WorldWideScience

Sample records for genes encoding cry11

  1. Detection of the mosquitocidal toxin genes encoding Cry11 proteins from Bacillus thuringiensis using a novel PCR-RFLP method Detección de genes que codifican proteínas mosquitocidas Cry11 de Bacillus thuringiensis mediante un método de PCR-RFLP novedoso

    Directory of Open Access Journals (Sweden)

    D. H. Sauka

    2010-02-01

    Full Text Available A polymerase chain reaction-restriction fragment length polymorphism (PCR-RFLP method for detection of cry11 genes from Bacillus thuringiensis was established. Based on the analysis of conserved regions of the cry11 genes, 2 oligonucleotide primers were designed to amplify a 1459-bp fragment of the cry11Aa gene, and a 1471-bp of the cry11Ba and cry11Bb genes. The amplification products were digested with restriction endonuclease HinfI. Exotic B. thuringiensis strains and native isolates collected from soils, leaves and stored product dust of Argentina were analyzed to study the distribution of cry11 genes. The PCR-RFLP patterns revealed the detection of cry11 genes in 3 of 64 exotic strains and in 10 of 107 native B. thuringiensis isolates tested. Just the cry11Aa gene subclass was detected among these bacteria. Since the methodology was also developed to detect cry11Ba and cry11Bb genes, an experimental future confirmation will be required. Based on the results obtained, the PCR-RFLP method presented may be a valuable tool for specific detection of the mosquitocidal toxin genes encoding Cry11 proteins from B. thuringiensis.En el presente estudio se estableció una estrategia basada en la amplificación génica (PCR y el posterior análisis de restricción (RFLP para detectar todos los genes cry11 de Bacillus thuringiensis informados hasta ahora. De acuerdo con el análisis de las regiones conservadas en los genes cry11, se diseñaron dos cebadores para amplificar un fragmento de 1459 pb de los genes cry11Aa y un fragmento de 1471 pb de los genes cry11Ba y cry11Bb. Los productos de la amplificación fueron digeridos con la enzima de restricción HinfI. Se analizaron cepas exóticas de B. thuringiensis y aislamientos nativos de Argentina obtenidos a partir de muestras de suelos, hojas y polvillo de silos, para estudiar la distribución de los genes cry11. Los patrones de PCR-RFLP revelaron la presencia de genes cry11 en 3 de las 64 cepas ex

  2. Cloning of the cryptochrome-encoding PeCRY1 gene from Populus euphratica and functional analysis in Arabidopsis.

    Directory of Open Access Journals (Sweden)

    Ke Mao

    Full Text Available Cryptochromes are photolyase-like blue/UV-A light receptors that evolved from photolyases. In plants, cryptochromes regulate various aspects of plant growth and development. Despite of their involvement in the control of important plant traits, however, most studies on cryptochromes have focused on lower plants and herbaceous crops, and no data on cryptochrome function are available for forest trees. In this study, we isolated a cryptochrome gene, PeCRY1, from Euphrates poplar (Populus euphratica, and analyzed its structure and function in detail. The deduced PeCRY1 amino acid sequence contained a conserved N-terminal photolyase-homologous region (PHR domain as well as a C-terminal DQXVP-acidic-STAES (DAS domain. Secondary and tertiary structure analysis showed that PeCRY1 shares high similarity with AtCRY1 from Arabidopsis thaliana. PeCRY1 expression was upregulated at the mRNA level by light. Using heterologous expression in Arabidopsis, we showed that PeCRY1 overexpression rescued the cry1 mutant phenotype. In addition, PeCRY1 overexpression inhibited hypocotyl elongation, promoted root growth, and enhanced anthocyanin accumulation in wild-type background seedlings grown under blue light. Furthermore, we examined the interaction between PeCRY1 and AtCOP1 using a bimolecular fluorescence complementation (BiFc assay. Our data provide evidence for the involvement of PeCRY1 in the control of photomorphogenesis in poplar.

  3. Cry-Bt identifier: a biological database for PCR detection of Cry genes present in transgenic plants.

    Science.gov (United States)

    Singh, Vinay Kumar; Ambwani, Sonu; Marla, Soma; Kumar, Anil

    2009-10-23

    We describe the development of a user friendly tool that would assist in the retrieval of information relating to Cry genes in transgenic crops. The tool also helps in detection of transformed Cry genes from Bacillus thuringiensis present in transgenic plants by providing suitable designed primers for PCR identification of these genes. The tool designed based on relational database model enables easy retrieval of information from the database with simple user queries. The tool also enables users to access related information about Cry genes present in various databases by interacting with different sources (nucleotide sequences, protein sequence, sequence comparison tools, published literature, conserved domains, evolutionary and structural data). http://insilicogenomics.in/Cry-btIdentifier/welcome.html.

  4. Expression of the sigma35 and cry2AB genes involved in Bacillus thuringiensis virulence Expressão dos genes sigma35 e cry2AB envolvidos na virulência de Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Ana Maria Guidelli-Thuler

    2009-06-01

    Full Text Available There are several genes involved in Bacillus thuringiensis sporulation. The regulation and expression of these genes results in an upregulation in Cry protein production, and this is responsible for the death of insect larvae infected by Bacillus thuringiensis. Gene expression was monitored in Bacillus thuringiensis during three developmental phases. DNA macroarrays were constructed for selected genes whose sequences are available in the GenBank database. These genes were hybridized to cDNA sequences from B. thuringiensis var. kurstaki HD-1. cDNA probes were synthesized by reverse transcription from B. thuringiensis RNA templates extracted during the exponential (log growth, stationary and sporulation phases, and labeled with 33PadCTP. Two genes were differentially expressed levels during the different developmental phases. One of these genes is related to sigma factor (sigma35, and the other is a cry gene (cry2Ab. There were differences between the differential levels of expression of various genes and among the expression detected for different combinations of the sigma factor and cry2Ab genes. The maximum difference in expression was observed for the gene encoding sigma35 factor in the log phase, which was also expressed at a high level during the sporulation phase. The cry2Ab gene was only expressed at a high level in the log phase, but at very low levels in the other phases when compared to the sigma35.Muitos genes estão envolvidos nos mecanismos de esporulação da bactéria Bacillus thuringiensis. A regulação e expressão desses genes resultam em uma produção massiva da proteína Cry, responsável pela morte das larvas de muitos insetos. Neste trabalho monitorou-se a expressão de genes de Bacillus thuringiensis, ao longo de três fases de seu desenvolvimento. Foram construídos macroarrays de DNA dos genes selecionados, cujas seqüências estão disponibilizadas no GenBank. Estes genes foram hibridizados com cDNAs obtidos de B

  5. Sequence and expression of two cry8 genes from Bacillus thuringiensis INTA Fr7-4, a native strain from Argentina.

    Science.gov (United States)

    Navas, Laura E; Berretta, Marcelo F; Pérez, Melisa P; Amadio, Ariel F; Ortiz, Elio M; Sauka, Diego H; Benintende, Graciela B; Zandomeni, Rubén O

    2014-01-01

    We found and characterized two cry8 genes from the Bacillus thuringiensis strain INTA Fr7-4 isolated in Argentina. These genes, cry8Kb3 and cry8Pa3, are located in a tandem array within a 13,200-bp DNA segment sequenced from a preparation of total DNA. They encode 1,169- and 1,176-amino-acid proteins, respectively. Both genes were cloned with their promoter sequences and the proteins were expressed separately in an acrystalliferous strain of B. thuringiensis leading to the formation of ovoid crystals in the recombinant strains. The toxicity against larvae of Anthonomus grandis Bh. (Coleoptera: Curculionidae) of a spore-crystal suspension from the recombinant strain containing cry8Pa3 was similar to that of the parent strain INTA Fr7-4. © 2014 S. Karger AG, Basel.

  6. Construction and characterization of the interdomain chimeras using Cry11Aa and Cry11Ba from Bacillus thuringiensis and identification of a possible novel toxic chimera.

    Science.gov (United States)

    Sun, Yunjun; Zhao, Qiang; Zheng, Dasheng; Ding, Xuezhi; Wang, Jingfang; Hu, Quanfang; Yuan, Zhiming; Park, Hyun-Woo; Xia, Liqiu

    2014-01-01

    Three structural domains of mosquitocidal Cry11Aa and Cry11Ba from Bacillus thuringiensis were exchanged to produce interdomain chimeras [BAA (11Ba/11Aa/11Aa), ABA (11Aa/11Ba/11Aa), AAB (11Aa/11Aa/11Ba), ABB (11Aa/11Ba/11Ba), BAB (11Ba/11Aa/11Ba), BBA (11Ba/11Ba/11Aa]. Chimeras BAB, BAA, BBA, and AAB formed inclusion bodies in the crystal-negative B. thuringiensis host and produced expected protein bands on SDS-PAGE gel. However, no inclusion body or target protein could be found for chimeras ABA and ABB. In bioassays using the fourth-instar larvae of Culex quinquefasciatus and Aedes aegypti, AAB had ~50 % lethal concentrations of 4.8 and 2.2 μg ml(-1), respectively; however, the rest of chimeras were not toxic. This study thus helps to understand the domain-function relationships of the Cry11Aa and Cry11Ba toxins. The toxic chimera, AAB, might be a candidate for mosquito control as its amino acid sequence is different from the two parental toxins.

  7. Characterization of lepidopteran-specific cry1 and cry2 gene harbouring native Bacillus thuringiensis isolates toxic against Helicoverpa armigera

    Directory of Open Access Journals (Sweden)

    Showkat Ahmad Lone

    2017-09-01

    Full Text Available Bacillus thuringiensis (Bt based biopesticides are feasible alternatives to chemical pesticides. Here, we present the distribution of lepidopteran-specific cry1 and cry2 genes in native B. thuringiensis. Forty four out of 86 colonies were found to harbour crystals by phase contrast microscopy exhibiting a Bt index of 0.51. PCR analysis resulted in the amplification of cry1 in 24 and cry2 in 14 isolates. Twelve of the isolates showed presence of both cry1 and cry2, while 18 isolates did not show presence of either of the genes. Toxicity screening using spore-crystal mixtures against 2nd instar larvae of Helicoverpa armigera revealed that the isolates (50% were either mildly toxic or not toxic (36.36%, and only 13.63% were toxic. The results are interesting, particularly so because the same isolates were previously reported to contain lepidopteran specific vip3A genes also, hence can complement the toxicity of the isolates harbouring vip3A genes.

  8. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    Science.gov (United States)

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  9. A synthetic cryIC gene, encoding a Bacillus thuringiensis δ-endotoxin, confers Spodoptera resistance in alfalfa and tobacco

    NARCIS (Netherlands)

    Strizhov, N.; Keller, M.; Mathur, J.; Koncz-Kaiman, Z.; Bosch, D.; Prudovksy, E.; Schell, J.; Sneh, B.; Koncz, C.; Zilberstein, A.

    1996-01-01

    Spodoptera species, representing widespread polyphagous insect pests, are resistant to Bacillus thuringiensis δ-endotoxins used thus far as insecticides in transgenic plants. Here we describe the chemical synthesis of a cryIC gene by a novel template directed ligation–PCR method. This simple and

  10. Cloning of partial cry1Ac gene from an indigenous isolate of Bacillus ...

    African Journals Online (AJOL)

    The discoveries of novel cry genes of Bacillus thuringiensis (Bt) with higher toxicity are important for the development of new products. The cry1 family genes are more toxic to the lepidopteran insects according to the previous reports. In the present study, nine indigenous isolates of Bt were used for screening of cry1 genes ...

  11. Cry3A δ-endotoxin gene mutagenized for enhanced toxicity

    African Journals Online (AJOL)

    Bacillus thuringiensis Cry3A gene was redesigned for high expression in Norwegian spruce and the sequence was slightly modified to allow for simple N- and C- terminal deletions and domain II loop 1 exchange for synthetic oligos. Modified Cry3A toxins from 13 variants of the synthetic gene were expressed in Escherichia ...

  12. Cry64Ba and Cry64Ca, Two ETX/MTX2-Type Bacillus thuringiensis Insecticidal Proteins Active against Hemipteran Pests.

    Science.gov (United States)

    Liu, Yonglei; Wang, Yinglong; Shu, Changlong; Lin, Kejian; Song, Fuping; Bravo, Alejandra; Soberón, Mario; Zhang, Jie

    2018-02-01

    Genetically modified crops that express insecticidal Bacillus thuringiensis (Bt) proteins have become a primary approach for control of lepidopteran (moth) and coleopteran (beetle) pests that feed by chewing the plants. However, the sap-sucking insects (Hemiptera) are not particularly susceptible to Bt toxins. In this study, we describe two Cry toxins (Cry64Ba and Cry64Ca) from Bt strain 1012 that showed toxicity against two important hemipteran rice pests, Laodelphax striatellus and Sogatella furcifera Both of these proteins contain an ETX/MTX2 domain and share common sequence features with the β-pore-forming toxins. Coexpression of cry64Ba and cry64Ca genes in the acrystalliferous Bt strain HD73 - resulted in high insecticidal activity against both hemipteran pests. No toxicity was observed on other pests such as Ostrinia furnacalis , Plutella xylostella , or Colaphellus bowringi Also, no hemolytic activity or toxicity against cancer cells was detected. Binding assays showed specific binding of the Cry64Ba/Cry64Ca toxin complex to brush border membrane vesicles isolated from L. striatellus Cry64Ba and Cry64Ca are Bt Cry toxins highly effective against hemipteran pests and could provide a novel strategy for the environmentally friendly biological control of rice planthoppers in transgenic plants. IMPORTANCE In Asia, rice is an important staple food, whose production is threatened by rice planthoppers. To date, no effective Bacillus thuringiensis (Bt) protein has been shown to have activity against rice planthoppers. We cloned two Bt toxin genes from Bt strain 1012 that showed toxicity against small brown planthoppers ( Laodelphax striatellus ) and white-backed planthoppers ( Sogatella furcifera ). To our knowledge, the proteins encoded by the cry64Ba and cry64Ca genes are the most efficient insecticidal Bt Cry proteins with activity against hemipteran insects reported so far. Cry64Ba and Cry64Ca showed no toxicity against some lepidopteran or coleopteran pests

  13. A Circadian Clock Gene, Cry, Affects Heart Morphogenesis and Function in Drosophila as Revealed by Optical Coherence Microscopy.

    Directory of Open Access Journals (Sweden)

    Aneesh Alex

    Full Text Available Circadian rhythms are endogenous, entrainable oscillations of physical, mental and behavioural processes in response to local environmental cues such as daylight, which are present in the living beings, including humans. Circadian rhythms have been related to cardiovascular function and pathology. However, the role that circadian clock genes play in heart development and function in a whole animal in vivo are poorly understood. The Drosophila cryptochrome (dCry is a circadian clock gene that encodes a major component of the circadian clock negative feedback loop. Compared to the embryonic stage, the relative expression levels of dCry showed a significant increase (>100-fold in Drosophila during the pupa and adult stages. In this study, we utilized an ultrahigh resolution optical coherence microscopy (OCM system to perform non-invasive and longitudinal analysis of functional and morphological changes in the Drosophila heart throughout its post-embryonic lifecycle for the first time. The Drosophila heart exhibited major morphological and functional alterations during its development. Notably, heart rate (HR and cardiac activity period (CAP of Drosophila showed significant variations during the pupa stage, when heart remodeling took place. From the M-mode (2D + time OCM images, cardiac structural and functional parameters of Drosophila at different developmental stages were quantitatively determined. In order to study the functional role of dCry on Drosophila heart development, we silenced dCry by RNAi in the Drosophila heart and mesoderm, and quantitatively measured heart morphology and function in those flies throughout its development. Silencing of dCry resulted in slower HR, reduced CAP, smaller heart chamber size, pupal lethality and disrupted posterior segmentation that was related to increased expression of a posterior compartment protein, wingless. Collectively, our studies provided novel evidence that the circadian clock gene, dCry, plays

  14. A Circadian Clock Gene, Cry, Affects Heart Morphogenesis and Function in Drosophila as Revealed by Optical Coherence Microscopy

    Science.gov (United States)

    Zeng, Xianxu; Tate, Rebecca E.; McKee, Mary L.; Capen, Diane E.; Zhang, Zhan; Tanzi, Rudolph E.; Zhou, Chao

    2015-01-01

    Circadian rhythms are endogenous, entrainable oscillations of physical, mental and behavioural processes in response to local environmental cues such as daylight, which are present in the living beings, including humans. Circadian rhythms have been related to cardiovascular function and pathology. However, the role that circadian clock genes play in heart development and function in a whole animal in vivo are poorly understood. The Drosophila cryptochrome (dCry) is a circadian clock gene that encodes a major component of the circadian clock negative feedback loop. Compared to the embryonic stage, the relative expression levels of dCry showed a significant increase (>100-fold) in Drosophila during the pupa and adult stages. In this study, we utilized an ultrahigh resolution optical coherence microscopy (OCM) system to perform non-invasive and longitudinal analysis of functional and morphological changes in the Drosophila heart throughout its post-embryonic lifecycle for the first time. The Drosophila heart exhibited major morphological and functional alterations during its development. Notably, heart rate (HR) and cardiac activity period (CAP) of Drosophila showed significant variations during the pupa stage, when heart remodeling took place. From the M-mode (2D + time) OCM images, cardiac structural and functional parameters of Drosophila at different developmental stages were quantitatively determined. In order to study the functional role of dCry on Drosophila heart development, we silenced dCry by RNAi in the Drosophila heart and mesoderm, and quantitatively measured heart morphology and function in those flies throughout its development. Silencing of dCry resulted in slower HR, reduced CAP, smaller heart chamber size, pupal lethality and disrupted posterior segmentation that was related to increased expression of a posterior compartment protein, wingless. Collectively, our studies provided novel evidence that the circadian clock gene, dCry, plays an essential

  15. Identificación de los Genes cry en Cepas Mexicanas de Bacillus thuringiensis con Potencial Insecticida Identificación de los Genes cry en Cepas Mexicanas de Bacillus thuringiensis con Potencial Insecticida

    Directory of Open Access Journals (Sweden)

    J. E. Ibarra

    2012-02-01

    Full Text Available En el presente estudio se determinó la morfología y la composición proteica de los cristales de las cepas LBIT-499 y LBIT-504 de B. thuringiensis, ambas nativas de Guanajuato, México. La primera mostró sólo cristales bipiramidales mientras que la segunda presentó cristales tanto bipiramidales como cúbicos. Estos cristales estuvieron compuestos de proteínas de aproximadamente 130 y 60 kDa, respectivamente. En ambas cepas, además de la LBIT-500 y LBIT-544, se detectó una gran variedad de genes cry1. En éstas últimas se encontraron los genes cry2A y cry2B, en la LBIT- 504 sólo el cry2B y en la LBIT-499 no se detectó ningún cry2. This report revealed the crystal morphology and protein composition of strains LBIT-499 and LBIT-504 of B. thuringiensis, native to Guanajuato, Mexico. LBIT-499 showed only bipyramidal crystals, while LBIT-504 showed both bipyramidal and cubical crystals. These crystals were composed by proteins of ca. 130 and 60 kDa, respectively. Both strains as well as LBIT-500 and LBIT-544, showed a great variety of cry1 genes, while cry2A and cry2B were identified in LBT-500 and LBIT-544, LBIT-504 showed only the cry2B gene, and no cry2 was detected in LBIT-499.

  16. Expression of a Chimeric Gene Encoding Insecticidal Crystal Protein Cry1Aabc of Bacillus thuringiensis in Chickpea (Cicer arietinum L.) Confers Resistance to Gram Pod Borer (Helicoverpa armigera Hubner.).

    Science.gov (United States)

    Das, Alok; Datta, Subhojit; Thakur, Shallu; Shukla, Alok; Ansari, Jamal; Sujayanand, G K; Chaturvedi, Sushil K; Kumar, P A; Singh, N P

    2017-01-01

    Domain swapping and generation of chimeric insecticidal crystal protein is an emerging area of insect pest management. The lepidopteran insect pest, gram pod borer ( Helicoverpa armigera H.) wreaks havoc to chickpea crop affecting production. Lepidopteran insects were reported to be controlled by Bt ( cryI ) genes. We designed a plant codon optimized chimeric Bt gene ( cry1Aabc ) using three domains from three different cry1A genes (domains I, II, and III from cry1Aa , cry1Ab , and cry1Ac , respectively) and expressed it under the control of a constitutive promoter in chickpea ( cv . DCP92-3) to assess its effect on gram pod borer. A total of six transgenic chickpea shoots were established by grafting into mature fertile plants. The in vitro regenerated (organogenetic) shoots were selected based on antibiotic kanamycin monosulfate (100 mg/L) with transformation efficiency of 0.076%. Three transgenic events were extensively studied based on gene expression pattern and insect mortality across generations. Protein expression in pod walls, immature seeds and leaves (pre- and post-flowering) were estimated and expression in pre-flowering stage was found higher than that of post-flowering. Analysis for the stable integration, expression and insect mortality (detached leaf and whole plant bioassay) led to identification of efficacious transgenic chickpea lines. The chimeric cry1Aabc expressed in chickpea is effective against gram pod borer and generated events can be utilized in transgenic breeding program.

  17. Expression of a Chimeric Gene Encoding Insecticidal Crystal Protein Cry1Aabc of Bacillus thuringiensis in Chickpea (Cicer arietinum L. Confers Resistance to Gram Pod Borer (Helicoverpa armigera Hubner.

    Directory of Open Access Journals (Sweden)

    Alok Das

    2017-08-01

    Full Text Available Domain swapping and generation of chimeric insecticidal crystal protein is an emerging area of insect pest management. The lepidopteran insect pest, gram pod borer (Helicoverpa armigera H. wreaks havoc to chickpea crop affecting production. Lepidopteran insects were reported to be controlled by Bt (cryI genes. We designed a plant codon optimized chimeric Bt gene (cry1Aabc using three domains from three different cry1A genes (domains I, II, and III from cry1Aa, cry1Ab, and cry1Ac, respectively and expressed it under the control of a constitutive promoter in chickpea (cv. DCP92-3 to assess its effect on gram pod borer. A total of six transgenic chickpea shoots were established by grafting into mature fertile plants. The in vitro regenerated (organogenetic shoots were selected based on antibiotic kanamycin monosulfate (100 mg/L with transformation efficiency of 0.076%. Three transgenic events were extensively studied based on gene expression pattern and insect mortality across generations. Protein expression in pod walls, immature seeds and leaves (pre- and post-flowering were estimated and expression in pre-flowering stage was found higher than that of post-flowering. Analysis for the stable integration, expression and insect mortality (detached leaf and whole plant bioassay led to identification of efficacious transgenic chickpea lines. The chimeric cry1Aabc expressed in chickpea is effective against gram pod borer and generated events can be utilized in transgenic breeding program.

  18. Intracellular and Extracellular Expression of Bacillus thuringiensis Crystal Protein Cry5B in Lactococcus lactis for Use as an Anthelminthic

    Science.gov (United States)

    Durmaz, Evelyn; Hu, Yan; Aroian, Raffi V.

    2015-01-01

    The Bacillus thuringiensis crystal (Cry) protein Cry5B (140 kDa) and a truncated version of the protein, tCry5B (79 kDa), are lethal to nematodes. Genes encoding the two proteins were separately cloned into a high-copy-number vector with a strong constitutive promoter (pTRK593) in Lactococcus lactis for potential oral delivery against parasitic nematode infections. Western blots using a Cry5B-specific antibody revealed that constitutively expressed Cry5B and tCry5B were present in both cells and supernatants. To increase production, cry5B was cloned into the high-copy-number plasmid pMSP3535H3, carrying a nisin-inducible promoter. Immunoblotting revealed that 3 h after nisin induction, intracellular Cry5B was strongly induced at 200 ng/ml nisin, without adversely affecting cell viability or cell membrane integrity. Both Cry5B genes were also cloned into plasmid pTRK1061, carrying a promoter and encoding a transcriptional activator that invoke low-level expression of prophage holin and lysin genes in Lactococcus lysogens, resulting in a leaky phenotype. Cry5B and tCry5B were actively expressed in the lysogenic strain L. lactis KP1 and released into cell supernatants without affecting culture growth. Lactate dehydrogenase (LDH) assays indicated that Cry5B, but not LDH, leaked from the bacteria. Lastly, using intracellular lysates from L. lactis cultures expressing both Cry5B and tCry5B, in vivo challenges of Caenorhabditis elegans worms demonstrated that the Cry proteins were biologically active. Taken together, these results indicate that active Cry5B proteins can be expressed intracellularly in and released extracellularly from L. lactis, showing potential for future use as an anthelminthic that could be delivered orally in a food-grade microbe. PMID:26682852

  19. Norway spruce (Picea abies) genetic transformation with modified Cry3A gene of Bacillus thuringiensis

    Czech Academy of Sciences Publication Activity Database

    Bříza, Jindřich; Pavingerová, Daniela; Vlasák, Josef; Niedermeierová, Hana

    2013-01-01

    Roč. 60, č. 3 (2013), s. 395-400 ISSN 0001-527X R&D Projects: GA MZe QH71290; GA ČR(CZ) GAP502/11/1471 Institutional support: RVO:60077344 Keywords : Cry3A gene modification * Picea abies * Agrobacterium tumefaciens Subject RIV: EB - Genetic s ; Molecular Biology Impact factor: 1.389, year: 2013

  20. Elucidation of the mechanisms of CryIIIA overproduction in a mutagenized strain of Bacillus thuringiensis var. tenebrionis

    International Nuclear Information System (INIS)

    Adams, L.F.; Mathewes, S.; O'Hara, P.; Peterson, A.; Gürtler, H.

    1994-01-01

    NB176 is a Bacillus thuringiensis mutant derived by λ-irradiation of NB125 Bacillus thuringiensis var. tenebrionis (Krieg). It exhibits two interesting phenotypes: (i) oligosporogeny and (ii) twofold to threefold overproduction of the CryIIIA protein. Southern profiles of the NB176 strain showed an additional copy(s) of the cryIIIA gene located on a 4 kb HindIII fragment, in addition to the expected cryIIIA gene on a 3 kb HindIII fragment. Each cryIIIA gene-bearing HindIII fragment was cloned from NB176. The restriction map of the 3 kb HindIII fragment was identical to that published by Donovan and coworkers. Sequencing of the 4 kb HindIII fragment showed no alterations in the promoter region of the cryIIIA gene but did show replacement of the region immediately following the cryIIIA open reading frame with a sequence encoding a transposase with 50% amino acid homology to that of Tn 1000. These findings suggest that the overproduction phenotype of NB176 results from extra copies of the cryIIIA gene produced from a transposition event(s) induced or stabilized by γ-irradiation. Integration of additional copies of the cryIIIA gene into the native 90MDa plasmid of the wild-type B. thuringiensis var. tenebrionis strain resulted in strains that made enormous crystals, many possessing greatly enhanced insecticidal activity

  1. Construction of occluded recombinant baculoviruses containing the full-length cry1Ab and cry1Ac genes from Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    B.M. Ribeiro

    1998-06-01

    Full Text Available The administration of baculoviruses to insects for bioassay purposes is carried out, in most cases, by contamination of food surfaces with a known amount of occlusion bodies (OBs. Since per os infection is the natural route of infection, occluded recombinant viruses containing crystal protein genes (cry1Ab and cry1Ac from Bacillus thuringiensis were constructed for comparison with the baculovirus prototype Autographa californica nucleopolyhedrovirus (AcNPV. The transfer vector pAcUW2B was used for construction of occluded recombinant viruses. The transfer vector containing the crystal protein genes was cotransfected with linearized DNA from a non-occluded recombinant virus. The isolation of recombinant viruses was greatly facilitated by the reduction of background "wild type" virus and the increased proportion of recombinant viruses. Since the recombinant viruses containing full-length and truncated forms of the crystal protein genes did not seem to improve the pathogenicity of the recombinant viruses when compared with the wild type AcNPV, and in order to compare expression levels of the full-length crystal proteins produced by non-occluded and occluded recombinant viruses the full-length cry1Ab and cry1Ac genes were chosen for construction of occluded recombinant viruses. The recombinant viruses containing full-length and truncated forms of the crystal protein genes did not seem to improve its pathogenicity but the size of the larvae infected with the recombinant viruses was significantly smaller than that of larvae infected with the wild type virus.

  2. Microarray detection and qPCR screening of potential biomarkers of Folsomia candida (Collembola: Isotomidae) exposed to Bt proteins (Cry1Ab and Cry1Ac)

    International Nuclear Information System (INIS)

    Yuan, Yiyang; Krogh, Paul Henning; Bai, Xue; Roelofs, Dick; Chen, Fajun; Zhu-Salzman, Keyan; Liang, Yuyong; Sun, Yucheng; Ge, Feng

    2014-01-01

    The impact of Bt proteins on non-target arthropods is less understood than their effects on target organisms where the mechanism of toxic action is known. Here, we report the effects of two Bt proteins, Cry1Ab and Cry1Ac, on gene expression in the non-target collembolan, Folsomia candida. A customized microarray was used to study gene expression in F. candida specimens that were exposed to Cry1Ab and Cry1Ac. All selected transcripts were subsequently confirmed by qPCR. Eleven transcripts were finally verified, and three of them were annotated. The responses of all eleven transcripts were tested in specimens for both Cry1Ab and Cry1Ac at a series of concentrations. These transcripts were separated into two and three groups for Cry1Ab and Cry1Ac, respectively, depend on their expression levels. However, those eleven transcripts did not respond to the Bt proteins in Bt-rice residues. -- Highlights: • We examined the effects of Bt proteins on gene expression of Folsomia candida. • Eleven transcripts were up-regulated by Bt proteins (Cry1Ab and Cry1Ac). • Only three of the eleven transcripts were annotated. • The responses of 11 transcripts were tested on both Cry1Ab and Cry1Ac. • These transcripts did not respond to the Bt proteins in Bt-rice residues. -- Eleven potential molecular biomarkers of Folsomia candida to Cry1Ab and Cry1Ac were screened by microarray and qPCR analysis

  3. Development and Application of Loop-Mediated Isothermal Amplification Assays for Rapid Visual Detection of cry2Ab and cry3A Genes in Genetically-Modified Crops

    Directory of Open Access Journals (Sweden)

    Feiwu Li

    2014-08-01

    Full Text Available The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

  4. Development and application of loop-mediated isothermal amplification assays for rapid visual detection of cry2Ab and cry3A genes in genetically-modified crops.

    Science.gov (United States)

    Li, Feiwu; Yan, Wei; Long, Likun; Qi, Xing; Li, Congcong; Zhang, Shihong

    2014-08-27

    The cry2Ab and cry3A genes are two of the most important insect-resistant exogenous genes and had been widely used in genetically-modified crops. To develop more effective alternatives for the quick identification of genetically-modified organisms (GMOs) containing these genes, a rapid and visual loop-mediated isothermal amplification (LAMP) method to detect the cry2Ab and cry3A genes is described in this study. The LAMP assay can be finished within 60 min at an isothermal condition of 63 °C. The derived LAMP products can be obtained by a real-time turbidimeter via monitoring the white turbidity or directly observed by the naked eye through adding SYBR Green I dye. The specificity of the LAMP assay was determined by analyzing thirteen insect-resistant genetically-modified (GM) crop events with different Bt genes. Furthermore, the sensitivity of the LAMP assay was evaluated by diluting the template genomic DNA. Results showed that the limit of detection of the established LAMP assays was approximately five copies of haploid genomic DNA, about five-fold greater than that of conventional PCR assays. All of the results indicated that this established rapid and visual LAMP assay was quick, accurate and cost effective, with high specificity and sensitivity. In addition, this method does not need specific expensive instruments or facilities, which can provide a simpler and quicker approach to detecting the cry2Ab and cry3A genes in GM crops, especially for on-site, large-scale test purposes in the field.

  5. Adsorption of Insecticidal Crystal Protein Cry11Aa onto Nano-Mg(OH)2: Effects on Bioactivity and Anti-Ultraviolet Ability.

    Science.gov (United States)

    Pan, Xiaohong; Xu, Zhangyan; Li, Lan; Shao, Enshi; Chen, Saili; Huang, Tengzhou; Chen, Zhi; Rao, Wenhua; Huang, Tianpei; Zhang, Lingling; Wu, Songqing; Guan, Xiong

    2017-11-01

    The traditional Bacillus thuringiensis (Bt) formulations for field applications are not resistant to harsh environmental conditions. Hence, the active ingredients of the Bt bioinsecticides could degrade quickly and has low anti-ultraviolet ability in the field, which significantly limits its practical application. In the present study, we developed an efficient and stable delivery system for Bt Cry11Aa toxins. We coated Cry11Aa proteins with Mg(OH) 2 nanoparticles (MHNPs), and then assessed the effects of MHNPs on bioactivity and anti-ultraviolet ability of the Cry11Aa proteins. Our results indicated that MHNPs, like "coating clothes", could effectively protect the Cry protein and enhance the insecticidal bioactivity after UV radiation (the degradation rate was decreased from 64.29% to 16.67%). In addtion, MHNPs could improve the proteolysis of Cry11Aa in the midgut and aggravate the damage of the Cry protein to the gut epithelial cells, leading to increased insecticidal activity against Culex quinquefasciatus. Our results revealed that MHNPs, as an excellent nanocarrier, could substantially improve the insecticidal bioactivity and anti-ultraviolet ability of Cry11Aa.

  6. Genetic engineering of cotton with a novel cry2AX1 gene to impart insect resistance against Helicoverpa armigera

    Directory of Open Access Journals (Sweden)

    Karunamurthy Dhivya

    2016-09-01

    Full Text Available Embryogenic calli of cotton (Coker310 were cocultivated with the Agrobacterium tumefaciens strain LBA4404 harbouring the codon-optimised, chimeric cry2AX1 gene consisting of sequences from cry2Aa and cry2Ac genes isolated from Indian strains of Bacillus thuringiensis. Forty-eight putative transgenic plants were regenerated, and PCR analysis of these plants revealed the presence of the cry2AX1 gene in 40 plants. Southern blot hybridisation analysis of selected transgenic plants confirmed stable T-DNA integration in the genome of transformed plants. The level of Cry2AX1 protein expression in PCR positive plants ranged from 4.9 to 187.5 ng g-1 of fresh tissue. A transgenic cotton event, TP31, expressing the cry2AX1 gene showed insecticidal activity of 56.66 per cent mortality against Helicoverpa armigera in detached leaf disc bioassay. These results indicate that the chimeric cry2AX1 gene expressed in transgenic cotton has insecticidal activity against H. armigera.

  7. Spatio Temporal Expression Pattern of an Insecticidal Gene (cry2A in Transgenic Cotton Lines

    Directory of Open Access Journals (Sweden)

    Allah BAKHSH

    2012-11-01

    Full Text Available The production of transgenic plants with stable, high-level transgene expression is important for the success of crop improvement programs based on genetic engineering. The present study was conducted to evaluate genomic integration and spatio temporal expression of an insecticidal gene (cry2A in pre-existing transgenic lines of cotton. Genomic integration of cry2A was evaluated using various molecular approaches. The expression levels of cry2A were determined at vegetative and reproductive stages of cotton at regular intervals. These lines showed a stable integration of insecticidal gene in advance lines of transgenic cotton whereas gene expression was found variable with at various growth stages as well as in different plant parts throughout the season. The leaves of transgenic cotton were found to have maximum expression of cry2A gene followed by squares, bolls, anthers and petals. The protein level in fruiting part was less as compared to other parts showing inconsistency in gene expression. It was concluded that for culturing of transgenic crops, strategies should be developed to ensure the foreign genes expression efficient, consistent and in a predictable manner.

  8. Agronomic performance, chromosomal stability and resistance to velvetbean caterpillar of transgenic soybean expressing cry1Ac gene Performance agronômica, estabilidade cromossômica e resistência à lagarta-da-soja em soja transgênica que expressa o gene cry1Ac

    Directory of Open Access Journals (Sweden)

    Milena Schenkel Homrich

    2008-07-01

    Full Text Available The objective of this work was to analyze the agronomic performance and chromosomal stability of transgenic homozygous progenies of soybean [Glycine max (L. Merrill.], and to confirm the resistance of these plants against Anticarsia gemmatalis. Eleven progenies expressing cry1Ac, hpt and gusA genes were evaluated for agronomic characteristics in relation to the nontransformed parent IAS 5 cultivar. Cytogenetical analysis was carried out on transgenic and nontransgenic plants. Two out of the 11 transgenic progenies were also evaluated, in vitro and in vivo, for resistance to A. gemmatalis. Two negative controls were used in resistance bioassays: a transgenic homozygous line, containing only the gusA reporter gene, and nontransgenic 'IAS 5' plants. The presence of cry1Ac transgene affected neither the development nor the yield of plants. Cytogenetical analysis showed that transgenic plants presented normal karyotype. In detached-leaf bioassay, cry1Ac plants exhibited complete efficacy against A. gemmatalis, whereas negative controls were significantly damaged. Whole-plant feeding assay confirmed a very high protection of cry1Ac against velvetbean caterpillar, while nontransgenic 'IAS 5' plants and homozygous gusA line exhibited 56.5 and 71.5% defoliation, respectively. The presence of cry1Ac transgene doesn't affect the majority of agronomic traits (including yield of soybean and grants high protection against A. gemmatalis.O objetivo deste trabalho foi analisar a performance agronômica e a estabilidade cromossômica de progênies transgênicas homozigotas de soja [Glycine max (L. Merrill.], e confirmar a resistência dessas plantas a Anticarsia gemmatalis. Onze progênies com expressão dos genes cry1Ac, hpt e gusA foram avaliadas quanto às características agronômicas, em relação à cultivar parental IAS 5 não transformada. Análises citogenéticas foram realizadas em plantas transgênicas e não transgênicas. Duas das 11 prog

  9. A theoretical model of the tridimensional structure of Bacillus thuringiensis subsp. medellin Cry 11Bb toxin deduced by homology modelling

    Directory of Open Access Journals (Sweden)

    Gutierrez Pablo

    2001-01-01

    Full Text Available Cry11Bb is an insecticidal crystal protein produced by Bacillus thuringiensis subsp. medellin during its stationary phase; this ¶-endotoxin is active against dipteran insects and has great potential for mosquito borne disease control. Here, we report the first theoretical model of the tridimensional structure of a Cry11 toxin. The tridimensional structure of the Cry11Bb toxin was obtained by homology modelling on the structures of the Cry1Aa and Cry3Aa toxins. In this work we give a brief description of our model and hypothesize the residues of the Cry11Bb toxin that could be important in receptor recognition and pore formation. This model will serve as a starting point for the design of mutagenesis experiments aimed to the improvement of toxicity, and to provide a new tool for the elucidation of the mechanism of action of these mosquitocidal proteins.

  10. The distinct properties of natural and GM cry insecticidal proteins.

    Science.gov (United States)

    Latham, Jonathan R; Love, Madeleine; Hilbeck, Angelika

    2017-04-01

    The Cry toxins are a family of crystal-forming proteins produced by the bacterium Bacillus thuringiensis. Their mode of action is thought to be to create pores that disrupt the gut epithelial membranes of juvenile insects. These pores allow pathogen entry into the hemocoel, thereby killing the insect. Genes encoding a spectrum of Cry toxins, including Cry mutants, Cry chimaeras and other Cry derivatives, are used commercially to enhance insect resistance in genetically modified (GM) crops. In most countries of the world, such GM crops are regulated and must be assessed for human and environmental safety. However, such risk assessments often do not test the GM crop or its tissues directly. Instead, assessments rely primarily on historical information from naturally occurring Cry proteins and on data collected on Cry proteins (called 'surrogates') purified from laboratory strains of bacteria engineered to express Cry protein. However, neither surrogates nor naturally occurring Cry proteins are identical to the proteins to which humans or other nontarget organisms are exposed by the production and consumption of GM plants. To-date there has been no systematic survey of these differences. This review fills this knowledge gap with respect to the most commonly grown GM Cry-containing crops approved for international use. Having described the specific differences between natural, surrogate and GM Cry proteins this review assesses these differences for their potential to undermine the reliability of risk assessments. Lastly, we make specific recommendations for improving risk assessments.

  11. Larvicidal activity of Bacillus thuringiensis var. israelensis Cry11Aa toxin against Haemonchus contortus.

    Science.gov (United States)

    DE Lara, Ana Paula DE Souza Stori; Lorenzon, Lucas Bigolin; Vianna, Ana Muñoz; Santos, Francisco Denis Souza; Pinto, Luciano Silva; Aires Berne, Maria Elisabeth; Leite, Fábio Pereira Leivas

    2016-10-01

    Effective control of gastrointestinal parasites is necessary in sheep production. The development of anthelmintics resistance is causing the available chemically based anthelmintics to become less effective. Biological control strategies present an alternative to this problem. In the current study, we tested the larvicidal effects of Bacillus thuringiensis var. israelensis Cry11Aa toxin against Haemonchus contortus larvae. Bacterial suspensions [2 × 108 colony-forming units (CFU) g-1 of the feces] of B. thuringiensis var. israelensis and recombinant Escherichia coli expressing Cry11Aa toxin were added to naturally H. contortus egg-contaminated feces. The larvae were quantified, and significant reductions of 62 and 81% (P var. israelensis and recombinant E. coli expressing Cry11Aa toxin were then orally administered to lambs naturally infected with H. contortus. Twelve hours after administration, feces were collected and submitted to coprocultures. Significant larvae reductions (P var. israelensis is a promising new class of biological anthelmintics for treating sheep against H. contortus.

  12. Dominant negative phenotype of Bacillus thuringiensis Cry1Ab, Cry11Aa and Cry4Ba mutants suggest hetero-oligomer formation among different Cry toxins.

    NARCIS (Netherlands)

    Carmona, D.; Rodriguez-Almazan, C.; Munoz-Garay, C.; Portugal, L.; Perez, C.; Maagd, de R.A.; Bakker, P.; Soberon, M.; Bravo, A.

    2011-01-01

    Background - Bacillus thuringiensis Cry toxins are used worldwide in the control of different insect pests important in agriculture or in human health. The Cry proteins are pore-forming toxins that affect the midgut cell of target insects. It was shown that non-toxic Cry1Ab helix a-4 mutants had a

  13. Susceptibility of Anthonomus grandis (cotton boll weevil) and Spodoptera frugiperda (fall armyworm) to a cry1ia-type toxin from a Brazilian Bacillus thuringiensis strain.

    Science.gov (United States)

    Grossi-de-Sa, Maria Fatima; Quezado de Magalhaes, Mariana; Silva, Marilia Santos; Silva, Shirley Margareth Buffon; Dias, Simoni Campos; Nakasu, Erich Yukio Tempel; Brunetta, Patricia Sanglard Felipe; Oliveira, Gustavo Ramos; Neto, Osmundo Brilhante de Oliveira; Sampaio de Oliveira, Raquel; Soares, Luis Henrique Barros; Ayub, Marco Antonio Zachia; Siqueira, Herbert Alvaro Abreu; Figueira, Edson L Z

    2007-09-30

    Different isolates of the soil bacterium Bacillus thuringiensis produce multiple crystal (Cry) proteins toxic to a variety of insects, nematodes and protozoans. These insecticidal Cry toxins are known to be active against specific insect orders, being harmless to mammals, birds, amphibians, and reptiles. Due to these characteristics, genes encoding several Cry toxins have been engineered in order to be expressed by a variety of crop plants to control insectpests. The cotton boll weevil, Anthonomus grandis, and the fall armyworm, Spodoptera frugiperda, are the major economically devastating pests of cotton crop in Brazil, causing severe losses, mainly due to their endophytic habit, which results in damages to the cotton boll and floral bud structures. A cry1Ia-type gene, designated cry1Ia12, was isolated and cloned from the Bt S811 strain. Nucleotide sequencing of the cry1Ia12 gene revealed an open reading frame of 2160 bp, encoding a protein of 719 amino acid residues in length, with a predicted molecular mass of 81 kDa. The amino acid sequence of Cry1Ia12 is 99% identical to the known Cry1Ia proteins and differs from them only in one or two amino acid residues positioned along the three domains involved in the insecticidal activity of the toxin. The recombinant Cry1Ia12 protein, corresponding to the cry1Ia12 gene expressed in Escherichia coli cells, showed moderate toxicity towards first instar larvae of both cotton boll weevil and fall armyworm. The highest concentration of the recombinant Cry1Ia12 tested to achieve the maximum toxicities against cotton boll weevil larvae and fall armyworm larvae were 230 microg/mL and 5 microg/mL, respectively. The herein demonstrated insecticidal activity of the recombinant Cry1Ia12 toxin against cotton boll weevil and fall armyworm larvae opens promising perspectives for the genetic engineering of cotton crop resistant to both these devastating pests in Brazil.

  14. The midgut cadherin-like gene is not associated with resistance to Bacillus thuringiensis toxin Cry1Ac in Plutella xylostella (L.).

    Science.gov (United States)

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-03-01

    The Gram-positive bacterium Bacillus thuringiensis (Bt) produces Cry toxins that have been used to control important agricultural pests. Evolution of resistance in target pests threatens the effectiveness of these toxins when used either in sprayed biopesticides or in Bt transgenic crops. Although alterations of the midgut cadherin-like receptor can lead to Bt Cry toxin resistance in many insects, whether the cadherin gene is involved in Cry1Ac resistance of Plutella xylostella (L.) remains unclear. Here, we present experimental evidence that resistance to Cry1Ac or Bt var. kurstaki (Btk) in P. xylostella is not due to alterations of the cadherin gene. The bona fide P. xylostella cadherin cDNA sequence was cloned and analyzed, and comparisons of the cadherin cDNA sequence among susceptible and resistant P. xylostella strains confirmed that Cry1Ac resistance was independent of mutations in this gene. In addition, real-time quantitative PCR (qPCR) indicated that cadherin transcript levels did not significantly differ among susceptible and resistant P. xylostella strains. RNA interference (RNAi)-mediated suppression of cadherin gene expression did not affect larval susceptibility to Cry1Ac toxin. Furthermore, genetic linkage assays using four cadherin gDNA allelic biomarkers confirmed that the cadherin gene is not linked to resistance against Cry1Ac in P. xylostella. Taken together, our findings demonstrate that Cry1Ac resistance of P. xylostella is independent of the cadherin gene. Copyright © 2015 Elsevier Inc. All rights reserved.

  15. Transgenic rice plants expressing synthetic cry2AX1 gene exhibits resistance to rice leaffolder (Cnaphalocrosis medinalis).

    Science.gov (United States)

    Manikandan, R; Balakrishnan, N; Sudhakar, D; Udayasuriyan, V

    2016-06-01

    Bacillus thuringiensis is a major source of insecticidal genes imparting insect resistance in transgenic plants. Level of expression of transgenes in transgenic plants is important to achieve desirable level of resistance against target insects. In order to achieve desirable level of expression, rice chloroplast transit peptide sequence was fused with synthetic cry2AX1 gene to target its protein in chloroplasts. Sixteen PCR positive lines of rice were generated by Agrobacterium mediated transformation using immature embryos. Southern blot hybridization analysis of T 0 transgenic plants confirmed the integration of cry2AX1 gene in two to five locations of rice genome and ELISA demonstrated its expression. Concentration of Cry2AX1 in transgenic rice events ranged 5.0-120 ng/g of fresh leaf tissue. Insect bioassay of T 0 transgenic rice plants against neonate larvae of rice leaffolder showed larval mortality ranging between 20 and 80 % in comparison to control plant. Stable inheritance and expression of cry2AX1 gene was demonstrated in T 1 progenies through Southern and ELISA. In T 1 progenies, the highest concentration of Cry2AX1 and mortality of rice leaffolder larvae were recorded as 150 ng/g of fresh leaf tissue and 80 %, respectively. The Cry2AX1 expression even at a very low concentration (120-150 ng/g) in transgenic rice plants was found effective against rice leaffolder larvae.

  16. Shared Midgut Binding Sites for Cry1A.105, Cry1Aa, Cry1Ab, Cry1Ac and Cry1Fa Proteins from Bacillus thuringiensis in Two Important Corn Pests, Ostrinia nubilalis and Spodoptera frugiperda

    Science.gov (United States)

    Hernández-Rodríguez, Carmen Sara; Hernández-Martínez, Patricia; Van Rie, Jeroen; Escriche, Baltasar; Ferré, Juan

    2013-01-01

    First generation of insect-protected transgenic corn (Bt-corn) was based on the expression of Cry1Ab or Cry1Fa proteins. Currently, the trend is the combination of two or more genes expressing proteins that bind to different targets. In addition to broadening the spectrum of action, this strategy helps to delay the evolution of resistance in exposed insect populations. One of such examples is the combination of Cry1A.105 with Cry1Fa and Cry2Ab to control O. nubilalis and S. frugiperda. Cry1A.105 is a chimeric protein with domains I and II and the C-terminal half of the protein from Cry1Ac, and domain III almost identical to Cry1Fa. The aim of the present study was to determine whether the chimeric Cry1A.105 has shared binding sites either with Cry1A proteins, with Cry1Fa, or with both, in O. nubilalis and in S. frugiperda. Brush-border membrane vesicles (BBMV) from last instar larval midguts were used in competition binding assays with 125I-labeled Cry1A.105, Cry1Ab, and Cry1Fa, and unlabeled Cry1A.105, Cry1Aa, Cry1Ab, Cry1Ac, Cry1Fa, Cry2Ab and Cry2Ae. The results showed that Cry1A.105, Cry1Ab, Cry1Ac and Cry1Fa competed with high affinity for the same binding sites in both insect species. However, Cry2Ab and Cry2Ae did not compete for the binding sites of Cry1 proteins. Therefore, according to our results, the development of cross-resistance among Cry1Ab/Ac, Cry1A.105, and Cry1Fa proteins is possible in these two insect species if the alteration of shared binding sites occurs. Conversely, cross-resistance between these proteins and Cry2A proteins is very unlikely in such case. PMID:23861865

  17. Molecular cloning and functional analysis of a blue light receptor gene MdCRY2 from apple (Malus domestica).

    Science.gov (United States)

    Li, Yuan-Yuan; Mao, Ke; Zhao, Cheng; Zhao, Xian-Yan; Zhang, Rui-Fen; Zhang, Hua-Lei; Shu, Huai-Rui; Hao, Yu-Jin

    2013-04-01

    MdCRY2 was isolated from apple fruit skin, and its function was analyzed in MdCRY2 transgenic Arabidopsis. The interaction between MdCRY2 and AtCOP1 was found by yeast two-hybrid and BiFC assays. Cryptochromes are blue/ultraviolet-A (UV-A) light receptors involved in regulating various aspects of plant growth and development. Investigations of the structure and functions of cryptochromes in plants have largely focused on Arabidopsis (Arabidopsis thaliana), tomato (Solanum lycopersicum), pea (Pisum sativum), and rice (Oryza sativa). However, no data on the function of CRY2 are available in woody plants. In this study, we isolated a cryptochrome gene, MdCRY2, from apple (Malus domestica). The deduced amino acid sequences of MdCRY2 contain the conserved N-terminal photolyase-related domain and the flavin adenine dinucleotide (FAD) binding domain, as well as the C-terminal DQXVP-acidic-STAES (DAS) domain. Relationship analysis indicates that MdCRY2 shows the highest similarity to the strawberry FvCRY protein. The expression of MdCRY2 is induced by blue/UV-A light, which represents a 48-h circadian rhythm. To investigate the function of MdCRY2, we overexpressed the MdCRY2 gene in a cry2 mutant and wild type (WT) Arabidopsis, assessed the phenotypes of the resulting transgenic plants, and found that MdCRY2 functions to regulate hypocotyl elongation, root growth, flower initiation, and anthocyanin accumulation. Furthermore, we examined the interaction between MdCRY2 and AtCOP1 using a yeast two-hybrid assay and a bimolecular fluorescence complementation assay. These data provide functional evidence for a role of blue/UV-A light-induced MdCRY2 in controlling photomorphogenesis in apple.

  18. Genomic sequences of murine gamma B- and gamma C-crystallin-encoding genes: promoter analysis and complete evolutionary pattern of mouse, rat and human gamma-crystallins.

    Science.gov (United States)

    Graw, J; Liebstein, A; Pietrowski, D; Schmitt-John, T; Werner, T

    1993-12-22

    The murine genes, gamma B-cry and gamma C-cry, encoding the gamma B- and gamma C-crystallins, were isolated from a genomic DNA library. The complete nucleotide (nt) sequences of both genes were determined from 661 and 711 bp, respectively, upstream from the first exon to the corresponding polyadenylation sites, comprising more than 2650 and 2890 bp, respectively. The new sequences were compared to the partial cDNA sequences available for the murine gamma B-cry and gamma C-cry, as well as to the corresponding genomic sequences from rat and man, at both the nt and predicted amino acid (aa) sequence levels. In the gamma B-cry promoter region, a canonical CCAAT-box, a TATA-box, putative NF-I and C/EBP sites were detected. An R-repeat is inserted 366 bp upstream from the transcription start point. In contrast, the gamma C-cry promoter does not contain a CCAAT-box, but some other putative binding sites for transcription factors (AP-2, UBP-1, LBP-1) were located by computer analysis. The promoter regions of all six gamma-cry from mouse, rat and human, except human psi gamma F-cry, were analyzed for common sequence elements. A complex sequence element of about 70-80 bp was found in the proximal promoter, which contains a gamma-cry-specific and almost invariant sequence (crygpel) of 14 nt, and ends with the also invariant TATA-box. Within the complex sequence element, a minimum of three further features specific for the gamma A-, gamma B- and gamma D/E/F-cry genes can be defined, at least two of which were recently shown to be functional. In addition to these four sequence elements, a subtype-specific structure of inverted repeats with different-sized spacers can be deduced from the multiple sequence alignment. A phylogenetic analysis based on the promoter region, as well as the complete exon 3 of all gamma-cry from mouse, rat and man, suggests separation of only five gamma-cry subtypes (gamma A-, gamma B-, gamma C-, gamma D- and gamma E/F-cry) prior to species separation.

  19. In vivo binding of the Cry11Bb toxin of Bacillus thuringiensis subsp. medellin to the midgut of mosquito larvae (Diptera: Culicidae

    Directory of Open Access Journals (Sweden)

    Ruiz Lina María

    2004-01-01

    Full Text Available Bacillus thuringiensis subsp. medellin produces numerous proteins among which 94 kDa known as Cry11Bb, has mosquitocidal activity. The mode of action of the Cry11 proteins has been described as similar to those of the Cry1 toxins, nevertheless, the mechanism of action is still not clear. In this study we investigated the in vivo binding of the Cry11Bb toxin to the midgut of the insect species Anopheles albimanus, Aedes aegypti, and Culex quinquefasciatus by immunohistochemical analysis. Spodoptera frugiperda was included as negative control. The Cry11Bb protein was detected on the apical microvilli of the midgut epithelial cells, mostly on the posterior midgut and gastric caeca of the three mosquito species. Additionally, the toxin was detected in the Malpighian tubules of An. albimanus, Ae. aegypti, Cx. quinquefasciatus, and in the basal membrane of the epithelial cells of Ae. aegypti midgut. No toxin accumulation was observed in the peritrophic membrane of any of the mosquito species studied. These results confirm that the primary site of action of the Cry11 toxins is the apical membrane of the midgut epithelial cells of mosquito larvae.

  20. Development and validation of an integrated DNA walking strategy to detect GMO expressing cry genes.

    Science.gov (United States)

    Fraiture, Marie-Alice; Vandamme, Julie; Herman, Philippe; Roosens, Nancy H C

    2018-06-27

    Recently, an integrated DNA walking strategy has been proposed to prove the presence of GMO via the characterisation of sequences of interest, including their transgene flanking regions and the unnatural associations of elements in their transgenic cassettes. To this end, the p35S, tNOS and t35S pCAMBIA elements have been selected as key targets, allowing the coverage of most of GMO, EU authorized or not. In the present study, a bidirectional DNA walking method anchored on the CryAb/c genes is proposed with the aim to cover additional GMO and additional sequences of interest. The performance of the proposed bidirectional DNA walking method anchored on the CryAb/c genes has been evaluated in a first time for its feasibility using several GM events possessing these CryAb/c genes. Afterwards, its sensitivity has been investigated through low concentrations of targets (as low as 20 HGE). In addition, to illustrate its applicability, the entire workflow has been tested on a sample mimicking food/feed matrices analysed in GMO routine analysis. Given the successful assessment of its performance, the present bidirectional DNA walking method anchored on the CryAb/c genes can easily be implemented in GMO routine analysis by the enforcement laboratories and allows completing the entire DNA walking strategy in targeting an additional transgenic element frequently found in GMO.

  1. Effects of the cryptochrome CryB from Rhodobacter sphaeroides on global gene expression in the dark or blue light or in the presence of singlet oxygen.

    Directory of Open Access Journals (Sweden)

    Sebastian Frühwirth

    Full Text Available Several regulators are controlling the formation of the photosynthetic apparatus in the facultatively photosynthetic bacterium Rhodobacter sphaeroides. Among the proteins affecting photosynthesis gene expression is the blue light photoreceptor cryptochrome CryB. This study addresses the effect of CryB on global gene expression. The data reveal that CryB does not only influence photosynthesis gene expression but also genes for the non-photosynthetic energy metabolism like citric acid cycle and oxidative phosphorylation. In addition several genes involved in RNA processing and in transcriptional regulation are affected by a cryB deletion. Although CryB was shown to undergo a photocycle it does not only affect gene expression in response to blue light illumination but also in response to singlet oxygen stress conditions. While there is a large overlap in these responses, some CryB-dependent effects are specific for blue-light or photooxidative stress. In addition to protein-coding genes some genes for sRNAs show CryB-dependent expression. These findings give new insight into the function of bacterial cryptochromes and demonstrate for the first time a function in the oxidative stress response.

  2. CRY2 genetic variants associate with dysthymia.

    Directory of Open Access Journals (Sweden)

    Leena Kovanen

    Full Text Available People with mood disorders often have disruptions in their circadian rhythms. Recent molecular genetics has linked circadian clock genes to mood disorders. Our objective was to study two core circadian clock genes, CRY1 and CRY2 as well as TTC1 that interacts with CRY2, in relation to depressive and anxiety disorders. Of these three genes, 48 single-nucleotide polymorphisms (SNPs whose selection was based on the linkage disequilibrium and potential functionality were genotyped in 5910 individuals from a nationwide population-based sample. The diagnoses of major depressive disorder, dysthymia and anxiety disorders were assessed with a structured interview (M-CIDI. In addition, the participants filled in self-report questionnaires on depressive and anxiety symptoms. Logistic and linear regression models were used to analyze the associations of the SNPs with the phenotypes. Four CRY2 genetic variants (rs10838524, rs7121611, rs7945565, rs1401419 associated significantly with dysthymia (false discovery rate q<0.05. This finding together with earlier CRY2 associations with winter depression and with bipolar type 1 disorder supports the view that CRY2 gene has a role in mood disorders.

  3. CRI, 4-Processor VAX-11/780 Simulation of CRAY Multitasking System

    International Nuclear Information System (INIS)

    Werner, N.E.; Van Matre, S.W.

    1988-01-01

    1 - Description of program or function: CRI is a subroutine library and set of utilities which allow the use of a four-processor shared memory DEC VAX11/780-4 computer for parallel processing in a manner compatible with the present use of Cray Research, Inc.'s (CRI's) multitasking primitives on Cray computers. Included in the library are subroutines to perform resource initialization, task functions, lock operations, event signals, file sharing, and work queueing synchronization. 2 - Method of solution: A task consists of code and data that can be scheduled for execution on a CPU. Locks are the facility for monitoring critical regions of code. Events allow signaling between tasks; they have two states: cleared and posted. Posting an event allows all other tasks waiting on that event to resume execution. The CRI utilities consist of command procedures for creating the files needed to use the shared memory; for compiling and liking a multitasking program; for starting the logical processors on the physical processors after the time specified by submitting the job(s) to the selected generic batch queue and, optionally, interactively relinquishing control to the multiprocessor debugger; and for removing jobs from the batch queue and, optionally, un-mapping specified global sections from shared memory. CRIDEBUG utility does not work properly in this release

  4. Effect of gamma irradiation on nutritional components and Cry1Ab protein in the transgenic rice with a synthetic cry1Ab gene from Bacillus thuringiensis

    International Nuclear Information System (INIS)

    Wu Dianxing; Ye Qingfu; Wang Zhonghua; Xia Yingwu

    2004-01-01

    The effects of gamma irradiation on the transgenic rice containing a synthetic cry1Ab gene from Bacillus thuringiensis were investigated. There was almost no difference in the content of the major nutritional components, i.e. crude protein, crude lipid, eight essential amino acids and total ash between the irradiated grains and the non-irradiated transgenic rice. However, the amounts of Cry1Ab protein and apparent amylose in the irradiated transgenic rice were reduced significantly by the doses higher than 200 Gy. In vivo observation showed that Cry1Ab protein contents also decreased in the fresh leaf tissues of survival seedlings after irradiation with 200 Gy or higher doses and showed inhibition of seedling growth. The results indicate that gamma irradiation might improve the quality of transgenic rice due to removal of the toxic Cry1Ab protein

  5. Use of endophytic diazotrophic bacteria as a vector to express the cry3A gene from Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Salles Joana Falcão

    2000-01-01

    Full Text Available The goal of this study was to evaluate the potential of endophytic diazotrophic bacteria as a vector to express a cry gene from Bacillus thuringiensis, envisaging the control of pests that attack sugarcane plants. The endophytic nitrogen-fixing bacteria Gluconacetobacter diazotrophicus strain BR11281 and Herbaspirillum seropedicae strain BR11335 were used as models. The cry3A gene was transferred by conjugation using a suicide plasmid and the recombinant strains were selected by their ability to fix nitrogen in semi-solid N-free medium. The presence of the cry gene was detected by Southern-blot using an internal fragment of 1.0 kb as a probe. The production of delta-endotoxin by the recombinant H. seropedicae strain was detected by dot blot while for G. diazotrophicus the Western-blot technique was used. In both cases, a specific antibody raised against the B. thuringiensis toxin was applied. The delta-endotoxin production showed by the G. diazotrophicus recombinant strain was dependent on the nitrogen fixing conditions since the cry3A gene was fused to a nif promoter. In the case of H. seropedicae the delta-endotoxin expression was not affected by the promoter (rhi used. These results suggest that endophytic diazotrophic bacteria can be used as vectors to express entomopathogenic genes envisaging control of sugarcane pests.

  6. Expression of Cry1Ab and Cry2Ab by a polycistronic transgene with a self-cleavage peptide in rice.

    Directory of Open Access Journals (Sweden)

    Qichao Zhao

    Full Text Available Insect resistance to Bacillus thuringiensis (Bt crystal protein is a major threat to the long-term use of transgenic Bt crops. Gene stacking is a readily deployable strategy to delay the development of insect resistance while it may also broaden insecticidal spectrum. Here, we report the creation of transgenic rice expressing discrete Cry1Ab and Cry2Ab simultaneously from a single expression cassette using 2A self-cleaving peptides, which are autonomous elements from virus guiding the polycistronic viral gene expression in eukaryotes. The synthetic coding sequences of Cry1Ab and Cry2Ab, linked by the coding sequence of a 2A peptide from either foot and mouth disease virus or porcine teschovirus-1, regardless of order, were all expressed as discrete Cry1Ab and Cry2Ab at high levels in the transgenic rice. Insect bioassays demonstrated that the transgenic plants were highly resistant to lepidopteran pests. This study suggested that 2A peptide can be utilized to express multiple Bt genes at high levels in transgenic crops.

  7. High Expression of Cry1Ac Protein in Cotton (Gossypium hirsutum by Combining Independent Transgenic Events that Target the Protein to Cytoplasm and Plastids.

    Directory of Open Access Journals (Sweden)

    Amarjeet Kumar Singh

    Full Text Available Transgenic cotton was developed using two constructs containing a truncated and codon-modified cry1Ac gene (1,848 bp, which was originally characterized from Bacillus thuringiensis subspecies kurstaki strain HD73 that encodes a toxin highly effective against many lepidopteran pests. In Construct I, the cry1Ac gene was cloned under FMVde, a strong constitutively expressing promoter, to express the encoded protein in the cytoplasm. In Construct II, the encoded protein was directed to the plastids using a transit peptide taken from the cotton rbcSIb gene. Genetic transformation experiments with Construct I resulted in a single copy insertion event in which the Cry1Ac protein expression level was 2-2.5 times greater than in the Bacillus thuringiensis cotton event Mon 531, which is currently used in varieties and hybrids grown extensively in India and elsewhere. Another high expression event was selected from transgenics developed with Construct II. The Cry protein expression resulting from this event was observed only in the green plant parts. No transgenic protein expression was observed in the non-green parts, including roots, seeds and non-green floral tissues. Thus, leucoplasts may lack the mechanism to allow entry of a protein tagged with the transit peptide from a protein that is only synthesized in tissues containing mature plastids. Combining the two events through sexual crossing led to near additive levels of the toxin at 4-5 times the level currently used in the field. The two high expression events and their combination will allow for effective resistance management against lepidopteran insect pests, particularly Helicoverpa armigera, using a high dosage strategy.

  8. Cry1F resistance in fall armyworm Spodoptera frugiperda: single gene versus pyramided Bt maize.

    Science.gov (United States)

    Huang, Fangneng; Qureshi, Jawwad A; Meagher, Robert L; Reisig, Dominic D; Head, Graham P; Andow, David A; Ni, Xinzi; Kerns, David; Buntin, G David; Niu, Ying; Yang, Fei; Dangal, Vikash

    2014-01-01

    Evolution of insect resistance to transgenic crops containing Bacillus thuringiensis (Bt) genes is a serious threat to the sustainability of this technology. However, field resistance related to the reduced efficacy of Bt maize has not been documented in any lepidopteran pest in the mainland U.S. after 18 years of intensive Bt maize planting. Here we report compelling evidence of field resistance in the fall armyworm, Spodoptera frugiperda (J.E. Smith), to Cry1F maize (TC 3507) in the southeastern region of the U.S. An F2 screen showed a surprisingly high (0.293) Cry1F resistance allele frequency in a population collected in 2011 from non-Bt maize in south Florida. Field populations from non-Bt maize in 2012-2013 exhibited 18.8-fold to >85.4-fold resistance to purified Cry1F protein and those collected from unexpectedly damaged Bt maize plants at several locations in Florida and North Carolina had >85.4-fold resistance. In addition, reduced efficacy and control failure of Cry1F maize against natural populations of S. frugiperda were documented in field trials using Cry1F-based and pyramided Bt maize products in south Florida. The Cry1F-resistant S. frugiperda also showed a low level of cross-resistance to Cry1A.105 and related maize products, but not to Cry2Ab2 or Vip3A. The occurrence of Cry1F resistance in the U.S. mainland populations of S. frugiperda likely represents migration of insects from Puerto Rico, indicating the great challenges faced in achieving effective resistance management for long-distance migratory pests like S. frugiperda.

  9. Down-regulation of a novel ABC transporter gene (Pxwhite) is associated with Cry1Ac resistance in the diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Guo, Zhaojiang; Kang, Shi; Zhu, Xun; Xia, Jixing; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhang, Youjun

    2015-04-01

    Biopesticides or transgenic crops based on Cry toxins from the soil bacterium Bacillus thuringiensis (Bt) effectively control agricultural insect pests. The sustainable use of Bt biopesticides and Bt crops is threatened, however, by the development of Cry resistance in the target pests. The diamondback moth, Plutella xylostella (L.), is the first pest that developed resistance to a Bt biopesticide in the field, and a recent study has shown that the resistance of P. xylostella to Cry1Ac is caused by a mutation in an ATP-binding cassette (ABC) transporter gene (ABCC2). In this study, we report that down-regulation of a novel ABC transporter gene from ABCG subfamily (Pxwhite) is associated with Cry1Ac resistance in P. xylostella. The full-length cDNA sequence of Pxwhite was cloned and analyzed. Spatial-temporal expression detection revealed that Pxwhite was expressed in all tissues and developmental stages, and highest expressed in Malpighian tubule tissue and in egg stage. Sequence variation analysis of Pxwhite indicated the absence of constant non-synonymous mutations between susceptible and resistant strains, whereas midgut transcript analysis showed that Pxwhite was remarkably reduced in all resistant strains and further reduced when larvae of the moderately resistant SZ-R strain were subjected to selection with Cry1Ac toxin. Furthermore, RNA interference (RNAi)-mediated suppression of Pxwhite gene expression significantly reduced larval susceptibility to Cry1Ac toxin, and genetic linkage analysis confirmed that down-regulation of Pxwhite gene is tightly linked to Cry1Ac resistance in P. xylostella. To our knowledge, this is the first report indicating that Pxwhite gene is involved in Cry1Ac resistance in P. xylostella. Copyright © 2015 Elsevier Ltd. All rights reserved.

  10. Safety assessment of lepidopteran insect-protected transgenic rice with cry2A* gene.

    Science.gov (United States)

    Zou, Shiying; Huang, Kunlun; Xu, Wentao; Luo, Yunbo; He, Xiaoyun

    2016-04-01

    Numerous genetically modified (GM) crops expressing proteins for insect resistance have been commercialized following extensive testing demonstrating that the foods obtained from them are as safe as that obtained from their corresponding non-GM varieties. In this paper, we report the outcome of safety studies conducted on a newly developed insect-resistant GM rice expressing the cry2A* gene by a subchronic oral toxicity study on rats. GM rice and non-GM rice were incorporated into the diet at levels of 30, 50, and 70% (w/w), No treatment-related adverse or toxic effects were observed based on an examination of the daily clinical signs, body weight, food consumption, hematology, serum biochemistry, and organ weight or based on gross and histopathological examination. These results demonstrate that the GM rice with cry2A* gene is as safe for food as conventional non-GM rice.

  11. Many Saccharomyces cerevisiae Cell Wall Protein Encoding Genes Are Coregulated by Mss11, but Cellular Adhesion Phenotypes Appear Only Flo Protein Dependent.

    Science.gov (United States)

    Bester, Michael C; Jacobson, Dan; Bauer, Florian F

    2012-01-01

    The outer cell wall of the yeast Saccharomyces cerevisiae serves as the interface with the surrounding environment and directly affects cell-cell and cell-surface interactions. Many of these interactions are facilitated by specific adhesins that belong to the Flo protein family. Flo mannoproteins have been implicated in phenotypes such as flocculation, substrate adhesion, biofilm formation, and pseudohyphal growth. Genetic data strongly suggest that individual Flo proteins are responsible for many specific cellular adhesion phenotypes. However, it remains unclear whether such phenotypes are determined solely by the nature of the expressed FLO genes or rather as the result of a combination of FLO gene expression and other cell wall properties and cell wall proteins. Mss11 has been shown to be a central element of FLO1 and FLO11 gene regulation and acts together with the cAMP-PKA-dependent transcription factor Flo8. Here we use genome-wide transcription analysis to identify genes that are directly or indirectly regulated by Mss11. Interestingly, many of these genes encode cell wall mannoproteins, in particular, members of the TIR and DAN families. To examine whether these genes play a role in the adhesion properties associated with Mss11 expression, we assessed deletion mutants of these genes in wild-type and flo11Δ genetic backgrounds. This analysis shows that only FLO genes, in particular FLO1/10/11, appear to significantly impact on such phenotypes. Thus adhesion-related phenotypes are primarily dependent on the balance of FLO gene expression.

  12. Bt rice harbouring cry genes controlled by a constitutive or wound-inducible promoter: protection and transgene expression under Mediterranean field conditions.

    Science.gov (United States)

    Breitler, Jean Christophe; Vassal, Jean Michel; del Mar Catala, Maria; Meynard, Donaldo; Marfà, Victoria; Melé, Enric; Royer, Monique; Murillo, Isabel; San Segundo, Blanca; Guiderdoni, Emmanuel; Messeguer, Joaquima

    2004-09-01

    Seven homozygous transgenic lines of two European commercial cultivars of rice (Ariete (A) and Senia (S)), harbouring the cry1B or cry1Aa Bacillus thuringiensis (Bt) delta-endotoxin genes, were field evaluated for protection from striped stem borer (SSB) (Chilo suppressalis) damage during the 2001 and 2002 summer crop seasons in the Delta de l'Ebre region, Spain. The plant codon-optimized toxin gene was placed under the control of the promoter of either the constitutive ubi1 gene or the wound-inducible mpi gene from maize. Stable, high-level, insecticidal protein accumulation was observed throughout root, leaf and seed tissues of field-grown plants harbouring the cry1B (lines A64.1, A33.1, A3.4 and S98.9) or cry1Aa (lines S05.1 and A19.14) genes under the control of the ubi1 promoter. Conversely, no toxin was detected in unwounded vegetative tissues of the A9.1 line harbouring the cry1B gene controlled by the mpi promoter, indicating that natural environmental stresses did not trigger the activity of the wound-inducible promoter. However, the toxin accumulated at 0.2% total soluble proteins in A9.1 sheath tissue exhibiting brown lesions resulting from SSB damage. The agronomical traits and performance of the transgenic lines were generally comparable with parental controls, except in the two lines accumulating Cry1Aa, which exhibited a high frequency of plants non-true to type. Natural infestation was assisted with manual infestations of L2/L3 SSB larvae in border control plants surrounding the experimental plots, which served as a reservoir for the second-cycle SSB population. The observation of damage (brown lesions and dead hearts) during the crop season and dissection of plants at harvest stage revealed a range of protection amongst the transgenic lines, which was highly consistent with the level of toxin accumulation and with previous experience in greenhouse assays. Lines A3.4 and S05.1 were found to exhibit stable and full protection against SSB attacks

  13. Involvement of the VDE homing endonuclease and rapamycin in regulation of the Saccharomyces cerevisiae GSH11 gene encoding the high affinity glutathione transporter.

    Science.gov (United States)

    Miyake, Tsuyoshi; Hiraishi, Hiroyuki; Sammoto, Hiroyuki; Ono, Bun-Ichiro

    2003-10-10

    The Saccharomyces cerevisiae gene HGT1/GSH11 encodes the high affinity glutathione transporter and is repressed by cysteine added to the culture medium. It has been found previously that a 5'-upstream cis-element, CCGCCACAC, is responsible for regulating GSH11 expression and that several proteins bind to this element (Miyake, T., Kanayama, M., Sammoto, H., and Ono, B. (2002) Mol. Genet. Genomics 266, 1004-1011). In this report we present evidence that the most prominent of these proteins is VDE, known previously as the homing endonuclease encoded by VMA1. We show also that GSH11 is not expressed in a VDE-deleted strain and that inability to express the GSH11 of this strain is overcome by introduction of the coding region of VDE or the entire VMA1 gene. It is also found that VDE does not cut DNA in the vicinity of the GSH11 cis-element. Rapamycin, an inhibitor of the target of rapamycin (TOR) signal-transduction system, is found to enhance expression of GSH11 in a VDE-dependent manner under conditions of sulfur starvation. These results indicate that GSH11 is regulated by a system sensitive to sulfur starvation (presumably via cysteine depletion) and a more general system involving the nutritional starvation signal mediated by the TOR system. Both systems need to be operational (inhibition of TOR and sulfur starvation) for full expression of GSH11.

  14. Transformation and evaluation of Cry1Ac+Cry2A and GTGene in Gossypium hirsutum L.

    Directory of Open Access Journals (Sweden)

    Agung Nugroho Puspito

    2015-11-01

    Full Text Available More than 50 countries around the globe cultivate cotton on a large scale. It is a major cash crop of Pakistan and is considered white gold because it is highly important to the economy of Pakistan. In addition to its importance, cotton cultivation faces several problems, such as insect pests, weeds, and viruses. In the past, insects have been controlled by insecticides, but this method caused a severe loss to the economy. However, conventional breeding methods have provided considerable breakthroughs in the improvement of cotton, but it also has several limitations. In comparison with conventional methods, biotechnology has the potential to create genetically modified plants that are environmentally safe and economically viable. In this study, a local cotton variety VH 289 was transformed with two Bt genes (Cry1Ac and Cry2A and a herbicide resistant gene (cp4 EPSPS using the Agrobacterium mediated transformation method. The constitutive CaMV 35S promoter was attached to the genes taken from Bacillus thuringiensis (Bt and to an herbicide resistant gene during cloning, and this promoter was used for the expression of the genes in cotton plants. This construct was used to develop the Glyphosate Tolerance Gene (GTGene for herbicide tolerance and insecticidal gene (Cry1Ac and Cry2A for insect tolerance in the cotton variety VH 289. The transgenic cotton variety performed 85% better compared with the non-transgenic variety. The study results suggest that farmers should use the transgenic cotton variety for general cultivation to improve the production of cotton.

  15. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  16. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  17. Functional analysis of the ASTE11 gene from the dimorphic yeast Arxula adeninivorans

    International Nuclear Information System (INIS)

    El Fiki, A.; El Metabteb, G.; Boer, E.; Kunze, G.

    2010-01-01

    Arxula adeninivorans is dimorphic yeast with unusual biochemical and physiological characteristic. It is thermo- and osmo- resistance and it can use a wide range of carbon sources for growth. One kinase of the HOG pathway, the MAPKKK is encoded by ASTE11 gene which was isolated from A. adeninivorans. The aste11 mutant was achieved by gene disruption procedure. The Sck1p gene encoding MAPKKK in S. cerevisiae can complement with aste11 mutation. Growth rate of G1211/pAL-ALEU2m, G1211/pAL-ALEU2m-ASTE11 (over-expression transformants) and IS1 [aleu2 aste11 ALEU2] (aste11 mutant), the ASTE11 expression level dose not correlates with salt resistance. However, the growth rate of G1211/pAL-ALEU2m, G1211/pAL-ALEU2m-ASTE11 (over-expression transformants) and IS1 [aleu2 aste11::ALEU2] (aste11 mutant) and the response to thermo stress were affected in the deleted mutant, the Aste11p influenced the thermo resistance of A. adeninivorans. The MAPKKK encoding by STE11 gene from various yeast species is involved in the mating process. The mutant strains and their transformants were lost the capacity to mate. Assessment of the ASTE11 promoter activity with lacZ reporter gene confirmed its inducibility by osmolaytes.

  18. LSSP-PCR para la identificación de polimorfismos en el gen cry1B en cepas nativas de Bacillus thuringiensis

    Directory of Open Access Journals (Sweden)

    Martha Ilce Orozco Mera

    2012-01-01

    Full Text Available Título en ingles: LSSP-PCR to identify polymorphisms in the gene cry1B of Bacillus thuringiensis native strain Resumen: Se estandarizó la técnica LSSP-PCR (reacción en cadena de la polimerasa con un único oligonucleótido en condiciones de baja astringencia, para identificar polimorfismos del gen cry1B en aislamientos nativos de Bacillus thuringiensis (Bt. Se evaluaron 164 aislamientos nativos colombianos identificándose el gen cry1Ba en 11 de estos aislamientos. Los 11 fragmentos amplificados, junto con el de la cepa de referencia Bt subsp. aizawai HD137, se analizaron por LSSP-PCR y los patrones electroforéticos obtenidos se compararon cualitativamente. Con los productos amplificados mediante el oligonucleótido directo se construyó un dendrograma utilizando UPGMA que  mostró tres agrupamientos con similitud de 83, 79 y 68%. La agrupación con 68% de similaridad correspondió al aislamiento nativo BtGC120 que presentó el patrón de bandas más variable. Con el oligonucleótido reverso el aislamiento BtGC120 mostró una menor variabilidad (43%. La secuencia nucleotidica obtenida de este fragmento de 806 pares de bases mostró una identidad de 93% con la secuencia de los genes cry1Bc1 de Bt morrisoni y cry1Bb1 de la cepa BT-EG5847. Se predijo del marco de lectura +3 una proteína de 268 residuos aminoácidicos, con 88% de identidad con la proteína Cry1Bc. Esta  secuencia reveló dos dominios, una endotoxina N implicada en la formación del poro y otra endotoxina M relacionada en el reconocimiento del receptor. La evaluación biológica del aislamiento BtGC120 sobre larvas de primer instar del insecto plaga Spodoptera frugiperda, mostró una CL50 de 1,896 ng de proteína total por cm2. Este estudio muestra que la LSSP-PCR es una técnica que permite identificar de una manera específica variaciones en las secuencias de los genes cry de Bt, con potencialidad de encontrar nuevos genes con novedosas actividades biológicas. Abstract

  19. Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

    Science.gov (United States)

    Oppert, Brenda; Dowd, Scot E; Bouffard, Pascal; Li, Lewyn; Conesa, Ana; Lorenzen, Marcé D; Toutges, Michelle; Marshall, Jeremy; Huestis, Diana L; Fabrick, Jeff; Oppert, Cris; Jurat-Fuentes, Juan Luis

    2012-01-01

    Bacillus thuringiensis (Bt) crystal (Cry) proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence dataset for T. molitor

  20. Transcriptome profiling of the intoxication response of Tenebrio molitor larvae to Bacillus thuringiensis Cry3Aa protoxin.

    Directory of Open Access Journals (Sweden)

    Brenda Oppert

    Full Text Available Bacillus thuringiensis (Bt crystal (Cry proteins are effective against a select number of insect pests, but improvements are needed to increase efficacy and decrease time to mortality for coleopteran pests. To gain insight into the Bt intoxication process in Coleoptera, we performed RNA-Seq on cDNA generated from the guts of Tenebrio molitor larvae that consumed either a control diet or a diet containing Cry3Aa protoxin. Approximately 134,090 and 124,287 sequence reads from the control and Cry3Aa-treated groups were assembled into 1,318 and 1,140 contigs, respectively. Enrichment analyses indicated that functions associated with mitochondrial respiration, signalling, maintenance of cell structure, membrane integrity, protein recycling/synthesis, and glycosyl hydrolases were significantly increased in Cry3Aa-treated larvae, whereas functions associated with many metabolic processes were reduced, especially glycolysis, tricarboxylic acid cycle, and fatty acid synthesis. Microarray analysis was used to evaluate temporal changes in gene expression after 6, 12 or 24 h of Cry3Aa exposure. Overall, microarray analysis indicated that transcripts related to allergens, chitin-binding proteins, glycosyl hydrolases, and tubulins were induced, and those related to immunity and metabolism were repressed in Cry3Aa-intoxicated larvae. The 24 h microarray data validated most of the RNA-Seq data. Of the three intoxication intervals, larvae demonstrated more differential expression of transcripts after 12 h exposure to Cry3Aa. Gene expression examined by three different methods in control vs. Cry3Aa-treated larvae at the 24 h time point indicated that transcripts encoding proteins with chitin-binding domain 3 were the most differentially expressed in Cry3Aa-intoxicated larvae. Overall, the data suggest that T. molitor larvae mount a complex response to Cry3Aa during the initial 24 h of intoxication. Data from this study represent the largest genetic sequence

  1. Microarray detection and qPCR screening of potential biomarkers of Folsomia candida (Collembola: Isotomidae) exposed to Bt proteins (Cry1Ab and Cry1Ac)

    DEFF Research Database (Denmark)

    Yuan, Yiyang; Krogh, Paul Henning; Bai, Xue

    2014-01-01

    The impact of Bt proteins on non-target arthropods is less understood than their effects on target organisms where the mechanism of toxic action is known. Here, we report the effects of two Bt proteins, Cry1Ab and Cry1Ac, on gene expression in the non-target collembolan, Folsomia candida....... A customized microarray was used to study gene expression in F. candida specimens that were exposed to Cry1Ab and Cry1Ac. All selected transcripts were subsequently confirmed by qPCR. Eleven transcripts were finally verified, and three of them were annotated. The responses of all eleven transcripts were...... tested in specimens for both Cry1Ab and Cry1Ac at a series of concentrations. These transcripts were separated into two and three groups for Cry1Ab and Cry1Ac, respectively, depend on their expression levels. However, those eleven transcripts did not respond to the Bt proteins in Bt-rice residues....

  2. [Transformation and expression of specific insecticide gene Bt cry3A in resident endogenetic bacteria isolated from Apriona germari (Hope) larvae intestines].

    Science.gov (United States)

    Zhongkang, Wang; Wei, He; Guoxiong, Peng; Yuxian, Xia; Qiang, Li; Youping, Yin

    2008-09-01

    Transforming the specific insecticidal gene Bt cry3A into the dominant resident endogenetic bacteria in intestines of Apriona germari (Hope) larvae to construct transgenic bacteria that can colonize and express the insecticidal gene Bt cry3A perfectly in intestines of Apriona germari (Hope) larvae. We isolated and identified the dominant resident endogenetic bacteria by traditional methods and molecular method based of 16S rDNA analysis. Two Escherichia coli--Bacillus thuringiensis shuttle plasmid pHT305a and pHT7911 which contained specific insecticidal gene Bt cry3A were transformed into two resident endogenetic bacteria Brevibacillus brevis Ag12 and Bacillus thuringiensis Ag13 isolated from A. germari larvae intestines respectively by electro-transformation. Eighteen species of bacteria have isolated and identified from Apriona germari larvae intestines and two of them (Brevibacillus brevis Ag12 and Bacillus thuringiensis Ag13) were selected as starting bacteria to recieve the Bt cry3A. The 4 transgenic engineering strains Ag12-7911, Ag12-305a, Ag13-7911 and Ag13-305a were obtained successfully and validated by testing the plasmid stability in recombinants, transformants vegetal properties, crystal poisonous protein observation, expressional protein SDS-PAGE. The Bt cry3A gene had been transformed into Brevibacillus brevis and Bacillus thuringiensis. Both bioassay and examination of the engineering strains in intestines after feeding them to larvae showed that all these transformant strains (Brevibacillus brevis Ag12-305a, Bacillus thurigiensis Ag13-305a, Brevibacillus brevis Ag12-7911 and Bacillus thurigiensis Ag13-7911) could colonize and express 65 kDa protoxin in intestines of A. germari larvae and had insecticidal activity. We obtained four transgenic bacteria that can colonize and express the target insecticide gene Bt cry3A in A. germari larvae. They may be developed as a new insecticide.

  3. Evaluation of two cotton varieties CRSP1 and CRSP2 for genetic transformation efficiency, expression of transgenes Cry1Ac + Cry2A, GT gene and insect mortality

    Directory of Open Access Journals (Sweden)

    Arfan Ali

    2016-03-01

    Full Text Available Expression of the transgene with a desirable character in crop plant is the ultimate goal of transgenic research. Transformation of two Bt genes namely Cry1Ac and Cry2A cloned as separate cassette under 35S promoter in pKHG4 plant expression vector was done by using shoot apex cut method of Agrobacterium. Molecular confirmation of putative transgenic cotton plants for Cry1Ac, Cry2A and GT gene was done through PCR and ELISA. Transformation efficiency of CRSP-1 and CRSP-2 was calculated to be 1.2 and 0.8% for Cry1Ac while 0.9 and 0.6% for Cry2A and 1.5 and 0.7% for GTG respectively. CRSP-1 was found to adopt natural environment (acclimatized earlier than CRSP-2 when exposed to sunlight for one month. Expression of Cry1Ac, Cry2A and GTG was found to be 1.2, 1 and 1.3 ng/μl respectively for CRSP-1 as compared to CRSP-2 where expression was recorded to be 0.9, 0.5 and 0.9 ng/μl respectively. FISH analysis of the transgenic CRSP-1 and CRSP-2 demonstrated the presence of one and two copy numbers respectively. Similarly, the response of CRSP-1 against Glyphosate @1900 ml/acre was far better with almost negligible necrotic spot and efficient growth after spray as compared to CRSP-2 where some plants were found to have necrosis and negative control where the complete decay of plant was observed after seven days of spray assay. Similarly, almost 100% mortality of 2nd instar larvae of Heliothis armigera was recorded after three days in CRSP-1 as compared CRSP-2 where insect mortality was found to be less than 90%. Quantitatively speaking non transgenic plants were found with 23–90% leaf damage by insect, while CRSP-1 was with less than 5% and CRSP-2 with 17%. Taken together CRSP1 was found to have better insect control and weedicide resistance along with its natural ability of genetic modification and can be employed by the valuable farmers for better insect control and simultaneously for better production.

  4. Assessment of potential adjuvanticity of Cry proteins.

    Science.gov (United States)

    Joshi, Saurabh S; Barnett, Brian; Doerrer, Nancy G; Glenn, Kevin; Herman, Rod A; Herouet-Guicheney, Corinne; Hunst, Penny; Kough, John; Ladics, Gregory S; McClain, Scott; Papineni, Sabitha; Poulsen, Lars K; Rascle, Jean-Baptiste; Tao, Ai-Lin; van Ree, Ronald; Ward, Jason; Bowman, Christal C

    2016-08-01

    Genetically modified (GM) crops have achieved success in the marketplace and their benefits extend beyond the overall increase in harvest yields to include lowered use of insecticides and decreased carbon dioxide emissions. The most widely grown GM crops contain gene/s for targeted insect protection, herbicide tolerance, or both. Plant expression of Bacillus thuringiensis (Bt) crystal (Cry) insecticidal proteins have been the primary way to impart insect resistance in GM crops. Although deemed safe by regulatory agencies globally, previous studies have been the basis for discussions around the potential immuno-adjuvant effects of Cry proteins. These studies had limitations in study design. The studies used animal models with extremely high doses of Cry proteins, which when given using the ig route were co-administered with an adjuvant. Although the presumption exists that Cry proteins may have immunostimulatory activity and therefore an adjuvanticity risk, the evidence shows that Cry proteins are expressed at very low levels in GM crops and are unlikely to function as adjuvants. This conclusion is based on critical review of the published literature on the effects of immunomodulation by Cry proteins, the history of safe use of Cry proteins in foods, safety of the Bt donor organisms, and pre-market weight-of-evidence-based safety assessments for GM crops. Copyright © 2016 Elsevier Inc. All rights reserved.

  5. Single amino acid insertions in extracellular loop 2 of Bombyx mori ABCC2 disrupt its receptor function for Bacillus thuringiensis Cry1Ab and Cry1Ac but not Cry1Aa toxins.

    Science.gov (United States)

    Tanaka, Shiho; Miyamoto, Kazuhisa; Noda, Hiroaki; Endo, Haruka; Kikuta, Shingo; Sato, Ryoichi

    2016-04-01

    In a previous report, seven Cry1Ab-resistant strains were identified in the silkworm, Bombyx mori; these strains were shown to have a tyrosine insertion at position 234 in extracellular loop 2 of the ABC transporter C2 (BmABCC2). This insertion was confirmed to destroy the receptor function of BmABCC2 and confer the strains resistance against Cry1Ab and Cry1Ac. However, these strains were susceptible to Cry1Aa. In this report, we examined the mechanisms of the loss of receptor function of the transporter by expressing mutations in Sf9 cells. After replacement of one or two of the five amino acid residues in loop 2 of the susceptible BmABCC2 gene [BmABCC2_S] with alanine, cells still showed susceptibility, retaining the receptor function. Five mutants with single amino acid insertions at position 234 in BmABCC2 were also generated, resulting in loop 2 having six amino acids, which corresponds to replacing the tyrosine insertion in the resistant BmABCC2 gene [BmABCC2_R(+(234)Y)] with another amino acid. All five mutants exhibited loss of function against Cry1Ab and Cry1Ac. These results suggest that the amino acid sequence in loop 2 is less important than the loop size (five vs. six amino acids) or loop structure for Cry1Ab and Cry1Ac activity. Several domain-swapped mutant toxins were then generated among Cry1Aa, Cry1Ab, and Cry1Ac, which are composed of three domains. Swapped mutants containing domain II of Cry1Ab or Cry1Ac did not kill Sf9 cells expressing BmABCC2_R(+(234)Y), suggesting that domain II of the Cry toxin is related to the interaction with the receptor function of BmABCC2. This also suggests that different reactions against Bt-toxins in some B. mori strains, that is, Cry1Ab resistance or Cry1Aa susceptibility, are attributable to structural differences in domain II of Cry1A toxins. Copyright © 2016. Published by Elsevier Inc.

  6. Exposure of a 23F Serotype Strain of Streptococcus pneumoniae to Cigarette Smoke Condensate Is Associated with Selective Upregulation of Genes Encoding the Two-Component Regulatory System 11 (TCS11

    Directory of Open Access Journals (Sweden)

    Riana Cockeran

    2014-01-01

    Full Text Available Alterations in whole genome expression profiles following exposure of the pneumococcus (strain 172, serotype 23F to cigarette smoke condensate (160 μg/mL for 15 and 60 min have been determined using the TIGR4 DNA microarray chip. Exposure to CSC resulted in the significant (P<0.014–0.0006 upregulation of the genes encoding the two-component regulatory system 11 (TCS11, consisting of the sensor kinase, hk11, and its cognate response regulator, rr11, in the setting of increased biofilm formation. These effects of cigarette smoke on the pneumococcus may contribute to colonization of the airways by this microbial pathogen.

  7. Mutational Analysis of PTPN11 Gene in Taiwanese Children with Noonan Syndrome

    Directory of Open Access Journals (Sweden)

    Chia-Sui Hung

    2007-01-01

    Full Text Available Noonan syndrome (NS is an autosomal dominant disorder presenting with characteristic facies, short stature, skeletal anomalies, and congenital heart defects. Mutations in protein-tyrosine phosphatase, nonreceptor-type 11 (PTPN11, encoding SHP-2, account for 33-50% of NS. This study screened for mutations in the PTPN11 gene in 34 Taiwanese patients with NS. Mutation analysis of the 15 coding exons and exon/intron boundaries was performed by polymerase chain reaction and direct sequencing of the PTPN11 gene. We identified 10 different missense mutations in 13 (38% patients, including a novel missense mutation (855T > G, F285L. These mutations were clustered in exon 3 (n = 6 encoding the N-SH2 domain, exon 4 (n = 2 encoding the C-SH2 domain, and in exons 8 (n = 2 and 13 (n = 3 encoding the PTP domain. In conclusion, this study provides further support that PTPN11 mutations are responsible for Noonan syndrome in Taiwanese patients. [J Formos Med Assoc 2007;106(2:169-172

  8. MAPK Signaling Pathway Alters Expression of Midgut ALP and ABCC Genes and Causes Resistance to Bacillus thuringiensis Cry1Ac Toxin in Diamondback Moth

    Science.gov (United States)

    Wu, Qingjun; Wang, Shaoli; Xie, Wen; Zhu, Xun; Baxter, Simon W.; Zhou, Xuguo; Jurat-Fuentes, Juan Luis; Zhang, Youjun

    2015-01-01

    Insecticidal crystal toxins derived from the soil bacterium Bacillus thuringiensis (Bt) are widely used as biopesticide sprays or expressed in transgenic crops to control insect pests. However, large-scale use of Bt has led to field-evolved resistance in several lepidopteran pests. Resistance to Bt Cry1Ac toxin in the diamondback moth, Plutella xylostella (L.), was previously mapped to a multigenic resistance locus (BtR-1). Here, we assembled the 3.15 Mb BtR-1 locus and found high-level resistance to Cry1Ac and Bt biopesticide in four independent P. xylostella strains were all associated with differential expression of a midgut membrane-bound alkaline phosphatase (ALP) outside this locus and a suite of ATP-binding cassette transporter subfamily C (ABCC) genes inside this locus. The interplay between these resistance genes is controlled by a previously uncharacterized trans-regulatory mechanism via the mitogen-activated protein kinase (MAPK) signaling pathway. Molecular, biochemical, and functional analyses have established ALP as a functional Cry1Ac receptor. Phenotypic association experiments revealed that the recessive Cry1Ac resistance was tightly linked to down-regulation of ALP, ABCC2 and ABCC3, whereas it was not linked to up-regulation of ABCC1. Silencing of ABCC2 and ABCC3 in susceptible larvae reduced their susceptibility to Cry1Ac but did not affect the expression of ALP, whereas suppression of MAP4K4, a constitutively transcriptionally-activated MAPK upstream gene within the BtR-1 locus, led to a transient recovery of gene expression thereby restoring the susceptibility in resistant larvae. These results highlight a crucial role for ALP and ABCC genes in field-evolved resistance to Cry1Ac and reveal a novel trans-regulatory signaling mechanism responsible for modulating the expression of these pivotal genes in P. xylostella. PMID:25875245

  9. MAPK signaling pathway alters expression of midgut ALP and ABCC genes and causes resistance to Bacillus thuringiensis Cry1Ac toxin in diamondback moth.

    Directory of Open Access Journals (Sweden)

    Zhaojiang Guo

    2015-04-01

    Full Text Available Insecticidal crystal toxins derived from the soil bacterium Bacillus thuringiensis (Bt are widely used as biopesticide sprays or expressed in transgenic crops to control insect pests. However, large-scale use of Bt has led to field-evolved resistance in several lepidopteran pests. Resistance to Bt Cry1Ac toxin in the diamondback moth, Plutella xylostella (L., was previously mapped to a multigenic resistance locus (BtR-1. Here, we assembled the 3.15 Mb BtR-1 locus and found high-level resistance to Cry1Ac and Bt biopesticide in four independent P. xylostella strains were all associated with differential expression of a midgut membrane-bound alkaline phosphatase (ALP outside this locus and a suite of ATP-binding cassette transporter subfamily C (ABCC genes inside this locus. The interplay between these resistance genes is controlled by a previously uncharacterized trans-regulatory mechanism via the mitogen-activated protein kinase (MAPK signaling pathway. Molecular, biochemical, and functional analyses have established ALP as a functional Cry1Ac receptor. Phenotypic association experiments revealed that the recessive Cry1Ac resistance was tightly linked to down-regulation of ALP, ABCC2 and ABCC3, whereas it was not linked to up-regulation of ABCC1. Silencing of ABCC2 and ABCC3 in susceptible larvae reduced their susceptibility to Cry1Ac but did not affect the expression of ALP, whereas suppression of MAP4K4, a constitutively transcriptionally-activated MAPK upstream gene within the BtR-1 locus, led to a transient recovery of gene expression thereby restoring the susceptibility in resistant larvae. These results highlight a crucial role for ALP and ABCC genes in field-evolved resistance to Cry1Ac and reveal a novel trans-regulatory signaling mechanism responsible for modulating the expression of these pivotal genes in P. xylostella.

  10. Cloning of cDNA encoding steroid 11β-hydroxylase (P450c11)

    International Nuclear Information System (INIS)

    Chua, S.C.; Szabo, P.; Vitek, A.; Grzeschik, K.H.; John, M.; White, P.C.

    1987-01-01

    The authors have isolated bovine and human adrenal cDNA clones encoding the adrenal cytochrome P-450 specific for 11β-hydroxylation (P450c11). A bovine adrenal cDNA library constructed in the bacteriophage λ vector gt10 was probed with a previously isolated cDNA clone corresponding to part of the 3' untranslated region of the 4.2-kilobase (kb) mRNA encoding P450c11. Several clones with 3.2-kb cDNA inserts were isolated. Sequence analysis showed that they overlapped the original probe by 300 base pairs (bp). Combined cDNA and RNA sequence data demonstrated a continuous open reading frame of 1509 bases. P450c11 is predicted to contain 479 amino acid residues in the mature protein in addition to a 24-residue amino-terminal mitochondrial signal sequence. A bovine clone was used to isolate a homologous clone with a 3.5-kb insert from a human adrenal cDNA library. A region of 1100 bp was 81% homologous to 769 bp of the coding sequence of the bovine cDNA except for a 400-bp segment presumed to be an unprocessed intron. Hybridization of the human cDNA to DNA from a panel of human-rodent somatic cell hybrid lines and in situ hybridization to metaphase spreads of human chromosomes localized the gene to the middle of the long arm of chromosome 8. These data should be useful in developing reagents for heterozygote detection and prenatal diagnosis of 11β-hydroxylase deficiency, the second most frequent cause of congenital adrenal hyperplasia

  11. CRY 1AB trangenic cowpea obtained by nodal electroporation ...

    African Journals Online (AJOL)

    Electroporation-mediated genetic transformation was used to introduce Cry 1 Ab insecticidal gene into cowpea. Nodal buds were electroporated in planta with a plasmid carrying the Cry 1Ab and antibiotic resistance npt II genes driven by a 35S CaMV promoter. T1 seeds derived from electroporated branches were selected ...

  12. Chloroplast localization of Cry1Ac and Cry2A protein- an alternative way of insect control in cotton

    Directory of Open Access Journals (Sweden)

    Adnan Muzaffar

    2015-01-01

    Full Text Available BACKGROUND: Insects have developed resistance against Bt-transgenic plants. A multi-barrier defense system to weaken their resistance development is now necessary. One such approach is to use fusion protein genes to increase resistance in plants by introducing more Bt genes in combination. The locating the target protein at the point of insect attack will be more effective. It will not mean that the non-green parts of the plants are free of toxic proteins, but it will inflict more damage on the insects because they are at maximum activity in the green parts of plants. RESULTS: Successful cloning was achieved by the amplification of Cry2A, Cry1Ac, and a transit peptide. The appropriate polymerase chain reaction amplification and digested products confirmed that Cry1Ac and Cry2A were successfully cloned in the correct orientation. The appearance of a blue color in sections of infiltrated leaves after 72 hours confirmed the successful expression of the construct in the plant expression system. The overall transformation efficiency was calculated to be 0.7%. The amplification of Cry1Ac-Cry2A and Tp2 showed the successful integration of target genes into the genome of cotton plants. A maximum of 0.673 μg/g tissue of Cry1Ac and 0.568 μg/g tissue of Cry2A was observed in transgenic plants. We obtained 100% mortality in the target insect after 72 hours of feeding the 2nd instar larvae with transgenic plants. The appearance of a yellow color in transgenic cross sections, while absent in the control, through phase contrast microscopy indicated chloroplast localization of the target protein. CONCLUSION: Locating the target protein at the point of insect attack increases insect mortality when compared with that of other transgenic plants. The results of this study will also be of great value from a biosafety point of view.

  13. Detection by real-time PCR and pyrosequencing of the cry1Ab and cry1Ac genes introduced in genetically modified (GM) constructs.

    Science.gov (United States)

    Debode, Frederic; Janssen, Eric; Bragard, Claude; Berben, Gilbert

    2017-08-01

    The presence of genetically modified organisms (GMOs) in food and feed is mainly detected by the use of targets focusing on promoters and terminators. As some genes are frequently used in genetically modified (GM) construction, they also constitute excellent screening elements and their use is increasing. In this paper we propose a new target for the detection of cry1Ab and cry1Ac genes by real-time polymerase chain reaction (PCR) and pyrosequencing. The specificity, sensitivity and robustness of the real-time PCR method were tested following the recommendations of international guidelines and the method met the expected performance criteria. This paper also shows how the robustness testing was assessed. This new cry1Ab/Ac method can provide a positive signal with a larger number of GM events than do the other existing methods using double dye-probes. The method permits the analysis of results with less ambiguity than the SYBRGreen method recommended by the European Reference Laboratory (EURL) GM Food and Feed (GMFF). A pyrosequencing method was also developed to gain additional information thanks to the sequence of the amplicon. This method of sequencing-by-synthesis can determine the sequence between the primers used for PCR. Pyrosequencing showed that the sequences internal to the primers present differences following the GM events considered and three different sequences were observed. The sensitivity of the pyrosequencing was tested on reference flours with a low percentage GM content and different copy numbers. Improvements in the pyrosequencing protocol provided correct sequences with 50 copies of the target. Below this copy number, the quality of the sequence was more random.

  14. Evaluation of Cytotoxicity, Genotoxicity and Hematotoxicity of the Recombinant Spore-Crystal Complexes Cry1Ia, Cry10Aa and Cry1Ba6 from Bacillus thuringiensis in Swiss Mice

    Directory of Open Access Journals (Sweden)

    Ingrid de Souza Freire

    2014-09-01

    Full Text Available The insecticidal properties of Cry-endotoxins from Bacillus thuringiensis (Bt have long been used as spore-crystals in commercial spray formulations for insect control. Recently, some Bt-endotoxin genes have been cloned in many different plants. Toxicological evaluations of three spore-crystal endotoxins, BtCry1Ia, BtCry10Aa and BtCry1Ba6 from B. thuringiensis, were carried out on mice to understand their adverse effects on hematological systems and on genetic material. These three spore-crystals have shown toxic activity to the boll weevil, which is one of the most aggressive pests of the cotton crop. Cry1Ia, Cry10Aa and Cry1Ba6 did not increase the micronucleus frequency in the peripheral erythrocytes of mice and did not cause changes in the frequency of polychromatic erythrocytes. However, some hematologic disburbances were observed, specifically related to Cry1Ia and Cry1Ba6, respectively, for the erythroid and lymphoid lineage. Thus, although the profile of such adverse side effects can be related to their high level of exposure, which is not commonly found in the environment, results showed that these Bt spore-crystals were not harmless to mice, indicating that each spore-crystal endotoxin presents a characteristic profile of toxicity and might be investigated individually.

  15. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  16. Cross-resistance to purified Bt proteins, Bt corn and Bt cotton in a Cry2Ab2-corn resistant strain of Spodoptera frugiperda.

    Science.gov (United States)

    Yang, Fei; Kerns, David L; Head, Graham P; Price, Paula; Huang, Fangneng

    2017-12-01

    Gene-pyramiding by combining two or more dissimilar Bacillus thuringiensis (Bt) proteins into a crop has been used to delay insect resistance. The durability of gene-pyramiding can be reduced by cross-resistance. Fall armyworm, Spodoptera frugiperda, is a major target pest of the Cry2Ab2 protein used in pyramided Bt corn and cotton. Here, we provide the first experimental evaluation of cross-resistance in S. frugiperda selected with Cry2Ab2 corn to multiple Bt sources including purified Bt proteins, Bt corn and Bt cotton. Concentration - response bioassays showed that resistance ratios for Cry2Ab2-resistant (RR) relative to Cry2Ab2-susceptible (SS) S. frugiperda were -1.4 for Cry1F, 1.2 for Cry1A.105, >26.7 for Cry2Ab2, >10.0 for Cry2Ae and -1.1 for Vip3A. Larvae of Cry2Ab2-heterozygous (RS), SS and RR S. frugiperda were all susceptible to Bt corn and Bt cotton containing Cry1 (Cry1F or Cry1A.105) and/or Vip3A proteins. Pyramided Bt cotton containing Cry1Ac + Cry2Ab2 or Cry1Ab + Cry2Ae were also effective against SS and RS, but not RR. These findings suggest that Cry2Ab2-corn-selected S. frugiperda is not cross-resistant to Cry1F, Cry1A.105 or Vip3A protein, or corn and cotton plants containing these Bt proteins, but it can cause strong cross-resistance to Cry2Ae and Bt crops expressing similar Bt proteins. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.

  17. Efficient genetic transformation of okra (Abelmoschus esculentus (L.) Moench) and generation of insect-resistant transgenic plants expressing the cry1Ac gene.

    Science.gov (United States)

    Narendran, M; Deole, Satish G; Harkude, Satish; Shirale, Dattatray; Nanote, Asaram; Bihani, Pankaj; Parimi, Srinivas; Char, Bharat R; Zehr, Usha B

    2013-08-01

    Agrobacterium -mediated transformation system for okra using embryos was devised and the transgenic Bt plants showed resistance to the target pest, okra shoot, and fruit borer ( Earias vittella ). Okra is an important vegetable crop and progress in genetic improvement via genetic transformation has been impeded by its recalcitrant nature. In this paper, we describe a procedure using embryo explants for Agrobacterium-mediated transformation and tissue culture-based plant regeneration for efficient genetic transformation of okra. Twenty-one transgenic okra lines expressing the Bacillus thuringiensis gene cry1Ac were generated from five transformation experiments. Molecular analysis (PCR and Southern) confirmed the presence of the transgene and double-antibody sandwich ELISA analysis revealed Cry1Ac protein expression in the transgenic plants. All 21 transgenic plants were phenotypically normal and fertile. T1 generation plants from these lines were used in segregation analysis of the transgene. Ten transgenic lines were selected randomly for Southern hybridization and the results confirmed the presence of transgene integration into the genome. Normal Mendelian inheritance (3:1) of cry1Ac gene was observed in 12 lines out of the 21 T0 lines. We selected 11 transgenic lines segregating in a 3:1 ratio for the presence of one transgene for insect bioassays using larvae of fruit and shoot borer (Earias vittella). Fruit from seven transgenic lines caused 100 % larval mortality. We demonstrate an efficient transformation system for okra which will accelerate the development of transgenic okra with novel agronomically useful traits.

  18. Mice deficient in cryptochrome 1 (Cry1-/- exhibit resistance to obesity induced by a high fat diet

    Directory of Open Access Journals (Sweden)

    Guy eGriebel

    2014-04-01

    Full Text Available Disruption of circadian clock enhances the risk of metabolic syndrome, obesity, and type 2 diabetes. Circadian clocks rely on a highly regulated network of transcriptional and translational loops that drive clock-controlled gene expression. Among these transcribed clock genes are cryptochrome (CRY family members, which comprise Cry1 and Cry2. While the metabolic effects of deletion of several core components of the clock gene machinery have been well characterized, those of selective inactivation of Cry1 or Cry2 genes have not been described. In this study we demonstrate that ablation of Cry1, but not Cry2, prevents high-fat diet (HFD-induced obesity in mice. Despite similar caloric intake, Cry1-/- mice on HFD gained markedly less weight (-18 % at the end of the 16-week experiment and displayed reduced fat accumulation compared to wild-type (WT littermates (-61 %, suggesting increased energy expenditure. Analysis of serum lipid and glucose profiles showed no difference between Cry1-/- and WT mice. Both Cry1-/- and Cry2-/- mice are indistinguishable from WT controls in body weight, fat and protein contents, and food consumption when they are allowed unlimited access to a standard rodent diet. We conclude that although CRY signaling may not be essential for the maintenance of energy homeostasis under steady-state nutritional conditions, Cry1 may play a role in readjusting energy balance under changing nutritional circumstances. These studies reinforce the important role of circadian clock genes in energy homeostasis and suggest that Cry1 is a plausible target for antiobesity therapy.

  19. Mice deficient in cryptochrome 1 (cry1 (-/-)) exhibit resistance to obesity induced by a high-fat diet.

    Science.gov (United States)

    Griebel, Guy; Ravinet-Trillou, Christine; Beeské, Sandra; Avenet, Patrick; Pichat, Philippe

    2014-01-01

    Disruption of circadian clock enhances the risk of metabolic syndrome, obesity, and type 2 diabetes. Circadian clocks rely on a highly regulated network of transcriptional and translational loops that drive clock-controlled gene expression. Among these transcribed clock genes are cryptochrome (CRY) family members, which comprise Cry1 and Cry2. While the metabolic effects of deletion of several core components of the clock gene machinery have been well characterized, those of selective inactivation of Cry1 or Cry2 genes have not been described. In this study, we demonstrate that ablation of Cry1, but not Cry2, prevents high-fat diet (HFD)-induced obesity in mice. Despite similar caloric intake, Cry1 (-/-) mice on HFD gained markedly less weight (-18%) at the end of the 16-week experiment and displayed reduced fat accumulation compared to wild-type (WT) littermates (-61%), suggesting increased energy expenditure. Analysis of serum lipid and glucose profiles showed no difference between Cry1 (-/-) and WT mice. Both Cry1 (-/-) and Cry2 (-/-) mice are indistinguishable from WT controls in body weight, fat and protein contents, and food consumption when they are allowed unlimited access to a standard rodent diet. We conclude that although CRY signaling may not be essential for the maintenance of energy homeostasis under steady-state nutritional conditions, Cry1 may play a role in readjusting energy balance under changing nutritional circumstances. These studies reinforce the important role of circadian clock genes in energy homeostasis and suggest that Cry1 is a plausible target for anti-obesity therapy.

  20. Transgenic cotton expressing Cry10Aa toxin confers high resistance to the cotton boll weevil.

    Science.gov (United States)

    Ribeiro, Thuanne Pires; Arraes, Fabricio Barbosa Monteiro; Lourenço-Tessutti, Isabela Tristan; Silva, Marilia Santos; Lisei-de-Sá, Maria Eugênia; Lucena, Wagner Alexandre; Macedo, Leonardo Lima Pepino; Lima, Janaina Nascimento; Santos Amorim, Regina Maria; Artico, Sinara; Alves-Ferreira, Márcio; Mattar Silva, Maria Cristina; Grossi-de-Sa, Maria Fatima

    2017-08-01

    Genetically modified (GM) cotton plants that effectively control cotton boll weevil (CBW), which is the most destructive cotton insect pest in South America, are reported here for the first time. This work presents the successful development of a new GM cotton with high resistance to CBW conferred by Cry10Aa toxin, a protein encoded by entomopathogenic Bacillus thuringiensis (Bt) gene. The plant transformation vector harbouring cry10Aa gene driven by the cotton ubiquitination-related promoter uceA1.7 was introduced into a Brazilian cotton cultivar by biolistic transformation. Quantitative PCR (qPCR) assays revealed high transcription levels of cry10Aa in both T 0 GM cotton leaf and flower bud tissues. Southern blot and qPCR-based 2 -ΔΔCt analyses revealed that T 0 GM plants had either one or two transgene copies. Quantitative and qualitative analyses of Cry10Aa protein expression showed variable protein expression levels in both flower buds and leaves tissues of T 0 GM cotton plants, ranging from approximately 3.0 to 14.0 μg g -1 fresh tissue. CBW susceptibility bioassays, performed by feeding adults and larvae with T 0 GM cotton leaves and flower buds, respectively, demonstrated a significant entomotoxic effect and a high level of CBW mortality (up to 100%). Molecular analysis revealed that transgene stability and entomotoxic effect to CBW were maintained in T 1 generation as the Cry10Aa toxin expression levels remained high in both tissues, ranging from 4.05 to 19.57 μg g -1 fresh tissue, and the CBW mortality rate remained around 100%. In conclusion, these Cry10Aa GM cotton plants represent a great advance in the control of the devastating CBW insect pest and can substantially impact cotton agribusiness. © 2017 The Authors. Plant Biotechnology Journal published by Society for Experimental Biology and The Association of Applied Biologists and John Wiley & Sons Ltd.

  1. Treatment of an Aedes aegypti colony with the Cry11Aa toxin for 54 generations results in the development of resistance

    Directory of Open Access Journals (Sweden)

    Gloria Cadavid-Restrepo

    2012-02-01

    Full Text Available To study the potential for the emergence of resistance in Aedes aegypti populations, a wild colony was subjected to selective pressure with Cry11Aa, one of four endotoxins that compose the Bacillus thuringiensis serovar israelensis toxin. This bacterium is the base component of the most important biopesticide used in the control of mosquitoes worldwide. After 54 generations of selection, significant resistance levels were observed. At the beginning of the selection experiment, the half lethal concentration was 26.3 ng/mL and had risen to 345.6 ng/mL by generation 54. The highest rate of resistance, 13.1, was detected in the 54th generation. Because digestive proteases play a key role in the processing and activation of B. thuringiensis toxin, we analysed the involvement of insect gut proteases in resistance to the Cry11Aa B. thuringiensis serovar israelensis toxin. The protease activity from larval gut extracts from the Cry11Aa resistant population was lower than that of the B. thuringiensisserovar israelensis susceptible colony. We suggest that differences in protoxin proteolysis could contribute to the resistance of this Ae. aegypti colony.

  2. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  3. A cry in the dark: depressed mothers show reduced neural activation to their own infant’s cry

    Science.gov (United States)

    Ablow, Jennifer C.

    2012-01-01

    This study investigated depression-related differences in primiparous mothers’ neural response to their own infant’s distress cues. Mothers diagnosed with major depressive disorder (n = 11) and comparison mothers with no diagnosable psychopathology (n = 11) were exposed to their own 18-months-old infant’s cry sound, as well as unfamiliar infant’s cry and control sound, during functional neuroimaging. Depressed mothers’ response to own infant cry greater than other sounds was compared to non-depressed mothers’ response in the whole brain [false discovery rate (FDR) corrected]. A continuous measure of self-reported depressive symptoms (CESD) was also tested as a predictor of maternal response. Non-depressed mothers activated to their own infant’s cry greater than control sound in a distributed network of para/limbic and prefrontal regions, whereas depressed mothers as a group failed to show activation. Non-depressed compared to depressed mothers showed significantly greater striatal (caudate, nucleus accumbens) and medial thalamic activation. Additionally, mothers with lower depressive symptoms activated more strongly in left orbitofrontal, dorsal anterior cingulate and medial superior frontal regions. Non-depressed compared to depressed mothers activated uniquely to own infant greater than other infant cry in occipital fusiform areas. Disturbance of these neural networks involved in emotional response and regulation may help to explain parenting deficits in depressed mothers. PMID:21208990

  4. Coevolution of Siglec-11 and Siglec-16 via gene conversion in primates.

    Science.gov (United States)

    Hayakawa, Toshiyuki; Khedri, Zahra; Schwarz, Flavio; Landig, Corinna; Liang, Suh-Yuen; Yu, Hai; Chen, Xi; Fujito, Naoko T; Satta, Yoko; Varki, Ajit; Angata, Takashi

    2017-11-23

    Siglecs-11 and -16 are members of the sialic acid recognizing Ig-like lectin family, and expressed in same cells. Siglec-11 functions as an inhibitory receptor, whereas Siglec-16 exhibits activating properties. In humans, SIGLEC11 and SIGLEC16 gene sequences are extremely similar in the region encoding the extracellular domain due to gene conversions. Human SIGLEC11 was converted by the nonfunctional SIGLEC16P allele, and the converted SIGLEC11 allele became fixed in humans, possibly because it provides novel neuroprotective functions in brain microglia. However, the detailed evolutionary history of SIGLEC11 and SIGLEC16 in other primates remains unclear. We analyzed SIGLEC11 and SIGLEC16 gene sequences of multiple primate species, and examined glycan binding profiles of these Siglecs. The phylogenetic tree demonstrated that gene conversions between SIGLEC11 and SIGLEC16 occurred in the region including the exon encoding the sialic acid binding domain in every primate examined. Functional assays showed that glycan binding preference is similar between Siglec-11 and Siglec-16 in all analyzed hominid species. Taken together with the fact that Siglec-11 and Siglec-16 are expressed in the same cells, Siglec-11 and Siglec-16 are regarded as paired receptors that have maintained similar ligand binding preferences via gene conversions. Relaxed functional constraints were detected on the SIGLEC11 and SIGLEC16 exons that underwent gene conversions, possibly contributing to the evolutionary acceptance of repeated gene conversions. The frequency of nonfunctional SIGLEC16P alleles is much higher than that of SIGLEC16 alleles in every human population. Our findings indicate that Siglec-11 and Siglec-16 have been maintained as paired receptors by repeated gene conversions under relaxed functional constraints in the primate lineage. The high prevalence of the nonfunctional SIGLEC16P allele and the fixation of the converted SIGLEC11 imply that the loss of Siglec-16 and the gain of

  5. Expresión de la toxina Cry11Aa de Bacillus thuringiensis serovar. israelensis en Asticcacaulis excentricus, para el control de larvas acuáticas de dípteros de la familia Culicidae, vectores de enfermedades Expression of Bacillus thuringiensis serovar. israelensis toxins in Asticcacaulis excentricus to control dipteran larvae of vectors of diseases

    Directory of Open Access Journals (Sweden)

    Orduz Sergio

    2004-07-01

    Full Text Available Los genes cry de Bacillus thuringiensis codifican para un diverso grupo de proteínas formadoras de cristales que exhiben actividad insecticida contra larvas de dípteros, lepidópteros y coleópteros, entre otros. La efectividad de los insecticidas basados en formulaciones de proteínas de B. thuringiensis puede ser mejorada usando bacterias prostecadas acuáticas como portadoras alternativas de los genes cry, ya que no se sedimentan rápidamente; las proteínas expresadas en el citoplasma están protegidas de los rayos ultra violeta y, lo más importante, las larvas de los mosquitos se alimentan de ellas. Una cepa de referencia de Asticcacaulis excentricus fue transformada con el plásmido pSOD3, el cual contiene el gen que codifica para la proteína Cry1 1 Aa de B. thuringiensis serovar. israelensis. La expresión de la proteína recombinante fue evaluada por electroforesis de proteínas y por Western blot. El Western blot revelado con un anticuerpo policlonal anti-Cry1 1 Aa mostró una banda de 72 kDa correspondiente a la proteína Cry 11 Aa. La toxicidad de las cepas de A. excentricus transformadas fue evaluada en bioensayos con larvas de primer estadío del mosquito Culex quinquefasciatus. Se alcanzó un promedio de mortalidad del 50% de las larvas de primer instar a concentraciones de 23 ng/mL de la toxina. Otros bioensayos indican que A. excentricus recombinante es tóxica para larvas de primer instar de las especies Aedes aegypti y Anopheles albimanus. Los ensayos de flotabilidad indican que A. excentricus no sedimenta hasta pasados 7 días, mientras que B. thuringiensis serovar. israelensis sedimenta al cabo de algunas horas. Palabras clave: Asticcacaulis excentricus, Bacillus thuringiensis, bacterias prostecadas, dengue, malaria.Bacillus thuringiensis cry genes encode for a diverse group of crystal-forming proteins that exhibit insecticidal activity towards dipteran, lepidopteran and coleopteran larvae. The effectiveness of

  6. Effects of feeding Bt MON810 maize to pigs for 110 days on peripheral immune response and digestive fate of the cry1Ab gene and truncated Bt toxin.

    Directory of Open Access Journals (Sweden)

    Maria C Walsh

    Full Text Available BACKGROUND: The objective of this study was to evaluate potential long-term (110 days and age-specific effects of feeding genetically modified Bt maize on peripheral immune response in pigs and to determine the digestive fate of the cry1Ab gene and truncated Bt toxin. METHODOLOGY/PRINCIPAL FINDINGS: Forty day old pigs (n = 40 were fed one of the following treatments: 1 isogenic maize-based diet for 110 days (isogenic; 2 Bt maize-based diet (MON810 for 110 days (Bt; 3 Isogenic maize-based diet for 30 days followed by Bt maize-based diet for 80 days (isogenic/Bt; and 4 Bt maize-based diet (MON810 for 30 days followed by isogenic maize-based diet for 80 days (Bt/isogenic. Blood samples were collected during the study for haematological analysis, measurement of cytokine and Cry1Ab-specific antibody production, immune cell phenotyping and cry1Ab gene and truncated Bt toxin detection. Pigs were sacrificed on day 110 and digesta and organ samples were taken for detection of the cry1Ab gene and the truncated Bt toxin. On day 100, lymphocyte counts were higher (P<0.05 in pigs fed Bt/isogenic than pigs fed Bt or isogenic. Erythrocyte counts on day 100 were lower in pigs fed Bt or isogenic/Bt than pigs fed Bt/isogenic (P<0.05. Neither the truncated Bt toxin nor the cry1Ab gene were detected in the organs or blood of pigs fed Bt maize. The cry1Ab gene was detected in stomach digesta and at low frequency in the ileum but not in the distal gastrointestinal tract (GIT, while the Bt toxin fragments were detected at all sites in the GIT. CONCLUSIONS/SIGNIFICANCE: Perturbations in peripheral immune response were thought not to be age-specific and were not indicative of Th 2 type allergenic or Th 1 type inflammatory responses. There was no evidence of cry1Ab gene or Bt toxin translocation to organs or blood following long-term feeding.

  7. Distinct and overlapping functions of ptpn11 genes in Zebrafish development.

    Directory of Open Access Journals (Sweden)

    Monica Bonetti

    Full Text Available The PTPN11 (protein-tyrosine phosphatase, non-receptor type 11 gene encodes SHP2, a cytoplasmic PTP that is essential for vertebrate development. Mutations in PTPN11 are associated with Noonan and LEOPARD syndrome. Human patients with these autosomal dominant disorders display various symptoms, including short stature, craniofacial defects and heart abnormalities. We have used the zebrafish as a model to investigate the role of Shp2 in embryonic development. The zebrafish genome encodes two ptpn11 genes, ptpn11a and ptpn11b. Here, we report that ptpn11a is expressed constitutively and ptpn11b expression is strongly upregulated during development. In addition, the products of both ptpn11 genes, Shp2a and Shp2b, are functional. Target-selected inactivation of ptpn11a and ptpn11b revealed that double homozygous mutants are embryonic lethal at 5-6 days post fertilization (dpf. Ptpn11a-/-ptpn11b-/- embryos showed pleiotropic defects from 4 dpf onwards, including reduced body axis extension and craniofacial defects, which was accompanied by low levels of phosphorylated Erk at 5 dpf. Interestingly, defects in homozygous ptpn11a-/- mutants overlapped with defects in the double mutants albeit they were milder, whereas ptpn11b-/- single mutants did not show detectable developmental defects and were viable and fertile. Ptpn11a-/-ptpn11b-/- mutants were rescued by expression of exogenous ptpn11a and ptpn11b alike, indicating functional redundance of Shp2a and Shp2b. The ptpn11 mutants provide a good basis for further unravelling of the function of Shp2 in vertebrate development.

  8. Degradation of endogenous and exogenous genes of genetically modified rice with Cry1Ab during food processing.

    Science.gov (United States)

    Zhang, Wei; Xing, Fuguo; Selvaraj, Jonathan Nimal; Liu, Yang

    2014-05-01

    In order to assess the degradation of endogenous and exogenous genes during food processing, genetically modified rice with Cry1Ab was used as raw material to produce 4 processed foods: steamed rice, rice noodles, rice crackers, and sweet rice wine. The results showed various processing procedures caused different degrees of degradation of both endogenous and exogenous genes. During the processing of steamed rice and rice noodles, the procedures were so mild that only genes larger than 1500 bp were degraded, and no degradation of NOS terminator and Hpt gene was detected. For rice crackers, frying was the most severe procedure, followed by microwaving, baking, boiling, 1st drying, and 2nd drying. For sweet rice wine, fermentation had more impact on degradation of genes than the other processing procedures. All procedures in this study did not lead to degradation of genes to below 200 bp, except for NOS terminator. In the case of stability of the genes studied during processing of rice crackers and sweet rice wine, SPS gene was the most, followed by the Cry1Ab gene, Hpt gene, Pubi promoter, and NOS terminator. In our study, we gained some information about the degradation of endogenous and exogenous genes during 4 foods processing, compared the different stabilities between endogenous and exogenous genes, and analyzed different effects of procedure on degradation of genes. In addition, the fragments of endogenous and exogenous genes about 200 bp could be detected in final products, except NOS terminator. As a result, we provided some base information about risk assessment of genetically modified (GM) food and appropriate length of fragment to detect GM component in processed foods. © 2014 Institute of Food Technologists®

  9. Stable integration and expression of a cry1Ia gene conferring resistance to fall armyworm and boll weevil in cotton plants.

    Science.gov (United States)

    Silva, Carliane Rc; Monnerat, Rose; Lima, Liziane M; Martins, Érica S; Melo Filho, Péricles A; Pinheiro, Morganna Pn; Santos, Roseane C

    2016-08-01

    Boll weevil is a serious pest of cotton crop. Effective control involves applications of chemical insecticides, increasing the cost of production and environmental pollution. The current genetically modified Bt crops have allowed great benefits to farmers but show activity limited to lepidopteran pests. This work reports on procedures adopted for integration and expression of a cry transgene conferring resistance to boll weevil and fall armyworm by using molecular tools. Four Brazilian cotton cultivars were microinjected with a minimal linear cassette generating 1248 putative lines. Complete gene integration was found in only one line (T0-34) containing one copy of cry1Ia detected by Southern blot. Protein was expressed in high concentration at 45 days after emergence (dae), decreasing by approximately 50% at 90 dae. Toxicity of the cry protein was demonstrated in feeding bioassays revealing 56.7% mortality to boll weevil fed buds and 88.1% mortality to fall armyworm fed leaves. A binding of cry1Ia antibody was found in the midgut of boll weevils fed on T0-34 buds in an immunodetection assay. The gene introduced into plants confers resistance to boll weevil and fall armyworm. Transmission of the transgene occurred normally to T1 progeny. All plants showed phenotypically normal growth, with fertile flowers and abundant seeds. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  10. Molecular studies of segmental aneusomy: FISHing for the atypical cry in del(5)(p15.3).

    Science.gov (United States)

    Hodge, J C; Lawson-Yuen, A; Stoler, J M; Ligon, A H

    2007-01-01

    We report a newborn male with multiple congenital anomalies including growth retardation, hypotonia, dysmorphic facies, widely-spaced nipples, micropenis, cryptorchidism, optic nerve hypoplasia, heart disease, and a striking, high-pitched cry. Chromosome analysis revealed de novo partial trisomy 11q due to a der(5)t(5;11)(p15.3;q22). Fluorescence in situ hybridization (FISH) showed loss of the 5p telomere signal on the der(5) chromosome, indicating the infant has partial monosomy 5p in addition to partial trisomy 11q. Among cases involving trisomy 11q, an unusual cry has only been documented in the presence of a der(5)t(5p;11q). This apparent dependence of the abnormal cry on monosomy 5p suggested the same genetic mechanism that occurs in Cri du chat syndrome (CDCS) may be responsible for the atypical cry in der(5)t(5p;11q) individuals. Neither a commercial CDCS probe (LSI D5S23, D5S721) nor a series of BAC clones encompassing distal regions implicated in the CDCS-associated cat-cry were deleted in our patient. These results suggest a second cry-modifying locus maps telomeric to BAC RP11-94J21 in band 5p15.33. This locus may not only cause the abnormal cry in individuals with a der(5)t(5p;11q) but could also contribute to the phenotypic variability and discordant mapping studies observed for CDCS. Copyright (c) 2007 S. Karger AG, Basel.

  11. Downregulation and Mutation of a Cadherin Gene Associated with Cry1Ac Resistance in the Asian Corn Borer, Ostrinia furnacalis (Guenée

    Directory of Open Access Journals (Sweden)

    Tingting Jin

    2014-09-01

    Full Text Available Development of resistance in target pests is a major threat to long-term use of transgenic crops expressing Bacillus thuringiensis (Bt Cry toxins. To manage and/or delay the evolution of resistance in target insects through the implementation of effective strategies, it is essential to understand the basis of resistance. One of the most important mechanisms of insect resistance to Bt crops is the alteration of the interactions between Cry toxins and their receptors in the midgut. A Cry1Ac-selected strain of Asian corn borer (ACB, Ostrinia furnacalis, a key pest of maize in China, evolved three mutant alleles of a cadherin-like protein (OfCAD (MPR-r1, MPR-r2 and MPR-r3, which mapped within the toxin-binding region (TBR. Each of the three mutant alleles possessed two or three amino acid substitutions in this region, especially Thr1457→Ser. In highly resistant larvae (ACB-Ac200, MPR-r2 had a 26-amino acid residue deletion in the TBR, which resulted in reduced binding of Cry1Ac compared to the MPR from the susceptible strain, suggesting that the number of amino acid deletions influences the level of resistance. Furthermore, downregulation of OfCAD gene (ofcad transcription was observed in the Cry1Ac resistant strain, ACB-Ac24, suggesting that Cry1Ac resistance in ACB is associated with the downregulation of the transcript levels of the cadherin-like protein gene. The OfCAD identified from ACB exhibited a high degree of similarity to other members of the cadherin super-family in lepidopteran species.

  12. CHARACTERIZATION OF H-Y AND CR-Y ZEOLITE CATALYSTS DURING THE OXIDATIVE DESTRUCTION OF CFC11 AND CFC12

    Science.gov (United States)

    The long term stability-deactivation characteristics of two Y zeolite catalysts, namely H-Y and cation exchanged Cr-Y, were studied during the oxidative destruction of CFC11 and CFC12 feeds. Experiments were carried out at 300 degrees C and 500 h-1 space velocity. Properties of...

  13. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  14. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  15. CRY2 is associated with rapid cycling in bipolar disorder patients.

    Directory of Open Access Journals (Sweden)

    Louise K Sjöholm

    2010-09-01

    Full Text Available Bipolar disorder patients often display abnormalities in circadian rhythm, and they are sensitive to irregular diurnal rhythms. CRY2 participates in the core clock that generates circadian rhythms. CRY2 mRNA expression in blood mononuclear cells was recently shown to display a marked diurnal variation and to respond to total sleep deprivation in healthy human volunteers. It was also shown that bipolar patients in a depressive state had lower CRY2 mRNA levels, nonresponsive to total sleep deprivation, compared to healthy controls, and that CRY2 gene variation was associated with winter depression in both Swedish and Finnish cohorts.Four CRY2 SNPs spanning from intron 2 to downstream 3'UTR were analyzed for association to bipolar disorder type 1 (n = 497, bipolar disorder type 2 (n = 60 and bipolar disorder with the feature rapid cycling (n = 155 versus blood donors (n = 1044 in Sweden. Also, the rapid cycling cases were compared with bipolar disorder cases without rapid cycling (n = 422. The haplotype GGAC was underrepresented among rapid cycling cases versus controls and versus bipolar disorder cases without rapid cycling (OR = 0.7, P = 0.006-0.02, whereas overrepresentation among rapid cycling cases was seen for AAAC (OR = 1.3-1.4, P = 0.03-0.04 and AGGA (OR = 1.5, P = 0.05. The risk and protective CRY2 haplotypes and their effect sizes were similar to those recently suggested to be associated with winter depression in Swedes.We propose that the circadian gene CRY2 is associated with rapid cycling in bipolar disorder. This is the first time a clock gene is implicated in rapid cycling, and one of few findings showing a molecular discrimination between rapid cycling and other forms of bipolar disorder.

  16. 47 CFR 11.32 - EAS Encoder.

    Science.gov (United States)

    2010-10-01

    ... Telecommunication FEDERAL COMMUNICATIONS COMMISSION GENERAL EMERGENCY ALERT SYSTEM (EAS) Equipment Requirements § 11... operation. (vi) Indicator Display. The encoder shall be provided with a visual and/or aural indicator which... to +50 degrees C and a range of relative humidity of up to 95%. (c) Primary Supply Voltage Variation...

  17. Identification and cloning of two insecticidal protein genes from ...

    African Journals Online (AJOL)

    Bacillus thuringiensis (Bt) is the most widely applied type of microbial pesticide due to its high specificity and environmental safety. The activity of Bt is largely attributed to the insecticidal crystal protein encoded by the cry genes. Different insecticidal crystal proteins of Bt have different bioactivity against distinct agricultural ...

  18. Field Trial Performance of Herculex XTRA (Cry34Ab1/Cry35Ab1) and SmartStax (Cry34Ab1/Cry35Ab1 + Cry3Bb1) Hybrids and Soil Insecticides Against Western and Northern Corn Rootworms (Coleoptera: Chrysomelidae).

    Science.gov (United States)

    Johnson, K D; Campbell, L A; Lepping, M D; Rule, D M

    2017-06-01

    Western corn rootworm, Diabrotica virgifera virgifera LeConte (Coleoptera: Chrysomelidae), and northern corn rootworm, Diabrotica barberi Smith and Lawrence (Coleoptera: Chrysomelidae), are important insect pests in corn, Zea mays L. For more than a decade, growers have been using transgenic plants expressing proteins from the bacterium Bacillus thuringiensis (Bt) to protect corn roots from feeding. In 2011, western corn rootworm populations were reported to have developed resistance to Bt hybrids expressing Cry3Bb1 and later found to be cross-resistant to hybrids expressing mCry3A and eCry3.1Ab. The identification of resistance to Cry3 (Cry3Bb1, mCry3A, and eCry3.1Ab) hybrids led to concerns about durability and efficacy of products with single traits and of products containing a pyramid of a Cry3 protein and the binary Bt proteins Cry34Ab1 and Cry35Ab1. From 2012 to 2014, 43 field trials were conducted across the central United States to estimate root protection provided by plants expressing Cry34Ab1/Cry35Ab1 alone (Herculex RW) or pyramided with Cry3Bb1 (SmartStax). These technologies were evaluated with and without soil-applied insecticides to determine if additional management measures provided benefit where Cry3 performance was reduced. Trials were categorized for analysis based on rootworm damage levels on Cry3-expressing hybrids and rootworm feeding pressure within each trial. Across scenarios, Cry34Ab1/Cry35Ab1 hybrids provided excellent root protection. Pyramided traits provided greater root and yield protection than non-Bt plus a soil-applied insecticide, and only in trials where larval feeding pressure exceeded two nodes of damage did Cry34Ab1/Cry35Ab1 single-trait hybrids and pyramided hybrids show greater root protection from the addition of soil-applied insecticides. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  19. Field-Evolved Mode 1 Resistance of the Fall Armyworm to Transgenic Cry1Fa-Expressing Corn Associated with Reduced Cry1Fa Toxin Binding and Midgut Alkaline Phosphatase Expression

    Science.gov (United States)

    Jakka, Siva R. K.; Gong, Liang; Hasler, James; Banerjee, Rahul; Sheets, Joel J.; Narva, Kenneth; Blanco, Carlos A.

    2015-01-01

    Insecticidal protein genes from the bacterium Bacillus thuringiensis (Bt) are expressed by transgenic Bt crops (Bt crops) for effective and environmentally safe pest control. The development of resistance to these insecticidal proteins is considered the most serious threat to the sustainability of Bt crops. Resistance in fall armyworm (Spodoptera frugiperda) populations from Puerto Rico to transgenic corn producing the Cry1Fa insecticidal protein resulted, for the first time in the United States, in practical resistance, and Bt corn was withdrawn from the local market. In this study, we used a field-collected Cry1Fa corn-resistant strain (456) of S. frugiperda to identify the mechanism responsible for field-evolved resistance. Binding assays detected reduced Cry1Fa, Cry1Ab, and Cry1Ac but not Cry1Ca toxin binding to midgut brush border membrane vesicles (BBMV) from the larvae of strain 456 compared to that from the larvae of a susceptible (Ben) strain. This binding phenotype is descriptive of the mode 1 type of resistance to Bt toxins. A comparison of the transcript levels for putative Cry1 toxin receptor genes identified a significant downregulation (>90%) of a membrane-bound alkaline phosphatase (ALP), which translated to reduced ALP protein levels and a 75% reduction in ALP activity in BBMV from 456 compared to that of Ben larvae. We cloned and heterologously expressed this ALP from susceptible S. frugiperda larvae and demonstrated that it specifically binds with Cry1Fa toxin. This study provides a thorough mechanistic description of field-evolved resistance to a transgenic Bt crop and supports an association between resistance and reduced Cry1Fa toxin binding and levels of a putative Cry1Fa toxin receptor, ALP, in the midguts of S. frugiperda larvae. PMID:26637593

  20. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  1. Insect Resistance to Bacillus thuringiensis Toxin Cry2Ab Is Conferred by Mutations in an ABC Transporter Subfamily A Protein.

    Directory of Open Access Journals (Sweden)

    Wee Tek Tay

    2015-11-01

    Full Text Available The use of conventional chemical insecticides and bacterial toxins to control lepidopteran pests of global agriculture has imposed significant selection pressure leading to the rapid evolution of insecticide resistance. Transgenic crops (e.g., cotton expressing the Bt Cry toxins are now used world wide to control these pests, including the highly polyphagous and invasive cotton bollworm Helicoverpa armigera. Since 2004, the Cry2Ab toxin has become widely used for controlling H. armigera, often used in combination with Cry1Ac to delay resistance evolution. Isolation of H. armigera and H. punctigera individuals heterozygous for Cry2Ab resistance in 2002 and 2004, respectively, allowed aspects of Cry2Ab resistance (level, fitness costs, genetic dominance, complementation tests to be characterised in both species. However, the gene identity and genetic changes conferring this resistance were unknown, as was the detailed Cry2Ab mode of action. No cross-resistance to Cry1Ac was observed in mutant lines. Biphasic linkage analysis of a Cry2Ab-resistant H. armigera family followed by exon-primed intron-crossing (EPIC marker mapping and candidate gene sequencing identified three independent resistance-associated INDEL mutations in an ATP-Binding Cassette (ABC transporter gene we named HaABCA2. A deletion mutation was also identified in the H. punctigera homolog from the resistant line. All mutations truncate the ABCA2 protein. Isolation of further Cry2Ab resistance alleles in the same gene from field H. armigera populations indicates unequal resistance allele frequencies and the potential for Bt resistance evolution. Identification of the gene involved in resistance as an ABC transporter of the A subfamily adds to the body of evidence on the crucial role this gene family plays in the mode of action of the Bt Cry toxins. The structural differences between the ABCA2, and that of the C subfamily required for Cry1Ac toxicity, indicate differences in the

  2. Field-Evolved Resistance in Corn Earworm to Cry Proteins Expressed by Transgenic Sweet Corn

    Science.gov (United States)

    Dively, Galen P.; Finkenbinder, Chad

    2016-01-01

    Background Transgenic corn engineered with genes expressing insecticidal toxins from the bacterium Bacillus thuringiensis (Berliner) (Bt) are now a major tool in insect pest management. With its widespread use, insect resistance is a major threat to the sustainability of the Bt transgenic technology. For all Bt corn expressing Cry toxins, the high dose requirement for resistance management is not achieved for corn earworm, Helicoverpa zea (Boddie), which is more tolerant to the Bt toxins. Methodology/Major Findings We present field monitoring data using Cry1Ab (1996–2016) and Cry1A.105+Cry2Ab2 (2010–2016) expressing sweet corn hybrids as in-field screens to measure changes in field efficacy and Cry toxin susceptibility to H. zea. Larvae successfully damaged an increasing proportion of ears, consumed more kernel area, and reached later developmental stages (4th - 6th instars) in both types of Bt hybrids (Cry1Ab—event Bt11, and Cry1A.105+Cry2Ab2—event MON89034) since their commercial introduction. Yearly patterns of H. zea population abundance were unrelated to reductions in control efficacy. There was no evidence of field efficacy or tissue toxicity differences among different Cry1Ab hybrids that could contribute to the decline in control efficacy. Supportive data from laboratory bioassays demonstrate significant differences in weight gain and fitness characteristics between the Maryland H. zea strain and a susceptible strain. In bioassays with Cry1Ab expressing green leaf tissue, Maryland H. zea strain gained more weight than the susceptible strain at all concentrations tested. Fitness of the Maryland H. zea strain was significantly lower than that of the susceptible strain as indicated by lower hatch rate, longer time to adult eclosion, lower pupal weight, and reduced survival to adulthood. Conclusions/Significance After ruling out possible contributing factors, the rapid change in field efficacy in recent years and decreased susceptibility of H. zea to Bt

  3. Bacillus thuringiensis delta-endotoxin Cry1Ac domain III enhances activity against Heliothis virescens in some, but not all Cry1-Cry1Ac hybrids

    NARCIS (Netherlands)

    Karlova, R.B.; Weemen, W.M.J.; Naimov, S.; Ceron, J.; Dukiandjiev, S.; Maagd, de R.A.

    2005-01-01

    We investigated the role of domain III of Bacillus thuringiensis d-endotoxin Cry1Ac in determining toxicity against Heliothis virescens. Hybrid toxins, containing domain III of Cry1Ac with domains I and II of Cry1Ba, Cry1Ca, Cry1Da, Cry1Ea, and Cry1Fb, respectively, were created. In this way Cry1Ca,

  4. Biocontrol of the Sugarcane Borer Eldana saccharina by Expression of the Bacillus thuringiensis cry1Ac7 and Serratia marcescens chiA Genes in Sugarcane-Associated Bacteria

    Science.gov (United States)

    Downing, Katrina J.; Leslie, Graeme; Thomson, Jennifer A.

    2000-01-01

    The cry1Ac7 gene of Bacillus thuringiensis strain 234, showing activity against the sugarcane borer Eldana saccharina, was cloned under the control of the tac promoter. The fusion was introduced into the broad-host-range plasmid pKT240 and the integration vector pJFF350 and without the tac promoter into the broad-host-range plasmids pML122 and pKmM0. These plasmids were introduced into a Pseudomonas fluorescens strain isolated from the phylloplane of sugarcane and the endophytic bacterium Herbaspirillum seropedicae found in sugarcane. The ptac-cry1Ac7 construct was introduced into the chromosome of P. fluorescens using the integration vector pJFF350 carrying the artificial interposon Omegon-Km. Western blot analysis showed that the expression levels of the integrated cry1Ac7 gene were much higher under the control of the tac promoter than under the control of its endogenous promoter. It was also determined that multicopy expression in P. fluorescens and H. seropedicae of ptac-cry1Ac7 carried on pKT240 caused plasmid instability with no detectable protein expression. In H. seropedicae, more Cry1Ac7 toxin was produced when the gene was cloned under the control of the Nmr promoter on pML122 than in the opposite orientation and bioassays showed that the former resulted in higher mortality of E. saccharina larvae than the latter. P. fluorescens 14::ptac-tox resulted in higher mortality of larvae than did P. fluorescens 14::tox. An increased toxic effect was observed when P. fluorescens 14::ptac-tox was combined with P. fluorescens carrying the Serratia marcescens chitinase gene chiA, under the control of the tac promoter, integrated into the chromosome. PMID:10877771

  5. Performance and cross-crop resistance of Cry1F-maize selected Spodoptera frugiperda on transgenic Bt cotton: implications for resistance management.

    Science.gov (United States)

    Yang, Fei; Kerns, David L; Brown, Sebe; Kurtz, Ryan; Dennehy, Tim; Braxton, Bo; Head, Graham; Huang, Fangneng

    2016-06-15

    Transgenic crops producing Bacillus thuringiensis (Bt) proteins have become a primary tool in pest management. Due to the intensive use of Bt crops, resistance of the fall armyworm, Spodoptera frugiperda, to Cry1F maize has occurred in Puerto Rico, Brazil, and some areas of the southeastern U.S. The sustainability of Bt crops faces a great challenge because the Cry1F-maize resistant S. frugiperda may also infest other Bt crops in multiple cropping ecosystems. Here we examined the survival and plant injury of a S. frugiperda population selected with Cry1F maize on three single-gene and five pyramided Bt cotton products. Larvae of Cry1F-susceptible (SS), -heterozygous (RS), and -resistant (RR) genotypes of S. frugiperda were all susceptible to the pyramided cotton containing Cry1Ac/Cry2Ab, Cry1Ac/Cry1F/Vip3A, Cry1Ab/Cry2Ae, or Cry1Ab/Cry2Ae/Vip3A, and the single-gene Cry2Ae cotton. Pyramided cotton containing Cry1Ac/Cry1F was effective against SS and RS, but not for RR. These findings show that the Cry1F-maize selected S. frugiperda can cause cross-crop resistance to other Bt crops expressing similar insecticidal proteins. Resistance management and pest management programs that utilize diversify mortality factors must be implemented to ensure the sustainability of Bt crops. This is especially important in areas where resistance to single-gene Bt crops is already widespread.

  6. Amino acid transporter genes are essential for FLO11-dependent and FLO11-independent biofilm formation and invasive growth in Saccharomyces cerevisiae.

    Directory of Open Access Journals (Sweden)

    Rasmus Torbensen

    Full Text Available Amino acids can induce yeast cell adhesion but how amino acids are sensed and signal the modulation of the FLO adhesion genes is not clear. We discovered that the budding yeast Saccharomyces cerevisiae CEN.PK evolved invasive growth ability under prolonged nitrogen limitation. Such invasive mutants were used to identify amino acid transporters as regulators of FLO11 and invasive growth. One invasive mutant had elevated levels of FLO11 mRNA and a Q320STOP mutation in the SFL1 gene that encodes a protein kinase A pathway regulated repressor of FLO11. Glutamine-transporter genes DIP5 and GNP1 were essential for FLO11 expression, invasive growth and biofilm formation in this mutant. Invasive growth relied on known regulators of FLO11 and the Ssy1-Ptr3-Ssy5 complex that controls DIP5 and GNP1, suggesting that Dip5 and Gnp1 operates downstream of the Ssy1-Ptr3-Ssy5 complex for regulation of FLO11 expression in a protein kinase A dependent manner. The role of Dip5 and Gnp1 appears to be conserved in the S. cerevisiae strain ∑1278b since the dip5 gnp1 ∑1278b mutant showed no invasive phenotype. Secondly, the amino acid transporter gene GAP1 was found to influence invasive growth through FLO11 as well as other FLO genes. Cells carrying a dominant loss-of-function PTR3(647::CWNKNPLSSIN allele had increased transcription of the adhesion genes FLO1, 5, 9, 10, 11 and the amino acid transporter gene GAP1. Deletion of GAP1 caused loss of FLO11 expression and invasive growth. However, deletions of FLO11 and genes encoding components of the mitogen-activated protein kinase pathway or the protein kinase A pathway were not sufficient to abolish invasive growth, suggesting involvement of other FLO genes and alternative pathways. Increased intracellular amino acid pools in the PTR3(647::CWNKNPLSSIN-containing strain opens the possibility that Gap1 regulates the FLO genes through alteration of the amino acid pool sizes.

  7. Positive selection in the SLC11A1 gene in the family Equidae

    DEFF Research Database (Denmark)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan

    2016-01-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes...... a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans...... and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence...

  8. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  9. The psychophysiology of crying.

    Science.gov (United States)

    Gross, J J; Frederickson, B L; Levenson, R W

    1994-09-01

    Two conflicting views have emerged as to why people cry when they are sad. One suggests that crying serves homeostasis by facilitating recovery; the other suggests that crying produces an aversive high-arousal state that motivates behavior aimed at ending the tears. To test hypotheses drawn from these views, we showed a short film known to elicit sadness to 150 women. During this film, 33 subjects spontaneously cried and 117 did not. Subjects who cried exhibited more expressive behavior and reported feeling more sadness and pain than did subjects who did not cry. Crying also was associated with increases in somatic and autonomic nervous system activity. The increases in autonomic activity could not be accounted for solely by the increases in somatic activity. Crying is thus associated with an aversive state, including negative emotion and a complex mixture of sympathetic, parasympathetic, and somatic activation, and we speculate about the functional implications of these findings.

  10. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  11. Recombinant Cry1Ia protein is highly toxic to cotton boll weevil (Anthonomus grandis Boheman) and fall armyworm (Spodoptera frugiperda).

    Science.gov (United States)

    Martins, E S; Aguiar, R W D S; Martins, N F; Melatti, V M; Falcão, R; Gomes, A C M M; Ribeiro, B M; Monnerat, R G

    2008-05-01

    To evaluate the activity of cry1Ia gene against cotton pests, Spodoptera frugiperda and Anthonomus grandis. Had isolated and characterized a toxin gene from the Bacillus thuringiensis S1451 strain which have been previously shown to be toxic to S. frugiperda and A. grandis. The toxin gene (cry1Ia) was amplified by PCR, sequenced, and cloned into the genome of a baculovirus. The Cry1Ia protein was expressed in baculovirus infected insect cells, producing protein inclusions in infected cells. The Cry1Ia protein has used in bioassays against to S. frugiperda and A. grandis. Bioassays using the purified recombinant protein showed high toxicity to S. frugiperda and A. grandis larvae. Molecular modelling of the Cry1Ia protein translated from the DNA sequence obtained in this work, showed that this protein possibly posses a similar structure to the Cry3A protein. Ultrastructural analysis of midgut cells from A. grandis incubated with the Cry1Ia toxin, showed loss of microvilli integrity. The results indicate that the cry1Ia is a good candidate for the construction of transgenic plants resistant to these important cotton pests.

  12. Effects of water management practices on residue decomposition and degradation of Cry1Ac protein from crop-wild Bt rice hybrids and parental lines during winter fallow season.

    Science.gov (United States)

    Xiao, Manqiu; Dong, Shanshan; Li, Zhaolei; Tang, Xu; Chen, Yi; Yang, Shengmao; Wu, Chunyan; Ouyang, Dongxin; Fang, Changming; Song, Zhiping

    2015-12-01

    Rice is the staple diet of over half of the world's population and Bacillus thuringiensis (Bt) rice expressing insecticidal Cry proteins is ready for deployment. An assessment of the potential impact of Bt rice on the soil ecosystem under varied field management practices is urgently required. We used litter bags to assess the residue (leaves, stems and roots) decomposition dynamics of two transgenic rice lines (Kefeng6 and Kefeng8) containing stacked genes from Bt and sck (a modified CpTI gene encoding a cowpea trypsin inhibitor) (Bt/CpTI), a non-transgenic rice near-isoline (Minghui86), wild rice (Oryza rufipogon) and crop-wild Bt rice hybrid under contrasting conditions (drainage or continuous flooding) in the field. No significant difference was detected in the remaining mass, total C and total N among cultivars under aerobic conditions, whereas significant differences in the remaining mass and total C were detected between Kefeng6 and Kefeng8 and Minghui86 under the flooded condition. A higher decomposition rate constant (km) was measured under the flooded condition compared with the aerobic condition for leaf residues, whereas the reverse was observed for root residues. The enzyme-linked immunosorbent assay (ELISA), which was used to monitor the changes in the Cry1Ac protein in Bt rice residues, indicated that (1) the degradation of the Cry1Ac protein under both conditions best fit first-order kinetics, and the predicted DT50 (50% degradation time) of the Cry1Ac protein ranged from 3.6 to 32.5 days; (2) the Cry1Ac protein in the residue degraded relatively faster under aerobic conditions; and (3) by the end of the study (~154 days), the protein was present at a low concentration in the remaining residues under both conditions. The degradation rate constant was negatively correlated with the initial carbon content and positively correlated with the initial Cry1Ac protein concentration, but it was only correlated with the mass decomposition rate constants under

  13. Isolation and characterization of cbbL and cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase large and small subunits in Nitrosomonas sp. strain ENI-11.

    Science.gov (United States)

    Hirota, Ryuichi; Kato, Junichi; Morita, Hiromu; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao

    2002-03-01

    The cbbL and cbbS genes encoding form I ribulose-1,5-bisphosphate carboxylase/oxygenase (RubisCO) large and small subunits in the ammonia-oxidizing bacterium Nitrosomonas sp. strain ENI-11 were cloned and sequenced. The deduced gene products, CbbL and CbbS, had 93 and 87% identity with Thiobacillus intermedius CbbL and Nitrobacter winogradskyi CbbS, respectively. Expression of cbbL and cbbS in Escherichia coli led to the detection of RubisCO activity in the presence of 0.1 mM isopropyl-beta-D-thiogalactopyranoside (IPTG). To our knowledge, this is the first paper to report the genes involved in the carbon fixation reaction in chemolithotrophic ammonia-oxidizing bacteria.

  14. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  15. Use of JH4 joining segment gene by an anti-arsonate antibody that bears the major A-strain cross-reactive idiotype but displays diminished antigen binding.

    Science.gov (United States)

    Slaughter, C A; Jeske, D J; Kuziel, W A; Milner, E C; Capra, J D

    1984-06-01

    One of the antibody families utilized by the A/J mouse in its response to p-azophenylarsonate (Ars) is characterized by the expression of the major anti-arsonate cross-reactive idiotype (CRI) of the A strain. This family has been termed the Ars-A family. A hybridoma antibody (HP 101F11 ) obtained after immunization of an A/J mouse with Ars was identified initially as displaying the CRI, but was subsequently found to bind antigen at a level much lower than most members of the Ars-A family. The results of binding studies suggested that HP 101F11 possesses reduced avidity for antigen. When isolated light and heavy chains were allowed to recombine with the heavy and light chains of a strongly antigen-binding, strongly CRI-positive antibody of the Ars-A family (HP 93G7 ), the low level of antigen binding by HP 101F11 was found to be due to a structurally variant heavy chain. Whereas antibodies of the Ars-A family with normal avidity for antigen had been shown to use the JH2 joining segment gene, amino acid sequence analysis of HP 101F11 revealed that this antibody has a JH segment with a sequence identical to that encoded by a portion of a different JH gene, JH4 . The implication that 101F11 uses the JH4 gene instead of JH2 was supported by the observation that the productively rearranged gene is associated with an Eco R1 restriction fragment 0.95 Kb smaller than the corresponding fragments of Ars-A hybridomas with normal avidity for antigen. The size difference of 0.95 Kb corresponds exactly to the known distance between the JH2 and JH4 genes in BALB/c germline DNA. In addition to the structural differences immediately attributable to the use of JH4 , HP 101F11 has shown an amino acid interchange in the DH segment, and a single amino acid deletion at the DH-JH boundary. These results show that variation among members of the Ars-A family in the DH and/or JH segments provides alternative structural forms of Ars-A antibodies upon which selective processes can operate

  16. Bt crops producing Cry1Ac, Cry2Ab and Cry1F do not harm the green lacewing, Chrysoperla rufilabris.

    Directory of Open Access Journals (Sweden)

    Jun-Ce Tian

    Full Text Available The biological control function provided by natural enemies is regarded as a protection goal that should not be harmed by the application of any new pest management tool. Plants producing Cry proteins from the bacterium, Bacillus thuringiensis (Bt, have become a major tactic for controlling pest Lepidoptera on cotton and maize and risk assessment studies are needed to ensure they do not harm important natural enemies. However, using Cry protein susceptible hosts as prey often compromises such studies. To avoid this problem we utilized pest Lepidoptera, cabbage looper (Trichoplusia ni and fall armyworm (Spodoptera frugiperda, that were resistant to Cry1Ac produced in Bt broccoli (T. ni, Cry1Ac/Cry2Ab produced in Bt cotton (T. ni, and Cry1F produced in Bt maize (S. frugiperda. Larvae of these species were fed Bt plants or non-Bt plants and then exposed to predaceous larvae of the green lacewing Chrysoperla rufilabris. Fitness parameters (larval survival, development time, fecundity and egg hatch of C. rufilabris were assessed over two generations. There were no differences in any of the fitness parameters regardless if C. rufilabris consumed prey (T. ni or S. frugiperda that had consumed Bt or non-Bt plants. Additional studies confirmed that the prey contained bioactive Cry proteins when they were consumed by the predator. These studies confirm that Cry1Ac, Cry2Ab and Cry1F do not pose a hazard to the important predator C. rufilabris. This study also demonstrates the power of using resistant hosts when assessing the risk of genetically modified plants on non-target organisms.

  17. Identification of Cha o 3 homolog Cry j 4 from Cryptomeria japonica (Japanese cedar) pollen: Limitation of the present Japanese cedar-specific ASIT.

    Science.gov (United States)

    Osada, Toshihiro; Tanaka, Yuki; Yamada, Akira; Sasaki, Eiji; Utsugi, Teruhiro

    2018-03-07

    About one-third of the Japanese population suffers from Japanese cedar pollinosis, which is frequently accompanied by Japanese cypress pollinosis. Recently, a novel major Japanese cypress pollen allergen, Cha o 3, was discovered. However, whether a Cha o 3 homolog is present in Japanese cedar pollen remains to be determined. Western blot analysis was performed using Cha o 3-specific antiserum. In addition, cloning of the gene encoding Cry j 4 was conducted using total cDNA from the male flower of Japanese cedar trees. Allergen potency and cross-reactivity were investigated using a T-cell proliferation assay, basophil activation test, and ImmunoCAP inhibition assay. A low amount of Cha o 3 homolog protein was detected in Japanese cedar pollen extract. The deduced amino acid sequence of Cry j 4 showed 84% identity to that of Cha o 3. Cross-reactivity between Cry j 4 and Cha o 3 was observed at the T cell and IgE levels. Cry j 4 was discovered as a counterpart allergen of Cha o 3 in Japanese cedar pollen, with a relationship similar to that between Cry j 1-Cha o 1 and Cry j 2-Cha o 2. Our findings also suggest that allergen-specific immunotherapy (ASIT) using Japanese cedar pollen extract does not induce adequate immune tolerance to Cha o 3 due to the low amount of Cry j 4 in Japanese cedar pollen. Therefore, ASIT using Cha o 3 or cypress pollen extract coupled with Japanese cedar pollen extract is required in order to optimally control allergy symptoms during Japanese cypress pollen season. Copyright © 2018 Japanese Society of Allergology. Production and hosting by Elsevier B.V. All rights reserved.

  18. Why try (not to cry: Intra- and inter-personal motives for crying regulation

    Directory of Open Access Journals (Sweden)

    Gwenda eSimons

    2013-01-01

    Full Text Available This article discusses inter- and intra-personal motives for the regulation of crying, and presents illustrative findings from an online survey (N = 110 exploring why and how people regulate crying in their everyday lives. In line with current theorizing on emotion regulation and crying (e.g., Vingerhoets et al., 2000, we propose that emotional crying is regulated using both antecedent-focused techniques targeting the underlying emotion and response-focused techniques targeting the act of crying itself. Indeed, our survey respondents reported having used both antecedent- and response-focused strategies to either up-regulate or down-regulate their crying. Motives for crying regulation may be both inter- and intra-personal and may serve both immediate, pleasure motives and future, utility motives (Tamir, 2009. Our findings suggest that down-regulation attempts are often driven by inter-personal motives (e.g., protecting the well-being of others; impression management in addition to intra-personal motives such as maintaining subjective well-being, whereas up-regulation attempts are mostly driven by intra-personal motives. Further progress requires methodologies for manipulating or tracking regulation motives and strategies in real-time crying episodes.

  19. Bacillus thuringiensis Cry1Ca-resistant Spodoptera exigua lacks expression of one of four Aminopeptidase N genes

    Directory of Open Access Journals (Sweden)

    Moar William J

    2005-06-01

    Full Text Available Abstract Background Insecticidal toxins from Bacillus thuringiensis bind to receptors on midgut epithelial cells of susceptible insect larvae. Aminopeptidases N (APNs from several insect species have been shown to be putative receptors for these toxins. Here we report the cloning and expression analysis of four APN cDNAs from Spodoptera exigua. Results Suppression Subtractive Hybridization (SSH was used to construct cDNA libraries of genes that are up-and down-regulated in the midgut of last instar larvae of beet armyworm, S. exigua exposed to B. thuringiensis Cry1Ca toxin. Among the clones from the SSH libraries, cDNA fragments coding for two different APNs were obtained (APN2 and APN4. A similar procedure was employed to compare mRNA differences between susceptible and Cry1Ca resistant S. exigua. Among the clones from this last comparison, cDNA fragments belonging to a third APN (APN1 were detected. Using sequences obtained from the three APN cDNA fragments and degenerate primers for a fourth APN (APN3, the full length sequences of four S. exigua APN cDNAs were obtained. Northern blot analysis of expression of the four APNs showed complete absence of APN1 expression in the resistant insects, while the other three APNs showed similar expression levels in the resistant and susceptible insects. Conclusion We have cloned and characterized four different midgut APN cDNAs from S. exigua. Expression analysis revealed the lack of expression of one of these APNs in the larvae of a Cry1Ca-resistant colony. Combined with previous evidence that shows the importance of APN in the mode of action of B. thuringiensis toxins, these results suggest that the lack of APN1 expression plays a role in the resistance to Cry1Ca in this S. exigua colony.

  20. Emergency Department Triage of the "Incessantly Crying" Baby.

    Science.gov (United States)

    Chua, Caroline; Setlik, Jennifer; Niklas, Victoria

    2016-11-01

    Incessant crying is one of the most common caregiver complaints during emergency department (ED) visits in the first few months of the child's life. Although the majority of cases are attributed to normal infant behavior, the differential diagnosis remains broad. Moreover, the potential for the negative impact of incessant crying on the mental well-being of caregivers as well as the infants necessitates that complaints be taken seriously and that "red flags" for underlying organic causes be ruled out and caregiver anxiety quelled. In addition, the apparent triviality of incessant crying in the face of the life-threatening illnesses or injuries that confront practitioners in the ED necessitates a high level of due diligence in the evaluation of these infants and their families. Ensuring the availability of family support is essential in the discharge planning. Families should also perceive the empathy of the physician and feel reassured about their safe discharge home. Although it is a challenge to examine an incessantly crying infant in all care settings, the failure to recognize the small percentage of infants that present with incessant crying as a manifestation of an underlying organic illness may have grave consequences. [Pediatr Ann. 2016;45(11):e394-e398.]. Copyright 2016, SLACK Incorporated.

  1. Transgenic potato plants expressing cry3A gene confer resistance to Colorado potato beetle.

    Science.gov (United States)

    Mi, Xiaoxiao; Ji, Xiangzhuo; Yang, Jiangwei; Liang, Lina; Si, Huaijun; Wu, Jiahe; Zhang, Ning; Wang, Di

    2015-07-01

    The Colorado potato beetle (Leptinotarsa decemlineata Say, CPB) is a fatal pest, which is a quarantine pest in China. The CPB has now invaded the Xinjiang Uygur Autonomous Region and is constantly spreading eastward in China. In this study, we developed transgenic potato plants expressing cry3A gene. Quantitative real-time polymerase chain reaction (qRT-PCR) analysis indicated that the cry3A gene expressed in leaves, stems and roots of the transgenic plants under the control of CaMV 35S promoter, while they expressed only in leaves and stems under the control of potato leaf and stem-specific promoter ST-LS1. The mortality of the larvae was higher (28% and 36%) on the transgenic plant line 35S1 on the 3rd and 4th days, and on ST3 (48%) on the 5th day after inoculation with instar larvae. Insect biomass accumulation on the foliage of the transgenic plant lines 35S1, 35S2 and ST3 was significantly lower (0.42%, 0.43% and 0.42%). Foliage consumption was lowest on transgenic lines 35S8 and ST2 among all plant foliage (7.47 mg/larvae/day and 12.46 mg/larvae/day). The different transgenic plant foliages had varied inhibition to larval growth. The survivors on the transgenic lines obviously were smaller than their original size and extremely weak. The transgenic potato plants with CPB resistance could be used to develop germplasms or varieties for controlling CPB damage and halting its spread in China. Copyright © 2015 Académie des sciences. Published by Elsevier SAS. All rights reserved.

  2. PRKCDBP (CAVIN3) and CRY2 associate with major depressive disorder.

    Science.gov (United States)

    Kovanen, Leena; Donner, Kati; Kaunisto, Mari; Partonen, Timo

    2017-01-01

    Dysfunctions in the intrinsic clocks are suggested in patients with depressive disorders. The cryptochrome circadian clocks 1 and 2 (CRY1 and CRY2) proteins modulate circadian rhythms in a cell and influence emotional reactions and mood in an individual. The protein kinase C delta binding protein (PRKCDBP, or CAVIN3), similar to the serum deprivation response protein (SDPR, or CAVIN2), reduces metabolic stability of the PER2-CRY2 transcription factor complex that plays a role in the circadian rhythm synchronization. Our aim was to study SDPR, PRKCDBP, CRY1 and CRY2 genetic variants in depressive disorders. The sample included 5910 Finnish individuals assessed with the Munich-Composite International Diagnostic Interview (M-CIDI) in year 2000. In year 2011, 3424 individuals were assessed again. After genotype quality control, there were 383 subjects with major depressive disorder, 166 with dysthymia, and 479 with depressive disorders (major depressive disorder, dysthymia or both), and 4154 healthy controls. A total of 48 single-nucleotide polymorphisms from SDPR, PRKCDBP, CRY1 and CRY2 genes were analyzed using logistic regression models controlling for age and gender. The earlier reported association of CRY2 variants with dysthymia was confirmed and extended to major depressive disorder (qdepressive disorders (q=0.02) and with major depressive disorder in specific (q=0.007) were found. The number of cases was moderate and coverage of PRKCDB was limited. CRY2 and PRKCDBP variants may be risk factors of major depressive disorder and provide information for diagnosis. Copyright © 2016 Elsevier B.V. All rights reserved.

  3. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  4. Organization and transient expression of the gene for human U11 snRNA

    Science.gov (United States)

    Clemens, Suter-Crazzolara; Walter, Keller

    1991-01-01

    The nucleotide sequence of U11 small nuclear RNA, a minor U RNA from HeLa cells, was determined. Computer analysis of the sequence (135 residues) predicts two strong hairpin loops which are separated by seventeen nucleotides containing an Sm binding site (AAUUUUUUGG). A synthetic gene was constructed in which the coding region of U11 RNA is under the control of a T7 promoter. This vector can be used to produce U11 RNA in vitro. Southern hybridization and PCR analysis of HeLa genomic DNA suggest that U11 RNA is encoded by a single copy gene, and that at least three genomic regions could be U11 RNA pseudogenes. A HeLa genomic copy of a U11 gene was isolated by inverted PCR. This gene contains the U11 RNA coding sequence and several sequence elements unique for the U RNA genes. These include a Distal Sequence Element (DSE, ATTTGCATA) present between positions −215 and −223 relative to the start of transcription; a Proximal Sequence Element (PSE, TTCACCTTTACCAAAAATG) located between positions −43 and −63 ; and a 3′box (GTTAGGCGAAATATTA) between positions +150 and +166. Transfection of HeLa cells with this gene revealed that it is functioning in vivo and can produce U11 RNA. PMID:1820214

  5. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  6. MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

    OpenAIRE

    Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

    2014-01-01

    The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes...

  7. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  8. Larval development of Spodoptera eridania and Spodoptera frugiperda fed on fresh ear of field corn expressing the Bt proteins (Cry1F and Cry1F + Cry1A.105 + Cry2Ab2

    Directory of Open Access Journals (Sweden)

    Orcial Ceolin Bortolotto

    Full Text Available ABSTRACT: The objective of this study was to evaluate extent of larval period, larval survival (%, food consumption, and pupal biomass of Spodoptera eridania and Spodoptera frugiperda (Lepidoptera: Noctuidae fed on fresh ears of field corn expressing Bt proteins (Cry1F and Cry1F+Cry1A.105+Cry2Ab2. Larvae of Spodoptera spp. survived less than two days when they consumed Bt corncobs and showed 100% mortality. Spodoptera eridania reared on non-Bt corn cobs showed higher larval development (21.6 days than S. frugiperda (18.4 days and lower viability (56.4% and 80.2% for S. eridania and S. frugiperda , respectively. A higher amount of corn grains was consumed by S. eridania (5.4g than by S. frugiperda (3.9g. In summary, this study demonstrated that the toxins Cry1F and Cry1F + Cry1A.105 + Cry2Ab2 expressed in fresh corn cobs contributed to protect ears of corn against S. frugiperda and the non-target pest S. eridania . However, itis important to monitor non-Bt cornfields because of the potential of both species to cause damage to ear sof corn.

  9. Larval development of Spodoptera eridania (Cramer fed on leaves of Bt maize expressing Cry1F and Cry1F + Cry1A.105 + Cry2Ab2 proteins and its non-Bt isoline

    Directory of Open Access Journals (Sweden)

    Orcial Ceolin Bortolotto

    2015-03-01

    Full Text Available This study aimed to evaluate, in controlled laboratory conditions (temperature of 25±2 °C, relative humidity of 60±10%, and 14/10 h L/D photoperiod, the larval development of Spodoptera eridania (Cramer, 1784 (Lepidoptera, Noctuidae fed with leaves of Bt maize expressing Cry1F and Cry1F + Cry1A.105 + Cry2Ab2 insecticide proteins and its non-Bt isoline. Maize leaves triggered 100% of mortality on S. eridania larvae independently of being Bt or non-Bt plants. However, it was observed that in overall Bt maize (expressing a single or pyramided protein slightly affects the larval development of S. eridania, even under reduced leaf consumption. Therefore, these results showed that Cry1F and Cry1F + Cry1A.105 + Cry2Ab2 can affect the larval development of S. eridania, although it is not a target pest of this plant; however, more research is needed to better understand this evidence. Finally, this study confirms that non-Bt maize leaves are unsuitable food source to S. eridania larvae, suggesting that they are not a potential pest in maize fields.

  10. Mutational analysis of the PTPN11 gene in Egyptian patients with Noonan syndrome.

    Science.gov (United States)

    Essawi, Mona L; Ismail, Manal F; Afifi, Hanan H; Kobesiy, Maha M; El Kotoury, Ahmed; Barakat, Maged M

    2013-11-01

    Noonan syndrome (NS) is inherited as an autosomal dominant disorder with dysmorphic facies, short stature, and cardiac defects, which can be caused by missense mutations in the protein tyrosine phosphatase nonreceptor type 11 (PTPN11) gene, which encodes src homology region 2 domain containing tyrosine phosphatase-2 (SHP-2), a protein tyrosine phosphatase that acts in signal transduction downstream to growth factors and cytokines. The current study aimed to study the molecular characterization of the PTPN11 gene among Egyptian patients with Noonan syndrome. Eleven exons of the PTPN11 gene were amplified and screened by single stranded conformational polymorphism (SSCP). DNA samples showing band shift in SSCP were subjected to sequencing. Mutational analysis of the PTPN11 gene revealed T→C transition at position 854 in exon 8, predicting Phe285Ser substitution within PTP domain of SHP-2 protein, in one NS patient and -21C→T polymorphism in intron 7 in four other cases. Knowing that NS is phenotypically heterogeneous, molecular characterization of the PTPN11 gene should serve to establish NS diagnosis in patients with atypical features, although lack of a mutation does not exclude the possibility of NS. Copyright © 2012. Published by Elsevier B.V.

  11. Regulation of expression of pectate lyase genes pelA, pelD, and pelE in Erwinia chrysanthemi.

    Science.gov (United States)

    Reverchon, S; Robert-Baudouy, J

    1987-06-01

    The regulation of pelA, pelD, and pelE genes encoding three of the five major pectate lyase isoenzymes (PLa, PLd, and PLe) in Erwinia chrysanthemi B374 was analyzed by using genetic fusions to lacZ. These three genes are clustered on a 5-kilobase DNA fragment in the order pelD-pelE-pelA and constitute three independent transcriptional units. We localized the pelDEA cluster near the pro-1 marker on the genetic map of B374 by chromosomal mobilization with RP4::mini-Mu plasmid pULB110. Three classes of regulatory mutations responsible for constitutive pectate lyase synthesis have been described (kdgR, gpiR, and cri). We studied the effects of each mutation on pelE, pelD, and pelA expression independently. The mutations kdgR and gpiR mainly affect the expression of pelE and pelD, although PLa synthesis is slightly increased. The cri mutation results in a low level of constitutive expression of the three pel genes, but it is a pleiotropic mutation since other genes not involved in pectinolysis are also affected. In addition, we demonstrated that exuR, a negative regulatory gene governing the catabolism of hexuronates, does not modify the expression of pel genes. The frequency of gpiR or cri mutations (about 10(-8)) and the resulting constitutivity of pectate lyase synthesis suggest that these genes act as negative regulatory genes in addition to kdgR, which is already known to encode a repressor. Moreover, we found that expression of pel-lac fusions carried on pBR322 derivatives was higher in E. chrysanthemi than in Escherichia coli; this fact suggests the existence of positive regulation of pectate lyase synthesis in E. chrysanthemi.

  12. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  13. Expression of Cry1Ac toxin-binding region in Plutella xyllostella cadherin-like receptor and studying their interaction mode by molecular docking and site-directed mutagenesis.

    Science.gov (United States)

    Hu, Xiaodan; Zhang, Xiao; Zhong, Jianfeng; Liu, Yuan; Zhang, Cunzheng; Xie, Yajing; Lin, Manman; Xu, Chongxin; Lu, Lina; Zhu, Qing; Liu, Xianjin

    2018-05-01

    Cadherin-like protein has been identified as the primary Bacillus thuringiensis (Bt) Cry toxin receptor in Lepidoptera pests and plays a key role in Cry toxin insecticidal. In this study, we successfully expressed the putative Cry1Ac toxin-binding region (CR7-CR11) of Plutella xylostella cadherin-like in Escherichia coli BL21 (DE3). The expressed CR7-CR11 fragment showed binding ability to Cry1Ac toxin under denaturing (Ligand blot) and non-denaturing (ELISA) conditions. The three-dimensional structure of CR7-CR11 was constructed by homology modeling. Molecular docking results of CR7-CR11 and Cry1Ac showed that domain II and domain III of Cry1Ac were taking part in binding to CR7-CR11, while CR7-CR8 was the region of CR7-CR11 in interacting with Cry1Ac. The interaction of toxin-receptor complex was found to arise from hydrogen bond and hydrophobic interaction. Through the computer-aided alanine mutation scanning, amino acid residues of Cry1Ac (Met341, Asn442 and Ser486) and CR7-CR11 (Asp32, Arg101 and Arg127) were predicted as the hot spot residues involved in the interaction of the toxin-receptor complex. At last, we verified the importance role of these key amino acid residues by binding assay. These results will lay a foundation for further elucidating the insecticidal mechanism of Cry toxin and enhancing Cry toxin insecticidal activity by molecular modification. Copyright © 2018 Elsevier B.V. All rights reserved.

  14. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  15. Is crying a self-soothing behavior?

    Directory of Open Access Journals (Sweden)

    Asmir eGračanin

    2014-05-01

    Full Text Available This contribution describes the current state-of-the-art of the scientific literature regarding the self-soothing effects of crying. Starting from the general hypothesis that crying is a self-soothing behavior, we consider different mechanisms through which these effects may appear. In the first section we briefly explain the main functions of human crying. Then we define self-soothing in terms of homeostatic processes of mood regulation and stress reduction and we underline the importance of distinguishing self-soothing effects of crying from social-soothing that it may elicit. We then provide a comprehensive review of the putative mood enhancing and relieving effects of crying and their variations stemming from characteristics of crying person, antecedents, manifestations, and social consequences of crying. We also discuss the possible methodological explanations for the seemingly discrepant findings regarding mood improvement and relief that may follow crying. We then provide theoretical and empirical support for our general hypothesis that crying is a self-soothing behavior by presenting and evaluating the possible physiological, cognitive, and behavioral mechanisms that may play a mediating role in the relationship between crying and homeostatic regulation that includes mood improvement and relief. Starting from the idea that social-soothing and self-soothing mechanisms share the same physiological systems, we propose that biological processes act in parallel with learning and reappraisal processes that accompany crying, which results in homeostatic regulation. Given the parallels between self-soothing behaviors in humans and animals, we also propose that crying might self-soothe through a mechanism that shares key properties with rhythmical, stereotypic behaviors. We conclude that, in addition to the importance of socially mediated mechanisms for the mood enhancing effects of crying, there is converging evidence for the direct, self

  16. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  17. Synergism and Antagonism between Bacillus thuringiensis Vip3A and Cry1 Proteins in Heliothis virescens, Diatraea saccharalis and Spodoptera frugiperda

    Science.gov (United States)

    Lemes, Ana Rita Nunes; Davolos, Camila Chiaradia; Legori, Paula Cristina Brunini Crialesi; Fernandes, Odair Aparecido; Ferré, Juan; Lemos, Manoel Victor Franco; Desiderio, Janete Apparecida

    2014-01-01

    Second generation Bt crops (insect resistant crops carrying Bacillus thuringiensis genes) combine more than one gene that codes for insecticidal proteins in the same plant to provide better control of agricultural pests. Some of the new combinations involve co-expression of cry and vip genes. Because Cry and Vip proteins have different midgut targets and possibly different mechanisms of toxicity, it is important to evaluate possible synergistic or antagonistic interactions between these two classes of toxins. Three members of the Cry1 class of proteins and three from the Vip3A class were tested against Heliothis virescens for possible interactions. At the level of LC50, Cry1Ac was the most active protein, whereas the rest of proteins tested were similarly active. However, at the level of LC90, Cry1Aa and Cry1Ca were the least active proteins, and Cry1Ac and Vip3A proteins were not significantly different. Under the experimental conditions used in this study, we found an antagonistic effect of Cry1Ca with the three Vip3A proteins. The interaction between Cry1Ca and Vip3Aa was also tested on two other species of Lepidoptera. Whereas antagonism was observed in Spodoptera frugiperda, synergism was found in Diatraea saccharalis. In all cases, the interaction between Vip3A and Cry1 proteins was more evident at the LC90 level than at the LC50 level. The fact that the same combination of proteins may result in a synergistic or an antagonistic interaction may be an indication that there are different types of interactions within the host, depending on the insect species tested. PMID:25275646

  18. Detection of Genes that Determine Maize Grain Quality Characteristics and Resistance to Stress Factors

    Directory of Open Access Journals (Sweden)

    Markovskyi, O.V.

    2014-01-01

    Full Text Available 200 experimental maize samples (Maize Company were examined for the presence of genes that determine the quality characteristics of grain (wx and fl-2 genes, herbicide (bar (pat, epsps genes and insect (cry-genes resistance. The total DNA was extracted from maize living plant tissue. Primers to detect wx, fl-2, bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 genes were designed and selected. Multiplex and Touchdown PCR were worked out. PCR amplification of certain sequences was carried out. No transgenes (bar (pat, mepsps, CP4 epsps, cry1A(b, cry1F, cry1A.105, mcry3A, cry2Ab2, cry3Bb1, cry34Ab1, cry35Ab1 were found among 200 analyzed experimental maize samples. At the same time, fl-2 gene was found in 41 samples, wx gene was found in 192 analyzed samples.

  19. "When I Want to Cry I Can't": Inability to Cry Following SSRI Treatment.

    Science.gov (United States)

    Holguín-Lew, Jorge Carlos; Bell, Vaughan

    2013-12-01

    We describe seven cases of patients with an inability to cry after treatment with selective serotonin re-uptake inhibitor (SSRI) medication, even during sad or distressing situations that would have normally initiated a crying episode, in the light of the role of the serotonergic system in emotional expression. Case series drawn from patients attended in a secondary care psychiatry service. While excessive crying without emotional distress has been previously reported in the literature, and is associated with reduced serotonin function, these reports suggest cases of the reverse dissociation, where emotional distress and an urge to cry was present, but crying was impaired. Although the case series presented here is new, these cases are consistent with the neuroscience of crying and their relationship with serotonergic function, and provide preliminary evidence for a double dissociation between subjective emotional experience and the behavioural expression of crying. This helps to further illuminate the neuroscience of emotional expression and suggests the possibility that the phenomenon is an under-recognised adverse effect of SSRI treatment. Copyright © 2013 Asociación Colombiana de Psiquiatría. Publicado por Elsevier España. All rights reserved.

  20. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  1. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  2. Inheritance Patterns, Dominance and Cross-Resistance of Cry1Ab- and Cry1Ac-Selected Ostrinia furnacalis (Guenée

    Directory of Open Access Journals (Sweden)

    Tiantao Zhang

    2014-09-01

    Full Text Available Two colonies of Asian corn borer, Ostrinia furnacalis (Guenée, artificially selected from a Bt-susceptible colony (ACB-BtS for resistance to Cry1Ab (ACB-AbR and Cry1Ac (ACB-AcR toxins, were used to analyze inheritance patterns of resistance to Cry1 toxins. ACB-AbR and ACB-AcR evolved significant levels of resistance, with resistance ratios (RR of 39-fold and 78.8-fold to Cry1Ab and Cry1Ac, respectively. The susceptibility of ACB-AbR larvae to Cry1Ac and Cry1F toxins, which had not previously been exposed, were significantly reduced, being >113-fold and 48-fold, respectively. Similarly, susceptibility of ACB-AcR larvae to Cry1Ab and Cry1F were also significantly reduced (RR > nine-fold, RR > 18-fold, respectively, indicating cross-resistance among Cry1Ab, Cry1Ac, and Cry1F toxins. However, ACB-AbR and ACB-AcR larvae were equally susceptible to Cry1Ie as were ACB-BtS larvae, indicating no cross-resistance between Cry1Ie and Cry1Ab or Cry1Ac toxins; this may provide considerable benefits in preventing or delaying the evolution of resistance in ACB to Cry1Ab and Cry1Ac toxins. Backcrossing studies indicated that resistance to Cry1Ab toxin was polygenic in ACB-AbR, but monogenic in ACB-AcR, whilst resistance to Cry1Ac toxin was primarily monogenic in both ACB-AbR and ACB-AcR, but polygenic as resistance increased.

  3. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  4. Larval development of Spodoptera eridania and Spodoptera frugiperda fed on fresh ear of field corn expressing the Bt proteins (Cry1F and Cry1F + Cry1A.105 + Cry2Ab2)

    OpenAIRE

    Bortolotto,Orcial Ceolin; Bueno,Adeney de Freitas; Queiroz,Ana Paula de; Silva,Gabriela Vieira

    2016-01-01

    ABSTRACT: The objective of this study was to evaluate extent of larval period, larval survival (%), food consumption, and pupal biomass of Spodoptera eridania and Spodoptera frugiperda (Lepidoptera: Noctuidae ) fed on fresh ears of field corn expressing Bt proteins (Cry1F and Cry1F+Cry1A.105+Cry2Ab2). Larvae of Spodoptera spp. survived less than two days when they consumed Bt corncobs and showed 100% mortality. Spodoptera eridania reared on non-Bt corn cobs showed higher larval development (...

  5. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  6. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  7. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  8. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  9. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  10. Safety and long-term immunological effects of CryJ2-LAMP plasmid vaccine in Japanese red cedar atopic subjects: A phase I study.

    Science.gov (United States)

    Su, Yan; Romeu-Bonilla, Eliezer; Anagnostou, Athanasia; Fitz-Patrick, David; Hearl, William; Heiland, Teri

    2017-12-02

    Japanese Red Cedar (JRC) pollen induced allergy affects one third of Japanese and the development of effective therapies remains an unachieved challenge. We designed a DNA vaccine encoding CryJ2 allergen from the JRC pollen and Lysosomal Associated Membrane Protein 1 (LAMP-1) to treat JRC allergy. These Phase IA and IB trials assessed safety and immunological effects of the investigational CryJ2-LAMP DNA vaccine in both non-sensitive and sensitive Japanese expatriates living in Honolulu, Hawaii. In the Phase IA trial, 6 JRC non-sensitive subjects and 9 JRC and/or Mountain Cedar (MC) sensitive subjects were given 4 vaccine doses (each 4mg/1ml) intramuscularly (IM) at 14-day intervals. Nine JRC and/or MC sensitive subjects were given 4 doses (2 mg/0.5 ml) IM at 14-day intervals. The safety and functional biomarkers were followed for 132 d. Following this, 17 of 24 subjects were recruited into the IB trial and received one booster dose (2 mg/0.5 ml) IM approximately 300 d after the first vaccination dose to which they were randomized in the first phase of the trial. All safety endpoints were met and all subjects tolerated CryJ2-LAMP vaccinations well. At the end of the IA trial, 10 out of 12 JRC sensitive and 6 out of 11 MC sensitive subjects experienced skin test negative conversion, possibly related to the CryJ2-LAMP vaccinations. Collectively, these data suggested that the CryJ2-LAMP DNA vaccine is safe and may be immunologically effective in treating JRC induced allergy.

  11. Chilo suppressalis and Sesamia inferens display different susceptibility responses to Cry1A insecticidal proteins.

    Science.gov (United States)

    Li, Bo; Xu, Yangyang; Han, Cao; Han, Lanzhi; Hou, Maolin; Peng, Yufa

    2015-10-01

    Chilo suppressalis and Sesamia inferens are important lepidopteran rice pests that occur concurrently in rice-growing areas of China. The development of transgenic rice expressing Cry1A insecticidal proteins has provided a useful strategy for controlling these pests. This study evaluated the baseline susceptibilities of C. suppressalis and S. inferens to Cry1A, as well as their responses to selection with Cry1A. Wide geographic variation in susceptibility was observed across all field populations. Within a given population, the LC50 of both Cry1Ab and Cry1Ac against S. inferens was drastically higher than that of C. suppressalis. Large LC50 differences (74.6-fold) were detected between the two species for Cry1Ab in the Poyang population, while small differences (3.6-fold) were detected for Cry1Ac in the Changsha population. The Cry1Ac LC50 of C. suppressalis and S. inferens increased 8.4- and 4.4-fold after 21 and eight selection generations respectively. Additionally, the estimated realised heritabilities (h(2) ) of Cry1Ac tolerance were 0.11 in C. suppressalis and 0.292 in S. inferens. S. inferens exhibited a significantly lower susceptibility and more rapidly evolved resistance to Cry1A compared with C. suppressalis. Therefore, S. inferens is more likely to evolve increased resistance, which threatens the sustainability of rice expressing Cry1A protein. © 2014 Society of Chemical Industry.

  12. Potential allergenicity research of Cry1C protein from genetically modified rice.

    Science.gov (United States)

    Cao, Sishuo; He, Xiaoyun; Xu, Wentao; Luo, Yunbo; Ran, Wenjun; Liang, Lixing; Dai, Yunqing; Huang, Kunlun

    2012-07-01

    With the development of genetically modified crops, there has been a growing interest in available approaches to assess the potential allergenicity of novel gene products. We were not sure whether Cry1C could induce allergy. We examined the protein with three other proteins to determine the potential allergenicity of Cry1C protein from genetically modified rice. Female Brown Norway (BN) rats received 0.1 mg peanut agglutinin (PNA), 1mg potato acid phosphatase (PAP), 1mg ovalbumin (OVA) or 5 mg purified Cry1C protein dissolved in 1 mL water by daily gavage for 42 days to test potential allergenicity. Ten days after the last gavage, rats were orally challenged with antigens, and physiologic and immunologic responses were studied. In contrast to sensitization with PNA, PAP and OVA Cry1C protein did not induce antigen-specific IgG2a in BN rats. Cytokine expression, serum IgE and histamine levels and the number of eosinophils and mast cells in the blood of Cry1C group rats were comparable to the control group rats, which were treated with water alone. As Cry1C did not show any allergenicity, we make the following conclusion that the protein could be safety used in rice or other plants. Copyright © 2012 Elsevier Inc. All rights reserved.

  13. Baby-Crying Acceptance

    Science.gov (United States)

    Martins, Tiago; de Magalhães, Sérgio Tenreiro

    The baby's crying is his most important mean of communication. The crying monitoring performed by devices that have been developed doesn't ensure the complete safety of the child. It is necessary to join, to these technological resources, means of communicating the results to the responsible, which would involve the digital processing of information available from crying. The survey carried out, enabled to understand the level of adoption, in the continental territory of Portugal, of a technology that will be able to do such a digital processing. It was used the TAM as the theoretical referential. The statistical analysis showed that there is a good probability of acceptance of such a system.

  14. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  15. Midgut transcriptome response to a Cry toxin in the diamondback moth, Plutella xylostella (Lepidoptera: Plutellidae).

    Science.gov (United States)

    Lei, Yanyuan; Zhu, Xun; Xie, Wen; Wu, Qingjun; Wang, Shaoli; Guo, Zhaojiang; Xu, Baoyun; Li, Xianchun; Zhou, Xuguo; Zhang, Youjun

    2014-01-01

    To investigate the response of Plutella xylostella transcriptome in defending against a Bt toxin, high-throughput RNA-sequencing was carried out to examine Cry1Ac-susceptible and -resistant strains. The comparative analysis indentified over 2900 differentially expressed unigenes (DEUs) between these two strains. Gene Ontology analysis placed these unigenes primarily into cell, cell part, organelle, binding, catalytic, cellular process, metabolic process, and response to stimulus categories. Based on pathway analyses, DEUs were enriched in oxidoreductase activity and membrane lipid metabolic processes, and they were also significantly enriched in pathways related to the metabolic and biosynthesis of secondary metabolites. Most of the unigenes involved in the metabolic pathway were up-regulated in resistant strains. Within the ABC transporter pathway, majority of the down-regulated unigenes belong to ABCC2 and ABCC10, respectively, while up-regulated unigenes were mainly categorized as ABCG2. Furthermore, two aminopeptidases, and four cadherins encoding genes were significantly elevated as well. This study provides a transcriptome foundation for the identification and functional characterization of genes involved in the Bt resistance in an agriculturally important insect pest, P. xylostella. © 2013 Elsevier B.V. All rights reserved.

  16. Food safety assessment of Cry8Ka5 mutant protein using Cry1Ac as a control Bt protein.

    Science.gov (United States)

    Farias, Davi Felipe; Viana, Martônio Ponte; Oliveira, Gustavo Ramos; Santos, Vanessa Olinto; Pinto, Clidia Eduarda Moreira; Viana, Daniel Araújo; Vasconcelos, Ilka Maria; Grossi-de-Sa, Maria Fátima; Carvalho, Ana Fontenele Urano

    2015-07-01

    Cry8Ka5 is a mutant protein from Bacillus thuringiensis (Bt) that has been proposed for developing transgenic plants due to promising activity against coleopterans, like Anthonomus grandis (the major pest of Brazilian cotton culture). Thus, an early food safety assessment of Cry8Ka5 protein could provide valuable information to support its use as a harmless biotechnological tool. This study aimed to evaluate the food safety of Cry8Ka5 protein following the two-tiered approach, based on weights of evidence, proposed by ILSI. Cry1Ac protein was used as a control Bt protein. The history of safe use revealed no convincing hazard reports for Bt pesticides and three-domain Cry proteins. The bioinformatics analysis with the primary amino acids sequence of Cry8Ka5 showed no similarity to any known toxic, antinutritional or allergenic proteins. The mode of action of Cry proteins is well understood and their fine specificity is restricted to insects. Cry8Ka5 and Cry1Ac proteins were rapidly degraded in simulated gastric fluid, but were resistant to simulated intestinal fluid and heat treatment. The LD50 for Cry8Ka5 and Cry1Ac was >5000 mg/kg body weight when administered by gavage in mice. Thus, no expected relevant risks are associated with the consumption of Cry8Ka5 protein. Copyright © 2015 Elsevier Ltd. All rights reserved.

  17. Evaluation of cytotoxic and antimicrobial effects of two Bt Cry proteins on a GMO safety perspective.

    Science.gov (United States)

    Farias, Davi Felipe; Viana, Martônio Ponte; de Oliveira, Gustavo Ramos; Beneventi, Magda Aparecida; Soares, Bruno Marques; Pessoa, Claudia; Pessoa, Igor Parra; Silva, Luciano Paulino; Vasconcelos, Ilka Maria; de Sá, Maria Fátima Grossi; Carvalho, Ana Fontenele Urano

    2014-01-01

    Studies have contested the innocuousness of Bacillus thuringiensis (Bt) Cry proteins to mammalian cells as well as to mammals microbiota. Thus, this study aimed to evaluate the cytotoxic and antimicrobial effects of two Cry proteins, Cry8Ka5 (a novel mutant protein) and Cry1Ac (a widely distributed protein in GM crops). Evaluation of cyto- and genotoxicity in human lymphocytes was performed as well as hemolytic activity coupled with cellular membrane topography analysis in mammal erythrocytes. Effects of Cry8Ka5 and Cry1Ac upon Artemia sp. nauplii and upon bacteria and yeast growth were assessed. The toxins caused no significant effects on the viability (IC50 > 1,000 µg/mL) or to the cellular DNA integrity of lymphocytes (no effects at 1,000 µg/mL). The Cry8Ka5 and Cry1Ac proteins did not cause severe damage to erythrocytes, neither with hemolysis (IC50 > 1,000 µg/mL) nor with alterations in the membrane. Likewise, the Cry8Ka5 and Cry1Ac proteins presented high LC50 (755.11 and >1,000 µg/mL, resp.) on the brine shrimp lethality assay and showed no growth inhibition of the microorganisms tested (MIC > 1,000 µg/mL). This study contributed with valuable information on the effects of Cry8Ka5 and Cry1Ac proteins on nontarget organisms, which reinforce their potential for safe biotechnological applications.

  18. Maternal anxiety disorders predict excessive infant crying: a prospective longitudinal study.

    Science.gov (United States)

    Petzoldt, Johanna; Wittchen, Hans-Ulrich; Wittich, Julia; Einsle, Franziska; Höfler, Michael; Martini, Julia

    2014-09-01

    To prospectively examine relations between maternal DSM-IV-TR anxiety and depressive disorders and excessive infant crying. Based on the prospective longitudinal Maternal Anxiety in Relation to Infant Development Study, n=306 expectant mothers were enrolled during early pregnancy and repeatedly interviewed until 16 months post partum. Lifetime and prospective information on maternal anxiety and depressive disorders was assessed via standardised diagnostic interviews (Composite International Diagnostic Interview for Women). Excessive crying (crying for ≥3 h per day on ≥3 days per week for ≥3 weeks) was assessed via Baby-DIPS. During the first 16 months after delivery, n=286 mother-infant dyads were available and included in the analyses. Excessive crying was reported by n=29 mothers (10.1%). Infants of mothers with anxiety disorders prior to pregnancy were at higher risk for excessive crying than infants of mothers without any anxiety disorder prior to pregnancy (OR=2.54, 95% CI 1.11 to 5.78, p=0.027). Risk was even increased when considering additionally incident anxiety disorders until delivery (OR=3.02, 95% CI 1.25 to 7.32, p=0.014) and until 16 months post partum (OR=2.87, 95% CI 1.13 to 7.28, p=0.027). Associations remained stable when adjusting for sociodemographic and perinatal covariates. Maternal depressive disorders prior to pregnancy were not significantly associated with excessive crying in this sample. Maternal lifetime and incident anxiety disorders revealed to be a robust predictor for excessive crying. Thus, early identification and monitoring of women with anxiety disorders is important to identify mother-infant dyads at risk for excessive crying. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to http://group.bmj.com/group/rights-licensing/permissions.

  19. Culture and crying : Prevalences and gender differences

    NARCIS (Netherlands)

    Hemert, D.A. van; Vijver, F.J.R. van de; Vingerhoets, A.J.J.M.

    2011-01-01

    Results of a cross-cultural study of adult crying across 37 countries are presented. Analyses focused on country differences in recency of last crying episode and crying proneness and relationships with country characteristics. Three hypotheses on the nature of country differences in crying were

  20. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  1. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  2. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  3. Infant Cries Rattle Adult Cognition.

    Directory of Open Access Journals (Sweden)

    Joanna Dudek

    Full Text Available The attention-grabbing quality of the infant cry is well recognized, but how the emotional valence of infant vocal signals affects adult cognition and cortical activity has heretofore been unknown. We examined the effects of two contrasting infant vocalizations (cries vs. laughs on adult performance on a Stroop task using a cross-modal distraction paradigm in which infant distractors were vocal and targets were visual. Infant vocalizations were presented before (Experiment 1 or during each Stroop trial (Experiment 2. To evaluate the influence of infant vocalizations on cognitive control, neural responses to the Stroop task were obtained by measuring electroencephalography (EEG and event-related potentials (ERPs in Experiment 1. Based on the previously demonstrated existence of negative arousal bias, we hypothesized that cry vocalizations would be more distracting and invoke greater conflict processing than laugh vocalizations. Similarly, we expected participants to have greater difficulty shifting attention from the vocal distractors to the target task after hearing cries vs. after hearing laughs. Behavioral results from both experiments showed a cry interference effect, in which task performance was slower with cry than with laugh distractors. Electrophysiology data further revealed that cries more than laughs reduced attention to the task (smaller P200 and increased conflict processing (larger N450, albeit differently for incongruent and congruent trials. Results from a correlation analysis showed that the amplitudes of P200 and N450 were inversely related, suggesting a reciprocal relationship between attention and conflict processing. The findings suggest that cognitive control processes contribute to an attention bias to infant signals, which is modulated in part by the valence of the infant vocalization and the demands of the cognitive task. The findings thus support the notion that infant cries elicit a negative arousal bias that is

  4. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  5. The Cry Toxin Operon of Clostridium bifermentans subsp. malaysia Is Highly Toxic to Aedes Larval Mosquitoes

    Science.gov (United States)

    Qureshi, Nadia; Chawla, Swati; Likitvivatanavong, Supaporn; Lee, Han Lim

    2014-01-01

    The management and control of mosquito vectors of human disease currently rely primarily on chemical insecticides. However, larvicidal treatments can be effective, and if based on biological insecticides, they can also ameliorate the risk posed to human health by chemical insecticides. The aerobic bacteria Bacillus thuringiensis and Lysinibacillus sphaericus have been used for vector control for a number of decades. But a more cost-effective use would be an anaerobic bacterium because of the ease with which these can be cultured. More recently, the anaerobic bacterium Clostridium bifermentans subsp. malaysia has been reported to have high mosquitocidal activity, and a number of proteins were identified as potentially mosquitocidal. However, the cloned proteins showed no mosquitocidal activity. We show here that four toxins encoded by the Cry operon, Cry16A, Cry17A, Cbm17.1, and Cbm17.2, are all required for toxicity, and these toxins collectively show remarkable selectivity for Aedes rather than Anopheles mosquitoes, even though C. bifermentans subsp. malaysia is more toxic to Anopheles. Hence, toxins that target Anopheles are different from those expressed by the Cry operon. PMID:25002432

  6. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  7. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  8. A Single-Nucleotide Polymorphism in Serine-Threonine Kinase 11, the Gene Encoding Liver Kinase B1, Is a Risk Factor for Multiple Sclerosis

    Directory of Open Access Journals (Sweden)

    Anne I. Boullerne

    2015-02-01

    Full Text Available We identified a family in which five siblings were diagnosed with multiple sclerosis (MS or clinically isolated syndrome. Several women in the maternal lineage have comorbidities typically associated with Peutz Jeghers Syndrome, a rare autosomal-dominant disease caused by mutations in the serine-threonine-kinase 11 (STK11 gene, which encodes liver kinase B1. Sequence analysis of DNA from one sibling identified a single-nucleotide polymorphism (SNP within STK11 intron 5. This SNP (dbSNP ID: rs9282860 was identified by TaqMan polymerase chain reaction (PCR assays in DNA samples available from two other siblings. Further screening was carried out in samples from 654 relapsing-remitting MS patients, 100 primary progressive MS patients, and 661 controls. The STK11-SNP has increased frequency in all female patients versus controls (odds ratio = 1.66, 95% CI = 1.05, 2.64, p = .032. The STK11-SNP was not associated with disease duration or onset; however, it was significantly associated with reduced severity (assessed by MS severity scores, with the lowest scores in patients who also harbored the HLA-DRB1*1501 allele. In vitro studies showed that peripheral blood mononuclear cells from members of the family were more sensitive to the mitochondrial inhibitor metformin than cells from MS patients with the major STK11 allele. The increased association of SNP rs9282860 in women with MS defines this variant as a genetic risk factor. The lower disease severity observed in the context of HLA-DRB1*1501 combined with limited in vitro studies raises the provocative possibility that cells harboring the STK11-SNP could be targeted by drugs which increase metabolic stress.

  9. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  10. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  11. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  12. Evaluation of Cytotoxic and Antimicrobial Effects of Two Bt Cry Proteins on a GMO Safety Perspective

    Directory of Open Access Journals (Sweden)

    Davi Felipe Farias

    2014-01-01

    Full Text Available Studies have contested the innocuousness of Bacillus thuringiensis (Bt Cry proteins to mammalian cells as well as to mammals microbiota. Thus, this study aimed to evaluate the cytotoxic and antimicrobial effects of two Cry proteins, Cry8Ka5 (a novel mutant protein and Cry1Ac (a widely distributed protein in GM crops. Evaluation of cyto- and genotoxicity in human lymphocytes was performed as well as hemolytic activity coupled with cellular membrane topography analysis in mammal erythrocytes. Effects of Cry8Ka5 and Cry1Ac upon Artemia sp. nauplii and upon bacteria and yeast growth were assessed. The toxins caused no significant effects on the viability (IC50>1,000 µg/mL or to the cellular DNA integrity of lymphocytes (no effects at 1,000 µg/mL. The Cry8Ka5 and Cry1Ac proteins did not cause severe damage to erythrocytes, neither with hemolysis (IC50>1,000 µg/mL nor with alterations in the membrane. Likewise, the Cry8Ka5 and Cry1Ac proteins presented high LC50 (755.11 and >1,000 µg/mL, resp. on the brine shrimp lethality assay and showed no growth inhibition of the microorganisms tested (MIC>1,000 µg/mL. This study contributed with valuable information on the effects of Cry8Ka5 and Cry1Ac proteins on nontarget organisms, which reinforce their potential for safe biotechnological applications.

  13. 40 CFR 180.1154 - CryIA(c) and CryIC derived delta-endotoxins of Bacillus thuringiensis var. kurstaki encapsulated...

    Science.gov (United States)

    2010-07-01

    ... expression plasmid and cloning vector genetic constructs. 180.1154 Section 180.1154 Protection of Environment... RESIDUES IN FOOD Exemptions From Tolerances § 180.1154 CryIA(c) and CryIC derived delta-endotoxins of... plasmid and cloning vector genetic constructs. CryIA(c) and CryIC derived delta-endotoxins of Bacillus...

  14. Phonotrauma associated with crying.

    Science.gov (United States)

    Murry, T; Rosen, C A

    2000-12-01

    Vocal fold hemorrhage often results in a sudden change in voice quality. Traumatic use of the voice (phonation or singing) is generally thought to be the cause of the vocal fold hemorrhage. The current report reviews three cases in which the traumatic event was crying. In one case, the patient's voice was only used for crying. All three patients were female and all were professional singers. The treatment of these individuals consisted of voice rest and subsequent phonomicrosurgery for lesions associated with the vocal fold hemorrhage. These case studies suggest that crying as a traumatic vocal behavior may result in vocal fold hemorrhage.

  15. Effects of insecticidal crystal proteins (Cry proteins) produced by genetically modified maize (Bt maize) on the nematode Caenorhabditis elegans

    International Nuclear Information System (INIS)

    Höss, Sebastian; Menzel, Ralph; Gessler, Frank; Nguyen, Hang T.; Jehle, Johannes A.; Traunspurger, Walter

    2013-01-01

    The genetically modified maize MON89034 × MON88017 expresses different crystal (Cry) proteins with pesticidal activity against the European corn borer (Cry1.105; Cry2Ab2) and the Western corn root worm (Cry3Bb1). Non-target organisms, such as soil nematodes, might be exposed to the Cry proteins that enter the soil in course of crop growing. Therefore, the risk of those proteins for nematodes was assessed by testing their toxic effects on Caenorhabditis elegans. All three insecticidal Cry proteins showed dose-dependent inhibitory effects on C. elegans reproduction (EC50: 0.12–0.38 μmol L −1 ), however, at concentrations that were far above the expected soil concentrations. Moreover, a reduced toxicity was observed when Cry proteins were added jointly. A C. elegans mutant strain deficient for receptors for the nematicidal Cry5B was also resistant against Cry1.105 and Cry2Ab2, suggesting that these Cry proteins bound to the same or similar receptors as nematicidal Cry proteins and thereby affect the reproduction of C. elegans. -- Highlights: •Insecticidal Cry proteins dose-dependently inhibited the reproduction of C. elegans. •Mixture toxicity was lower than expected from concentration-additive single effects. •Genes for MAPK-defense-pathway were up-regulated in presence of Cry protein mixture. •Knock-out strains deficient for Cry5B-receptors showed lower susceptibility to insecticidal Cry proteins. •Toxicity of insecticidal Cry-proteins on C. elegans occurred at concentrations far above expected field concentrations. -- Insecticidal Cry proteins expressed by genetically modified maize act on nematodes via a similar mode of action as nematicidal Cry proteins, however, at concentrations far above expected soil levels

  16. Genome-wide identification of Bcl11b gene targets reveals role in brain-derived neurotrophic factor signaling.

    Directory of Open Access Journals (Sweden)

    Bin Tang

    Full Text Available B-cell leukemia/lymphoma 11B (Bcl11b is a transcription factor showing predominant expression in the striatum. To date, there are no known gene targets of Bcl11b in the nervous system. Here, we define targets for Bcl11b in striatal cells by performing chromatin immunoprecipitation followed by high-throughput sequencing (ChIP-seq in combination with genome-wide expression profiling. Transcriptome-wide analysis revealed that 694 genes were significantly altered in striatal cells over-expressing Bcl11b, including genes showing striatal-enriched expression similar to Bcl11b. ChIP-seq analysis demonstrated that Bcl11b bound a mixture of coding and non-coding sequences that were within 10 kb of the transcription start site of an annotated gene. Integrating all ChIP-seq hits with the microarray expression data, 248 direct targets of Bcl11b were identified. Functional analysis on the integrated gene target list identified several zinc-finger encoding genes as Bcl11b targets, and further revealed a significant association of Bcl11b to brain-derived neurotrophic factor/neurotrophin signaling. Analysis of ChIP-seq binding regions revealed significant consensus DNA binding motifs for Bcl11b. These data implicate Bcl11b as a novel regulator of the BDNF signaling pathway, which is disrupted in many neurological disorders. Specific targeting of the Bcl11b-DNA interaction could represent a novel therapeutic approach to lowering BDNF signaling specifically in striatal cells.

  17. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  18. Crying in Middle Childhood: A Report on Gender Differences.

    Science.gov (United States)

    Jellesma, Francine C; Vingerhoets, Ad J J M

    2012-10-01

    The aims of this study were (1) to confirm gender differences in crying in middle childhood and (2) to identify factors that may explain why girls cry more than boys in a Dutch sample (North Holland and Utrecht). We examined 186 children's (age: 9-13 years) self-reports on crying, catharsis, seeking support for feelings, and internalizing feelings. Girls reported a greater crying frequency and crying proneness, and more emotional and physical catharsis after crying. In addition, they more frequently sought support for feelings and more often experienced sadness and somatic complaints than boys. Seeking help for negative feelings and the experience of sadness and somatic complaints were positively associated with crying frequency and crying proneness. Emotional catharsis was positively linked to crying proneness. Support was found for the potential mediating role of sadness and somatic complaints with respect to the gender difference in crying frequency and for the potential mediating role of emotional catharsis and somatic complaints for crying proneness. This study demonstrates that gender differences in crying frequency already exist in middle childhood and the findings suggest a linkage between these gender differences in crying and psychosocial factors.

  19. Preliminary evaluation of a primary care intervention for cry-fuss behaviours in the first 3-4 months of life ('The Possums Approach'): effects on cry-fuss behaviours and maternal mood.

    Science.gov (United States)

    Douglas, Pamela S; Miller, Yvette; Bucetti, Anne; Hill, Peter S; Creedy, Debra K

    2015-01-01

    Problem crying in the first few months of life is both common and complex, arising out of multiple interacting and co-evolving factors. Parents whose babies cry and fuss a lot receive conflicting advice as they seek help from multiple health providers and emergency departments, and may be admitted into tertiary residential services. Conflicting advice is costly, and arises out of discipline-specific interpretations of evidence. An integrated, interdisciplinary primary care intervention ('The Possums Approach') for cry-fuss problems in the first months of life was developed from available peer-reviewed evidence. This study reports on preliminary evaluation of delivery of the intervention. A total of 20 mothers who had crying babies under 16 weeks of age (average age 6.15 weeks) completed questionnaires, including the Crying Patterns Questionnaire and the Edinburgh Postnatal Depression Scale, before and 3-4 weeks after their first consultation with trained primary care practitioners. Preliminary evaluation is promising. The Crying Patterns Questionnaire showed a significant decrease in crying and fussing duration, by 1h in the evening (P=0.001) and 30 min at night (P=0.009). The median total amount of crying and fussing in a 24-h period was reduced from 6.12 to 3h. The Edinburgh Postnatal Depression Scale showed a significant improvement in depressive symptoms, with the median score decreasing from 11 to 6 (P=0.005). These findings are corroborated by an analysis of results for the subset of 16 participants whose babies were under 12 weeks of age (average age 4.71 weeks). These preliminary results demonstrate significantly decreased infant crying in the evening and during the night and improved maternal mood, validating an innovative interdisciplinary clinical intervention for cry-fuss problems in the first few months of life. This intervention, delivered by trained health professionals, has the potential to mitigate the costly problem of health professionals giving

  20. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  1. Can interactions between Bt proteins be predicted and how should effects on non-target organisms of GM crops with multiple Bt Proteins be assessed?

    NARCIS (Netherlands)

    Schrijver, De A.; Clercq, de P.; Booij, K.; Maagd, de R.A.; Frankenhuyzen, van K.

    2014-01-01

    Genes expressing Bacillus thuringiensis (Bt) toxins have been incorporated into genetically modified (GM) plants to render these resistant to certain insect pests. Of particular interest have been the genes encoding Cry (Crystal) proteins, but also the gene encoding the vegetative insecticidal

  2. Crying and Depression Among Older Adults.

    Science.gov (United States)

    Hastrup, Janice L.; And Others

    1986-01-01

    Self-reports of frequency of crying episodes are described for two nonclinical samples of younger and older adult men and women. Comparison of samples revealed no evidence for either a decreased or increased frequency of crying among the older sample. Crying episodes function as an adaptive coping response to and should not be automatically…

  3. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  4. DDB1-Mediated CRY1 Degradation Promotes FOXO1-Driven Gluconeogenesis in Liver.

    Science.gov (United States)

    Tong, Xin; Zhang, Deqiang; Charney, Nicholas; Jin, Ethan; VanDommelen, Kyle; Stamper, Kenneth; Gupta, Neil; Saldate, Johnny; Yin, Lei

    2017-10-01

    Targeted protein degradation through ubiquitination is an important step in the regulation of glucose metabolism. Here, we present evidence that the DDB1-CUL4A ubiquitin E3 ligase functions as a novel metabolic regulator that promotes FOXO1-driven hepatic gluconeogenesis. In vivo, hepatocyte-specific Ddb1 deletion leads to impaired hepatic gluconeogenesis in the mouse liver but protects mice from high-fat diet-induced hyperglycemia. Lack of Ddb1 downregulates FOXO1 protein expression and impairs FOXO1-driven gluconeogenic response. Mechanistically, we discovered that DDB1 enhances FOXO1 protein stability via degrading the circadian protein cryptochrome 1 (CRY1), a known target of DDB1 E3 ligase. In the Cry1 depletion condition, insulin fails to reduce the nuclear FOXO1 abundance and suppress gluconeogenic gene expression. Chronic depletion of Cry1 in the mouse liver not only increases FOXO1 protein but also enhances hepatic gluconeogenesis. Thus, we have identified the DDB1-mediated CRY1 degradation as an important target of insulin action on glucose homeostasis. © 2017 by the American Diabetes Association.

  5. Induction of rapid and selective cell necrosis in Drosophila using Bacillus thuringiensis Cry toxin and its silkworm receptor.

    Science.gov (United States)

    Obata, Fumiaki; Tanaka, Shiho; Kashio, Soshiro; Tsujimura, Hidenobu; Sato, Ryoichi; Miura, Masayuki

    2015-07-08

    Genetic ablation of target cells is a powerful tool to study the origins and functions of cells, tissue regeneration, or pathophysiology in a human disease model in vivo. Several methods for selective cell ablation by inducing apoptosis have been established, using exogenous toxins or endogenous proapoptotic genes. However, their application is limited to cells with intact apoptotic machinery. Herein, we established a method for inducing rapid and selective cell necrosis by the pore-forming bacterial toxin Cry1Aa, which is specifically active in cells expressing the Cry1Aa receptor (CryR) derived from the silkworm Bombyx mori. We demonstrated that overexpressing CryR in Drosophila melanogaster tissues induced rapid cell death of CryR-expressing cells only, in the presence of Cry1Aa toxin. Cry/CryR system was effective against both proliferating cells in imaginal discs and polyploid postmitotic cells in the fat body. Live imaging analysis of cell ablation revealed swelling and subsequent osmotic lysis of CryR-positive cells after 30 min of incubation with Cry1Aa toxin. Osmotic cell lysis was still triggered when apoptosis, JNK activation, or autophagy was inhibited, suggesting that Cry1Aa-induced necrotic cell death occurred independently of these cellular signaling pathways. Injection of Cry1Aa into the body cavity resulted in specific ablation of CryR-expressing cells, indicating the usefulness of this method for in vivo cell ablation. With Cry toxins from Bacillus thuringiensis, we developed a novel method for genetic induction of cell necrosis. Our system provides a "proteinous drill" for killing target cells through physical injury of the cell membrane, which can potentially be used to ablate any cell type in any organisms, even those that are resistant to apoptosis or JNK-dependent programmed cell death.

  6. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  7. Defective canalicular transport and toxicity of dietary ursodeoxycholic acid in the abcb11-/- mouse: transport and gene expression studies.

    Science.gov (United States)

    Wang, Renxue; Liu, Lin; Sheps, Jonathan A; Forrest, Dana; Hofmann, Alan F; Hagey, Lee R; Ling, Victor

    2013-08-15

    The bile salt export pump (BSEP), encoded by the abcb11 gene, is the major canalicular transporter of bile acids from the hepatocyte. BSEP malfunction in humans causes bile acid retention and progressive liver injury, ultimately leading to end-stage liver failure. The natural, hydrophilic, bile acid ursodeoxycholic acid (UDCA) is efficacious in the treatment of cholestatic conditions, such as primary biliary cirrhosis and cholestasis of pregnancy. The beneficial effects of UDCA include promoting bile flow, reducing hepatic inflammation, preventing apoptosis, and maintaining mitochondrial integrity in hepatocytes. However, the role of BSEP in mediating UDCA efficacy is not known. Here, we used abcb11 knockout mice (abcb11-/-) to test the effects of acute and chronic UDCA administration on biliary secretion, bile acid composition, liver histology, and liver gene expression. Acutely infused UDCA, or its taurine conjugate (TUDC), was taken up by the liver but retained, with negligible biliary output, in abcb11-/- mice. Feeding UDCA to abcb11-/- mice led to weight loss, retention of bile acids, elevated liver enzymes, and histological damage to the liver. Semiquantitative RT-PCR showed that genes encoding Mdr1a and Mdr1b (canalicular) as well as Mrp4 (basolateral) transporters were upregulated in abcb11-/- mice. We concluded that infusion of UDCA and TUDC failed to induce bile flow in abcb11-/- mice. UDCA fed to abcb11-/- mice caused liver damage and the appearance of biliary tetra- and penta-hydroxy bile acids. Supplementation with UDCA in the absence of Bsep caused adverse effects in abcb11-/- mice.

  8. Cry1Ab protein from Bt transgenic rice does not residue in rhizosphere soil

    International Nuclear Information System (INIS)

    Wang Haiyan; Ye Qingfu; Wang Wei; Wu Licheng; Wu Weixiang

    2006-01-01

    Expression of Cry1Ab protein in Bt transgenic rice (KMD) and its residue in the rhizosphere soil during the whole growth in field, as well as degradation of the protein from KMD straw in five soils under laboratory incubation were studied. The residue of Cry1Ab protein in KMD rhizosphere soil was undetectable (below the limit of 0.5 ng/g air-dried soil). The Cry1Ab protein contents in the shoot and root of KMD were 3.23-8.22 and 0.68-0.89 μg/g (fresh weight), respectively. The half-lives of the Cry1Ab protein in the soils amended with KMD straw (4%, w/w) ranged from 11.5 to 34.3 d. The residence time of the protein varied significantly in a Fluvio-marine yellow loamy soil amended with KMD straw at the rate of 3, 4 and 7%, with half-lives of 9.9, 13.8 and 18 d, respectively. In addition, an extraction method for Cry1Ab protein in soil was developed, with extraction efficiencies of 46.4-82.3%. - Cry1Ab protein was not detected in the rhizosphere soil of field-grown Bt transgenic rice

  9. Evolution of Bacillus thuringiensis Cry toxins insecticidal activity.

    Science.gov (United States)

    Bravo, Alejandra; Gómez, Isabel; Porta, Helena; García-Gómez, Blanca Ines; Rodriguez-Almazan, Claudia; Pardo, Liliana; Soberón, Mario

    2013-01-01

    Insecticidal Cry proteins produced by Bacillus thuringiensis are use worldwide in transgenic crops for efficient pest control. Among the family of Cry toxins, the three domain Cry family is the better characterized regarding their natural evolution leading to a large number of Cry proteins with similar structure, mode of action but different insect specificity. Also, this group is the better characterized regarding the study of their mode of action and the molecular basis of insect specificity. In this review we discuss how Cry toxins have evolved insect specificity in nature and analyse several cases of improvement of Cry toxin action by genetic engineering, some of these examples are currently used in transgenic crops. We believe that the success in the improvement of insecticidal activity by genetic evolution of Cry toxins will depend on the knowledge of the rate-limiting steps of Cry toxicity in different insect pests, the mapping of the specificity binding regions in the Cry toxins, as well as the improvement of mutagenesis strategies and selection procedures. © 2012 The Authors. Microbial Biotechnology © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.

  10. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  11. Hypothalamic expression and moonlight-independent changes of Cry3 and Per4 implicate their roles in lunar clock oscillators of the lunar-responsive Goldlined spinefoot.

    Directory of Open Access Journals (Sweden)

    Riko Toda

    Full Text Available Lunar cycle-associated physiology has been found in a wide variety of organisms. Studies suggest the presence of a circalunar clock in some animals, but the location of the lunar clock is unclear. We previously found lunar-associated expression of transcripts for Cryptochrome3 gene (SgCry3 in the brain of a lunar phase-responsive fish, the Goldlined spinefoot (Siganus guttatus. Then we proposed a photoperiodic model for the lunar phase response, in which SgCry3 might function as a phase-specific light response gene and/or an oscillatory factor in unidentified circalunar clock. In this study, we have developed an anti-SgCRY3 antibody to identify SgCRY3-immunoreactive cells in the brain. We found immunoreactions in the subependymal cells located in the mediobasal region of the diencephalon, a crucial site for photoperiodic seasonal responses in birds. For further assessment of the lunar-responding mechanism and the circalunar clock, we investigated mRNA levels of Cry3 as well as those of the other clock(-related genes, Period (Per2 and Per4, in S. guttatus reared under nocturnal moonlight interruption or natural conditions. Not only SgCry3 but SgPer4 mRNA levels showed lunar phase-dependent variations in the diencephalon without depending on light condition during the night. These results suggest that the expressions of SgCry3 and SgPer4 are not directly regulated by moonlight stimulation but endogenously mediated in the brain, and implicate that circadian clock(-related genes may be involved in the circalunar clock locating within the mediobasal region of the diencephalon.

  12. Hypothalamic expression and moonlight-independent changes of Cry3 and Per4 implicate their roles in lunar clock oscillators of the lunar-responsive Goldlined spinefoot.

    Science.gov (United States)

    Toda, Riko; Okano, Keiko; Takeuchi, Yuki; Yamauchi, Chihiro; Fukushiro, Masato; Takemura, Akihiro; Okano, Toshiyuki

    2014-01-01

    Lunar cycle-associated physiology has been found in a wide variety of organisms. Studies suggest the presence of a circalunar clock in some animals, but the location of the lunar clock is unclear. We previously found lunar-associated expression of transcripts for Cryptochrome3 gene (SgCry3) in the brain of a lunar phase-responsive fish, the Goldlined spinefoot (Siganus guttatus). Then we proposed a photoperiodic model for the lunar phase response, in which SgCry3 might function as a phase-specific light response gene and/or an oscillatory factor in unidentified circalunar clock. In this study, we have developed an anti-SgCRY3 antibody to identify SgCRY3-immunoreactive cells in the brain. We found immunoreactions in the subependymal cells located in the mediobasal region of the diencephalon, a crucial site for photoperiodic seasonal responses in birds. For further assessment of the lunar-responding mechanism and the circalunar clock, we investigated mRNA levels of Cry3 as well as those of the other clock(-related) genes, Period (Per2 and Per4), in S. guttatus reared under nocturnal moonlight interruption or natural conditions. Not only SgCry3 but SgPer4 mRNA levels showed lunar phase-dependent variations in the diencephalon without depending on light condition during the night. These results suggest that the expressions of SgCry3 and SgPer4 are not directly regulated by moonlight stimulation but endogenously mediated in the brain, and implicate that circadian clock(-related) genes may be involved in the circalunar clock locating within the mediobasal region of the diencephalon.

  13. Crying, oral contraceptive use and the menstrual cycle.

    Science.gov (United States)

    Romans, Sarah E; Clarkson, Rose F; Einstein, Gillian; Kreindler, David; Laredo, Sheila; Petrovic, Michele J; Stanley, James

    2017-01-15

    Crying, a complex neurobiological behavior with psychosocial and communication features, has been little studied in relationship to the menstrual cycle. In the Mood and Daily Life study (MiDL), a community sample of Canadian women aged 18-43 years, n=76, recorded crying proneness and crying frequency daily for six months along with menstrual cycle phase information. Crying proneness was most likely during the premenstruum, a little less likely during menses and least likely during the mid-cycle phase, with statistically significant differences although the magnitude of these differences were small. By contrast, actual crying did not differ between the three menstrual cycle phases. Oral contraceptive use did not alter the relationship between menstrual cycle phase and either crying variable. A wide range of menstrual cycle phase - crying proneness patterns were seen with visual inspection of the individual women's line graphs. timing of ovulation was not ascertained. Using a three phase menstrual cycle division precluded separate late follicular and early luteal data analysis. The sample size was inadequate for a robust statistical test of actual crying. reproductive aged women as a group report feeling more like crying premenstrually but may not actually cry more during this menstrual cycle phase. Individual patterns vary substantially. Oral contraceptive use did not affect these relationships. Suggestions for future research are included. Copyright © 2016 Elsevier B.V. All rights reserved.

  14. Structural studies of {delta}-endotoxin Cry 1 C from Bacillus thuringiensis

    Energy Technology Data Exchange (ETDEWEB)

    Guimaraes, B.G.; Garratt, R.C.; Oliva, G. [Sao Paulo Univ., Sao Carlos, SP (Brazil). Inst. de Fisica; Lemos, M.V.F. [UNESP, Jaboticabal, SP (Brazil). Dept. de Biologia Aplicada Agropecuaria; Arantes, O.M.N. [Universidade Estadual de Londrina, PR (Brazil). Dept. de Biologia Geral

    1996-12-31

    Full text. The {delta}-endotoxins are a family of crystal protein by a soil bacterium, Bacillus thuringiensis. The study of these proteins has been of great interest due to their highly specific activity against insects of the orders Lepidoptera, Diptera and Coleoptera. Thus, the {delta}a-endotoxins have been used for more than two decades as biological insecticides to control agricultural pests and, more recently, insects vectors of some diseases. The knowledge of their three-dimensional structures is very important to understand their mechanism of action and their high specificity. To date, the structure of only three proteins of the {delta}-endotoxins family have been reported: Cry3A, a coleopteran-specific toxin (beetle toxin){sup 1}, Cry1Aa, a lepidopteran-specific toxin (butterfly toxin){sup 2} and CytB, a dipteran-specific toxin (mosquito toxin){sup 3} Our work is aimed at the determination of the crystallographic structure by X-ray diffraction of {delta}-endotoxin Cry1C, also toxic to insects of the Lepidoptera order but towards families other than those affected by Cry1Aa. A comparison between these structures may lead to important conclusions about the reasons for the specificity and would allow the planning of mutants with more efficient activity. The cry1C gene was cloned into an adequate vector and expressed in an acrystalliferous B. thuringiensis strain. After cell culture and sporulation the microcrystals of Cry1C were separated by ultra-centrifugation in sacharose. The protoxin inclusion bodies were activated by commercial trpsin and the protease-resistant core was purified by anion-exchange chromatography. Crystallization experiments are being conducted in order to obtain single crystals suitable for diffraction measurements. We intend to use the Protein Crystallograph Station of the LNLS to collect data as soon as it is available and we have suitable crystals. (author) 3 refs.

  15. Structural studies of δ-endotoxin Cry 1 C from Bacillus thuringiensis

    International Nuclear Information System (INIS)

    Guimaraes, B.G.; Garratt, R.C.; Oliva, G.; Lemos, M.V.F.; Arantes, O.M.N.

    1996-01-01

    Full text. The δ-endotoxins are a family of crystal protein by a soil bacterium, Bacillus thuringiensis. The study of these proteins has been of great interest due to their highly specific activity against insects of the orders Lepidoptera, Diptera and Coleoptera. Thus, the δa-endotoxins have been used for more than two decades as biological insecticides to control agricultural pests and, more recently, insects vectors of some diseases. The knowledge of their three-dimensional structures is very important to understand their mechanism of action and their high specificity. To date, the structure of only three proteins of the δ-endotoxins family have been reported: Cry3A, a coleopteran-specific toxin (beetle toxin) 1 , Cry1Aa, a lepidopteran-specific toxin (butterfly toxin) 2 and CytB, a dipteran-specific toxin (mosquito toxin) 3 Our work is aimed at the determination of the crystallographic structure by X-ray diffraction of δ-endotoxin Cry1C, also toxic to insects of the Lepidoptera order but towards families other than those affected by Cry1Aa. A comparison between these structures may lead to important conclusions about the reasons for the specificity and would allow the planning of mutants with more efficient activity. The cry1C gene was cloned into an adequate vector and expressed in an acrystalliferous B. thuringiensis strain. After cell culture and sporulation the microcrystals of Cry1C were separated by ultra-centrifugation in sacharose. The protoxin inclusion bodies were activated by commercial trpsin and the protease-resistant core was purified by anion-exchange chromatography. Crystallization experiments are being conducted in order to obtain single crystals suitable for diffraction measurements. We intend to use the Protein Crystallograph Station of the LNLS to collect data as soon as it is available and we have suitable crystals. (author)

  16. Expression of hybrid fusion protein (Cry1Ac::ASAL) in transgenic rice plants imparts resistance against multiple insect pests.

    Science.gov (United States)

    Boddupally, Dayakar; Tamirisa, Srinath; Gundra, Sivakrishna Rao; Vudem, Dashavantha Reddy; Khareedu, Venkateswara Rao

    2018-05-31

    To evolve rice varieties resistant to different groups of insect pests a fusion gene, comprising DI and DII domains of Bt Cry1Ac and carbohydrate binding domain of garlic lectin (ASAL), was constructed. Transgenic rice lines were generated and evaluated to assess the efficacy of Cry1Ac::ASAL fusion protein against three major pests, viz., yellow stem borer (YSB), leaf folder (LF) and brown planthopper (BPH). Molecular analyses of transgenic plants revealed stable integration and expression of the fusion gene. In planta insect bioassays on transgenics disclosed enhanced levels of resistance compared to the control plants. High insect mortality of YSB, LF and BPH was observed on transgenics compared to that of control plants. Furthermore, honeydew assays revealed significant decreases in the feeding ability of BPH on transgenic plants as compared to the controls. Ligand blot analysis, using BPH insects fed on cry1Ac::asal transgenic rice plants, revealed a modified receptor protein-binding pattern owing to its ability to bind to additional receptors in insects. The overall results authenticate that Cry1Ac::ASAL protein is endowed with remarkable entomotoxic effects against major lepidopteran and hemipteran insects. As such, the fusion gene appears promising and can be introduced into various other crops to control multiple insect pests.

  17. Congenital asymmetric crying face: a case report

    Directory of Open Access Journals (Sweden)

    Semra Kara

    2011-12-01

    Full Text Available Congenital asymmetric crying face is an anomalia caused by unilateral absence or weakness of depressor anguli oris muscle The major finding of the disease is the absence or weakness in the outer and lower movement of the commissure during crying. The other expression muscles are normal and the face is symmetric at rest. The asymmetry in congenital asymmetric crying face is most evident during infancy but decreases by age. Congenital asymmetric crying face can be associated with cervicofacial, musclebone, respiratory, genitourinary and central nervous system anomalia. It is diagnosed by physical examination. This paper presents a six days old infant with Congenital asymmetric crying face and discusses the case in terms of diagnosis and disease features.

  18. Sex stereotypes influence adults' perception of babies' cries.

    Science.gov (United States)

    Reby, David; Levréro, Florence; Gustafsson, Erik; Mathevon, Nicolas

    2016-04-14

    Despite widespread evidence that gender stereotypes influence human parental behavior, their potential effects on adults' perception of babies' cries have been overlooked. In particular, whether adult listeners overgeneralize the sex dimorphism that characterizes the voice of adult speakers (men are lower-pitched than women) to their perception of babies' cries has not been investigated. We used playback experiments combining natural and re-synthesised cries of 3 month-old babies to investigate whether the interindividual variation in the fundamental frequency (pitch) of cries affected adult listeners' identification of the baby's sex, their perception the baby's femininity and masculinity, and whether these biases interacted with their perception of the level of discomfort expressed by the cry. We show that low-pitched cries are more likely to be attributed to boys and high-pitched cries to girls, despite the absence of sex differences in pitch. Moreover, low-pitched boys are perceived as more masculine and high-pitched girls are perceived as more feminine. Finally, adult men rate relatively low-pitched cries as expressing more discomfort when presented as belonging to boys than to girls. Such biases in caregivers' responses to babies' cries may have implications on children's immediate welfare and on the development of their gender identity.

  19. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  20. MicroRNA Dysregulation, Gene Networks, and Risk for Schizophrenia in 22q11.2 Deletion Syndrome

    Science.gov (United States)

    Merico, Daniele; Costain, Gregory; Butcher, Nancy J.; Warnica, William; Ogura, Lucas; Alfred, Simon E.; Brzustowicz, Linda M.; Bassett, Anne S.

    2014-01-01

    The role of microRNAs (miRNAs) in the etiology of schizophrenia is increasingly recognized. Microdeletions at chromosome 22q11.2 are recurrent structural variants that impart a high risk for schizophrenia and are found in up to 1% of all patients with schizophrenia. The 22q11.2 deletion region overlaps gene DGCR8, encoding a subunit of the miRNA microprocessor complex. We identified miRNAs overlapped by the 22q11.2 microdeletion and for the first time investigated their predicted target genes, and those implicated by DGCR8, to identify targets that may be involved in the risk for schizophrenia. The 22q11.2 region encompasses seven validated or putative miRNA genes. Employing two standard prediction tools, we generated sets of predicted target genes. Functional enrichment profiles of the 22q11.2 region miRNA target genes suggested a role in neuronal processes and broader developmental pathways. We then constructed a protein interaction network of schizophrenia candidate genes and interaction partners relevant to brain function, independent of the 22q11.2 region miRNA mechanisms. We found that the predicted gene targets of the 22q11.2 deletion miRNAs, and targets of the genome-wide miRNAs predicted to be dysregulated by DGCR8 hemizygosity, were significantly represented in this schizophrenia network. The findings provide new insights into the pathway from 22q11.2 deletion to expression of schizophrenia, and suggest that hemizygosity of the 22q11.2 region may have downstream effects implicating genes elsewhere in the genome that are relevant to the general schizophrenia population. These data also provide further support for the notion that robust genetic findings in schizophrenia may converge on a reasonable number of final pathways. PMID:25484875

  1. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  2. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  3. Child Abuse: The Crying Baby at Risk.

    Science.gov (United States)

    Kirkland, John

    The author considers the relationship between uncontrollable infant crying and child abuse. An integrative scheme is offered from evidence of child abuse literature, experimentally induced infant crying effects, attribution theory, and learned helplessness. It is suggested that infant crying often has causes beyond caregiver control, such as birth…

  4. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  5. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  6. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  7. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  8. Detection of cry1 genes in Bacillus thuringiensis isolates from South of Brazil and activity against Aanticarsia gemmatalis (Lepidoptera:Noctuidae

    Directory of Open Access Journals (Sweden)

    Bobrowski Vera Lucia

    2001-01-01

    Full Text Available The bacterium Bacillus thuringiensis (Bt is characterized by its ability to produce proteic crystalline inclusions during sporulation. Cry1 protein has insecticidal activity and is highly specific to certain insects and not toxic to unrelated insects, plants or vertebrates. In this work, the patogenicity of twelve Bt isolates was tested against Anticarsia gemmatalis, one of the most important insect pests of soybeans. Spore-crystal complex was applied to the surface of artificial diets and the mortality of A. gemmatalis larvae was assessed seven days after each treatment. When compared to a control Bt isolate known by its high toxicity to A. gemmatalis larvae, four novel Bt isolates exhibited even higher toxic activities against the insect, resulting in more than 90% mortality. PCR was used to amplify DNA fragments related to known cry1 genes. Bt strains with high toxicity produced expected PCR products of around 280 bp, whereas non-toxic or low toxic strains did not produce any PCR product or showed amplified fragments of different sizes. Toxic Bt isolates also exhibited an expected protein profile when total protein extracts were evaluated by SDS-PAGE.

  9. Positive selection in the SLC11A1 gene in the family Equidae.

    Science.gov (United States)

    Bayerova, Zuzana; Janova, Eva; Matiasovic, Jan; Orlando, Ludovic; Horin, Petr

    2016-05-01

    Immunity-related genes are a suitable model for studying effects of selection at the genomic level. Some of them are highly conserved due to functional constraints and purifying selection, while others are variable and change quickly to cope with the variation of pathogens. The SLC11A1 gene encodes a transporter protein mediating antimicrobial activity of macrophages. Little is known about the patterns of selection shaping this gene during evolution. Although it is a typical evolutionarily conserved gene, functionally important polymorphisms associated with various diseases were identified in humans and other species. We analyzed the genomic organization, genetic variation, and evolution of the SLC11A1 gene in the family Equidae to identify patterns of selection within this important gene. Nucleotide SLC11A1 sequences were shown to be highly conserved in ten equid species, with more than 97 % sequence identity across the family. Single nucleotide polymorphisms (SNPs) were found in the coding and noncoding regions of the gene. Seven codon sites were identified to be under strong purifying selection. Codons located in three regions, including the glycosylated extracellular loop, were shown to be under diversifying selection. A 3-bp indel resulting in a deletion of the amino acid 321 in the predicted protein was observed in all horses, while it has been maintained in all other equid species. This codon comprised in an N-glycosylation site was found to be under positive selection. Interspecific variation in the presence of predicted N-glycosylation sites was observed.

  10. Uptake and bioaccumulation of Cry toxins by an aphidophagous predator

    International Nuclear Information System (INIS)

    Paula, Débora P.; Andow, David A.

    2016-01-01

    Uptake of Cry toxins by insect natural enemies has rarely been considered and bioaccumulation has not yet been demonstrated. Uptake can be demonstrated by the continued presence of Cry toxin after exposure has stopped and gut contents eliminated. Bioaccumulation can be demonstrated by showing uptake and that the concentration of Cry toxin in the natural enemy exceeds that in its food. We exposed larvae of the aphidophagous predator, Harmonia axyridis, to Cry1Ac and Cry1F through uniform and constant tritrophic exposure via an aphid, Myzus persicae, and looked for toxin presence in the pupae. We repeated the experiment using only Cry1F and tested newly emerged adults. Both Cry toxins were detected in pupae, and Cry1F was detected in recently emerged, unfed adults. Cry1Ac was present 2.05 times and Cry1F 3.09 times higher in predator pupae than in the aphid prey. Uptake and bioaccumulation in the third trophic level might increase the persistence of Cry toxins in the food web and mediate new exposure routes to natural enemies. - Highlights: • Uptake and bioaccumulation of two Cry toxins by a larval coccinellid was tested. • Uptake was demonstrated by presence of the toxins in pupae and adults. • Bioaccumulation was shown by higher toxin concentration in pupae than prey. • Cry1Ac was present 2.05× and Cry1F 3.09× higher in predator pupae than prey. • This might increase persistence of Cry toxins in food webs with new exposure routes. - Immatures of the predaceous coccinellid Harmonia axyridis can uptake and bioaccumulate Cry toxins delivered via their aphid prey.

  11. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  12. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  13. Recombinant Bacillus thuringiensis subsp. kurstaki HD73 strain that synthesizes Cry1Ac and chimeric ChiA74∆sp chitinase inclusions.

    Science.gov (United States)

    González-Ponce, Karen S; Casados-Vázquez, Luz E; Salcedo-Hernández, Rubén; Bideshi, Dennis K; Del Rincón-Castro, María C; Barboza-Corona, José E

    2017-05-01

    In this study, the endochitinase chiA74 gene lacking its secretion signal peptide sequence (chiA74∆sp) was fused in frame with the sequence coding for the C-terminal crystallization domain and transcription terminator of cry1Ac. The chimeric gene was expressed under the strong pcytA-p/STAB-SD promoter system in an acrystalliferous Cry - B strain of Bacillus thuringiensis and B. thuringiensis subsp. kurstaki HD73. We showed that the chimeric ChiA74∆sp produced amorphous inclusions in both Cry - B and HD73. In addition to the amorphous inclusions putatively composed of the chimera, bipyramidal Cry1Ac crystals, smaller than the wild-type crystal, were observed in recombinant HD73, and chitinase activity was remarkably higher (75-fold) in this strain when compared with parental HD73. Moreover, we observed that lyophilized samples of a mixture containing Cry1Ac, amorphous inclusions, and spores maintained chitinase activity. Amorphous inclusions could not be separated from Cry1Ac crystals by sucrose gradient centrifugation. Interestingly, the chitinase activity of purified Cry1Ac/amorphous inclusions was 51-fold higher compared to purified Cry1Ac inclusions of parental HD73, indicating that the increased enzymatic activity was due primarily to the presence of the atypical amorphous component. The possibility that the chimera is occluded with the Cry1Ac crystal, thereby contributing to the increased endochitinolytic activity, cannot be excluded. Finally, bioassays against larvae of Spodoptera frugiperda with spore/crystals of HD73 or spore-crystal ChiA74∆sp chimeric inclusions of recombinant HD73 strain showed LC 50 s of 396.86 and 290.25 ng/cm 2 , respectively. Our study suggests a possible practical application of the chimera in formulations of B. thuringiensis-based lepidopteran larvicides.

  14. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  15. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  16. Coping with Crying in Babies and Toddlers

    Science.gov (United States)

    High, Pamela

    2012-01-01

    Pamela High, MS, MD, co-director of the Infant Behavior, Cry and Sleep Clinic at the Brown Center for the Study of Children at Risk, discusses the phenomena of infant crying and the impact it has on families. In most cases, infant crying will peak and resolve in the early months, but infant irritability can increase the risk of maternal…

  17. Toxicological, Biochemical, and Histopathological Analyses Demonstrating That Cry1C and Cry2A Are Not Toxic to Larvae of the Honeybee, Apis mellifera.

    Science.gov (United States)

    Wang, Yuan-Yuan; Li, Yun-He; Huang, Zachary Y; Chen, Xiu-Ping; Romeis, Jörg; Dai, Ping-Li; Peng, Yu-Fa

    2015-07-15

    The honey bee, Apis mellifera, is commonly used as a test species for the regulatory risk assessment of insect-resistant genetically engineered (IRGE) plants. In the current study, a dietary exposure assay was developed, validated, and used to assess the potential toxicity of Cry1C and Cry2A proteins from Bacillus thuringiensis (Bt) to A. mellifera larvae; Cry1C and Cry2A are produced by different IRGE crops. The assay, which uses the soybean trypsin inhibitor (SBTI) as a positive control and bovine serum albumin (BSA) as a negative control, was used to measure the responses of A. mellifera larvae to high concentrations of Cry1C and Cry2A. Survival was reduced and development was delayed when larvae were fed SBTI (1 mg/g diet) but were unaffected when larvae were fed BSA (400 μg/g), Cry1C (50 μg/g), or Cry2A (400 μg/g). The enzymatic activities of A. mellifera larvae were not altered and their midgut brush border membranes (BBMs) were not damaged after being fed with diets containing BSA, Cry1C, or Cry2A; however, enzymatic activities were increased and BBMs were damaged when diets contained SBTI. The study confirms that Cry1C and Cry2A have no acute toxicity to A. mellifera larvae at concentrations >10 times higher than those detected in pollen from Bt plants.

  18. Baby please stop crying: an experimental approach to infant crying, affect, and expected parenting self-efficacy

    NARCIS (Netherlands)

    de Cock, E.S.A.; Henrichs, J.; Rijk, C.H.A.M.; van Bakel, H.J.A.

    2015-01-01

    Objective: The present study examines the effect of infant crying on parental affect, state anxiety and parenting self-efficacy in an experimental setting. Background: Infant crying causes distress and feelings of incompetence in many parents. These frustrating parental feelings can lead to

  19. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  20. Segmentation of expiratory and inspiratory sounds in baby cry audio recordings using hidden Markov models.

    Science.gov (United States)

    Aucouturier, Jean-Julien; Nonaka, Yulri; Katahira, Kentaro; Okanoya, Kazuo

    2011-11-01

    The paper describes an application of machine learning techniques to identify expiratory and inspiration phases from the audio recording of human baby cries. Crying episodes were recorded from 14 infants, spanning four vocalization contexts in their first 12 months of age; recordings from three individuals were annotated manually to identify expiratory and inspiratory sounds and used as training examples to segment automatically the recordings of the other 11 individuals. The proposed algorithm uses a hidden Markov model architecture, in which state likelihoods are estimated either with Gaussian mixture models or by converting the classification decisions of a support vector machine. The algorithm yields up to 95% classification precision (86% average), and its ability generalizes over different babies, different ages, and vocalization contexts. The technique offers an opportunity to quantify expiration duration, count the crying rate, and other time-related characteristics of baby crying for screening, diagnosis, and research purposes over large populations of infants.

  1. Crying and Mood Change : a Cross-Cultural Study

    NARCIS (Netherlands)

    Becht, M.C.; Vingerhoets, A.J.J.M.

    2002-01-01

    This study was designed to determine the influence of crying-related variables and country characteristics on mood change after crying. It was hypothesized that mood improvement would be positively associated to crying frequency, Individualism-Collectivism, and the extent of gender empowerment in a

  2. CRY Drives Cyclic CK2-Mediated BMAL1 Phosphorylation to Control the Mammalian Circadian Clock.

    Directory of Open Access Journals (Sweden)

    Teruya Tamaru

    Full Text Available Intracellular circadian clocks, composed of clock genes that act in transcription-translation feedback loops, drive global rhythmic expression of the mammalian transcriptome and allow an organism to anticipate to the momentum of the day. Using a novel clock-perturbing peptide, we established a pivotal role for casein kinase (CK-2-mediated circadian BMAL1-Ser90 phosphorylation (BMAL1-P in regulating central and peripheral core clocks. Subsequent analysis of the underlying mechanism showed a novel role of CRY as a repressor for protein kinase. Co-immunoprecipitation experiments and real-time monitoring of protein-protein interactions revealed that CRY-mediated periodic binding of CK2β to BMAL1 inhibits BMAL1-Ser90 phosphorylation by CK2α. The FAD binding domain of CRY1, two C-terminal BMAL1 domains, and particularly BMAL1-Lys537 acetylation/deacetylation by CLOCK/SIRT1, were shown to be critical for CRY-mediated BMAL1-CK2β binding. Reciprocally, BMAL1-Ser90 phosphorylation is prerequisite for BMAL1-Lys537 acetylation. We propose a dual negative-feedback model in which a CRY-dependent CK2-driven posttranslational BMAL1-P-BMAL1 loop is an integral part of the core clock oscillator.

  3. Isolation and characterization of Bacillus thuringiensis from soils in ...

    African Journals Online (AJOL)

    Bioassays were used to test the insecticidal activity of B. thuringiensis strains ... of crystal protein genes, 7 tested positive for cry 4, cry 11, and cyt toxin genes. ... mosquitocidal cry and cyt genes in Bacillus thuringiensis subsp. israelensis.

  4. Laughter, crying and sadness in ALS.

    Science.gov (United States)

    Thakore, Nimish J; Pioro, Erik P

    2017-10-01

    Pseudobulbar affect (PBA) is prevalent in amyotrophic lateral sclerosis (ALS), but there is limited information on its associations and course. Explore prevalence, associations, course and manifestations of PBA in outpatient cohort of patients with ALS and examine its relationship to depression. Self-reported measures of PBA and depression (Center for Neurologic Study-Lability Scale (CNS-LS) and Patient Health Questionnaire (PHQ-9), respectively) were obtained from consecutive patients with ALS using tablet devices in waiting rooms (Knowledge Program). PBA (CNS-LS ≥13) was seen in 209/735 patients (28.4%). PBA was associated with bulbar onset and dysfunction, upper motor neuron dysfunction, cognitive impairment, depression and lower quality of life. A multivariable model that included lower bulbar and gross motor subscores, female gender, younger age and shorter duration of disease predicted PBA with 74% accuracy. CNS-LS scores increased only slowly with time. Women with PBA reported more crying than men. Crying (but not laughter) correlated with depression, and crying was associated with poorer quality of life. Exploratory factor analysis of pooled questions of CNS-LS and PHQ-9 identified three underlying factors (laughter, crying and depression) loaded on appropriate questions of the respective instruments. This study identifies associations of PBA and additionally finds PBA (especially crying-predominant PBA) more prevalent in women with ALS. Although the two self-report instruments (CNS-LS and PHQ-9) discriminate well between PBA and depression, there is significant overlap between depression and crying in PBA. Studies of PBA should stratify for gender, examine crying and laughter as separate outcomes and adjust for depression. © Article author(s) (or their employer(s) unless otherwise stated in the text of the article) 2017. All rights reserved. No commercial use is permitted unless otherwise expressly granted.

  5. Caregiving and early infant crying in a danish community.

    Science.gov (United States)

    Alvarez, Marissa

    2004-04-01

    Maternal caregiving and fussing/crying in Danish infants at 3, 6, and 12 weeks were examined using self-report scales and 24-hour behavior diaries. Mothers reported practices commonly associated with responsive caregiving: frequent feeding, prompt response to infant cries, and considerable time holding the infant. Fuss/cry durations peaked in the first 2 months, were highest in evenings, and decreased approximately 50% by 12 weeks. Fussing was the majority behavior, and 9.2% of the infants fussed and cried more than 3 hours per day. In contrast with other Western studies, 24-hour fuss/cry durations were lower, and fussing accounted for up to 80% of total distress. Danish caregiving practices may partially explain the lower durations of infant distress and the lower ratio of cry to fuss. However, some infants fuss/cry a great deal despite sensitive care, which may reflect individual differences in infant maturation of behavior regulation.

  6. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  7. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  8. Characterization of Baculovirus Insecticides Expressing Tailored Bacillus thuringiensis CryIA(b) Crystal Proteins

    NARCIS (Netherlands)

    Martens, John W M; Knoester, Marga; Weijts, Franci; Groffen, Sander J A; Hu, Zhihong; Bosch, Dirk; Vlak, Just M.

    1995-01-01

    Full-length, truncated, and mature forms of the CryIA(b) insecticidal crystal protein gene of Bacillus thuringiensis were engineered into the p10 locus of Autographa californica nuclear polyhedrosis virus (AcNPV). A signal sequence of Heliothis virescens juvenile hormone esterase was introduced at

  9. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  10. RiArsB and RiMT-11: Two novel genes induced by arsenate in arbuscular mycorrhiza.

    Science.gov (United States)

    Maldonado-Mendoza, Ignacio E; Harrison, Maria J

    Plants associated with arbuscular mycorrhizal fungi (AMF) increase their tolerance to arsenic-polluted soils. This study aims to investigate the genes involved in the AMF molecular response to arsenic pollution. Genes encoding proteins involved in arsenic metabolism were identified and their expression assessed by PCR or RT-qPCR. The As-inducible gene GiArsA (R. irregularis ABC ATPase component of the ArsAB arsenite efflux pump) and two new genes, an arsenate/arsenite permease component of ArsAB (RiArsB) and a methyltransferase type 11 (RiMT-11) were induced when arsenate was added to two-compartment in vitro monoxenic cultures of R. irregularis-transformed carrot roots. RiArsB and RiMT-11 expression in extraradical hyphae in response to arsenate displayed maximum induction 4-6 h after addition of 350 μM arsenate. Their expression was also detected in colonized root tissues grown in pots, or in the root-fungus compartment of two-compartment in vitro systems. We used a Medicago truncatula double mutant (mtpt4/mtpt8) to demonstrate that RiMT-11 and RiArsB transcripts accumulate in response to the addition of arsenate but not in response to phosphate. These results suggest that these genes respond to arsenate addition regardless of non-functional Pi symbiotic transport, and that RiMT-11 may be involved in arsenate detoxification by methylation in AMF-colonized tissues. Copyright © 2017 British Mycological Society. All rights reserved.

  11. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  12. Response Cries.

    Science.gov (United States)

    Goffman, Erving

    1978-01-01

    Considers utterances that appear to violate the interdependence assumed by the interactionist view, entering the stream of behavior at peculiar and unnatural places, producing communicative effects but no dialogue. Self-talk, imprecations, and response cries are discussed. (EJS)

  13. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  14. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  15. Cloning and characterization of a potato StAN11 gene involved in anthocyanin biosynthesis regulation.

    Science.gov (United States)

    Li, Wang; Wang, Bing; Wang, Man; Chen, Min; Yin, Jing-Ming; Kaleri, Ghullam Murtaza; Zhang, Rui-Jie; Zuo, Tie-Niu; You, Xiong; Yang, Qing

    2014-04-01

    Anthocyanins are a class of products of plant secondary metabolism and are responsible for tubers color in potato. The biosynthesis of anthocyanins is a complex biological process, in which multiple genes are involved including structural genes and regulatory genes. In this study, StAN11, a WD40-repeat gene, was cloned from potato cultivar Chieftain (Solanum tuberosum L.). StAN11 (HQ599506) contained no intron and its open reading frame (ORF) was 1,029 bp long, encoding a putative protein of 342 amino acids. In order to verify its role in anthocyanin biosynthesis, StAN11 was inserted behind the CaMV-35S promoter of pCMBIA1304 and the recombination vector was introduced into the potato cultivar Désirée plants by Agrobacterium-mediated transformation. The color of transgenic tuber skin was significantly deepened, compared to the wild-type control, which was highly consistent with the accumulation of anthocyanin and expression of StAN11 in transgenic lines tuber skin. Further analysis on the expression of Flavonone-3-hydroxylase (F3H), Dihydroflavonol reductase (DFR), Anthocyanidin synthase (ANS), and Flavonoid 3-O-glucosyl transferase (3GT) in transgenic plants revealed that only DFR was upregulated. This result suggested that StAN11 regulated anthocyanin biosynthesis in potato by controlling DFR expression and accumulation of anthocyanin could be increased through overexpression of StAN11 in the tubers with the genetic background of anthocyanin biosynthesis. © 2013 Institute of Botany, Chinese Academy of Sciences.

  16. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  17. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  18. Doctors do cry.

    Science.gov (United States)

    Pruthi, Sonal; Goel, Ashish

    2014-01-01

    Physicians have tried to understand whether crying for a patient is a raw emotion that demonstrates their lack of control over themselves and the situation, or whether it is a sign of humanity and concern for one's fellow beings. Studies on medical students and doctors'narrations of times when they have shed tears over a patient's suffering or death have established beyond doubt that medical students and physicians are not immune to their patients'suffering and may cry when overwhelmed by stress and emotions. Even though humanity is the cornerstone of medicine, depersonalisation has somehow crept into the physician-patient relationship and crying is considered incompatible with the image of a good physician, who is supposed to be strong, confident and fully in charge. Thus, crying has been equated to weakness and at times, incompetence. This could be attributed to the fact that our medical curriculum has ingrained in us the belief that emotion clouds rationality and prevents us from being objective while making decisions regarding a patient's clinical progress. Our curriculum fails to teach us how to handle emotional situations, witness the dying process, communicate bad news, interact with the bereaved during the period of grief immediately following death, and reduce the professional stress involved in working with newly bereaved persons. Our training focuses on cure, amelioration of disease and the restoration of good health, with little emphasis on death, which is an absolute reality. It is crucial that medical educators take note of these lacunae in the curriculum. Physicians and teachers must recognise and accept the emotions that medical students experience in these situations, and teach them to offer their patients a sound blend of rationality and compassion with an attitude of humility.

  19. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  20. Unraveling flp-11/flp-32 dichotomy in nematodes.

    Science.gov (United States)

    Atkinson, Louise E; Miskelly, Iain R; Moffett, Christy L; McCoy, Ciaran J; Maule, Aaron G; Marks, Nikki J; Mousley, Angela

    2016-10-01

    FMRFamide-like peptide (FLP) signalling systems are core to nematode neuromuscular function. Novel drug discovery efforts associated with nematode FLP/FLP receptor biology are advanced through the accumulation of basic biological data that can reveal subtle complexities within the neuropeptidergic system. This study reports the characterisation of FMRFamide-like peptide encoding gene-11 (flp-11) and FMRFamide-like peptide encoding gene-32 (flp-32), two distinct flp genes which encode the analogous peptide, AMRN(A/S)LVRFamide, in multiple nematode species - the only known example of this phenomenon within the FLPergic system of nematodes. Using bioinformatics, in situ hybridisation, immunocytochemistry and behavioural assays we show that: (i) flp-11 and -32 are distinct flp genes expressed individually or in tandem across multiple nematode species, where they encode a highly similar peptide; (ii) flp-11 does not appear to be the most widely expressed flp in Caenorhabditis elegans; (iii) in species expressing both flp-11 and flp-32, flp-11 displays a conserved, restricted expression pattern across nematode clades and lifestyles; (iv) in species expressing both flp-11 and flp-32, flp-32 expression is more widespread and less conserved than flp-11; (v) in species expressing only flp-11, the flp-11 expression profile is more similar to the flp-32 profile observed in species expressing both; and (vi) FLP-11 peptides inhibit motor function in multiple nematode species. The biological significance and evolutionary origin of flp-11 and -32 peptide duplication remains unclear despite attempts to identify a common ancestor; this may become clearer as the availability of genomic data improves. This work provides insight into the complexity of the neuropeptidergic system in nematodes, and begins to examine how nematodes may compensate for structural neuronal simplicity. From a parasite control standpoint, this work underscores the importance of basic biological data, and has

  1. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  2. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  3. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  4. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  5. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  6. Keefektivan padi transgenik terhadap hama penggerek batang padi kuning Scirpophaga incertulas (Walker (Lepidoptera: Crambidae

    Directory of Open Access Journals (Sweden)

    N. Usyati

    2016-12-01

    Full Text Available Transformation two cry genes (cryIB-cryIAa and transformation with a single the cry1B gene under the control of a wound-inducible maize proteinase inhibitor gene (mpi promoter were two approaches that were used to get resistant rice to the rice stemborer which may be had a durable resistance. To obtain information on the effectiveness of seven transgenic rice lines to the rice yellow stemborer S. incertulas, a test was conducted in greenhouse. The seven lines were 1. line 4.2.3 and 2 line 4.2.4 both contain fusion of two cry genes (cryIB-cryIAa; 3 line 3R9 and 4 line 3R7 lines both contain of mpi-cryIB gene; and 5 line 6.11 contains of cryIAb gene by particle bombardment, 6 line DT-cry (Azygous that do not contain cry gene (null, and 7 DT-cry line contains cryIAb gene by Agrobacterium, and as a negative control, we used three non transgenic rice varieties i.e., Rojolele, Cilosari, and Ciherang. The result showed that transgenic rice lines, except DT-cry and DT-cry (Azygous lines were effective to suppress damage by the insect, and showed an inhibition effect on the growth of S. incertulas, and had a high level ofresistance than non transgenic rice varieties had. There were differences on resistance value/level among transgenic rice lines. Based on the resistance value, 6.11 line was the highest followed by 4.2.4 line and 3R7 line, these lines were categorized as high resistance. Transgenic rice-4.2.3 line and 3R9 line were categorized as moderat resistance. DT-cry and DT-cry (Azygous lines were susceptible.

  7. Sequence of a cloned cDNA encoding human ribosomal protein S11

    Energy Technology Data Exchange (ETDEWEB)

    Lott, J B; Mackie, G A

    1988-02-11

    The authors have isolated a cloned cDNA that encodes human ribosomal protein (rp) S11 by screening a human fibroblast cDNA library with a labelled 204 bp DNA fragment encompassing residues 212-416 of pRS11, a rat rp Sll cDNA clone. The human rp S11 cloned cDNA consists of 15 residues of the 5' leader, the entire coding sequence and all 51 residues of the 3' untranslated region. The predicted amino acid sequence of 158 residues is identical to rat rpS11. The nucleotide sequence in the coding region differs, however, from that in rat in the first position in two codons and in the third position in 44 codons.

  8. Comparative analysis of the genetic basis of Cry1F resistance in two strains of Spodoptera frugiperda originated from Puerto Rico and Florida.

    Science.gov (United States)

    Camargo, Ana M; Castañera, Pedro; Farinós, Gema P; Huang, Fangneng

    2017-06-01

    The fall armyworm, Spodoptera frugiperda (J.E. Smith), is a major target pest of Bacillus thuringiensis (Bt) maize and cotton in America. Since the commercialization of Cry1F maize (event TC1507) in 2003, resistance to Cry1F maize in field populations of S. frugiperda has occurred in Puerto Rico, Brazil and the southeast region of the United States. In this paper, we conducted a comparative analysis of the inheritance of two Cry1F-resistant colonies of S. frugiperda originated from Puerto Rico (PR) and Florida (FL), respectively. The objective of the analysis was to determine if the genetic basis of the resistance was similar in the two different originated colonies. To accomplish the objective, besides PR, FL, and a known Cry1F-susceptible colony, 14 additional colonies were developed by reciprocal crosses among the three parents, F 1 by F 1 crosses, backcrosses, and intercolony-crosses between PR and FL. Larval mortalities of the 17 colonies were assayed on both Cry1F maize leaf tissue and Cry1F-treated diet at the concentrations of 3.16, 10.00, and 31.60µg/g. Resistance to Cry1F in both PR and FL was autosomal and recessive or incompletely recessive. Segregations in F 2 and backcrossed generations associated with FL fitted the Mendelian monogenic model well, while with PR the segregations did not follow the single gene model in some bioassays. Further analyses with the intercolony complementation tests showed a similar level of resistance in the F 1 progeny as their parents FL and PR. Together with the data, it was likely that a single (or a few tightly-linked) gene was involved in FL; PR shared the same locus of the major resistance gene as FL, but the resistance in PR might also be associated with additional minor factors. Information generated from this study should be useful in understanding the origin of Cry1F resistance in the U.S. mainland and developing effective strategies for Bt resistance management in S. frugiperda. Copyright © 2017 Elsevier Inc

  9. Existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot

    Science.gov (United States)

    Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza

    2016-01-01

    Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570

  10. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  11. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  12. Hyperactivity of the Arabidopsis cryptochrome (cry1) L407F mutant is caused by a structural alteration close to the cry1 ATP-binding site.

    Science.gov (United States)

    Orth, Christian; Niemann, Nils; Hennig, Lars; Essen, Lars-Oliver; Batschauer, Alfred

    2017-08-04

    Plant cryptochromes (cry) act as UV-A/blue light receptors. The prototype, Arabidopsis thaliana cry1, regulates several light responses during the life cycle, including de-etiolation, and is also involved in regulating flowering time. The cry1 photocycle is initiated by light absorption by its FAD chromophore, which is most likely fully oxidized (FAD ox ) in the dark state and photoreduced to the neutral flavin semiquinone (FADH°) in its lit state. Cryptochromes lack the DNA-repair activity of the closely related DNA photolyases, but they retain the ability to bind nucleotides such as ATP. The previously characterized L407F mutant allele of Arabidopsis cry1 is biologically hyperactive and seems to mimic the ATP-bound state of cry1, but the reason for this phenotypic change is unclear. Here, we show that cry1 L407F can still bind ATP, has less pronounced photoreduction and formation of FADH° than wild-type cry1, and has a dark reversion rate 1.7 times lower than that of the wild type. The hyperactivity of cry1 L407F is not related to a higher FADH° occupancy of the photoreceptor but is caused by a structural alteration close to the ATP-binding site. Moreover, we show that ATP binds to cry1 in both the dark and the lit states. This binding was not affected by cry1's C-terminal extension, which is important for signal transduction. Finally, we show that a recently discovered chemical inhibitor of cry1, 3-bromo-7-nitroindazole, competes for ATP binding and thereby diminishes FADH° formation, which demonstrates that both processes are important for cry1 function. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  13. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  14. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  15. Functional characterization of MAT1-1-specific mating-type genes in the homothallic ascomycete Sordaria macrospora provides new insights into essential and nonessential sexual regulators.

    Science.gov (United States)

    Klix, V; Nowrousian, M; Ringelberg, C; Loros, J J; Dunlap, J C; Pöggeler, S

    2010-06-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the alpha domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes.

  16. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  17. Transcriptional analysis of the multicopy hao gene coding for hydroxylamine oxidoreductase in Nitrosomonas sp. strain ENI-11.

    Science.gov (United States)

    Hirota, Ryuichi; Kuroda, Akio; Ikeda, Tsukasa; Takiguchi, Noboru; Ohtake, Hisao; Kato, Junichi

    2006-08-01

    The nitrifying bacterium Nitrosomonas sp. strain ENI-11 has three copies of the gene encoding hydroxylamine oxidoreductase (hao(1), hao(2), and hao(3)) on its genome. Broad-host-range reporter plasmids containing transcriptional fusion genes between hao copies and lacZ were constructed to analyze the expression of each hydroxylamine oxidoreductase gene (hao) copy individually and quantitatively. beta-Galactosidase assays of ENI-11 harboring reporter plasmids revealed that all hao copies were transcribed in the wild-type strain. Promoter analysis of hao copies revealed that transcription of hao(3) was highest among the hao copies. Expression levels of hao(1) and hao(2) were 40% and 62% of that of hao(3) respectively. Transcription of hao(1) was negatively regulated, whereas a portion of hao(3) transcription was read through transcription from the rpsT promoter. When energy-depleted cells were incubated in the growth medium, only hao(3) expression increased. This result suggests that it is hao(3) that is responsible for recovery from energy-depleted conditions in Nitrosomonas sp. strain ENI-11.

  18. Polymorphisms of genes encoding P2X7R, IL-1B, OPG and RANK in orthodontic-induced apical root resorption.

    Science.gov (United States)

    Pereira, S; Lavado, N; Nogueira, L; Lopez, M; Abreu, J; Silva, H

    2014-10-01

    Orthodontic-induced external apical root resorption (EARR) is a complex phenotype determined by poorly defined mechanical and patient intrinsic factors. The aim of this work was to construct a multifactorial integrative model, including clinical and genetic susceptibility factors, to analyze the risk of developing this common orthodontic complication. This retrospective study included 195 orthodontic patients. Using a multiple-linear regression model, where the dependent variable was the maximum% of root resorption (%EARRmax) for each patient, we assessed the contribution of nine clinical variables and four polymorphisms of genes involved in bone and tooth root remodeling (rs1718119 from P2RX7, rs1143634 from IL1B, rs3102735 from TNFRSF11B, encoding OPG, and rs1805034 from TNFRSF11A, encoding RANK). Clinical and genetic variables explained 30% of%EARRmax variability. The variables with the most significant unique contribution to the model were: gender (P < 0.05), treatment duration (P < 0.001), premolar extractions (P < 0.01), Hyrax appliance (P < 0.001) and GG genotype of rs1718119 from P2RX7 gene (P < 0.01). Age, overjet, tongue thrust, skeletal class II and the other polymorphisms made minor contributions. This study highlights the P2RX7 gene as a possible factor of susceptibility to EARR. A more extensive genetic profile may improve this model. © 2013 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  19. Cry, Baby, Cry: Expression of Distress As a Biomarker and Modulator in Autism Spectrum Disorder

    Science.gov (United States)

    Hiroi, Noboru; Scattoni, Maria Luisa

    2017-01-01

    Abstract Background: Early diagnosis of autism spectrum disorder is critical, because early intensive treatment greatly improves its prognosis. Methods: We review studies that examined vocalizations of infants with autism spectrum disorder and mouse models of autism spectrum disorder as a potential means to identify autism spectrum disorder before the symptomatic elements of autism spectrum disorder emerge. We further discuss clinical implications and future research priorities in the field. Results: Atypical early vocal calls (i.e., cry) may represent an early biomarker for autism spectrum disorder (or at least for a subgroup of children with autism spectrum disorder), and thus can assist with early detection. Moreover, cry is likely more than an early biomarker of autism spectrum disorder; it is also an early causative factor in the development of the disorder. Specifically, atypical crying, as recently suggested, might induce a “self-generated environmental factor” that in turn, influences the prognosis of the disorder. Because atypical crying in autism spectrum disorder is difficult to understand, it may have a negative impact on the quality of care by the caregiver (see graphical abstract). Conclusions: Evidence supports the hypothesis that atypical vocalization is an early, functionally integral component of autism spectrum disorder. PMID:28204487

  20. Application of six multiplex PCR's among 200 clinical isolates of Pseudomonas aeruginosa for the detection of 20 drug resistance encoding genes

    Directory of Open Access Journals (Sweden)

    Nandagopal Murugan

    2018-02-01

    Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.

  1. Characterization of Asian Corn Borer Resistance to Bt Toxin Cry1Ie

    Directory of Open Access Journals (Sweden)

    Yueqin Wang

    2017-06-01

    Full Text Available A strain of the Asian corn borer (ACB, Ostrinia furnacalis (Guenée, has evolved >800-fold resistance to Cry1Ie (ACB-IeR after 49 generations of selection. The inheritance pattern of resistance to Cry1Ie in ACB-IeR strain and its cross-resistance to other Bt toxins were determined through bioassay by exposing neonates from genetic-crosses to toxins incorporated into the diet. The response of progenies from reciprocal F1 crosses were similar (LC50s: 76.07 vs. 74.32 μg/g, which suggested the resistance was autosomal. The effective dominance (h decreased as concentration of Cry1Ie increased. h was nearly recessive or incompletely recessive on Cry1Ie maize leaf tissue (h = 0.02, but nearly dominant or incompletely dominant (h = 0.98 on Cry1Ie maize silk. Bioassay of the backcross suggested that the resistance was controlled by more than one locus. In addition, the resistant strain did not perform cross-resistance to Cry1Ab (0.8-fold, Cry1Ac (0.8-fold, Cry1F (0.9-fold, and Cry1Ah (1.0-fold. The present study not only offers the manifestation for resistance management, but also recommends that Cry1Ie will be an appropriate candidate for expression with Cry1Ab, Cry1Ac, Cry1F, or Cry1Ah for the development of Bt maize.

  2. Characterization of Asian Corn Borer Resistance to Bt Toxin Cry1Ie.

    Science.gov (United States)

    Wang, Yueqin; Yang, Jing; Quan, Yudong; Wang, Zhenying; Cai, Wanzhi; He, Kanglai

    2017-06-07

    A strain of the Asian corn borer (ACB), Ostrinia furnacalis (Guenée), has evolved >800-fold resistance to Cry1Ie (ACB-IeR) after 49 generations of selection. The inheritance pattern of resistance to Cry1Ie in ACB-IeR strain and its cross-resistance to other Bt toxins were determined through bioassay by exposing neonates from genetic-crosses to toxins incorporated into the diet. The response of progenies from reciprocal F₁ crosses were similar (LC 50 s: 76.07 vs. 74.32 μg/g), which suggested the resistance was autosomal. The effective dominance ( h ) decreased as concentration of Cry1Ie increased. h was nearly recessive or incompletely recessive on Cry1Ie maize leaf tissue ( h = 0.02), but nearly dominant or incompletely dominant ( h = 0.98) on Cry1Ie maize silk. Bioassay of the backcross suggested that the resistance was controlled by more than one locus. In addition, the resistant strain did not perform cross-resistance to Cry1Ab (0.8-fold), Cry1Ac (0.8-fold), Cry1F (0.9-fold), and Cry1Ah (1.0-fold). The present study not only offers the manifestation for resistance management, but also recommends that Cry1Ie will be an appropriate candidate for expression with Cry1Ab, Cry1Ac, Cry1F, or Cry1Ah for the development of Bt maize.

  3. Brain stem hypoplasia associated with Cri-du-Chat syndrome

    Energy Technology Data Exchange (ETDEWEB)

    Hong, Jin Ho; Lee, Ha Young; Lim, Myung Kwan; Kim, Mi Young; Kang, Young Hye; Lee, Kyung Hee; Cho, Soon Gu [Dept. of Radiology, Inha University Hospital, Inha University School of Medicine, Incheon (Korea, Republic of)

    2013-12-15

    Cri-du-Chat syndrome, also called the 5p-syndrome, is a rare genetic abnormality, and only few cases have been reported on its brain MRI findings. We describe the magnetic resonance imaging findings of a 1-year-old girl with Cri-du-Chat syndrome who showed brain stem hypoplasia, particularly in the pons, with normal cerebellum and diffuse hypoplasia of the cerebral hemispheres. We suggest that Cri-du-Chat syndrome chould be suspected in children with brain stem hypoplasia, particularly for those with high-pitched cries.

  4. Sex stereotypes influence adults' perception of babies' cries

    OpenAIRE

    Reby, David; Levréro, Florence; Gustafsson, Erik; Mathevon, Nicolas

    2016-01-01

    Background Despite widespread evidence that gender stereotypes influence human parental behavior, their potential effects on adults? perception of babies? cries have been overlooked. In particular, whether adult listeners overgeneralize the sex dimorphism that characterizes the voice of adult speakers (men are lower-pitched than women) to their perception of babies? cries has not been investigated. Methods We used playback experiments combining natural and re-synthesised cries of 3?month-old ...

  5. Baseline sensitivity of maize borers in India to the Bacillus thuringiensis insecticidal proteins Cry1A.105 and Cry2Ab2.

    Science.gov (United States)

    Jalali, Sushil K; Yadavalli, Lalitha; Ojha, Rakshit; Kumar, Pradyumn; Sulaikhabeevi, Suby B; Sharma, Reema; Nair, Rupa; Kadanur, Ravi C; Kamath, Subray P; Komarlingam, Mohan S

    2015-08-01

    Among the major pests of maize in India are two stem borers, Chilo partellus (Swinhoe) and Sesamia inferens (Walker), and an earworm, Helicoverpa armigera (Hübner). As a pest control strategy, transgenic Bacillus thuringiensis (Bt) maize hybrids are undergoing regulatory trials in India. We have determined the sensitivity of the target lepidopterans to the insecticidal Bt proteins expressed in Bt maize, as this determines product efficacy and the resistance management strategy to be adopted. Maize hybrids with event MON89034 express two insecticidal Bt proteins, Cry1A.105 and Cry2Ab2. Sensitivity profiles of 53 populations of C. partellus, 21 populations of S. inferens and 21 populations of H. armigera, collected between 2008 and 2013 from maize-growing areas in India, to Cry1A.105 and Cry2Ab2 proteins were generated through dose-response assays. Cry1A.105 protein was the most effective to neonates of C. partellus (mean MIC90 range 0.30-1.0 µg mL(-1) ) and H. armigera (mean MIC90 range 0.71-8.22 µg mL(-1) ), whereas Cry2Ab2 (mean MIC90 range 0.65-1.70 µg mL(-1) ) was the most effective to S. inferens. Populations of C. partellus, S. inferens and H. armigera were susceptible to the Bt proteins Cry1A.105 and Cry2Ab2. The Bt sensitivity data will serve as precommercialisation benchmarks for resistance monitoring purposes. © 2014 Society of Chemical Industry.

  6. Establishment of a sensitive time-resolved fluoroimmunoassay for detection of Bacillus thuringiensis Cry1Ie toxin based nanobody from a phage display library.

    Science.gov (United States)

    Xu, Chongxin; Liu, Xiaoqin; Zhang, Cunzheng; Zhang, Xiao; Zhong, Jianfeng; Liu, Yuan; Hu, Xiaodan; Lin, Manman; Liu, Xianjin

    2017-02-01

    Cry1Ie toxin was an insect-resistant protein used in genetically modified crops (GMC). In this study, a large human VH gene nanobodies phage displayed library was employed to select anti-Cry1Ie toxin antibody by affinity panning. After 5 rounds of panning, total 12 positive monoclonal phage particles were obtained. One of the identified positive phage nanobody was expressed in E.coli BL21 and the purified protein was indicated as a molecular mass of approximately 20 kDa by sodium dodecyl sulfate polyacrylamide gel electrophoresis (SDS-PAGE). Then a sensitive indirect competitive time-resolved fluoroimmunoassay (IC-TRFIA) was established for detection of Cry1Ie toxin by the purified protein. The working range of detection for Cry1Ie toxin standards in the IC-TRFIA were 0.08-6.44 ng mL -1 and the medium inhibition of control (IC 50 ) was 0.73 ng mL -1 . It showed a weak cross-reactivity with Cry1Ab toxin (at 5.6%), but did not recognize Cry1B, Cry1C, Cry1F, and Cry2A toxins (were <0.1%). The average recoveries of Cry1Ie toxin from respectively spiked in rice, corn and soil samples were in the range of 83.5%-96.6% and with a coefficient of variation (CV) among 2.0%-8.6%. These results showed the IC-TRFIA was promising for detection of Cry1Ie toxin in agricultural and environmental samples. Copyright © 2016 Elsevier Inc. All rights reserved.

  7. Nitrogen Rate Effects on Cry3Bb1 and Cry3Bb1 + Cry34/35Ab1 Expression in Transgenic Corn Roots, Resulting Root Injury, and Corn Rootworm Beetle Emergence.

    Science.gov (United States)

    Leaf, T M; Ostlie, K R

    2017-06-01

    Nitrogen (N) application rates have been recommended historically for maximum economic yield of corn (Zea mays L.), but not for optimal expression or impacts of Bt (Bacillus thuringiensis Berliner) Cry protein(s) on target insects. This study explored the need to adjust N rates to optimize expression of corn rootworm-active Bt (Bt-RW) protein(s) in a single and a pyramided trait hybrid and resulting impacts on beetle emergence and root injury, under field conditions. The experiment featured a factorial treatment arrangement in a split-plot randomized complete block design with six N rates as the main plots and three hybrids (MON88017 expressing Cry3Bb1, MON88017 x DAS-59122 expressing Cry3Bb1 + Cry34/35Ab1, and a non-Bt-RW hybrid) as the subplots. Corn roots were sampled at the beginning of, and after, peak larval feeding to determine Bt-expression levels using an enzyme-linked immunosorbent assay. Beetles were collected every 2-3 d during emergence using cut-plant emergence cages. Cry3Bb1 expression was significantly reduced when little or no N was applied. Cry34Ab1 and Cry35Ab1 expression was highly variable and unaffected by N rate. Beetle emergence increased with N rate in the non-Bt-RW hybrid while root injury declined. Provided Bt-RW hybrids had sufficient applied N, root injury was relatively low. Results indicate that N management could affect Bt-RW expression and success of insect resistance management plans provided N is applied at rates that enhance production of susceptible beetles emerging from the non-Bt-RW (refuge) hybrid, and achieve optimal expression and efficacy of Bt traits. © The Authors 2017. Published by Oxford University Press on behalf of Entomological Society of America. All rights reserved. For Permissions, please email: journals.permissions@oup.com.

  8. Molecular basis for vulnerability to mitochondrial and oxidative stress in a neuroendocrine CRI-G1 cell line.

    Directory of Open Access Journals (Sweden)

    Natasha Chandiramani

    2011-01-01

    Full Text Available Many age-associated disorders (including diabetes, cancer, and neurodegenerative diseases are linked to mitochondrial dysfunction, which leads to impaired cellular bioenergetics and increased oxidative stress. However, it is not known what genetic and molecular pathways underlie differential vulnerability to mitochondrial dysfunction observed among different cell types.Starting with an insulinoma cell line as a model for a neuronal/endocrine cell type, we isolated a novel subclonal line (named CRI-G1-RS that was more susceptible to cell death induced by mitochondrial respiratory chain inhibitors than the parental CRI-G1 line (renamed CRI-G1-RR for clarity. Compared to parental RR cells, RS cells were also more vulnerable to direct oxidative stress, but equally vulnerable to mitochondrial uncoupling and less vulnerable to protein kinase inhibition-induced apoptosis. Thus, differential vulnerability to mitochondrial toxins between these two cell types likely reflects differences in their ability to handle metabolically generated reactive oxygen species rather than differences in ATP production/utilization or in downstream apoptotic machinery. Genome-wide gene expression analysis and follow-up biochemical studies revealed that, in this experimental system, increased vulnerability to mitochondrial and oxidative stress was associated with (1 inhibition of ARE/Nrf2/Keap1 antioxidant pathway; (2 decreased expression of antioxidant and phase I/II conjugation enzymes, most of which are Nrf2 transcriptional targets; (3 increased expression of molecular chaperones, many of which are also considered Nrf2 transcriptional targets; (4 increased expression of β cell-specific genes and transcription factors that specify/maintain β cell fate; and (5 reconstitution of glucose-stimulated insulin secretion.The molecular profile presented here will enable identification of individual genes or gene clusters that shape vulnerability to mitochondrial dysfunction and

  9. Bt rice expressing Cry2Aa does not harm Cyrtorhinus lividipennis, a main predator of the nontarget herbivore Nilapavarta lugens.

    Directory of Open Access Journals (Sweden)

    Yu Han

    Full Text Available T2A-1 is a newly developed transgenic rice that expresses a synthesized cry2Aa gene driven by the maize ubiquitin promoter. T2A-1 exhibits high resistance against lepidopteran pests of rice. The brown planthopper, Nilapavarta lugens (Stål, is a main nontarget sap-sucking insect pest of rice, and Cyrtorhinus lividipennis (Reuter is the major predator of the eggs and young nymphs of planthoppers. As C. lividipennis may expose to the Cry2Aa protein via N. lugens, it is therefore essential to assess the potential effects of transgenic cry2Aa rice on this predator. In the present study, three experiments were conducted to evaluate the ecological risk of transgenic cry2Aa rice to C. lividipennis: (1 a direct feeding experiment in which C. lividipennis was fed an artificial diet containing Cry2Aa at the dose of 10-time higher than that it may encounter in the realistic field condition; (2 a tritrophic experiment in which the Cry2Aa protein was delivered to C. lividipennis indirectly through prey eggs or nymphs; (3 a realistic field experiment in which the population dynamics of C. lividipennis were investigated using vacuum-suction. Both direct exposure to elevated doses of the Cry2Aa protein and prey-mediated exposure to realistic doses of the protein did not result in significant detrimental effects on the development, survival, female ratio and body weight of C. lividipennis. No significant differences in population density and population dynamics were observed between C. lividipennis in transgenic cry2Aa and nontransgenic rice fields. It may be concluded that transgenic cry2Aa rice had no detrimental effects on C. lividipennis. This study represents the first report of an assessment continuum for the effects of transgenic cry2Aa rice on C. lividipennis.

  10. Potential factors impacting season-long expression of Cry1Ac in 13 commercial varieties of Bollgard® cotton

    Directory of Open Access Journals (Sweden)

    John J. Adamczyk, Jr.

    2001-11-01

    Full Text Available Thirteen commercial varieties of transgenic Cry1Ac Bacillus thuringiensis Berliner (Bt cotton were examined across two sites in 2000 for potential factors that impact endotoxin expression. In all cases, two varieties (NuCOTN 33B and DP 458B/RR, Delta and Pineland Co., Scott, MS expressed more Cry1Ac than the other 11 varieties in various plant structures. These two varieties share the same parental background (DP 5415. Furthermore, when the next generation of plants were tested in the greenhouse, the same varietal patterns were exhibited. These data strongly suggest that factors such as parental background had a stronger impact on the expression of Cry1Ac than the environment.

  11. Investigations of immunogenic, allergenic and adjuvant properties of Cry1Ab protein after intragastric exposure in a food allergy model in mice.

    Science.gov (United States)

    Andreassen, Monica; Bøhn, Thomas; Wikmark, Odd-Gunnar; Bodin, Johanna; Traavik, Terje; Løvik, Martinus; Nygaard, Unni Cecilie

    2016-05-04

    In genetically modified (GM) crops there is a risk that the inserted genes may introduce new allergens and/or adjuvants into the food and feed chain. The MON810 maize, expressing the insecticidal Cry1Ab toxin, is grown in many countries worldwide. In animal models, intranasal and intraperitoneal immunisations with the purified Cry1Ab proteins have induced immune responses, and feeding trials with Cry1Ab-containing feed have revealed some altered immune responses. Previous investigations have primarily measured antibody responses to the protein, while investigations of clinical food allergy symptoms, or allergy promotion (adjuvant effect) associated with the Cry1Ab protein are largely missing. We aimed to investigate immunogenic, allergenic and adjuvant properties of purified Cry1Ab toxin (trypCry1Ab, i.e., trypsin activated Cry1Ab) in a mouse model of food allergy. Female C3H/HeJ mice were immunized by intragastric gavage of 10 μg purified, trypsin activated Cry1Ab toxin (trypCry1Ab) alone or together with the food allergen lupin. Cholera toxin was added as a positive control for adjuvant effect to break oral tolerance. Clinical symptoms (anaphylaxis) as well as humoral and cellular responses were assessed. In contrast to results from previous airway investigations, we observed no indication of immunogenic properties of trypCry1Ab protein after repeated intragastric exposures to one dose, with or without CT as adjuvant. Moreover, the results indicated that trypCry1Ab given by the intragastric route was not able to promote allergic responses or anaphylactic reactions against the co-administered allergen lupin at the given dose. The study suggests no immunogenic, allergenic or adjuvant capacity of the given dose of trypCry1Ab protein after intragastric exposure of prime aged mice.

  12. THE SEGREGATION PATTERN OF INSECT RESISTANCE GENES IN THE PROGENIES AND CROSSES OF TRANSGENIC ROJOLELE RICE

    Directory of Open Access Journals (Sweden)

    Satoto Satoto

    2016-10-01

    Full Text Available Successful application of genetic transformation technique, especially in developing rice variety resistant to brown plant hopper and stem borer, will depend on transgene being expressed and the gene inherited in a stable and predictable manner. This study aimed to analyse transgene segregation pattern of the progenies and the crosses of transgenic rice cv. Rojolele harboring cry1Ab and gna genes. The third generation (T2 of fivetransgenic Rojolele events containing gna and/or cry1Ab were evaluated for two generations to identify the homozygous lines and to study their inheritance. The homozygous lines were selected based on the result of PCR technique. The segregation patterns of gna and cry1Ab were studied in eight F2 populations derived from Rojolele x transgenic Rojolele homozygous for cry1Ab and or gna and their reciprocal crosses. Data  resulted from PCR of F2 population were analysed using a Chi Square test. The study obtained six homozygous lines for gna, namely A22- 1-32, A22-1-37, C72-1-9, F11-1-48, K21-1-39, K21-1-48, and two homozygous lines for cry1Ab, namely K21-1-39 and K21- 1-48. Both cry1Ab and gna transgenes had been inherited through selfing and crossing with their wild type as indicated from the F1 containing gna and cry1Ab as many as 48.4% and 47.4%, respectively. In six of the eight crosses, gna was inherited in a 3:1 ratio consistent with Mendelian inheritance of a single dominant locus, while in the remaining two crosses, gna was segregated in a 1:1 ratio. The presence of cry1Ab in F2 populations also showed a 3:1 segregation ratio in all crosses. In the F2 population derived from F1 plant containing cry1Ab and gna, both transgenes segregated in a 9:3:3:1 dihybrid segregation ratio. This study will add to the diversity of genetic sources for insect resistance and allow further use of these transgenic lines for pyramiding resistance to brown plant hopper and stem borer or  separately in rice breeding programs whenever

  13. Arabidopsis EMB1990 Encoding a Plastid-Targeted YlmG Protein Is Required for Chloroplast Biogenesis and Embryo Development

    Directory of Open Access Journals (Sweden)

    Hongyu Chen

    2018-02-01

    Full Text Available In higher plants, embryo development originated from fertilized egg cell is the first step of the life cycle. The chloroplast participates in many essential metabolic pathways, and its function is highly associated with embryo development. However, the mechanisms and relevant genetic components by which the chloroplast functions in embryogenesis are largely uncharacterized. In this paper, we describe the Arabidopsis EMB1990 gene, encoding a plastid-targeted YlmG protein which is required for chloroplast biogenesis and embryo development. Loss of the EMB1990/YLMG1-1 resulted in albino seeds containing abortive embryos, and the morphological development of homozygous emb1990 embryos was disrupted after the globular stage. Our results showed that EMB1990/YLMG1-1 was expressed in the primordia and adaxial region of cotyledon during embryogenesis, and the encoded protein was targeted to the chloroplast. TEM observation of cellular ultrastructure showed that chloroplast biogenesis was impaired in emb1990 embryo cells. Expression of certain plastid genes was also affected in the loss-of-function mutants, including genes encoding core protein complex subunits located in the thylakoid membrane. Moreover, the tissue-specific genes of embryo development were misexpressed in emb1990 mutant, including genes known to delineate cell fate decisions in the SAM (shoot apical meristem, cotyledon and hypophysis. Taken together, we propose that the nuclear-encoded YLMG1-1 is targeted to the chloroplast and required for normal plastid gene expression. Hence, YLMG1-1 plays a critical role in Arabidopsis embryogenesis through participating in chloroplast biogenesis.

  14. Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

    International Nuclear Information System (INIS)

    Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

    1989-01-01

    The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

  15. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  16. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  17. Presence and significance of Bacillus thuringiensis Cry proteins associated with the Andean weevil Premnotrypes vorax (Coleoptera: Curculionidae

    Directory of Open Access Journals (Sweden)

    SilvioAlejandro López-Pazos

    2009-12-01

    Full Text Available The Andean weevil Premnotrypes vorax represents an important cause of damage to Colombian potato crops. Due to the impact of this plague on the economy of the country, we searched for new alternatives for its biological control, based on the entomopathogenic bacteria Bacillus thuringiensis. A total of 300 B. thuringiensis strains obtained from potato plantations infested with P. vorax were analyzed through crystal morphology, SDS-PAGE, PCR and bioassays. We used site- directed mutagenesis to modify the Cry3Aa protein. Most of the B. thuringiensis isolates had a bipyramidal crystal morphology. SDS-PAGE analyses had seven strains groups with σ-endotoxins from 35 to 135 kDa. The genes cry 2 and cry 1 were significantly more frequent in the P. vorax habitat (PCR analyses. Three mutant toxins, 1 (D354E, 2 (R345A, ∆Y350, ∆Y351, and 3 (Q482A, S484A, R485A, were analyzed to assess their activity against P. vorax larvae. Toxicity was low, or absent, against P. vorax for isolates, wild type cry 3Aa and cry 3Aa mutants. The genetic characterization of the collection provides opportunities for the selection of strains to be tested in bioassays against other insect pests of agricultural importance, and for designing Cry proteins with improved insecticidal toxicity. Rev. Biol. Trop. 57 (4: 1235-1243. Epub 2009 December 01.El gorgojo andino Premnotrypes vorax es una causa importante de daño en los cultivos colombianos de este tubérculo. Debido al impacto que esta plaga tiene sobre la economía del país, nos interesamos en buscar alternativas nuevas para el control biológico de P. vorax, basadas en la bacteria entomopatógena Bacillus thuringiensis. Se recolectaron un total de 300 cepas de B. thuringiensis a partir de plantaciones de papa infestadas con P. vorax, las cuales fueron analizadas por medio de la morfología del cristal, SDS-PAGE, PCR y ensayos biológicos. La mayoría de los aislamientos de B. thuringiensis presentaron cristales

  18. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  19. Functional Characterization of MAT1-1-Specific Mating-Type Genes in the Homothallic Ascomycete Sordaria macrospora Provides New Insights into Essential and Nonessential Sexual Regulators▿†

    Science.gov (United States)

    Klix, V.; Nowrousian, M.; Ringelberg, C.; Loros, J. J.; Dunlap, J. C.; Pöggeler, S.

    2010-01-01

    Mating-type genes in fungi encode regulators of mating and sexual development. Heterothallic ascomycete species require different sets of mating-type genes to control nonself-recognition and mating of compatible partners of different mating types. Homothallic (self-fertile) species also carry mating-type genes in their genome that are essential for sexual development. To analyze the molecular basis of homothallism and the role of mating-type genes during fruiting-body development, we deleted each of the three genes, SmtA-1 (MAT1-1-1), SmtA-2 (MAT1-1-2), and SmtA-3 (MAT1-1-3), contained in the MAT1-1 part of the mating-type locus of the homothallic ascomycete species Sordaria macrospora. Phenotypic analysis of deletion mutants revealed that the PPF domain protein-encoding gene SmtA-2 is essential for sexual reproduction, whereas the α domain protein-encoding genes SmtA-1 and SmtA-3 play no role in fruiting-body development. By means of cross-species microarray analysis using Neurospora crassa oligonucleotide microarrays hybridized with S. macrospora targets and quantitative real-time PCR, we identified genes expressed under the control of SmtA-1 and SmtA-2. Both genes are involved in the regulation of gene expression, including that of pheromone genes. PMID:20435701

  20. Crying Baby: What to Do When Your Newborn Cries

    Science.gov (United States)

    ... a crying baby — and renewing your ability to handle the tears. By Mayo Clinic Staff The dream: Your baby sleeps through the night after just a few weeks, gurgles happily while you run errands and fusses only when hunger strikes. The reality: Your baby's favorite playtime is after ...

  1. [Eukaryotic expression of Leptospira interrogans lipL32/1-ompL1/1 fusion gene encoding genus-specific protein antigens and the immunoreactivity of expression products].

    Science.gov (United States)

    Yan, Jie; Zhao, Shou-feng; Mao, Ya-fei; Ruan, Ping; Luo, Yi-hui; Li, Shu-ping; Li, Li-wei

    2005-01-01

    To construct the eukaryotic expression system of L.interrogans lipL32/1-ompL1/1 fusion gene and to identify the immunoreactivity of expression products. PCR with linking primer was used to construct the fusion gene lipL32/1-ompL1/1. The P.pastoris eukaryotic expression system of the fusion gene, pPIC9K-lipL32/1-ompL1/1-P. pastorisGS115, was constructed after the fusion gene was cloned and sequenced. Colony with phenotype His(+)Mut(+) was isolated by using MD and MM plates and His(+) Mut(+) transformant with high resistance to G418 was screened out by using YPD plate. Using lysate of His(+) Mut(+) colony with high copies of the target gene digested with yeast lyase as the template and 5'AOX1 and 3'AOX1 as the primers, the target fusion gene in chromosome DNA of the constructed P. pastoris engineering strain was detected by PCR. Methanol in BMMY medium was used to induce the target recombinant protein rLipL32/1-rOmpL1/1 expression. rLipL32/1-rOmpL1/1 in the medium supernatant was extracted by using ammonium sulfate precipitation and Ni-NTA affinity chromatography. Output and immunoreactivity of rLipL32/1-rOmpL1/1 were measured by SDS-PAGE and Western blot methods, respectively. Amplification fragments of the obtained fusion gene lipL32/1-ompL1/1 was 1794 bp in size. The homogeneity of nucleotide and putative amino acid sequences of the fusion gene were as high as 99.94 % and 100 %, respectively, compared with the sequences of original lipL32/1 and ompL1/1 genotypes. The constructed eukaryotic expression system was able to secrete rLipL32/1-rOmpL1/1 with an output of 10 % of the total proteins in the supernatant, which located the expected position after SDS-PAGE. The rabbit anti-rLipL32/1 and anti-rOmpL1/1 sera could combine the expressed rLipL32/1-rOmpL1/1. An eukaryotic expression system with high efficiency in P.pastoris of L.interrogans lipL32/1-ompL1/1 fusion gene was successfully constructed in this study. The expressed fusion protein shows specific

  2. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  3. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  4. Interaction of two photoreceptors in the regulation of bacterial photosynthesis genes.

    Science.gov (United States)

    Metz, Sebastian; Haberzettl, Kerstin; Frühwirth, Sebastian; Teich, Kristin; Hasewinkel, Christian; Klug, Gabriele

    2012-07-01

    The expression of photosynthesis genes in the facultatively photosynthetic bacterium Rhodobacter sphaeroides is controlled by the oxygen tension and by light quantity. Two photoreceptor proteins, AppA and CryB, have been identified in the past, which are involved in this regulation. AppA senses light by its N-terminal BLUF domain, its C-terminal part binds heme and is redox-responsive. Through its interaction to the transcriptional repressor PpsR the AppA photoreceptor controls expression of photosynthesis genes. The cryptochrome-like protein CryB was shown to affect regulation of photosynthesis genes, but the underlying signal chain remained unknown. Here we show that CryB interacts with the C-terminal domain of AppA and modulates the binding of AppA to the transcriptional repressor PpsR in a light-dependent manner. Consequently, binding of the transcription factor PpsR to its DNA target is affected by CryB. In agreement with this, all genes of the PpsR regulon showed altered expression levels in a CryB deletion strain after blue-light illumination. These results elucidate for the first time how a bacterial cryptochrome affects gene expression.

  5. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  6. Genomic Epidemiology of Hypervirulent Serogroup W, ST-11 Neisseria meningitidis.

    Science.gov (United States)

    Mustapha, Mustapha M; Marsh, Jane W; Krauland, Mary G; Fernandez, Jorge O; de Lemos, Ana Paula S; Dunning Hotopp, Julie C; Wang, Xin; Mayer, Leonard W; Lawrence, Jeffrey G; Hiller, N Luisa; Harrison, Lee H

    2015-10-01

    Neisseria meningitidis is a leading bacterial cause of sepsis and meningitis globally with dynamic strain distribution over time. Beginning with an epidemic among Hajj pilgrims in 2000, serogroup W (W) sequence type (ST) 11 emerged as a leading cause of epidemic meningitis in the African 'meningitis belt' and endemic cases in South America, Europe, Middle East and China. Previous genotyping studies were unable to reliably discriminate sporadic W ST-11 strains in circulation since 1970 from the Hajj outbreak strain (Hajj clone). It is also unclear what proportion of more recent W ST-11 disease clusters are caused by direct descendants of the Hajj clone. Whole genome sequences of 270 meningococcal strains isolated from patients with invasive meningococcal disease globally from 1970 to 2013 were compared using whole genome phylogenetic and major antigen-encoding gene sequence analyses. We found that all W ST-11 strains were descendants of an ancestral strain that had undergone unique capsular switching events. The Hajj clone and its descendants were distinct from other W ST-11 strains in that they shared a common antigen gene profile and had undergone recombination involving virulence genes encoding factor H binding protein, nitric oxide reductase, and nitrite reductase. These data demonstrate that recent acquisition of a distinct antigen-encoding gene profile and variations in meningococcal virulence genes was associated with the emergence of the Hajj clone. Importantly, W ST-11 strains unrelated to the Hajj outbreak contribute a significant proportion of W ST-11 cases globally. This study helps illuminate genomic factors associated with meningococcal strain emergence and evolution.

  7. The excessively crying infant : etiology and treatment

    NARCIS (Netherlands)

    Akhnikh, S.; Engelberts, A.C.; Sleuwen, B.E. van; Hoir, M.P. L’; Benninga, M.A.

    2014-01-01

    Excessive crying, often described as infantile colic, is the cause of 10% to 20% of all early pediatrician visits of infants aged 2 weeks to 3 months. Although usually benign and selflimiting, excessive crying is associated with parental exhaustion and stress. However, and underlying organic cause

  8. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  9. Anhedonic behavior in cryptochrome 2-deficient mice is paralleled by altered diurnal patterns of amygdala gene expression.

    Science.gov (United States)

    Savalli, Giorgia; Diao, Weifei; Berger, Stefanie; Ronovsky, Marianne; Partonen, Timo; Pollak, Daniela D

    2015-07-01

    Mood disorders are frequently paralleled by disturbances in circadian rhythm-related physiological and behavioral states and genetic variants of clock genes have been associated with depression. Cryptochrome 2 (Cry2) is one of the core components of the molecular circadian machinery which has been linked to depression, both, in patients suffering from the disease and animal models of the disorder. Despite this circumstantial evidence, a direct causal relationship between Cry2 expression and depression has not been established. Here, a genetic mouse model of Cry2 deficiency (Cry2 (-/-) mice) was employed to test the direct relevance of Cry2 for depression-like behavior. Augmented anhedonic behavior in the sucrose preference test, without alterations in behavioral despair, was observed in Cry2 (-/-) mice. The novelty suppressed feeding paradigm revealed reduced hyponeophagia in Cry2 (-/-) mice compared to wild-type littermates. Given the importance of the amygdala in the regulation of emotion and their relevance for the pathophysiology of depression, potential alterations in diurnal patterns of basolateral amygdala gene expression in Cry2 (-/-) mice were investigated focusing on core clock genes and neurotrophic factor systems implicated in the pathophysiology of depression. Differential expression of the clock gene Bhlhe40 and the neurotrophic factor Vegfb were found in the beginning of the active (dark) phase in Cry2 (-/-) compared to wild-type animals. Furthermore, amygdala tissue of Cry2 (-/-) mice contained lower levels of Bdnf-III. Collectively, these results indicate that Cry2 exerts a critical role in the control of depression-related emotional states and modulates the chronobiological gene expression profile in the mouse amygdala.

  10. Food safety knowledge on the Bt mutant protein Cry8Ka5 employed in the development of coleopteran-resistant transgenic cotton plants.

    Science.gov (United States)

    Farias, Davi F; Peijnenburg, Ad A C M; Grossi-de-Sá, Maria F; Carvalho, Ana F U

    2015-01-01

    Insecticidal Cry proteins from Bacillus thuringiensis (Bt) have been exploited in the development of genetically modified (GM) crops for pest control. However, several pests are still difficult to control such as the coleopteran boll weevil Anthonomus grandis. By applying in vitro molecular evolution to the cry8Ka1 gene sequence, variants were generated with improved activity against A. grandis. Among them, Cry8Ka5 mutant protein showed coleoptericidal activity 3-fold higher (LC50 2.83 μg/mL) than that of the original protein (Cry8Ka1). Cry8Ka5 has been used in breeding programs in order to obtain coleopteran-resistant cotton plants. Nevertheless, there is some concern in relation to the food safety of transgenic crops, especially to the heterologously expressed proteins. In this context, our research group has performed risk assessment studies on Cry8Ka5, using the tests recommended by Codex as well as tests that we proposed as alternative and/or complementary approaches. Our results on the risk analysis of Cry8Ka5 taken together with those of other Cry proteins, point out that there is a high degree of certainty on their food safety. It is reasonable to emphasize that most safety studies on Cry proteins have essentially used the Codex approach. However, other methodologies would potentially provide additional information such as studies on the effects of Cry proteins and derived peptides on the indigenous gastrointestinal microbiota and on intestinal epithelial cells of humans. Additionally, emerging technologies such as toxicogenomics potentially will offer sensitive alternatives for some current approaches or methods.

  11. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  12. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  13. Exposure to tobacco smoke and infant crying

    NARCIS (Netherlands)

    Reijneveld, S.A.; Lanting, C.I.; Crone, M.R.; Wouwe, J.P. van

    2005-01-01

    Aim: To examine the association of excessive infant crying with maternal smoking during and after pregnancy, paternal smoking, and smoking by other people in the living environment of the infant. Methods: We collected data on infant crying and smoking in a Dutch national sample of 5845 infants aged

  14. Exposure to tobacco smoke and infant crying

    NARCIS (Netherlands)

    Reijneveld, SA; Lanting, Caren; Crone, MR; Van Wouwe, JP

    Aim: To examine the association of excessive infant crying with maternal smoking during and after pregnancy, paternal smoking, and smoking by other people in the living environment of the infant. Methods: We collected data on infant crying and smoking in a Dutch national sample of 5845 infants aged

  15. Monitoring resistance to Bacillus thuringiensis subsp. israelensis in the field by performing bioassays with each Cry toxin separately

    Directory of Open Access Journals (Sweden)

    Guillaume Tetreau

    2013-11-01

    Full Text Available Bacillus thuringiensis subsp. israelensis (Bti is increasingly used worldwide for mosquito control and is the only larvicide used in the French Rhône-Alpes region since decades. The artificial selection of mosquitoes with field-persistent Bti collected in breeding sites from this region led to a moderate level of resistance to Bti, but to relatively high levels of resistance to individual Bti Cry toxins. Based on this observation, we developed a bioassay procedure using each Bti Cry toxin separately to detect cryptic Bti-resistance evolving in field mosquito populations. Although no resistance to Bti was detected in none of the three mosquito species tested (Aedes rusticus, Aedes sticticus and Aedes vexans, an increased tolerance to Cry4Aa (3.5-fold and Cry11Aa toxins (8-fold was found in one Ae. sticticus population compared to other populations of the same species, suggesting that resistance to Bti may be arising in this population. This study confirms previous works showing a lack of Bti resistance in field mosquito populations treated for decades with this bioinsecticide. It also provides a first panorama of their susceptibility status to individual Bti Cry toxins. In combination with bioassays with Bti, bioassays with separate Cry toxins allow a more sensitive monitoring of Bti-resistance in the field.

  16. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  17. Crying in infancy

    Science.gov (United States)

    ... your child. As long as caregivers are taking safety precautions and comforting the baby when necessary, you may be sure that your child is well cared for during your break. Call your provider immediately if your baby's crying ...

  18. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  19. Excessive crying in infants with regulatory disorders.

    Science.gov (United States)

    Maldonado-Duran, M; Sauceda-Garcia, J M

    1996-01-01

    The authors point out a correlation between regulatory disorders in infants and the problem of excessive crying. The literature describes other behavioral problems involving excessive crying in very young children, but with little emphasis on this association. The recognition and diagnosis of regulatory disorders in infants who cry excessively can help practitioners design appropriate treatment interventions. Understanding these conditions can also help parents tailor their caretaking style, so that they provide appropriate soothing and stimulation to their child. In so doing, they will be better able to develop and preserve a satisfactory parent-child relationship, as well as to maintain their own sense of competence and self-esteem as parents.

  20. A comprehensive assessment of the effects of Bt cotton on Coleomegilla maculata demonstrates no detrimental effects by Cry1Ac and Cry2Ab.

    Directory of Open Access Journals (Sweden)

    Yunhe Li

    Full Text Available The ladybird beetle, Coleomegilla maculata (DeGeer, is a common and abundant predator in many cropping systems. Its larvae and adults are predaceous, feeding on aphids, thrips, lepidopteran larvae and plant tissues, such as pollen. Therefore, this species is exposed to insecticidal proteins expressed in insect-resistant, genetically engineered cotton expressing Cry proteins derived from Bacillus thuringiensis (Bt. A tritrophic bioassay was conduced to evaluate the potential impact of Cry2Ab- and Cry1Ac-expressing cotton on fitness parameters of C. maculata using Bt-susceptible and -resistant larvae of Trichoplusia ni as prey. Coleomegilla maculata survival, development time, adult weight and fecundity were not different when they were fed with resistant T. ni larvae reared on either Bt or control cotton. To ensure that C. maculata were not sensitive to the tested Cry toxins independent from the plant background and to add certainty to the hazard assessment, C. maculata larvae were fed artificial diet incorporated with Cry2Ab, Cry1Ac or both at >10 times higher concentrations than in cotton tissue. Artificial diet containing E-64 was included as a positive control. No differences were detected in any life-table parameters between Cry protein-containing diet treatments and the control diet. In contrast, larvae of C. maculata fed the E-64 could not develop to the pupal stage and the 7-d larval weight was significantly negatively affected. In both feeding assays, the stability and bioactivity of Cry proteins in the food sources were confirmed by ELISA and sensitive-insect bioassays. Our results show that C. maculata is not affected by Bt cotton and is not sensitive to Cry2Ab and Cry1Ac at concentrations exceeding the levels in Bt cotton, thus demonstrating that Bt cotton will pose a negligible risk to C. maculata. More importantly, this study demonstrates a comprehensive system for assessing the risk of genetically modified plants on non

  1. Strategies of day care center educators in dealing crying babies

    Directory of Open Access Journals (Sweden)

    Lígia Ebner Melchiori

    2004-06-01

    Full Text Available The purpose of this study is to explore the views of day care center educators on how they act when babies cry, if they are able to identify the causes of crying and what are the subjection reasons that make them take action or not. Twenty-one caretakers were interviewed about each of the ninety babies, aged 4 to 24 months, under their care, using a semi-structured guide. The results show that overall the proportion of babies that do not cry significantly increases with age. However, crying for primary needs, in the view of the educators, tends to decrease as the average age increases, whilst crying for secondary needs tends to increase. Most of the time, the educators try to eliminate the needs that provoke crying, giving priority to the baby’s welfare. The article discusses the caretakers’ educative practices with data found in literature. Keywords: day care; educative practices; educators.

  2. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  3. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  4. Crying in Context: Understanding Associations With Interpersonal Dependency and Social Support

    Directory of Open Access Journals (Sweden)

    Katherine L. Fiori

    2013-06-01

    Full Text Available This study examines the associations among interpersonal dependency, social support, and crying proneness, since crying is a behavior that is particularly relevant to the affiliative interpersonal goals characterizing maladaptive forms of dependency (Keltner & Kring, 1998. Data were collected from 305 first-year university students (M age = 18 years. A series of hierarchical linear regressions, controlling for gender, commuting status, romantic relationship status, stress, loneliness, and depressive symptoms, partially supported our hypotheses. That is, we found that a measure of maladaptive dependency (destructive overdependence, or DO and crying proneness were positively correlated, and that DO moderated the associations between social support and crying proneness. Specifically, we found that social support and crying were more closely positively associated among individuals high on DO compared to individuals low on DO. Our findings imply that interpersonal dependency may be an important factor in understanding individual differences in crying, and in determining whether crying is a successful elicitor of social support.

  5. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  6. Sympathy Crying: Insights from Infrared Thermal Imaging on a Female Sample

    Science.gov (United States)

    Morris, Paul; Terry, Samantha; Baker, Marc; Gallese, Vittorio; Reddy, Vasudevi

    2016-01-01

    Sympathy crying is an odd and complex mixture of physiological and emotional phenomena. Standard psychophysiological theories of emotion cannot attribute crying to a single subdivision of the autonomic nervous system (ANS) and disagreement exists regarding the emotional origin of sympathy crying. The current experiment examines sympathy crying using functional thermal infrared imaging (FTII), a novel contactless measure of ANS activity. To induce crying female participants were given the choice to decide which film they wanted to cry to. Compared to baseline, temperature started increasing on the forehead, the peri-orbital region, the cheeks and the chin before crying and reached even higher temperatures during crying. The maxillary area showed the opposite pattern and a gradual temperature decrease was observed compared to baseline as a result of emotional sweating. The results suggest that tears of sympathy are part of a complex autonomic interaction between the sympathetic and the parasympathetic nervous systems, with the latter preceding the former. The emotional origin of the phenomenon seems to derive from subjective internal factors that relate to one’s personal experiences and attributes with tears arising in the form of catharses or as part of shared sadness. PMID:27716801

  7. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  8. Cry features reflect pain intensity in term newborns: an alarm threshold.

    Science.gov (United States)

    Bellieni, Carlo V; Sisto, Renata; Cordelli, Duccio M; Buonocore, Giuseppe

    2004-01-01

    The purpose of this study was to assess differences in sound spectra of crying of term newborns in relation to different pain levels. Fifty-seven consecutively born neonates were evaluated during heel-prick performed with different analgesic techniques. Crying was recorded and frequency spectrograms analyzed. A pain score on the DAN (Douleur Aiguë du Nouveau-né) scale was assigned to each baby after the sampling. Three features were considered and correlated with the corresponding DAN scores: 1) whole spectral form; 2) the fundamental frequency of the first cry emitted (F0); and 3) root mean square sound pressure normalized to its maximum. After emission of the first cry, babies with DAN scores >8, but not with DAN scores cry") characterized by a sequence of almost identical cries with a period on the order of 1 s. A statistically significant correlation was found between root mean square (r2 = 89%, p cry (r2 = 68.2%, p = 0.02), and DAN score. F0 did not show significant correlation with DAN score in the subset of neonates with DAN scores babies with a DAN score >8 had a significantly higher F0 than those with lower DAN scores (p = 0.016). An alarm threshold exists between high (>8) and low (cry at a high pitch is emitted, followed by the siren cry, with a sound level maintained near its maximum.

  9. No impact of transgenic cry1C rice on the rove beetle Paederus fuscipes, a generalist predator of brown planthopper Nilaparvata lugens

    Science.gov (United States)

    Meng, Jiarong; Mabubu, Juma Ibrahim; Han, Yu; He, Yueping; Zhao, Jing; Hua, Hongxia; Feng, Yanni; Wu, Gang

    2016-07-01

    T1C-19 is newly developed transgenic rice active against lepidopteran pests, and expresses a synthesized cry1C gene driven by the maize ubiquitin promoter. The brown planthopper, Nilaparvata lugens, is a major non-target pest of rice, and the rove beetle (Paederus fuscipes) is a generalist predator of N. lugens nymphs. As P. fuscipes may be exposed to the Cry1C protein through preying on N. lugens, it is essential to assess the potential effects of transgenic cry1C rice on this predator. In this study, two experiments (a direct feeding experiment and a tritrophic experiment) were conducted to evaluate the ecological risk of cry1C rice to P. fuscipes. No significant negative effects were observed in the development, survival, female ratio and body weight of P. fuscipes in both treatments of direct exposure to elevated doses of Cry1C protein and prey-mediated exposure to realistic doses of the protein. This indicated that cry1C rice had no detrimental effects on P. fuscipes. This work represents the first study of an assessment continuum for the effects of transgenic cry1C rice on P. fuscipes. Use of the rove beetle as an indicator species to assess potential effects of genetically modified crops on non-target arthropods is feasible.

  10. in silico identification of cross affinity towards Cry1Ac pesticidal protein with receptor enzyme in Bos taurus and sequence, structure analysis of crystal proteins for stability.

    Science.gov (United States)

    Ebenezer, King Solomon; Nachimuthu, Ramesh; Thiagarajan, Prabha; Velu, Rajesh Kannan

    2013-01-01

    Any novel protein introduced into the GM crops need to be evaluated for cross affinity on living organisms. Many researchers are currently focusing on the impact of Bacillus thuringiensis cotton on soil and microbial diversity by field experiments. In spite of this, in silico approach might be helpful to elucidate the impact of cry genes. The crystal a protein which was produced by Bt at the time of sporulation has been used as a biological pesticide to target the insectivorous pests like Cry1Ac for Helicoverpa armigera and Cry2Ab for Spodoptera sp. and Heliothis sp. Here, we present the comprehensive in silico analysis of Cry1Ac and Cry2Ab proteins with available in silico tools, databases and docking servers. Molecular docking of Cry1Ac with procarboxypeptidase from Helicoverpa armigera and Cry1Ac with Leucine aminopeptidase from Bos taurus has showed the 125(th) amino acid position to be the preference site of Cry1Ac protein. The structures were compared with each other and it showed 5% of similarity. The cross affinity of this toxin that have confirmed the earlier reports of ill effects of Bt cotton consumed by cattle.

  11. Strategies of day care center educators in dealing crying babies

    OpenAIRE

    Lígia Ebner Melchiori; Zélia Maria Mendes Biasoli Alves

    2004-01-01

    The purpose of this study is to explore the views of day care center educators on how they act when babies cry, if they are able to identify the causes of crying and what are the subjection reasons that make them take action or not. Twenty-one caretakers were interviewed about each of the ninety babies, aged 4 to 24 months, under their care, using a semi-structured guide. The results show that overall the proportion of babies that do not cry significantly increases with age. However, crying f...

  12. Midgut GPI-anchored proteins with alkaline phosphatase activity from the cotton boll weevil (Anthonomus grandis) are putative receptors for the Cry1B protein of Bacillus thuringiensis.

    Science.gov (United States)

    Martins, Erica Soares; Monnerat, Rose Gomes; Queiroz, Paulo Roberto; Dumas, Vinicius Fiuza; Braz, Shélida Vasconcelos; de Souza Aguiar, Raimundo Wagner; Gomes, Ana Cristina Menezes Mendes; Sánchez, Jorge; Bravo, Alejandra; Ribeiro, Bergmann Morais

    2010-02-01

    Cry toxins from Bacillus thuringiensis (Bt) are used for insect control. They interact with specific receptors located on the host cell surface and are activated by host proteases following receptor binding resulting in midgut epithelial cells lysis. In this work we had cloned, sequenced and expressed a cry1Ba toxin gene from the B thuringiensis S601 strain which was previously shown to be toxic to Anthonomus grandis, a cotton pest. The Cry1Ba6 protein expressed in an acrystaliferous B. thuringiensis strain was toxic to A. grandis in bioassays. The binding of Cry1Ba6 toxin to proteins located in the midgut brush border membrane of A. grandis was analyzed and we found that Cry1Ba6 binds to two proteins (62 and 65kDa) that showed alkaline phosphatase (ALP) activity. This work is the first report that shows the localization of Cry toxin receptors in the midgut cells of A. grandis. 2009. Published by Elsevier Ltd.

  13. Germline variants in MRE11/RAD50/NBN complex genes in childhood leukemia

    International Nuclear Information System (INIS)

    Mosor, Maria; Ziółkowska-Suchanek, Iwona; Nowicka, Karina; Dzikiewicz-Krawczyk, Agnieszka; Januszkiewicz–Lewandowska, Danuta; Nowak, Jerzy

    2013-01-01

    The MRE11, RAD50, and NBN genes encode proteins of the MRE11-RAD50-NBN (MRN) complex involved in cellular response to DNA damage and the maintenance of genome stability. In our previous study we showed that the germline p.I171V mutation in NBN may be considered as a risk factor in the development of childhood acute lymphoblastic leukemia (ALL) and some specific haplotypes of that gene may be associated with childhood leukemia. These findings raise important questions about the role of mutations in others genes of the MRN complex in childhood leukemia. The aim of this study was to answer the question whether MRE11 and RAD50 alterations may be associated with childhood ALL or AML. We estimated the frequency of constitutional mutations and polymorphisms in selected regions of MRE11, RAD50, and NBN in the group of 220 children diagnosed with childhood leukemias and controls (n=504/2200). The analysis was performed by specific amplification of region of interest by PCR and followed by multi-temperature single-strand conformation polymorphism (PCR-MSSCP) technique. We performed two molecular tests to examine any potential function of the detected the c.551+19G>A SNP in RAD50 gene. To our knowledge, this is the first analysis of the MRE11, RAD50 and NBN genes in childhood leukemia. The frequency of either the AA genotype or A allele of RAD50-rs17166050 were significantly different in controls compared to leukemia group (ALL+AML) (p<0.0019 and p<0.0019, respectively). The cDNA analysis of AA or GA genotypes carriers has not revealed evidence of splicing abnormality of RAD50 pre-mRNA. We measured the allelic-specific expression of G and A alleles at c.551+19G>A and the statistically significant overexpression of the G allele has been observed. Additionally we confirmed the higher incidence of the p.I171V mutation in the leukemia group (7/220) than among controls (12/2400) (p<0.0001). The formerly reported sequence variants in the RAD50 and MRE11 gene may not constitute a

  14. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  15. Identification of Bacillus thuringiensis Cry1AbMod binding-proteins from Spodoptera frugiperda.

    Science.gov (United States)

    Martínez de Castro, Diana L; García-Gómez, Blanca I; Gómez, Isabel; Bravo, Alejandra; Soberón, Mario

    2017-12-01

    Bacillus thuringiensis Cry toxins are currently used for pest control in transgenic crops but evolution of resistance by the insect pests threatens the use of this technology. The Cry1AbMod toxin was engineered to lack the alpha helix-1 of the parental Cry1Ab toxin and was shown to counter resistance to Cry1Ab and Cry1Ac toxins in different insect species including the fall armyworm Spodoptera frugiperda. In addition, Cry1AbMod showed enhanced toxicity to Cry1Ab-susceptible S. frugiperda populations. To gain insights into the mechanisms of this Cry1AbMod-enhanced toxicity, we isolated the Cry1AbMod toxin binding proteins from S. frugiperda brush border membrane vesicles (BBMV), which were identified by pull-down assay and liquid chromatography-tandem mass spectrometry (LC-MS/MS). The LC-MS/MS results indicated that Cry1AbMod toxin could bind to four classes of aminopeptidase (N1, N3, N4 y N5) and actin, with the highest amino acid sequence coverage acquired for APN 1 and APN4. In addition to these proteins, we found other proteins not previously described as Cry toxin binding proteins. This is the first report that suggests the interaction between Cry1AbMod and APN in S. frugiperda. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Bacillus thuringiensis Cry1Ia10 and Vip3Aa protein interactions and their toxicity in Spodoptera spp. (Lepidoptera).

    Science.gov (United States)

    Bergamasco, V B; Mendes, D R P; Fernandes, O A; Desidério, J A; Lemos, M V F

    2013-02-01

    The polyphagous pests belonging to the genus Spodoptera are considered to be among the most important causes of damage and are widely distributed throughout the Americas'. Due to the extensive use of genetically modified plants containing Bacillus thuringiensis genes that code for insecticidal proteins, resistant insects may arise. To prevent the development of resistance, pyramided plants, which express multiple insecticidal proteins that act through distinct mode of actions, can be used. This study analyzed the mechanisms of action for the proteins Cry1Ia10 and Vip3Aa on neonatal Spodoptera frugiperda, Spodoptera albula, Spodoptera eridania and Spodoptera cosmioides larvae. The interactions of these toxins with receptors on the intestinal epithelial membrane were also analyzed by binding biotinylated toxins to brush border membrane vesicles (BBMVs) from the intestines of these insects. A putative receptor of approximately 65 kDa was found by ligand blotting in all of these species. In vitro competition assays using biotinylated proteins have indicated that Vip3Aa and Cry1Ia10 do not compete for the same receptor for S. frugiperda, S. albula and S. cosmioides and that Vip3Aa was more efficient than Cry1Ia10 when tested individually, by bioassays. A synergistic effect of the toxins in S. frugiperda, S. albula and S. cosmioides was observed when they were combined. However, in S. eridania, Cry1Ia10 and Vip3Aa might compete for the same receptor and through bioassays Cry1Ia10 was more efficient than Vip3Aa and showed an antagonistic effect when the proteins were combined. These results suggest that using these genes to develop pyramided plants may not prove effective in preventing the development of resistance in S. eridiana. Copyright © 2012 Elsevier Inc. All rights reserved.

  17. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  18. Analysis of the CYP51 gene and encoded protein in propiconazole-resistant isolates of Mycosphaerella fijiensis.

    Science.gov (United States)

    Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael

    2009-08-01

    Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.

  19. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  20. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  1. Transgenic cotton coexpressing Vip3A and Cry1Ac has a broad insecticidal spectrum against lepidopteran pests.

    Science.gov (United States)

    Chen, Wen-Bo; Lu, Guo-Qing; Cheng, Hong-Mei; Liu, Chen-Xi; Xiao, Yu-Tao; Xu, Chao; Shen, Zhi-Cheng; Wu, Kong-Ming

    2017-10-01

    Although farmers in China have grown transgenic Bt-Cry1Ac cotton to resist the major pest Helicoverpa armigera since 1997 with great success, many secondary lepidopteran pests that are tolerant to Cry1Ac are now reported to cause considerable economic damage. Vip3AcAa, a chimeric protein with the N-terminal part of Vip3Ac and the C-terminal part of Vip3Aa, has a broad insecticidal spectrum against lepidopteran pests and has no cross resistance to Cry1Ac. In the present study, we tested insecticidal activities of Vip3AcAa against Spodoptera litura, Spodoptera exigua, and Agrotis ipsilon, which are relatively tolerant to Cry1Ac proteins. The bioassay results showed that insecticidal activities of Vip3AcAa against these three pests are superior to Cry1Ac, and after an activation pretreatment, Vip3AcAa retained insecticidal activity against S. litura, S. exigua and A. ipsilon that was similar to the unprocessed protein. The putative receptor for this chimeric protein in the brush border membrane vesicle (BBMV) in the three pests was also identified using biotinylated Vip3AcAa toxin. To broaden Bt cotton activity against a wider spectrum of pests, we introduced the vip3AcAa and cry1Ac genes into cotton. Larval mortality rates for S. litura, A. ipsilon and S. exigua that had fed on this new cotton increased significantly compared with larvae fed on non-Bt cotton and Bt-Cry1Ac cotton in a laboratory experiment. These results suggested that the Vip3AcAa protein is an excellent option for a "pyramid" strategy for integrated pest management in China. Copyright © 2017 Elsevier Inc. All rights reserved.

  2. Are TMEM genes potential candidate genes for panic disorder?

    DEFF Research Database (Denmark)

    NO, Gregersen; Buttenschøn, Henriette Nørmølle; Hedemand, Anne

    2014-01-01

    We analysed single nucleotide polymorphisms in two transmembrane genes (TMEM98 and TMEM132E) in panic disorder (PD) patients and control individuals from the Faroe Islands, Denmark and Germany. The genes encode single-pass membrane proteins and are located within chromosome 17q11.2-q12...

  3. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  4. Evaluation of Bt Corn with Pyramided Genes on Efficacy and Insect Resistance Management for the Asian Corn Borer in China.

    Directory of Open Access Journals (Sweden)

    Fan Jiang

    Full Text Available A Bt corn hybrid (AcIe with two Bt genes (cry1Ie and cry1Ac was derived by breeding stack from line expressing Cry1Ie and a line expressing Cry1Ac. Efficacy of this pyramided Bt corn hybrid against the Asian corn borer (ACB, Ostrinia furnacalis, was evaluated. We conducted laboratory bioassays using susceptible and resistant ACB strains fed on artificial diet or fresh plant tissues. We also conducted field trials with artificial infestations of ACB neonates at the V6 and silk stages. The toxin-diet bioassay data indicated that mixtures of Cry1Ac and Cry1Ie proteins had synergistic insecticidal efficacy. The plant tissue bioassay data indicated that Bt corn hybrids expressing either a single toxin (Cry1Ac or Cry1Ie or two toxins had high efficacy against susceptible ACB. Damage ratings in the field trials indicated that the Bt corn hybrids could effectively protect against 1st and the 2nd generation ACB in China. The hybrid line with two Bt genes showed a higher efficacy against ACB larvae resistant to Cry1Ac or CryIe than the hybrid containing one Bt gene, and the two gene hybrid would have increased potential for managing or delaying the evolution of ACB resistance to Bt corn plants.

  5. Evaluation of Bt Corn with Pyramided Genes on Efficacy and Insect Resistance Management for the Asian Corn Borer in China.

    Science.gov (United States)

    Jiang, Fan; Zhang, Tiantao; Bai, Shuxiong; Wang, Zhenying; He, Kanglai

    2016-01-01

    A Bt corn hybrid (AcIe) with two Bt genes (cry1Ie and cry1Ac) was derived by breeding stack from line expressing Cry1Ie and a line expressing Cry1Ac. Efficacy of this pyramided Bt corn hybrid against the Asian corn borer (ACB), Ostrinia furnacalis, was evaluated. We conducted laboratory bioassays using susceptible and resistant ACB strains fed on artificial diet or fresh plant tissues. We also conducted field trials with artificial infestations of ACB neonates at the V6 and silk stages. The toxin-diet bioassay data indicated that mixtures of Cry1Ac and Cry1Ie proteins had synergistic insecticidal efficacy. The plant tissue bioassay data indicated that Bt corn hybrids expressing either a single toxin (Cry1Ac or Cry1Ie) or two toxins had high efficacy against susceptible ACB. Damage ratings in the field trials indicated that the Bt corn hybrids could effectively protect against 1st and the 2nd generation ACB in China. The hybrid line with two Bt genes showed a higher efficacy against ACB larvae resistant to Cry1Ac or CryIe than the hybrid containing one Bt gene, and the two gene hybrid would have increased potential for managing or delaying the evolution of ACB resistance to Bt corn plants.

  6. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  7. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  8. An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin.

    Directory of Open Access Journals (Sweden)

    Linda J Gahan

    2010-12-01

    Full Text Available Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.

  9. An ABC transporter mutation is correlated with insect resistance to Bacillus thuringiensis Cry1Ac toxin.

    Science.gov (United States)

    Gahan, Linda J; Pauchet, Yannick; Vogel, Heiko; Heckel, David G

    2010-12-16

    Transgenic crops producing insecticidal toxins from Bacillus thuringiensis (Bt) are commercially successful in reducing pest damage, yet knowledge of resistance mechanisms that threaten their sustainability is incomplete. Insect resistance to the pore-forming Cry1Ac toxin is correlated with the loss of high-affinity, irreversible binding to the mid-gut membrane, but the genetic factors responsible for this change have been elusive. Mutations in a 12-cadherin-domain protein confer some Cry1Ac resistance but do not block this toxin binding in in vitro assays. We sought to identify mutations in other genes that might be responsible for the loss of binding. We employed a map-based cloning approach using a series of backcrosses with 1,060 progeny to identify a resistance gene in the cotton pest Heliothis virescens that segregated independently from the cadherin mutation. We found an inactivating mutation of the ABC transporter ABCC2 that is genetically linked to Cry1Ac resistance and is correlated with loss of Cry1Ac binding to membrane vesicles. ABC proteins are integral membrane proteins with many functions, including export of toxic molecules from the cell, but have not been implicated in the mode of action of Bt toxins before. The reduction in toxin binding due to the inactivating mutation suggests that ABCC2 is involved in membrane integration of the toxin pore. Our findings suggest that ABC proteins may play a key role in the mode of action of Bt toxins and that ABC protein mutations can confer high levels of resistance that could threaten the continued utilization of Bt-expressing crops. However, such mutations may impose a physiological cost on resistant insects, by reducing export of other toxins such as plant secondary compounds from the cell. This weakness could be exploited to manage this mechanism of Bt resistance in the field.

  10. Baby Cry Detection in Domestic Environment using Deep Learning

    OpenAIRE

    Ijzerman, Hans

    2017-01-01

    Automatic detection of a baby cry in audio signals is an essential step in applications such as remote baby monitoring. It is also important for researchers, who study the relation between baby cry patterns and various health or developmental parameters. In this paper, we propose two machine-learning algorithms for automatic detection of baby cry in audio recordings. The first algorithm is a low-complexity logistic regression classifier, used as a reference. To train this classifier, we extra...

  11. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  12. Excessive crying: behavioral and emotional regulation disorder in infancy

    Directory of Open Access Journals (Sweden)

    Joon Sik Kim

    2011-06-01

    Full Text Available In the pediatric literature, excessive crying has been reported solely in association with 3-month colic and is described, if at all, as unexplained crying and fussing during the first 3 months of life. The bouts of crying are generally thought to be triggered by abdominal colic (over-inflation of the still immature gastrointestinal tract, and treatment is prescribed accordingly. According to this line of reasoning, excessive crying is harmless and resolves by the end of the third month without long-term consequences. However, there is evidence that it may cause tremendous distress in the mother&#8211;infant relationship, and can lead to disorders of behavioral and emotional regulation at the toddler stage (such as sleep and feeding disorders, chronic fussiness, excessive clinginess, and temper tantrums. Early treatment of excessive crying focuses on parent&#8211;infant communication, and parent-infant interaction in the context of soothing and settling the infant to sleep is a promising approach that may prevent later behavioral and emotional disorders in infancy.

  13. Genomic organization and promoter cloning of the human X11α gene APBA1.

    LENUS (Irish Health Repository)

    Chai, Ka-Ho

    2012-05-01

    X11α is a brain specific multi-modular protein that interacts with the Alzheimer\\'s disease amyloid precursor protein (APP). Aggregation of amyloid-β peptide (Aβ), an APP cleavage product, is believed to be central to the pathogenesis of Alzheimer\\'s disease. Recently, overexpression of X11α has been shown to reduce Aβ generation and to ameliorate memory deficit in a transgenic mouse model of Alzheimer\\'s disease. Therefore, manipulating the expression level of X11α may provide a novel route for the treatment of Alzheimer\\'s disease. Human X11α is encoded by the gene APBA1. As evidence suggests that X11α expression can be regulated at transcription level, we have determined the gene structure and cloned the promoter of APBA1. APBA1 spans over 244 kb on chromosome 9 and is composed of 13 exons and has multiple transcription start sites. A putative APBA1 promoter has been identified upstream of exon 1 and functional analysis revealed that this is highly active in neurons. By deletion analysis, the minimal promoter was found to be located between -224 and +14, a GC-rich region that contains a functional Sp3 binding site. In neurons, overexpression of Sp3 stimulates the APBA1 promoter while an Sp3 inhibitor suppresses the promoter activity. Moreover, inhibition of Sp3 reduces endogenous X11α expression and promotes the generation of Aβ. Our findings reveal that Sp3 play an essential role in APBA1 transcription.

  14. Deletion of aprA and nprA genes for alkaline protease A and neutral protease A from bacillus thuringiensis: effect on insecticidal crystal proteins.

    Science.gov (United States)

    Tan, Y; Donovan, W P

    2001-11-17

    The aprA gene encoding alkaline protease A (AprA) was cloned from Bacillus thuringiensis subsp. kurstaki, and the cloned gene was used to construct aprA-deleted (aprA1) strains of B. thuringiensis. An aprA1 strain of B. thuringiensis that contained the wild-type gene for neutral protease A (nprA(+)) displayed levels of extracellular proteolytic activity that were similar to those of an aprA(+)nprA(+) strain. However, when EDTA was included in the protease assay to inhibit NprA activity the aprA1nprA(+) strain displayed only 2% of the extracellular proteolytic activity of the aprA(+)nprA(+) strain. A strain that was deleted for both aprA and nprA (aprA1nprA3 strain) failed to produce detectable levels of proteolytic activity either in the presence or absence of EDTA in the assay. Compared with the aprA(+)nprA(+) strain the aprA1nprA(+) strain yielded 10% more full-length Cry1Bb crystal protein and the aprA1nprA3 strain yielded 25% more full-length Cry1Bb protein. No significant differences were seen in the 50% lethal dose of Cry1Bb protein from aprA(+)nprA(+) and aprA1nprA3 strains against three species of lepidopteran insects. These results suggest that enhanced yield of certain crystal proteins can be obtained by deletion of the genes aprA and nprA which are the major extracellular proteases of B. thuringiensis.

  15. Cry1F resistance among lepidopteran pests: a model for improved resistance management?

    Science.gov (United States)

    Vélez, Ana M; Vellichirammal, Neetha Nanoth; Jurat-Fuentes, Juan Luis; Siegfried, Blair D

    2016-06-01

    The Cry1Fa protein from the bacterium Bacillus thuringiensis (Bt) is known for its potential to control lepidopteran pests, especially through transgenic expression in maize and cotton. The maize event TC1507 expressing the cry1Fa toxin gene became commercially available in the United States in 2003 for the management of key lepidopteran pests including the European corn borer, Ostrinia nubilalis, and the fall armyworm, Spodoptera frugiperda. A high-dose/refuge strategy has been widely adopted to delay evolution of resistance to event TC1507 and other transgenic Bt crops. Efficacy of this strategy depends on the crops expressing a high dose of the Bt toxin to targeted pests and adjacent refuges of non-Bt host plants serving as a source of abundant susceptible insects. While this strategy has proved effective in delaying O. nubilalis resistance, field-evolved resistance to event TC1507 has been reported in S. frugiperda populations in Puerto Rico, Brazil, and the southeastern United States. This paper examines available information on resistance to Cry1Fa in O. nubilalis and S. frugiperda and discusses how this information identifies opportunities to refine resistance management recommendations for Bt maize. Copyright © 2016 Elsevier Inc. All rights reserved.

  16. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  17. KPNB1 mediates PER/CRY nuclear translocation and circadian clock function.

    Science.gov (United States)

    Lee, Yool; Jang, A Reum; Francey, Lauren J; Sehgal, Amita; Hogenesch, John B

    2015-08-29

    Regulated nuclear translocation of the PER/CRY repressor complex is critical for negative feedback regulation of the circadian clock of mammals. However, the precise molecular mechanism is not fully understood. Here, we report that KPNB1, an importin β component of the ncRNA repressor of nuclear factor of activated T cells (NRON) ribonucleoprotein complex, mediates nuclear translocation and repressor function of the PER/CRY complex. RNAi depletion of KPNB1 traps the PER/CRY complex in the cytoplasm by blocking nuclear entry of PER proteins in human cells. KPNB1 interacts mainly with PER proteins and directs PER/CRY nuclear transport in a circadian fashion. Interestingly, KPNB1 regulates the PER/CRY nuclear entry and repressor function, independently of importin α, its classical partner. Moreover, inducible inhibition of the conserved Drosophila importin β in lateral neurons abolishes behavioral rhythms in flies. Collectively, these data show that KPNB1 is required for timely nuclear import of PER/CRY in the negative feedback regulation of the circadian clock.

  18. Individual recognition of human infants on the basis of cries alone.

    Science.gov (United States)

    Green, J A; Gustafson, G E

    1983-11-01

    Human parents were asked to identify their infants on the basis of tape-recorded cries that they had not previously heard. The cries of twenty 30-day-old infants were recorded just prior to a feeding, then rerecorded onto a test tape containing cries from three other infants. Eighty percent of mothers were able to recognize their infants' cries, as were 45% of fathers. An additional 140 adults (non-parents) were tested in order to determine if the process of dubbing cries onto test tapes had left extraneous auditory cues to infants' identities and if the foil infants were equally discriminable. The results indicated that parents' recognition was not based on extraneous cues and that, overall, the foils were appropriate distractors in the parents' task. Thus, the majority of parents can recognize their 30-day-old infants on the sole basis of acoustic cues contained in the infants' cries. The acoustic features that underlie this recognition are now being investigated.

  19. Identification of proteins interacting with Arabidopsis ACD11

    DEFF Research Database (Denmark)

    Petersen, Nikolaj H T; Joensen, Jan; McKinney, Lea V

    2009-01-01

    The Arabidopsis ACD11 gene encodes a sphingosine transfer protein and was identified by the accelerated cell death phenotype of the loss of function acd11 mutant, which exhibits heightened expression of genes involved in the disease resistance hypersensitive response (HR). We used ACD11 as bait...... in a yeast two-hybrid screen of an Arabidopsis cDNA library to identify ACD11 interacting proteins. One interactor identified is a protein of unknown function with an RNA recognition motif (RRM) designated BPA1 (binding partner of ACD11). Co-immunoprecipitation experiments confirmed the ACD11-BPA1...

  20. Characterization of a dehydrogenase activity responsible for oxidation of 11-cis-retinol in the retinal pigment epithelium of mice with a disrupted RDH5 gene. A model for the human hereditary disease fundus albipunctatus.

    NARCIS (Netherlands)

    Jang, G.F.; Hooser, J.P. van; Kuksa, V.; McBee, J.K.; He, Y.G.; Janssen, J.J.M.; Driessen, C.A.G.G.; Palczewski, K.

    2001-01-01

    In the vertebrate retina, the final step of visual chromophore production is the oxidation of 11-cis-retinol to 11-cis-retinal. This reaction is catalyzed by 11-cis-retinol dehydrogenases (11-cis-RDHs), prior to the chromophore rejoining with the visual pigment apo-proteins. The RDH5 gene encodes a

  1. Cri du chat syndrome

    Science.gov (United States)

    ... the ear Slow or incomplete development of motor skills Small head ( microcephaly ) Small jaw ( micrognathia ) Wide-set ... of children with this syndrome learn enough verbal skills to communicate. The cat-like cry becomes less ...

  2. I thought that I heard you laughing: Contextual facial expressions modulate the perception of authentic laughter and crying.

    Science.gov (United States)

    Lavan, Nadine; Lima, César F; Harvey, Hannah; Scott, Sophie K; McGettigan, Carolyn

    2015-01-01

    It is well established that categorising the emotional content of facial expressions may differ depending on contextual information. Whether this malleability is observed in the auditory domain and in genuine emotion expressions is poorly explored. We examined the perception of authentic laughter and crying in the context of happy, neutral and sad facial expressions. Participants rated the vocalisations on separate unipolar scales of happiness and sadness and on arousal. Although they were instructed to focus exclusively on the vocalisations, consistent context effects were found: For both laughter and crying, emotion judgements were shifted towards the information expressed by the face. These modulations were independent of response latencies and were larger for more emotionally ambiguous vocalisations. No effects of context were found for arousal ratings. These findings suggest that the automatic encoding of contextual information during emotion perception generalises across modalities, to purely non-verbal vocalisations, and is not confined to acted expressions.

  3. Transcriptome analyses reveal the involvement of both C and N termini of cryptochrome 1 in its regulation of phytohormone-responsive gene expression in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Wenxiu eWang

    2016-03-01

    Full Text Available Cryptochromes (CRY are blue-light photoreceptors that mediate various light responses in plants and animals. It has long been demonstrated that Arabidopsis CRY (CRY1 and CRY2 C termini (CCT1 and CCT2 mediate light signaling through direct interaction with COP1. Most recently, CRY1 N terminus (CNT1 has been found to be involved in CRY1 signaling independent of CCT1, and implicated in the inhibition of gibberellin acids (GA/brassinosteroids (BR/auxin-responsive gene expression. Here, we performed RNA-Seq assay using transgenic plants expressing CCT1 fused to β-glucuronidase (GUS-CCT1, abbreviated as CCT1, which exhibit a constitutively photomorphogenic phenotype, and compared the results with those obtained previously from cry1cry2 mutant and the transgenic plants expressing CNT1 fused to nuclear localization signal sequence (NLS-tagged YFP (CNT1-NLS-YFP, abbreviated as CNT1, which display enhanced responsiveness to blue light. We found that 2,903 (67.85% of the CRY-regulated genes are regulated by CCT1 and that 1,095 of these CCT1-regulated genes are also regulated by CNT1. After annotating the gene functions, we found that CCT1 is involved in mediating CRY1 regulation of phytohormone-responsive genes, like CNT1, and that about half of the up-regulated genes by GA/BR/auxin are down-regulated by CCT1 and CNT1, consistent with the antagonistic role for CRY1 and these phytohormones in regulating hypocotyl elongation. Physiological studies showed that both CCT1 and CNT1 are likely involved in mediating CRY1 reduction of seedlings sensitivity to GA under blue light. Furthermore, protein expression studies demonstrate that the inhibition of GA promotion of HY5 degradation by CRY1 is likely mediated by CCT1, but not by CNT1. These results give genome-wide transcriptome information concerning the signaling mechanism of CRY1, unraveling possible involvement of its C and N termini in its regulation of response of GA and likely other phytohormones.

  4. Excessive crying in infants

    Directory of Open Access Journals (Sweden)

    Ricardo Halpern

    2016-05-01

    Full Text Available Objective: Review the literature on excessive crying in young infants, also known as infantile colic, and its effects on family dynamics, its pathophysiology, and new treatment interventions. Data source: The literature review was carried out in the Medline, PsycINFO, LILACS, SciELO, and Cochrane Library databases, using the terms “excessive crying,” and “infantile colic,” as well technical books and technical reports on child development, selecting the most relevant articles on the subject, with emphasis on recent literature published in the last five years. Summary of the findings: Excessive crying is a common symptom in the first 3 months of life and leads to approximately 20% of pediatric consultations. Different prevalence rates of excessive crying have been reported, ranging from 14% to approximately 30% in infants up to 3 months of age. There is evidence linking excessive crying early in life with adaptive problems in the preschool period, as well as with early weaning, maternal anxiety and depression, attention deficit hyperactivity disorder, and other behavioral problems. Several pathophysiological mechanisms can explain these symptoms, such as circadian rhythm alterations, central nervous system immaturity, and alterations in the intestinal microbiota. Several treatment alternatives have been described, including behavioral measures, manipulation techniques, use of medication, and acupuncture, with controversial results and effectiveness. Conclusion: Excessive crying in the early months is a prevalent symptom; the pediatrician's attention is necessary to understand and adequately manage the problem and offer support to exhausted parents. The prescription of drugs of questionable action and with potential side effects is not a recommended treatment, except in extreme situations. The effectiveness of dietary treatments and use of probiotics still require confirmation. There is incomplete evidence regarding alternative treatments

  5. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  7. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  8. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  9. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  10. Correspondence of High Levels of Beta-Exotoxin I and the Presence of cry1B in Bacillus thuringiensis

    Science.gov (United States)

    Espinasse, Sylvain; Gohar, Michel; Chaufaux, Josette; Buisson, Christophe; Perchat, Stéphane; Sanchis, Vincent

    2002-01-01

    Examination of 640 natural isolates of Bacillus thuringiensis showed that the 58 strains (9%) whose supernatants were toxic to Anthonomus grandis (Coleoptera: Curculionidae) produced between 10 and 175 μg of β-exotoxin I per ml. We also found that 55 (46%) of a sample of 118 strains whose culture supernatants were not toxic to A. grandis nevertheless produced between 2 and 5 μg/ml. However, these amounts of β-exotoxin I were below the threshold for detectable toxicity against this insect species. Secretion of large amounts of β-exotoxin I was strongly associated with the presence of cry1B and vip2 genes in the 640 natural B. thuringiensis isolates studied. We concluded that strains carrying cry1B and vip2 genes also possess, on the same plasmid, genetic determinants necessary to promote high levels of production of β-exotoxin I. PMID:12200263

  11. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  12. The SBP-Box Gene VpSBP11 from Chinese Wild Vitis Is Involved in Floral Transition and Affects Leaf Development.

    Science.gov (United States)

    Hou, Hongmin; Yan, Xiaoxiao; Sha, Ting; Yan, Qin; Wang, Xiping

    2017-07-13

    Flowering occurs in angiosperms during a major developmental transition from vegetative growth to the reproductive phase. Squamosa promoter binding protein (SBP)-box genes have been found to play critical roles in regulating flower and fruit development, but their roles in grapevine have remained unclear. To better understand the functions of the grape SBP-box genes in both vegetative and reproductive growth phases, a full-length complementary DNA (cDNA) sequence of the putative SBP-box transcription factor gene, VpSBP11 , was obtained from Chinese wild grapevine Vitis pseudoreticulata Wen Tsai Wang (W. T. Wang) clone 'Baihe-35-1'. VpSBP11 encoded a putative polypeptide of 170 amino acids with a highly conserved SBP-domain with two zinc-binding sites of the Cx2C-x3-H-x11-C-x6-H (C2HCH) type and a nuclear localization signal. We confirmed that the VpSBP11 protein was targeted to the nucleus and possessed transcriptional activation activity by subcellular localization and trans -activation assay. Over-expression of VpSBP11 in Arabidopsis thaliana was shown to activate the FUL gene, and subsequently the AP1 and LFY genes, all of which were floral meristem identity genes, and to cause earlier flowering than in wild type (WT) plants. The pattern of vegetative growth was also different between the transgenic and WT plants. For example, in the VpSBP11 over-expressing transgenic plants, the number of rosette leaves was less than that of WT; the petiole was significantly elongated; and the rosette and cauline leaves curled upwards or downwards. These results were consistent with VpSBP11 acting as a transcription factor during the transition from the vegetative stage to the reproductive stage.

  13. Investigation of the Cry4B-prohibitin interaction in Aedes aegypti cells.

    Science.gov (United States)

    Kuadkitkan, Atichat; Smith, Duncan R; Berry, Colin

    2012-10-01

    Bacillus thuringiensis (Bt) produces insecticidal toxins active against insects. Cry4B, one of the major insecticidal toxins produced by Bt subsp. israelensis, is highly toxic to mosquitoes in the genus Aedes: the major vectors of dengue, yellow fever, and chikungunya. Previous work has shown that Cry4B binds to several mid-gut membrane proteins in Aedes aegypti larvae including prohibitin, a protein recently identified as a receptor that also mediates entry of dengue virus into Aedes cells. This study confirms the interaction between Cry4B and prohibitin by co-immunoprecipitation analysis and demonstrates colocalization of prohibitin and Cry4B by confocal microscopy. While activated Cry4B toxin showed high larvicidal activity, it was not cytotoxic to two Aedes cell lines, allowing determination of its effect on dengue virus infectivity in the absence of Cry4B-induced cell lysis. Pre-exposure of Aedes cells to Cry4B resulted in a significant reduction in the number of infected cells compared to untreated cells.

  14. M-l Swaco opens industry's only dedicated CRI training centre

    Energy Technology Data Exchange (ETDEWEB)

    Robertson, John; Wilkinson, Tony; Minton, Reg

    2005-07-01

    Recognising the growing attraction of cuttings re-injection (CRI) as a viable drilling waste management option in the North Sea and other zero discharge environments, M-I Swaco has officially unveiled the industry's only dedicated CRI training center in Aberdeen. Located in Aliens Industrial Estate, the all-inclusive facility includes two training rooms, two project specific CRI training simulators, one CRI full-scale slurrification system, one Cleancut cuttings collection and transport system, a vacuum cuttings collection system and a 518 Centrifuge. The center, which can accommodate up to 12 students at one time, is fully equipped to deliver both theoretical and practical hands-on training in all aspects of the CRI process. Training at the center is competency-based and follows ISO 9001 and ISO 10015 requirements. The training centre is a natural extension of the newly established M-I Swaco CRI Assurance Program, or CAP the core of which is a geomechanics team organised to provide integrated CRI services that include engineering, monitoring and assurance capabilities for operators worldwide.

  15. Phage-Mediated Immuno-PCR for Ultrasensitive Detection of Cry1Ac Protein Based on Nanobody.

    Science.gov (United States)

    Liu, Yuanyuan; Jiang, Dongjian; Lu, Xin; Wang, Wei; Xu, Yang; He, Qinghua

    2016-10-11

    The widespread use of Cry proteins in transgenic plants for insect control has raised concerns about the environment and food safety in the public. An effective detection method for introduced Cry proteins is of significance for environmental risk assessment and product quality control. This paper describes a novel phage mediated immuno-PCR (iPCR) for the ultrasensitive determination of Cry proteins based on nanobodies. Three nanobodies against Cry1Ac protein were obtained from a naı̈ve phage displayed nanobody library without animal immunization process and were applied to the iPCR assay for Cry1Ac. The phage-mediated iPCR for Cry1Ac based on nanobodies showed a dynamic range of 0.001-100 ng/mL and a limit detection of 0.1 pg/mL. Specific measurement of this established method was performed by testing cross-reativity of other Cry1Ac analogues, and the result showed negligible cross-reactivity with other test Cry proteins (Cry1Ab, Cry1F, Cry3B). Furthermore, the phage-mediated iPCR based on nanobody should be easily applicable to the detection of many other Cry proteins.

  16. Association of PER2 and CRY1 Polymorphisms with the Morningness-Eveningness in Korean Adults

    Directory of Open Access Journals (Sweden)

    Jung Hie Lee

    2015-12-01

    Full Text Available Background and Objective Individuals have a unique circadian preference, which is based on differences in endogenous rhythm and environmental factors. There has been no study on the relationship between the morningness-eveningness (ME preference and the polymorphisms of PER2 and CRY1 genes, which may play an essential role in the modulation of circadian rhythm. Our present study aims to examine the difference in the polymorphisms of PER2-2221A/G and CRY1-2790T/G, which are related to a greater cancer risk, according to the ME preference. Methods The Korean version of the Morningness-Eveningness Questionnaire was administered and buccal DNA samples were obtained from 425 Korean adults aged 18 years or older. We excluded subjects who were being treated for sleep disorders or those with shift work. 47 morning type (MT (age: 44.57 ± 12.33, M:F = 14:33 subjects, 59 neither type (NT (age: 35.20 ± 9.53, M:F = 20:39 subjects and 51 evening type (ET (age: 28.80 ± 8.03, M:F = 14:37 subjects were finally included in the present study. The above candidate single nucleotide polymorphisms were analyzed by DNA sequencing or a SNaPshot assay. Results For the PER2-2221A/G and CRY1-2790T/G, there were no significant differences in the genotype distribution, allele frequency, or proportion of G allele positive subjects between the MT and ET groups. There was no significant difference in the mean scores of the MEQ-K, KESS, or PSQI between G allele positive and negative subjects for either PER2-A2221A/G or CRY1-2790T/G. Conclusions Our study did not support the association of the ME preference with the PER2-2221 A/G and CRY1-2790T/G in Korean adults.

  17. Mean – Variance parametric Model for the Classification based on Cries of Babies

    OpenAIRE

    Khalid Nazim S. A; Dr. M.B Sanjay Pande

    2010-01-01

    Cry is a feature which makes a individual to take certain care about the infant which has initiated it. It is also equally understood that cry makes a person to take certain steps. In the present work, we have tried to implement a mathematical model which can classify the cry into its cluster or group based on certain parameters based on which a cry is classified into a normal or abnormal. To corroborate the methodology we taken 17 distinguished features of cry. The implemented mathematical m...

  18. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  19. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  20. Familial factors responsible for persistent crying-induced asthma: a case report.

    Science.gov (United States)

    Weinstein, A G

    1987-10-01

    Crying behavior of the asthmatic child may induce wheezing symptoms. This may be a clinical problem for families with asthmatic children who exhibit frequent and persistent crying behavior. This case report identifies behaviors by the child and parents that may be responsible for continual crying. Child factors include (1) "spoiled" personality, (2) poor self-image, (3) biologic sensitivity to foods, medication, and environmental allergens producing irritability. Parental factors include poor disciplinary practices secondary to (1) disrupted home life, (2) guilt, and (3) overprotective behavior. Identification of these factors may be helpful in establishing clinical management strategies to reduce crying-induced asthma.

  1. Susceptibility of field populations of the fall armyworm (Lepidoptera: Noctuidae) from Florida and Puerto Rico to purified Cry1F protein and corn leaf tissue containing single and pyramided Bt genes

    Science.gov (United States)

    Larval survival of Cry1F-susceptible (FL), -resistant (PR and Cry1F-RR), and -heterozygous (FL x PR and Cry1F-RS) populations of the fall armyworm, Spodoptera frugiperda (J.E. Smith) to purified Cry1F protein and corn leaf tissue of seven Bacillus thuringiensis (Bt) corn hybrids and five non-Bt corn...

  2. Geographical and Temporal Variability in Susceptibility to Cry1F Toxin From Bacillus thuringiensis in Spodoptera frugiperda (Lepidoptera: Noctuidae) Populations in Brazil.

    Science.gov (United States)

    Farias, Juliano R; Horikoshi, Renato J; Santos, Antonio C; Omoto, Celso

    2014-12-01

    The genetically modified maize TC1507 event with the cry1F gene (Cry1F maize) has been used to control Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae) in Brazil since the 2009-2010 cropping season. As part of the insect resistance management program, we conducted studies to determine the baseline susceptibility to Cry1F before the widespread planting of Cry1F maize. Subsequently, we evaluated the geographical and temporal variability of susceptibility to this toxin in populations of S. frugiperda collected from major maize-growing regions in Brazil. The baseline susceptibility to Cry1F was determined using a diet-overlay bioassay for a susceptible reference population and four field populations of S. frugiperda. We then monitored the susceptibility to Cry1F in 43 populations of S. frugiperda sampled in nine States of Brazil between 2011 and 2013. In the baseline study, the MIC50 (the concentration that inhibits molting to second instars in 50% of individuals) ranged from 3.59 to 72.47 ng Cry1F toxin per centimeter square. Based on the upper limit of the MIC99 value of the joint analysis from the baseline susceptibility data, the concentrations of 200 and 2,000 ng of Cry1F toxin per centimeter square were defined as diagnostic concentrations for potentially resistant individuals, and these were used to monitor the susceptibility of S. frugiperda to Cry1F. Survival at 2,000 ng Cry1F toxin per centimeter square increased significantly throughout the cropping seasons in S. frugiperda populations from São Paulo, Santa Catarina, Rio Grande do Sul, Bahia, Mato Grosso, Goiás, Mato Grosso do Sul, and Paraná. The highest survival (>50%) was reached in populations collected from Bahia, Mato Grosso, Goiás, Mato Grosso do Sul, and Paraná during the 2012-2013 cropping season. Therefore, a significant decrease in susceptibility to Cry1F was detected in S. frugiperda throughout cropping seasons, especially in regions with intensive maize production in Brazil

  3. Analysis of infant cry through weighted linear prediction cepstral coefficients and Probabilistic Neural Network.

    Science.gov (United States)

    Hariharan, M; Chee, Lim Sin; Yaacob, Sazali

    2012-06-01

    Acoustic analysis of infant cry signals has been proven to be an excellent tool in the area of automatic detection of pathological status of an infant. This paper investigates the application of parameter weighting for linear prediction cepstral coefficients (LPCCs) to provide the robust representation of infant cry signals. Three classes of infant cry signals were considered such as normal cry signals, cry signals from deaf babies and babies with asphyxia. A Probabilistic Neural Network (PNN) is suggested to classify the infant cry signals into normal and pathological cries. PNN is trained with different spread factor or smoothing parameter to obtain better classification accuracy. The experimental results demonstrate that the suggested features and classification algorithms give very promising classification accuracy of above 98% and it expounds that the suggested method can be used to help medical professionals for diagnosing pathological status of an infant from cry signals.

  4. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  5. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  6. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  7. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  8. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  9. Systems-level analysis of risk genes reveals the modular nature of schizophrenia.

    Science.gov (United States)

    Liu, Jiewei; Li, Ming; Luo, Xiong-Jian; Su, Bing

    2018-05-19

    Schizophrenia (SCZ) is a complex mental disorder with high heritability. Genetic studies (especially recent genome-wide association studies) have identified many risk genes for schizophrenia. However, the physical interactions among the proteins encoded by schizophrenia risk genes remain elusive and it is not known whether the identified risk genes converge on common molecular networks or pathways. Here we systematically investigated the network characteristics of schizophrenia risk genes using the high-confidence protein-protein interactions (PPI) from the human interactome. We found that schizophrenia risk genes encode a densely interconnected PPI network (P = 4.15 × 10 -31 ). Compared with the background genes, the schizophrenia risk genes in the interactome have significantly higher degree (P = 5.39 × 10 -11 ), closeness centrality (P = 7.56 × 10 -11 ), betweeness centrality (P = 1.29 × 10 -11 ), clustering coefficient (P = 2.22 × 10 -2 ), and shorter average shortest path length (P = 7.56 × 10 -11 ). Based on the densely interconnected PPI network, we identified 48 hub genes and 4 modules formed by highly interconnected schizophrenia genes. We showed that the proteins encoded by schizophrenia hub genes have significantly more direct physical interactions. Gene ontology (GO) analysis revealed that cell adhesion, cell cycle, immune system response, and GABR-receptor complex categories were enriched in the modules formed by highly interconnected schizophrenia risk genes. Our study reveals that schizophrenia risk genes encode a densely interconnected molecular network and demonstrates the modular nature of schizophrenia. Copyright © 2018 Elsevier B.V. All rights reserved.

  10. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  11. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  12. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  13. Neonatal facial coding system scores and spectral characteristics of infant crying during newborn circumcision.

    Science.gov (United States)

    Lehr, Victoria Tutag; Zeskind, Philip Sanford; Ofenstein, John P; Cepeda, Eugene; Warrier, Indulekha; Aranda, J V

    2007-06-01

    To determine the relations between Neonatal Facial Coding System (NFCS) scores and measures of infant crying during newborn circumcision. Video and audio recordings were made of infant facial activity and cry sounds, respectively, during the lysis phase of circumcisions of 44 healthy term males (analgesia before circumcision. NFCS scores were determined by blinded assistant from video recordings of facial activity. Measures of infant crying were determined via spectrum analysis of audio recordings by a blinded, independent researcher. Pearson product-moment correlations were used to examine relationship between NFCS scores and measures of crying. Principal component factor analysis detected dimensions underlying related measures of crying. Factor scores from a factor analysis were used in stepwise linear regression to predict NFCS scores. Higher NFCS scores correlated with lower peak fundamental frequency of crying (P<0.01) and with higher amplitudes of crying at peak fundamental frequency and dominant frequency and in overall cry sample (P<0.01). The factor analysis showed 3 significant orthogonal dimensions underlying measures of crying: Power and Velocity (amplitude and rapidity), Pitch of Crying (frequency characteristics), and Infant Arousal (turbulence and intensity) accounting for 42.3%, 17.8%, and 14.6% of variance, respectively. A regression analysis showed all 3 factor scores accounted for significant and separate portions of variance (P<0.001). The best predictor of NFCS score was Power and Velocity (P<0.002), followed by Infant Arousal (P<0.002), and Pitch of Crying (P<0.007). These data provide some of the first known evidence linking specific measures of infant crying with an independent, validated measure of pain.

  14. 40 CFR 174.505 - Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis modified Cry3A protein (mCry3A) in corn; exemption from the requirement of a tolerance. 174.505 Section 174.505 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS...

  15. Intended Sensitive and Harsh Caregiving Responses to Infant Crying: The Role of Cry Pitch and Perceived Urgency in an Adult Twin Sample

    Science.gov (United States)

    Out, Dorothee; Pieper, Suzanne; Bakermans-Kranenburg, Marian J.; Zeskind, Philip Sanford; van IJzendoorn, Marinus H.

    2010-01-01

    Objective: To examine the underlying mechanisms of adults' intended caregiving responses to cry sounds in a behavioral genetic design and to investigate the role of cry pitch and perceived urgency in sensitive and harsh caregiving responses. Methods: The sample consisted of 184 adult twin pairs (18-69 years), including males and females, parents…

  16. Efectividad de las salidas frontal y lateral para la prueba de pista 300 metros CRI, patinaje de velocidad sobre ruedas

    OpenAIRE

    Bohórquez-Páez, Daniel A. A; Pinzón-Castro, Luis A; Obando-Bastidas, Jorge A

    2014-01-01

    Se analizó y evaluó biomecánicamente, desde el plano sagital izquierdo, la Salida Frontal (SF) y la Salida Lateral (SL) en pruebas de velocidad de pista Contra el Reloj Individual (CRI), de once (11) Patinadores de Velocidad Sobre Ruedas (VSR), empleando el Software SIMI°Twinner Pro y el software SPSS (versión 19); lo que permitió determinar que la SF es la más efectiva que la SL para el desarrollo de las pruebas CRI en el patinaje de VSR. We analyzed and evaluated biomechanically, from th...

  17. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  18. [Cloning and expression analysis of a zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein encoding gene in Dendrobium officinale].

    Science.gov (United States)

    Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing

    2015-01-01

    The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.

  19. α1B-Adrenergic receptor signaling controls circadian expression of Tnfrsf11b by regulating clock genes in osteoblasts

    Directory of Open Access Journals (Sweden)

    Takao Hirai

    2015-11-01

    Full Text Available Circadian clocks are endogenous and biological oscillations that occur with a period of <24 h. In mammals, the central circadian pacemaker is localized in the suprachiasmatic nucleus (SCN and is linked to peripheral tissues through neural and hormonal signals. In the present study, we investigated the physiological function of the molecular clock on bone remodeling. The results of loss-of-function and gain-of-function experiments both indicated that the rhythmic expression of Tnfrsf11b, which encodes osteoprotegerin (OPG, was regulated by Bmal1 in MC3T3-E1 cells. We also showed that REV-ERBα negatively regulated Tnfrsf11b as well as Bmal1 in MC3T3-E1 cells. We systematically investigated the relationship between the sympathetic nervous system and the circadian clock in osteoblasts. The administration of phenylephrine, a nonspecific α1-adrenergic receptor (AR agonist, stimulated the expression of Tnfrsf11b, whereas the genetic ablation of α1B-AR signaling led to the alteration of Tnfrsf11b expression concomitant with Bmal1 and Per2 in bone. Thus, this study demonstrated that the circadian regulation of Tnfrsf11b was regulated by the clock genes encoding REV-ERBα (Nr1d1 and Bmal1 (Bmal1, also known as Arntl, which are components of the core loop of the circadian clock in osteoblasts.

  20. Thylakoid redox signals are integrated into organellar-gene-expression-dependent retrograde signalling in the prors1-1 mutant

    Directory of Open Access Journals (Sweden)

    Luca eTadini

    2012-12-01

    Full Text Available Perturbations in organellar gene expression (OGE and the thylakoid redox state (TRS activate retrograde signalling pathways that adaptively modify nuclear gene expression (NGE, according to developmental and metabolic needs. The prors1-1 mutation in Arabidopsis down-regulates the expression of the nuclear gene Prolyl-tRNA Synthetase1 (PRORS1 which acts in both plastids and mitochondria, thereby impairing protein synthesis in both organelles and triggering OGE-dependent retrograde signalling. Because the mutation also affects thylakoid electron transport, TRS-dependent signals may likewise have an impact on the changes in NGE observed in this genotype. In this study, we have investigated whether signals related to TRS are actually integrated into the OGE-dependent retrograde signalling pathway. To this end, the chaos mutation (for chlorophyll a/b binding protein harvesting-organelle specific, which shows a partial loss of PSII antennae proteins and thus a reduction in PSII light absorption capability, was introduced into the prors1-1 mutant background. The resulting double mutant displayed a prors1-1-like reduction in plastid translation rate and a chaos-like decrease in PSII antenna size, whereas the hyper-reduction of the thylakoid electron transport chain, caused by the prors1-1 mutation, was alleviated, as determined by monitoring chlorophyll (Chl fluorescence and thylakoid phosphorylation. Interestingly, a substantial fraction of the nucleus-encoded photosynthesis genes down-regulated in the prors1-1 mutant are expressed at nearly wild-type rates in prors1-1 chaos leaves, and this recovery is reflected in the steady-state levels of their protein products in the chloroplast. We therefore conclude that signals related to photosynthetic electron transport and TRS, and indirectly to carbohydrate metabolism and energy balance, are indeed fed into the OGE-dependent retrograde pathway to modulate NGE and adjust the abundance of chloroplast proteins.

  1. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  2. Atypical cry acoustics in 6-month-old infants at risk for autism spectrum disorder.

    Science.gov (United States)

    Sheinkopf, Stephen J; Iverson, Jana M; Rinaldi, Melissa L; Lester, Barry M

    2012-10-01

    This study examined differences in acoustic characteristics of infant cries in a sample of babies at risk for autism and a low-risk comparison group. Cry samples derived from vocal recordings of 6-month-old infants at risk for autism spectrum disorder (ASD; n = 21) and low-risk infants (n = 18) were subjected to acoustic analyses using analysis software designed for this purpose. Cries were categorized as either pain-related or non-pain-related based on videotape coding. At-risk infants produced pain-related cries with higher and more variable fundamental frequency (F (0) ) than low-risk infants. At-risk infants later classified with ASD at 36 months had among the highest F (0) values for both types of cries and produced cries that were more poorly phonated than those of nonautistic infants, reflecting cries that were less likely to be produced in a voiced mode. These results provide preliminary evidence that disruptions in cry acoustics may be part of an atypical vocal signature of autism in early life. © 2012 International Society for Autism Research, Wiley Periodicals, Inc.

  3. The Arabidopsis GASA10 gene encodes a cell wall protein strongly expressed in developing anthers and seeds.

    Science.gov (United States)

    Trapalis, Menelaos; Li, Song Feng; Parish, Roger W

    2017-07-01

    The Arabidopsis GASA10 gene encodes a GAST1-like (Gibberellic Acid-Stimulated) protein. Reporter gene analysis identified consistent expression in anthers and seeds. In anthers expression was developmentally regulated, first appearing at stage 7 of anther development and reaching a maximum at stage 11. Strongest expression was in the tapetum and developing microspores. GASA10 expression also occurred throughout the seed and in root vasculature. GASA10 was shown to be transported to the cell wall. Using GASA1 and GASA6 as positive controls, gibberellic acid was found not to induce GASA10 expression in Arabidopsis suspension cells. Overexpression of GASA10 (35S promoter-driven) resulted in a reduction in silique elongation. GASA10 shares structural similarities to the antimicrobial peptide snakin1, however, purified GASA10 failed to influence the growth of a variety of bacterial and fungal species tested. We propose cell wall associated GASA proteins are involved in regulating the hydroxyl radical levels at specific sites in the cell wall to facilitate wall growth (regulating cell wall elongation). Copyright © 2017 Elsevier B.V. All rights reserved.

  4. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  5. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  6. Expressed sequence tags from larval gut of the European corn borer (Ostrinia nubilalis: Exploring candidate genes potentially involved in Bacillus thuringiensis toxicity and resistance

    Directory of Open Access Journals (Sweden)

    Crespo Andre LB

    2009-06-01

    Full Text Available Abstract Background Lepidoptera represents more than 160,000 insect species which include some of the most devastating pests of crops, forests, and stored products. However, the genomic information on lepidopteran insects is very limited. Only a few studies have focused on developing expressed sequence tag (EST libraries from the guts of lepidopteran larvae. Knowledge of the genes that are expressed in the insect gut are crucial for understanding basic physiology of food digestion, their interactions with Bacillus thuringiensis (Bt toxins, and for discovering new targets for novel toxins for use in pest management. This study analyzed the ESTs generated from the larval gut of the European corn borer (ECB, Ostrinia nubilalis, one of the most destructive pests of corn in North America and the western world. Our goals were to establish an ECB larval gut-specific EST database as a genomic resource for future research and to explore candidate genes potentially involved in insect-Bt interactions and Bt resistance in ECB. Results We constructed two cDNA libraries from the guts of the fifth-instar larvae of ECB and sequenced a total of 15,000 ESTs from these libraries. A total of 12,519 ESTs (83.4% appeared to be high quality with an average length of 656 bp. These ESTs represented 2,895 unique sequences, including 1,738 singletons and 1,157 contigs. Among the unique sequences, 62.7% encoded putative proteins that shared significant sequence similarities (E-value ≤ 10-3with the sequences available in GenBank. Our EST analysis revealed 52 candidate genes that potentially have roles in Bt toxicity and resistance. These genes encode 18 trypsin-like proteases, 18 chymotrypsin-like proteases, 13 aminopeptidases, 2 alkaline phosphatases and 1 cadherin-like protein. Comparisons of expression profiles of 41 selected candidate genes between Cry1Ab-susceptible and resistant strains of ECB by RT-PCR showed apparently decreased expressions in 2 trypsin-like and 2

  7. Bacillus thuringiensis delta-endotoxin Cry1 hybrid proteins with increased activity against the Colorado potato beetle

    NARCIS (Netherlands)

    Naimov, S.; Weemen-Hendriks, M.; Dukiandjiev, S.; Maagd, de R.A.

    2001-01-01

    Cry1 delta-endotoxins of Bacillus thuringiensis are generally active against lepidopteran insects, but Cry1Ba and Cry1Ia have additional, though low, levels of activity against coleopterans such as the Colorado potato beetle. Here we report the construction of Cry1Ba/Cry1Ia hybrid toxins which have

  8. Degradation and detection of transgenic Bacillus thuringiensis DNA and proteins in flour of three genetically modified rice events submitted to a set of thermal processes.

    Science.gov (United States)

    Wang, Xiaofu; Chen, Xiaoyun; Xu, Junfeng; Dai, Chen; Shen, Wenbiao

    2015-10-01

    This study aimed to investigate the degradation of three transgenic Bacillus thuringiensis (Bt) genes (Cry1Ab, Cry1Ac, and Cry1Ab/Ac) and the corresponding encoded Bt proteins in KMD1, KF6, and TT51-1 rice powder, respectively, following autoclaving, cooking, baking, or microwaving. Exogenous Bt genes were more stable than the endogenous sucrose phosphate synthase (SPS) gene, and short DNA fragments were detected more frequently than long DNA fragments in both the Bt and SPS genes. Autoclaving, cooking (boiling in water, 30 min), and baking (200 °C, 30 min) induced the most severe Bt protein degradation effects, and Cry1Ab protein was more stable than Cry1Ac and Cry1Ab/Ac protein, which was further confirmed by baking samples at 180 °C for different periods of time. Microwaving induced mild degradation of the Bt and SPS genes, and Bt proteins, whereas baking (180 °C, 15 min), cooking and autoclaving led to further degradation, and baking (200 °C, 30 min) induced the most severe degradation. The findings of the study indicated that degradation of the Bt genes and proteins somewhat correlated with the treatment intensity. Polymerase chain reaction, enzyme-linked immunosorbent assay, and lateral flow tests were used to detect the corresponding transgenic components. Strategies for detecting transgenic ingredients in highly processed foods are discussed. Copyright © 2015 Elsevier Ltd. All rights reserved.

  9. Evaluation of 6 candidate genes on chromosome 11q23 for coeliac disease susceptibility: a case control study

    Directory of Open Access Journals (Sweden)

    Close Eimear

    2010-05-01

    Full Text Available Abstract Background Recent whole genome analysis and follow-up studies have identified many new risk variants for coeliac disease (CD, gluten intolerance. The majority of newly associated regions encode candidate genes with a clear functional role in T-cell regulation. Furthermore, the newly discovered risk loci, together with the well established HLA locus, account for less than 50% of the heritability of CD, suggesting that numerous additional loci remain undiscovered. Linkage studies have identified some well-replicated risk regions, most notably chromosome 5q31 and 11q23. Methods We have evaluated six candidate genes in one of these regions (11q23, namely CD3E, CD3D, CD3G, IL10RA, THY1 and IL18, as risk factors for CD using a 2-phase candidate gene approach directed at chromosome 11q. 377 CD cases and 349 ethnically matched controls were used in the initial screening, followed by an extended sample of 171 additional coeliac cases and 536 additional controls. Results Promotor SNPs (-607, -137 in the IL18 gene, which has shown association with several autoimmune diseases, initially suggested association with CD (P IL18-137/-607 also supported this effect, primarily due to one relatively rare haplotype IL18-607C/-137C (P Conclusion Haplotypes of the IL18 promotor region may contribute to CD risk, consistent with this cytokine's role in maintaining inflammation in active CD.

  10. National survey of Australian paediatricians' approach to infant crying.

    Science.gov (United States)

    Rimer, Romi; Hiscock, Harriet

    2014-03-01

    Persistent crying in infancy (i.e. crying that lasts for more than 3 h a day for more than 3 days per week for at least 3 weeks) is widespread. Although there is no gold standard approach to its management, guidelines exist with common management principles. This study aims to document how Australian general paediatricians (i) assess and manage persistent crying compared with published guidelines; (ii) screen for and manage associated post-natal depression; and (iii) rate their training in this area. Online survey were administered to all 394 members of the Australian Paediatric Research Network in November 2011 to February 2012. Members are predominantly general paediatricians. A total of 168 paediatricians (45%) responded. The majority (n = 96 (69%)) take one session to assess infant crying and at least two sessions to manage it (n = 106 (79%)). Specific approaches are not always evidence based (e.g. use of antacids/simethicone by 8%) and do not follow available guidelines. Most paediatricians routinely asked about maternal (n = 120 (88%)) but not paternal (n = 51 (33%)) mental health. Paediatricians typically received training around this issue before rather than after gaining formal paediatric qualifications (61% vs. 37%, respectively) and rate their training as satisfactory (67%). Despite this, only 39% feel very confident in managing infant crying. The lack of a gold standard approach to managing persistent infant crying has likely contributed to a lack of uniform care among Australian general paediatricians. Given that most paediatricians do not feel very confident in dealing with this problem, there is a scope for further training supported by evidence-based guidelines. © 2013 The Authors. Journal of Paediatrics and Child Health © 2013 Paediatrics and Child Health Division (Royal Australasian College of Physicians).

  11. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  12. Cry1A(b)16 toxin from Bacillus thuringiensis: Theoretical refinement of three-dimensional structure and prediction of peptides as molecular markers for detection of genetically modified organisms.

    Science.gov (United States)

    Plácido, Alexandra; Coelho, Andreia; Abreu Nascimento, Lucas; Gomes Vasconcelos, Andreanne; Fátima Barroso, Maria; Ramos-Jesus, Joilson; Costa, Vladimir; das Chagas Alves Lima, Francisco; Delerue-Matos, Cristina; Martins Ramos, Ricardo; Marani, Mariela M; Roberto de Souza de Almeida Leite, José

    2017-07-01

    Transgenic maize produced by the insertion of the Cry transgene into its genome became the second most cultivated crop worldwide. Cry gene from Bacillus thuringiensis kurstaki expresses protein derivatives of crystalline endotoxins which confer insect resistance onto the maize crop. Mandatory labeling of processed food containing or made by genetically modified organisms is in force in many countries, so, it is very urgent to develop fast and practical methods for GMO identification, for example, biosensors. In the absence of an available empirical structure of Cry1A(b)16 protein, a theoretical model was effectively generated, in this work, by homology modeling and molecular dynamics simulations based on two available homologous protein structures. Molecular dynamics simulations were carried out to refine the selected model, and an analysis of its global structure was performed. The refined models of Cry1A(b)16 showed a standard fold and structural characteristics similar to those seen in Bacillus thuringiensis Cry1A(a) insecticidal toxin and Bacillus thuringiensis serovar kurstaki Cry1A(c) toxin. After in silico analysis of Cry1A(b)16, two immunoreactive candidate peptides were selected and specific polyclonal antibodies were produced resulting in antibody-peptide interaction. Biosensing devices are expected to be developed for detection of the Cry1A(b) protein as a marker of transgenic maize in food. Proteins 2017; 85:1248-1257. © 2017 Wiley Periodicals, Inc. © 2017 Wiley Periodicals, Inc.

  13. 40 CFR 174.506 - Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of...

    Science.gov (United States)

    2010-07-01

    ... 40 Protection of Environment 23 2010-07-01 2010-07-01 false Bacillus thuringiensis Cry34Ab1 and Cry35Ab1 proteins in corn; exemption from the requirement of a tolerance. 174.506 Section 174.506 Protection of Environment ENVIRONMENTAL PROTECTION AGENCY (CONTINUED) PESTICIDE PROGRAMS PROCEDURES AND REQUIREMENTS FOR PLANT-INCORPORATED PROTECTANTS...

  14. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  15. Influence of transgenic rice expressing a fused Cry1Ab/1Ac protein on frogs in paddy fields.

    Science.gov (United States)

    Wang, Jia-Mei; Chen, Xiu-Ping; Liang, Yu-Yong; Zhu, Hao-Jun; Ding, Jia-Tong; Peng, Yu-Fa

    2014-11-01

    As genetic engineering in plants is increasingly used to control agricultural pests, it is important to determine whether such transgenic plants adversely affect non-target organisms within and around cultivated fields. The cry1Ab/1Ac fusion gene from Bacillus thuringiensis (Bt) has insecticidal activity and has been introduced into rice line Minghui 63 (MH63). We evaluated the effect of transgenic cry1Ab/1Ac rice (Huahui 1, HH1) on paddy frogs by comparing HH1 and MH63 rice paddies with and without pesticide treatment. The density of tadpoles in rice fields was surveyed at regular intervals, and Cry1Ab/1Ac protein levels were determined in tissues of tadpoles and froglets collected from the paddy fields. In addition, Rana nigromaculata froglets were raised in purse nets placed within these experimental plots. The survival, body weight, feeding habits, and histological characteristics of the digestive tract of these froglets were analyzed. We found that the tadpole density was significantly decreased immediately after pesticide application, and the weight of R. nigromaculata froglets of pesticide groups was significantly reduced compared with no pesticide treatment, but we found no differences between Bt and non-Bt rice groups. Moreover, no Cry1Ab/1Ac protein was detected in tissue samples collected from 192 tadpoles and froglets representing all four experimental groups. In addition, R. nigromaculata froglets raised in purse seines fed primarily on stem borer and non-target insects, and showed no obvious abnormality in the microstructure of their digestive tracts. Based on these results, we conclude that cultivation of transgenic cry1Ab/1Ac rice does not adversely affect paddy frogs.

  16. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  17. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  18. Inheritance of Cry1F resistance, cross-resistance and frequency of resistant alleles in Spodoptera frugiperda (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Vélez, A M; Spencer, T A; Alves, A P; Moellenbeck, D; Meagher, R L; Chirakkal, H; Siegfried, B D

    2013-12-01

    Transgenic maize, Zea maize L., expressing the Cry1F protein from Bacillus thuringiensis has been registered for Spodoptera frugiperda (J. E. Smith) control since 2003. Unexpected damage to Cry1F maize was reported in 2006 in Puerto Rico and Cry1F resistance in S. frugiperda was documented. The inheritance of Cry1F resistance was characterized in a S. frugiperda resistant strain originating from Puerto Rico, which displayed >289-fold resistance to purified Cry1F. Concentration-response bioassays of reciprocal crosses of resistant and susceptible parental populations indicated that resistance is recessive and autosomal. Bioassays of the backcross of the F1 generation crossed with the resistant parental strain suggest that a single locus is responsible for resistance. In addition, cross-resistance to Cry1Aa, Cry1Ab, Cry1Ac, Cry1Ba, Cry2Aa and Vip3Aa was assessed in the Cry1F-resistant strain. There was no significant cross-resistance to Cry1Aa, Cry1Ba and Cry2Aa, although only limited effects were observed in the susceptible strain. Vip3Aa was highly effective against susceptible and resistant insects indicating no cross-resistance with Cry1F. In contrast, low levels of cross-resistance were observed for both Cry1Ab and Cry1Ac. Because the resistance is recessive and conferred by a single locus, an F1 screening assay was used to measure the frequency of Cry1F-resistant alleles from populations of Florida and Texas in 2010 and 2011. A total frequency of resistant alleles of 0.13 and 0.02 was found for Florida and Texas populations, respectively, indicating resistant alleles could be found in US populations, although there have been no reports of reduced efficacy of Cry1F-expressing plants.

  19. Existence of a photoinducible phase for ovarian development and photoperiod-related alteration of clock gene expression in a damselfish.

    Science.gov (United States)

    Takeuchi, Yuki; Hada, Noriko; Imamura, Satoshi; Hur, Sung-Pyo; Bouchekioua, Selma; Takemura, Akihiro

    2015-10-01

    The sapphire devil, Chrysiptera cyanea, is a reef-associated damselfish and their ovarian development can be induced by a long photoperiod. In this study, we demonstrated the existence of a photoinducible phase for the photoperiodic ovarian development in the sapphire devil. Induction of ovarian development under night-interruption light schedules and Nanda-Hamner cycles revealed that the photoinducible phase appeared in a circadian manner between ZT12 and ZT13. To characterize the effect of photoperiod on clock gene expression in the brain of this species, we determined the expression levels of the sdPer1, sdPer2, sdCry1, and sdCry2 clock genes under constant light and dark conditions (LL and DD) and photoperiodic (short and long photoperiods). The expression of sdPer1 exhibited clear circadian oscillation under both LL and DD conditions, while sdPer2 and sdCry1 expression levels were lower under DD than under LL conditions and sdCry2 expression was lower under LL than under DD conditions. These results suggest a key role for sdPer1 in circadian clock cycling and that sdPer2, sdCry1, and sdCry2 are light-responsive clock genes in the sapphire devil. After 1 week under a long photoperiod, we observed photoperiod-related changes in sdPer1, sdPer2, and sdCry2 expression, but not in sdCry1 expression. These results suggest that the expression patterns of some clock genes exhibit seasonal variation according to seasonal changes in day length and that such seasonal alteration of clock gene expression may contribute to seasonal recognition by the sapphire devil. Copyright © 2015 Elsevier Inc. All rights reserved.

  20. The interaction of two-spotted spider mites, Tetranychus urticae Koch, with Cry protein production and predation by Amblyseius andersoni (Chant) in Cry1Ac/Cry2Ab cotton and Cry1F maize.

    Science.gov (United States)

    Crops producing insecticidal crystal (Cry) proteins from the bacterium, Bacillus thuringiensis (Bt), are an important tool for managing lepidopteran pests on cotton and maize. However, the effects of these Bt crops on non-target organisms, especially natural enemies that provide biological control s...

  1. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  2. Neonatal diabetes mellitus: description of two Puerto Rican children with KCNJ11 activating gene mutation.

    Science.gov (United States)

    Nieves-Rivera, Francisco; González-Pijem, Lilliam

    2011-06-01

    Neonatal diabetes mellitus (NDM) is a rare disorder. A one-month-old boy presented with vomiting, hyperglycemia (968 mg/dl [53.8 mmol/L]), severe acetonemia, and metabolic acidosis (pH 6.95, HCO3-4.2 mmol/L). A second child (three months of age) presented with upper respiratory tract symptoms and a plasma glucose level of 835 mg/dl, without acetonemia or acidosis. Both were hospitalized and managed with intravenous fluids and then discharged on insulin. Genetic testing identified the presence of the de nova V59M and E322K activating mutations in the KCNJ11 gene encoding the sulphonylurea/potassium channel (Kir6.2 subunit) of the insulin beta cell. Both patients were switched to glibenclamide and remain off insulin. To our knowledge, these are the first children in Puerto Rico identified with NDM secondary to a KCNJ11 activating mutation. We conclude that NDM secondary to KCNJ11/Kir6.2 activating mutations, although unusual, should be considered in similar cases since patients with these mutations could come off insulin.

  3. The effect of nitrogen rate on transgenic corn Cry3Bb1 protein expression.

    Science.gov (United States)

    Marquardt, Paul T; Krupke, Christian H; Camberato, James J; Johnson, William G

    2014-05-01

    Combining herbicide-resistant and Bacillus thuringiensis (Bt) traits in corn (Zea mays L.) hybrids may affect insect resistance management owing to volunteer corn. Some Bt toxins may be expressed at lower levels by nitrogen-deficient corn roots. Corn plants with sublethal levels of Bt expression could accelerate the evolution of Bt resistance in target insects. The present objective was to quantify the concentration of Bt (Cry3Bb1) in corn root tissue with varying tissue nitrogen concentrations. Expression of Cry3Bb1 toxin in root tissue was highly variable, but there were no differences in the overall concentration of Cry3Bb1 expressed between roots taken from Cry3Bb1-positive volunteer and hybrid corn plants. The nitrogen rate did affect Cry3Bb1 expression in the greenhouse, less nitrogen resulted in decreased Cry3Bb1 expression, yet this result was not documented in the field. A positive linear relationship of plant nitrogen status on Cry3Bb1 toxin expression was documented. Also, high variability in Cry3Bb1 expression is potentially problematic from an insect resistance management perspective. This variability could create a mosaic of toxin doses in the field, which does not fit into the high-dose refuge strategy and could alter predictions about the speed of evolution of resistance to Cry3Bb1 in western corn rootworm Diabrotica virgifera virgifera LeConte. © 2013 Society of Chemical Industry.

  4. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  5. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  6. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  7. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  8. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  9. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  10. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  11. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  12. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  13. Mothers' perception of excessive crying in infancy in south eastern ...

    African Journals Online (AJOL)

    We undertook this study to determine the prevalence of excessive crying in our area of practice and also determine associated factors. Method: This was a cross sectional, questionnaire based descriptive study on mothers' perception of their infants' crying. Subjects were mother/ infant pairs attending the well baby clinics at ...

  14. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  15. Role of type II protein arginine methyltransferase 5 in the regulation of Circadian Per1 gene.

    Directory of Open Access Journals (Sweden)

    Jungtae Na

    Full Text Available Circadian clocks are the endogenous oscillators that regulate rhythmic physiological and behavioral changes to correspond to daily light-dark cycles. Molecular dissections have revealed that transcriptional feedback loops of the circadian clock genes drive the molecular oscillation, in which PER/CRY complexes inhibit the transcriptional activity of the CLOCK/BMAL1 heterodimer to constitute a negative feedback loop. In this study, we identified the type II protein arginine methyltransferase 5 (PRMT5 as an interacting molecule of CRY1. Although the Prmt5 gene was constitutively expressed, increased interaction of PRMT5 with CRY1 was observed when the Per1 gene was repressed both in synchronized mouse liver and NIH3T3 cells. Moreover, rhythmic recruitment of PRMT5 and CRY1 to the Per1 gene promoter was found to be associated with an increased level of histone H4R3 dimethylation and Per1 gene repression. Consistently, decreased histone H4R3 dimethylation and altered rhythmic Per1 gene expression were observed in Prmt5-depleted cells. Taken together, these findings provide an insight into the link between histone arginine methylation by PRMT5 and transcriptional regulation of the circadian Per1 gene.

  16. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  17. Consumption of Bt Rice Pollen Containing Cry1C or Cry2A Protein Poses a Low to Negligible Risk to the Silkworm Bombyx mori (Lepidoptera: Bombyxidae)

    Science.gov (United States)

    Yang, Yan; Liu, Yue; Cao, Fengqin; Chen, Xiuping; Cheng, Lisheng; Romeis, Jörg; Li, Yunhe; Peng, Yufa

    2014-01-01

    By consuming mulberry leaves covered with pollen from nearby genetically engineered, insect-resistant rice lines producing Cry proteins derived from Bacillus thuringiensis (Bt), larvae of the domestic silkworm, Bombyx mori (Linnaeus) (Lepidoptera: Bombyxidae), could be exposed to insecticidal proteins. Laboratory experiments were conducted to assess the potential effects of Cry1C- or Cry2A-producing transgenic rice (T1C-19, T2A-1) pollen on B. mori fitness. In a short-term assay, B. mori larvae were fed mulberry leaves covered with different densities of pollen from Bt rice lines or their corresponding near isoline (control) for the first 3 d and then were fed mulberry leaves without pollen. No effect was detected on any life table parameter, even at 1800 pollen grains/cm2 leaf, which is much higher than the mean natural density of rice pollen on leaves of mulberry trees near paddy fields. In a long-term assay, the larvae were fed Bt and control pollen in the same way but for their entire larval stage (approximately 27 d). Bt pollen densities ≥150 grains/cm2 leaf reduced 14-d larval weight, increased larval development time, and reduced adult eclosion rate. ELISA analyses showed that 72.6% of the Cry protein was still detected in the pollen grains excreted with the feces. The low exposure of silkworm larvae to Cry proteins when feeding Bt rice pollen may be the explanation for the relatively low toxicity detected in the current study. Although the results demonstrate that B. mori larvae are sensitive to Cry1C and Cry2A proteins, the exposure levels that harmed the larvae in the current study are far greater than natural exposure levels. We therefore conclude that consumption of Bt rice pollen will pose a low to negligible risk to B. mori. PMID:25014054

  18. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  19. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  20. A Novel Tenebrio molitor Cadherin Is a Functional Receptor for Bacillus thuringiensis Cry3Aa Toxin*

    Science.gov (United States)

    Fabrick, Jeff; Oppert, Cris; Lorenzen, Marcé D.; Morris, Kaley; Oppert, Brenda; Jurat-Fuentes, Juan Luis

    2009-01-01

    Cry toxins produced by the bacterium Bacillus thuringiensis are effective biological insecticides. Cadherin-like proteins have been reported as functional Cry1A toxin receptors in Lepidoptera. Here we present data that demonstrate that a coleopteran cadherin is a functional Cry3Aa toxin receptor. The Cry3Aa receptor cadherin was cloned from Tenebrio molitor larval midgut mRNA, and the predicted protein, TmCad1, has domain structure and a putative toxin binding region similar to those in lepidopteran cadherin B. thuringiensis receptors. A peptide containing the putative toxin binding region from TmCad1 bound specifically to Cry3Aa and promoted the formation of Cry3Aa toxin oligomers, proposed to be mediators of toxicity in lepidopterans. Injection of TmCad1-specific double-stranded RNA into T. molitor larvae resulted in knockdown of the TmCad1 transcript and conferred resistance to Cry3Aa toxicity. These data demonstrate the functional role of TmCad1 as a Cry3Aa receptor in T. molitor and reveal similarities between the mode of action of Cry toxins in Lepidoptera and Coleoptera. PMID:19416969

  1. Construction and characterisation of near-isogenic Plutella xylostella (Lepidoptera: Plutellidae) strains resistant to Cry1Ac toxin.

    Science.gov (United States)

    Zhu, Xun; Lei, Yanyuan; Yang, Yanjv; Baxter, Simon W; Li, Jianhong; Wu, Qingjun; Wang, Shaoli; Xie, Wen; Guo, Zhaojiang; Fu, Wei; Zhang, Youjun

    2015-02-01

    Resistance to insecticidal Bacillus thuringiensis (Bt) toxins has arisen in multiple populations of the worldwide Brassica pest Plutella xylostella (L.). To help elucidate the mechanism of resistance to Bt Cry1Ac toxin in a population from Florida, two pairs of near-isogenic lines (NILs) were developed. NILs were generated using either backcross or recombinant inbred line methodologies and evaluated for near-isogenicity with inter-simple-sequence-repeat (ISSR) markers. Backcross line BC6F4 maintained a similar level of Cry1Ac resistance to parental strain DBM1Ac-R (>5000-fold) yet showed 98.24% genetic similarity to the susceptible parental strain DBM1Ac-S. Single-pair backcrosses between DBM1Ac-S and BC6F4 revealed that Cry1Ac resistance was controlled by one recessive autosomal locus. BC6F4 exhibited high levels of cross-resistance to Cry1Ab and Cry1Ah but not to Cry1Ca or Cry1Ie. Near-isogenic strains were constructed to provide a reliable biological system to investigate the mechanism of Cry1Ac resistance in P. xylostella. These data suggest that resistance to Cry1Ac, Cry1Ab and Cry1Ah is probably caused by the alteration of a common receptor not recognised by Cry1Ca or Cry1Ie. Understanding Bt toxin cross-resistance provides valuable information to consider when developing pest control strategies to delay resistance evolution. © 2014 Society of Chemical Industry. © 2014 Society of Chemical Industry.

  2. Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis).

    Science.gov (United States)

    Oliveira, Gustavo R; Silva, Maria C M; Lucena, Wagner A; Nakasu, Erich Y T; Firmino, Alexandre A P; Beneventi, Magda A; Souza, Djair S L; Gomes, José E; de Souza, José D A; Rigden, Daniel J; Ramos, Hudson B; Soccol, Carlos R; Grossi-de-Sa, Maria F

    2011-09-09

    The cotton boll weevil (Anthonomus grandis) is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

  3. Improving Cry8Ka toxin activity towards the cotton boll weevil (Anthonomus grandis

    Directory of Open Access Journals (Sweden)

    Gomes José E

    2011-09-01

    Full Text Available Abstract Background The cotton boll weevil (Anthonomus grandis is a serious insect-pest in the Americas, particularly in Brazil. The use of chemical or biological insect control is not effective against the cotton boll weevil because of its endophytic life style. Therefore, the use of biotechnological tools to produce insect-resistant transgenic plants represents an important strategy to reduce the damage to cotton plants caused by the boll weevil. The present study focuses on the identification of novel molecules that show improved toxicity against the cotton boll weevil. In vitro directed molecular evolution through DNA shuffling and phage display screening was applied to enhance the insecticidal activity of variants of the Cry8Ka1 protein of Bacillus thuringiensis. Results Bioassays carried out with A. grandis larvae revealed that the LC50 of the screened mutant Cry8Ka5 toxin was 3.15-fold higher than the wild-type Cry8Ka1 toxin. Homology modelling of Cry8Ka1 and the Cry8Ka5 mutant suggested that both proteins retained the typical three-domain Cry family structure. The mutated residues were located mostly in loops and appeared unlikely to interfere with molecular stability. Conclusions The improved toxicity of the Cry8Ka5 mutant obtained in this study will allow the generation of a transgenic cotton event with improved potential to control A. grandis.

  4. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  5. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  6. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  7. Fatores de virulência de Bacillus thuringiensis: o que existe além das proteínas Cry

    Directory of Open Access Journals (Sweden)

    Gislayne Vilas-Bôas

    2012-03-01

    Virulence Factors of Bacillus thuringiensis Berliner: Something Beyond of Cry Proteins? Abstract. The Cry proteins produced by the entomopathogenic bacterium Bacillus thuringiensis Berliner are widely known due to its high toxicity against a variety of insects. The mode of action of these proteins is specific and becomes B. thuringiensis-based products the most used in biological control programs of insect pests in agriculture and of important human disease vectors. However, while the Cry proteins are the best-known insect-specific virulence factor, strains of B. thuringiensis show also a wide range of other virulence factors, which allow the bacteria to achieve the hemolymph and colonize efficiently the insect host. Among these factors, we highlight the Vip proteins, Cyt, enterotoxins, hemolysins, phospholipases, proteases and enzymes of degradation, in addition to the recently described parasporin. This review explores the action of these virulence factors, as well as, the characterization and control of expression of their genes. Additionally, we discuss aspects related to the ecological niche of the bacteria with emphasis on the characteristics involved in the biosafety of the use of B. thuringiensis-based products for biological control of target insects.

  8. Population dynamics of Sesamia inferens on transgenic rice expressing Cry1Ac and CpTI in southern China.

    Science.gov (United States)

    Han, Lanzhi; Liu, Peilei; Wu, Kongming; Peng, Yufa; Wang, Feng

    2008-10-01

    Genetically modified insect-resistant rice lines containing the cry1Ac gene from Bacillus thuringiensis (Bt) or the CpTI (cowpea trypsin inhibitor) gene developed for the management of lepidopterous pests are highly resistant to the major target pests, Chilo suppressalis (Walker), Cnaphalocrocis medinalis (Guenée), and Scirpophaga incertulas (Walker), in the main rice-growing areas of China. However, the effects of these transgenic lines on Sesamia inferens (Walker), an important lepidopterous rice pest, are currently unknown. Because different insect species have varying susceptibility to Bt insecticidal proteins that may affect population dynamics, research into the effects of these transgenic rice lines on the population dynamics of S. inferens was conducted in Fuzhou, southern China, in 2005 and 2006. The results of laboratory, field cage, and field plot experiments show that S. inferens has comparatively high susceptibility to the transgenic line during the early growing season, with significant differences observed in larval density and infestation levels between transgenic and control lines. Because of a decrease in Cry1Ac levels in the plant as it ages, the transgenic line provided only a low potential for population suppression late in the growing season. There is a correlation between the changing expression of Cry1Ac and the impact of transgenic rice on the population dynamics of S. inferens during the season. These results indicate that S. inferens may become a major pest in fields of prospective commercially released transgenic rice, and more attention should be paid to developing an effective alternative management strategy.

  9. Diversity of Bacillus thuringiensis strains in the maize and bean phylloplane and their respective soils in Colombia.

    Science.gov (United States)

    Jara, S; Maduell, P; Orduz, S

    2006-07-01

    To evaluate the distribution of Bacillus thuringiensis strains from maize and bean phylloplane and their respective soils. B. thuringiensis was isolated from the phylloplane and soil of maize and bean from three municipalities in Antioquia, Colombia. Ninety six samples of phylloplane and 24 of soil were analyzed. A total of 214 isolates were obtained from 96 phylloplane samples while 59 isolates were recovered from 24 soil samples. Sixty five per cent and 12% of the phylloplane and soil isolates, respectively, showed activity against Spodoptera frugiperda. These isolates contained delta-endotoxin proteins of 57 and 130 kDa. The most toxic isolates against S. frugiperda had the genotype cry1Aa, cry1Ac, cry1B, and cry1D. In contrast, 27% of the phylloplane isolates and 88% of the soil isolates were active against Culex quinquefasciatus and had protein profiles similar to B. thuringiensis serovar. medellin and B. thuringiensis serovar. israelensis. The most active isolates contain cry4 and cry11 genes. The predominant population of B. thuringiensis on the phylloplane harbored the cry1 gene and was active against S. frugiperda, whereas in soil, isolates harboring cry11 gene and active against C. quinquefasciatus were the majority. The predominance of specific B. thuringiensis populations, both on the leaves and in the soil, suggests the presence of selection in B. thuringiensis populations on the studied environment.

  10. IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

    International Nuclear Information System (INIS)

    Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.

    2006-01-01

    The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions

  11. The Cry in the Holy Quran and the Effect on the Human Behavior

    Science.gov (United States)

    al-Domi, Mohammad Mahmoud

    2015-01-01

    This study aims that cry is the ideal way to release the negative emotions distress, sorrow, and sadness. Which sometimes is also a way to express situations of joy and pleasure of humans. The Almighty Allah also said about cry in The Holy Quran. The prophet pbuh also cry for the expressions of reverence and fear of Allah in perhaps the sort of…

  12. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  13. The Effect of Crying on Long-Term Memory in Infancy.

    Science.gov (United States)

    Fagen, Jeffrey W.; And Others

    1985-01-01

    Infants who cried in response to a reward shift evidenced no retention of the contingency 1 week later but did have excellent retention at one day. Reactivation treatment alleviated forgetting at three weeks. Results indicate that crying in response to violation of a reward-expectation habit functions as an amnesic agent to produce accelerated…

  14. Crying - excessive (0-6 months)

    Science.gov (United States)

    ... place the infant within sight. Place baby-safe toys where the child can see them. If crying is due to ... lot of gas? What other symptoms does the child have? Such as, difficulty ... infant's growth and development. Antibiotics may be prescribed if the baby has ...

  15. Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

    Science.gov (United States)

    Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

    2005-01-01

    Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

  16. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  17. A multiplex degenerate PCR analytical approach targeting to eight genes for screening GMOs.

    Science.gov (United States)

    Guo, Jinchao; Chen, Lili; Liu, Xin; Gao, Ying; Zhang, Dabing; Yang, Litao

    2012-06-01

    Currently, the detection methods with lower cost and higher throughput are the major trend in screening genetically modified (GM) food or feed before specific identification. In this study, we developed a quadruplex degenerate PCR screening approach for more than 90 approved GMO events. This assay is consisted of four PCR systems targeting on nine DNA sequences from eight trait genes widely introduced into GMOs, such as CP4-EPSPS derived from Acetobacterium tumefaciens sp. strain CP4, phosphinothricin acetyltransferase gene derived from Streptomyceshygroscopicus (bar) and Streptomyces viridochromogenes (pat), and Cry1Ab, Cry1Ac, Cry1A(b/c), mCry3A, and Cry3Bb1 derived from Bacillus thuringiensis. The quadruplex degenerate PCR assay offers high specificity and sensitivity with the absolute limit of detection (LOD) of approximate 80targetcopies. Furthermore, the applicability of the quadruplex PCR assay was confirmed by screening either several artificially prepared samples or samples of Grain Inspection, Packers and Stockyards Administration (GIPSA) proficiency program. Copyright © 2011 Elsevier Ltd. All rights reserved.

  18. Influences of Cry1Ac broccoli on larval survival and oviposition of diamondback moth.

    Science.gov (United States)

    Yi, Dengxia; Cui, Shusong; Yang, Limei; Fang, Zhiyuan; Liu, Yumei; Zhuang, Mu; Zhang, Yangyong

    2015-01-01

    Larval survival and oviposition behavior of three genotypes of diamondback moth, Plutella xylostella L. (Lepidoptera: Plutellidae), (homozygous Cry1Ac-susceptibile, Cry1Ac-resistant, and their F1 hybrids), on transgenic Bacillus thuringiensis (Bt) broccoli expressing different levels of Cry1Ac protein were evaluated in laboratory. These Bt broccoli lines were designated as relative low, medium, and high, respectively, according to the Cry1Ac content. Untransformed brocccoli plants were used as control. Larval survival of diamondback moth on non-Bt leaves was not significantly different among the three genotypes. The Cry1Ac-resistant larvae could survive on the low level of Bt broccoli plants, while Cry1Ac-susceptible and F1 larvae could not survive on them. The three genotypes of P. xylostella larvae could not survive on medium and high levels of Bt broccoli. In oviposition choice tests, there was no significant difference in the number of eggs laid by the three P. xylostella genotypes among different Bt broccoli plants. The development of Cry1Ac-susceptible and Cry1Ac-resistant P. xylostella on intact Bt plants was also tested in greenhouse. All susceptible P. xylostella larvae died on all Bt plants, while resistant larvae could survive on broccoli, which expresses low Cry1Ac protein under greenhouse conditions. The results of the greenhouse trials were similar to that of laboratory tests. This study indicated that high dose of Bt toxins in broccoli cultivars or germplasm lines is required for effective resistance management. © The Author 2015. Published by Oxford University Press on behalf of the Entomological Society of America.

  19. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  20. Screening for single-chain variable fragment antibodies against multiple Cry1 toxins from an immunized mouse phage display antibody library.

    Science.gov (United States)

    Dong, Sa; Bo, Zongyi; Zhang, Cunzheng; Feng, Jianguo; Liu, Xianjin

    2018-04-01

    Single-chain variable fragment (scFv) is a kind of antibody that possess only one chain of the complete antibody while maintaining the antigen-specific binding abilities and can be expressed in prokaryotic system. In this study, scFvs against Cry1 toxins were screened out from an immunized mouse phage displayed antibody library, which was successfully constructed with capacity of 6.25 × 10 7  CFU/mL. Using the mixed and alternative antigen coating strategy and after four rounds of affinity screening, seven positive phage-scFvs against Cry1 toxins were selected and characterized. Among them, clone scFv-3H9 (MG214869) showing relative stable and high binding abilities to six Cry1 toxins was selected for expression and purification. SDS-PAGE indicated that the scFv-3H9 fragments approximately 27 kDa were successfully expressed in Escherichia coli HB2151 strain. The purified scFv-3H9 was used to establish the double antibody sandwich enzyme-linked immunosorbent assay method (DAS-ELISA) for detecting six Cry1 toxins, of which the lowest detectable limits (LOD) and the lowest quantitative limits (LOQ) were 3.14-11.07 and 8.22-39.44 ng mL -1 , respectively, with the correlation coefficient higher than 0.997. The average recoveries of Cry1 toxins from spiked rice leaf samples were ranged from 84 to 95%, with coefficient of variation (CV) less than 8.2%, showing good accuracy for the multi-residue determination of six Cry1 toxins in agricultural samples. This research suggested that the constructed phage display antibody library based on the animal which was immunized with the mixture of several antigens under the same category can be used for the quick and effective screening of generic antibodies.

  1. Persistence of detectable insecticidal proteins from Bacillus thuringiensis (Cry) and toxicity after adsorption on contrasting soils

    International Nuclear Information System (INIS)

    Hung, T.P.; Truong, L.V.; Binh, N.D.; Frutos, R.; Quiquampoix, H.; Staunton, S.

    2016-01-01

    Insecticidal Cry, or Bt, proteins are produced by the soil-endemic bacterium, Bacillus thuringiensis and some genetically modified crops. Their environmental fate depends on interactions with soil. Little is known about the toxicity of adsorbed proteins and the change in toxicity over time. We incubated Cry1Ac and Cry2A in contrasting soils subjected to different treatments to inhibit microbial activity. The toxin was chemically extracted and immunoassayed. Manduca sexta was the target insect for biotests. Extractable toxin decreased during incubation for up to four weeks. Toxicity of Cry1Ac was maintained in the adsorbed state, but lost after 2 weeks incubation at 25 °C. The decline in extractable protein and toxicity were much slower at 4 °C with no significant effect of soil sterilization. The major driving force for decline may be time-dependent fixation of adsorbed protein, leading to a decrease in the extraction yield in vitro, paralleled by decreasing solubilisation in the larval gut. - Graphical abstract: Biotest, presenting Cry-contaminated feed to Manduca sexta larvae in individual Perspex boxes. Display Omitted - Highlights: • Toxicity of Cry protein is initially conserved after adsorption on soil. • Toxicity and extractability decline with time, more rapidly at 25 °C than 4 °C. • Similar dynamics of Cry1AC and Cry2A on soil with varying texture and organic C. • Sterilization of soil does not change Cry dynamics or temperature effect in soil. • Cry decline is determined by progressive fixation on soil not microbial breakdown. - Toxicity was initially maintained after adsorption on soil and both extractable Cry and toxicity declined rapidly, more slowly at low temperature, due to different fixation dynamics. Toxicity of Cry protein is initially conserved after adsorption on soil.

  2. Effects of feeding transgenic corn with mCry1Ac or maroACC gene to laying hens for 12 weeks on growth, egg quality and organ health.

    Science.gov (United States)

    Zhong, R Q; Chen, L; Gao, L X; Zhang, L L; Yao, B; Yang, X G; Zhang, H F

    2016-08-01

    The objective of the present study was to investigate the effect of feeding two transgenic corn lines containing the mCry1Ac gene from Bacillus thuringiensis strain (BT-799) and the maroACC gene from Agrobacterium tumefaciens strain (CC-2), respectively, on growth, egg quality and organ health indicators. Expression of the mCry1Ac gene confers resistance to Pyrausta nubilalis and the maroACC gene confers tolerance to herbicides. Healthy hens (n=96 placed in cages; 3 hens/cage) were randomly assigned to one of four corn-soybean meal dietary treatments (8 cages/treatment) formulated with the following corn: non-transgenic near-isoline control corn (control), BT-799 corn, CC-2 corn and commercially available non-transgenic reference corn (reference). The experiment was divided into three 4-week phases (week 1 to 4, week 5 to 8 and week 9 to 12), during which hens were fed mash diets. Performance (BW, feed intake and egg production) and egg quality were determined. Following slaughter at the end of 12 weeks of feeding (n=8/treatment), carcass yield and organ weights (heart, liver, spleen, lung, kidneys, stomach and ovary) were recorded; organs and intestines were sampled for histological analysis. Analysis of serum biochemistry parameters to assess the liver and kidney function were performed. No differences in BW, egg production and production efficiency were observed between hens consuming the control diet and hens consuming the BT-799 or CC-2 diet. Haugh unit measures and egg component weights were similar between the control and test groups. Carcass yield was not affected by the diet treatment. Similar organosomatic indices and serum parameters did not indicate the characteristics of organ dysfunction. All observed values of the BT-799 and CC-2 groups were within the calculated tolerance intervals. This research indicates that the performance, egg quality, organ health and carcass yield of laying hens fed diets containing the BT-799 or CC-2 corn line were similar

  3. Mechanistic and single-dose in vivo therapeutic studies of Cry5B anthelmintic action against hookworms.

    Directory of Open Access Journals (Sweden)

    Yan Hu

    Full Text Available Hookworm infections are one of the most important parasitic infections of humans worldwide, considered by some second only to malaria in associated disease burden. Single-dose mass drug administration for soil-transmitted helminths, including hookworms, relies primarily on albendazole, which has variable efficacy. New and better hookworm therapies are urgently needed. Bacillus thuringiensis crystal protein Cry5B has potential as a novel anthelmintic and has been extensively studied in the roundworm Caenorhabditis elegans. Here, we ask whether single-dose Cry5B can provide therapy against a hookworm infection and whether C. elegans mechanism-of-action studies are relevant to hookworms.To test whether the C. elegans invertebrate-specific glycolipid receptor for Cry5B is relevant in hookworms, we fed Ancylostoma ceylanicum hookworm adults Cry5B with and without galactose, an inhibitor of Cry5B-C. elegans glycolipid interactions. As with C. elegans, galactose inhibits Cry5B toxicity in A. ceylanicum. Furthermore, p38 mitogen-activated protein kinase (MAPK, which controls one of the most important Cry5B signal transduction responses in C. elegans, is functionally operational in hookworms. A. ceylanicum hookworms treated with Cry5B up-regulate p38 MAPK and knock down of p38 MAPK activity in hookworms results in hypersensitivity of A. ceylanicum adults to Cry5B attack. Single-dose Cry5B is able to reduce by >90% A. ceylanicum hookworm burdens from infected hamsters, in the process eliminating hookworm egg shedding in feces and protecting infected hamsters from blood loss. Anthelmintic activity is increased about 3-fold, eliminating >97% of the parasites with a single 3 mg dose (∼30 mg/kg, by incorporating a simple formulation to help prevent digestion in the acidic stomach of the host mammal.These studies advance the development of Cry5B protein as a potent, safe single-dose anthelmintic for hookworm therapy and make available the information of how

  4. [Exposure degree of important non-target arthropods to Cry2Aa in Bt rice fields].

    Science.gov (United States)

    Zhang, Qing-Ling; Li, Yun-He; Hua, Hong-Xia; Yang, Chang-Ju; Wu, Hong-Jin; Peng, Yu-Fa

    2013-06-01

    Based on the principle of "risk = hazard x exposure", the selected representative nontarget organisms in the assessment of the potential effects of insect-resistant genetically modified (GM) crops on non-target arthropods in laboratory are generally the arthropod species highly exposed to the insecticidal proteins expressed by the GM crops in farmland ecosystem. In order to understand the exposure degree of the important arthropod species to Cry proteins in Bt rice fields, and to select the appropriate non-target arthropods in the risk assessment of insect-resistant GM crops, the enzyme-linked immunosorbent assay (ELISA) was conducted to measure the Cry2Aa protein concentration in the arthropods collected from the cry2Aa rice fields at different rice growth stages. The results showed that there was a significant difference in the Cry2Aa content protein concentration in different arthropod species. Some species did not contain Cry2Aa protein, while some species contained larger amounts of Cry2Aa protein. Relative to the arthropods colleted after rice anthesis, the arthropods colleted in rice anthesis contained relative higher concentrations of Cry2Aa protein, especially for the predacious arthropods. No Cry proteins were detected in parasitic arthropods. This study provided references for the laboratory assessment of the effects of GM rice on nontarget arthropods.

  5. Coffin-Siris syndrome and cardiac anomaly with a novel SOX11 mutation.

    Science.gov (United States)

    Okamoto, Nobuhiko; Ehara, Eiji; Tsurusaki, Yoshinori; Miyake, Noriko; Matsumoto, Naomichi

    2017-08-08

    Coffin-Siris syndrome (CSS) is characterized by growth deficiency, intellectual disability, microcephaly, dysmorphic features, and hypoplastic nails of the fifth fingers and/or toes. Variants in the genes encoding subunits of the BAF complex as well as in SOX11 encoding the transcriptional factor under the control of BAF complex are associated with CSS. We report a new patient with a novel SOX11 mutation. He showed the CSS phenotype and coarctation of the aorta. Sox11 is known to be associated with cardiac outflow development in mouse studies. Therefore, cardiac anomalies might be an important complication in patients with SOX11 mutations. © 2017 Japanese Teratology Society.

  6. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  7. A Major Facilitator Superfamily protein encoded by TcMucK gene is not required for cuticle pigmentation, growth and development in Tribolium castaneum.

    Science.gov (United States)

    Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki

    2014-06-01

    Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down

  8. Improved binary dragonfly optimization algorithm and wavelet packet based non-linear features for infant cry classification.

    Science.gov (United States)

    Hariharan, M; Sindhu, R; Vijean, Vikneswaran; Yazid, Haniza; Nadarajaw, Thiyagar; Yaacob, Sazali; Polat, Kemal

    2018-03-01

    Infant cry signal carries several levels of information about the reason for crying (hunger, pain, sleepiness and discomfort) or the pathological status (asphyxia, deaf, jaundice, premature condition and autism, etc.) of an infant and therefore suited for early diagnosis. In this work, combination of wavelet packet based features and Improved Binary Dragonfly Optimization based feature selection method was proposed to classify the different types of infant cry signals. Cry signals from 2 different databases were utilized. First database contains 507 cry samples of normal (N), 340 cry samples of asphyxia (A), 879 cry samples of deaf (D), 350 cry samples of hungry (H) and 192 cry samples of pain (P). Second database contains 513 cry samples of jaundice (J), 531 samples of premature (Prem) and 45 samples of normal (N). Wavelet packet transform based energy and non-linear entropies (496 features), Linear Predictive Coding (LPC) based cepstral features (56 features), Mel-frequency Cepstral Coefficients (MFCCs) were extracted (16 features). The combined feature set consists of 568 features. To overcome the curse of dimensionality issue, improved binary dragonfly optimization algorithm (IBDFO) was proposed to select the most salient attributes or features. Finally, Extreme Learning Machine (ELM) kernel classifier was used to classify the different types of infant cry signals using all the features and highly informative features as well. Several experiments of two-class and multi-class classification of cry signals were conducted. In binary or two-class experiments, maximum accuracy of 90.18% for H Vs P, 100% for A Vs N, 100% for D Vs N and 97.61% J Vs Prem was achieved using the features selected (only 204 features out of 568) by IBDFO. For the classification of multiple cry signals (multi-class problem), the selected features could differentiate between three classes (N, A & D) with the accuracy of 100% and seven classes with the accuracy of 97.62%. The experimental

  9. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  10. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  11. A concerted action of a paired-type homeobox gene, aristaless, and a homolog of Hox11/tlx homeobox gene, clawless, is essential for the distal tip development of the Drosophila leg.

    Science.gov (United States)

    Kojima, Tetsuya; Tsuji, Takuya; Saigo, Kaoru

    2005-03-15

    The subdivision of the developing field by region-specific expression of genes encoding transcription factors is an essential step during appendage development in arthropod and vertebrates. In Drosophila leg development, the distal-most region (pretarsus) is specified by the expression of homeobox genes, aristaless and Lim1, and its immediate neighbor (distal tarsus) is specified by the expression of a pair of Bar homeobox genes. Here, we show that one additional gene, clawless, which is a homolog of vertebrate Hox11/tlx homeobox gene family and formerly known as C15, is specifically expressed in the pretarsus and cooperatively acts with aristaless to repress Bar and possibly to activate Lim1. Similar to aristaless, the maximal expression of clawless requires Lim1 and its co-factor, Chip. Bar attenuates aristaless and clawless expression through Lim1 repression. Aristaless and Clawless proteins form a complex capable of binding to specific DNA targets, which cannot be well recognized solely by Aristaless or Clawless.

  12. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  13. In Silico Modeling and Functional Interpretations of Cry1Ab15 Toxin from Bacillus thuringiensis BtB-Hm-16

    Directory of Open Access Journals (Sweden)

    Sudhanshu Kashyap

    2013-01-01

    Full Text Available The theoretical homology based structural model of Cry1Ab15 δ-endotoxin produced by Bacillus thuringiensis BtB-Hm-16 was predicted using the Cry1Aa template (resolution 2.25 Å. The Cry1Ab15 resembles the template structure by sharing a common three-domain extending conformation structure responsible for pore-forming and specificity determination. The novel structural differences found are the presence of β0 and α3, and the absence of α7b, β1a, α10a, α10b, β12, and α11a while α9 is located spatially downstream. Validation by SUPERPOSE and with the use of PROCHECK program showed folding of 98% of modeled residues in a favourable and stable orientation with a total energy Z-score of −6.56; the constructed model has an RMSD of only 1.15 Å. These increments of 3D structure information will be helpful in the design of domain swapping experiments aimed at improving toxicity and will help in elucidating the common mechanism of toxin action.

  14. Deletion of the Candida glabrata ERG3 and ERG11 genes: effect on cell viability, cell growth, sterol composition, and antifungal susceptibility.

    Science.gov (United States)

    Geber, A; Hitchcock, C A; Swartz, J E; Pullen, F S; Marsden, K E; Kwon-Chung, K J; Bennett, J E

    1995-01-01

    We have cloned and sequenced the structural genes encoding the delta 5,6 sterol desaturase (ERG3 gene) and the 14 alpha-methyl sterol demethylase (ERG11 gene) from Candida glabrata L5 (leu2). Single and double mutants of these genes were created by gene deletion. The phenotypes of these mutants, including sterol profiles, aerobic viabilities, antifungal susceptibilities, and generation times, were studied. Strain L5D (erg3 delta::LEU2) accumulated mainly ergosta-7,22-dien-3 beta-ol, was aerobically viable, and remained susceptible to antifungal agents but had a slower generation time than its parent strain. L5LUD (LEU2 erg11 delta::URA3) strains required medium supplemented with ergosterol and an anaerobic environment for growth. A spontaneous aerobically viable mutant, L5LUD40R (LEU erg11 delta::URA3), obtained from L5LUD (LEU2 erg11 delta::URA3), was found to accumulate lanosterol and obtusifoliol, was resistant to azole antifungal agents, demonstrated some increase in resistance to amphotericin B, and exhibited a 1.86-fold increase in generation time in comparison with L5 (leu2). The double-deletion mutant L5DUD61 (erg3 delta::LEU2 erg11 delta::URA3) was aerobically viable, produced mainly 14 alpha-methyl fecosterol, and had the same antifungal susceptibility pattern as L5LUD40R (LEU2 erg11 delta::URA3), and its generation time was threefold greater than that of L5 (leu2). Northern (RNA) analysis revealed that the single-deletion mutants had a marked increase in message for the undeleted ERG3 and ERG11 genes. These results indicate that differences in antifungal susceptibilities and the restoration of aerobic viability exist between the C. glabrata ergosterol mutants created in this study and those sterol mutants with similar genetic lesions previously reported for Saccharomyces cerevisiae. PMID:8593007

  15. Improved insecticidal toxicity by fusing Cry1Ac of Bacillus thuringiensis with Av3 of Anemonia viridis.

    Science.gov (United States)

    Yan, Fu; Cheng, Xing; Ding, Xuezhi; Yao, Ting; Chen, Hanna; Li, Wenping; Hu, Shengbiao; Yu, Ziquan; Sun, Yunjun; Zhang, Youming; Xia, Liqiu

    2014-05-01

    Av3, a neurotoxin of Anemonia viridis, is toxic to crustaceans and cockroaches but inactive in mammals. In the present study, Av3 was expressed in Escherichia coli Origami B (DE3) and purified by reversed-phase liquid chromatography. The purified Av3 was injected into the hemocoel of Helicoverpa armigera, rendering the worm paralyzed. Then, Av3 was expressed alone or fusion expressed with the Cry1Ac in acrystalliferous strain Cry(-)B of Bacillus thuringiensis. The shape of Cry1Ac was changed by fusion with Av3. The expressed fusion protein, Cry1AcAv3, formed irregular rhombus- or crescent-shaped crystalline inclusions, which is quite different from the shape of original Cry1Ac crystals. The toxicity of Cry1Ac was improved by fused expression. Compared with original Cry1Ac expressed in Cry(-)B, the oral toxicity of Cry1AcAv3 to H. armigera was elevated about 2.6-fold. No toxicity was detected when Av3 was expressed in Cry(-)B alone. The present study confirmed that marine toxins could be used in bio-control and implied that fused expression with other insecticidal proteins could be an efficient way for their application.

  16. Manejo de lepidópteros-praga na cultura do milho com o evento Bt piramidado Cry1A.105 e Cry2Ab2

    Directory of Open Access Journals (Sweden)

    José Magid Waquil

    2013-12-01

    Full Text Available O objetivo deste trabalho foi avaliar a eficácia do evento piramidado (MON 89034, que expressa as proteínas Cry1A.105 e Cry2Ab2, no controle dos principais lepidópteros-praga da cultura do milho no Brasil, Spodoptera frugiperda, Helicoverpa spp. e Diatraea saccharalis. Os ensaios foram conduzidos em quatro regiões do país, com o híbrido DKB 390, submetido a seis tratamentos: híbrido com o evento piramidado, híbrido com o evento que expressa apenas a proteína Cry1A(b (MON 810 e híbrido convencional (não Bt, todos com e sem manejo integrado de S. frugiperda. Para o evento piramidado, não foi necessário o controle químico em nenhum dos locais avaliados. Diferenças significativas foram observadas entre os tratamentos quanto aos danos e à presença de lagartas. Em geral, essas variáveis foram mais baixas no híbrido com o evento piramidado e mais altas no híbrido convencional, sem controle químico. Sob alta infestação, o controle químico reduziu os danos causados por S. frugiperda e D. saccharalis, tanto no evento que expressa apenas uma proteína, como no híbrido convencional. Com base nos danos causados pelos insetos, o evento piramidado Cry1A.105 e Cry2Ab2 é eficiente no controle dos principais lepidópteros-pragas do milho no Brasil.

  17. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  18. Polimorfismos en los genes CYP11α y CYP17 y etiología del hiperandrogenismo en pacientes con poliquistosis ovárica Polymorphism in CYP11alpha and CYP17 genes and the etiology of hyperandrogenism in patients with polycystic ovary syndrome

    Directory of Open Access Journals (Sweden)

    María S. Pérez

    2008-04-01

    etiology of this disorder. Among these genes are those encoding the enzymes involved in the ovarian androgen biosynthesis. Two of the candidate genes are the CYP17 and the CYP11alpha, encoding the 17-alpha-hydroxylase (P45017alpha and the cholesterol side chain cleavage (P450scc respectively. The polymorphisms of these genes are linked to the development of an hyperandrogenic phenotype. The aim of this work was to analyze the allelic frequencies of such polymorphisms in a cohort of women with PCOS and to compare them with those of healthy women. Furthermore, the correlation between each allelic variant and the corresponding hyperandrogenic phenotype was also assessed. Therefore, 65 patients and 58 age matched healthy controls were analyzed. The serum levels of testosterone and the frequency of each polymorphism were determined. When the PCOS population was analyzed, a significant statistical difference was found when relating the group with the highest androgenemia level with the presence of A2/A2 genotype of CYP 17 gene, and a higher level of circulating androgen was found in PCO women carrying the 216- allele of CYP11alpha gene (that did not reach statistical significance. Our results suggest that both alleles play a minor role in the development of PCOS and could be a genetic risk marker of the hyperandrogenic phenotype.

  19. Effects of a diet containing genetically modified rice expressing the Cry1Ab/1Ac protein (Bacillus thuringiensis toxin) on broiler chickens.

    Science.gov (United States)

    Li, Zeyang; Gao, Yang; Zhang, Minhong; Feng, Jinghai; Xiong, Yandan

    2015-01-01

    The aim of this study was to evaluate the effect of feeding Bacillus thuringiensis (Bt) rice expressing the Cry1Ab/1Ac protein on broiler chicken. The genetically modified (GM) Bt rice was compared with the corresponding non-GM rice regarding performance of feeding groups, their health status, relative organ weights, biochemical serum parameters and occurrence of Cry1Ab/1Ac gene fragments. One hundred and eighty day-old Arbor Acres female broilers with the same health condition were randomly allocated to the two treatments (6 replicate cages with 15 broilers in each cage per treatment). They received diets containing GM rice (GM group) or its parental non-GM rice (non-GM group) at 52-57% of the air-dried diet for 42 days. The results show that the transgenic rice had a similar nutrient composition as the non-GM rice and had no adverse effects on chicken growth, biochemical serum parameters and necropsy during the 42-day feeding period. In birds fed the GM rice, no transgenic gene fragments were detected in the samples of blood, liver, kidneys, spleen, jejunum, ileum, duodenum and muscle tissue. In conclusion, the results suggest that Bt rice expressing Cry1Ab/1Ac protein has no adverse effects on broiler chicken. Therefore, it can be considered as safe and used as feed source for broiler chicken.

  20. Gene expression profiles deciphering rice phenotypic variation between Nipponbare (Japonica and 93-11 (Indica during oxidative stress.

    Directory of Open Access Journals (Sweden)

    Fengxia Liu

    Full Text Available Rice is a very important food staple that feeds more than half the world's population. Two major Asian cultivated rice (Oryza sativa L. subspecies, japonica and indica, show significant phenotypic variation in their stress responses. However, the molecular mechanisms underlying this phenotypic variation are still largely unknown. A common link among different stresses is that they produce an oxidative burst and result in an increase of reactive oxygen species (ROS. In this study, methyl viologen (MV as a ROS agent was applied to investigate the rice oxidative stress response. We observed that 93-11 (indica seedlings exhibited leaf senescence with severe lesions under MV treatment compared to Nipponbare (japonica. Whole-genome microarray experiments were conducted, and 1,062 probe sets were identified with gene expression level polymorphisms between the two rice cultivars in addition to differential expression under MV treatment, which were assigned as Core Intersectional Probesets (CIPs. These CIPs were analyzed by gene ontology (GO and highlighted with enrichment GO terms related to toxin and oxidative stress responses as well as other responses. These GO term-enriched genes of the CIPs include glutathine S-transferases (GSTs, P450, plant defense genes, and secondary metabolism related genes such as chalcone synthase (CHS. Further insertion/deletion (InDel and regulatory element analyses for these identified CIPs suggested that there may be some eQTL hotspots related to oxidative stress in the rice genome, such as GST genes encoded on chromosome 10. In addition, we identified a group of marker genes individuating the japonica and indica subspecies. In summary, we developed a new strategy combining biological experiments and data mining to study the possible molecular mechanism of phenotypic variation during oxidative stress between Nipponbare and 93-11. This study will aid in the analysis of the molecular basis of quantitative traits.

  1. Why lions roar like babies cry

    Science.gov (United States)

    Titze, Ingo

    2012-11-01

    When an angry lion roars, the sounds it emits can terrify anyone within earshot. But, as Ingo Titze explains, the properties of a lion's roar have some surprising similarities with those of a crying baby.

  2. Field-evolved resistance to Cry1Ab maize by Spodoptera frugiperda in Brazil.

    Science.gov (United States)

    Omoto, Celso; Bernardi, Oderlei; Salmeron, Eloisa; Sorgatto, Rodrigo J; Dourado, Patrick M; Crivellari, Augusto; Carvalho, Renato A; Willse, Alan; Martinelli, Samuel; Head, Graham P

    2016-09-01

    The first Bt maize in Brazil was launched in 2008 and contained the MON 810 event, which expresses Cry1Ab protein. Although the Cry1Ab dose in MON 810 is not high against fall armyworm (FAW), Spodoptera frugiperda (J.E. Smith), MON 810 provided commercial levels of control. To support insect resistance management in Brazil, the baseline and ongoing susceptibility of FAW was examined using protein bioassays, and the level of control and life history parameters of FAW were evaluated on MON 810 maize. Baseline diet overlay assays with Cry1Ab (16 µg cm(-2) ) caused 76.3% mortality to field FAW populations sampled in 2009. Moderate mortality (48.8%) and significant growth inhibition (88.4%) were verified in leaf-disc bioassays. In greenhouse trials, MON 810 had significantly less damage than non-Bt maize. The surviving FAW larvae on MON 810 (22.4%) had a 5.5 day increase in life cycle time and a 24% reduction in population growth rate. Resistance monitoring (2010-2015) showed a significant reduction in Cry1Ab susceptibility of FAW over time. Additionally, a significant reduction in the field efficacy of MON 810 maize against FAW was observed in different regions from crop season 2009 to 2013. The decrease in susceptibility to Cry1Ab was expected, but the specific contributions to this resistance by MON 810 maize cannot be distinguished from cross-resistance to Cry1Ab caused by exposure to Cry1F maize. Technologies combining multiple novel insecticidal traits with no cross-resistance to the current Cry1 proteins and high activity against the same target pests should be pursued in Brazil and similar environments. © 2015 Society of Chemical Industry. © 2015 Society of Chemical Industry.

  3. Differential brain responses to cries of infants with autistic disorder and typical development: an fMRI study.

    Science.gov (United States)

    Venuti, Paola; Caria, Andrea; Esposito, Gianluca; De Pisapia, Nicola; Bornstein, Marc H; de Falco, Simona

    2012-01-01

    This study used fMRI to measure brain activity during adult processing of cries of infants with autistic disorder (AD) compared to cries of typically developing (TD) infants. Using whole brain analysis, we found that cries of infants with AD compared to those of TD infants elicited enhanced activity in brain regions associated with verbal and prosodic processing, perhaps because altered acoustic patterns of AD cries render them especially difficult to interpret, and increased activity in brain regions associated with emotional processing, indicating that AD cries also elicit more negative feelings and may be perceived as more aversive and/or arousing. Perceived distress engendered by AD cries related to increased activation in brain regions associated with emotional processing. This study supports the hypothesis that cry is an early and meaningful anomaly displayed by children with AD. It could be that cries associated with AD alter parent-child interactions much earlier than the time that reliable AD diagnosis normally occurs. Copyright © 2012 Elsevier Ltd. All rights reserved.

  4. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  5. Loss and gain of function in SERPINB11: an example of a gene under selection on standing variation, with implications for host-pathogen interactions.

    Directory of Open Access Journals (Sweden)

    Susana Seixas

    Full Text Available Serine protease inhibitors (SERPINs are crucial in the regulation of diverse biological processes including inflammation and immune response. SERPINB11, located in the 18q21 gene cluster, is a polymorphic gene/pseudogene coding for a non-inhibitory SERPIN. In a genome-wide scan for recent selection, SERPINB11 was identified as a potential candidate gene for adaptive evolution in Yoruba. The present study sought a better understanding of the evolutionary history of SERPINB11, with special focus on evaluating its selective signature. Through the resequencing of coding and noncoding regions of SERPINB11 in 20 Yorubans and analyzing primate orthologous sequences, we identified a full-length SERPINB11 variant encoding a non-inhibitory SERPIN as the putative candidate of selection--probably driven to higher frequencies by an adaptive response using preexisting variation. In addition, we detected contrasting evolutionary features of SERPINB11 in primates: While primate phylogeny as a whole is under purifying selection, the human lineage shows evidence of positive selection in a few codons, all associated with the active SERPINB11. Comparative modeling studies suggest that positively selected codons reduce SERPINB11's ability to undergo the conformational changes typical of inhibitory SERPINs--suggesting that it is evolving towards a new non-inhibitory function in humans. Significant correlations between SERPINB11 variants and the environmental variables, pastoralism and pathogen richness, have led us to propose a selective advantage through host-pathogen interactions, possibly linked to an adaptive response combating the emergence of infectious diseases in recent human evolution. This work represents the first description of a resurrected gene in humans, and may well exemplify selection on standing variation triggered by drastic ecological shifts.

  6. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  7. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    International Nuclear Information System (INIS)

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

    2006-01-01

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  8. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  9. Serotonin 5HT1A receptor availability and pathological crying after stroke

    DEFF Research Database (Denmark)

    Møller, Mette; Andersen, G; Gjedde, A

    2007-01-01

    OBJECTIVES: Post-stroke depression and pathological crying (PC) implicate an imbalance of serotonergic neurotransmission. We claim that PC follows serotonin depletion that raises the binding potential (p(B)) of the 5-HT(1A) receptor antagonist [carbonyl-(11)C]WAY-100635, which is reversible...... by selective serotonin re-uptake inhibitor (SSRI) treatment. MATERIALS AND METHODS: We PET scanned patients with acute stroke and PC and age-matched control subjects. Maps of receptor availability were generated from the images of eight cortical regions and raphe nuclei. RESULTS: The maps showed highest...

  10. Analysis of Cry8Ka5-binding proteins from Anthonomus grandis (Coleoptera: Curculionidae) midgut.

    Science.gov (United States)

    Nakasu, Erich Y T; Firmino, Alexandre A P; Dias, Simoni C; Rocha, Thales L; Ramos, Hudson B; Oliveira, Gustavo R; Lucena, Wagner; Carlini, Célia R; Grossi-de-Sá, Maria Fátima

    2010-07-01

    Biotech crops expressing Bacillus thuringiensis Cry toxins present a valuable approach for insect control. Cry8Ka5, which is highly toxic to the cotton boll weevil (Anthonomus grandis), was used as a model to study toxin-ligand interactions. Three Cry-binding proteins were detected after toxin overlay assays. Following de novo sequencing, a heat-shock cognate protein and a V-ATPase were identified, whilst a approximately 120 kDa protein remained unknown. Additional Cry8Ka5-binding proteins were visualized by two-dimensional gel electrophoresis ligand blots. (c) 2010 Elsevier Inc. All rights reserved.

  11. Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

    Science.gov (United States)

    Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

    2009-01-01

    There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

  12. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  13. The bZip transscription factor HY5 mediates CRY1a-induced anthocyanin biosynthesis in tomato.

    Science.gov (United States)

    Liu, Chao-Chao; Chi, Cheng; Jin, Li-Juan; Zhu, Jianhua; Yu, Jing-Quan; Zhou, Yan-Hong

    2018-03-22

    The production of anthocyanin is regulated by light and corresponding photoreceptors. In this study, we found that exposure to blue light and overexpression of CRY1a are associated with increased accumulation of anthocyanin in tomato (Solanum lycopersicum L.). These responses are the result of changes in mRNA and the protein levels of SlHY5, a transcription factor. In vitro and in vivo experiments using EMSA and ChIP-qPCR assays revealed that SlHY5 could directly recognize and bind to the G-box and ACE motifs in the promoters of anthocyanin biosynthesis genes, such as CHS1, CHS2 and DFR. Silencing of SlHY5 in OE-CRY1a lines decreased the accumulation of anthocyanin. The findings presented here not only deepened our understanding of how light controls anthocyanin biosynthesis and associated photoprotection in tomato leaves, but also allowed us to explore potential targets for improving pigment production. This article is protected by copyright. All rights reserved.

  14. Analysis of the ergosterol biosynthesis pathway cloning, molecular characterization and phylogeny of lanosterol 14α-demethylase (ERG11 gene of Moniliophthora perniciosa

    Directory of Open Access Journals (Sweden)

    Geruza de Oliveira Ceita

    2014-12-01

    Full Text Available The phytopathogenic fungus Moniliophthora perniciosa (Stahel Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11 that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR. Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

  15. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  16. Mental health and well-being in parents of excessively crying infants: Prospective evaluation of a support package.

    Science.gov (United States)

    Powell, C; Bamber, D; Long, J; Garratt, R; Brown, J; Rudge, S; Morris, T; Bhupendra Jaicim, N; Plachcinski, R; Dyson, S; Boyle, E M; St James-Roberts, I

    2018-04-17

    During the first 4 months of age, approximately 20% of infants cry a lot without an apparent reason. Most research has targeted the crying, but the impact of the crying on parents, and subsequent outcomes, need to receive equal attention. This study reports the findings from a prospective evaluation of a package of materials designed to support the well-being and mental health of parents who judge their infant to be crying excessively. The resulting "Surviving Crying" package comprised a website, printed materials, and programme of Cognitive Behaviour Therapy-based support sessions delivered to parents by a qualified practitioner. It was designed to be suitable for United Kingdom (UK) National Health Service (NHS) use. Parents were referred to the study by 12 NHS Health Visitor/Community Public Health Nurse teams in one UK East Midlands NHS Trust. Fifty-two of 57 parents of excessively crying babies received the support package and completed the Edinburgh Postnatal Depression Scale and Generalized Anxiety Disorder-7 anxiety questionnaire, as well as other measures, before receiving the support package and afterwards. Significant reductions in depression and anxiety were found, with numbers of parents meeting clinical criteria for depression or anxiety halving between baseline and outcome. These improvements were not explained by reductions in infant crying. Reductions also occurred in the number of parents reporting the crying to be a large or severe problem (from 28 to 3 parents) or feeling very or extremely frustrated by the crying (from 31 to 1 parent). Other findings included increases in parents' confidence, knowledge of infant crying, and improvements in parents' sleep. The findings suggest that the Surviving Crying package may be effective in supporting the well-being and mental health of parents of excessively crying babies. Further, large-scale controlled trials of the package in NHS settings are warranted. © 2018 John Wiley & Sons Ltd.

  17. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  18. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  19. Gene-Environment Interactions of Circadian-Related Genes for Cardiometabolic Traits

    DEFF Research Database (Denmark)

    Dashti, Hassan S; Follis, Jack L; Smith, Caren E

    2015-01-01

    OBJECTIVE: Common circadian-related gene variants associate with increased risk for metabolic alterations including type 2 diabetes. However, little is known about whether diet and sleep could modify associations between circadian-related variants (CLOCK-rs1801260, CRY2-rs11605924, MTNR1B-rs13871...

  20. Gene-environment interactions of circadian-related genes for cardiometabolic traits

    Science.gov (United States)

    Objective: Common circadian-related gene variants associate with increased risk for metabolic alterations including type 2 diabetes. However, little is known about whether diet and sleep could modify associations between circadian-related variants (CLOCK-rs1801260, CRY2-rs11605924, MTNR1B-rs1387153,...

  1. Achieving high CRI from warm to super white

    Science.gov (United States)

    Bailey, Edward; Tormey, Ellen S.

    2007-09-01

    Light sources which produce a high color rendering index (CRI) have many applications in the lighting industry today. High color rendering accents the rich color which abounds in nature, interior design, theatrical costumes and props, clothing and fabric, jewelry, and machine vision applications. Multi-wavelength LED sources can pump phosphors at multiple stokes shift emission regimes and when combined with selected direct emission sources can allow for greater flexibility in the production of warm-white and cool white light of specialty interest. Unique solutions to R8 and R14 CRI >95 at 2850K, 4750K, 5250K, and 6750K presented.

  2. Evaluation of sampling plans to detect Cry9C protein in corn flour and meal.

    Science.gov (United States)

    Whitaker, Thomas B; Trucksess, Mary W; Giesbrecht, Francis G; Slate, Andrew B; Thomas, Francis S

    2004-01-01

    StarLink is a genetically modified corn that produces an insecticidal protein, Cry9C. Studies were conducted to determine the variability and Cry9C distribution among sample test results when Cry9C protein was estimated in a bulk lot of corn flour and meal. Emphasis was placed on measuring sampling and analytical variances associated with each step of the test procedure used to measure Cry9C in corn flour and meal. Two commercially available enzyme-linked immunosorbent assay kits were used: one for the determination of Cry9C protein concentration and the other for % StarLink seed. The sampling and analytical variances associated with each step of the Cry9C test procedures were determined for flour and meal. Variances were found to be functions of Cry9C concentration, and regression equations were developed to describe the relationships. Because of the larger particle size, sampling variability associated with cornmeal was about double that for corn flour. For cornmeal, the sampling variance accounted for 92.6% of the total testing variability. The observed sampling and analytical distributions were compared with the Normal distribution. In almost all comparisons, the null hypothesis that the Cry9C protein values were sampled from a Normal distribution could not be rejected at 95% confidence limits. The Normal distribution and the variance estimates were used to evaluate the performance of several Cry9C protein sampling plans for corn flour and meal. Operating characteristic curves were developed and used to demonstrate the effect of increasing sample size on reducing false positives (seller's risk) and false negatives (buyer's risk).

  3. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  4. Susceptibility of The Asian Corn Borer, Ostrinia furnacalis, to Bacillus thuringiensis Toxin CRY1AC

    Directory of Open Access Journals (Sweden)

    Aye Kyawt Kyawt Ei

    2008-07-01

    Full Text Available The larval susceptibility of the Asian corn borer, Ostrinia furnacalis (Guenee (Lepidoptera: Crambidae, to a Bacillus thuringiensis protein (Cry1Ac was evaluated using insect feeding bioassays. The founding population of O. furnacalis was originally collected from the experimental station of UGM at Kalitirto and had been reared in the laboratory for three generations using an artificial diet “InsectaLf”. The tested instars were exposed on diets treated with a series of concentrations of Cry1Ac for one week. The LC50 values on the seventh day after treatment for 1st, 2nd, 3rd and 4th instars were 7.79, 21.12, 113.66, and 123.17 ppm, respectively, showing that the higher the instars the lesser the susceptibility to Cry1Ac. When the neonates were exposed to sublethal concentrations of Cry1Ac (0.0583, 0.116, and 0.5830 ppm, growth and development of the surviving larvae were inhibited. The fecundity and viability of females produced from treated larvae decreased with increasing the concentrations. These findings indicate that Cry1Ac is toxic to larva of O. furnacalis and has chronic effects to larvae surviving from Cry1Ac ingestion.   Kepekaan larva penggerek batang jagung Asia, Ostrinia furnacalis (Guenee (Lepidoptera: Crambidae, terhadap protein Bacillus thuringiensis Cry1Ac diuji dengan metode celup pakan. Larva berasal dari pertanaman jagung di KP-4, UGM di Kalitirto dan telah dikembangbiakkan di laboratorium menggunakan pakan buatan (InsectaLF selama tiga generasi sebelum digunakan untuk pengujian. Larva O. furnacalis yang diuji dipaparkan pada pakan buatan yang telah dicelupkan pada seri konsentrasi Cry1Ac. Nilai LC50 pada hari ketujuh setelah perlakukan untuk instar 1, 2, 3, dan 4 berturut-turut adalah 0,79; 21,12; 113,66; dan 123,17 ppm. Hal ini menunjukkan bahwa instar yang semakin tinggi tingkat kepekaannya terhadap Cry1Ac semakin menurun. Larva yang baru menetas dan diberi pakan yang telah dicelupkan pada konsentrasi sublethal Cry1Ac

  5. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  6. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  7. Frequency of Cry1F Non-Recessive Resistance Alleles in North Carolina Field Populations of Spodoptera frugiperda (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Li, Guoping; Reisig, Dominic; Miao, Jin; Gould, Fred; Huang, Fangneng; Feng, Hongqiang

    2016-01-01

    Fall armyworm, Spodoptera frugiperda (J.E. Smith) (Lepidoptera: Noctuidae), is a target species of transgenic corn (Zea mays L.) that expresses single and pyramided Bacillus thuringiensis (Bt) toxin. In 2014, S. frugiperda were collected from a light trap in North Carolina, and a total of 212 F1/F2 isofemale lines of S. frugiperda were screened for resistance to Bt and non-Bt corn. All of the 212 isolines were susceptible to corn tissue expressing Cry1A.105 + Cry2Ab, Cry1F + Cry1A.105 + Cry2Ab, and Cry1F + Cry1Ab + Vip3Aa20. Growth rate bioassays were performed to isolate non-recessive Bt resistance alleles. Seven individuals out of the 212 isofemale lines carried major non-recessive alleles conferring resistance to Cry1F. A pooled colony was created from the seven individuals. This colony was 151.21 times more resistant to Cry1F than a known-susceptible population and was also resistant to Cry1A.105, but was not resistant to Cry2Ab and Vip3Aa20. The results demonstrate that field populations of S. frugiperda collected from North Carolina are generally susceptible to Cry1F, but that some individuals carry resistant alleles. The data generated in this study can be used as baseline data for resistance monitoring.

  8. Seleção e caracterização molecular de isolados de Bacillus thuringiensis para o controle de Spodoptera spp.

    Directory of Open Access Journals (Sweden)

    Kelly Christiane Constanski

    2015-08-01

    Full Text Available Resumo:O objetivo deste trabalho foi selecionar e caracterizar molecularmente isolados de Bacillus thuringiensistóxicos a Spodoptera eridaniaeS. frugiperda. Trinta e quatro isolados foram submetidos ao bioensaio, dos quais três foram selecionados e usados para a estimativa da CL50. Os isolados selecionados não diferiram da linhagem padrão HD-1. Na caracterização molecular, identificou-se a presença dos genes cry1 e cry2, nos isolados BR37 e BR94, e dos genes cry4A, cry4B, cry10, cry11 e cyt1 no isolado BR58, o que confirmou o perfil proteico obtido de 130, 70 e 65 kDa. Foram identificados cristais bipiramidais e esféricos. O isolado BR58, apesar de não conter os genes relacionados à toxicidade a Lepidoptera, causa mortalidade em ambas as espécies

  9. [Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

    Science.gov (United States)

    Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

    2008-01-01

    The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

  10. Acoustic Features and Auditory Perceptions of the Cries of Newborns with Prenatal and Perinatal Complications.

    Science.gov (United States)

    Zeskind, Philip Sanford; Lester, Barry M.

    1978-01-01

    Describes two experiments which examined the relation between neonatal cry features and obstetric histories. Experiment 1 showed differences in pitch and durational features between the cries of high- and low-complication newborns. Experiment 2 showed differences in the cry ratings of the two groups on dimensions such as aversive, sick, urgent,…

  11. Acquisition of Cry1Ac protein by non-target arthropods in Bt soybean fields.

    Directory of Open Access Journals (Sweden)

    Huilin Yu

    Full Text Available Soybean tissue and arthropods were collected in Bt soybean fields in China at different times during the growing season to investigate the exposure of arthropods to the plant-produced Cry1Ac toxin and the transmission of the toxin within the food web. Samples from 52 arthropod species/taxa belonging to 42 families in 10 orders were analysed for their Cry1Ac content using enzyme-linked immunosorbent assay (ELISA. Among the 22 species/taxa for which three samples were analysed, toxin concentration was highest in the grasshopper Atractomorpha sinensis and represented about 50% of the concentration in soybean leaves. Other species/taxa did not contain detectable toxin or contained a concentration that was between 1 and 10% of that detected in leaves. These Cry1Ac-positive arthropods included a number of mesophyll-feeding Hemiptera, a cicadellid, a curculionid beetle and, among the predators, a thomisid spider and an unidentified predatory bug belonging to the Anthocoridae. Within an arthropod species/taxon, the Cry1Ac content sometimes varied between life stages (nymphs/larvae vs. adults and sampling dates (before, during, and after flowering. Our study is the first to provide information on Cry1Ac-expression levels in soybean plants and Cry1Ac concentrations in non-target arthropods in Chinese soybean fields. The data will be useful for assessing the risk of non-target arthropod exposure to Cry1Ac in soybean.

  12. Acquisition of Cry1Ac Protein by Non-Target Arthropods in Bt Soybean Fields

    Science.gov (United States)

    Yu, Huilin; Romeis, Jörg; Li, Yunhe; Li, Xiangju; Wu, Kongming

    2014-01-01

    Soybean tissue and arthropods were collected in Bt soybean fields in China at different times during the growing season to investigate the exposure of arthropods to the plant-produced Cry1Ac toxin and the transmission of the toxin within the food web. Samples from 52 arthropod species/taxa belonging to 42 families in 10 orders were analysed for their Cry1Ac content using enzyme-linked immunosorbent assay (ELISA). Among the 22 species/taxa for which three samples were analysed, toxin concentration was highest in the grasshopper Atractomorpha sinensis and represented about 50% of the concentration in soybean leaves. Other species/taxa did not contain detectable toxin or contained a concentration that was between 1 and 10% of that detected in leaves. These Cry1Ac-positive arthropods included a number of mesophyll-feeding Hemiptera, a cicadellid, a curculionid beetle and, among the predators, a thomisid spider and an unidentified predatory bug belonging to the Anthocoridae. Within an arthropod species/taxon, the Cry1Ac content sometimes varied between life stages (nymphs/larvae vs. adults) and sampling dates (before, during, and after flowering). Our study is the first to provide information on Cry1Ac-expression levels in soybean plants and Cry1Ac concentrations in non-target arthropods in Chinese soybean fields. The data will be useful for assessing the risk of non-target arthropod exposure to Cry1Ac in soybean. PMID:25110881

  13. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  14. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  15. Socioeconomic disadvantages and neural sensitivity to infant cry: role of maternal distress.

    Science.gov (United States)

    Kim, Pilyoung; Capistrano, Christian; Congleton, Christina

    2016-10-01

    Socioeconomic disadvantage such as poverty can increase distress levels, which may further make low-income mothers more vulnerable to difficulties in the transition to parenthood. However, little is known about the neurobiological processes by which poverty and maternal distress are associated with risks for adaptations to motherhood. Thus, the current study examined the associations between income and neural responses to infant cry sounds among first-time new mothers (N = 28) during the early postpartum period. Lower income was associated with reduced responses to infant cry in the medial prefrontal gyrus (involved in evaluating emotional values of stimuli), middle prefrontal gyrus (involved in affective regulation) and superior temporal gyrus (involved in sensory information processing). When examining the role of maternal distress, we found a mediating role of perceived stress, but not depressive symptoms, in the links between income and prefrontal responses to infant cry. Reduced neural responses to infant cry in the right middle frontal gyrus and superior temporal gyrus were further associated with less positive perceptions of parenting. The results demonstrate that perceived stress associated with socioeconomic disadvantages may contribute to reduced neural responses to infant cry, which is further associated with less positive perceptions of motherhood. © The Author (2016). Published by Oxford University Press. For Permissions, please email: journals.permissions@oup.com.

  16. Differential protection of Cry1Fa toxin against Spodoptera frugiperda larval gut proteases by cadherin orthologs correlates with increased synergism.

    Science.gov (United States)

    Rahman, Khalidur; Abdullah, Mohd Amir F; Ambati, Suresh; Taylor, Milton D; Adang, Michael J

    2012-01-01

    The Cry proteins produced by Bacillus thuringiensis (Bt) are the most widely used biopesticides effective against a range of crop pests and disease vectors. Like chemical pesticides, development of resistance is the primary threat to the long-term efficacy of Bt toxins. Recently discovered cadherin-based Bt Cry synergists showed the potential to augment resistance management by improving efficacy of Cry toxins. However, the mode of action of Bt Cry synergists is thus far unclear. Here we elucidate the mechanism of cadherin-based Cry toxin synergism utilizing two cadherin peptides, Spodoptera frugiperda Cad (SfCad) and Manduca sexta Cad (MsCad), which differentially enhance Cry1Fa toxicity to Spodoptera frugiperda neonates. We show that differential SfCad- and MsCad-mediated protection of Cry1Fa toxin in the Spodoptera frugiperda midgut correlates with differential Cry1Fa toxicity enhancement. Both peptides exhibited high affinity for Cry1Fa toxin and an increased rate of Cry1Fa-induced pore formation in S. frugiperda. However, only SfCad bound the S. frugiperda brush border membrane vesicle and more effectively prolonged the stability of Cry1Fa toxin in the gut, explaining higher Cry1Fa enhancement by this peptide. This study shows that cadherin fragments may enhance B. thuringiensis toxicity by at least two different mechanisms or a combination thereof: (i) protection of Cry toxin from protease degradation in the insect midgut and (ii) enhancement of pore-forming ability of Cry toxin.

  17. Development of materials to support parents whose babies cry excessively: findings and health service implications.

    Science.gov (United States)

    Long, Jaqui; Powell, Charlotte; Bamber, Deborah; Garratt, Rosemary; Brown, Jayne; Dyson, Sue; James-Roberts, Ian St

    2018-01-10

    Aim To develop evidence-based materials which provide information and support for parents who are concerned about their baby's excessive crying. As well as meeting these parents' needs, the aim was to develop a package of materials suitable for use by the UK National Health Service (NHS). Parents report that around 20% of infants in Western countries cry excessively without an apparent reason during the first four months of age. Traditionally, research has focused on the crying and its causes. However, evidence is growing that how parents evaluate and respond to the crying needs to receive equal attention. This focus encompasses parental resources, vulnerabilities, well-being and mental health. At present, the UK NHS lacks a set of routine provisions to support parents who are concerned about their baby's excessive crying. The rationales, methods and findings from a study developing materials for this purpose are reported. Following a literature review, 20 parents whose babies previously cried excessively took part in focus groups or interviews. They provided reports on their experiences and the supports they would have liked when their baby was crying excessively. In addition, they identified their preferred delivery methods and devices for accessing information and rated four example support packages identified by the literature review. Findings During the period their baby cried excessively, most parents visited a health service professional and most considered these direct contacts to have provided helpful information and support. Websites were similarly popular. Telephones and tablets were the preferred means of accessing online information. Groups to meet other parents were considered an important additional resource by all the parents. Three package elements - a Surviving Crying website, a printed version of the website and a programme of Cognitive Behaviour Therapy-based support sessions delivered to parents by a qualified practitioner, were developed for

  18. ATP sensitive potassium channels in the skeletal muscle functions : involvement of the KCNJ11(Kir6.2 gene in the determination of Warner Bratzer shear force

    Directory of Open Access Journals (Sweden)

    Domenico eTricarico

    2016-05-01

    Full Text Available The ATP-sensitive K+-channels (KATP are distributed in the tissues coupling metabolism with K+ ions efflux. KATP subunits are encoded by KCNJ8 (Kir6.1, KCNJ11 (Kir6.2, ABCC8 (SUR1 and ABCC9 (SUR2 genes, alternative RNA splicing give rise to SUR variants that confer distinct physiological properties on the channel. An high expression/activity of the sarco-KATP channel is observed in various rat fast-twitch muscles, characterized by elevated muscle strength, while a low expression/activity is observed in the slow-twitch muscles characterized by reduced strength and frailty. Down-regulation of the KATP subunits of fast-twitch fibres is found in conditions characterized by weakness and frailty. KCNJ11 gene knockout mice have reduced glycogen, lean phenotype, lower body fat, and weakness. KATP channel is also a sensor of muscle atrophy. The KCNJ11 gene is located on BTA15, close to a QTL for meat tenderness, it has also a role in glycogen storage, a key mechanism of the postmortem transformation of muscle into meat. The role of KCNJ11 gene in muscle function may underlie an effect of KCNJ11 genotypes on meat tenderness, as recently reported. The fiber phenotype and genotype are important in livestock production science. Quantitative traits including meat production and quality are influenced both by environment and genes. Molecular markers can play an important role in the genetic improvement of animals through breeding strategies. Many factors influence the muscle Warner-Bratzler shear force including breed, age, feeding, the biochemical and functional parameters. The role of KCNJ11gene and related genes on muscle tenderness will be discussed in the present review.

  19. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  20. An Arduino-Based Resonant Cradle Design with Infant Cries Recognition.

    Science.gov (United States)

    Chao, Chun-Tang; Wang, Chia-Wei; Chiou, Juing-Shian; Wang, Chi-Jo

    2015-08-03

    This paper proposes a resonant electric cradle design with infant cries recognition, employing an Arduino UNO as the core processor. For most commercially available electric cradles, the drive motor is closely combined with the bearing on the top, resulting in a lot of energy consumption. In this proposal, a ball bearing design was adopted and the driving force is under the cradle to increase the distance from the object to fulcrum and torque. The sensors are designed to detect the oscillation state, and then the force is driven at the critical time to achieve the maximum output response while saving energy according to the principle of resonance. As for the driving forces, the winding power and motors are carefully placed under the cradle. The sensors, including the three-axis accelerometer and infrared sensor, are tested and applied under swinging amplitude control. In addition, infant cry recognition technology was incorporated in the design to further develop its functionality, which is a rare feature in this kind of hardware. The proposed nonlinear operator of fundamental frequency (f0) analysis is able to identify different types of infant cries. In conclusion, this paper proposes an energy-saving electric cradle with infant cries recognition and the experimental results demonstrate the effectiveness of this approach.