (PK domain at the N-terminus and a LRR domain at the C-terminus, forming a complete structure of PK-NBS-LRR (PNL, reminiscent of TNL and CNL classes in angiosperms. The second class is found from the liverwort genome and a typical member of this class possesses an α/β-hydrolase domain at the N-terminus and also a LRR domain at the C-terminus (Hydrolase-NBS-LRR, HNL. Analysis on intron positions and phases also confirmed the novelty of HNL and PNL classes, as reflected by their specific intron locations or phase characteristics. Phylogenetic analysis covering all four classes of NBS-encoding genes revealed a closer relationship among the HNL, PNL and TNL classes, suggesting the CNL class having a more divergent status from the others. The presence of specific introns highlights the chimerical structures of HNL, PNL and TNL genes, and implies their possible origin via exon-shuffling during the quick lineage separation processes of early land plants.

  4. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature.

    Directory of Open Access Journals (Sweden)

    Peter K Busk

    Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.

  5. Capsicum annuum WRKY transcription factor d (CaWRKYd) regulates hypersensitive response and defense response upon Tobacco mosaic virus infection.

    Science.gov (United States)

    Huh, Sung Un; Choi, La Mee; Lee, Gil-Je; Kim, Young Jin; Paek, Kyung-Hee

    2012-12-01

    WRKY transcription factors regulate biotic, abiotic, and developmental processes. In terms of plant defense, WRKY factors have important roles as positive and negative regulators via transcriptional regulation or protein-protein interaction. Here, we report the characterization of the gene encoding Capsicum annuum WRKY transcription factor d (CaWRKYd) isolated from microarray analysis in the Tobacco mosaic virus (TMV)-P(0)-inoculated hot pepper plants. CaWRKYd belongs to the WRKY IIa group, a very small clade in the WRKY subfamily, and WRKY IIa group has positive/negative regulatory roles in Arabidopsis and rice. CaWRKYd transcripts were induced by various plant defense-related hormone treatments and TMV-P(0) inoculation. Silencing of CaWRKYd affected TMV-P(0)-mediated hypersensitive response (HR) cell death and accumulation of TMV-P(0) coat protein in local and systemic leaves. Furthermore, expression of some pathogenesis-related (PR) genes and HR-related genes was reduced in the CaWRKYd-silenced plants compared with TRV2 vector control plants upon TMV-P(0) inoculation. CaWRKYd was confirmed to bind to the W-box. Thus CaWRKYd is a newly identified Capsicum annuum WRKY transcription factor that appears to be involved in TMV-P(0)-mediated HR cell death by regulating downstream gene expression. Copyright © 2012 Elsevier Ireland Ltd. All rights reserved.

  6. Spreading of genes encoding enterotoxins, haemolysins, adhesin and biofilm among methicillin resistant Staphylococcus aureus strains with staphylococcal cassette chromosome mec type IIIA isolated from burn patients.

    Science.gov (United States)

    Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad

    2016-08-01

    The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.

  7. A mutation in a coproporphyrinogen III oxidase gene confers growth inhibition, enhanced powdery mildew resistance and powdery mildew-induced cell death in Arabidopsis.

    Science.gov (United States)

    Guo, Chuan-yu; Wu, Guang-heng; Xing, Jin; Li, Wen-qi; Tang, Ding-zhong; Cui, Bai-ming

    2013-05-01

    A gene encoding a coproporphyrinogen III oxidase mediates disease resistance in plants by the salicylic acid pathway. A number of genes that regulate powdery mildew resistance have been identified in Arabidopsis, such as ENHANCED DISEASE RESISTANCE 1 to 3 (EDR1 to 3). To further study the molecular interactions between the powdery mildew pathogen and Arabidopsis, we isolated and characterized a mutant that exhibited enhanced resistance to powdery mildew. The mutant also showed dramatic powdery mildew-induced cell death as well as growth defects and early senescence in the absence of pathogens. We identified the affected gene by map-based cloning and found that the gene encodes a coproporphyrinogen III oxidase, a key enzyme in the tetrapyrrole biosynthesis pathway, previously known as LESION INITIATION 2 (LIN2). Therefore, we designated the mutant lin2-2. Further studies revealed that the lin2-2 mutant also displayed enhanced resistance to Hyaloperonospora arabidopsidis (H.a.) Noco2. Genetic analysis showed that the lin2-2-mediated disease resistance and spontaneous cell death were dependent on PHYTOALEXIN DEFICIENT 4 (PAD4), SALICYLIC ACID INDUCTION-DEFICIENT 2 (SID2), and NONEXPRESSOR OF PATHOGENESIS-RELATED GENES 1 (NPR1), which are all involved in salicylic acid signaling. Furthermore, the relative expression levels of defense-related genes were induced after powdery mildew infection in the lin2-2 mutant. These data indicated that LIN2 plays an important role in cell death control and defense responses in plants.

  8. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  9. Use of nfsB, encoding nitroreductase, as a reporter gene to determine the mutational spectrum of spontaneous mutations in Neisseria gonorrhoeae

    Directory of Open Access Journals (Sweden)

    Dunham Stephen

    2009-11-01

    Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.

  10. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  11. The Pseudomonas aeruginosa pirA gene encodes a second receptor for ferrienterobactin and synthetic catecholate analogues.

    Science.gov (United States)

    Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra

    2005-05-15

    Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two

  12. Prokaryotic homologs of Argonaute proteins are predicted to function as key components of a novel system of defense against mobile genetic elements

    Directory of Open Access Journals (Sweden)

    van der Oost John

    2009-08-01

    Full Text Available Abstract Background In eukaryotes, RNA interference (RNAi is a major mechanism of defense against viruses and transposable elements as well of regulating translation of endogenous mRNAs. The RNAi systems recognize the target RNA molecules via small guide RNAs that are completely or partially complementary to a region of the target. Key components of the RNAi systems are proteins of the Argonaute-PIWI family some of which function as slicers, the nucleases that cleave the target RNA that is base-paired to a guide RNA. Numerous prokaryotes possess the CRISPR-associated system (CASS of defense against phages and plasmids that is, in part, mechanistically analogous but not homologous to eukaryotic RNAi systems. Many prokaryotes also encode homologs of Argonaute-PIWI proteins but their functions remain unknown. Results We present a detailed analysis of Argonaute-PIWI protein sequences and the genomic neighborhoods of the respective genes in prokaryotes. Whereas eukaryotic Ago/PIWI proteins always contain PAZ (oligonucleotide binding and PIWI (active or inactivated nuclease domains, the prokaryotic Argonaute homologs (pAgos fall into two major groups in which the PAZ domain is either present or absent. The monophyly of each group is supported by a phylogenetic analysis of the conserved PIWI-domains. Almost all pAgos that lack a PAZ domain appear to be inactivated, and the respective genes are associated with a variety of predicted nucleases in putative operons. An additional, uncharacterized domain that is fused to various nucleases appears to be a unique signature of operons encoding the short (lacking PAZ pAgo form. By contrast, almost all PAZ-domain containing pAgos are predicted to be active nucleases. Some proteins of this group (e.g., that from Aquifex aeolicus have been experimentally shown to possess nuclease activity, and are not typically associated with genes for other (putative nucleases. Given these observations, the apparent extensive

  13. Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

    Science.gov (United States)

    Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

    2012-10-15

    IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

  14. Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

    Directory of Open Access Journals (Sweden)

    Senta Heiss-Blanquet

    Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

  15. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Science.gov (United States)

    Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm

    2015-05-01

    Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  16. Autoselection of cytoplasmic yeast virus like elements encoding toxin/antitoxin systems involves a nuclear barrier for immunity gene expression.

    Directory of Open Access Journals (Sweden)

    Alene Kast

    2015-05-01

    Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.

  17. Sustained mitogen-activated protein kinase activation reprograms defense metabolism and phosphoprotein profile in Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Ines eLassowskat

    2014-10-01

    Full Text Available Mitogen-activated protein kinases (MAPKs target a variety of protein substrates to regulate cellular signaling processes in eukaryotes. In plants, the number of identified MAPK substrates that control plant defense responses is still limited. Here, we generated transgenic Arabidopsis thaliana plants with an inducible system to simulate in vivo activation of two stress-activated MAPKs, MPK3 and MPK6. Metabolome analysis revealed that this artificial MPK3/6 activation (without any exposure to pathogens or other stresses is sufficient to drive the production of major defense-related metabolites, including various camalexin, indole glucosinolate and agmatine derivatives. An accompanying (phosphoproteome analysis led to detection of hundreds of potential phosphoproteins downstream of MPK3/6 activation. Besides known MAPK substrates, many candidates on this list possess typical MAPK-targeted phosphosites and in many cases, the corresponding phosphopeptides were detected by mass spectrometry. Notably, several of these putative phosphoproteins have been reported to be associated with the biosynthesis of antimicrobial defense substances (e.g. WRKY transcription factors and proteins encoded by the genes from the PEN pathway required for penetration resistance to filamentous pathogens. Thus, this work provides an inventory of candidate phosphoproteins, including putative direct MAPK substrates, for future analysis of MAPK-mediated defense control. (Proteomics data are available with the identifier PXD001252 via ProteomeXchange, http://proteomecentral.proteomexchange.org.

  18. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  19. Chloroquine mediated modulation of Anopheles gambiae gene expression.

    Directory of Open Access Journals (Sweden)

    Patrícia Abrantes

    2008-07-01

    Full Text Available Plasmodium development in the mosquito is crucial for malaria transmission and depends on the parasite's interaction with a variety of cell types and specific mosquito factors that have both positive and negative effects on infection. Whereas the defensive response of the mosquito contributes to a decrease in parasite numbers during these stages, some components of the blood meal are known to favor infection, potentiating the risk of increased transmission. The presence of the antimalarial drug chloroquine in the mosquito's blood meal has been associated with an increase in Plasmodium infectivity for the mosquito, which is possibly caused by chloroquine interfering with the capacity of the mosquito to defend against the infection.In this study, we report a detailed survey of the Anopheles gambiae genes that are differentially regulated by the presence of chloroquine in the blood meal, using an A. gambiae cDNA microarray. The effect of chloroquine on transcript abundance was evaluated separately for non-infected and Plasmodium berghei-infected mosquitoes. Chloroquine was found to affect the abundance of transcripts that encode proteins involved in a variety of processes, including immunity, apoptosis, cytoskeleton and the response to oxidative stress. This pattern of differential gene expression may explain the weakened mosquito defense response which accounts for the increased infectivity observed in chloroquine-treated mosquitoes.The results of the present study suggest that chloroquine can interfere with several putative mosquito mechanisms of defense against Plasmodium at the level of gene expression and highlight the need for a better understanding of the impacts of antimalarial agents on parasite transmission.

  20. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  1. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

    Science.gov (United States)

    de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

    2002-04-15

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

  2. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  3. BIOLOGICAL FUNCTION OF TOMBUSVIRUS-ENCODED SUPPRESSOR OF RNA SILENCING IN PLANTS

    Directory of Open Access Journals (Sweden)

    Omarov R.T.

    2012-08-01

    Full Text Available RNA interference (RNAi plays multiple biological roles in eukaryotic organisms to regulate gene expression. RNAi also operates as a conserved adaptive molecular immune mechanism against invading viruses. The antiviral RNAi pathway is initiated with the generation of virus-derived short-interfering RNAs (siRNAs that are used for subsequent sequence-specific recognition and degradation of the cognate viral RNA molecules. As an efficient counter-defensive strategy, most plant viruses evolved the ability to encode specific proteins capable of interfering with RNAi, and this process is commonly known as RNA silencing suppression. Virus-encoded suppressors of RNAi (VSRs operate at different steps in the RNAi pathway and display distinct biochemical properties that enable these proteins to efficiently interfere with the host-defense system. Tombusvirus-encoded P19 is an important pathogenicity factor, required for symptom development and elicitation of a hypersensitive response in a host-dependent manner. Protein plays a crucial role of TBSV P19 in protecting viral RNA during systemic infection on Nicotiana benthamiana. The X-ray crystallographic studies conducted by two independent groups revealed the existence of a P19-siRNA complex; a conformation whereby caliper tryptophan residues on two subunits of P19 dimers measure and bind 21-nt siRNA duplexes. These structural studies provided the first details on the possible molecular mechanism of any viral suppressor to block RNAi. The association between P19 and siRNAs was also shown to occur in infected plants These and related studies revealed that in general the ability of P19 to efficiently sequester siRNAs influences symptom severity, however this is not a strict correlation in all hosts.The current working model is that during TBSV infection of plants, P19 appropriates abundantly circulating Tombusvirus-derived siRNAs thereby rendering these unavailable to program RISC, to prevent degradation of

  4. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  5. Identification and Functional Characterization of Genes Encoding Omega-3 Polyunsaturated Fatty Acid Biosynthetic Activities from Unicellular Microalgae

    Directory of Open Access Journals (Sweden)

    Royah Vaezi

    2013-12-01

    Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.

  6. Lymphotoxin organizes contributions to host defense and metabolic illness from innate lymphoid cells.

    Science.gov (United States)

    Upadhyay, Vaibhav; Fu, Yang-Xin

    2014-04-01

    The lymphotoxin (LT)-pathway is a unique constituent branch of the Tumor Necrosis Superfamily (TNFSF). Use of LT is a critical mechanism by which fetal innate lymphoid cells regulate lymphoid organogenesis. Within recent years, adult innate lymphoid cells have been discovered to utilize this same pathway to regulate IL-22 and IL-23 production for host defense. Notably, genetic studies have linked polymorphisms in the genes encoding LTα to several phenotypes contributing to metabolic syndrome. The role of the LT-pathway may lay the foundation for a bridge between host immune response, microbiota, and metabolic syndrome. The contribution of the LT-pathway to innate lymphoid cell function and metabolic syndrome will be visited in this review. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. The gene encoding the melanin-concentrating hormone receptor 1 is associated with schizophrenia in a Danish case-control sample

    DEFF Research Database (Denmark)

    Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H

    2012-01-01

    OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...

  8. Gene encoding gamma-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7.

    Science.gov (United States)

    Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K

    2010-07-04

    Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  9. Tobacco plants transformed with the bean. alpha. ai gene express an inhibitor of insect. alpha. -amylase in their seeds. [Nicotiana tabacum; Tenebrio molitor

    Energy Technology Data Exchange (ETDEWEB)

    Altabella, T.; Chrispeels, M.J. (Univ. of California, San Diego, La Jolla (USA))

    1990-06-01

    Bean (Phaseolus vulgaris L.) seeds contain a putative plant defense protein that inhibits insect and mammalian but not plant {alpha}-amylases. We recently presented strong circumstantial evidence that this {alpha}-amylase inhibitor ({alpha}Al) is encoded by an already-identified lectin gene whose product is referred to as lectin-like-protein (LLP). We have now made a chimeric gene consisting of the coding sequence of the lectin gene that encodes LLP and the 5{prime} and 3{prime} flanking sequences of the lectin gene that encodes phytohemagglutinin-L. When this chimeric gene was expressed in transgenic tobacco (Nicotiana tabacum), we observed in the seeds a series of polypeptides (M{sub r} 10,000-18,000) that cross-react with antibodies to the bean {alpha}-amylase inhibitor. Most of these polypeptides bind to a pig pancreas {alpha}-amylase affinity column. An extract of the seeds of the transformed tobacco plants inhibits pig pancreas {alpha}-amylase activity as well as the {alpha}-amylase present in the midgut of Tenebrio molitor. We suggest that introduction of this lectin gene (to be called {alpha}ai) into other leguminous plants may be a strategy to protect the seeds from the seed-eating larvae of Coleoptera.

  10. Gene activation by UV light, fungal elicitor or fungal infection in Petroselinum crispum is correlated with repression of cell cycle-related genes

    International Nuclear Information System (INIS)

    Logemann, E.; Wu ShengCheng; Schröder, J.; Schmelzer, E.; Somssich, I.E.; Hahlbrock, K.

    1995-01-01

    The effects of UV light or fungal elicitors on plant cells have so far been studied mostly with respect to defense-related gene activation. Here, an inverse correlation of these stimulatory effects with the activities of several cell cycle-related genes is demonstrated. Concomitant with the induction of flavonoid biosynthetic enzymes in UV-irradiated cell suspension cultures of parsley (Petroselinum crispum), total histone synthesis declined to about half the initial rate. A subclass of the histone H3 gene family was selected to demonstrate the close correlation of its expression with cell division, both in intact plants and cultured cells. Using RNA-blot and run-on transcription assays, it was shown that one arbitrarily selected subclass of each of the histone H2A, H2B, H3 and H4 gene families and of the genes encoding a p34cdc2 protein kinase and a mitotic cyclin were transcriptionally repressed in UV-irradiated as well as fungal elicitor-treated parsley cells. The timing and extent of repression differed between the two stimuli; the response to light was more transient and smaller in magnitude. These differential responses to light and elicitor were inversely correlated with the induction of phenylalanine ammonia-lyase, a key enzyme of phenylpropanoid metabolism. Essentially the same result was obtained with a defined oligopeptide elicitor, indicating that the same signaling pathway is responsible for defense-related gene activation and cell cycle-related gene repression. A temporary (UV light) or long-lasting (fungal elicitor) cessation of cell culture growth is most likely due to an arrest of cell division which may be a prerequisite for full commitment of the cells to transcriptional activation of full commitment of the cells to transcriptional activation of pathways involved in UV protection or pathogen defense. This conclusion is corroborated by the observation that the histone H3 mRNA level greatly declined around fungal infection sites in young parsley

  11. Nuclear-Cytoplasmic Conflict in Pea (Pisum sativum L.) Is Associated with Nuclear and Plastidic Candidate Genes Encoding Acetyl-CoA Carboxylase Subunits

    Science.gov (United States)

    Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.

    2015-01-01

    In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472

  12. Nuclear-cytoplasmic conflict in pea (Pisum sativum L. is associated with nuclear and plastidic candidate genes encoding acetyl-CoA carboxylase subunits.

    Directory of Open Access Journals (Sweden)

    Vera S Bogdanova

    Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.

  13. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  14. CRISPR/Cas systems: new players in gene regulation and bacterial physiology

    Directory of Open Access Journals (Sweden)

    David eWeiss

    2014-04-01

    Full Text Available CRISPR-Cas systems are bacterial defenses against foreign nucleic acids derived from bacteriophages, plasmids or other sources. These systems are targeted in an RNA-dependent, sequence-specific manner, and are also adaptive, providing protection against previously encountered foreign elements. In addition to their canonical function in defense against foreign nucleic acid, their roles in various aspects of bacterial physiology are now being uncovered. We recently revealed a role for a Cas9-based Type II CRISPR-Cas system in the control of endogenous gene expression, a novel form of prokaryotic gene regulation. Cas9 functions in association with two small RNAs to target and alter the stability of an endogenous transcript encoding a bacterial lipoprotein (BLP. Since BLPs are recognized by the host innate immune protein Toll-like Receptor 2 (TLR2, CRISPR-Cas-mediated repression of BLP expression facilitates evasion of TLR2 by the intracellular bacterial pathogen Francisella novicida, and is essential for its virulence. Here we describe the Cas9 regulatory system in detail, as well as data on its role in controlling virulence traits of Neisseria meningitidis and Campylobacter jejuni. We also discuss potential roles of CRISPR-Cas systems in the response to envelope stress and other aspects of bacterial physiology. Since ~45% of bacteria and ~83% of Archaea encode these machineries, the newly appreciated regulatory functions of CRISPR-Cas systems are likely to play broad roles in controlling the pathogenesis and physiology of diverse prokaryotes.

  15. AFLP markers for the R-gene in the flea beetle, Phyllotreta nemorum, conferring resistance to defenses in Barbarea vulgaris

    NARCIS (Netherlands)

    Breuker, C.J.; Victoir, K.; Jong, de P.W.; Meijden, van der E.; Brakefield, P.M.; Vrieling, K.

    2005-01-01

    A so-called R-gene renders the yellow-striped flea beetle Phyllotreta nemorum L. (Coleoptera: Chrysomelidae: Alticinae) resistant to the defenses of the yellow rocket Barbarea vulgaris R.Br. (Brassicacea) and enables it to use it as a host plant in Denmark. In this study, genetic markers for an

  16. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  17. Stress tolerances of nullmutants of function-unknown genes encoding menadione stress-responsive proteins in Aspergillus nidulans.

    Science.gov (United States)

    Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István

    2016-07-01

    A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  18. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  19. Whiteflies interfere with indirect plant defense against spider mites in Lima bean

    Science.gov (United States)

    Zhang, Peng-Jun; Zheng, Si-Jun; van Loon, Joop J. A.; Boland, Wilhelm; David, Anja; Mumm, Roland; Dicke, Marcel

    2009-01-01

    Plants under herbivore attack are able to initiate indirect defense by synthesizing and releasing complex blends of volatiles that attract natural enemies of the herbivore. However, little is known about how plants respond to infestation by multiple herbivores, particularly if these belong to different feeding guilds. Here, we report the interference by a phloem-feeding insect, the whitefly Bemisia tabaci, with indirect plant defenses induced by spider mites (Tetranychus urticae) in Lima bean (Phaseolus lunatus) plants. Additional whitefly infestation of spider-mite infested plants resulted in a reduced attraction of predatory mites (Phytoseiulus persimilis) compared to attraction to plants infested by spider mites only. This interference is shown to result from the reduction in (E)-β-ocimene emission from plants infested by both spider mites and whiteflies. When using exogenous salicylic acid (SA) application to mimic B. tabaci infestation, we observed similar results in behavioral and chemical analyses. Phytohormone and gene-expression analyses revealed that B. tabaci infestation, as well as SA application, inhibited spider mite-induced jasmonic acid (JA) production and reduced the expression of two JA-regulated genes, one of which encodes for the P. lunatus enzyme β-ocimene synthase that catalyzes the synthesis of (E)-β-ocimene. Remarkably, B. tabaci infestation concurrently inhibited SA production induced by spider mites. We therefore conclude that in dual-infested Lima bean plants the suppression of the JA signaling pathway by whitefly feeding is not due to enhanced SA levels. PMID:19965373

  20. Immunoglobulin superfamily members encoded by viruses and their multiple roles in immune evasion.

    Science.gov (United States)

    Farré, Domènec; Martínez-Vicente, Pablo; Engel, Pablo; Angulo, Ana

    2017-05-01

    Pathogens have developed a plethora of strategies to undermine host immune defenses in order to guarantee their survival. For large DNA viruses, these immune evasion mechanisms frequently rely on the expression of genes acquired from host genomes. Horizontally transferred genes include members of the immunoglobulin superfamily, whose products constitute the most diverse group of proteins of vertebrate genomes. Their promiscuous immunoglobulin domains, which comprise the building blocks of these molecules, are involved in a large variety of functions mediated by ligand-binding interactions. The flexible structural nature of the immunoglobulin domains makes them appealing targets for viral capture due to their capacity to generate high functional diversity. Here, we present an up-to-date review of immunoglobulin superfamily gene homologs encoded by herpesviruses, poxviruses, and adenoviruses, that include CD200, CD47, Fc receptors, interleukin-1 receptor 2, interleukin-18 binding protein, CD80, carcinoembryonic antigen-related cell adhesion molecules, and signaling lymphocyte activation molecules. We discuss their distinct structural attributes, binding properties, and functions, shaped by evolutionary pressures to disarm specific immune pathways. We include several novel genes identified from extensive genome database surveys. An understanding of the properties and modes of action of these viral proteins may guide the development of novel immune-modulatory therapeutic tools. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  1. CLE peptide-encoding gene families in Medicago truncatula and Lotus japonicus, compared with those of soybean, common bean and Arabidopsis

    DEFF Research Database (Denmark)

    Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M

    2017-01-01

    these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...

  2. PRGPred: A platform for prediction of domains of resistance gene analogue (RGA in Arecaceae developed using machine learning algorithms

    Directory of Open Access Journals (Sweden)

    MATHODIYIL S. MANJULA

    2015-12-01

    Full Text Available Plant disease resistance genes (R-genes are responsible for initiation of defense mechanism against various phytopathogens. The majority of plant R-genes are members of very large multi-gene families, which encode structurally related proteins containing nucleotide binding site domains (NBS and C-terminal leucine rich repeats (LRR. Other classes possess' an extracellular LRR domain, a transmembrane domain and sometimes, an intracellular serine/threonine kinase domain. R-proteins work in pathogen perception and/or the activation of conserved defense signaling networks. In the present study, sequences representing resistance gene analogues (RGAs of coconut, arecanut, oil palm and date palm were collected from NCBI, sorted based on domains and assembled into a database. The sequences were analyzed in PRINTS database to find out the conserved domains and their motifs present in the RGAs. Based on these domains, we have also developed a tool to predict the domains of palm R-genes using various machine learning algorithms. The model files were selected based on the performance of the best classifier in training and testing. All these information is stored and made available in the online ‘PRGpred' database and prediction tool.

  3. Geographical variation in the presence of genes encoding superantigenic exotoxins and beta-hemolysin among Staphylococcus aureus isolated from bovine mastitis in Europe and USA

    DEFF Research Database (Denmark)

    Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.

    2002-01-01

    The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...

  4. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  5. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites§

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-01-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118

  6. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  7. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  8. Defects in rhizobial cyclic glucan and lipopolysaccharide synthesis alter legume gene expression during nodule development

    DEFF Research Database (Denmark)

    D'Antuono, Alejandra L; Ott, Thomas; Krusell, Lene

    2008-01-01

    cDNA array technology was used to compare transcriptome profiles of Lotus japonicus roots inoculated with a Mesorhizobium loti wild-type and two mutant strains affected in cyclic beta(1-2) glucan synthesis (cgs) and in lipopolysaccharide synthesis (lpsbeta2). Expression of genes associated...... with the development of a fully functional nodule was significantly affected in plants inoculated with the cgs mutant. Array results also revealed that induction of marker genes for nodule development was delayed when plants were inoculated with the lpsbeta2 mutant. Quantitative real-time reverse......-transcriptase polymerase chain reaction was used to quantify gene expression of a subset of genes involved in plant defense response, redox metabolism, or genes that encode for nodulins. The majority of the genes analyzed in this study were more highly expressed in roots inoculated with the wild type compared with those...

  9. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  10. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  11. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  12. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  13. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  14. More JAZ in the orchestration of jasmonate-mediated plant defense

    NARCIS (Netherlands)

    Zhou, Meiliang

    2014-01-01

    Jasmonates (JAs) are plant hormones that regulate defense against microbial pathogens and insect herbivores via two antagonistic branches of the JAs signaling pathway leading to activation of distinct sets of defense genes. In Arabidopsis thaliana defense against herbivores is regulated by JAs alone

  15. Microbial Genomics: The Expanding Universe of Bacterial Defense Systems.

    Science.gov (United States)

    Forsberg, Kevin J; Malik, Harmit S

    2018-04-23

    Bacteria protect themselves against infection using multiple defensive systems that move by horizontal gene transfer and accumulate in genomic 'defense islands'. A recent study exploited these features to uncover ten novel defense systems, substantially expanding the catalog of bacterial defense systems and predicting the discovery of many more. Copyright © 2018 Elsevier Ltd. All rights reserved.

  16. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  17. EBV tegument protein BNRF1 disrupts DAXX-ATRX to activate viral early gene transcription.

    Directory of Open Access Journals (Sweden)

    Kevin Tsai

    2011-11-01

    Full Text Available Productive infection by herpesviruses involve the disabling of host-cell intrinsic defenses by viral encoded tegument proteins. Epstein-Barr Virus (EBV typically establishes a non-productive, latent infection and it remains unclear how it confronts the host-cell intrinsic defenses that restrict viral gene expression. Here, we show that the EBV major tegument protein BNRF1 targets host-cell intrinsic defense proteins and promotes viral early gene activation. Specifically, we demonstrate that BNRF1 interacts with the host nuclear protein Daxx at PML nuclear bodies (PML-NBs and disrupts the formation of the Daxx-ATRX chromatin remodeling complex. We mapped the Daxx interaction domain on BNRF1, and show that this domain is important for supporting EBV primary infection. Through reverse transcription PCR and infection assays, we show that BNRF1 supports viral gene expression upon early infection, and that this function is dependent on the Daxx-interaction domain. Lastly, we show that knockdown of Daxx and ATRX induces reactivation of EBV from latently infected lymphoblastoid cell lines (LCLs, suggesting that Daxx and ATRX play a role in the regulation of viral chromatin. Taken together, our data demonstrate an important role of BNRF1 in supporting EBV early infection by interacting with Daxx and ATRX; and suggest that tegument disruption of PML-NB-associated antiviral resistances is a universal requirement for herpesvirus infection in the nucleus.

  18. EBV Tegument Protein BNRF1 Disrupts DAXX-ATRX to Activate Viral Early Gene Transcription

    Science.gov (United States)

    Tsai, Kevin; Thikmyanova, Nadezhda; Wojcechowskyj, Jason A.; Delecluse, Henri-Jacques; Lieberman, Paul M.

    2011-01-01

    Productive infection by herpesviruses involve the disabling of host-cell intrinsic defenses by viral encoded tegument proteins. Epstein-Barr Virus (EBV) typically establishes a non-productive, latent infection and it remains unclear how it confronts the host-cell intrinsic defenses that restrict viral gene expression. Here, we show that the EBV major tegument protein BNRF1 targets host-cell intrinsic defense proteins and promotes viral early gene activation. Specifically, we demonstrate that BNRF1 interacts with the host nuclear protein Daxx at PML nuclear bodies (PML-NBs) and disrupts the formation of the Daxx-ATRX chromatin remodeling complex. We mapped the Daxx interaction domain on BNRF1, and show that this domain is important for supporting EBV primary infection. Through reverse transcription PCR and infection assays, we show that BNRF1 supports viral gene expression upon early infection, and that this function is dependent on the Daxx-interaction domain. Lastly, we show that knockdown of Daxx and ATRX induces reactivation of EBV from latently infected lymphoblastoid cell lines (LCLs), suggesting that Daxx and ATRX play a role in the regulation of viral chromatin. Taken together, our data demonstrate an important role of BNRF1 in supporting EBV early infection by interacting with Daxx and ATRX; and suggest that tegument disruption of PML-NB-associated antiviral resistances is a universal requirement for herpesvirus infection in the nucleus. PMID:22102817

  19. Heterogeneous genetic diversity pattern in Plasmodium vivax genes encoding merozoite surface proteins (MSP) -7E, -7F and -7L.

    Science.gov (United States)

    Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A

    2014-12-13

    The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.

  20. Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.

    Science.gov (United States)

    Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A

    1993-09-15

    Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.

  1. Apoplastic peroxidases are required for salicylic acid-mediated defense against Pseudomonas syringae.

    Science.gov (United States)

    Mammarella, Nicole D; Cheng, Zhenyu; Fu, Zheng Qing; Daudi, Arsalan; Bolwell, G Paul; Dong, Xinnian; Ausubel, Frederick M

    2015-04-01

    Reactive oxygen species (ROS) generated by NADPH oxidases or apoplastic peroxidases play an important role in the plant defense response. Diminished expression of at least two Arabidopsis thaliana peroxidase encoding genes, PRX33 (At3g49110) and PRX34 (At3g49120), as a consequence of anti-sense expression of a heterologous French bean peroxidase gene (asFBP1.1), were previously shown to result in reduced levels of ROS following pathogen attack, enhanced susceptibility to a variety of bacterial and fungal pathogens, and reduced levels of callose production and defense-related gene expression in response to the microbe associated molecular pattern (MAMP) molecules flg22 and elf26. These data demonstrated that the peroxidase-dependent oxidative burst plays an important role in the elicitation of pattern-triggered immunity (PTI). Further work reported in this paper, however, shows that asFBP1.1 antisense plants are not impaired in all PTI-associated responses. For example, some but not all flg22-elicited genes are induced to lower levels by flg22 in asFPB1.1, and callose deposition in asFPB1.1 is similar to wild-type following infiltration with a Pseudomonas syringae hrcC mutant or with non-host P. syringae pathovars. Moreover, asFPB1.1 plants did not exhibit any apparent defect in their ability to mount a hypersensitive response (HR). On the other hand, salicylic acid (SA)-mediated activation of PR1 was dramatically impaired in asFPB1.1 plants. In addition, P. syringae-elicited expression of many genes known to be SA-dependent was significantly reduced in asFBP1.1 plants. Consistent with this latter result, in asFBP1.1 plants the key regulator of SA-mediated responses, NPR1, showed both dramatically decreased total protein abundance and a failure to monomerize, which is required for its translocation into the nucleus. Copyright © 2014 Elsevier Ltd. All rights reserved.

  2. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    Directory of Open Access Journals (Sweden)

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  3. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  4. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  5. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  6. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  7. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  8. An antiviral defense role of AGO2 in plants.

    Directory of Open Access Journals (Sweden)

    Jagger J W Harvey

    2011-01-01

    Full Text Available Argonaute (AGO proteins bind to small-interfering (siRNAs and micro (miRNAs to target RNA silencing against viruses, transgenes and in regulation of mRNAs. Plants encode multiple AGO proteins but, in Arabidopsis, only AGO1 is known to have an antiviral role.To uncover the roles of specific AGOs in limiting virus accumulation we inoculated turnip crinkle virus (TCV to Arabidopsis plants that were mutant for each of the ten AGO genes. The viral symptoms on most of the plants were the same as on wild type plants although the ago2 mutants were markedly hyper-susceptible to this virus. ago2 plants were also hyper-susceptible to cucumber mosaic virus (CMV, confirming that the antiviral role of AGO2 is not specific to a single virus. For both viruses, this phenotype was associated with transient increase in virus accumulation. In wild type plants the AGO2 protein was induced by TCV and CMV infection.Based on these results we propose that there are multiple layers to RNA-mediated defense and counter-defense in the interactions between plants and their viruses. AGO1 represents a first layer. With some viruses, including TCV and CMV, this layer is overcome by viral suppressors of silencing that can target AGO1 and a second layer involving AGO2 limits virus accumulation. The second layer is activated when the first layer is suppressed because AGO2 is repressed by AGO1 via miR403. The activation of the second layer is therefore a direct consequence of the loss of the first layer of defense.

  9. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  10. Molecular detection of genes encoding AcrAB , Qep A efflux pumps in Klebsiella pneumoniae strains isolated from hospitalized patients in selected hospitals in Tehran

    Directory of Open Access Journals (Sweden)

    Mohsen Heidary

    2017-03-01

    Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae  (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.

  11. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    Science.gov (United States)

    2010-01-01

    Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158

  12. Gene encoding γ-carbonic anhydrase is cotranscribed with argC and induced in response to stationary phase and high CO2 in Azospirillum brasilense Sp7

    Directory of Open Access Journals (Sweden)

    Mishra Mukti N

    2010-07-01

    Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.

  13. Seaweed Polysaccharides and Derived Oligosaccharides Stimulate Defense Responses and Protection Against Pathogens in Plants

    Directory of Open Access Journals (Sweden)

    Alejandra Moenne

    2011-11-01

    Full Text Available Plants interact with the environment by sensing “non-self” molecules called elicitors derived from pathogens or other sources. These molecules bind to specific receptors located in the plasma membrane and trigger defense responses leading to protection against pathogens. In particular, it has been shown that cell wall and storage polysaccharides from green, brown and red seaweeds (marine macroalgae corresponding to ulvans, alginates, fucans, laminarin and carrageenans can trigger defense responses in plants enhancing protection against pathogens. In addition, oligosaccharides obtained by depolymerization of seaweed polysaccharides also induce protection against viral, fungal and bacterial infections in plants. In particular, most seaweed polysaccharides and derived oligosaccharides trigger an initial oxidative burst at local level and the activation of salicylic (SA, jasmonic acid (JA and/or ethylene signaling pathways at systemic level. The activation of these signaling pathways leads to an increased expression of genes encoding: (i Pathogenesis-Related (PR proteins with antifungal and antibacterial activities; (ii defense enzymes such as pheylalanine ammonia lyase (PAL and lipoxygenase (LOX which determine accumulation of phenylpropanoid compounds (PPCs and oxylipins with antiviral, antifugal and antibacterial activities and iii enzymes involved in synthesis of terpenes, terpenoids and/or alkaloids having antimicrobial activities. Thus, seaweed polysaccharides and their derived oligosaccharides induced the accumulation of proteins and compounds with antimicrobial activities that determine, at least in part, the enhanced protection against pathogens in plants.

  14. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    Science.gov (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

    2013-03-01

    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  15. Mutations in pncA, a gene encoding pyrazinamidase/nicotinamidase, cause resistance to the antituberculous drug pyrazinamide in tubercle bacillus.

    Science.gov (United States)

    Scorpio, A; Zhang, Y

    1996-06-01

    Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.

  16. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    Science.gov (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  17. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

  18. Role of proline and pyrroline-5-carboxylate metabolism in plant defense against invading pathogens

    Science.gov (United States)

    Qamar, Aarzoo; Mysore, Kirankumar S.; Senthil-Kumar, Muthappa

    2015-01-01

    Pyrroline-5-carboxylate (P5C) is an intermediate product of both proline biosynthesis and catabolism. Recent evidences indicate that proline-P5C metabolism is tightly regulated in plants, especially during pathogen infection and abiotic stress. However, role of P5C and its metabolism in plants has not yet been fully understood. Studies indicate that P5C synthesized in mitochondria has a role in both resistance (R)-gene-mediated and non-host resistance against invading pathogens. Proline dehydrogenase and delta-ornithine amino transferase-encoding genes, both involved in P5C synthesis in mitochondria are implicated in defense response of Nicotiana benthamiana and Arabidopsis thaliana against bacterial pathogens. Such defense response is proposed to involve salicylic acid-dependent pathway, reactive oxygen species (ROS) and hypersensitive response (HR)-associated cell death. Recently HR, a form of programmed cell death (PCD), has been proposed to be induced by changes in mitochondrial P5C synthesis or the increase in P5C levels per se in plants inoculated with either a host pathogen carrying suitable avirulent (Avr) gene or a non-host pathogen. Consistently, A. thaliana mutant plants deficient in P5C catabolism showed HR like cell death when grown in external P5C or proline supplemented medium. Similarly, yeast and plant cells under oxidative stress were shown to increase ROS production and PCD due to increase in P5C levels. Similar mechanism has also been reported as one of the triggers for apoptosis in mammalian cells. This review critically analyzes results from various studies and enumerates the pathways for regulation of P5C levels in the plant cell, especially in mitochondria, during pathogen infection. Further, mechanisms regulating P5C- mediated defense responses, namely HR are outlined. This review also provides new insights into the differential role of proline-P5C metabolism in plants exposed to pathogen infection. PMID:26217357

  19. Isolation of Nicotiana plumbaginifolia cDNAs encoding isoforms of serine acetyltransferase and O-acetylserine (thiol) lyase in a yeast two-hybrid system with Escherichia coli cysE and cysK genes as baits.

    Science.gov (United States)

    Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka

    2005-01-01

    We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.

  20. Jasmonate-dependent modifications of the pectin matrix during potato development function as a defense mechanism targeted by Dickeya dadantii virulence factors.

    Science.gov (United States)

    Taurino, Marco; Abelenda, Jose A; Río-Alvarez, Isabel; Navarro, Cristina; Vicedo, Begonya; Farmaki, Theodora; Jiménez, Pedro; García-Agustín, Pilar; López-Solanilla, Emilia; Prat, Salomé; Rojo, Enrique; Sánchez-Serrano, José J; Sanmartín, Maite

    2014-02-01

    The plant cell wall constitutes an essential protection barrier against pathogen attack. In addition, cell-wall disruption leads to accumulation of jasmonates (JAs), which are key signaling molecules for activation of plant inducible defense responses. However, whether JAs in return modulate the cell-wall composition to reinforce this defensive barrier remains unknown. The enzyme 13-allene oxide synthase (13-AOS) catalyzes the first committed step towards biosynthesis of JAs. In potato (Solanum tuberosum), there are two putative St13-AOS genes, which we show here to be differentially induced upon wounding. We also determine that both genes complement an Arabidopsis aos null mutant, indicating that they encode functional 13-AOS enzymes. Indeed, transgenic potato plants lacking both St13-AOS genes (CoAOS1/2 lines) exhibited a significant reduction of JAs, a concomitant decrease in wound-responsive gene activation, and an increased severity of soft rot disease symptoms caused by Dickeya dadantii. Intriguingly, a hypovirulent D. dadantii pel strain lacking the five major pectate lyases, which causes limited tissue maceration on wild-type plants, regained infectivity in CoAOS1/2 plants. In line with this, we found differences in pectin methyl esterase activity and cell-wall pectin composition between wild-type and CoAOS1/2 plants. Importantly, wild-type plants had pectins with a lower degree of methyl esterification, which are the substrates of the pectate lyases mutated in the pel strain. These results suggest that, during development of potato plants, JAs mediate modification of the pectin matrix to form a defensive barrier that is counteracted by pectinolytic virulence factors from D. dadantii. © 2013 The Authors The Plant Journal © 2013 John Wiley & Sons Ltd.

  1. Phytohormone and Putative Defense Gene Expression Differentiates the Response of ‘Hayward’ Kiwifruit to Psa and Pfm Infections

    Directory of Open Access Journals (Sweden)

    Kirstin V. Wurms

    2017-08-01

    Full Text Available Pseudomonas syringae pv. actinidiae (Psa and Pseudomonas syringae pv. actinidifoliorum (Pfm are closely related pathovars infecting kiwifruit, but Psa is considered one of the most important global pathogens, whereas Pfm is not. In this study of Actinidia deliciosa ‘Hayward’ responses to the two pathovars, the objective was to test whether differences in plant defense responses mounted against the two pathovars correlated with the contrasting severity of the symptoms caused by them. Results showed that Psa infections were always more severe than Pfm infections, and were associated with highly localized, differential expression of phytohormones and putative defense gene transcripts in stem tissue closest to the inoculation site. Phytohormone concentrations of jasmonic acid (JA, jasmonate isoleucine (JA-Ile, salicylic acid (SA and abscisic acid were always greater in stem tissue than in leaves, and leaf phytohormones were not affected by pathogen inoculation. Pfm inoculation induced a threefold increase in SA in stems relative to Psa inoculation, and a smaller 1.6-fold induction of JA. Transcript expression showed no effect of inoculation in leaves, but Pfm inoculation resulted in the greatest elevation of the SA marker genes, PR1 and glucan endo-1,3-beta-glucosidase (β-1,3-glucosidase (32- and 25-fold increases, respectively in stem tissue surrounding the inoculation site. Pfm inoculation also produced a stronger response than Psa inoculation in localized stem tissue for the SA marker gene PR6, jasmonoyl-isoleucine-12-hydrolase (JIH1, which acts as a negative marker of the JA pathway, and APETALA2/Ethylene response factor 2 transcription factor (AP2 ERF2, which is involved in JA/SA crosstalk. WRKY40 transcription factor (a SA marker was induced equally in stems by wounding (mock inoculation and pathovar inoculation. Taken together, these results suggest that the host appears to mount a stronger, localized, SA-based defense response to Pfm

  2. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  3. Construction of a genetically modified wine yeast strain expressing the Aspergillus aculeatus rhaA gene, encoding an -L-Rhamnosidase of enological interest

    NARCIS (Netherlands)

    Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.

    2003-01-01

    The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain

  4. Identification and validation of human papillomavirus encoded microRNAs.

    Directory of Open Access Journals (Sweden)

    Kui Qian

    Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.

  5. The 380 kb pCMU01 plasmid encodes chloromethane utilization genes and redundant genes for vitamin B12- and tetrahydrofolate-dependent chloromethane metabolism in Methylobacterium extorquens CM4: a proteomic and bioinformatics study.

    Directory of Open Access Journals (Sweden)

    Sandro Roselli

    Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of

  6. Gene Expression Profiling Soybean Stem Tissue Early Response to Sclerotinia sclerotiorum and In Silico Mapping in Relation to Resistance Markers

    Directory of Open Access Journals (Sweden)

    Bernarda Calla

    2009-07-01

    Full Text Available White mold, caused by (Lib. de Bary, can be a serious disease of crops grown under cool, moist environments. In many plants, such as soybean [ (L. Merr.], complete genetic resistance does not exist. To identify possible genes involved in defense against this pathogen, and to determine possible physiological changes that occur during infection, a microarray screen was conducted using stem tissue to evaluate changes in gene expression between partially resistant and susceptible soybean genotypes at 8 and 14 hours post inoculation. RNA from 15 day-old inoculated plants was labeled and hybridized to soybean cDNA microarrays. ANOVA identified 1270 significant genes from the comparison between time points and 105 genes from the comparison between genotypes. Selected genes were classified into functional categories. The analyses identified changes in cell-wall composition and signaling pathways, as well as suggesting a role for anthocyanin and anthocyanidin synthesis in the defense against . In-silico mapping of both the differentially expressed transcripts and of public markers associated with partial resistance to white mold, provided evidence of several differentially expressed genes being closely positioned to white mold resistance markers, with the two most promising genes encoding a PR-5 and anthocyanidin synthase.

  7. A gene encoding maize caffeoyl-CoA O-methyltransferase confers quantitative resistance to multiple pathogens.

    Science.gov (United States)

    Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter

    2017-09-01

    Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.

  8. Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

    Directory of Open Access Journals (Sweden)

    Wang Yu

    2011-04-01

    Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15

  9. Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1.

    Science.gov (United States)

    Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang

    2011-04-06

    In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and

  10. A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

    Science.gov (United States)

    Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

    2017-01-01

    Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

  11. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  12. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  13. Molecular Cloning and Nucleotide Sequence of the Gene Encoding the Major Peptidoglycan Hydrolase of Lactococcus lactis, a Muramidase Needed for Cell Separation

    NARCIS (Netherlands)

    Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.

    A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,

  14. Linkage of the gene that encodes the alpha 1 chain of type V collagen (COL5A1) to type II Ehlers-Danlos syndrome (EDS II).

    Science.gov (United States)

    Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B

    1995-09-01

    Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.

  15. Clustering, haplotype diversity and locations of MIC-3: a unique root-specific defense-related gene family in upland cotton (Gossypium hirsutum L.)

    Science.gov (United States)

    MIC-3-related genes of cotton (Gossypium spp.) were identified and shown to have root-specific expression, associated with pathogen defense-related function and specifically increased expression in root-knot nematode (RKN) resistant plants after nematode infection. Here we cloned and sequenced MIC-...

  16. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  17. A member of a new plant gene family encoding a meprin and TRAF homology (MATH) domain-containing protein is involved in restriction of long distance movement of plant viruses

    Science.gov (United States)

    Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie

    2010-01-01

    Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558

  18. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

    Science.gov (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

    2009-08-01

    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  19. MUREIN-METABOLIZING ENZYMES FROM ESCHERICHIA-COLI - SEQUENCE-ANALYSIS AND CONTROLLED OVEREXPRESSION OF THE SLT GENE, WHICH ENCODES THE SOLUBLE LYTIC TRANSGLYCOSYLASE

    NARCIS (Netherlands)

    ENGEL, H; KAZEMIER, B; KECK, W

    The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or

  20. Mapping of the gene encoding the. beta. -amyloid precursor protein and its relationship to the Down syndrome region of chromosome 21

    Energy Technology Data Exchange (ETDEWEB)

    Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))

    1988-11-01

    The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.

  1. MicroRNA expression in rainbow trout (Oncorhynchus mykiss) vaccinated with a DNA vaccine encoding the glycoprotein gene of Viral hemorrhagic septicemia virus

    DEFF Research Database (Denmark)

    Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels

    particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...

  2. A Rice Gene Homologous to Arabidopsis AGD2-LIKE DEFENSE1 Participates in Disease Resistance Response against Infection with Magnaporthe oryzae

    Directory of Open Access Journals (Sweden)

    Ga Young Jung

    2016-08-01

    Full Text Available ALD1 (ABERRANT GROWTH AND DEATH2 [AGD2]-LIKE DEFENSE1 is one of the key defense regulators in Arabidopsis thaliana and Nicotiana benthamiana. In these model plants, ALD1 is responsible for triggering basal defense response and systemic resistance against bacterial infection. As well ALD1 is involved in the production of pipecolic acid and an unidentified compound(s for systemic resistance and priming syndrome, respectively. These previous studies proposed that ALD1 is a potential candidate for developing genetically modified (GM plants that may be resistant to pathogen infection. Here we introduce a role of ALD1-LIKE gene of Oryza sativa, named as OsALD1, during plant immunity. OsALD1 mRNA was strongly transcribed in the infected leaves of rice plants by Magnaporthe oryzae, the rice blast fungus. OsALD1 proteins predominantly localized at the chloroplast in the plant cells. GM rice plants over-expressing OsALD1 were resistant to the fungal infection. The stable expression of OsALD1 also triggered strong mRNA expression of PATHOGENESIS-RELATED PROTEIN1 genes in the leaves of rice plants during infection. Taken together, we conclude that OsALD1 plays a role in disease resistance response of rice against the infection with rice blast fungus.

  3. Virally encoded 7TM receptors

    DEFF Research Database (Denmark)

    Rosenkilde, M M; Waldhoer, M; Lüttichau, H R

    2001-01-01

    expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...

  4. Identification of human genes involved in cellular responses to ionizing radiation: molecular and cellular studies of gene encoding the p68 helicase in mammalian cells

    International Nuclear Information System (INIS)

    Menaa, F.

    2003-12-01

    Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)

  5. Overcompensation of herbivore reproduction through hyper-suppression of plant defenses in response to competition.

    Science.gov (United States)

    Schimmel, Bernardus C J; Ataide, Livia M S; Chafi, Rachid; Villarroel, Carlos A; Alba, Juan M; Schuurink, Robert C; Kant, Merijn R

    2017-06-01

    Spider mites are destructive arthropod pests on many crops. The generalist herbivorous mite Tetranychus urticae induces defenses in tomato (Solanum lycopersicum) and this constrains its fitness. By contrast, the Solanaceae-specialist Tetranychus evansi maintains a high reproductive performance by suppressing tomato defenses. Tetranychus evansi outcompetes T. urticae when infesting the same plant, but it is unknown whether this is facilitated by the defenses of the plant. We assessed the extent to which a secondary infestation by a competitor affects local plant defense responses (phytohormones and defense genes), mite gene expression and mite performance. We observed that T. evansi switches to hyper-suppression of defenses after its tomato host is also invaded by its natural competitor T. urticae. Jasmonate (JA) and salicylate (SA) defenses were suppressed more strongly, albeit only locally at the feeding site of T. evansi, upon introduction of T. urticae to the infested leaflet. The hyper-suppression of defenses coincided with increased expression of T. evansi genes coding for salivary defense-suppressing effector proteins and was paralleled by an increased reproductive performance. Together, these observations suggest that T. evansi overcompensates its reproduction through hyper-suppression of plant defenses in response to nearby competitors. We hypothesize that the competitor-induced overcompensation promotes competitive population growth of T. evansi on tomato. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  6. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  7. Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme.

    Science.gov (United States)

    Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O

    1998-01-01

    All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

  8. Potential costs of bacterial infection on storage protein gene expression and reproduction in queenless Apis mellifera worker bees on distinct dietary regimes.

    Science.gov (United States)

    Lourenço, Anete Pedro; Martins, Juliana Ramos; Guidugli-Lazzarini, Karina Rosa; Macedo, Liliane Maria Fróes; Bitondi, Márcia Maria Gentile; Simões, Zilá Luz Paulino

    2012-09-01

    Insects are able to combat infection by initiating an efficient immune response that involves synthesizing antimicrobial peptides and a range of other defense molecules. These responses may be costly to the organism, resulting in it exploiting endogenous resources to maintain homeostasis or support defense to the detriment of other physiological needs. We used queenless worker bees on distinct dietary regimes that may alter hemolymph protein storage and ovary activation to investigate the physiological costs of infection with Serratia marcescens. The expression of the genes encoding the storage proteins vitellogenin and hexamerin 70a, the vitellogenin receptor, and vasa (which has a putative role in reproduction), was impaired in the infected bees. This impairment was mainly evident in the bees fed beebread, which caused significantly higher expression of these genes than did royal jelly or syrup, and this was confirmed at the vitellogenin and hexamerin 70a protein levels. Beebread was also the only diet that promoted ovary activation in the queenless bees, but this activation was significantly impaired by the infection. The expression of the genes encoding the storage proteins apolipophorins-I and -III and the lipophorin receptor was not altered by infection regardless the diet provided to the bees. Similarly, the storage of apolipophorin-I in the hemolymph was only slightly impaired by the infection, independently of the supplied diet. Taken together these results indicate that, infection demands a physiological cost from the transcription of specific protein storage-related genes and from the reproductive capacity. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. The knottin-like Blufensin family regulates genes involved in nuclear import and the secretory pathway in barley-powdery mildew interactions

    Science.gov (United States)

    Xu, Weihui; Meng, Yan; Surana, Priyanka; Fuerst, Greg; Nettleton, Dan; Wise, Roger P.

    2015-01-01

    Plants have evolved complex regulatory mechanisms to control a multi-layered defense response to microbial attack. Both temporal and spatial gene expression are tightly regulated in response to pathogen ingress, modulating both positive and negative control of defense. BLUFENSINs, small knottin-like peptides in barley, wheat, and rice, are highly induced by attack from fungal pathogens, in particular, the obligate biotrophic fungus, Blumeria graminis f. sp. hordei (Bgh), causal agent of barley powdery mildew. Previous research indicated that Blufensin1 (Bln1) functions as a negative regulator of basal defense mechanisms. In the current report, we show that BLN1 and BLN2 can both be secreted to the apoplast and Barley stripe mosaic virus (BSMV)-mediated overexpression of Bln2 increases susceptibility of barley to Bgh. Bimolecular fluorescence complementation (BiFC) assays signify that BLN1 and BLN2 can interact with each other, and with calmodulin. We then used BSMV-induced gene silencing to knock down Bln1, followed by Barley1 GeneChip transcriptome analysis, to identify additional host genes influenced by Bln1. Analysis of differential expression revealed a gene set enriched for those encoding proteins annotated to nuclear import and the secretory pathway, particularly Importin α1-b and Sec61 γ subunits. Further functional analysis of these two affected genes showed that when silenced, they also reduced susceptibility to Bgh. Taken together, we postulate that Bln1 is co-opted by Bgh to facilitate transport of disease-related host proteins or effectors, influencing the establishment of Bgh compatibility on its barley host. PMID:26089830

  10. Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes

    Directory of Open Access Journals (Sweden)

    Nandagopal Murugan

    2018-02-01

    Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.

  11. A WRKY transcription factor from Withania somnifera regulates triterpenoid withanolide accumulation and biotic stress tolerance through modulation of phytosterol and defense pathways.

    Science.gov (United States)

    Singh, Anup Kumar; Kumar, Sarma Rajeev; Dwivedi, Varun; Rai, Avanish; Pal, Shaifali; Shasany, Ajit K; Nagegowda, Dinesh A

    2017-08-01

    Withania somnifera produces pharmacologically important triterpenoid withanolides that are derived via phytosterol pathway; however, their biosynthesis and regulation remain to be elucidated. A jasmonate- and salicin-inducible WRKY transcription factor from W. somnifera (WsWRKY1) exhibiting correlation with withaferin A accumulation was functionally characterized employing virus-induced gene silencing and overexpression studies combined with transcript and metabolite analyses, and chromatin immunoprecipitation assay. WsWRKY1 silencing resulted in stunted plant growth, reduced transcripts of phytosterol pathway genes with corresponding reduction in phytosterols and withanolides in W. somnifera. Its overexpression elevated the biosynthesis of triterpenoids in W. somnifera (phytosterols and withanolides), as well as tobacco and tomato (phytosterols). Moreover, WsWRKY1 binds to W-box sequences in promoters of W. somnifera genes encoding squalene synthase and squalene epoxidase, indicating its direct regulation of triterpenoid pathway. Furthermore, while WsWRKY1 silencing in W. somnifera compromised the tolerance to bacterial growth, fungal infection, and insect feeding, its overexpression in tobacco led to improved biotic stress tolerance. Together these findings demonstrate that WsWRKY1 has a positive regulatory role on phytosterol and withanolides biosynthesis, and defense against biotic stress, highlighting its importance as a metabolic engineering tool for simultaneous improvement of triterpenoid biosynthesis and plant defense. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  12. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  13. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  14. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  15. In vitro efficacy of a gene-activated nerve guidance conduit incorporating non-viral PEI-pDNA nanoparticles carrying genes encoding for NGF, GDNF and c-Jun.

    Science.gov (United States)

    Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J

    2018-06-07

    Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate

  16. Genome-Wide Identification and Analysis of the TIFY Gene Family in Grape

    Science.gov (United States)

    Zhang, Yucheng; Gao, Min; Singer, Stacy D.; Fei, Zhangjun; Wang, Hua; Wang, Xiping

    2012-01-01

    Background The TIFY gene family constitutes a plant-specific group of genes with a broad range of functions. This family encodes four subfamilies of proteins, including ZML, TIFY, PPD and JASMONATE ZIM-Domain (JAZ) proteins. JAZ proteins are targets of the SCFCOI1 complex, and function as negative regulators in the JA signaling pathway. Recently, it has been reported in both Arabidopsis and rice that TIFY genes, and especially JAZ genes, may be involved in plant defense against insect feeding, wounding, pathogens and abiotic stresses. Nonetheless, knowledge concerning the specific expression patterns and evolutionary history of plant TIFY family members is limited, especially in a woody species such as grape. Methodology/Principal Findings A total of two TIFY, four ZML, two PPD and 11 JAZ genes were identified in the Vitis vinifera genome. Phylogenetic analysis of TIFY protein sequences from grape, Arabidopsis and rice indicated that the grape TIFY proteins are more closely related to those of Arabidopsis than those of rice. Both segmental and tandem duplication events have been major contributors to the expansion of the grape TIFY family. In addition, synteny analysis between grape and Arabidopsis demonstrated that homologues of several grape TIFY genes were found in the corresponding syntenic blocks of Arabidopsis, suggesting that these genes arose before the divergence of lineages that led to grape and Arabidopsis. Analyses of microarray and quantitative real-time RT-PCR expression data revealed that grape TIFY genes are not a major player in the defense against biotrophic pathogens or viruses. However, many of these genes were responsive to JA and ABA, but not SA or ET. Conclusion The genome-wide identification, evolutionary and expression analyses of grape TIFY genes should facilitate further research of this gene family and provide new insights regarding their evolutionary history and regulatory control. PMID:22984514

  17. Searching for resistance genes to Bursaphelenchus xylophilus using high throughput screening

    Directory of Open Access Journals (Sweden)

    Santos Carla S

    2012-11-01

    Full Text Available Abstract Background Pine wilt disease (PWD, caused by the pinewood nematode (PWN; Bursaphelenchus xylophilus, damages and kills pine trees and is causing serious economic damage worldwide. Although the ecological mechanism of infestation is well described, the plant’s molecular response to the pathogen is not well known. This is due mainly to the lack of genomic information and the complexity of the disease. High throughput sequencing is now an efficient approach for detecting the expression of genes in non-model organisms, thus providing valuable information in spite of the lack of the genome sequence. In an attempt to unravel genes potentially involved in the pine defense against the pathogen, we hereby report the high throughput comparative sequence analysis of infested and non-infested stems of Pinus pinaster (very susceptible to PWN and Pinus pinea (less susceptible to PWN. Results Four cDNA libraries from infested and non-infested stems of P. pinaster and P. pinea were sequenced in a full 454 GS FLX run, producing a total of 2,083,698 reads. The putative amino acid sequences encoded by the assembled transcripts were annotated according to Gene Ontology, to assign Pinus contigs into Biological Processes, Cellular Components and Molecular Functions categories. Most of the annotated transcripts corresponded to Picea genes-25.4-39.7%, whereas a smaller percentage, matched Pinus genes, 1.8-12.8%, probably a consequence of more public genomic information available for Picea than for Pinus. The comparative transcriptome analysis showed that when P. pinaster was infested with PWN, the genes malate dehydrogenase, ABA, water deficit stress related genes and PAR1 were highly expressed, while in PWN-infested P. pinea, the highly expressed genes were ricin B-related lectin, and genes belonging to the SNARE and high mobility group families. Quantitative PCR experiments confirmed the differential gene expression between the two pine species

  18. Searching for resistance genes to Bursaphelenchus xylophilus using high throughput screening

    Science.gov (United States)

    2012-01-01

    Background Pine wilt disease (PWD), caused by the pinewood nematode (PWN; Bursaphelenchus xylophilus), damages and kills pine trees and is causing serious economic damage worldwide. Although the ecological mechanism of infestation is well described, the plant’s molecular response to the pathogen is not well known. This is due mainly to the lack of genomic information and the complexity of the disease. High throughput sequencing is now an efficient approach for detecting the expression of genes in non-model organisms, thus providing valuable information in spite of the lack of the genome sequence. In an attempt to unravel genes potentially involved in the pine defense against the pathogen, we hereby report the high throughput comparative sequence analysis of infested and non-infested stems of Pinus pinaster (very susceptible to PWN) and Pinus pinea (less susceptible to PWN). Results Four cDNA libraries from infested and non-infested stems of P. pinaster and P. pinea were sequenced in a full 454 GS FLX run, producing a total of 2,083,698 reads. The putative amino acid sequences encoded by the assembled transcripts were annotated according to Gene Ontology, to assign Pinus contigs into Biological Processes, Cellular Components and Molecular Functions categories. Most of the annotated transcripts corresponded to Picea genes-25.4-39.7%, whereas a smaller percentage, matched Pinus genes, 1.8-12.8%, probably a consequence of more public genomic information available for Picea than for Pinus. The comparative transcriptome analysis showed that when P. pinaster was infested with PWN, the genes malate dehydrogenase, ABA, water deficit stress related genes and PAR1 were highly expressed, while in PWN-infested P. pinea, the highly expressed genes were ricin B-related lectin, and genes belonging to the SNARE and high mobility group families. Quantitative PCR experiments confirmed the differential gene expression between the two pine species. Conclusions Defense-related genes

  19. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar.

    Science.gov (United States)

    González, Ana M; Godoy, Luís; Santalla, Marta

    2017-11-23

    Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F₂ populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL), Natural Resistance Associated Macrophage (NRAMP) and Pentatricopeptide Repeat family (PPR) proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s) in UI3 genotype.

  20. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-07-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  1. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    Science.gov (United States)

    Xu, J; Johnson, R C

    1995-06-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.

  2. Reduced Neuronal Transcription of Escargot, the Drosophila Gene Encoding a Snail-Type Transcription Factor, Promotes Longevity

    Science.gov (United States)

    Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.

    2018-01-01

    In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717

  3. Characterization of a Staphylococcal Plasmid Related to pUB110 and Carrying Two Novel Genes, vatC and vgbB, Encoding Resistance to Streptogramins A and B and Similar Antibiotics

    Science.gov (United States)

    Allignet, Jeanine; Liassine, Nadia; El Solh, Névine

    1998-01-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023

  4. Characterization of a staphylococcal plasmid related to pUB110 and carrying two novel genes, vatC and vgbB, encoding resistance to streptogramins A and B and similar antibiotics.

    Science.gov (United States)

    Allignet, J; Liassine, N; el Solh, N

    1998-07-01

    We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.

  5. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

    Science.gov (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

    1997-07-01

    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  6. Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

    Science.gov (United States)

    Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

    1999-07-01

    The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

  7. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  8. The Drosophila melanogaster DmCK2beta transcription unit encodes for functionally non-redundant protein isoforms.

    Science.gov (United States)

    Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas

    2006-06-07

    Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.

  9. Transcriptome analysis describing new immunity and defense genes in peripheral blood mononuclear cells of rheumatoid arthritis patients.

    Directory of Open Access Journals (Sweden)

    Vitor Hugo Teixeira

    Full Text Available BACKGROUND: Large-scale gene expression profiling of peripheral blood mononuclear cells from Rheumatoid Arthritis (RA patients could provide a molecular description that reflects the contribution of diverse cellular responses associated with this disease. The aim of our study was to identify peripheral blood gene expression profiles for RA patients, using Illumina technology, to gain insights into RA molecular mechanisms. METHODOLOGY/PRINCIPAL FINDINGS: The Illumina Human-6v2 Expression BeadChips were used for a complete genome-wide transcript profiling of peripheral blood mononuclear cells (PBMCs from 18 RA patients and 15 controls. Differential analysis per gene was performed with one-way analysis of variance (ANOVA and P values were adjusted to control the False Discovery Rate (FDR<5%. Genes differentially expressed at significant level between patients and controls were analyzed using Gene Ontology (GO in the PANTHER database to identify biological processes. A differentially expression of 339 Reference Sequence genes (238 down-regulated and 101 up-regulated between the two groups was observed. We identified a remarkably elevated expression of a spectrum of genes involved in Immunity and Defense in PBMCs of RA patients compared to controls. This result is confirmed by GO analysis, suggesting that these genes could be activated systemically in RA. No significant down-regulated ontology groups were found. Microarray data were validated by real time PCR in a set of nine genes showing a high degree of correlation. CONCLUSIONS/SIGNIFICANCE: Our study highlighted several new genes that could contribute in the identification of innovative clinical biomarkers for diagnostic procedures and therapeutic interventions.

  10. Isolation and characterisation of cDNA clones representing the genes encoding the major tuber storage protein (dioscorin) of yam (Dioscorea cayenensis Lam.).

    Science.gov (United States)

    Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C

    1995-06-01

    cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.

  11. Cloning and Characterization of the Genes Encoding the Murine Homologues of the Human Melanoma Antigens MART1 and gp100

    Science.gov (United States)

    Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.

    2008-01-01

    The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410

  12. The implications of alternative splicing in the ENCODE protein complement

    DEFF Research Database (Denmark)

    Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam

    2007-01-01

    suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...

  13. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  14. Involvement of Trichoderma harzianum Epl-1 Protein in the Regulation of Botrytis Virulence- and Tomato Defense-Related Genes

    OpenAIRE

    Gomes, Eriston V.; Ulhoa, Cirano J.; Cardoza, Rosa E.; Silva, Roberto N.; Guti?rrez, Santiago

    2017-01-01

    Several Trichoderma spp. are well known for their ability to: (i) act as important biocontrol agents against phytopathogenic fungi; (ii) function as biofertilizers; (iii) increase the tolerance of plants to biotic and abiotic stresses; and (iv) induce plant defense responses via the production and secretion of elicitor molecules. In this study, we analyzed the gene-regulation effects of Trichoderma harzianum Epl-1 protein during the interactions of mutant Δepl-1 or wild-type T. harzianum stra...

  15. Differential gene expression in response to Fusarium oxysporum infection in resistant and susceptible genotypes of flax (Linum usitatissimum L.).

    Science.gov (United States)

    Dmitriev, Alexey A; Krasnov, George S; Rozhmina, Tatiana A; Novakovskiy, Roman O; Snezhkina, Anastasiya V; Fedorova, Maria S; Yurkevich, Olga Yu; Muravenko, Olga V; Bolsheva, Nadezhda L; Kudryavtseva, Anna V; Melnikova, Nataliya V

    2017-12-28

    Flax (Linum usitatissimum L.) is a crop plant used for fiber and oil production. Although potentially high-yielding flax varieties have been developed, environmental stresses markedly decrease flax production. Among biotic stresses, Fusarium oxysporum f. sp. lini is recognized as one of the most devastating flax pathogens. It causes wilt disease that is one of the major limiting factors for flax production worldwide. Breeding and cultivation of flax varieties resistant to F. oxysporum is the most effective method for controlling wilt disease. Although the mechanisms of flax response to Fusarium have been actively studied, data on the plant response to infection and resistance gene candidates are currently very limited. The transcriptomes of two resistant and two susceptible flax cultivars with respect to Fusarium wilt, as well as two resistant BC 2 F 5 populations, which were grown under control conditions or inoculated with F. oxysporum, were sequenced using the Illumina platform. Genes showing changes in expression under F. oxysporum infection were identified in both resistant and susceptible flax genotypes. We observed the predominant overexpression of numerous genes that are involved in defense response. This was more pronounced in resistant cultivars. In susceptible cultivars, significant downregulation of genes involved in cell wall organization or biogenesis was observed in response to F. oxysporum. In the resistant genotypes, upregulation of genes related to NAD(P)H oxidase activity was detected. Upregulation of a number of genes, including that encoding beta-1,3-glucanase, was significantly greater in the cultivars and BC 2 F 5 populations resistant to Fusarium wilt than in susceptible cultivars in response to F. oxysporum infection. Using high-throughput sequencing, we identified genes involved in the early defense response of L. usitatissimum against the fungus F. oxysporum. In response to F. oxysporum infection, we detected changes in the

  16. Structural characteristics of ScBx genes controlling the biosynthesis of hydroxamic acids in rye (Secale cereale L.).

    Science.gov (United States)

    Bakera, Beata; Makowska, Bogna; Groszyk, Jolanta; Niziołek, Michał; Orczyk, Wacław; Bolibok-Brągoszewska, Hanna; Hromada-Judycka, Aneta; Rakoczy-Trojanowska, Monika

    2015-08-01

    Benzoxazinoids (BX) are major secondary metabolites of gramineous plants that play an important role in disease resistance and allelopathy. They also have many other unique properties including anti-bacterial and anti-fungal activity, and the ability to reduce alfa-amylase activity. The biosynthesis and modification of BX are controlled by the genes Bx1 ÷ Bx10, GT and glu, and the majority of these Bx genes have been mapped in maize, wheat and rye. However, the genetic basis of BX biosynthesis remains largely uncharacterized apart from some data from maize and wheat. The aim of this study was to isolate, sequence and characterize five genes (ScBx1, ScBx2, ScBx3, ScBx4 and ScBx5) encoding enzymes involved in the synthesis of DIBOA, an important defense compound of rye. Using a modified 3D procedure of BAC library screening, seven BAC clones containing all of the ScBx genes were isolated and sequenced. Bioinformatic analyses of the resulting contigs were used to examine the structure and other features of these genes, including their promoters, introns and 3'UTRs. Comparative analysis showed that the ScBx genes are similar to those of other Poaceae species, especially to the TaBx genes. The polymorphisms present both in the coding sequences and non-coding regions of ScBx in relation to other Bx genes are predicted to have an impact on the expression, structure and properties of the encoded proteins.

  17. Metabolic consequences of knocking out UGT85B1, the gene encoding the glucosyltransferase required for synthesis of dhurrin in Sorghum bicolor (L. Moench)

    DEFF Research Database (Denmark)

    Blomstedt, Cecilia K; O'Donnell, Natalie H; Bjarnholt, Nanna

    2016-01-01

    Many important food crops produce cyanogenic glucosides as natural defense compounds to protect against herbivory or pathogen attack. It has also been suggested that these nitrogen-based secondary metabolites act as storage reserves of nitrogen. In sorghum, three key genes, CYP79A1, CYP71E1 and U...

  18. The polyketide components of waxes and the Cer-cqu gene cluster encoding a novel polyketide synthase, the β-diketone synthase, DKS

    DEFF Research Database (Denmark)

    von Wettstein, Penny

    2017-01-01

    The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...

  19. Global analysis of gene expression in response to L-Cysteine deprivation in the anaerobic protozoan parasite Entamoeba histolytica

    Science.gov (United States)

    2011-01-01

    Background Entamoeba histolytica, an enteric protozoan parasite, causes amebic colitis and extra intestinal abscesses in millions of inhabitants of endemic areas. E. histolytica completely lacks glutathione metabolism but possesses L-cysteine as the principle low molecular weight thiol. L-Cysteine is essential for the structure, stability, and various protein functions, including catalysis, electron transfer, redox regulation, nitrogen fixation, and sensing for regulatory processes. Recently, we demonstrated that in E. histolytica, L-cysteine regulates various metabolic pathways including energy, amino acid, and phospholipid metabolism. Results In this study, employing custom-made Affymetrix microarrays, we performed time course (3, 6, 12, 24, and 48 h) gene expression analysis upon L-cysteine deprivation. We identified that out of 9,327 genes represented on the array, 290 genes encoding proteins with functions in metabolism, signalling, DNA/RNA regulation, electron transport, stress response, membrane transport, vesicular trafficking/secretion, and cytoskeleton were differentially expressed (≥3 fold) at one or more time points upon L-cysteine deprivation. Approximately 60% of these modulated genes encoded proteins of no known function and annotated as hypothetical proteins. We also attempted further functional analysis of some of the most highly modulated genes by L-cysteine depletion. Conclusions To our surprise, L-cysteine depletion caused only limited changes in the expression of genes involved in sulfur-containing amino acid metabolism and oxidative stress defense. In contrast, we observed significant changes in the expression of several genes encoding iron sulfur flavoproteins, a major facilitator super-family transporter, regulator of nonsense transcripts, NADPH-dependent oxido-reductase, short chain dehydrogenase, acetyltransferases, and various other genes involved in diverse cellular functions. This study represents the first genome-wide analysis of

  20. Global analysis of gene expression in response to L-Cysteine deprivation in the anaerobic protozoan parasite Entamoeba histolytica

    Directory of Open Access Journals (Sweden)

    Jeelani Ghulam

    2011-05-01

    Full Text Available Abstract Background Entamoeba histolytica, an enteric protozoan parasite, causes amebic colitis and extra intestinal abscesses in millions of inhabitants of endemic areas. E. histolytica completely lacks glutathione metabolism but possesses L-cysteine as the principle low molecular weight thiol. L-Cysteine is essential for the structure, stability, and various protein functions, including catalysis, electron transfer, redox regulation, nitrogen fixation, and sensing for regulatory processes. Recently, we demonstrated that in E. histolytica, L-cysteine regulates various metabolic pathways including energy, amino acid, and phospholipid metabolism. Results In this study, employing custom-made Affymetrix microarrays, we performed time course (3, 6, 12, 24, and 48 h gene expression analysis upon L-cysteine deprivation. We identified that out of 9,327 genes represented on the array, 290 genes encoding proteins with functions in metabolism, signalling, DNA/RNA regulation, electron transport, stress response, membrane transport, vesicular trafficking/secretion, and cytoskeleton were differentially expressed (≥3 fold at one or more time points upon L-cysteine deprivation. Approximately 60% of these modulated genes encoded proteins of no known function and annotated as hypothetical proteins. We also attempted further functional analysis of some of the most highly modulated genes by L-cysteine depletion. Conclusions To our surprise, L-cysteine depletion caused only limited changes in the expression of genes involved in sulfur-containing amino acid metabolism and oxidative stress defense. In contrast, we observed significant changes in the expression of several genes encoding iron sulfur flavoproteins, a major facilitator super-family transporter, regulator of nonsense transcripts, NADPH-dependent oxido-reductase, short chain dehydrogenase, acetyltransferases, and various other genes involved in diverse cellular functions. This study represents the first

  1. The antimicrobial resistance monitoring and research (ARMoR) program: the US Department of Defense response to escalating antimicrobial resistance.

    Science.gov (United States)

    Lesho, Emil P; Waterman, Paige E; Chukwuma, Uzo; McAuliffe, Kathryn; Neumann, Charlotte; Julius, Michael D; Crouch, Helen; Chandrasekera, Ruvani; English, Judith F; Clifford, Robert J; Kester, Kent E

    2014-08-01

    Responding to escalating antimicrobial resistance (AMR), the US Department of Defense implemented an enterprise-wide collaboration, the Antimicrobial Resistance Monitoring and Research Program, to aid in infection prevention and control. It consists of a network of epidemiologists, bioinformaticists, microbiology researchers, policy makers, hospital-based infection preventionists, and healthcare providers who collaborate to collect relevant AMR data, conduct centralized molecular characterization, and use AMR characterization feedback to implement appropriate infection prevention and control measures and influence policy. A particularly concerning type of AMR, carbapenem-resistant Enterobacteriaceae, significantly declined after the program was launched. Similarly, there have been no further reports or outbreaks of another concerning type of AMR, colistin resistance in Acinetobacter, in the Department of Defense since the program was initiated. However, bacteria containing AMR-encoding genes are increasing. To update program stakeholders and other healthcare systems facing such challenges, we describe the processes and impact of the program. Published by Oxford University Press on behalf of the Infectious Diseases Society of America 2014. This work is written by (a) US Government employee(s) and is in the public domain in the US.

  2. Effect of temperature on the fate of genes encoding tetracycline resistance and the integrase of class 1 integrons within anaerobic and aerobic digesters treating municipal wastewater solids.

    Science.gov (United States)

    Diehl, David L; LaPara, Timothy M

    2010-12-01

    The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.

  3. Cloning and analysis of the genes encoding the type IIS restriction-modification system HphI from Haemophilus parahaemolyticus.

    Science.gov (United States)

    Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A

    1996-07-15

    The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.

  4. Map-based cloning and characterization of Zea mays male sterility33 (ZmMs33) gene, encoding a glycerol-3-phosphate acyltransferase.

    Science.gov (United States)

    Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan

    2018-06-01

    Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.

  5. Age-related Resistance and the Defense Signaling Pathway of Ph-3 Gene Against Phytophthora infestans in Tomatoes

    Directory of Open Access Journals (Sweden)

    Sayed Rashad Ali Shah

    2015-09-01

    Full Text Available Resistance (R genes against plant pathogens often have age-related resistance (ARR effects. However, the mechanism involved in this phenomenon remains unknown. In this paper, Solanum lycopersicum ‘CLN2037B’ and S. pimpinellifolium ‘L3708’ harboring the Ph-3 gene, as well as S. habrochaites ‘LA2099’, ‘LA1777’ and ‘LA1033’ harboring quantitative trait loci (QTLs, were tested to investigate age-related resistance against late blight (LB; caused by Phytophthora infestans in the three-leaf stage of the plants. The results demonstrated that the QTL-related LB resistance showed the same age-related resistance as the Ph-3-mediated resistance at the six- and nine-leaf stages compared with the three-leaf stage. This indicated that there is a common defense mechanism in tomatoes against P. infestans via ARR. In addition, we combined ethylene (ET, salicylic acid (SA and jasmonic acid (JA mutants with virus-induced gene silencing (VIGS to study the Ph-3-dependent resistance signaling pathway. The results showed that ethylene and salicylic acid, but not jasmonic acid, are involved in the LB resistance mediated by the Ph-3 gene.

  6. Isolation and characterization of cDNAs encoding leucoanthocyanidin reductase and anthocyanidin reductase from Populus trichocarpa.

    Directory of Open Access Journals (Sweden)

    Lijun Wang

    Full Text Available Proanthocyanidins (PAs contribute to poplar defense mechanisms against biotic and abiotic stresses. Transcripts of PA biosynthetic genes accumulated rapidly in response to infection by the fungus Marssonina brunnea f.sp. multigermtubi, treatments of salicylic acid (SA and wounding, resulting in PA accumulation in poplar leaves. Anthocyanidin reductase (ANR and leucoanthocyanidin reductase (LAR are two key enzymes of the PA biosynthesis that produce the main subunits: (+-catechin and (--epicatechin required for formation of PA polymers. In Populus, ANR and LAR are encoded by at least two and three highly related genes, respectively. In this study, we isolated and functionally characterized genes PtrANR1 and PtrLAR1 from P. trichocarpa. Phylogenetic analysis shows that Populus ANR1 and LAR1 occurr in two distinct phylogenetic lineages, but both genes have little difference in their tissue distribution, preferentially expressed in roots. Overexpression of PtrANR1 in poplar resulted in a significant increase in PA levels but no impact on catechin levels. Antisense down-regulation of PtrANR1 showed reduced PA accumulation in transgenic lines, but increased levels of anthocyanin content. Ectopic expression of PtrLAR1 in poplar positively regulated the biosynthesis of PAs, whereas the accumulation of anthocyanin and flavonol was significantly reduced (P<0.05 in all transgenic plants compared to the control plants. These results suggest that both PtrANR1 and PtrLAR1 contribute to PA biosynthesis in Populus.

  7. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Science.gov (United States)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  8. Cocaine Administration and Its Withdrawal Enhance the Expression of Genes Encoding Histone-Modifying Enzymes and Histone Acetylation in the Rat Prefrontal Cortex.

    Science.gov (United States)

    Sadakierska-Chudy, Anna; Frankowska, Małgorzata; Jastrzębska, Joanna; Wydra, Karolina; Miszkiel, Joanna; Sanak, Marek; Filip, Małgorzata

    2017-07-01

    Chronic exposure to cocaine, craving, and relapse are attributed to long-lasting changes in gene expression arising through epigenetic and transcriptional mechanisms. Although several brain regions are involved in these processes, the prefrontal cortex seems to play a crucial role not only in motivation and decision-making but also in extinction and seeking behavior. In this study, we applied cocaine self-administration and extinction training procedures in rats with a yoked triad to determine differentially expressed genes in prefrontal cortex. Microarray analysis showed significant upregulation of several genes encoding histone modification enzymes during early extinction training. Subsequent real-time PCR testing of these genes following cocaine self-administration or early (third day) and late (tenth day) extinction revealed elevated levels of their transcripts. Interestingly, we found the enrichment of Brd1 messenger RNA in rats self-administering cocaine that lasted until extinction training during cocaine withdrawal with concomitant increased acetylation of H3K9 and H4K8. However, despite elevated levels of methyl- and demethyltransferase-encoded transcripts, no changes in global di- and tri-methylation of histone H3 at lysine 4, 9, 27, and 79 were observed. Surprisingly, at the end of extinction training (10 days of cocaine withdrawal), most of the analyzed genes in the rats actively and passively administering cocaine returned to the control level. Together, the alterations identified in the rat prefrontal cortex may suggest enhanced chromatin remodeling and transcriptional activity induced by early cocaine abstinence; however, to know whether they are beneficial or not for the extinction of drug-seeking behavior, further in vivo evaluation is required.

  9. Endogenous egg immune defenses in the yellow mealworm beetle (Tenebrio molitor).

    Science.gov (United States)

    Jacobs, Chris G C; Gallagher, Joe D; Evison, Sophie E F; Heckel, David G; Vilcinskas, Andreas; Vogel, Heiko

    2017-05-01

    In order to survive microbe encounters, insects rely on both physical barriers as well as local and systemic immune responses. Most research focusses on adult or larval defenses however, whereas insect eggs are also in need of protection. Lately, the defense of eggs against microbes has received an increasing amount of attention, be it through endogenous egg defenses, trans-generational immune priming (TGIP) or parental investment. Here we studied the endogenous immune response in eggs and adults of Tenebrio molitor. We show that many immune genes are induced in both adults and eggs. Furthermore, we show that eggs reach comparable levels of immune gene expression as adults. These findings show that the eggs of Tenebrio are capable of an impressive endogenous immune response, and indicate that such inducible egg defenses are likely common in insects. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Exome sequencing identifies variants in two genes encoding the LIM-proteins NRAP and FHL1 in an Italian patient with BAG3 myofibrillar myopathy.

    Science.gov (United States)

    D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan

    2016-06-01

    Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.

  11. Modulation of gene expression in Actinobacillus pleuropneumoniae exposed to bronchoalveolar fluid.

    Directory of Open Access Journals (Sweden)

    Abdul G Lone

    Full Text Available BACKGROUND: Actinobacillus pleuropneumoniae, the causative agent of porcine contagious pleuropneumonia, is an important pathogen of swine throughout the world. It must rapidly overcome the innate pulmonary immune defenses of the pig to cause disease. To better understand this process, the objective of this study was to identify genes that are differentially expressed in a medium that mimics the lung environment early in the infection process. METHODS AND PRINCIPAL FINDINGS: Since bronchoalveolar lavage fluid (BALF contains innate immune and other components found in the lungs, we examined gene expression of a virulent serovar 1 strain of A. pleuropneumoniae after a 30 min exposure to BALF, using DNA microarrays and real-time PCR. The functional classes of genes found to be up-regulated most often in BALF were those encoding proteins involved in energy metabolism, especially anaerobic metabolism, and in cell envelope, DNA, and protein biosynthesis. Transcription of a number of known virulence genes including apxIVA and the gene for SapF, a protein which is involved in resistance to antimicrobial peptides, was also up-regulated in BALF. Seventy-nine percent of the genes that were up-regulated in BALF encoded a known protein product, and of these, 44% had been reported to be either expressed in vivo and/or involved in virulence. CONCLUSIONS: The results of this study suggest that in early stages of infection, A. pleuropneumoniae may modulate expression of genes involved in anaerobic energy generation and in the synthesis of proteins involved in cell wall biogenesis, as well as established virulence factors. Given that many of these genes are thought to be expressed in vivo or involved in virulence, incubation in BALF appears, at least partially, to simulate in vivo conditions and may provide a useful medium for the discovery of novel vaccine or therapeutic targets.

  12. Herbivore Oral Secreted Bacteria Trigger Distinct Defense Responses in Preferred and Non-Preferred Host Plants.

    Science.gov (United States)

    Wang, Jie; Chung, Seung Ho; Peiffer, Michelle; Rosa, Cristina; Hoover, Kelli; Zeng, Rensen; Felton, Gary W

    2016-06-01

    Insect symbiotic bacteria affect host physiology and mediate plant-insect interactions, yet there are few clear examples of symbiotic bacteria regulating defense responses in different host plants. We hypothesized that plants would induce distinct defense responses to herbivore- associated bacteria. We evaluated whether preferred hosts (horsenettle) or non-preferred hosts (tomato) respond similarly to oral secretions (OS) from the false potato beetle (FPB, Leptinotarsa juncta), and whether the induced defense triggered by OS was due to the presence of symbiotic bacteria in OS. Both horsenettle and tomato damaged by antibiotic (AB) treated larvae showed higher polyphenol oxidase (PPO) activity than those damaged by non-AB treated larvae. In addition, application of OS from AB treated larvae induced higher PPO activity compared with OS from non-AB treated larvae or water treatment. False potato beetles harbor bacteria that may provide abundant cues that can be recognized by plants and thus mediate corresponding defense responses. Among all tested bacterial isolates, the genera Pantoea, Acinetobacter, Enterobacter, and Serratia were found to suppress PPO activity in tomato, while only Pantoea sp. among these four isolates was observed to suppress PPO activity in horsenettle. The distinct PPO suppression caused by symbiotic bacteria in different plants was similar to the pattern of induced defense-related gene expression. Pantoea inoculated FPB suppressed JA-responsive genes and triggered a SA-responsive gene in both tomato and horsenettle. However, Enterobacter inoculated FPB eliminated JA-regulated gene expression and elevated SA-regulated gene expression in tomato, but did not show evident effects on the expression levels of horsenettle defense-related genes. These results indicate that suppression of plant defenses by the bacteria found in the oral secretions of herbivores may be a more widespread phenomenon than previously indicated.

  13. Transfer RNA Derived Small RNAs Targeting Defense Responsive Genes Are Induced during Phytophthora capsici Infection in Black Pepper (Piper nigrum L.).

    Science.gov (United States)

    Asha, Srinivasan; Soniya, Eppurath V

    2016-01-01

    Small RNAs derived from transfer RNAs were recently assigned as potential gene regulatory candidates for various stress responses in eukaryotes. In this study, we report on the cloning and identification of tRNA derived small RNAs from black pepper plants in response to the infection of the quick wilt pathogen, Phytophthora capsici. 5'tRFs cloned from black pepper were validated as highly expressed during P. capsici infection. A high-throughput systematic analysis of the small RNAome (sRNAome) revealed the predominance of 5'tRFs in the infected leaf and root. The abundance of 5'tRFs in the sRNAome and the defense responsive genes as their potential targets indicated their regulatory role during stress response in black pepper. The 5'Ala(CGC) tRF mediated cleavage was experimentally mapped at the tRF binding sites on the mRNA targets of Non-expresser of pathogenesis related protein (NPR1), which was down-regulated during pathogen infection. Comparative sRNAome further demonstrated sequence conservation of 5'Ala tRFs across the angiosperm plant groups, and many important genes in the defense response were identified in silico as their potential targets. Our findings uncovered the diversity, differential expression and stress responsive functional role of tRNA-derived small RNAs during Phytophthora infection in black pepper.

  14. Recessive Resistance to Plant Viruses: Potential Resistance Genes Beyond Translation Initiation Factors

    Directory of Open Access Journals (Sweden)

    Masayoshi Hashimoto

    2016-10-01

    Full Text Available The ability of plant viruses to propagate their genomes in host cells depends on many host factors. In the absence of an agrochemical that specifically targets plant viral infection cycles, one of the most effective methods for controlling viral diseases in plants is taking advantage of the host plant’s resistance machinery. Recessive resistance is conferred by a recessive gene mutation that encodes a host factor critical for viral infection. It is a branch of the resistance machinery and, as an inherited characteristic, is very durable. Moreover, recessive resistance may be acquired by a deficiency in a negative regulator of plant defense responses, possibly due to the autoactivation of defense signaling. Eukaryotic translation initiation factor (eIF 4E and eIF4G and their isoforms are the most widely exploited recessive resistance genes in several crop species, and they are effective against a subset of viral species. However, the establishment of efficient, recessive resistance-type antiviral control strategies against a wider range of plant viral diseases requires genetic resources other than eIF4Es. In this review, we focus on recent advances related to antiviral recessive resistance genes evaluated in model plants and several crop species. We also address the roles of next-generation sequencing and genome editing technologies in improving plant genetic resources for recessive resistance-based antiviral breeding in various crop species.

  15. Isonitrosoacetophenone drives transcriptional reprogramming in Nicotiana tabacum cells in support of innate immunity and defense.

    Directory of Open Access Journals (Sweden)

    Arnaud T Djami-Tchatchou

    Full Text Available Plants respond to various stress stimuli by activating broad-spectrum defense responses both locally as well as systemically. As such, identification of expressed genes represents an important step towards understanding inducible defense responses and assists in designing appropriate intervention strategies for disease management. Genes differentially expressed in tobacco cell suspensions following elicitation with isonitrosoacetophenone (INAP were identified using mRNA differential display and pyro-sequencing. Sequencing data produced 14579 reads, which resulted in 198 contigs and 1758 singletons. Following BLAST analyses, several inducible plant defense genes of interest were identified and classified into functional categories including signal transduction, transcription activation, transcription and protein synthesis, protein degradation and ubiquitination, stress-responsive, defense-related, metabolism and energy, regulation, transportation, cytoskeleton and cell wall-related. Quantitative PCR was used to investigate the expression of 17 selected target genes within these categories. Results indicate that INAP has a sensitising or priming effect through activation of salicylic acid-, jasmonic acid- and ethylene pathways that result in an altered transcriptome, with the expression of genes involved in perception of pathogens and associated cellular re-programming in support of defense. Furthermore, infection assays with the pathogen Pseudomonas syringae pv. tabaci confirmed the establishment of a functional anti-microbial environment in planta.

  16. Prevalence of genes encoding extracellular virulence factors among meticillin-resistant Staphylococcus aureus isolates from the University Hospital, Olomouc, Czech Republic.

    Science.gov (United States)

    Sauer, P; Síla, J; Stosová, T; Vecerová, R; Hejnar, P; Vágnerová, I; Kolár, M; Raclavsky, V; Petrzelová, J; Lovecková, Y; Koukalová, D

    2008-04-01

    A rather fast and complicated progression of an infection caused by some strains of Staphylococcus aureus could be associated with the expression and co-action of virulence factor complexes in these strains. This study screened the antibiotic susceptibility and prevalence of virulence markers in isolates of meticillin-resistant S. aureus (MRSA) obtained from patients hospitalized at the University Hospital in Olomouc, Czech Republic. A total of 100 isolates was screened for 13 genes encoding extracellular virulence determinants (tst, pvl, eta, etb, sea, seb, sec, sed, see, seg, seh, sei and sej) and for their distribution in sample types. Eighty-nine isolates were positive for at least one of the genes. Genes for etb, pvl, see and seh were not detected in any of the MRSA isolates. No statistically significant differences in the occurrence of the determinants studied among sample types were found.

  17. Impact of haloperidol and quetiapine on the expression of genes encoding antioxidant enzymes in human neuroblastoma SH-SY5Y cells.

    Science.gov (United States)

    Schmidt, Andreas Johannes; Hemmeter, Ulrich Michael; Krieg, Jürgen-Christian; Vedder, Helmut; Heiser, Philip

    2009-05-01

    Antipsychotics are known to alter antioxidant activities in vivo. Therefore, the aim of the present study was to examine in the human neuroblastoma SH-SY5Y cell line the impact of a typical (haloperidol) and an atypical (quetiapine) antipsychotic on the expression of genes encoding the key enzymes of the antioxidant metabolism (Cu, Zn superoxide dismutase; Mn superoxide dismutase; glutathione peroxidase; catalase) and enzymes of the glutathione metabolism (gamma-glutamyl cysteine synthetase, glutathione-S-transferase, gamma-glutamyltranspeptidase, glutathione reductase). The cells were incubated for 24h with 0.3, 3, 30 and 300microM haloperidol and quetiapine, respectively; mRNA levels were measured by polymerase chain reaction. In the present study, we observed mostly significant decreases of mRNA contents. With respect to the key pathways, we detected mainly effects on the mRNA levels of the hydrogen peroxide detoxifying enzymes. Among the enzymes of the glutathione metabolism, glutathione-S-transferase- and gamma-glutamyltranspeptidase-mRNA levels showed the most prominent effects. Taken together, our results demonstrate a significantly reduced expression of genes encoding for antioxidant enzymes after treatment with the antipsychotics, haloperidol and quetiapine.

  18. Read-through transcript from NM23-H1 into the neighboring NM23-H2 gene encodes a novel protein, NM23-LV

    NARCIS (Netherlands)

    Valentijn, Linda J.; Koster, Jan; Versteeg, Rogier

    2006-01-01

    NM23-H1 and NM23-H2 are neighboring genes on chromosome 17q. They encode nucleoside diphosphate kinases that have additional roles in signal transduction, transcription, and apoptosis. NM23-H1 expression is a strong marker for prognosis and metastatic behavior in many tumor types. A new

  19. High prevalence of diarrheagenic Escherichia coli carrying toxin-encoding genes isolated from children and adults in southeastern Brazil.

    Science.gov (United States)

    Spano, Liliana Cruz; da Cunha, Keyla Fonseca; Monfardini, Mariane Vedovatti; de Cássia Bergamaschi Fonseca, Rita; Scaletsky, Isabel Christina Affonso

    2017-12-18

    Diarrheagenic Escherichia coli (DEC) are important bacterial causes of childhood diarrhea in Brazil, but its impact in adults is unknown. This study aimed at investigating DEC among children and adults living in endemic areas. A total of 327 stools specimens were collected from children (n = 141) and adults (n = 186) with diarrhea attending health centers. Diarrheagenic E. coli (DEC) were identified by their virulence genes (multiplex polymerase chain reaction) and HEp-2 cell adherence patterns. DEC were detected in 56 (40%) children and 74 (39%) adults; enteroaggregative E. coli (EAEC) (23%) was the most prevalent pathotype, followed by diffusely adherent E. coli (DAEC) (13%), and occurred at similar frequencies in both diarrheal groups. Atypical enteropathogenic E. coli (aEPEC) strains were recovered more frequently from children (6%) than from adults (1%). Twenty-six percent of the EAEC were classified as typical EAEC possessing aggR gene, and carried the aap gene. EAEC strains carrying aggR-aap-aatA genes were significantly more frequent among children than adults (p < 0.05). DAEC strains possessing Afa/Dr. genes were detected from children (10%) and adults (6%). EAEC and DAEC strains harboring genes for the EAST1 (astA), Pet, Pic, and Sat toxins were common in both diarrheal groups. The astA and the porcine AE/associated adhesin (paa) genes were found in most of aEPEC strains. High levels of resistance to antimicrobial drugs were found among DAEC and aEPEC isolates. The results show a high proportion of EAEC and DAEC carrying toxin-encoding genes among adults with diarrhea.

  20. Mutation of CDH23, encoding a new member of the cadherin gene family, causes Usher syndrome type 1D.

    Science.gov (United States)

    Bolz, H; von Brederlow, B; Ramírez, A; Bryda, E C; Kutsche, K; Nothwang, H G; Seeliger, M; del C-Salcedó Cabrera, M; Vila, M C; Molina, O P; Gal, A; Kubisch, C

    2001-01-01

    Usher syndrome type I (USH1) is an autosomal recessive disorder characterized by congenital sensorineural hearing loss, vestibular dysfunction and visual impairment due to early onset retinitis pigmentosa (RP). So far, six loci (USH1A-USH1F) have been mapped, but only two USH1 genes have been identified: MYO7A for USH1B and the gene encoding harmonin for USH1C. We identified a Cuban pedigree linked to the locus for Usher syndrome type 1D (MIM 601067) within the q2 region of chromosome 10). Affected individuals present with congenital deafness and a highly variable degree of retinal degeneration. Using a positional candidate approach, we identified a new member of the cadherin gene superfamily, CDH23. It encodes a protein of 3,354 amino acids with a single transmembrane domain and 27 cadherin repeats. In the Cuban family, we detected two different mutations: a severe course of the retinal disease was observed in individuals homozygous for what is probably a truncating splice-site mutation (c.4488G-->C), whereas mild RP is present in individuals carrying the homozygous missense mutation R1746Q. A variable expression of the retinal phenotype was seen in patients with a combination of both mutations. In addition, we identified two mutations, Delta M1281 and IVS51+5G-->A, in a German USH1 patient. Our data show that different mutations in CDH23 result in USH1D with a variable retinal phenotype. In an accompanying paper, it is shown that mutations in the mouse ortholog cause disorganization of inner ear stereocilia and deafness in the waltzer mouse.

  1. Global changes in gene expression during compatible and incompatible interactions of cowpea (Vigna unguiculata L.) with the root parasitic angiosperm Striga gesnerioides.

    Science.gov (United States)

    Huang, Kan; Mellor, Karolina E; Paul, Shom N; Lawson, Mark J; Mackey, Aaron J; Timko, Michael P

    2012-08-17

    Cowpea, Vigna unguiculata L. Walp., is one of the most important food and forage legumes in the semi-arid tropics. While most domesticated forms of cowpea are susceptible to the root parasitic weed Striga gesnerioides, several cultivars have been identified that show race-specific resistance. Cowpea cultivar B301 contains the RSG3-301 gene for resistance to S. gesnerioides race SG3, but is susceptible to race SG4z. When challenged by SG3, roots of cultivar B301 develop a strong resistance response characterized by a hypersensitive reaction and cell death at the site of parasite attachment. In contrast, no visible response occurs in B301 roots parasitized by SG4z. Gene expression in the roots of the cowpea cultivar B301 during compatible (susceptible) and incompatible (resistant) interactions with S. gesnerioides races SG4z and SG3, respectively, were investigated at the early (6 days post-inoculation (dpi)) and late (13 dpi) stages of the resistance response using a Nimblegen custom design cowpea microarray. A total of 111 genes were differentially expressed in B301 roots at 6 dpi; this number increased to 2102 genes at 13 dpi. At 13 dpi, a total of 1944 genes were differentially expressed during compatible (susceptible) interactions of B301 with SG4z. Genes and pathways involved in signal transduction, programmed cell death and apoptosis, and defense response to biotic and abiotic stress were differentially expressed in the early resistance response; at the later time point, enrichment was primarily for defense-related gene expression, and genes encoding components of lignifications and secondary wall formation. In compatible interactions (B301-SG4z), multiple defense pathways were repressed, including those involved in lignin biosynthesis and secondary cell wall modifications, while cellular transport processes for nitrogen and sulfur were increased. Distinct changes in global gene expression profiles occur in host roots following successful and unsuccessful

  2. Structure of the human gene encoding the associated microfibrillar protein (MFAP1) and localization to chromosome 15q15-q21

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others

    1994-09-15

    Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.

  3. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  4. Expression of Nudix hydrolase genes in barley under UV irradiation

    Science.gov (United States)

    Tanaka, Sayuri; Sugimoto, Manabu; Kihara, Makoto

    Seed storage and cultivation should be necessary to self-supply foods when astronauts would stay and investigate during long-term space travel and habitation in the bases on the Moon and Mars. Thought the sunlight is the most importance to plants, both as the ultimate energy source and as an environmental signal regulating growth and development, UV presenting the sunlight can damage many aspects of plant processes at the physiological and DNA level. Especially UV-C, which is eliminated by the stratospheric ozone layer, is suspected to be extremely harmful and give a deadly injury to plants in space. However, the defense mechanism against UV-C irradiation damage in plant cells has not been clear. In this study, we investigated the expression of Nudix hydrolases, which defense plants from biotic / abiotic stress, in barley under UV irradiation. The genes encoding the amino acid sequences, which show homology to those of 28 kinds of Nudix hydrolases in Arabidopsis thaliana, were identified in the barley full-length cDNA library. BLAST analysis showed 14 kinds of barley genes (HvNUDX1-14), which encode the Nudix motif sequence. A phylogenetic tree showed that HvNUDX1, HvNUDX7, HvNUDX9 and HvNUDX11 belonged to the ADP-ribose pyrophosphohydrolase, ADP-sugar pyrophosphohydrolase, NAD(P)H pyrophosphohydrolase and FAD pyrophosphohydrolase subfamilies, respectively, HvNUDX3, HvNUDX6, and HvNUDX8 belonged to the Ap _{n}A pyrophosphohydrolase subfamilies, HvNUDX5 and HvNUDX14 belonged to the coenzyme A pyrophosphohydrolase subfamilies, HvNUDX12 and HvNUDX13 belonged to the Ap _{4}A pyrophosphohydrolase subfamilies. Induction of HvNUDX genes by UV-A (340nm), UV-B (312nm), and UV-C (260nm) were analyzed by quantitative RT-PCR. The results showed that HvNUDX4 was induced by UV-A and UV-B, HvNUDX6 was induced by UV-B and UV-C, and HvNUDX7 and HvNUDX14 were induced by UV-C, significantly. Our results suggest that the response of HvNUDXs to UV irradiation is different by UV

  5. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals

    Science.gov (United States)

    2012-01-01

    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  6. Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

    Science.gov (United States)

    Howe, J G; Shu, M D

    1988-08-01

    Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

  7. Effect of recombinant adenovirus encoding human p53 tumor suppressor gene combined with radiation therapy on human lymphoma cells lines

    International Nuclear Information System (INIS)

    Yu Zeyang; Fan Wo; Li Dongqing; Zhu Ran; Wan Jianmei; Wang Yongqing; Wu Jinchang

    2008-01-01

    This paper analyzes the inhibitory effect and radiation sensitization of recombinant adenovirus encoding human p53 tumor suppressor gene (rAd-p53) on human lymphoma cell lines. Human lymphoma cell lines were treated with rAd-p53, radiation therapy and combined treatment, respectively. The cell growth inhibition was assessed by MTF. The cell cycle and apoptosis were detected by flow cytometry, and the p53 protein expression was detected by Western blotting. The results showed that extrinsic p53 gene have expressed to some degree, but not at high level. The role of inhibition and radiation sensitivity of rAd-p53 was not significant to human lymphoma cell lines. (authors)

  8. Polymorphisms of genes encoding P2X7R, IL-1B, OPG and RANK in orthodontic-induced apical root resorption.

    Science.gov (United States)

    Pereira, S; Lavado, N; Nogueira, L; Lopez, M; Abreu, J; Silva, H

    2014-10-01

    Orthodontic-induced external apical root resorption (EARR) is a complex phenotype determined by poorly defined mechanical and patient intrinsic factors. The aim of this work was to construct a multifactorial integrative model, including clinical and genetic susceptibility factors, to analyze the risk of developing this common orthodontic complication. This retrospective study included 195 orthodontic patients. Using a multiple-linear regression model, where the dependent variable was the maximum% of root resorption (%EARRmax) for each patient, we assessed the contribution of nine clinical variables and four polymorphisms of genes involved in bone and tooth root remodeling (rs1718119 from P2RX7, rs1143634 from IL1B, rs3102735 from TNFRSF11B, encoding OPG, and rs1805034 from TNFRSF11A, encoding RANK). Clinical and genetic variables explained 30% of%EARRmax variability. The variables with the most significant unique contribution to the model were: gender (P < 0.05), treatment duration (P < 0.001), premolar extractions (P < 0.01), Hyrax appliance (P < 0.001) and GG genotype of rs1718119 from P2RX7 gene (P < 0.01). Age, overjet, tongue thrust, skeletal class II and the other polymorphisms made minor contributions. This study highlights the P2RX7 gene as a possible factor of susceptibility to EARR. A more extensive genetic profile may improve this model. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  9. Identification of a Novel UTY‐Encoded Minor Histocompatibility Antigen

    DEFF Research Database (Denmark)

    Mortensen, B. K.; Rasmussen, A. H.; Larsen, Malene Erup

    2012-01-01

    Minor histocompatibility antigens (mHags) encoded by the Y‐chromosome (H‐Y‐mHags) are known to play a pivotal role in allogeneic haematopoietic cell transplantation (HCT) involving female donors and male recipients. We present a new H‐Y‐mHag, YYNAFHWAI (UTY139–147), encoded by the UTY gene...... obtained post‐HCT from male recipients of female donor grafts. In one of these recipients, a CD8+ T cell response was observed against a peptide stretch encoded by the UTY gene. Another bioinformatics tool, HLArestrictor, was used to identify the optimal peptide and HLA‐restriction element. Using peptide....../HLA tetramers, the specificity of the CD8+ T cell response was successfully validated as being HLA‐A*24:02‐restricted and directed against the male UTY139–147 peptide. Functional analysis of these T cells demonstrated male UTY139–147 peptide‐specific cytokine secretion (IFNγ, TNFα and MIP‐1β) and cytotoxic...

  10. Dissection of Resistance Genes to Pseudomonas syringae pv. phaseolicola in UI3 Common Bean Cultivar

    Directory of Open Access Journals (Sweden)

    Ana M. González

    2017-11-01

    Full Text Available Few quantitative trait loci have been mapped for resistance to Pseudomonas syringae pv. phaseolicola in common bean. Two F2 populations were developed from the host differential UI3 cultivar. The objective of this study was to further characterize the resistance to races 1, 5, 7 and 9 of Psp included in UI3. Using a QTL mapping approach, 16 and 11 main-effect QTLs for pod and primary leaf resistance were located on LG10, explaining up to 90% and 26% of the phenotypic variation, respectively. The homologous genomic region corresponding to primary leaf resistance QTLs detected tested positive for the presence of resistance-associated gene cluster encoding nucleotide-binding and leucine-rich repeat (NL, Natural Resistance Associated Macrophage (NRAMP and Pentatricopeptide Repeat family (PPR proteins. It is worth noting that the main effect QTLs for resistance in pod were located inside a 3.5 Mb genomic region that included the Phvul.010G021200 gene, which encodes a protein that has the highest sequence similarity to the RIN4 gene of Arabidopsis, and can be considered an important candidate gene for the organ-specific QTLs identified here. These results support that resistance to Psp from UI3 might result from the immune response activated by combinations of R proteins, and suggest the guard model as an important mechanism in pod resistance to halo blight. The candidate genes identified here warrant functional studies that will help in characterizing the actual defense gene(s in UI3 genotype.

  11. Methanogenesis and methane genes

    International Nuclear Information System (INIS)

    Reeve, J.N.; Shref, B.A.

    1991-01-01

    An overview of the pathways leading to methane biosynthesis is presented. The steps investigated to date by gene cloning and DNA sequencing procedures are identified and discussed. The primary structures of component C of methyl coenzyme M reductase encoded by mcr operons in different methanogens are compared. Experiments to detect the primary structure of the genes encoding F420 reducing hydrogenase (frhABG) and methyl hydrogen reducing hydrogenase (mvhDGA) in methanobacterium thermoautotrophicum strain H are compared with each other and with eubacterial hydrogenase encoding genes. A biotechnological use for hydrogenases from hypermorphillic archaebacteria is suggested. (author)

  12. Tissue-specific and pathogen-induced regulation of a Nicotiana plumbaginifolia beta-1,3-glucanase gene.

    Science.gov (United States)

    Castresana, C; de Carvalho, F; Gheysen, G; Habets, M; Inzé, D; Van Montagu, M

    1990-01-01

    The Nicotiana plumbaginifolia gn1 gene encoding a beta-1,3-glucanase isoform has been characterized. The gn1 product represents an isoform distinct from the previously identified tobacco beta-1,3-glucanases. By expressing gn1 in Escherichia coli, we have determined directly that the encoded protein does, indeed, correspond to a beta-1,3-glucanase. In N. plumbaginifolia, gn1 was found to be expressed in roots and older leaves. Transgenic tobacco plants containing the 5'-noncoding region of gn1 fused to the beta-glucuronidase (GUS) reporter gene also showed maximum levels of GUS activity in roots and older leaves. No detectable activity was present in the upper part of the transgenic plants with the exception of stem cells at the bases of emerging shoots. The expression conferred by the gn1 promoter was differentially induced in response to specific plant stress treatments. Studies of three plant-bacteria interactions showed high levels of GUS activity when infection resulted in a hypersensitive reaction. Increased gene expression was confined to cells surrounding the necrotic lesions. The observed expression pattern suggests that the characterized beta-1,3-glucanase plays a role both in plant development and in the defense response against pathogen infection. PMID:2152158

  13. Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

    Science.gov (United States)

    Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

    2015-10-01

    Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  14. Jasmonic acid and salicylic acid activate a common defense system in rice.

    Science.gov (United States)

    Tamaoki, Daisuke; Seo, Shigemi; Yamada, Shoko; Kano, Akihito; Miyamoto, Ayumi; Shishido, Hodaka; Miyoshi, Seika; Taniguchi, Shiduku; Akimitsu, Kazuya; Gomi, Kenji

    2013-06-01

    Jasmonic acid (JA) and salicylic acid (SA) play important roles in plant defense systems. JA and SA signaling pathways interact antagonistically in dicotyledonous plants, but, the status of crosstalk between JA and SA signaling is unknown in monocots. Our rice microarray analysis showed that more than half of the genes upregulated by the SA analog BTH are also upregulated by JA, suggesting that a major portion of the SA-upregulated genes are regulated by JA-dependent signaling in rice. A common defense system that is activated by both JA and SA is thus proposed which plays an important role in pathogen defense responses in rice.

  15. Candida albicans infection of Caenorhabditis elegans induces antifungal immune defenses.

    Directory of Open Access Journals (Sweden)

    Read Pukkila-Worley

    2011-06-01

    Full Text Available Candida albicans yeast cells are found in the intestine of most humans, yet this opportunist can invade host tissues and cause life-threatening infections in susceptible individuals. To better understand the host factors that underlie susceptibility to candidiasis, we developed a new model to study antifungal innate immunity. We demonstrate that the yeast form of C. albicans establishes an intestinal infection in Caenorhabditis elegans, whereas heat-killed yeast are avirulent. Genome-wide, transcription-profiling analysis of C. elegans infected with C. albicans yeast showed that exposure to C. albicans stimulated a rapid host response involving 313 genes (124 upregulated and 189 downregulated, ~1.6% of the genome many of which encode antimicrobial, secreted or detoxification proteins. Interestingly, the host genes affected by C. albicans exposure overlapped only to a small extent with the distinct transcriptional responses to the pathogenic bacteria Pseudomonas aeruginosa or Staphylococcus aureus, indicating that there is a high degree of immune specificity toward different bacterial species and C. albicans. Furthermore, genes induced by P. aeruginosa and S. aureus were strongly over-represented among the genes downregulated during C. albicans infection, suggesting that in response to fungal pathogens, nematodes selectively repress the transcription of antibacterial immune effectors. A similar phenomenon is well known in the plant immune response, but has not been described previously in metazoans. Finally, 56% of the genes induced by live C. albicans were also upregulated by heat-killed yeast. These data suggest that a large part of the transcriptional response to C. albicans is mediated through "pattern recognition," an ancient immune surveillance mechanism able to detect conserved microbial molecules (so-called pathogen-associated molecular patterns or PAMPs. This study provides new information on the evolution and regulation of the innate

  16. Ribose catabolism of Escherichia coli: characterization of the rpiB gene encoding ribose phosphate isomerase B and of the rpiR gene, which is involved in regulation of rpiB expression

    DEFF Research Database (Denmark)

    Sørensen, Kim I.; Hove-Jensen, Bjarne

    1996-01-01

    . The rpiB gene resided on a 4.6-kbp HindIII-EcoRV DNA fragment from phage lambda 10H5 (642) of the Kohara gene library and mapped at 92.85 min. Consistent with this map position, the cloned DNA fragment contained two divergent open reading frames of 149 and 296 codons, encoding ribose phosphate isomerase B...

  17. Root defense analysis against Fusarium oxysporum reveals new regulators to confer resistance

    Science.gov (United States)

    Chen, Yi Chung; Wong, Chin Lin; Muzzi, Frederico; Vlaardingerbroek, Ido; Kidd, Brendan N.; Schenk, Peer M.

    2014-01-01

    Fusarium oxysporum is a root-infecting fungal pathogen that causes wilt disease on a broad range of plant species, including Arabidopsis thaliana. Investigation of the defense response against this pathogen had primarily been conducted using leaf tissue and little was known about the root defense response. In this study, we profiled the expression of root genes after infection with F. oxysporum by microarray analysis. In contrast to the leaf response, root tissue did not show a strong induction of defense-associated gene expression and instead showed a greater proportion of repressed genes. Screening insertion mutants from differentially expressed genes in the microarray uncovered a role for the transcription factor ETHYLENE RESPONSE FACTOR72 (ERF72) in susceptibility to F. oxysporum. Due to the role of ERF72 in suppressing programmed cell death and detoxifying reactive oxygen species (ROS), we examined the pub22/pub23/pub24 U-box type E3 ubiquitin ligase triple mutant which is known to possess enhanced ROS production in response to pathogen challenge. We found that the pub22/23/24 mutant is more resistant to F. oxysporum infection, suggesting that a heightened innate immune response provides protection against F. oxysporum. We conclude that root-mediated defenses against soil-borne pathogens can be provided at multiple levels. PMID:24998294

  18. MicroRNAs Suppress NB Domain Genes in Tomato That Confer Resistance to Fusarium oxysporum

    Science.gov (United States)

    Ouyang, Shouqiang; Park, Gyungsoon; Atamian, Hagop S.; Han, Cliff S.; Stajich, Jason E.; Kaloshian, Isgouhi; Borkovich, Katherine A.

    2014-01-01

    MicroRNAs (miRNAs) suppress the transcriptional and post-transcriptional expression of genes in plants. Several miRNA families target genes encoding nucleotide-binding site–leucine-rich repeat (NB-LRR) plant innate immune receptors. The fungus Fusarium oxysporum f. sp. lycopersici causes vascular wilt disease in tomato. We explored a role for miRNAs in tomato defense against F. oxysporum using comparative miRNA profiling of susceptible (Moneymaker) and resistant (Motelle) tomato cultivars. slmiR482f and slmiR5300 were repressed during infection of Motelle with F. oxysporum. Two predicted mRNA targets each of slmiR482f and slmiR5300 exhibited increased expression in Motelle and the ability of these four targets to be regulated by the miRNAs was confirmed by co-expression in Nicotiana benthamiana. Silencing of the targets in the resistant Motelle cultivar revealed a role in fungal resistance for all four genes. All four targets encode proteins with full or partial nucleotide-binding (NB) domains. One slmiR5300 target corresponds to tm-2, a susceptible allele of the Tomato Mosaic Virus resistance gene, supporting functions in immunity to a fungal pathogen. The observation that none of the targets correspond to I-2, the only known resistance (R) gene for F. oxysporum in tomato, supports roles for additional R genes in the immune response. Taken together, our findings suggest that Moneymaker is highly susceptible because its potential resistance is insufficiently expressed due to the action of miRNAs. PMID:25330340

  19. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  20. aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.

    Science.gov (United States)

    de Vries, R P; Poulsen, C H; Madrid, S; Visser, J

    1998-01-01

    An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

  1. aguA, the Gene Encoding an Extracellular α-Glucuronidase from Aspergillus tubingensis, Is Specifically Induced on Xylose and Not on Glucuronic Acid

    Science.gov (United States)

    de Vries, Ronald P.; Poulsen, Charlotte H.; Madrid, Susan; Visser, Jaap

    1998-01-01

    An extracellular α-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70°C. The α-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and β-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this α-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and α-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose. PMID:9440512

  2. Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

    Science.gov (United States)

    Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

    2006-10-01

    We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

  3. Thc6 protein, isolated from Trichoderma harzianum, can induce maize defense response against Curvularia lunata.

    Science.gov (United States)

    Fan, Lili; Fu, Kehe; Yu, Chuanjin; Li, Yingying; Li, Yaqian; Chen, Jie

    2015-05-01

    Mutant T66 was isolated from 450 mutants (constructed with Agrobacterium tumefaciens-mediated transformation method) of Trichoderma harzianum. Maize seeds coated with T66 were more susceptible to Curvularia lunata when compared with those coated with wild-type (WT) strain. The disease index of maize treated with T66 and WT were 62.5 and 42.1%, respectively. Further research showed T-DNA has inserted into the ORF of one gene, which resulted in the functional difference between WT and T66. The gene was cloned and named Thc6, which encodes a novel 327 amino acid protein. To investigate its function, we obtained knockout, complementation, and overexpression mutants of Thc6. Challenge inoculation studies suggested that the Thc6 overexpression mutant can reduce the disease index of maize inbred line Huangzao 4 against the leaf spot pathogen (C. lunata). Meanwhile, The Thc6 mutants were found to affect the resistance of maize inbred line Huangzao 4 against C. lunata by enhancing the activation of jasmonate-responsive genes expression. Liquid chromatography-mass spectrometry (LC-MS) data further confirmed that the concentration of jasmonate in the induced maize exhibits a parallel change tendency with the expression level of defense-related genes. Hence, the Thc6 gene could be participated in the induced resistance of maize inbred line Huangzao 4 against C. lunata infection through a jasmonic acid-dependent pathway. © 2014 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Identification, gene expression and immune function of the novel Bm-STAT gene in virus-infected Bombyx mori.

    Science.gov (United States)

    Zhang, Xiaoli; Guo, Rui; Kumar, Dhiraj; Ma, Huanyan; Liu, Jiabin; Hu, Xiaolong; Cao, Guangli; Xue, Renyu; Gong, Chengliang

    2016-02-10

    Genes in the signal transducer and activator of transcription (STAT) family are vital for activities including gene expression and immune response. To investigate the functions of the silkworm Bombyx mori STAT (Bm-STAT) gene in antiviral immunity, two Bm-STAT gene isoforms, Bm-STAT-L for long form and Bm-STAT-S for short form, were cloned. Sequencing showed that the open reading frames were 2313 bp encoding 770 amino acid residues for Bm-STAT-L and 2202 bp encoding 734 amino acid residues for Bm-STAT-S. The C-terminal 42 amino acid residues of Bm-STAT-L were different from the last 7 amino acid residues of Bm-STAT-S. Immunofluorescence showed that Bm-STAT was primarily distributed in the nucleus. Transcription levels of Bm-STAT in different tissues were determined by quantitative PCR, and the results revealed Bm-STAT was mainly expressed in testes. Western blots showed two bands with molecular weights of 70 kDa and 130 kDa in testes, but no bands were detected in ovaries by using anti-Bm-STAT antibody as the primary antibody. Expression of Bm-STAT in hemolymph at 48 h post infection with B. mori macula-like virus (BmMLV) was slightly enhanced compared with controls, suggesting a weak response induced by infection with BmMLV. Hemocyte immunofluorescence showed that Bm-STAT expression was elevated in B. mori nucleopolyhedrovirus (BmNPV)-infected cells. Moreover, resistance of BmN cells to BmNPV was reduced by downregulation of Bm-STAT expression and increased by upregulation. Resistance of BmN cells to BmCPV was not significantly improved by upregulating Bm-STAT expression. Therefore, we concluded that Bm-STAT is a newly identified insect gene of the STAT family. The JAK-STAT pathway has a more specialized role in antiviral defense in silkworms, but JAK-STAT pathway is not triggered in response to all viruses. Copyright © 2015 Elsevier B.V. All rights reserved.

  5. A rare sugar, d-allose, confers resistance to rice bacterial blight with upregulation of defense-related genes in Oryza sativa.

    Science.gov (United States)

    Kano, Akihito; Gomi, Kenji; Yamasaki-Kokudo, Yumiko; Satoh, Masaru; Fukumoto, Takeshi; Ohtani, Kouhei; Tajima, Shigeyuki; Izumori, Ken; Tanaka, Keiji; Ishida, Yutaka; Tada, Yasuomi; Nishizawa, Yoko; Akimitsu, Kazuya

    2010-01-01

    We investigated responses of rice plant to three rare sugars, d-altrose, d-sorbose, and d-allose, due to establishment of mass production methods for these rare sugars. Root growth and shoot growth were significantly inhibited by d-allose but not by the other rare sugars. A large-scale gene expression analysis using a rice microarray revealed that d-allose treatment causes a high upregulation of many defense-related, pathogenesis-related (PR) protein genes in rice. The PR protein genes were not upregulated by other rare sugars. Furthermore, d-allose treatment of rice plants conferred limited resistance of the rice against the pathogen Xanthomonas oryzae pv. oryzae but the other tested sugars did not. These results indicate that d-allose has a growth inhibitory effect but might prove to be a candidate elicitor for reducing disease development in rice.

  6. Acral peeling skin syndrome resulting from a homozygous nonsense mutation in the CSTA gene encoding cystatin A.

    Science.gov (United States)

    Krunic, Aleksandar L; Stone, Kristina L; Simpson, Michael A; McGrath, John A

    2013-01-01

    Acral peeling skin syndrome (APSS) is a clinically and genetically heterogeneous disorder. We used whole-exome sequencing to identify the molecular basis of APSS in a consanguineous Jordanian-American pedigree. We identified a homozygous nonsense mutation (p.Lys22X) in the CSTA gene, encoding cystatin A, that was confirmed using Sanger sequencing. Cystatin A is a protease inhibitor found in the cornified cell envelope, and loss-of-function mutations have previously been reported in two cases of exfoliative ichthyosis. Our study expands the molecular pathology of APSS and demonstrates the value of next-generation sequencing in the genetic characterization of inherited skin diseases. © 2013 Wiley Periodicals, Inc.

  7. Identification of two novel genes encoding 97- to 99-kilodalton outer membrane proteins of Chlamydia pneumoniae.Infect Immun. 1999 Jan;67(1):375-83

    DEFF Research Database (Denmark)

    Knudsen, K; Madsen, AS; Mygind, P

    1999-01-01

    Two genes encoding 97- to 99-kDa Chlamydia pneumoniae VR1310 outer membrane proteins (Omp4 and Omp5) with mutual similarity were cloned and sequenced. The proteins were shown to be constituents of the C. pneumoniae outer membrane complex, and the deduced amino acid sequences were similar to those...

  8. Detection of a Bacteriophage Gene Encoding a Mu-like Portal Protein in Haemophilus parasuis Reference Strains and Field Isolates by Nested Polymerase Chain Reaction

    Science.gov (United States)

    A nested PCR assay was developed to determine the presence of a gene encoding a bacteriophage Mu-like portal protein, gp29, in 15 reference strains and 31 field isolates of Haemophilus parasuis. Specific primers, based on the gene’s sequence, were utilized. A majority of the virulent reference strai...

  9. Human Transcriptome and Chromatin Modifications: An ENCODE Perspective

    Directory of Open Access Journals (Sweden)

    Li Shen

    2013-06-01

    Full Text Available A decade-long project, led by several international research groups, called the Encyclopedia of DNA Elements (ENCODE, recently released an unprecedented amount of data. The ambitious project covers transcriptome, cistrome, epigenome, and interactome data from more than 1,600 sets of experiments in human. To make use of this valuable resource, it is important to understand the information it represents and the techniques that were used to generate these data. In this review, we introduce the data that ENCODE generated, summarize the observations from the data analysis, and revisit a computational approach that ENCODE used to predict gene expression, with a focus on the human transcriptome and its association with chromatin modifications.

  10. Trans-suppression of defense DEFB1 gene in intestinal epithelial cells following Cryptosporidium parvum infection is associated with host delivery of parasite Cdg7_FLc_1000 RNA.

    Science.gov (United States)

    Ming, Zhenping; Gong, Ai-Yu; Wang, Yang; Zhang, Xin-Tian; Li, Min; Dolata, Courtney E; Chen, Xian-Ming

    2018-03-01

    To counteract host immunity, Cryptosporidium parvum has evolved multiple strategies to suppress host antimicrobial defense. One such strategy is to reduce the production of the antimicrobial peptide beta-defensin 1 (DEFB1) by host epithelial cells but the underlying mechanisms remain unclear. Recent studies demonstrate that a panel of parasite RNA transcripts of low protein-coding potential are delivered into infected host cells and may modulate host gene transcription. Using in vitro models of intestinal cryptosporidiosis, in this study, we analyzed the expression profile of host beta-defensin genes in host cells following infection. We found that C. parvum infection caused a significant downregulation of the DEFB1 gene. Interestingly, downregulation of DEFB1 gene was associated with host delivery of Cdg7_FLc_1000 RNA transcript, a C. parvum RNA that has previously demonstrated to be delivered into the nuclei of infected host cells. Knockdown of Cdg7_FLc_1000 in host cells could attenuate the trans-suppression of host DEFB1 gene and decreased the parasite burden. Therefore, our data suggest that trans-suppression of DEFB1 gene in intestinal epithelial cells following C. parvum infection involves host delivery of parasite Cdg7_FLc_1000 RNA, a process that may be relevant to the epithelial defense evasion by C. parvum at the early stage of infection.

  11. Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.

    Science.gov (United States)

    Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya

    2008-11-01

    A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.

  12. Comparative Digital Gene Expression Analysis of the Arabidopsis Response to Volatiles Emitted by Bacillus amyloliquefaciens.

    Directory of Open Access Journals (Sweden)

    Hai-Ting Hao

    Full Text Available Some plant growth-promoting rhizobacteria (PGPR regulated plant growth and elicited plant basal immunity by volatiles. The response mechanism to the Bacillus amyloliquefaciens volatiles in plant has not been well studied. We conducted global gene expression profiling in Arabidopsis after treatment with Bacillus amyloliquefaciens FZB42 volatiles by Illumina Digital Gene Expression (DGE profiling of different growth stages (seedling and mature and tissues (leaves and roots. Compared with the control, 1,507 and 820 differentially expressed genes (DEGs were identified in leaves and roots at the seedling stage, respectively, while 1,512 and 367 DEGs were identified in leaves and roots at the mature stage. Seventeen genes with different regulatory patterns were validated using quantitative RT-PCR. Numerous DEGs were enriched for plant hormones, cell wall modifications, and protection against stress situations, which suggests that volatiles have effects on plant growth and immunity. Moreover, analyzes of transcriptome difference in tissues and growth stage using DGE profiling showed that the plant response might be tissue-specific and/or growth stage-specific. Thus, genes encoding flavonoid biosynthesis were downregulated in leaves and upregulated in roots, thereby indicating tissue-specific responses to volatiles. Genes related to photosynthesis were downregulated at the seedling stage and upregulated at the mature stage, respectively, thereby suggesting growth period-specific responses. In addition, the emission of bacterial volatiles significantly induced killing of cells of other organism pathway with up-regulated genes in leaves and the other three pathways (defense response to nematode, cell morphogenesis involved in differentiation and trichoblast differentiation with up-regulated genes were significantly enriched in roots. Interestingly, some important alterations in the expression of growth-related genes, metabolic pathways, defense response

  13. Identification and Expression Profiles of Six Transcripts Encoding Carboxylesterase Protein in Vitis flexuosa Infected with Pathogens

    Directory of Open Access Journals (Sweden)

    Md. Zaherul Islam

    2016-08-01

    Full Text Available Plants protect themselves from pathogen attacks via several mechanisms, including hypersensitive cell death. Recognition of pathogen attack by the plant resistance gene triggers expression of carboxylesterase genes associated with hypersensitive response. We identified six transcripts of carboxylesterase genes, Vitis flexuosa carboxylesterase 5585 (VfCXE5585, VfCXE12827, VfCXE13132, VfCXE17159, VfCXE18231, and VfCXE47674, which showed different expression patterns upon transcriptome analysis of V. flexuosa inoculated with Elsinoe ampelina. The lengths of genes ranged from 1,098 to 1,629 bp, and their encoded proteins consisted of 309 to 335 amino acids. The predicted amino acid sequences showed hydrolase like domains in all six transcripts and contained two conserved motifs, GXSXG of serine hydrolase characteristics and HGGGF related to the carboxylesterase family. The deduced amino acid sequence also contained a potential catalytic triad consisted of serine, aspartic acid and histidine. Of the six transcripts, VfCXE12827 showed upregulated expression against E. ampelina at all time points. Three genes (VfCXE5585, VfCXE12827, and VfCXE13132 showed upregulation, while others (VfCXE17159, VfCXE18231, and VfCXE47674 were down regulated in grapevines infected with Botrytis cinerea. All transcripts showed upregulated expression against Rhizobium vitis at early and later time points except VfCXE12827, and were downregulated for up to 48 hours post inoculation (hpi after upregulation at 1 hpi in response to R. vitis infection. All tested genes showed high and differential expression in response to pathogens, indicating that they all may play a role in defense pathways during pathogen infection in grapevines.

  14. Co-silencing of tomato S-adenosylhomocysteine hydrolase genes confers increased immunity against Pseudomonas syringae pv. tomato DC3000 and enhanced tolerance to drought stress

    Directory of Open Access Journals (Sweden)

    Li Xiao Hui

    2015-09-01

    Full Text Available S-adenosylhomocysteine hydrolase (SAHH, catalyzing the reversible hydrolysis of S-adenosylhomocysteine to adenosine and homocysteine, is a key enzyme that maintain the cellular methylation potential in all organisms. We report here the biological functions of tomato SlSAHHs in stress response. The tomato genome contains three SlSAHH genes that encode SlSAHH proteins with high level of sequence identity. qRT-PCR analysis revealed that SlSAHHs responded with distinct expression induction patterns to Pseudomonas syringae pv. tomato (Pst DC3000 and Botrytis cinerea as well as to defense signaling hormones such as salicylic acid, jasmonic acid and a precursor of ethylene. Virus-induced gene silencing-based knockdown of individual SlSAHH gene did not affect the growth performance and the response to Pst DC3000. However, co-silencing of three SlSAHH genes using a conserved sequence led to significant inhibition of vegetable growth. The SlSAHH-co-silenced plants displayed increased resistance to Pst DC3000 but did not alter the resistance to B. cinerea. Co-silencing of SlSAHHs resulted in constitutively activated defense responses including elevated SA level, upregulated expression of defense-related and PAMP-triggered immunity marker genes and increased callose deposition and H2O2 accumulation. Furthermore, the SlSAHH-co-silenced plants also exhibited enhanced drought stress tolerance although they had relatively small roots. These data demonstrate that, in addition to the functions in growth and development, SAHHs also play important roles in regulating biotic and abiotic stress responses in plants.

  15. Genetic association analysis of 13 nuclear-encoded mitochondrial candidate genes with type II diabetes mellitus: The DAMAGE study

    DEFF Research Database (Denmark)

    Reiling, Erwin; van Vliet-Ostaptchouk, Jana V; van 't Riet, Esther

    2009-01-01

    ). After a meta-analysis, only one SNP in SIRT4 (rs2522138) remained significant (P=0.01). Extending the second stage with samples from the Danish Steno Study (n=1220 participants) resulted in a common odds ratio (OR) of 0.92 (0.85-1.00), P=0.06. Moreover, in a large meta-analysis of three genome......Mitochondria play an important role in many processes, like glucose metabolism, fatty acid oxidation and ATP synthesis. In this study, we aimed to identify association of common polymorphisms in nuclear-encoded genes involved in mitochondrial protein synthesis and biogenesis with type II diabetes...

  16. Expression of genes encoding F-1-ATPase results in uncoupling of glycolysis from biomass production in Lactococcus lactis

    DEFF Research Database (Denmark)

    Købmann, Brian Jensen; Solem, Christian; Pedersen, M.B.

    2002-01-01

    of the genes encoding F-1-ATPase was found to decrease the intracellular energy level and resulted in a decrease in the growth rate. The yield of biomass also decreased, which showed that the incorporated F-1-ATPase activity caused glycolysis to be uncoupled from biomass production. The increase in ATPase...... threefold in nongrowing cells resuspended in buffer, but in steadily growing cells no increase in flux was observed. The latter result shows that glycolysis occurs close to its maximal capacity and indicates that control of the glycolytic flux under these conditions resides in the glycolytic reactions...

  17. The arabidopsis thaliana AGRAVITROPIC 1 gene encodes a component of the polar-auxin-transport efflux carrier

    Science.gov (United States)

    Chen, R.; Hilson, P.; Sedbrook, J.; Rosen, E.; Caspar, T.; Masson, P. H.

    1998-01-01

    Auxins are plant hormones that mediate many aspects of plant growth and development. In higher plants, auxins are polarly transported from sites of synthesis in the shoot apex to their sites of action in the basal regions of shoots and in roots. Polar auxin transport is an important aspect of auxin functions and is mediated by cellular influx and efflux carriers. Little is known about the molecular identity of its regulatory component, the efflux carrier [Estelle, M. (1996) Current Biol. 6, 1589-1591]. Here we show that mutations in the Arabidopsis thaliana AGRAVITROPIC 1 (AGR1) gene involved in root gravitropism confer increased root-growth sensitivity to auxin and decreased sensitivity to ethylene and an auxin transport inhibitor, and cause retention of exogenously added auxin in root tip cells. We used positional cloning to show that AGR1 encodes a putative transmembrane protein whose amino acid sequence shares homologies with bacterial transporters. When expressed in Saccharomyces cerevisiae, AGR1 promotes an increased efflux of radiolabeled IAA from the cells and confers increased resistance to fluoro-IAA, a toxic IAA-derived compound. AGR1 transcripts were localized to the root distal elongation zone, a region undergoing a curvature response upon gravistimulation. We have identified several AGR1-related genes in Arabidopsis, suggesting a global role of this gene family in the control of auxin-regulated growth and developmental processes.

  18. Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

    International Nuclear Information System (INIS)

    Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

    1989-01-01

    The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

  19. Global Transcriptome Analysis of Gracilaria changii (Rhodophyta) in Response to Agarolytic Enzyme and Bacterium.

    Science.gov (United States)

    Lim, Ee-Leen; Siow, Rouh-San; Abdul Rahim, Raha; Ho, Chai-Ling

    2016-04-01

    Many bacterial epiphytes of agar-producing seaweeds secrete agarase that degrade algal cell wall matrix into oligoagars which elicit defense-related responses in the hosts. The molecular defense responses of red seaweeds are largely unknown. In this study, we surveyed the defense-related transcripts of an agarophyte, Gracilaria changii, treated with β-agarase through next generation sequencing (NGS). We also compared the defense responses of seaweed elicited by agarase with those elicited by an agarolytic bacterium isolated from seaweed, by profiling the expression of defense-related genes using quantitative reverse transcription real-time PCR (qRT-PCR). NGS detected a total of 391 differentially expressed genes (DEGs) with a higher abundance (>2-fold change with a p value <0.001) in the agarase-treated transcriptome compared to that of the non-treated G. changii. Among these DEGs were genes related to signaling, bromoperoxidation, heme peroxidation, production of aromatic amino acids, chorismate, and jasmonic acid. On the other hand, the genes encoding a superoxide-generating NADPH oxidase and related to photosynthesis were downregulated. The expression of these DEGs was further corroborated by qRT-PCR results which showed more than 90 % accuracy. A comprehensive analysis of their gene expression profiles between 1 and 24 h post treatments (hpt) revealed that most of the genes analyzed were consistently upregulated or downregulated by both agarase and agarolytic bacterial treatments, indicating that the defense responses induced by both treatments are highly similar except for genes encoding vanadium bromoperoxidase and animal heme peroxidase. Our study has provided the first glimpse of the molecular defense responses of G. changii to agarase and agarolytic bacterial treatments.

  20. Horizontal Gene Transfer Contributes to the Evolution of Arthropod Herbivory.

    Science.gov (United States)

    Wybouw, Nicky; Pauchet, Yannick; Heckel, David G; Van Leeuwen, Thomas

    2016-06-27

    Within animals, evolutionary transition toward herbivory is severely limited by the hostile characteristics of plants. Arthropods have nonetheless counteracted many nutritional and defensive barriers imposed by plants and are currently considered as the most successful animal herbivores in terrestrial ecosystems. We gather a body of evidence showing that genomes of various plant feeding insects and mites possess genes whose presence can only be explained by horizontal gene transfer (HGT). HGT is the asexual transmission of genetic information between reproductively isolated species. Although HGT is known to have great adaptive significance in prokaryotes, its impact on eukaryotic evolution remains obscure. Here, we show that laterally transferred genes into arthropods underpin many adaptations to phytophagy, including efficient assimilation and detoxification of plant produced metabolites. Horizontally acquired genes and the traits they encode often functionally diversify within arthropod recipients, enabling the colonization of more host plant species and organs. We demonstrate that HGT can drive metazoan evolution by uncovering its prominent role in the adaptations of arthropods to exploit plants. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.