WorldWideScience

Sample records for genes encoding copper-containing

  1. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  2. Evidence that translation reinitiation leads to a partially functional Menkes protein containing two copper-binding sites

    DEFF Research Database (Denmark)

    Paulsen, Marianne; Lund, Connie; Akram, Zarqa

    2006-01-01

    Menkes disease (MD) is an X-linked recessive disorder of copper metabolism. It is caused by mutations in the ATP7A gene encoding a copper-translocating P-type ATPase, which contains six N-terminal copper-binding sites (CBS1-CBS6). Most patients die in early childhood. We investigated the functional...... effect of a large frameshift deletion in ATP7A (including exons 3 and 4) identified in a patient with MD with unexpectedly mild symptoms and long survival. The mutated transcript, ATP7A(Delta ex3+ex4), contains a premature termination codon after 46 codons. Although such transcripts are generally...... degraded by nonsense-mediated mRNA decay (NMD), it was established by real-time PCR quantification that the ATP7A(Delta ex3+ex4) transcript was protected from degradation. A combination of in vitro translation, recombinant expression, and immunocytochemical analysis provided evidence that the ATP7A...

  3. Copper economy in Chlamydomonas: Prioritized allocation and reallocation of copper to respiration vs. photosynthesis

    Science.gov (United States)

    Kropat, Janette; Gallaher, Sean D.; Urzica, Eugen I.; Nakamoto, Stacie S.; Strenkert, Daniela; Tottey, Stephen; Mason, Andrew Z.; Merchant, Sabeeha S.

    2015-01-01

    Inorganic elements, although required only in trace amounts, permit life and primary productivity because of their functions in catalysis. Every organism has a minimal requirement of each metal based on the intracellular abundance of proteins that use inorganic cofactors, but elemental sparing mechanisms can reduce this quota. A well-studied copper-sparing mechanism that operates in microalgae faced with copper deficiency is the replacement of the abundant copper protein plastocyanin with a heme-containing substitute, cytochrome (Cyt) c6. This switch, which is dependent on a copper-sensing transcription factor, copper response regulator 1 (CRR1), dramatically reduces the copper quota. We show here that in a situation of marginal copper availability, copper is preferentially allocated from plastocyanin, whose function is dispensable, to other more critical copper-dependent enzymes like Cyt oxidase and a ferroxidase. In the absence of an extracellular source, copper allocation to Cyt oxidase includes CRR1-dependent proteolysis of plastocyanin and quantitative recycling of the copper cofactor from plastocyanin to Cyt oxidase. Transcriptome profiling identifies a gene encoding a Zn-metalloprotease, as a candidate effecting copper recycling. One reason for the retention of genes encoding both plastocyanin and Cyt c6 in algal and cyanobacterial genomes might be because plastocyanin provides a competitive advantage in copper-depleted environments as a ready source of copper. PMID:25646490

  4. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  5. Cloning and molecular characterization of a copper chaperone gene ...

    African Journals Online (AJOL)

    The cDNA encoding a copper chaperone, designated as HbCCH1, was isolated from Hevea brasiliensis. HbCC1 was 589 bp long containing a 261 bp open reading frame encoding a putative protein of 86 amino acids, flanked by a 103 bp 5'UTR and a 225 bp 3'UTR. The predicted molecular mass of HbCCH1 was 9.2 kDa, ...

  6. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  7. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog-dependent

    International Nuclear Information System (INIS)

    Asselman, Jana; Shaw, Joseph R.; Glaholt, Stephen P.; Colbourne, John K.; De Schamphelaere, Karel A.C.

    2013-01-01

    Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species

  8. Transcription patterns of genes encoding four metallothionein homologs in Daphnia pulex exposed to copper and cadmium are time- and homolog-dependent

    Energy Technology Data Exchange (ETDEWEB)

    Asselman, Jana, E-mail: jana.asselman@ugent.be [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium); Shaw, Joseph R.; Glaholt, Stephen P. [The School of Public and Environmental Affairs, Indiana University, Bloomington, IN (United States); Colbourne, John K. [School of Biosciences, The University of Birmingham, Birmingham (United Kingdom); De Schamphelaere, Karel A.C. [Laboratory of Environmental Toxicology and Aquatic Ecology, Ghent University, Ghent (Belgium)

    2013-10-15

    Highlights: •Transcription patterns of 4 metallothionein isoforms in Daphnia pulex. •Under cadmium and copper stress these patterns are time-dependent. •Under cadmium and copper stress these patterns are homolog-dependent. •The results stress the complex regulation of metallothioneins. -- Abstract: Metallothioneins are proteins that play an essential role in metal homeostasis and detoxification in nearly all organisms studied to date. Yet discrepancies between outcomes of chronic and acute exposure experiments hamper the understanding of the regulatory mechanisms of their isoforms following metal exposure. Here, we investigated transcriptional differences among four identified homologs (mt1–mt4) in Daphnia pulex exposed across time to copper and cadmium relative to a control. Transcriptional upregulation of mt1 and mt3 was detected on day four following exposure to cadmium, whereas that of mt2 and mt4 was detected on day two and day eight following exposure to copper. These results confirm temporal and metal-specific differences in the transcriptional induction of genes encoding metallothionein homologs upon metal exposure which should be considered in ecotoxicological monitoring programs of metal-contaminated water bodies. Indeed, the mRNA expression patterns observed here illustrate the complex regulatory system associated with metallothioneins, as these patterns are not only dependent on the metal, but also on exposure time and the homolog studied. Further phylogenetic analysis and analysis of regulatory elements in upstream promoter regions revealed a high degree of similarity between metallothionein genes of Daphnia pulex and Daphnia magna, a species belonging to the same genus. These findings, combined with a limited amount of available expression data for D. magna metallothionein genes, tentatively suggest a potential generalization of the metallothionein response system between these Daphnia species.

  9. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  10. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  11. Identification and characterization of a novel Cut family cDNA that encodes human copper transporter protein CutC

    International Nuclear Information System (INIS)

    Li Jixi; Ji Chaoneng; Chen Jinzhong; Yang Zhenxing; Wang Yijing; Fei, Xiangwei; Zheng Mei; Gu Xing; Wen Ge; Xie Yi; Mao Yumin

    2005-01-01

    Copper is an essential heavy metal trace element that plays important roles in cell physiology. The Cut family was associated with the copper homeostasis and involved in several important metabolisms, such as uptake, storage, delivery, and efflux of copper. In this study, a novel Cut family cDNA was isolated from the human fetal brain library, which encodes a 273 amino acid protein with a molecular mass of about 29.3 kDa and a calculated pI of 8.17. It was named hCutC (human copper transporter protein CutC). The ORF of hCutC gene was cloned into pQE30 vector and expressed in Escherichia coli M15. The secreted hCutC protein was purified to a homogenicity of 95% by using the Ni-NTA affinity chromatography. RT-PCR analysis showed that the hCutC gene expressed extensively in human tissues. Subcellular location analysis of hCutC-EGFP fusion protein revealed that hCutC was distributed to cytoplasm of COS-7 cells, and both cytoplasm and nucleus of AD293 cells. The results suggest that hCutC may be one shuttle protein and play important roles in intracellular copper trafficking

  12. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  13. LIGNOCELLULOSE NANOCOMPOSITE CONTAINING COPPER SULFIDE

    OpenAIRE

    Sanchi Nenkova; Peter Velev; Mirela Dragnevska; Diyana Nikolova; Kiril Dimitrov

    2011-01-01

    Copper sulfide-containing lignocellulose nanocomposites with improved electroconductivity were obtained. Two methods for preparing the copper sulfide lignocellulose nanocomposites were developed. An optimization of the parameters for obtaining of the nanocomposites with respect to obtaining improved electroconductivity, economy, and lower quantities and concentration of copper and sulfur ions in waste waters was conducted. The mechanisms and schemes of delaying and subsequent connection of co...

  14. The number of genes encoding repeat domain-containing proteins positively correlates with genome size in amoebal giant viruses

    Science.gov (United States)

    Shukla, Avi; Chatterjee, Anirvan

    2018-01-01

    Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275

  15. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    Directory of Open Access Journals (Sweden)

    Hille Fieten

    2016-01-01

    Full Text Available The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to Wilson disease, which is characterized by a predominantly hepatic copper accumulation. The low incidence and the phenotypic variability of human copper toxicosis hamper identification of causal genes or modifier genes involved in the disease pathogenesis. The Labrador retriever was recently characterized as a new canine model for copper toxicosis. Purebred dogs have reduced genetic variability, which facilitates identification of genes involved in complex heritable traits that might influence phenotype in both humans and dogs. We performed a genome-wide association study in 235 Labrador retrievers and identified two chromosome regions containing ATP7A and ATP7B that were associated with variation in hepatic copper levels. DNA sequence analysis identified missense mutations in each gene. The amino acid substitution ATP7B:p.Arg1453Gln was associated with copper accumulation, whereas the amino acid substitution ATP7A:p.Thr327Ile partly protected against copper accumulation. Confocal microscopy indicated that aberrant copper metabolism upon expression of the ATP7B variant occurred because of mis-localization of the protein in the endoplasmic reticulum. Dermal fibroblasts derived from ATP7A:p.Thr327Ile dogs showed copper accumulation and delayed excretion. We identified the Labrador retriever as the first natural, non-rodent model for ATP7B-associated copper toxicosis. Attenuation of copper accumulation by the ATP7A mutation sheds an interesting light on the interplay of copper transporters in body copper homeostasis and warrants a thorough investigation of ATP7A as a modifier gene in copper-metabolism disorders. The identification of two new functional

  16. Copper induces expression and methylation changes of early development genes in Crassostrea gigas embryos.

    Science.gov (United States)

    Sussarellu, Rossana; Lebreton, Morgane; Rouxel, Julien; Akcha, Farida; Rivière, Guillaume

    2018-03-01

    Copper contamination is widespread along coastal areas and exerts adverse effects on marine organisms such as mollusks. In the Pacific oyster, copper induces severe developmental abnormalities during early life stages; however, the underlying molecular mechanisms are largely unknown. This study aims to better understand whether the embryotoxic effects of copper in Crassostrea gigas could be mediated by alterations in gene expression, and the putative role of DNA methylation, which is known to contribute to gene regulation in early embryo development. For that purpose, oyster embryos were exposed to 4 nominal copper concentrations (0.1, 1, 10 and 20 μg L -1 Cu 2+ ) during early development assays. Embryotoxicity was monitored through the oyster embryo-larval bioassay at the D-larva stage 24 h post fertilization (hpf) and genotoxicity at gastrulation 7 hpf. In parallel, the relative expression of 15 genes encoding putative homeotic, biomineralization and DNA methylation proteins was measured at three developmental stages (3 hpf morula stage, 7 hpf gastrula stage, 24 hpf D-larvae stage) using RT-qPCR. Global DNA content in methylcytosine and hydroxymethylcytosine were measured by HPLC and gene-specific DNA methylation levels were monitored using MeDIP-qPCR. A significant increase in larval abnormalities was observed from copper concentrations of 10 μg L -1 , while significant genotoxic effects were detected at 1 μg L -1 and above. All the selected genes presented a stage-dependent expression pattern, which was impaired for some homeobox and DNA methylation genes (Notochord, HOXA1, HOX2, Lox5, DNMT3b and CXXC-1) after copper exposure. While global DNA methylation (5-methylcytosine) at gastrula stage didn't show significant changes between experimental conditions, 5-hydroxymethylcytosine, its degradation product, decreased upon copper treatment. The DNA methylation of exons and the transcript levels were correlated in control samples for HOXA1 but such

  17. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  18. Gene ercA, encoding a putative iron-containing alcohol dehydrogenase, is involved in regulation of ethanol utilization in Pseudomonas aeruginosa.

    Science.gov (United States)

    Hempel, Niels; Görisch, Helmut; Mern, Demissew S

    2013-09-01

    Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.

  19. Copper-induced apical trafficking of ATP7B in polarized hepatoma cells provides a mechanism for biliary copper excretion

    NARCIS (Netherlands)

    Roelofsen, H; Wolters, H; Van Luyn, MJA; Miura, N; Kuipers, F; Vonk, RJ

    Background & Aims: Mutations in the ATP7B gene, encoding a copper-transporting P-type adenosine triphosphatase, lead to excessive hepatic copper accumulation because of impaired biliary copper excretion in Wilson's disease. In human liver, ATP7B is predominantly localized to the trans-Golgi network,

  20. Transgenic Mice Expressing Yeast CUP1 Exhibit Increased Copper Utilization from Feeds

    Science.gov (United States)

    Chen, Zhenliang; Liao, Rongrong; Zhang, Xiangzhe; Wang, Qishan; Pan, Yuchun

    2014-01-01

    Copper is required for structural and catalytic properties of a variety of enzymes participating in many vital biological processes for growth and development. Feeds provide most of the copper as an essential micronutrient consumed by animals, but inorganic copper could not be utilized effectively. In the present study, we aimed to develop transgenic mouse models to test if copper utilization will be increased by providing the animals with an exogenous gene for generation of copper chelatin in saliva. Considering that the S. cerevisiae CUP1 gene encodes a Cys-rich protein that can bind copper as specifically as copper chelatin in yeast, we therefore constructed a transgene plasmid containing the CUP1 gene regulated for specific expression in the salivary glands by a promoter of gene coding pig parotid secretory protein. Transgenic CUP1 was highly expressed in the parotid and submandibular salivary glands and secreted in saliva as a 9-kDa copper-chelating protein. Expression of salivary copper-chelating proteins reduced fecal copper contents by 21.61% and increased body-weight by 12.97%, suggesting that chelating proteins improve the utilization and absorbed efficacy of copper. No negative effects on the health of the transgenic mice were found by blood biochemistry and histology analysis. These results demonstrate that the introduction of the salivary CUP1 transgene into animals offers a possible approach to increase the utilization efficiency of copper and decrease the fecal copper contents. PMID:25265503

  1. LIGNOCELLULOSE NANOCOMPOSITE CONTAINING COPPER SULFIDE

    Directory of Open Access Journals (Sweden)

    Sanchi Nenkova

    2011-04-01

    Full Text Available Copper sulfide-containing lignocellulose nanocomposites with improved electroconductivity were obtained. Two methods for preparing the copper sulfide lignocellulose nanocomposites were developed. An optimization of the parameters for obtaining of the nanocomposites with respect to obtaining improved electroconductivity, economy, and lower quantities and concentration of copper and sulfur ions in waste waters was conducted. The mechanisms and schemes of delaying and subsequent connection of copper sulfides in the lignocellulosic matrix were investigated. The modification with a system of 2 components: cupric sulfate pentahydrate (CuSO4. 5H2O and sodium thiosulfate pentahydrate (Na2S2O3.5H2O for wood fibers is preferred. Optimal parameters were established for the process: 40 % of the reduction system; hydromodule M=1:6; and ratio of cupric sulfate pentahydrate:sodium thiosulfate pentahydrate = 1:2. The coordinative connection of copper ions with oxygen atoms of cellulose OH groups and aromatic nucleus in lignin macromolecule was observed.

  2. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  3. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  4. Molecular control of copper homeostasis in filamentous fungi: increased expression of a metallothionein gene during aging of Podospora anserina.

    Science.gov (United States)

    Averbeck, N B; Borghouts, C; Hamann, A; Specke, V; Osiewacz, H D

    2001-01-01

    The lifespan of the ascomycete Podospora anserina was previously demonstrated to be significantly increased in a copper-uptake mutant, suggesting that copper is a potential stressor involved in degenerative processes. In order to determine whether changes in copper stress occur in the cells during normal aging of cultures, we cloned and characterized a gene coding for a component of the molecular machinery involved in the control of copper homeostasis. This gene, PaMt1, is a single-copy gene that encodes a metallothionein of 26 amino acids. The coding sequence of PaMt1 is interrupted by a single intron. The deduced amino acid sequence shows a high degree of sequence identity to metallothioneins of the filamentous ascomycete Neurospora crassa and the basidiomycete Agaricus bisporus, and to the N-terminal portion of mammalian metallothioneins. Levels of PaMt1 transcript increase in response to elevated amounts of copper in the growth medium and during aging of wild-type cultures. In contrast, in the long-lived mutant grisea, transcript levels first increase but then decrease again. The ability of wild-type cultures to respond to exogenous copper stress via the induction of PaMt1 transcription is not affected as they grow older.

  5. Molecular Characterization of CTR-type Copper Transporters in an Oceanic Diatom, Thalassiosira oceanica 1005

    Science.gov (United States)

    Kong, L.; Price, N. M.

    2016-02-01

    Copper is an essential micronutrient for phytoplankton growth because of its role as a redox cofactor in electron transfer proteins in photosynthesis and respiration, and a potentially limiting resource in parts of the open sea. Thalassiosira oceanica 1005 can grow at inorganic copper concentrations varying from 10 fmol/L to 10 nmol/L by regulating copper uptake across plasma membrane. Four putative CTR-type copper transporter genes (ToCTR1, ToCTR2, ToCTR3.1 and ToCTR3.2) were identified by BLASTP search against the T. oceanica genome. Predicted gene models were revised by assembled mRNA sequencing transcripts and updated gene models contained all conserved features of characterized CTR-type copper transporters. ToCTR3.1 and ToCTR3.2 may arise from one another by gene duplication as they shared a sequence similarity of 97.6% with a peptide insertion of 5 amino acids at N-terminus of ToCTR3.1. The expression of ToCTR1, ToCTR2 and ToCTR3.1/3.2 was upregulated in low copper concentrations, but only ToCTR3.1/3.2 showed a significant increase (2.5 fold) in copper-starved cells. Both ToCTR3.1 and ToCTR3.2 restored growth of a yeast double mutant, Saccharomyces cerevisiae ctr1Δctr3Δ, in copper deficient medium. GFP-fused ToCTR expression showed that some ToCTR3.1 localized to the plasma membrane but a large portion was retained in the endoplasmic reticulum. Inefficient targeting of ToCTR3.1 to the yeast outer membrane may explain poorer growth compared to the Saccharomyces native ScCTR1 transformant. Thus, diatom CTR genes encoding CTR-type copper transporters show high-affinity copper uptake and their regulation may enable diatoms to survive in ocean environments containing a wide range of copper concentrations.

  6. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  7. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  8. Development of a container failure function for copper

    International Nuclear Information System (INIS)

    King, F.; Litke, C.D.

    1990-01-01

    A simple approach to the modeling of failure rates for a copper container under Canadian waste disposal conditions is presented. Both uniform corrosion and pitting must be considered. Short-term failures due to fabrication defects must be taken into account. The model allows for short-term sorption of copper by the clay buffer material, and assumes a steady-state condition for uniform corrosion. Using worst-case assumptions, a container penetration time of 3300 years can be predicted

  9. Sulfidation treatment of copper-containing plating sludge towards copper resource recovery.

    Science.gov (United States)

    Kuchar, D; Fukuta, T; Onyango, M S; Matsuda, H

    2006-11-02

    The present study is concerned with the sulfidation treatment of copper-containing plating sludge towards copper resource recovery by flotation of copper sulfide from treated sludge. The sulfidation treatment was carried out by contacting simulated or real copper plating sludge with Na(2)S solution for a period of 5 min to 24 h. The initial molar ratio of S(2-) to Cu(2+) (S(2-) to Me(2+) in the case of real sludge) was adjusted to 1.00, 1.25 or 1.50, while the solid to liquid ratio was set at 1:50. As a result, it was found that copper compounds were converted to various copper sulfides within the first 5 min. In the case of simulated copper sludge, CuS was identified as the main sulfidation product at the molar ratio of S(2-) to Cu(2+) of 1.00, while Cu(7)S(4) (Roxbyite) was mainly found at the molar ratios of S(2-) to Cu(2+) of 1.50 and 1.25. Based on the measurements of oxidation-reduction potential, the formation of either CuS or Cu(7)S(4) at different S(2-) to Cu(2+) molar ratios was attributed to the changes in the oxidation-reduction potential. By contrast, in the case of sulfidation treatment of real copper sludge, CuS was predominantly formed, irrespective of S(2-) to Me(2+) molar ratio.

  10. Cold spray copper coatings for used fuel containers

    Energy Technology Data Exchange (ETDEWEB)

    Keech, P. [Nuclear Waste Management Organization, Toronto, ON (Canada); Vo, P.; Poirier, D.; Legoux, J-G [National Research Council, Boucherville QC, (Canada)

    2015-07-01

    Recently, the Nuclear Waste Management Organization has been developing copper coatings as a method of protecting steel used fuel containers (UFCs) from corrosion within a deep geological repository. The corrosion barrier design is based on the application of a copper coating bonded directly to the exterior surface of the UFC structural core. Copper coating technologies amendable to supply of pre-coated UFC vessel components and application to the weld zone following UFC closure within the radiological environment have been investigated. Copper cold spray has been assessed for both operations; this paper outlines the research and development to date of this technique. (author)

  11. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  12. Integrated copper-containing wastewater treatment using xanthate process.

    Science.gov (United States)

    Chang, Yi-Kuo; Chang, Juu-En; Lin, Tzong-Tzeng; Hsu, Yu-Ming

    2002-09-02

    Although, the xanthate process has been shown to be an effective method for heavy metal removal from contaminated water, a heavy metal contaminated residual sludge is produced by the treatment process and the metal-xanthate sludge must be handled in accordance with the Taiwan EPA's waste disposal requirements. This work employed potassium ethyl xanthate (KEX) to remove copper ions from wastewater. The toxicity characteristic leaching procedure (TCLP) and semi-dynamic leaching test (SDLT) were used to determine the leaching potential and stability characteristics of the residual copper xanthate (Cu-EX) complexes. Results from metal removal experiments showed that KEX was suitable for the treatment of copper-containing wastewater over a wide copper concentration range (50, 100, 500, and 1000 mg/l) to the level that meets the Taiwan EPA's effluent regulations (3mg/l). The TCLP results of the residual Cu-EX complexes could meet the current regulations and thus the Cu-EX complexes could be treated as a non-hazardous material. Besides, the results of SDLT indicated that the complexes exhibited an excellent performance for stabilizing metals under acidic conditions, even slight chemical changes of the complexes occurred during extraction. The xanthate process, mixing KEX with copper-bearing solution to form Cu-EX precipitates, offered a comprehensive strategy for solving both copper-containing wastewater problems and subsequent sludge disposal requirements.

  13. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  14. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  15. Corrosion of copper alloys in sulphide containing district heting systems

    DEFF Research Database (Denmark)

    Thorarinsdottir, R.I.; Maahn, Ernst Emanuel

    1999-01-01

    Copper and some copper alloys are prone to corrosion in sulphide containing geothermal water analogous to corrosion observed in district heating systems containing sulphide due to sulphate reducing bacteria. In order to study the corrosion of copper alloys under practical conditions a test...... was carried out at four sites in the Reykjavik District Heating System. The geothermal water chemistry is different at each site. The corrosion rate and the amount and chemical composition of deposits on weight loss coupons of six different copper alloys are described after exposure of 12 and 18 months......, respectively. Some major differences in scaling composition and the degree of corrosion attack are observed between alloys and water types....

  16. Evaluation of copper, aluminum bronze, and copper-nickel container material for the Yucca mountain project

    International Nuclear Information System (INIS)

    Kass, J.

    1990-01-01

    Copper, 70 percent aluminum bronze, and 70/30 copper-nickel were evaluated as potential waste-packaging materials as part of the Yucca Mountain Project. The proposed waste repository site is under a desert mountain in southern Nevada. The expected temperatures at the container surface are higher than at other sites, about 250C at the beginning of the containment period; they could fall below the boiling point of water during this period, but will be exposed to very little water, probably less than 5 l/a. Initial gamma flux will be 10 4 rad/h, and no significant hydrostatic or lithostatic pressure is expected. Packages will contain PWR or BWR fuel, or processed-glass waste. Three copper alloys are being considered for containers: oxygen-free copper (CDA 102); 7 percent aluminum bronze (CDA 613); and 70/30 copper-nickel (CDA 715). Phase separation due to prolonged thermal exposure could be a problem for the two alloys, causing embrittlement. The reduction of internal oxides present in pure copper by hydrogen could cause mechanical degradation. Corrosion and oxidation rates measured for the three materials in well water with and without gamma irradiation at flux rates about ten times higher than those expected were all quite small. The corrosion/oxidation rates for CDA715 show a marked increase under irradiation, but are still acceptable. In the presence of ammonia and other nitrogen-bearing species stress corrosion cracking (SCC) is a concern. Welded U-bend specimens of all three materials have been tested for up to 10000 h in highly irradiated environments, showing no SCC. There was some alloy segregation in the Al bronze specimens. The investigators believe that corrosion and mechanical properties will not present problems for these materials at this site. Further work is needed in the areas of weld inspection, welding techniques, embrittlement of weld metal, the effects of dropping the containers during emplacement, and stress corrosion cracking. Other materials

  17. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  18. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  19. [Effects of copper on biodegradation mechanism of trichloroethylene by mixed microorganisms].

    Science.gov (United States)

    Gao, Yanhui; Zhao, Tiantao; Xing, Zhilin; He, Zhi; Zhang, Lijie; Peng, Xuya

    2016-05-25

    We isolated and enriched mixed microorganisms SWA1 from landfill cover soils supplemented with trichloroethylene (TCE). The microbial mixture could degrade TCE effectively under aerobic conditions. Then, we investigated the effect of copper ion (0 to 15 μmol/L) on TCE biodegradation. Results show that the maximum TCE degradation speed was 29.60 nmol/min with 95.75% degradation when copper ion was at 0.03 μmol/L. In addition, genes encoding key enzymes during biodegradation were analyzed by Real-time quantitative reverse transcription PCR (RT-qPCR). The relative expression abundance of pmoA gene (4.22E-03) and mmoX gene (9.30E-06) was the highest when copper ion was at 0.03 μmol/L. Finally, we also used MiSeq pyrosequencing to investigate the diversity of microbial community. Methylocystaceae that can co-metabolic degrade TCE were the dominant microorganisms; other microorganisms with the function of direct oxidation of TCE were also included in SWA1 and the microbial diversity decreased significantly along with increasing of copper ion concentration. Based on the above results, variation of copper ion concentration affected the composition of SWA1 and degradation mechanism of TCE. The degradation mechanism of TCE included co-metabolism degradation of methanotrophs and oxidation metabolism directly at copper ion of 0.03 μmol/L. When copper ion at 5 μmol/L (biodegradation was 84.75%), the degradation mechanism of TCE included direct-degradation and co-metabolism degradation of methanotrophs and microorganisms containing phenol hydroxylase. Therefore, biodegradation of TCE by microorganisms was a complicated process, the degradation mechanism included co-metabolism degradation of methanotrophs and bio-oxidation of non-methanotrophs.

  20. Biologic assessment of copper-containing amalgams.

    Science.gov (United States)

    Mjor, I A; Eriksen, H M; Haugen, E; Skogedal, O

    1977-12-01

    In order to reduce creep and avoid marginal fractures in amalgam restorations, new alloys containing higher proportions of copper have been introduced. Fillings of these materials were placed in cavities prepared in the deciduous teeth of monkeys or placed in polyethylene tubes and implanted subcutaneously in rats. Conventional silver/tin alloys and zinc oxide eugenol cement were used as reference materials. Despite limitations due to the varying depths of cavities and the small number of animals involved it was concluded that the high copper alloys caused more severe pulp damage than the other materials studied. In the implantation studies many of the high copper specimens were exfoliated before the end of the experimental period. It is concluded that in deep cavities these materials require the use of a non-toxic base or lining material although as they are commonly used in young children's teeth the placement of linings and the isolation of the cavity pose problems.

  1. Treatment of copper ores containing atacamite by the brisa process

    International Nuclear Information System (INIS)

    Carranza, F.; Mazuelos, A.; Romero, R.

    2003-01-01

    The current treatment of copper ores containing atacamite and secondary copper sulphides consists of heap leaching, by the TL process. copper recoveries by this treatment are very low (less than 50% for operating times higher than six months). In order to improve the copper extraction yields, several treatment options are presented in this work, wich consist on promoting the acid leaching of the atacamite and the indirect bio leaching (Brisk process) of the secondary copper sulphides. All the options lead to improved copper recoveries in comparison with the current treatment. An economic estimation of each option of treatment is included, with really attractive results. (Author) 13 refs

  2. VARIABILITY OF COORDINATION COMPLEXES OF COPPER ACCUMULATED WITHIN FUNGAL COLONY IN THE PRESENCE OF COPPER-CONTAINING MINERALS

    Directory of Open Access Journals (Sweden)

    M. O. Fomina

    2014-04-01

    Full Text Available The aim of work was to elucidate the mechanisms of bioaccumulation of copper leached from minerals by fungus Aspergillus niger with great bioremedial potential due to its ability to produce chelating metabolites and transform toxic metals and minerals. The special attention was paid to the chemical speciation of copper bioaccumulated within fungal colony in the process of fungal transformation of copper-containing minerals. Chemical speciation of copper within different parts of the fungal colony was studied using solid-state chemistry methods such as synchrotron-based X-ray absorption spectroscopy providing information about the oxidation state of the target element, and its coordination environment. The analysis of the obtained X-ray absorption spectroscopy spectra was carried out using Fourier transforms of Extended X-ray Absorption Fine Structure regions, which correspond to the oscillating part of the spectrum to the right of the absorption edge. Results of this study showed that fungus A. niger was involved in the process of solubilization of copper-containing minerals resulted in leaching of mobile copper and its further immobilization by fungal biomass with variable coordination of accumulated copper within fungal colony which depended on the age and physiological/reproductive state of fungal mycelium. X-ray absorption spectroscopy data demonstrated that copper accumulated within outer zone of fungal colony with immature vegetative mycelium was coordinated with sulphur–containing ligands, in contrast to copper coordination with phosphate ligands within mature mycelium with profuse conidia in the central zone of the colony. The findings of this study not only broaden our understanding of the biogeochemical role of fungi but can also be used in the development of various fungal-based biometallurgy technologies such as bioremediation, bioaccumulation and bioleaching and in the assessment of their reliability. The main conclusion is that

  3. A novel anti-influenza copper oxide containing respiratory face mask.

    Science.gov (United States)

    Borkow, Gadi; Zhou, Steve S; Page, Tom; Gabbay, Jeffrey

    2010-06-25

    Protective respiratory face masks protect the nose and mouth of the wearer from vapor drops carrying viruses or other infectious pathogens. However, incorrect use and disposal may actually increase the risk of pathogen transmission, rather than reduce it, especially when masks are used by non-professionals such as the lay public. Copper oxide displays potent antiviral properties. A platform technology has been developed that permanently introduces copper oxide into polymeric materials, conferring them with potent biocidal properties. We demonstrate that impregnation of copper oxide into respiratory protective face masks endows them with potent biocidal properties in addition to their inherent filtration properties. Both control and copper oxide impregnated masks filtered above 99.85% of aerosolized viruses when challenged with 5.66+/-0.51 and 6.17+/-0.37 log(10)TCID(50) of human influenza A virus (H1N1) and avian influenza virus (H9N2), respectively, under simulated breathing conditions (28.3 L/min). Importantly, no infectious human influenza A viral titers were recovered from the copper oxide containing masks within 30 minutes (masks. Similarly, the infectious avian influenza titers recovered from the copper oxide containing masks were masks 5.03+/-0.54 log(10)TCID(50). The copper oxide containing masks successfully passed Bacterial Filtration Efficacy, Differential Pressure, Latex Particle Challenge, and Resistance to Penetration by Synthetic Blood tests designed to test the filtration properties of face masks in accordance with the European EN 14683:2005 and NIOSH N95 standards. Impregnation of copper oxide into respiratory protective face masks endows them with potent anti-influenza biocidal properties without altering their physical barrier properties. The use of biocidal masks may significantly reduce the risk of hand or environmental contamination, and thereby subsequent infection, due to improper handling and disposal of the masks.

  4. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  5. Copper-Containing Anti-Biofilm Nanofiber Scaffolds as a Wound Dressing Material.

    Directory of Open Access Journals (Sweden)

    Jayesh J Ahire

    Full Text Available Copper particles were incorporated into nanofibers during the electrospinning of poly-D,L-lactide (PDLLA and poly(ethylene oxide (PEO. The ability of the nanofibers to prevent Pseudomonas aeruginosa PA01 and Staphylococcus aureus (strain Xen 30 to form biofilms was tested. Nanofibers containing copper particles (Cu-F were thinner (326 ± 149 nm in diameter, compared to nanofibers without copper (CF; 445 ± 93 nm in diameter. The crystalline structure of the copper particles in Cu-F was confirmed by X-ray diffraction (XRD. Copper crystals were encapsulated, but also attached to the surface of Cu-F, as shown scanning transmission electron microscopy (STEM and transmission electron microscopy (TEM, respectively. The copper particles had no effect on the thermal degradation and thermal behaviour of Cu-F, as shown by thermogravimetric analysis (TGA and differential scanning calorimeter (DSC. After 48 h in the presence of Cu-F, biofilm formation by P. aeruginosa PA01 and S. aureus Xen 30 was reduced by 41% and 50%, respectively. Reduction in biofilm formation was ascribed to copper released from the nanofibers. Copper-containing nanofibers may be incorporated into wound dressings.

  6. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  7. Effects of Copper Addition on Copper Resistance, Antibiotic Resistance Genes, and intl1 during Swine Manure Composting

    Science.gov (United States)

    Yin, Yanan; Gu, Jie; Wang, Xiaojuan; Song, Wen; Zhang, Kaiyu; Sun, Wei; Zhang, Xin; Zhang, Yajun; Li, Haichao

    2017-01-01

    Copper is one of the most abundant heavy metals present in swine manure. In this study, a laboratory-scale aerobic composting system was amended with Cu at three levels (0, 200, and 2000 mg kg-1, i.e., control, Cu200, and Cu2000 treatments, respectively) to determine its effect on the fate of copper resistance genes [copper resistance genes (CRGs): pcoA, cusA, copA, and tcrB], antibiotic resistance genes [antibiotic resistance genes (ARGs): erm(A) and erm(B)], and intl1. The results showed that the absolute abundances of pcoA, tcrB, erm(A), erm(B), and intl1 were reduced, whereas those of copA and cusA increased after swine manure composting. Redundancy analysis showed that temperature significantly affected the variations in CRGs, ARGs, and intl1. The decreases in CRGs, ARGs, and intI1 were positively correlated with the exchangeable Cu levels. The bacterial community could be grouped according to the composting time under different treatments, where the high concentration of copper had a more persistent effect on the bacterial community. Network analysis determined that the co-occurrence of CRGs, ARGs, and intI1, and the bacterial community were the main contributors to the changes in CRGs, ARG, and intl1. Thus, temperature, copper, and changes in the bacterial community composition had important effects on the variations in CRGs, ARGs, and intl1 during manure composting in the presence of added copper. PMID:28316595

  8. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  9. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  10. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  11. A novel anti-influenza copper oxide containing respiratory face mask.

    Directory of Open Access Journals (Sweden)

    Gadi Borkow

    Full Text Available BACKGROUND: Protective respiratory face masks protect the nose and mouth of the wearer from vapor drops carrying viruses or other infectious pathogens. However, incorrect use and disposal may actually increase the risk of pathogen transmission, rather than reduce it, especially when masks are used by non-professionals such as the lay public. Copper oxide displays potent antiviral properties. A platform technology has been developed that permanently introduces copper oxide into polymeric materials, conferring them with potent biocidal properties. METHODOLOGY/PRINCIPAL FINDINGS: We demonstrate that impregnation of copper oxide into respiratory protective face masks endows them with potent biocidal properties in addition to their inherent filtration properties. Both control and copper oxide impregnated masks filtered above 99.85% of aerosolized viruses when challenged with 5.66+/-0.51 and 6.17+/-0.37 log(10TCID(50 of human influenza A virus (H1N1 and avian influenza virus (H9N2, respectively, under simulated breathing conditions (28.3 L/min. Importantly, no infectious human influenza A viral titers were recovered from the copper oxide containing masks within 30 minutes (< or = 0.88 log(10TCID(50, while 4.67+/-1.35 log(10TCID(50 were recovered from the control masks. Similarly, the infectious avian influenza titers recovered from the copper oxide containing masks were < or = 0.97+/-0.01 log(10TCID(50 and from the control masks 5.03+/-0.54 log(10TCID(50. The copper oxide containing masks successfully passed Bacterial Filtration Efficacy, Differential Pressure, Latex Particle Challenge, and Resistance to Penetration by Synthetic Blood tests designed to test the filtration properties of face masks in accordance with the European EN 14683:2005 and NIOSH N95 standards. CONCLUSIONS/SIGNIFICANCE: Impregnation of copper oxide into respiratory protective face masks endows them with potent anti-influenza biocidal properties without altering their physical

  12. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  13. Cloning, sequence determination, and expression of the genes encoding the subunits of the nickel-containing 8-hydroxy-5-deazaflavin reducing hydrogenase from Methanobacterium thermoautotrophicum ΔH

    International Nuclear Information System (INIS)

    Alex, L.A.; Reeve, J.N.; Orme-Johnson, W.H.; Walsh, C.T.

    1990-01-01

    The genes frhA (1,217 bp), frhB (845 bp), and frhG (710 bp) encoding the three known subunits, α, β, and γ, of the 8-hydroxy-5-deazaflavin (F 420 ) reducing hydrogenase (FRH) from the thermophilic methanogen Methanobacterium thermoautotrophicum ΔH have been cloned, sequenced, and shown to be tightly linked, indicative of a single transcriptional unit. The DNA sequence contains a fourth open reading frame, designated frhD (476 bp), encoding a polypeptide (δ) that does not copurify with the active enzyme. Expression of the frh gene cluster in Escherichia coli shows that four polypeptides are synthesized. When analyzed by SDS-PAGE, the proteins migrate with mobilities consistent with their calculated molecular weights. In order to understand the mechanism of H 2 oxidation by this enzyme, localization of redox cofactors (Ni, Fe/S, FAD) to specific subunits and information on their structure is needed. This has been hindered due to the refractory nature of the enzyme to denaturation methods needed in order to obtain individual subunits with cofactors intact. In this paper they discuss the possible localization of the redox cofactors as implicated from the DNA-derived protein sequences of the subunits. The amino acid sequences of the subunits of the FRH are compared with those of other Ni-containing hydrogenases, including the methyl viologen reducing hydrogenase (MVH) of M. thermoautotrophicum ΔH

  14. Biological role of copper and copper-containing proteins in human and animal organism

    OpenAIRE

    ANTONYAK H.L.; VAZHNENKO A.V.; PANAS N.E.

    2011-01-01

    Current scientific data related to copper metabolism and functional activity of Cu-containing proteins in human and animal cells are reviewed in the article. Important functional role of this essential element in human and animal organism is analyzed.

  15. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  16. Anti-EGFR immunonanoparticles containing IL12 and salmosin genes for targeted cancer gene therapy.

    Science.gov (United States)

    Kim, Jung Seok; Kang, Seong Jae; Jeong, Hwa Yeon; Kim, Min Woo; Park, Sang Il; Lee, Yeon Kyung; Kim, Hong Sung; Kim, Keun Sik; Park, Yong Serk

    2016-09-01

    Tumor-directed gene delivery is of major interest in the field of cancer gene therapy. Varied functionalizations of non-viral vectors have been suggested to enhance tumor targetability. In the present study, we prepared two different types of anti-EGF receptor (EGFR) immunonanoparticles containing pDNA, neutrally charged liposomes and cationic lipoplexes, for tumor-directed transfection of cancer therapeutic genes. Even though both anti-EGFR immunonanoparticles had a high binding affinity to the EGFR-positive cancer cells, the anti-EGFR immunolipoplex formulation exhibited approximately 100-fold higher transfection to the target cells than anti-EGFR immunoliposomes. The lipoplex formulation also showed a higher transfection to SK-OV-3 tumor xenografts in mice. Thus, IL12 and/or salmosin genes were loaded in the anti-EGFR immunolipoplexes and intravenously administered to mice carrying SK-OV-3 tumors. Co-transfection of IL12 and salmosin genes using anti-EGFR immunolipoplexes significantly reduced tumor growth and pulmonary metastasis. Furthermore, combinatorial treatment with doxorubicin synergistically inhibited tumor growth. These results suggest that anti-EGFR immunolipoplexes containing pDNA encoding therapeutic genes could be utilized as a gene-transfer modality for cancer gene therapy.

  17. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  18. Characterization of big bang, a novel gene encoding for PDZ domain-containing proteins that are dynamically expressed throughout Drosophila development.

    Science.gov (United States)

    Kim, Sabrina Y; Renihan, Maia K; Boulianne, Gabrielle L

    2006-06-01

    PDZ (PSD-95, Discs-large, ZO-1) domain proteins often function as scaffolding proteins and have been shown to play important roles in diverse cellular processes such as the establishment and maintenance of cell polarity, and signal transduction. Here, we report the identification and cloning of a novel Drosophila melanogaster gene that is predicted to produce several different PDZ domain-containing proteins through alternative promoter usage and alternative splicing. This gene, that we have named big bang (bbg), was first identified as C96-GAL4, a GAL4 enhancer trap line that was generated in our lab. To further characterize bbg, its expression pattern was examined in ovaries, embryos, and late third instar larvae using UAS reporter gene constructs, in situ hybridization, or immunocytochemistry. In addition, the expression of alternatively spliced transcripts was examined in more detail using in situ hybridization. We find that during embryogenesis bbg is predominantly expressed in the developing gut, but it is also expressed in external sensory organs found in the epidermis. In the late third instar larva, bbg is expressed along the presumptive wing margin in the wing disc, broadly in the eye disc, and in other imaginal discs as well as in the brain. The expression patterns observed are dynamic and specific during development, suggesting that like other genes that encode for several different PDZ domain protein isoforms, bbg likely plays important roles in multiple developmental processes.

  19. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  20. Electrical conduction in composites containing copper core-copper

    Indian Academy of Sciences (India)

    Composites of nanometre-sized copper core-copper oxide shell with diameters in the range 6.1 to 7.3 nm dispersed in a silica gel were synthesised by a technique comprising reduction followed by oxidation of a suitably chosen precursor gel. The hot pressed gel powders mixed with nanometre-sized copper particles ...

  1. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  2. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  3. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  4. Metallic copper spray--a new control technique to combat invasive container-inhabiting mosquitoes.

    Science.gov (United States)

    Becker, Norbert; Oo, Thin Thin; Schork, Nino

    2015-11-09

    The control of container-inhabiting mosquitoes is mainly based on environmental management with special emphasis on community participation e.g. source reduction by elimination or modification of water bodies. However, citizens are often not aware of the problems related to urban mosquito control or just ignore the advice provided during anti-mosquito control campaigns. In particular, cemeteries contain favourite breeding sites for container-inhabiting mosquitoes like Ochlerotatus j. japonicus, Culex pipiens s.l./Cx. torrentium, Aedes aegypti or Aedes albopictus. In our study, we investigated whether metallic copper e.g. in form of copper spray can be a suitable and cost-effective tool to combat mosquito breeding in vases or other similar small containers where no commonly used insecticides can be applied. The effect of metallic copper spray in comparison to 5 Euro cent coins or copper tubes at different dosages and water qualities applied in small water collections such as widely used plastic grave vases were evaluated by assessing the mortality rates of larvae of Oc.j. japonicus, Cx. pipiens s.l./Cx. torrentium and Ae.aegypti. Different water qualities were tested to assess the influence of pH on the solubility of the copper ions. The copper concentrations were quantified using ICP/MS (Inductively coupled plasma/Mass spectrometry) in relation to the exposure time and mortality rates of mosquito larvae. All statistical analyses were computed using JMP 10.0.2 (SAS Institute Inc., 2012, Cary, NC, USA). Dosages of less than 500 ppb of copper in the water of small containers led to a 100% mortality rate after 2 weeks for all tested mosquito species by using one or more 5 Euro cent coins/vase. When the interior surface of plastic grave vases was covered by metallic copper spray, all of the tested larvae died after 7-10 days in the laboratory and under field conditions the reduction rate was 99.44% for Oc.j. japonicus and 99.6% for Culex pipiens s.l./Cx. torrentium

  5. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  6. Selective leaching process for the recovery of copper and zinc oxide from copper-containing dust.

    Science.gov (United States)

    Wu, Jun-Yi; Chang, Fang-Chih; Wang, H Paul; Tsai, Ming-Jer; Ko, Chun-Han; Chen, Chih-Cheng

    2015-01-01

    The purpose of this study was to develop a resource recovery procedure for recovering copper and zinc from dust produced by copper smelting furnaces during the manufacturing of copper-alloy wires. The concentrations of copper in copper-containing dust do not meet the regulation standards defined by the Taiwan Environmental Protection Administration; therefore, such waste is classified as hazardous. In this study, the percentages of zinc and copper in the dust samples were approximately 38.4% and 2.6%, respectively. To reduce environmental damage and recover metal resources for industrial reuse, acid leaching was used to recover metals from these inorganic wastes. In the first stage, 2 N of sulphuric acid was used to leach the dust, with pH values controlled at 2.0-3.0, and a solid-to-liquid ratio of 1:10. The results indicated that zinc extraction efficiency was higher than 95%. A selective acid leaching process was then used to recover the copper content of the residue after filtration. In the second stage, an additional 1 N of sulphuric acid was added to the suspension in the selective leaching process, and the pH value was controlled at 1.5-2.0. The reagent sodium hydroxide (2 N) was used as leachate at a pH greater than 7. A zinc hydroxide compound formed during the process and was recovered after drying. The yields for zinc and copper were 86.9-93.5% and 97.0-98.9%, respectively.

  7. Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

    Directory of Open Access Journals (Sweden)

    Senta Heiss-Blanquet

    Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

  8. Fission neutron irradiation of copper containing implanted and transmutation produced helium

    DEFF Research Database (Denmark)

    Singh, B.N.; Horsewell, A.; Eldrup, Morten Mostgaard

    1992-01-01

    High purity copper containing approximately 100 appm helium was produced in two ways. In the first, helium was implanted by cyclotron at Harwell at 323 K. In the second method, helium was produced as a transmutation product in 800 MeV proton irradiation at Los Alamos, also at 323 K. The distribut......High purity copper containing approximately 100 appm helium was produced in two ways. In the first, helium was implanted by cyclotron at Harwell at 323 K. In the second method, helium was produced as a transmutation product in 800 MeV proton irradiation at Los Alamos, also at 323 K...... as well as the effect of the presence of other transmutation produced impurity atoms in the 800 MeV proton irradiated copper will be discussed....

  9. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  10. Effect of heat treatment duration on phase separation of sodium borosilicate glass, containing copper

    International Nuclear Information System (INIS)

    Shejnina, T.G.; Gutner, S.Kh.; Anan'in, N.I.

    1989-01-01

    The effect of heat treatment duration on phase separation of sodium borosilicate (SBS) glass, containing copper is studied. It is stated that phase separation close to equilibrium one is attained under 12 hours of heat treatment of SBS glass containing copper

  11. Copper Metabolism Domain-Containing 1 Represses Genes That Promote Inflammation and Protects Mice From Colitis and Colitis-Associated Cancer

    NARCIS (Netherlands)

    Li, Haiying; Chan, Lillienne; Bartuzi, Paulina; Melton, Shelby D.; Weber, Axel; Ben-Shlomo, Shani; Varol, Chen; Raetz, Megan; Mao, Xicheng; Starokadomskyy, Petro; van Sommeren, Suzanne; Mokadem, Mohamad; Schneider, Heike; Weisberg, Reid; Westra, Harm-Jan; Esko, Tonu; Metspalu, Andres; Magadi Gopalaiah, Vinod Kumar; Faubion, William A.; Yarovinsky, Felix; Hofker, Marten; Wijmenga, Cisca; Kracht, Michael; Franke, Lude; Aguirre, Vincent; Weersma, Rinse K.; Gluck, Nathan; van de Sluis, Bart; Burstein, Ezra

    BACKGROUND & AIMS: Activation of the transcription factor nuclear factor-kappa B (NF-kappa B) has been associated with the development of inflammatory bowel disease (IBD). Copper metabolism MURR1 domain containing 1 (COMMD1), a regulator of various transport pathways, has been shown to limit

  12. COPPER AND COPPER-CONTAINING PESTICIDES: METABOLISM, TOXICITY AND OXIDATIVE STRESS

    Directory of Open Access Journals (Sweden)

    Viktor Husak

    2015-05-01

    Full Text Available The purpose of this paper is to provide a brief review of the current knowledge regarding metabolism and toxicity of copper and copper-based pesticides in living organisms. Copper is an essential trace element in all living organisms (bacteria, fungi, plants, and animals, because it participates in different metabolic processes and maintain functions of organisms. The transport and metabolism of copper in living organisms is currently the subject of many studies. Copper is absorbed, transported, distributed, stored, and excreted in the body via the complex of homeostatic processes, which provide organisms with a needed constant level of this micronutrient and avoid excessive amounts. Many aspects of copper homeostasis were studied at the molecular level. Copper based-pesticides, in particularly fungicides, bacteriocides and herbicides, are widely used in agricultural practice throughout the world. Copper is an integral part of antioxidant enzymes, particularly copper-zinc superoxide dismutase (Cu,Zn-SOD, and plays prominent roles in iron homeostasis. On the other hand, excess of copper in organism has deleterious effect, because it stimulates free radical production in the cell, induces lipid peroxidation, and disturbs the total antioxidant capacity of the body. The mechanisms of copper toxicity are discussed in this review also.

  13. Increased copper toxicity in Saccharomyces cerevisiae lacking VPS35, a component of the retromer and monogenic Parkinson disease gene in humans.

    Science.gov (United States)

    Sowada, Nadine; Stiller, Barbara; Kubisch, Christian

    2016-08-05

    The Saccharomyces cerevisiae gene VPS35 encodes a component of the retromer complex which is involved in vesicle transport from endosomes to the trans-Golgi network. Yeast and human VPS35 orthologs are highly conserved and mutations in human VPS35 cause an autosomal dominant form of late-onset Parkinson disease (PD). We now show that deletion of VPS35 in yeast (vps35Δ) leads to a dose-dependent growth defect towards copper. This increased sensitivity could be rescued by transformation with yeast wild-type VPS35 but not by the expression of a construct harboring the yeast equivalent (i.e. D686N) of the most commonly identified VPS35-associated PD mutation, p.D620N. In addition, we show that expression of one copy of α-synuclein, which is known to directly interact with copper, leads to a pronounced aggravation of copper toxicity in vps35Δ cells, thereby linking the regulation of copper homeostasis by Vps35p in yeast to one of the key molecules in PD pathophysiology. Copyright © 2016 Elsevier Inc. All rights reserved.

  14. Multicistronic lentiviral vectors containing the FMDV 2A cleavage factor demonstrate robust expression of encoded genes at limiting MOI

    Directory of Open Access Journals (Sweden)

    Margison Geoffrey P

    2006-03-01

    Full Text Available Abstract Background A number of gene therapy applications would benefit from vectors capable of expressing multiple genes. In this study we explored the feasibility and efficiency of expressing two or three transgenes in HIV-1 based lentiviral vector. Bicistronic and tricistronic self-inactivating lentiviral vectors were constructed employing the internal ribosomal entry site (IRES sequence of encephalomyocarditis virus (EMCV and/or foot-and-mouth disease virus (FMDV cleavage factor 2A. We employed enhanced green fluorescent protein (eGFP, O6-methylguanine-DNA-methyltransferase (MGMT, and homeobox transcription factor HOXB4 as model genes and their expression was detected by appropriate methods including fluorescence microscopy, flow cytometry, immunocytochemistry, biochemical assay, and western blotting. Results All the multigene vectors produced high titer virus and were able to simultaneously express two or three transgenes in transduced cells. However, the level of expression of individual transgenes varied depending on: the transgene itself; its position within the construct; the total number of transgenes expressed; the strategy used for multigene expression and the average copy number of pro-viral insertions. Notably, at limiting MOI, the expression of eGFP in a bicistronic vector based on 2A was ~4 times greater than that of an IRES based vector. Conclusion The small and efficient 2A sequence can be used alone or in combination with an IRES for the construction of multicistronic lentiviral vectors which can express encoded transgenes at functionally relevant levels in cells containing an average of one pro-viral insert.

  15. Modeling the effects of evolving redox conditions on the corrosion of copper containers

    International Nuclear Information System (INIS)

    Kng, F.; LeNeveu, D.M.; Jobe, D.J.

    1994-01-01

    The corrosive environment around the containers in a Canadian nuclear fuel waste disposal vault will change over time from open-quotes warm and oxidizingclose quotes to open-quotes cool and anoxic.close quotes As the conditions change, so too will the corrosion behaviour of the containers. For copper containers, uniform corrosion and, possibly, pitting will occur during the initial aggressive phase, to be replaced by slow uniform corrosion during the long-term anoxic period. The corrosion behaviour of copper has been studied over a range of conditions representing all phases in the evolution of the vault environment. The results of these studies are summarized and used to illustrate how a model can be developed to predict the corrosion behaviour and container lifetimes over long periods of time. Lifetimes in excess of 10 6 a are predicted for 25-mm-thick copper containers under Canadian disposal conditions

  16. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  17. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  18. Feasibility assessment of copper-base waste package container materials in a tuff repository

    International Nuclear Information System (INIS)

    Acton, C.F.; McCright, R.D.

    1986-01-01

    This report discussed progress made during the second year of a two-year study on the feasibility of using copper or a copper-base alloy as a container material for a waste package in a potential repository in tuff rock at the Yucca Mountain site in Nevada. Corrosion testing in potentially corrosive irradiated environments received emphasis during the feasibility study. Results of experiments to evaluate the effect of a radiation field on the uniform corrosion rate of the copper-base materials in repository-relevant aqueous environments are given as well as results of an electrochemical study of the copper-base materials in normal and concentrated J-13 water. Results of tests on the irradiation of J-13 water and on the subsequent formation of hydrogen peroxide are given. A theoretical study was initiated to predict the long-term corrosion behavior of copper in the repository. Tests were conducted to determine whether copper would adversely affect release rates of radionuclides to the environment because of degradation of the Zircaloy cladding. A manufacturing survey to determine the feasibility of producing copper containers utilizing existing equipment and processes was completed. The cost and availability of copper was also evaluated and predicted to the year 2000. Results of this feasibility assessment are summarized

  19. Copper Resistance of the Emerging Pathogen Acinetobacter baumannii

    Science.gov (United States)

    Williams, Caitlin L.; Neu, Heather M.; Gilbreath, Jeremy J.; Michel, Sarah L. J.; Zurawski, Daniel V.

    2016-01-01

    , and treatment options are incredibly limited. Copper is an essential nutrient but becomes toxic at high concentrations. The inherent antimicrobial properties of copper give it potential for use in novel therapeutics against drug-resistant pathogens. We show that A. baumannii clinical isolates are sensitive to copper in vitro, both in liquid and on solid metal surfaces. Since bacterial resistance to copper is mediated though mechanisms of efflux and detoxification, we identified genes encoding putative copper-related proteins in A. baumannii and showed that expression of some of these genes is regulated by the copper concentration. We propose that the antimicrobial effects of copper may be beneficial in the development of future therapeutics that target multidrug-resistant bacteria. PMID:27520808

  20. Copper Resistance of the Emerging Pathogen Acinetobacter baumannii.

    Science.gov (United States)

    Williams, Caitlin L; Neu, Heather M; Gilbreath, Jeremy J; Michel, Sarah L J; Zurawski, Daniel V; Merrell, D Scott

    2016-10-15

    are incredibly limited. Copper is an essential nutrient but becomes toxic at high concentrations. The inherent antimicrobial properties of copper give it potential for use in novel therapeutics against drug-resistant pathogens. We show that A. baumannii clinical isolates are sensitive to copper in vitro, both in liquid and on solid metal surfaces. Since bacterial resistance to copper is mediated though mechanisms of efflux and detoxification, we identified genes encoding putative copper-related proteins in A. baumannii and showed that expression of some of these genes is regulated by the copper concentration. We propose that the antimicrobial effects of copper may be beneficial in the development of future therapeutics that target multidrug-resistant bacteria. Copyright © 2016, American Society for Microbiology. All Rights Reserved.

  1. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  2. Copper bioavailability from breakfasts containing tea : influence of the addition of milk

    NARCIS (Netherlands)

    Vaquero, M.P.; Veldhuizen, M.; Dokkum, W. van; Hamer, C.J.A. van den; Schaafsma, G.

    1994-01-01

    The influence of drinking tea on copper bioavailability is unclear, particularly when tea is consumed with food. A breakfast meal containing white bread, margarine, strawberry jam, cheese and tea, with or without milk, was digested in; vitro and the dialysis of copper investigated. Reference

  3. Wilson’s Disease: An Inherited, Silent, Copper Intoxication Disease

    Directory of Open Access Journals (Sweden)

    Uta Merle

    2016-07-01

    Full Text Available Wilson’s disease is a rare, autosomal recessive, genetic, copper overload disease, which evokes multiple motor or neuropsychiatric symptoms and liver disease. It is the consequence of a variety of different mutations affecting the ATP7B gene. This gene encodes for a class IB, P-type, copper-transporting ATPase, which is located in the trans-Golgi network of the liver and brain, and mediates the excretion of excess copper into the bile. When functionally inactive, the excess copper is deposited in the liver, brain, and other tissues. Free copper induces oxidative stress, lipid peroxidation, and lowers the apoptotic threshold of the cell. The symptoms in affected persons can vary widely and usually appear between the ages of 6 years and 20 years, but there are also cases in which the disease manifests in advanced age. In this review, we discuss the considerations in diagnosis, clinical management, and treatment of Wilson’s disease. In addition, we highlight experimental efforts that address the pathogenesis of Wilson’s disease in ATP7B deficient mice, novel analytical techniques that will improve the diagnosis at an early stage of disease onset, and treatment results with copper-chelating agents.

  4. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  5. Neural effects in copper defiient Menkes disease: ATP7A-a distinctive marker

    Directory of Open Access Journals (Sweden)

    S K Kanthlal

    2016-08-01

    Full Text Available Menkes disease, also termed as “Menkes’s syndrome”, is a disastrous infantile neurodegenerative disorder originated by diverse mutations in cupric cation-transport gene called ATP7A. This gene encodes a protein termed as copper transporting P-type ATPase, essential for copper ion transport from intestine to the other parts of our body along with other transporters like copper transporter receptor 1 and divalent metal transporter 1. The copper transportation is vital in the neuronal development and synthesis of various enzymes. It is found to be an appreciated trace element for normal biological functioning but toxic in excess. It is essential for the metallation of cuproenzymes which is responsible for the biosynthesis of neurotransmitters and other vital physiological mechanisms. Copper is also actively involved in the transmission pathway of N-methyl-D-aspartate receptors and its subsequent molecular changes in neural cells. The expression of ATP7A gene in regions of brain depicts the importance of copper in neural development and stabilization. Studies revealed that the mutation of ATP7A gene leads the pathophysiology of various neurodegenerative disorders. This review focused on the normal physiological function of the gene with respect to their harmful outcome of the mutated gene and its associated deficiency which detriments the neural mechanism in Menkes patients.

  6. X-ray absorption spectroscopic studies on novel microporous copper containing catalytic systems

    International Nuclear Information System (INIS)

    Bhargava, Suresh K.; Akolekar, Deepak B.; Foran, Garry

    2006-01-01

    Novel copper metal modified microporous aluminosilicate and aluminophosphate catalysts with the high phase purity were synthesized and characterized. CuK-edge XAS measurements were carried out over a series of copper containing SAPO-34 and ZSM-5 catalysts. EXAFS technique was used to obtain specific climacteric information related to the copper atomic distances, coordination and near neighbour environments. EXAFS studies indicated the presence of different of Cu species on ZSM-5/SAPO34 catalysts

  7. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  8. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  9. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  10. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  11. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  12. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers : a new canine model for copper-metabolism disorders

    NARCIS (Netherlands)

    Fieten, Hille; Gill, Yadvinder; Martin, Alan J.; Concilli, Mafalda; Dirksen, Karen; van Steenbeek, Frank G.; Spee, Bart; van den Ingh, Ted S. G. A. M.; Martens, Ellen C. C. P.; Festa, Paola; Chesi, Giancarlo; Sluis, van de Bart; Houwen, Roderick H. J. H.; Watson, Adrian L.; Aulchenko, Yurii S.; Hodgkinson, Victoria L.; Zhu, Sha; Petris, Michael J.; Polishchuk, Roman S.; Leegwater, Peter A. J.; Rothuizen, Jan

    2016-01-01

    The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to

  13. The Menkes and Wilson disease genes counteract in copper toxicosis in Labrador retrievers: a new canine model for copper-metabolism disorders

    NARCIS (Netherlands)

    Fieten, Hille; Gill, Yadvinder; Martin, Alan J.; Concilli, Mafalda; Dirksen, Karen; van Steenbeek, Frank G.; Spee, Bart; van den Ingh, Ted S. G. A. M.; Martens, Ellen C. C. P.; Festa, Paola; Chesi, Giancarlo; van de Sluis, Bart; Houwen, Roderick H. J. H.; Watson, Adrian L.; Aulchenko, Yurii S.; Hodgkinson, Victoria L.; Zhu, Sha; Petris, Michael J.; Polishchuk, Roman S.; Leegwater, Peter A. J.; Rothuizen, Jan

    2016-01-01

    The deleterious effects of a disrupted copper metabolism are illustrated by hereditary diseases caused by mutations in the genes coding for the copper transporters ATP7A and ATP7B. Menkes disease, involving ATP7A, is a fatal neurodegenerative disorder of copper deficiency. Mutations in ATP7B lead to

  14. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  15. The ArcD1 and ArcD2 arginine/ornithine exchangers encoded in the arginine deiminase (ADI) pathway gene cluster of Lactococcus lactis

    NARCIS (Netherlands)

    Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S

    2015-01-01

    The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of

  16. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  17. Copper and ectopic expression of the Arabidopsis transport protein COPT1 alter iron homeostasis in rice (Oryza sativa L.).

    Science.gov (United States)

    Andrés-Bordería, Amparo; Andrés, Fernando; Garcia-Molina, Antoni; Perea-García, Ana; Domingo, Concha; Puig, Sergi; Peñarrubia, Lola

    2017-09-01

    Copper deficiency and excess differentially affect iron homeostasis in rice and overexpression of the Arabidopsis high-affinity copper transporter COPT1 slightly increases endogenous iron concentration in rice grains. Higher plants have developed sophisticated mechanisms to efficiently acquire and use micronutrients such as copper and iron. However, the molecular mechanisms underlying the interaction between both metals remain poorly understood. In the present work, we study the effects produced on iron homeostasis by a wide range of copper concentrations in the growth media and by altered copper transport in Oryza sativa plants. Gene expression profiles in rice seedlings grown under copper excess show an altered expression of genes involved in iron homeostasis compared to standard control conditions. Thus, ferritin OsFER2 and ferredoxin OsFd1 mRNAs are down-regulated whereas the transcriptional iron regulator OsIRO2 and the nicotianamine synthase OsNAS2 mRNAs rise under copper excess. As expected, the expression of OsCOPT1, which encodes a high-affinity copper transport protein, as well as other copper-deficiency markers are down-regulated by copper. Furthermore, we show that Arabidopsis COPT1 overexpression (C1 OE ) in rice causes root shortening in high copper conditions and under iron deficiency. C1 OE rice plants modify the expression of the putative iron-sensing factors OsHRZ1 and OsHRZ2 and enhance the expression of OsIRO2 under copper excess, which suggests a role of copper transport in iron signaling. Importantly, the C1 OE rice plants grown on soil contain higher endogenous iron concentration than wild-type plants in both brown and white grains. Collectively, these results highlight the effects of rice copper status on iron homeostasis, which should be considered to obtain crops with optimized nutrient concentrations in edible parts.

  18. Combined two-stage xanthate processes for the treatment of copper-containing wastewater

    Energy Technology Data Exchange (ETDEWEB)

    Chang, Y.K. [Department of Safety Health and Environmental Engineering, Central Taiwan University of Sciences and Technology, Taichung (Taiwan); Leu, M.H. [Department of Environmental Engineering, Kun Shan University of Technology, Yung-Kang City (Taiwan); Chang, J.E.; Lin, T.F.; Chen, T.C. [Department of Environmental Engineering, National Cheng Kung University, Tainan City (Taiwan); Chiang, L.C.; Shih, P.H. [Department of Environmental Engineering and Science, Fooyin University, Kaohsiung County (Taiwan)

    2007-02-15

    Heavy metal removal is mainly conducted by adjusting the wastewater pH to form metal hydroxide precipitates. However, in recent years, the xanthate process with a high metal removal efficiency, attracted attention due to its use of sorption/desorption of heavy metals from aqueous solutions. In this study, two kinds of agricultural xanthates, insoluble peanut-shell xanthate (IPX) and insoluble starch xanthate (ISX), were used as sorbents to treat the copper-containing wastewater (Cu concentration from 50 to 1,000 mg/L). The experimental results showed that the maximum Cu removal efficiency by IPX was 93.5 % in the case of high Cu concentrations, whereby 81.1 % of copper could rapidly be removed within one minute. Moreover, copper-containing wastewater could also be treated by ISX over a wide range (50 to 1,000 mg/L) to a level that meets the Taiwan EPA's effluent regulations (3 mg/L) within 20 minutes. Whereas IPX had a maximum binding capacity for copper of 185 mg/g IPX, the capacity for ISX was 120 mg/g ISX. IPX is cheaper than ISX, and has the benefits of a rapid reaction and a high copper binding capacity, however, it exhibits a lower copper removal efficiency. A sequential IPX and ISX treatment (i.e., two-stage xanthate processes) could therefore be an excellent alternative. The results obtained using the two-stage xanthate process revealed an effective copper treatment. The effluent (C{sub e}) was below 0.6 mg/L, compared to the influent (C{sub 0}) of 1,001 mg/L at pH = 4 and a dilution rate of 0.6 h{sup -1}. Furthermore, the Cu-ISX complex formed could meet the Taiwan TCLP regulations, and be classified as non-hazardous waste. The xanthatilization of agricultural wastes offers a comprehensive strategy for solving both agricultural waste disposal and metal-containing wastewater treatment problems. (Abstract Copyright [2007], Wiley Periodicals, Inc.)

  19. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  20. Facial Skin Lifting and Brightening Following Sleep on Copper Oxide Containing Pillowcases

    Directory of Open Access Journals (Sweden)

    Gadi Borkow

    2016-07-01

    Full Text Available Copper plays a key role in many of the physiological processes that occur in the skin. Previously it was found that sleeping on pillowcases impregnated with microscopic copper oxide particles results in reduction of wrinkles and fine lines. In the current study, it was examined if sleeping on copper oxide impregnated pillowcases results also in skin lifting and skin brightness. A four week, double blind, randomized study was performed, during which 45 women, aged 37–54, slept on copper oxide containing pillowcases (test group, n = 23 or on control pillowcases without copper oxide (control group, n = 22. Facial and eye skin surface was measured using an F-ray 3D measurement system and surface analysis was conducted using Image-pro® plus. Skin brightness was measured using a tristimulus colorimeter. Sleeping on the test pillowcases resulted in statistically significant skin lifting on the cheek area (p = 0.039 and eye area (p = 0.001 after four weeks of use as compared to baseline. The mean skin brightness in those sleeping on the test pillowcases increased after two (p = 0.024 and four weeks (p = 0.008. No statistically significant changes occurred during the study in the study participants using the control pillowcases. Statistically significant differences between both groups were recorded at two and four weeks for skin brightness and skin lifting, respectively. In conclusion, sleeping on copper oxide containing pillowcases results in facial skin lifting and brightness of the skin.

  1. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  2. Effects of container cavity size and copper coating on field performance of container-grown longleaf pine seedlings

    Science.gov (United States)

    Shi-Jean Susana Sung; James D. Haywood; Mary A. Sword-Sayer; Kristina F. Connor; D. Andrew Scott

    2010-01-01

    Longleaf pine (Pinus palustris Mill.) seedlings were grown for 27 weeks in 3 container cavity sizes [small (S), medium (M), and large (L)], and half the containers were coated with copper (Cu). In November 2004, we planted 144 seedlings from each of 6 container treatments in each of 4 replications in central LA. All plots were burned in February 2006...

  3. Copper radical oxidases and related extracellular oxidoreductases of wood-decay Agaricomycetes

    Science.gov (United States)

    Phil Kersten; Dan Cullen

    2014-01-01

    Extracellular peroxide generation, a key component of oxidative lignocellulose degradation, has been attributed to various enzymes including the copper radical oxidases. Encoded by a family of structurally related sequences, the genes are widely distributed among wood decay fungi including three recently completed polypore genomes. In all cases, core catalytic residues...

  4. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  5. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  6. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  7. Copper Root Pruning and Container Cavity Size Influence Longleaf Pine Growth through Five Growing Seasons

    Science.gov (United States)

    James D. Haywood; Shi-Jean Susana Sung; Mary Anne Sword Sayer

    2012-01-01

    However, type and size of container can influence field performance. In this study, longleaf pine seedlings were grown in Beaver Plastics Styroblocks either without a copper treatment (Superblock) or with a copper oxychloride coating (Copperblock) and with three sizes of cavities that were 60, 108, and 164 ml. Seedlings from the six container types (two types of...

  8. A horizontally gene transferred copper resistance locus confers hyper‐resistance to antibacterial copper toxicity and enables survival of community acquired methicillin resistant Staphylococcus aureus USA300 in macrophages

    Science.gov (United States)

    Purves, Joanne; Thomas, Jamie; Riboldi, Gustavo P.; Zapotoczna, Marta; Tarrant, Emma; Andrew, Peter W.; Londoño, Alejandra; Planet, Paul J.; Geoghegan, Joan A.; Waldron, Kevin J.

    2018-01-01

    Summary Excess copper is highly toxic and forms part of the host innate immune system's antibacterial arsenal, accumulating at sites of infection and acting within macrophages to kill engulfed pathogens. We show for the first time that a novel, horizontally gene transferred copper resistance locus (copXL), uniquely associated with the SCCmec elements of the highly virulent, epidemic, community acquired methicillin resistant Staphylococcus aureus (CA‐MRSA) USA300, confers copper hyper‐resistance. These genes are additional to existing core genome copper resistance mechanisms, and are not found in typical S. aureus lineages, but are increasingly identified in emerging pathogenic isolates. Our data show that CopX, a putative P1B‐3‐ATPase efflux transporter, and CopL, a novel lipoprotein, confer copper hyper‐resistance compared to typical S. aureus strains. The copXL genes form an operon that is tightly repressed in low copper environments by the copper regulator CsoR. Significantly, CopX and CopL are important for S. aureus USA300 intracellular survival within macrophages. Therefore, the emergence of new S. aureus clones with the copXL locus has significant implications for public health because these genes confer increased resistance to antibacterial copper toxicity, enhancing bacterial fitness by altering S. aureus interaction with innate immunity. PMID:29521441

  9. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  10. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  11. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  12. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  13. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  14. A random-sequential mechanism for nitrite binding and active site reduction in copper-containing nitrite reductase

    NARCIS (Netherlands)

    Wijma, HJ; Jeuken, LJC; Verbeet, MP; Armstrong, FA; Canters, GW

    2006-01-01

    The homotrimeric copper-containing nitrite reductase ( NiR) contains one type-1 and one type-2 copper center per monomer. Electrons enter through the type-1 site and are shuttled to the type-2 site where nitrite is reduced to nitric oxide. To investigate the catalytic mechanism of NiR the effects of

  15. Characterization of a Highly Thermostable and Organic Solvent-Tolerant Copper-Containing Polyphenol Oxidase with Dye-Decolorizing Ability from Kurthia huakuii LAM0618T.

    Directory of Open Access Journals (Sweden)

    Xiang Guo

    Full Text Available Laccases are green biocatalysts that possess attractive advantages for the treatment of resistant environmental pollutants and dye effluents. A putative laccase-like gene, laclK, encoding a protein of 29.3 kDa and belonging to the Cu-oxidase_4 superfamily, was cloned and overexpressed in Escherichia coli. The purified recombinant protein LaclK (LaclK was able to oxidize typical laccase substrates such as 2,6-dimethoxyphenol and l-dopamine. The characteristic adsorption maximums of typical laccases at 330 nm and 610 nm were not detected for LaclK. Cu2+ was essential for substrate oxidation, but the ratio of copper atoms/molecule of LaclK was determined to only be 1:1. Notably, the optimal temperature of LaclK was 85°C with 2,6-dimethoxyphenol as substrates, and the half-life approximately 3 days at 80°C. Furthermore, 10% (v/v organic solvents (methanol, ethanol, isopropyl alcohol, butyl alcohol, Triton x-100 or dimethyl sulfoxide could promote enzymatic activity. LaclK exhibited wide-spectrum decolorization ability towards triphenylmethane dyes, azo dyes and aromatic dyes, decolorizing 92% and 94% of Victoria Blue B (25 μM and Ethyl Violet (25 μM, respectively, at a concentration of 60 U/L after 1 h of incubation at 60°C. Overall, we characterized a novel thermostable and organic solvent-tolerant copper-containing polyphenol oxidase possessing dye-decolorizing ability. These unusual properties make LaclK an alternative for industrial applications, particularly processes that require high-temperature conditions.

  16. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  17. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  18. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  19. The short mRNA isoform of the immunoglobulin superfamily, member 1 gene encodes an intracellular glycoprotein.

    Directory of Open Access Journals (Sweden)

    Ying Wang

    Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.

  20. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  1. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  2. Effect of Sulfide Concentration on Copper Corrosion in Anoxic Chloride-Containing Solutions

    Science.gov (United States)

    Kong, Decheng; Dong, Chaofang; Xu, Aoni; Man, Cheng; He, Chang; Li, Xiaogang

    2017-04-01

    The structure and property of passive film on copper are strongly dependent on the sulfide concentration; based on this, a series of electrochemical methods were applied to investigate the effect of sulfide concentration on copper corrosion in anaerobic chloride-containing solutions. The cyclic voltammetry and x-ray photoelectron spectroscopy analysis demonstrated that the corrosion products formed on copper in anaerobic sulfide solutions comprise Cu2S and CuS. And the corrosion resistance of copper decreased with increasing sulfide concentration and faster sulfide addition, owing to the various structures of the passive films observed by the atomic force microscope and scanning electron microscope. A p-type semiconductor character was obtained under all experimental conditions, and the defect concentration, which had a magnitude of 1022-1023 cm-3, increased with increasing sulfide concentration, resulting in a higher rate of both film growth and dissolution.

  3. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  4. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  5. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  6. Diffusion of 64Cu in copper-containing chalcogenide glasses

    International Nuclear Information System (INIS)

    Vlasov, Yu.G.; Bychkov, E.A.; Bolotov, A.M.; Tsegel'nik, V.S.; Gavrilov, Yu.A.

    1996-01-01

    Diffusion experiments with 64 Cu radioactive tracer for a number of copper-containing chalcogenide glasses CuI-As 2 Se 3 , Cu-SbI 3 -As 2 Se 3 , CuI-PbI 2 -As 2 Se 3 , CuI-PbI 2 -SbI 3 -As 2 Se 3 and Cu 2 Se-As 2 Se 3 are carried out for the first time. The results of diffusion and electrodiffusion measurements are in correspondence with information on electroconductivity and diffusion in a limited space (cage diffusion) from the Moessbauer spectroscopy on 124 I. It is shown for the first time that the Cheivin factor index for copper-conducting glasses in by 2-3 times higher as compared to silver-conducting glasses with approximate diffusion coefficients indices. 27 refs., 3 figs., 1 tab

  7. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  8. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  9. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  10. Prevalence of quinolone resistance genes, copper resistance genes, and the bacterial communities in a soil-ryegrass system co-polluted with copper and ciprofloxacin.

    Science.gov (United States)

    Tuo, Xiaxia; Gu, Jie; Wang, Xiaojuan; Sun, YiXin; Duan, Manli; Sun, Wei; Yin, Yanan; Guo, Aiyun; Zhang, Li

    2018-04-01

    The presence of high concentrations of residual antibiotics and antibiotic resistance genes (ARGs) in soil may pose potential health and environmental risks. This study investigated the prevalence of plasmid-mediated quinolone resistance (PMQR) genes, copper resistance genes (CRGs), and the bacterial communities in a soil-ryegrass pot system co-polluted with copper and ciprofloxacin (CIP; 0, 20, or 80 mg kg -1 dry soil). Compared with the samples on day 0, the total relative abundances of the PMQR genes and mobile genetic elements (MGEs) were reduced significantly by 80-89% in the ryegrass and soil by the cutting stage (after 75 days). The abundances of PMQR genes and MGEs were reduced by 63-81% in soil treated with 20 mg kg -1 CIP compared with the other treatments, but the abundances of CRGs increased by 18-42%. The presence of 80 mg kg -1 CIP affected the microbial community structure in the soil by increasing the abundances of Acidobacteria and Thaumarchaeota, but decreasing those of Firmicutes. Redundancy analysis indicated that the pH and microbial composition were the main factors that affected the variations in PMQR genes, MGEs, and CRGs, where they could explain 42.2% and 33.3% of the variation, respectively. Furthermore, intI2 may play an important role in the transfer of ARGs. We found that 80 mg kg -1 CIP could increase the abundances of ARGs and CRGs in a soil-ryegrass pot system. Copyright © 2018 Elsevier Ltd. All rights reserved.

  11. Adaptation to copper stress influences biofilm formation in Alteromonas macleodii.

    Science.gov (United States)

    Cusick, Kathleen D; Dale, Jason R; Fitzgerald, Lisa A; Little, Brenda J; Biffinger, Justin C

    2017-07-01

    An Alteromonas macleodii strain was isolated from copper-containing coupons incubated in surface seawater (Key West, FL, USA). In addition to the original isolate, a copper-adapted mutant was created and maintained with 0.78 mM Cu 2+ . Biofilm formation was compared between the two strains under copper-amended and low-nutrient conditions. Biofilm formation was significantly increased in the original isolate under copper amendment, while biofilm formation was significantly higher in the mutant under low-nutrient conditions. Biofilm expression profiles of diguanylate cyclase (DGC) genes, as well as genes involved in secretion, differed between the strains. Comparative genomic analysis demonstrated that both strains possessed a large number of gene attachment harboring cyclic di-GMP synthesis and/or degradation domains. One of the DGC genes, induced at very high levels in the mutant, possessed a degradation domain in the original isolate that was lacking in the mutant. The genetic and transcriptional mechanisms contributing to biofilm formation are discussed.

  12. Systemic serum amyloid A as a biomarker for exposure to zinc and/or copper-containing metal fumes.

    Science.gov (United States)

    Baumann, R; Gube, M; Markert, A; Davatgarbenam, S; Kossack, V; Gerhards, B; Kraus, T; Brand, P

    2018-01-01

    Zinc- and copper-containing welding fumes increase systemic C-reactive protein (CRP). The aim of this study was to investigate the performance of the biomarkers serum amyloid A (SAA) and soluble vascular cell adhesion molecule-1 (VCAM-1) in this regard. Fifteen male subjects were exposed under controlled conditions to welding fumes containing either zinc, or copper, or copper and zinc for 6 h. Plasma samples were collected before, 6 and 24 h after start of exposure and biomarkers therein were measured by electrochemiluminescent assay. For each exposure, systemic concentrations of systemic SAA, but not VCAM-1, increased significantly at 24 h after exposure start compared with baseline ("copper only": P=0.0005, "zinc only": P=0.027, "copper and zinc": P=0.001). SAA showed a wider range of concentrations than did CRP and its levels increased up to 19-fold after welding fume exposure. The recognition of copper as a potential harmful component in welding fumes, also independent from zinc, deserves further consideration. SAA might represent a new sensitive biomarker for potential subclinical sterile inflammation after inhalation of copper- and/or zinc-containing welding fumes. As elevations of CRP and SAA protein have both been linked to a higher risk for cardiovascular disease, these findings might particularly be important for long-term welders.

  13. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  14. Molecular cloning and characterization of two novel genes from hexaploid wheat that encode double PR-1 domains coupled with a receptor-like protein kinase

    Science.gov (United States)

    Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...

  15. Molecular Cloning and Nucleotide Sequence of the Gene Encoding the Major Peptidoglycan Hydrolase of Lactococcus lactis, a Muramidase Needed for Cell Separation

    NARCIS (Netherlands)

    Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.

    A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,

  16. Mechanistic modelling of the corrosion behaviour of copper nuclear fuel waste containers

    Energy Technology Data Exchange (ETDEWEB)

    King, F; Kolar, M

    1996-10-01

    A mechanistic model has been developed to predict the long-term corrosion behaviour of copper nuclear fuel waste containers in a Canadian disposal vault. The model is based on a detailed description of the electrochemical, chemical, adsorption and mass-transport processes involved in the uniform corrosion of copper, developed from the results of an extensive experimental program. Predictions from the model are compared with the results of some of these experiments and with observations from a bronze cannon submerged in seawater saturated clay sediments. Quantitative comparisons are made between the observed and predicted corrosion potential, corrosion rate and copper concentration profiles adjacent to the corroding surface, as a way of validating the long-term model predictions. (author). 12 refs., 5 figs.

  17. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  18. Composition and particle size of electrolytic copper powders prepared in water-containing dimethyl sulfoxide electrolytes

    Science.gov (United States)

    Mamyrbekova, Aigul'; Abzhalov, B. S.; Mamyrbekova, Aizhan

    2017-07-01

    The possibility of the electroprecipitation of copper powder via the cathodic reduction of an electrolyte solution containing copper(II) nitrate trihydrate and dimethyl sulfoxide (DMSO) is shown. The effect electrolysis conditions (current density, concentration and temperature of electrolyte) have on the dimensional characteristics of copper powder is studied. The size and shape of the particles of the powders were determined by means of electron microscopy; the qualitative composition of the powders, with X-ray diffraction.

  19. A copper-induced quinone degradation pathway provides protection against combined copper/quinone stress in Lactococcus lactis IL1403.

    Science.gov (United States)

    Mancini, Stefano; Abicht, Helge K; Gonskikh, Yulia; Solioz, Marc

    2015-02-01

    Quinones are ubiquitous in the environment. They occur naturally but are also in widespread use in human and industrial activities. Quinones alone are relatively benign to bacteria, but in combination with copper, they become toxic by a mechanism that leads to intracellular thiol depletion. Here, it was shown that the yahCD-yaiAB operon of Lactococcus lactis IL1403 provides resistance to combined copper/quinone stress. The operon is under the control of CopR, which also regulates expression of the copRZA copper resistance operon as well as other L. lactis genes. Expression of the yahCD-yaiAB operon is induced by copper but not by quinones. Two of the proteins encoded by the operon appear to play key roles in alleviating quinone/copper stress: YaiB is a flavoprotein that converts p-benzoquinones to less toxic hydroquinones, using reduced nicotinamide adenine dinucleotide phosphate (NADPH) as reductant; YaiA is a hydroquinone dioxygenase that converts hydroquinone putatively to 4-hydroxymuconic semialdehyde in an oxygen-consuming reaction. Hydroquinone and methylhydroquinone are both substrates of YaiA. Deletion of yaiB causes increased sensitivity of L. lactis to quinones and complete growth arrest under combined quinone and copper stress. Copper induction of the yahCD-yaiAB operon offers protection to copper/quinone toxicity and could provide a growth advantage to L. lactis in some environments. © 2014 John Wiley & Sons Ltd.

  20. Molecular Diagnostics of Copper-Transporting Protein Mutations Allows Early Onset Individual Therapy of Menkes Disease.

    Science.gov (United States)

    Králík, L; Flachsová, E; Hansíková, H; Saudek, V; Zeman, J; Martásek, P

    2017-01-01

    Menkes disease is a severe X-linked recessive disorder caused by a defect in the ATP7A gene, which encodes a membrane copper-transporting ATPase. Deficient activity of the ATP7A protein results in decreased intestinal absorption of copper, low copper level in serum and defective distribution of copper in tissues. The clinical symptoms are caused by decreased activities of copper-dependent enzymes and include neurodegeneration, connective tissue disorders, arterial changes and hair abnormalities. Without therapy, the disease is fatal in early infancy. Rapid diagnosis of Menkes disease and early start of copper therapy is critical for the effectiveness of treatment. We report a molecular biology-based strategy that allows early diagnosis of copper transport defects and implementation of individual therapies before the full development of pathological symptoms. Low serum copper and decreased activity of copperdependent mitochondrial cytochrome c oxidase in isolated platelets found in three patients indicated a possibility of functional defects in copper-transporting proteins, especially in the ATPA7 protein, a copper- transporting P-type ATPase. Rapid mutational screening of the ATP7A gene using high-resolution melting analysis of DNA indicated presence of mutations in the patients. Molecular investigation for mutations in the ATP7A gene revealed three nonsense mutations: c.2170C>T (p.Gln724Ter); c.3745G>T (p.Glu1249Ter); and c.3862C>T (p.Gln1288Ter). The mutation c.3745G>T (p.Glu1249Ter) has not been identified previously. Molecular analysis of the ATOX1 gene as a possible modulating factor of Menkes disease did not reveal presence of pathogenic mutations. Molecular diagnostics allowed early onset of individual therapies, adequate genetic counselling and prenatal diagnosis in the affected families.

  1. Isolation, sequencing and expression of RED, a novel human gene encoding an acidic-basic dipeptide repeat.

    Science.gov (United States)

    Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T

    1999-04-16

    A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.

  2. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  3. Copper accumulation by stickleback nests containing spiggin.

    Science.gov (United States)

    Pinho, G L L; Martins, C M G; Barber, I

    2016-07-01

    The three-spined stickleback is a ubiquitous fish of marine, brackish and freshwater ecosystems across the Northern hemisphere that presents intermediate sensitivity to copper. Male sticklebacks display a range of elaborate reproductive behaviours that include nest construction. To build the nests, each male binds nesting material together using an endogenous glycoprotein nesting glue, known as 'spiggin'. Spiggin is a cysteine-rich protein and, therefore, potentially binds heavy metals present in the environment. The aim of this study was to investigate the capacity of stickleback nests to accumulate copper from environmental sources. Newly built nests, constructed by male fish from polyester threads in laboratory aquaria, were immersed in copper solutions ranging in concentration from 21.1-626.6 μg Cu L(-1). Bundles of polyester threads from aquaria without male fish were also immersed in the same copper solutions. After immersion, nests presented higher amounts of copper than the thread bundles, indicating a higher capacity of nests to bind this metal. A significant, positive correlation between the concentration of copper in the exposure solution and in the exposed nests was identified, but there was no such relationship for thread bundles. Since both spiggin synthesis and male courtship behaviour are under the control of circulating androgens, we predicted that males with high courtship scores would produce and secrete high levels of the spiggin protein. In the present study, nests built by high courtship score males accumulated more copper than those built by low courtship score males. Considering the potential of spiggin to bind metals, the positive relationship between fish courtship and spiggin secretion seems to explain the higher amount of copper on the nests from the fish showing high behaviour scores. Further work is now needed to determine the consequences of the copper binding potential of spiggin in stickleback nests for the health and survival of

  4. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  5. Functional analysis of the Phycomyces carRA gene encoding the enzymes phytoene synthase and lycopene cyclase.

    Directory of Open Access Journals (Sweden)

    Catalina Sanz

    Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.

  6. A genomic island provides Acidithiobacillus ferrooxidans ATCC 53993 additional copper resistance: a possible competitive advantage.

    Science.gov (United States)

    Orellana, Luis H; Jerez, Carlos A

    2011-11-01

    There is great interest in understanding how extremophilic biomining bacteria adapt to exceptionally high copper concentrations in their environment. Acidithiobacillus ferrooxidans ATCC 53993 genome possesses the same copper resistance determinants as strain ATCC 23270. However, the former strain contains in its genome a 160-kb genomic island (GI), which is absent in ATCC 23270. This GI contains, amongst other genes, several genes coding for an additional putative copper ATPase and a Cus system. A. ferrooxidans ATCC 53993 showed a much higher resistance to CuSO(4) (>100 mM) than that of strain ATCC 23270 (<25 mM). When a similar number of bacteria from each strain were mixed and allowed to grow in the absence of copper, their respective final numbers remained approximately equal. However, in the presence of copper, there was a clear overgrowth of strain ATCC 53993 compared to ATCC 23270. This behavior is most likely explained by the presence of the additional copper-resistance genes in the GI of strain ATCC 53993. As determined by qRT-PCR, it was demonstrated that these genes are upregulated when A. ferrooxidans ATCC 53993 is grown in the presence of copper and were shown to be functional when expressed in copper-sensitive Escherichia coli mutants. Thus, the reason for resistance to copper of two strains of the same acidophilic microorganism could be determined by slight differences in their genomes, which may not only lead to changes in their capacities to adapt to their environment, but may also help to select the more fit microorganisms for industrial biomining operations. © Springer-Verlag 2011

  7. Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice

    Science.gov (United States)

    Ren, Juansheng; Gao, Fangyuan; Wu, Xianting; Lu, Xianjun; Zeng, Lihua; Lv, Jianqun; Su, Xiangwen; Luo, Hong; Ren, Guangjun

    2016-01-01

    An urgent need exists to identify more brown planthopper (Nilaparvata lugens Stål, BPH) resistance genes, which will allow the development of rice varieties with resistance to BPH to counteract the increased incidence of this pest species. Here, using bioinformatics and DNA sequencing approaches, we identified a novel BPH resistance gene, LOC_Os06g03240 (MSU LOCUS ID), from the rice variety Ptb33 in the interval between the markers RM19291 and RM8072 on the short arm of chromosome 6, where a gene for resistance to BPH was mapped by Jirapong Jairin et al. and renamed as “Bph32”. This gene encodes a unique short consensus repeat (SCR) domain protein. Sequence comparison revealed that the Bph32 gene shares 100% sequence identity with its allele in Oryza latifolia. The transgenic introgression of Bph32 into a susceptible rice variety significantly improved resistance to BPH. Expression analysis revealed that Bph32 was highly expressed in the leaf sheaths, where BPH primarily settles and feeds, at 2 and 24 h after BPH infestation, suggesting that Bph32 may inhibit feeding in BPH. Western blotting revealed the presence of Pph (Ptb33) and Tph (TN1) proteins using a Penta-His antibody, and both proteins were insoluble. This study provides information regarding a valuable gene for rice defence against insect pests. PMID:27876888

  8. Bph32, a novel gene encoding an unknown SCR domain-containing protein, confers resistance against the brown planthopper in rice.

    Science.gov (United States)

    Ren, Juansheng; Gao, Fangyuan; Wu, Xianting; Lu, Xianjun; Zeng, Lihua; Lv, Jianqun; Su, Xiangwen; Luo, Hong; Ren, Guangjun

    2016-11-23

    An urgent need exists to identify more brown planthopper (Nilaparvata lugens Stål, BPH) resistance genes, which will allow the development of rice varieties with resistance to BPH to counteract the increased incidence of this pest species. Here, using bioinformatics and DNA sequencing approaches, we identified a novel BPH resistance gene, LOC_Os06g03240 (MSU LOCUS ID), from the rice variety Ptb33 in the interval between the markers RM19291 and RM8072 on the short arm of chromosome 6, where a gene for resistance to BPH was mapped by Jirapong Jairin et al. and renamed as "Bph32". This gene encodes a unique short consensus repeat (SCR) domain protein. Sequence comparison revealed that the Bph32 gene shares 100% sequence identity with its allele in Oryza latifolia. The transgenic introgression of Bph32 into a susceptible rice variety significantly improved resistance to BPH. Expression analysis revealed that Bph32 was highly expressed in the leaf sheaths, where BPH primarily settles and feeds, at 2 and 24 h after BPH infestation, suggesting that Bph32 may inhibit feeding in BPH. Western blotting revealed the presence of Pph (Ptb33) and Tph (TN1) proteins using a Penta-His antibody, and both proteins were insoluble. This study provides information regarding a valuable gene for rice defence against insect pests.

  9. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  10. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  11. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  12. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  13. A member of a new plant gene family encoding a meprin and TRAF homology (MATH) domain-containing protein is involved in restriction of long distance movement of plant viruses

    Science.gov (United States)

    Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie

    2010-01-01

    Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558

  14. Molecular characterization of a phloem-specific gene encoding the filament protein, phloem protein 1 (PP1), from Cucurbita maxima.

    Science.gov (United States)

    Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A

    1997-07-01

    Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.

  15. Technical assistance to AECL: electron beam welding of thick-walled copper containers for nuclear fuel waste disposal

    International Nuclear Information System (INIS)

    Maak, P.Y.Y.

    1984-01-01

    This report describes the results of Phase Two of the copper electron beam welding project for the final closure of copper containers for nuclear fuel waste disposal. It has been demonstrated that single pass, electron beam square butt welds (depth of weld penetration > 25 mm) can be made without preheat in both electrolytic tough-pitch copper and oxygen-free copper plates. The present results show that oxygen-free copper exhibits better weldability than the electrolytic tough-pitch copper in terms of weld penetration and vulnerability to weld defects such as gas porosity, erratic metal overflow and blow holes. The results of ultrasonic inspection studies of the welds are also discussed

  16. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  17. Spectroscopy of Cu(II)-PcoC and the multicopper oxidase function of PcoA, two essential components of Escherichia coli pco copper resistance operon.

    Science.gov (United States)

    Huffman, David L; Huyett, Jennifer; Outten, F Wayne; Doan, Peter E; Finney, Lydia A; Hoffman, Brian M; O'Halloran, Thomas V

    2002-08-06

    The plasmid-encoded pco copper resistance operon in Escherichia coli consists of seven genes that are expressed from two pco promoters in response to elevated copper; however, little is known about how they mediate resistance to excess environmental copper. Two of the genes encode the soluble periplasmic proteins PcoA and PcoC. We show here that inactivation of PcoC, and PcoA to a lesser extent, causes cells to become more sensitive to copper than wild-type nonresistant strains, consistent with a tightly coupled detoxification pathway. Periplasmic extracts show copper-inducible oxidase activity, attributed to the multicopper oxidase function of PcoA. PcoC, a much smaller protein than PcoA, binds one Cu(II) and exhibits a weak electronic transition characteristic of a type II copper center. ENDOR and ESEEM spectroscopy of Cu(II)-PcoC and the (15)N- and Met-CD(3)-labeled samples are consistent with a tetragonal ligand environment of three nitrogens and one aqua ligand "in the plane". A weakly associated S-Met and aqua are likely axial ligands. At least one N is a histidine and is likely trans to the in-plane aqua ligand. The copper chemistry of PcoC and the oxidase function of PcoA are consistent with the emerging picture of the chromosomally encoded copper homeostasis apparatus in the E. coli cell envelope [Outten, F. W., Huffman, D. L., Hale, J. A., and O'Halloran, T. V. (2001) J. Biol. Chem. 276, 30670-30677]. We propose a model for the plasmid system in which Cu(I)-PcoC functions in this copper efflux pathway as a periplasmic copper binding protein that docks with the multiple repeats of Met-rich domains in PcoA to effect oxidation of Cu(I) to the less toxic Cu(II) form. The solvent accessibility of the Cu(II) in PcoC may allow for metal transfer to other plasmid and chromosomal factors and thus facilitate removal of Cu(II) from the cell envelope.

  18. Interferon-induced transcription of a gene encoding a 15-kDA protein depends on an upstream enhancer element

    International Nuclear Information System (INIS)

    Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.

    1987-01-01

    A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene

  19. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  20. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  1. Copper tolerance in Frankia sp. strain EuI1c involves surface binding and copper transport.

    Science.gov (United States)

    Rehan, Medhat; Furnholm, Teal; Finethy, Ryan H; Chu, Feixia; El-Fadly, Gomaah; Tisa, Louis S

    2014-09-01

    Several Frankia strains have been shown to be copper-tolerant. The mechanism of their copper tolerance was investigated for Frankia sp. strain EuI1c. Copper binding was shown by binding studies. Unusual globular structures were observed on the surface of the bacterium. These globular structures were composed of aggregates containing many relatively smaller "leaf-like" structures. Scanning electron microscopy with energy-dispersive X-ray (SEM-EDAX) analysis of these structures indicated elevated copper and phosphate levels compared to the control cells. Fourier transform infrared spectroscopy (FTIR) analysis indicated an increase in extracellular phosphate on the cell surface of copper-stressed cells. Bioinformatics' analysis of the Frankia sp. strain EuI1c genome revealed five potential cop genes: copA, copZ, copC, copCD, and copD. Experiments with Frankia sp. strain EuI1c using qRT-PCR indicated an increase in messenger RNA (mRNA) levels of the five cop genes upon Cu(2+) stress. After 5 days of Cu(2+) stress, the copA, copZ, copC, copCD, and copD mRNA levels increased 25-, 8-, 18-, 18-, and 25-fold, respectively. The protein profile of Cu(2+)-stressed Frankia sp. strain EuI1c cells revealed the upregulation of a 36.7 kDa protein that was identified as FraEuI1c_1092 (sulfate-binding periplasmic transport protein). Homologues of this gene were only present in the genomes of the Cu(2+)-resistant Frankia strains (EuI1c, DC12, and CN3). These data indicate that copper tolerance by Frankia sp. strain EuI1c involved the binding of copper to the cell surface and transport proteins.

  2. A novel gene encoding a TIG multiple domain protein is a positional candidate for autosomal recessive polycystic kidney disease.

    Science.gov (United States)

    Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing

    2002-07-01

    Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.

  3. Plasmid Complement of Lactococcus lactis NCDO712 Reveals a Novel Pilus Gene Cluster.

    Science.gov (United States)

    Tarazanova, Mariya; Beerthuyzen, Marke; Siezen, Roland; Fernandez-Gutierrez, Marcela M; de Jong, Anne; van der Meulen, Sjoerd; Kok, Jan; Bachmann, Herwig

    2016-01-01

    Lactococcus lactis MG1363 is an important gram-positive model organism. It is a plasmid-free and phage-cured derivative of strain NCDO712. Plasmid-cured strains facilitate studies on molecular biological aspects, but many properties which make L. lactis an important organism in the dairy industry are plasmid encoded. We sequenced the total DNA of strain NCDO712 and, contrary to earlier reports, revealed that the strain carries 6 rather than 5 plasmids. A new 50-kb plasmid, designated pNZ712, encodes functional nisin immunity (nisCIP) and copper resistance (lcoRSABC). The copper resistance could be used as a marker for the conjugation of pNZ712 to L. lactis MG1614. A genome comparison with the plasmid cured daughter strain MG1363 showed that the number of single nucleotide polymorphisms that accumulated in the laboratory since the strains diverted more than 30 years ago is limited to 11 of which only 5 lead to amino acid changes. The 16-kb plasmid pSH74 was found to contain a novel 8-kb pilus gene cluster spaCB-spaA-srtC1-srtC2, which is predicted to encode a pilin tip protein SpaC, a pilus basal subunit SpaB, and a pilus backbone protein SpaA. The sortases SrtC1/SrtC2 are most likely involved in pilus polymerization while the chromosomally encoded SrtA could act to anchor the pilus to peptidoglycan in the cell wall. Overexpression of the pilus gene cluster from a multi-copy plasmid in L. lactis MG1363 resulted in cell chaining, aggregation, rapid sedimentation and increased conjugation efficiency of the cells. Electron microscopy showed that the over-expression of the pilus gene cluster leads to appendices on the cell surfaces. A deletion of the gene encoding the putative basal protein spaB, by truncating spaCB, led to more pilus-like structures on the cell surface, but cell aggregation and cell chaining were no longer observed. This is consistent with the prediction that spaB is involved in the anchoring of the pili to the cell.

  4. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  5. In silico characterization and transcriptomic analysis of nif family genes from Anabaena sp. PCC7120.

    Science.gov (United States)

    Singh, Shilpi; Shrivastava, Alok Kumar

    2017-10-01

    In silico approaches in conjunction with morphology, nitrogenase activity, and qRT-PCR explore the impact of selected abiotic stressor such as arsenic, salt, cadmium, copper, and butachlor on nitrogen fixing (nif family) genes of diazotrophic cyanobacterium Anabaena sp. PCC7120. A total of 19 nif genes are present within the Anabaena genome that is involved in the process of nitrogen fixation. Docking studies revealed the interaction between these nif gene-encoded proteins and the selected abiotic stressors which were further validated through decreased heterocyst frequency, fragmentation of filaments, and downregulation of nitrogenase activity under these stresses indicating towards their toxic impact on nitrogen fixation potential of filamentous cyanobacterium Anabaena sp. PCC7120. Another appealing finding of this study is even though having similar binding energy and similar interacting residues between arsenic/salt and copper/cadmium to nif-encoded proteins, arsenic and cadmium are more toxic than salt and copper for nitrogenase activity of Anabaena which is crucial for growth and yield of rice paddy and soil reclamation.

  6. Ti plasmid-encoded genes responsible for catabolism of the crown gall opine mannopine by Agrobacterium tumefaciens are homologs of the T-region genes responsible for synthesis of this opine by the plant tumor.

    Science.gov (United States)

    Kim, K S; Farrand, S K

    1996-06-01

    Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.

  7. Identifying pathogenicity genes in the rubber tree anthracnose fungus Colletotrichum gloeosporioides through random insertional mutagenesis.

    Science.gov (United States)

    Cai, Zhiying; Li, Guohua; Lin, Chunhua; Shi, Tao; Zhai, Ligang; Chen, Yipeng; Huang, Guixiu

    2013-07-19

    To gain more insight into the molecular mechanisms of Colletotrichum gloeosporioides pathogenesis, Agrobacterium tumefaciens-mediated transformation (ATMT) was used to identify mutants of C. gloeosporioides impaired in pathogenicity. An ATMT library of 4128 C. gloeosporioides transformants was generated. Transformants were screened for defects in pathogenicity with a detached copper brown leaf assay. 32 mutants showing reproducible pathogenicity defects were obtained. Southern blot analysis showed 60.4% of the transformants had single-site T-DNA integrations. 16 Genomic sequences flanking T-DNA were recovered from mutants by thermal asymmetric interlaced PCR, and were used to isolate the tagged genes from the genome sequence of wild-type C. gloeosporioides by Basic Local Alignment Search Tool searches against the local genome database of the wild-type C. gloeosporioides. One potential pathogenicity genes encoded calcium-translocating P-type ATPase. Six potential pathogenicity genes had no known homologs in filamentous fungi and were likely to be novel fungal virulence factors. Two putative genes encoded Glycosyltransferase family 28 domain-containing protein and Mov34/MPN/PAD-1 family protein, respectively. Five potential pathogenicity genes had putative function matched with putative protein of other Colletotrichum species. Two known C. gloeosporioides pathogenicity genes were also identified, the encoding Glomerella cingulata hard-surface induced protein and C. gloeosporioides regulatory subunit of protein kinase A gene involved in cAMP-dependent PKA signal transduction pathway. Copyright © 2013 Elsevier GmbH. All rights reserved.

  8. Copper-containing plastocyanin used for electron transport by an oceanic diatom.

    Science.gov (United States)

    Peers, Graham; Price, Neil M

    2006-05-18

    The supply of some essential metals to pelagic ecosystems is less than the demand, so many phytoplankton have slow rates of photosynthetic production and restricted growth. The types and amounts of metals required by phytoplankton depends on their evolutionary history and on their adaptations to metal availability, which varies widely among ocean habitats. Diatoms, for example, need considerably less iron (Fe) to grow than chlorophyll-b-containing taxa, and the oceanic species demand roughly one-tenth the amount of coastal strains. Like Fe, copper (Cu) is scarce in the open sea, but notably higher concentrations of it are required for the growth of oceanic than of coastal isolates. Here we report that the greater Cu requirement in an oceanic diatom, Thalassiosira oceanica, is entirely due to a single Cu-containing protein, plastocyanin, which--until now--was only known to exist in organisms with chlorophyll b and cyanobacteria. Algae containing chlorophyll c, including the closely related coastal species T. weissflogii, are thought to lack plastocyanin and contain a functionally equivalent Fe-containing homologue, cytochrome c6 (ref. 9). Copper deficiency in T. oceanica inhibits electron transport regardless of Fe status, implying a constitutive role for plastocyanin in the light reactions of photosynthesis in this species. The results suggest that selection pressure imposed by Fe limitation has resulted in the use of a Cu protein for photosynthesis in an oceanic diatom. This biochemical switch reduces the need for Fe and increases the requirement for Cu, which is relatively more abundant in the open sea.

  9. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  10. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  11. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  12. Crystal structure and dimerization equilibria of PcoC, a methionine-rich copper resistance protein from Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Wernimont, A.K.; Huffman, D.L.; Finney, L.A.; Demeler, B.; O' Halloran, T.V.; Rosenzweig, A.C.

    2010-03-08

    PcoC is a soluble periplasmic protein encoded by the plasmid-born pco copper resistance operon of Escherichia coli. Like PcoA, a multicopper oxidase encoded in the same locus and its chromosomal homolog CueO, PcoC contains unusual methionine rich sequences. Although essential for copper resistance, the functions of PcoC, PcoA, and their conserved methionine-rich sequences are not known. Similar methionine motifs observed in eukaryotic copper transporters have been proposed to bind copper, but there are no precedents for such metal binding sites in structurally characterized proteins. The high-resolution structures of apo PcoC, determined for both the native and selenomethionine-containing proteins, reveal a seven-stranded barrel with the methionines unexpectedly housed on a solvent-exposed loop. Several potential metal-binding sites can be discerned by comparing the structures to spectroscopic data reported for copper-loaded PcoC. In the native structure, the methionine loop interacts with the same loop on a second molecule in the asymmetric unit. In the selenomethionine structure, the methionine loops are more exposed, forming hydrophobic patches on the protein surface. These two arrangements suggest that the methionine motifs might function in protein-protein interactions between PcoC molecules or with other methionine-rich proteins such as PcoA. Analytical ultracentrifugation data indicate that a weak monomer-dimer equilibrium exists in solution for the apo protein. Dimerization is significantly enhanced upon binding Cu(I) with a measured {Delta}({Delta}G{sup o}) {le} -8.0 kJ/mole, suggesting that copper might bind at the dimer interface.

  13. The stress corrosion cracking of copper nuclear waste containers

    International Nuclear Information System (INIS)

    King, F.; Litke, C.D.; Ikeda, B.M.

    1999-01-01

    The extent of stress corrosion cracking (SCC) of copper nuclear waste containers is being predicted on the basis of a 'limited propagation' argument. In this argument, it is accepted that crack initiation may occur, but it is argued that the environmental conditions and material properties required for a through-wall crack to propagate will not be present. In this paper, the effect of one environmental parameter, the supply of oxidant (J ox ), on the crack growth rate is examined. Experiments have been conducted on two grades of Cu in NANO 2 environments using two loading techniques. The supply of oxidant has been varied either electrochemically in bulk solution using different applied current densities or by embedding the loaded test specimens in compacted buffer material containing O 2 as the oxidant. Measured and theoretical crack growth rates as a function of J ox are compared with the predicted oxidant flux to the containers in a disposal vault and an estimate of the maximum crack depth on a container obtained. (author)

  14. The stress corrosion cracking of copper nuclear waste containers

    International Nuclear Information System (INIS)

    King, F.; Litke, C.D.; Ikeda, B.M.

    1999-01-01

    The extent of stress corrosion cracking (SCC) of copper nuclear waste containers is being predicted on the basis of a limited propagation argument. In this argument, it is accepted that crack initiation may occur, but it is argued that the environmental conditions and material properties required for a through-wall crack to propagate will not be present. In this paper, the effect of one environmental parameter, the supply of oxidant (J OX ), on the crack growth rate is examined. Experiments have been conducted on two grades of Cu in NaNO 2 environments using two loading techniques. The supply of oxidant has been varied either electrochemically in bulk solution using different applied current densities or by embedding the loaded test specimens in compacted buffer material containing O 2 as the oxidant. Measured and theoretical crack growth rates as a function of J OX are compared with the predicted oxidant flux to the containers in a disposal vault and an estimate of the maximum crack depth on a container obtained

  15. Effects of chlortetracycline and copper supplementation on the prevalence, distribution, and quantity of antimicrobial resistance genes in the fecal metagenome of weaned pigs.

    Science.gov (United States)

    Agga, Getahun E; Scott, H Morgan; Vinasco, Javier; Nagaraja, T G; Amachawadi, Raghavendra G; Bai, Jianfa; Norby, Bo; Renter, David G; Dritz, Steve S; Nelssen, Jim L; Tokach, Mike D

    2015-05-01

    Use of in-feed antibiotics such as chlortetracycline (CTC) in food animals is fiercely debated as a cause of antimicrobial resistance in human pathogens; as a result, alternatives to antibiotics such as heavy metals have been proposed. We used a total community DNA approach to experimentally investigate the effects of CTC and copper supplementation on the presence and quantity of antimicrobial resistance elements in the gut microbial ecology of pigs. Total community DNA was extracted from 569 fecal samples collected weekly over a 6-week period from groups of 5 pigs housed in 32 pens that were randomized to receive either control, CTC, copper, or copper plus CTC regimens. Qualitative and quantitative PCR were used to detect the presence of 14 tetracycline resistance (tet) genes and to quantify gene copies of tetA, tetB, blaCMY-2 (a 3rd generation cephalosporin resistance gene), and pcoD (a copper resistance gene), respectively. The detection of tetA and tetB decreased over the subsequent sampling periods, whereas the prevalence of tetC and tetP increased. CTC and copper plus CTC supplementation increased both the prevalence and gene copy numbers of tetA, while decreasing both the prevalence and gene copies of tetB. In summary, tet gene presence was initially very diverse in the gut bacterial community of weaned pigs; thereafter, copper and CTC supplementation differentially impacted the prevalence and quantity of the various tetracycline, ceftiofur and copper resistance genes resulting in a less diverse gene population. Published by Elsevier B.V.

  16. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  17. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  18. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  19. Extensive diversification of IgD-, IgY-, and truncated IgY(δFc)-encoding genes in the red-eared turtle (Trachemys scripta elegans).

    Science.gov (United States)

    Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng

    2012-10-15

    IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.

  20. Ribose catabolism of Escherichia coli: characterization of the rpiB gene encoding ribose phosphate isomerase B and of the rpiR gene, which is involved in regulation of rpiB expression

    DEFF Research Database (Denmark)

    Sørensen, Kim I.; Hove-Jensen, Bjarne

    1996-01-01

    . The rpiB gene resided on a 4.6-kbp HindIII-EcoRV DNA fragment from phage lambda 10H5 (642) of the Kohara gene library and mapped at 92.85 min. Consistent with this map position, the cloned DNA fragment contained two divergent open reading frames of 149 and 296 codons, encoding ribose phosphate isomerase B...

  1. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  2. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  3. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  4. Electrical conduction in composites containing copper core–copper ...

    Indian Academy of Sciences (India)

    Unknown

    of Mott's small polaron hopping conduction model. ... sample exhibited a metallic conduction confirming the formation of a percolative chain of ..... value of εp. Also the oxide layer formation on the initially unoxidized copper particles will increase the resistivity level of the nanocomposite. This is borne out by results shown in ...

  5. aguA, the gene encoding an extracellular alpha-glucuronidase from Aspergillus tubingensis, is specifically induced on xylose and not on glucuronic acid.

    Science.gov (United States)

    de Vries, R P; Poulsen, C H; Madrid, S; Visser, J

    1998-01-01

    An extracellular alpha-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70 degrees C. The alpha-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and beta-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this alpha-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and alpha-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose.

  6. aguA, the Gene Encoding an Extracellular α-Glucuronidase from Aspergillus tubingensis, Is Specifically Induced on Xylose and Not on Glucuronic Acid

    Science.gov (United States)

    de Vries, Ronald P.; Poulsen, Charlotte H.; Madrid, Susan; Visser, Jaap

    1998-01-01

    An extracellular α-glucuronidase was purified and characterized from a commercial Aspergillus preparation and from culture filtrate of Aspergillus tubingensis. The enzyme has a molecular mass of 107 kDa as determined by sodium dodecyl sulfate-polyacrylamide gel electrophoresis and 112 kDa as determined by mass spectrometry, has a determined pI just below 5.2, and is stable at pH 6.0 for prolonged times. The pH optimum for the enzyme is between 4.5 and 6.0, and the temperature optimum is 70°C. The α-glucuronidase is active mainly on small substituted xylo-oligomers but is also able to release a small amount of 4-O-methylglucuronic acid from birchwood xylan. The enzyme acts synergistically with endoxylanases and β-xylosidase in the hydrolysis of xylan. The enzyme is N glycosylated and contains 14 putative N-glycosylation sites. The gene encoding this α-glucuronidase (aguA) was cloned from A. tubingensis. It consists of an open reading frame of 2,523 bp and contains no introns. The gene codes for a protein of 841 amino acids, containing a eukaryotic signal sequence of 20 amino acids. The mature protein has a predicted molecular mass of 91,790 Da and a calculated pI of 5.13. Multiple copies of the gene were introduced in A. tubingensis, and expression was studied in a highly overproducing transformant. The aguA gene was expressed on xylose, xylobiose, and xylan, similarly to genes encoding endoxylanases, suggesting a coordinate regulation of expression of xylanases and α-glucuronidase. Glucuronic acid did not induce the expression of aguA and also did not modulate the expression on xylose. Addition of glucose prevented expression of aguA on xylan but only reduced the expression on xylose. PMID:9440512

  7. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  8. The ANGULATA7 gene encodes a DnaJ-like zinc finger-domain protein involved in chloroplast function and leaf development in Arabidopsis.

    Science.gov (United States)

    Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis

    2017-03-01

    The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.

  9. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  10. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  11. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  12. The nature of ancient Egyptian copper-containing carbon inks is revealed by synchrotron radiation based X-ray microscopy

    OpenAIRE

    Christiansen , Thomas; Cotte , Marine; Loredo-Portales , René; Lindelof , Poul ,; Mortensen , Kell; Ryholt , Kim; Larsen , Sine

    2017-01-01

    International audience; For the first time it is shown that carbon black inks on ancient Egyptian papyri from different time periods and geographical regions contain copper. The inks have been investigated using synchrotron-based micro X-ray fluorescence (XRF) and micro X-ray absorption near-edge structure spectroscopy (XANES) at the European Synchrotron Radiation Facility (ESRF). The composition of the copper-containing carbon inks showed no significant differences that could be related to t...

  13. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  14. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  15. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  16. batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

    Science.gov (United States)

    Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

    2003-02-01

    Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

  17. Gene Expression Analysis of Copper Tolerance and Wood Decay in the Brown Rot Fungus Fibroporia radiculosa

    Science.gov (United States)

    J. D. Tang; L. A. Parker; A. D. Perkins; T. S. Sonstegard; S. G. Schroeder; D. D. Nicholas; S. V. Diehl

    2013-01-01

    High-throughput transcriptomics was used to identify Fibroporia radiculosa genes that were differentially regulated during colonization of wood treated with a copper-based preservative. The transcriptome was profiled at two time points while the fungus was growing on wood treated with micronized copper quat (MCQ). A total of 917 transcripts were...

  18. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  19. A copper container corrosion model for the in-room emplacement of used CANDU fuel

    International Nuclear Information System (INIS)

    King, F.

    1996-11-01

    Copper containers in a Canadian nuclear fuel waste disposal vault are expected to undergo uniform corrosion and, possibly, pitting. The corrosion behaviour of the containers will be dictated by the evolution of environmental conditions within the disposal vault. The environment will evolve from an early warm, oxidizing phase, during which fast uniform corrosion and pitting may occur, to an indefinite period of cool, anoxic conditions, during which the container will only be susceptible to slow uniform corrosion. The results of corrosion and electrochemical studies of the uniform corrosion of Cu in O 2 -containing Cl - solutions are discussed and a detailed reaction mechanism presented. The relevant literature on pitting corrosion is briefly reviewed and models for the prediction of pit depth discussed. The potential for microbially influenced corrosion and stress-corrosion cracking is discussed, as are vapour-phase corrosion and the effects of β-radiation. The use of natural analogues for justifying long-term corrosion predictions is also considered. Finally, a model for uniform corrosion and pitting is presented and container lifetimes predicted. Copper containers having a minimum wall thickness of 25.4 mm are not predicted to fail by corrosion in periods 6 a. Thus, despite the assumption of poor rock quality made here, the safety of the entire disposal concept can be assured by the use of a long-lived container. (author). 125 refs., 1 tab., 24 figs

  20. aes, the gene encoding the esterase B in Escherichia coli, is a powerful phylogenetic marker of the species

    Directory of Open Access Journals (Sweden)

    Tuffery Pierre

    2009-12-01

    Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.

  1. Antimicrobial resistance and detection of the mecA gene besides enterotoxin-encoding genes among coagulase-negative Staphylococci isolated from clam meat of Anomalocardia brasiliana.

    Science.gov (United States)

    Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor

    2013-12-01

    The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.

  2. Structure of genes for dermaseptins B, antimicrobial peptides from frog skin. Exon 1-encoded prepropeptide is conserved in genes for peptides of highly different structures and activities.

    Science.gov (United States)

    Vouille, V; Amiche, M; Nicolas, P

    1997-09-01

    We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.

  3. Dissolution of copper in chloride/ammonia mixtures and the implications for the stress corrosion cracking of copper containers

    International Nuclear Information System (INIS)

    King, F.; Greidanus, G.; Jobe, D.J.

    1999-05-01

    Stress-corrosion cracking is a possible failure mechanism for copper nuclear fuel waste disposal containers. One species known to cause the stress corrosion of copper alloys is ammonia. It is conceivable that ammonia could be produced in a disposal vault under certain, very specific conditions. There are a number of conditions, however, that mitigate against container failure by stress corrosion, one of which is the presence of chloride ions in deep Canadian Shield groundwaters. There are a number of reports in the literature that suggest that Cl - has an inhibitive effect on the stress corrosion of Cu alloys in ammonia solutions. The electrochemical behaviour of Cu in Cl - /ammonia solutions has been studied as a function of ammonia concentration, pH, the rate of mass transport and electrochemical potential. In particular, the effects of these parameters on the formation Of Cu 2 O films and the steady-state dissolution behaviour have been determined. All experiments were carried out in 0.1 mol·dm -3 NaC1 as a base solution. A series of aqueous speciation and equilibrium potential/pH diagrams are also presented for the quaternary system Cu-C1 - NH 3 /NH 4 + H 2 O. These diagrams are used to interpret the results of the electrochemical experiments reported here. In addition, it is demonstrated how these diagrams could be used to predict the time-dependence of the susceptibility to stress corrosion cracking of Cu containers in a disposal vault. (author)

  4. Control of Copper Resistance and Inorganic Sulfur Metabolism by Paralogous Regulators in Staphylococcus aureus*

    Science.gov (United States)

    Grossoehme, Nicholas; Kehl-Fie, Thomas E.; Ma, Zhen; Adams, Keith W.; Cowart, Darin M.; Scott, Robert A.; Skaar, Eric P.; Giedroc, David P.

    2011-01-01

    All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027–0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes. PMID:21339296

  5. Control of copper resistance and inorganic sulfur metabolism by paralogous regulators in Staphylococcus aureus.

    Science.gov (United States)

    Grossoehme, Nicholas; Kehl-Fie, Thomas E; Ma, Zhen; Adams, Keith W; Cowart, Darin M; Scott, Robert A; Skaar, Eric P; Giedroc, David P

    2011-04-15

    All strains of Staphylococcus aureus encode a putative copper-sensitive operon repressor (CsoR) and one other CsoR-like protein of unknown function. We show here that NWMN_1991 encodes a bona fide Cu(I)-inducible CsoR of a genetically unlinked copA-copZ copper resistance operon in S. aureus strain Newman. In contrast, an unannotated open reading frame found between NWMN_0027 and NWMN_0026 (denoted NWMN_0026.5) encodes a CsoR-like regulator that represses expression of adjacent genes by binding specifically to a pair of canonical operator sites positioned in the NWMN_0027-0026.5 intergenic region. Inspection of these regulated genes suggests a role in assimilation of inorganic sulfur from thiosulfate and vectorial sulfur transfer, and we designate NWMN_0026.5 as CstR (CsoR-like sulfur transferase repressor). Expression analysis demonstrates that CsoR and CstR control their respective regulons in response to distinct stimuli with no overlap in vivo. Unlike CsoR, CstR does not form a stable complex with Cu(I); operator binding is instead inhibited by oxidation of the intersubunit cysteine pair to a mixture of disulfide and trisulfide linkages by a likely metabolite of thiosulfate assimilation, sulfite. CsoR is unreactive toward sulfite under the same conditions. We conclude that CsoR and CstR are paralogs in S. aureus that function in the same cytoplasm to control distinct physiological processes.

  6. Genome Sequences of Two Copper-Resistant Escherichia coli Strains Isolated from Copper-Fed Pigs

    DEFF Research Database (Denmark)

    Lüthje, Freja L.; Hasman, Henrik; Aarestrup, Frank Møller

    2014-01-01

    The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances.......The draft genome sequences of two copper-resistant Escherichia coli strains were determined. These had been isolated from copper-fed pigs and contained additional putative operons conferring copper and other metal and metalloid resistances....

  7. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  8. A conserved gene family encodes transmembrane proteins with fibronectin, immunoglobulin and leucine-rich repeat domains (FIGLER

    Directory of Open Access Journals (Sweden)

    Haga Christopher L

    2007-09-01

    Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.

  9. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  10. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  11. Copper carrier protein in copper toxic sheep liver

    Energy Technology Data Exchange (ETDEWEB)

    Harris, A L; Dean, P D.G.

    1973-01-01

    The livers of copper-toxic sheep have been analyzed by gel electrophoresis followed by staining the gels for copper with diethyldithiocarbamate and for protein with amido schwartz. These gels were compared with similar gels obtained from the livers of normal and copper-deficient animals. The copper-toxic livers contained an extra protein band which possessed relatively weakly bound copper. Possible origins of this protein are discussed. 8 references, 1 figure, 2 tables.

  12. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  13. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  14. Prenatal treatment of mosaic mice (Atp7a mo-ms) mouse model for Menkes disease, with copper combined by dimethyldithiocarbamate (DMDTC)

    DEFF Research Database (Denmark)

    Lenartowicz, Małgorzata; Krzeptowski, Wojciech; Koteja, Paweł

    2012-01-01

    Menkes disease is a fatal neurodegenerative disorder in infants caused by mutations in the gene ATP7A which encodes a copper (Cu) transporter. Defects in ATP7A lead to accumulated copper in the small intestine and kidneys and to copper deficiencies in the brain and the liver. The copper level...... and 18 with a combination of CuCl(2) (50 mg/kg) and dimethyldithiocarbamate (DMDTC) (280 mg/kg) leads to an increase in survival to about 76±25.3 days, whereas treatment with CuCl(2) alone (50 mg/kg) only leads to survival for about 21 days ±5 days. These copper-DMDTC treated mutants showed an improved...... locomotor activity performance and a gain in body mass. In contrast to treatment with CuCl(2) alone, a significant increase in the amount of copper was observed in the brain after prenatal copper-DMDTC treatment as well as a decrease in the amount of accumulated copper in the kidney, both leading towards...

  15. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  16. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  17. Transcriptional response of the mussel Mytilus galloprovincialis (Lam. following exposure to heat stress and copper.

    Directory of Open Access Journals (Sweden)

    Alessandro Negri

    Full Text Available Global warming is a major factor that may affect biological organization, especially in marine ecosystems and in coastal areas that are particularly subject to anthropogenic pollution. We evaluated the effects of simultaneous changes in temperature and copper concentrations on lysosomal membrane stability (N-acetyl-hexosaminidase activity and malondialdehyde accumulation (MDA in the gill of the blue mussel Mytilus galloprovincialis (Lam.. Temperature and copper exerted additive effects on lysosomal membrane stability, exacerbating the toxic effects of metal cations present in non-physiological concentrations. Mussel lysosomal membrane stability is known to be positively related to scope for growth, indicating possible effects of increasing temperature on mussel populations in metal-polluted areas. To clarify the molecular response to environmental stressors, we used a cDNA microarray with 1,673 sequences to measure the relative transcript abundances in the gills of mussels exposed to copper (40 µg/L and a temperature gradient (16°C, 20°C, and 24°C. In animals exposed only to heat stress, hierarchical clustering of the microarray data revealed three main clusters, which were largely dominated by down-regulation of translation-related differentially expressed genes, drastic up-regulation of protein folding related genes, and genes involved in chitin metabolism. The response of mussels exposed to copper at 24°C was characterized by an opposite pattern of the genes involved in translation, most of which were up-regulated, as well as the down-regulation of genes encoding heat shock proteins and "microtubule-based movement" proteins. Our data provide novel information on the transcriptomic modulations in mussels facing temperature increases and high copper concentrations; these data highlight the risk of marine life exposed to toxic chemicals in the presence of temperature increases due to climate change.

  18. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  19. Phylogenetic analysis of fungal heterotrimeric G protein-encoding genes and their expression during dimorphism in Mucor circinelloides.

    Science.gov (United States)

    Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor

    2015-12-01

    In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.

  20. Copper and hypoxia modulate transcriptional and mitochondrial functional-biochemical responses in warm acclimated rainbow trout (Oncorhynchus mykiss)

    International Nuclear Information System (INIS)

    Sappal, Ravinder; Fast, Mark; Purcell, Sara; MacDonald, Nicole; Stevens, Don; Kibenge, Fred; Siah, Ahmed; Kamunde, Collins

    2016-01-01

    To survive in changing environments fish utilize a wide range of biological responses that require energy. We examined the effect of warm acclimation on the electron transport system (ETS) enzymes and transcriptional responses to hypoxia and copper (Cu) exposure in fish. Rainbow trout (Oncorhynchus mykiss) were acclimated to cold (11 °C; control) and warm (20 °C) temperatures for 3 weeks followed by exposure to Cu, hypoxia or both for 24 h. Activities of ETS enzyme complexes I-IV (CI–CIV) were measured in liver and gill mitochondria. Analyses of transcripts encoding for proteins involved in mitochondrial respiration (cytochrome c oxidase subunits 4-1 and 2: COX4-1 and COX4-2), metal detoxification/stress response (metallothioneins A and B: MT-A and MT-B) and energy sensing (AMP-activated protein kinase α1: AMPKα1) were done in liver mitochondria, and in whole liver and gill tissues by RT-qPCR. Warm acclimation inhibited activities of ETS enzymes while effects of Cu and hypoxia depended on the enzyme and thermal acclimation status. The genes encoding for COX4-1, COX4-2, MT-A, MT-B and AMPKα1 were strongly and tissue-dependently altered by warm acclimation. While Cu and hypoxia clearly increased MT-A and MT-B transcript levels in all tissues, their effects on COX4-1, COX4-2 and AMPKα1 mRNA levels were less pronounced. Importantly, warm acclimation differentially altered COX4-2/COX4-1 ratio in liver mitochondria and gill tissue. The three stressors showed both independent and joint actions on activities of ETS enzymes and transcription of genes involved in energy metabolism, stress response and metals homeostasis. Overall, we unveiled novel interactive effects that should not be overlooked in real world situations wherein fish normally encounter multiple stress factors. - Highlights: • Joint and individual effects of copper, hypoxia and warm acclimation differ quantitatively. • Energy metabolism genes are differentially altered by multiple stressors.

  1. The Copper Homeostasis Transcription Factor CopR Is Involved in H2O2 Stress in Lactobacillus plantarum CAUH2

    Directory of Open Access Journals (Sweden)

    Yang Yang

    2017-10-01

    Full Text Available Transcriptional factors (TFs play important roles in the responses to oxidative, acid, and other environmental stresses in Gram-positive bacteria, but the regulatory mechanism of TFs involved in oxidative stress remains unknown in lactic acid bacteria. In the present work, homologous overexpression strains with 43 TFs were constructed in the Lactobacillus plantarum CAUH2 parent strain. The strain overexpressing CopR displayed the highest sensitivity and a 110-fold decrease in survival rate under H2O2 challenge. The importance of CopR in the response to H2O2 stress was further confirmed by a 10.8-fold increase in the survival of a copR insertion mutant. In silico analysis of the genes flanking copR revealed putative CopR-binding “cop box” sequences in the promoter region of the adjacent gene copB encoding a Cu2+-exporting ATPase. Electrophoretic mobility shift assay (EMSA analysis demonstrated the specific binding of CopR with copB in vitro, suggesting copB is a target gene of CopR in L. plantarum. The role of CopB involved in oxidative stress was verified by the significantly decreased survival in the copB mutant. Furthermore, a growth defect in copper-containing medium demonstrated that CopB functions as an export ATPase for copper ions. Furthermore, EMSAs revealed that CopR functions as a regulator that negatively regulates copB gene and Cu2+ serves as inducer of CopR to activate the expression of CopB in response to H2O2 stress in L. plantarum CAUH2. Our findings indicated that CopR plays an important role in enhancing oxidative resistance by regulating copB to modulate copper homeostasis.

  2. Predicting the effects of microbial activity on the corrosion of copper nuclear fuel waste disposal containers

    International Nuclear Information System (INIS)

    King, F.; Stroes-Gascoyne, S.

    1996-08-01

    Microbially influenced corrosion (MIC) of copper nuclear fuel waste containers may occur in a disposal vault located 500-1000 m underground in the granitic rock of the Canadian Shield. The extent and diversity of microbial activity in the vault is expected to be limited initially because of the aggressive conditions produced by γ-radiation, elevated temperatures and desiccation of the clay-based buffer in which the containers will be embedded. Experimental results on the heat- and radiation-sensitivity of the natural microbiota in buffer material are presented. The data suggest that the low water activity in the buffer material will severely limit the growth of microbes near the container. The most likely form of MIC involves sulphate-reducing bacteria (SRB). Electrochemical experiments using a clay-covered copper electrode have shown that sulphide ions produced by SRB could diffuse through buffer material and induce corrosion of the container. A method to predict the long-term corrosion behaviour is presented. (author)

  3. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  4. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  5. Clinically distinct presentations of copper deficiency myeloneuropathy and cytopenias in a patient using excessive zinc-containing denture adhesive.

    Science.gov (United States)

    Cathcart, Sahara J; Sofronescu, Alina G

    2017-08-01

    While copper deficiency has long been known to cause cytopenias, copper deficiency myeloneuropathy is a more recently described entity. Here, we present the case of two clinically distinct presentations of acquired copper deficiency syndromes secondary to excessive use of zinc-containing denture adhesive over five years: myeloneuropathy and severe macrocytic anemia and neutropenia. Extensive laboratory testing and histologic evaluation of the liver and bone marrow, were necessary to rule out other disease processes and establish the diagnosis of copper deficiency. The initial presentation consisted of a myelopathy involving the posterior columns. Serum and urine copper were significantly decreased, and serum zinc was elevated. On second presentation (five years later), multiple hematological abnormalities were detected. Serum copper was again decreased, while serum zinc was elevated. Zinc overload is a preventable cause of copper deficiency syndromes. This rare entity presented herein highlights the importance of patient, as well as provider, education. Copyright © 2017 The Canadian Society of Clinical Chemists. Published by Elsevier Inc. All rights reserved.

  6. Two draft genome sequences of Pseudomonas jessenii strains isolated from a copper contaminated site in Denmark

    DEFF Research Database (Denmark)

    Qin, Yanan; Wang, Dan; Brandt, Kristian Koefoed

    2016-01-01

    Pseudomonas jessenii C2 and Pseudomonas jessenii H16 were isolated from low-Cu and high-Cu industrially contaminated soil, respectively. P. jessenii H16 displayed significant resistance to copper when compared to P. jessenii C2. Here we describe genome sequences and interesting features of these ......Pseudomonas jessenii C2 and Pseudomonas jessenii H16 were isolated from low-Cu and high-Cu industrially contaminated soil, respectively. P. jessenii H16 displayed significant resistance to copper when compared to P. jessenii C2. Here we describe genome sequences and interesting features...... of these two strains. The genome of P. jessenii C2 comprised 6,420,113 bp, with 5814 protein-coding genes and 67 RNA genes. P. jessenii H16 comprised 6,807,788 bp, with 5995 protein-coding genes and 70 RNA genes. Of special interest was a specific adaptation to this harsh copper-contaminated environment as P....... jessenii H16 contained a novel putative copper resistance genomic island (GI) of around 50,000 bp....

  7. Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1

    Directory of Open Access Journals (Sweden)

    Wang Yu

    2011-04-01

    Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15

  8. Identification of a spliced gene from duck enteritis virus encoding a protein homologous to UL15 of herpes simplex virus 1.

    Science.gov (United States)

    Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang

    2011-04-06

    In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and

  9. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  10. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  11. Polyurethane nanofibers containing copper nanoparticles as future materials

    DEFF Research Database (Denmark)

    Sheikh, Faheem A.; Kanjwal, Muzafar Ahmed; Saran, Saurabh

    2011-01-01

    nanofibers. Typically, a colloidal gel consisting of copper NPs and polyurethane has been electrospun. SEM-EDX and TEM results confirmed well oriented nanofibers and good dispersion of pure copper NPs. Copper NPs have diameter in the range of 5–10nm. The thermal stability of the synthesized nanofibers...... the antimicrobial efficacy of these nanofiber mats. Subsequently, antimicrobial tests have indicated that the prepared nanofibers do posses good bactericidal effect. Accordingly, it is noted that the obtained nanofiber mats can be used as future filter membranes with good antimicrobial activities....

  12. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds.

    Science.gov (United States)

    de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap

    2002-04-15

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.

  13. Dissolution of copper in chloride/ammonia mixtures and the implications for the stress corrosion cracking of copper containers

    Energy Technology Data Exchange (ETDEWEB)

    King, F.; Greidanus, G.; Jobe, D.J

    1999-05-01

    Stress-corrosion cracking is a possible failure mechanism for copper nuclear fuel waste disposal containers. One species known to cause the stress corrosion of copper alloys is ammonia. It is conceivable that ammonia could be produced in a disposal vault under certain, very specific conditions. There are a number of conditions, however, that mitigate against container failure by stress corrosion, one of which is the presence of chloride ions in deep Canadian Shield groundwaters. There are a number of reports in the literature that suggest that Cl{sup -} has an inhibitive effect on the stress corrosion of Cu alloys in ammonia solutions. The electrochemical behaviour of Cu in Cl{sup -}/ammonia solutions has been studied as a function of ammonia concentration, pH, the rate of mass transport and electrochemical potential. In particular, the effects of these parameters on the formation Of Cu{sub 2}O films and the steady-state dissolution behaviour have been determined. All experiments were carried out in 0.1 mol{center_dot}dm{sup -3} NaC1 as a base solution. A series of aqueous speciation and equilibrium potential/pH diagrams are also presented for the quaternary system Cu-C1{sup -}NH{sub 3}/NH{sub 4{sup +}}H{sub 2}O. These diagrams are used to interpret the results of the electrochemical experiments reported here. In addition, it is demonstrated how these diagrams could be used to predict the time-dependence of the susceptibility to stress corrosion cracking of Cu containers in a disposal vault. (author)

  14. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  15. Efficient procedure for transferring specific human genes into Chinese hamster cell mutants: interspecific transfer of the human genes encoding leucyl- and asparaginyl-tRNA synthetases

    International Nuclear Information System (INIS)

    Cirullo, R.E.; Dana, S.; Wasmuth, J.J.

    1983-01-01

    A simple and efficient procedure for transferring specific human genes into mutant Chinese hamster ovary cell recipients has been developed that does not rely on using calcium phosphate-precipitated high-molecular-weight DNA. Interspecific cell hybrids between human leukocytes and temperature-sensitive Chinese hamster cell mutants with either a thermolabile leucyl-tRNA synthetase or a thermolabile asparaginyl-tRNA synthetase were used as the starting material in these experiments. These hybrids contain only one or a few human chromosomes and require expression of the appropriate human aminoacyl-tRNA synthetase gene to grow at 39 degrees C. Hybrids were exposed to very high doses of gamma-irradiation to extensively fragment the chromosomes and re-fused immediately to the original temperature-sensitive Chinese hamster mutant, and secondary hybrids were isolated at 39 degrees C. Secondary hybrids, which had retained small fragments of the human genome containing the selected gene, were subjected to another round of irradiation, refusion, and selection at 39 degrees C to reduce the amount of human DNA even further. Using this procedure, Chinese hamster cell lines have been constructed that express the human genes encoding either asparaginyl- or leucyl-tRNA synthetase, yet less than 0.1% of their DNA is derived from the human genome, as quantitated by a sensitive dot-blot nucleic acid hybridization procedure

  16. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  17. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  18. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  19. Plasmids encoding PKI(1-31), a specific inhibitor of cAMP-stimulated gene expression, inhibit the basal transcriptional activity of some but not all cAMP-regulated DNA response elements in JEG-3 cells.

    Science.gov (United States)

    Grove, J R; Deutsch, P J; Price, D J; Habener, J F; Avruch, J

    1989-11-25

    Plasmids that encode a bioactive amino-terminal fragment of the heat-stable inhibitor of the cAMP-dependent protein kinase, PKI(1-31), were employed to characterize the role of this protein kinase in the control of transcriptional activity mediated by three DNA regulatory elements in the JEG-3 human placental cell line. The 5'-flanking sequence of the human collagenase gene contains the heptameric sequence, 5'-TGAGTCA-3', previously identified as a "phorbol ester" response element. Reporter genes containing either the intact 1.2-kilobase 5'-flanking sequence from the human collagenase gene or just the 7-base pair (bp) response element, when coupled to an enhancerless promoter, each exhibit both cAMP and phorbol ester-stimulated expression in JEG-3 cells. Cotransfection of either construct with plasmids encoding PKI(1-31) inhibits cAMP-stimulated but not basal- or phorbol ester-stimulated expression. Pretreatment of cells with phorbol ester for 1 or 2 days abrogates completely the response to rechallenge with phorbol ester but does not alter the basal expression of either construct; cAMP-stimulated expression, while modestly inhibited, remains vigorous. The 5'-flanking sequence of the human chorionic gonadotropin-alpha subunit (HCG alpha) gene has two copies of the sequence, 5'-TGACGTCA-3', contained in directly adjacent identical 18-bp segments, previously identified as a cAMP-response element. Reporter genes containing either the intact 1.5 kilobase of 5'-flanking sequence from the HCG alpha gene, or just the 36-bp tandem repeat cAMP response element, when coupled to an enhancerless promoter, both exhibit a vigorous cAMP stimulation of expression but no response to phorbol ester in JEG-3 cells. Cotransfection with plasmids encoding PKI(1-31) inhibits both basal and cAMP-stimulated expression in a parallel fashion. The 5'-flanking sequence of the human enkephalin gene mediates cAMP-stimulated expression of reporter genes in both JEG-3 and CV-1 cells. Plasmids

  20. HFE gene mutations and Wilson's disease in Sardinia.

    Science.gov (United States)

    Sorbello, Orazio; Sini, Margherita; Civolani, Alberto; Demelia, Luigi

    2010-03-01

    Hypocaeruloplasminaemia can lead to tissue iron storage in Wilson's disease and the possibility of iron overload in long-term overtreated patients should be considered. The HFE gene encodes a protein that is intimately involved in intestinal iron absorption. The aim of this study was to determine the prevalence of the HFE gene mutation, its role in iron metabolism of Wilson's disease patients and the interplay of therapy in copper and iron homeostasis. The records of 32 patients with Wilson's disease were reviewed for iron and copper indices, HFE gene mutations and liver biopsy. Twenty-six patients were negative for HFE gene mutations and did not present significant alterations of iron metabolism. The HFE mutation was significantly associated with increased hepatic iron content (PHFE gene wild-type. The HFE gene mutations may be an addictional factor in iron overload in Wilson's disease. Our results showed that an adjustment of dosage of drugs could prevent further iron overload induced by overtreatment only in patients HFE wild-type. 2009. Published by Elsevier Ltd.

  1. Genetics and Molecular Biology of Epstein-Barr Virus-Encoded BART MicroRNA: A Paradigm for Viral Modulation of Host Immune Response Genes and Genome Stability

    Directory of Open Access Journals (Sweden)

    David H. Dreyfus

    2017-01-01

    Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.

  2. Magnetic Field Interactions of Copper-Containing Intrauterine Devices in 3.0-Tesla Magnetic Resonance Imaging: In Vivo Study

    Energy Technology Data Exchange (ETDEWEB)

    Berger-Kulemann, Vanessa; Einspieler, Henrik [Department of Radiology, Medical University of Vienna, Vienna 1090 (Austria); Hachemian, Nilouparak [Department of Obstetrics and Gynecology, Medical University of Vienna, Vienna 1090 (Austria); Prayer, Daniela; Trattnig, Siegfried; Weber, Michael; Ba-Ssalamah, Ahmed [Department of Radiology, Medical University of Vienna, Vienna 1090 (Austria)

    2013-07-01

    An ex vivo study found a copper-containing intrauterine device (IUD) to be safe for women undergoing an MRI examination at a 3.0-T field. No significant artifacts caused by the metallic implant were detected. However, there are still no in vivo data about these concerns. The aim of this study was to evaluate 3.0-T magnetic field interactions of copper-containing IUDs in vivo. Magnetic field interactions and potential adverse events were evaluated in 33 women using a questionnaire-based telephone survey. Two experienced radiologists performed artifact evaluation on MR images of the pelvis. Eighteen patients were eligible for the survey. One patient reported a dislocation of the IUD after the MR examination. All other patients had no signs of field interactions. No IUD-related artifacts were found. MRI at 3.0-T is possible for women with copper-containing IUDs. However, consulting a gynecologist to check the correct position of the IUD and exclude complications after an MR examination is highly recommended. High-quality clinical imaging of the female pelvis can be performed without a loss in image quality.

  3. Magnetic Field Interactions of Copper-Containing Intrauterine Devices in 3.0-Tesla Magnetic Resonance Imaging: In Vivo Study

    International Nuclear Information System (INIS)

    Berger-Kulemann, Vanessa; Einspieler, Henrik; Hachemian, Nilouparak; Prayer, Daniela; Trattnig, Siegfried; Weber, Michael; Ba-Ssalamah, Ahmed

    2013-01-01

    An ex vivo study found a copper-containing intrauterine device (IUD) to be safe for women undergoing an MRI examination at a 3.0-T field. No significant artifacts caused by the metallic implant were detected. However, there are still no in vivo data about these concerns. The aim of this study was to evaluate 3.0-T magnetic field interactions of copper-containing IUDs in vivo. Magnetic field interactions and potential adverse events were evaluated in 33 women using a questionnaire-based telephone survey. Two experienced radiologists performed artifact evaluation on MR images of the pelvis. Eighteen patients were eligible for the survey. One patient reported a dislocation of the IUD after the MR examination. All other patients had no signs of field interactions. No IUD-related artifacts were found. MRI at 3.0-T is possible for women with copper-containing IUDs. However, consulting a gynecologist to check the correct position of the IUD and exclude complications after an MR examination is highly recommended. High-quality clinical imaging of the female pelvis can be performed without a loss in image quality

  4. Streptococcus mutans copper chaperone, CopZ, is critical for biofilm formation and competitiveness.

    Science.gov (United States)

    Garcia, S S; Du, Q; Wu, H

    2016-12-01

    The oral cavity is a dynamic environment characterized by hundreds of bacterial species, saliva, and an influx of nutrients and metal ions such as copper. Although there is a physiologic level of copper in the saliva, the oral cavity is often challenged with an influx of copper ions. At high concentrations copper is toxic and must therefore be strictly regulated by pathogens for them to persist and cause disease. The cariogenic pathogen Streptococcus mutans manages excess copper using the copYAZ operon that encodes a negative DNA-binding repressor (CopY), the P1-ATPase copper exporter (CopA), and the copper chaperone (CopZ). These hypothetical roles of the copYAZ operon in regulation and copper transport to receptors led us to investigate their contribution to S. mutans virulence. Mutants defective in the copper chaperone CopZ, but not CopY or CopA, were impaired in biofilm formation and competitiveness against commensal streptococci. Characterization of the CopZ mutant biofilm revealed a decreased secretion of glucosyltransferases and reduced expression of mutacin genes. These data suggest that the function of copZ on biofilm and competitiveness is independent of copper resistance and CopZ is a global regulator for biofilm and other virulence factors. Further characterization of CopZ may lead to the identification of new biofilm pathways. © 2015 John Wiley & Sons A/S. Published by John Wiley & Sons Ltd.

  5. Deletion of the Sm1 encoding motif in the lsm gene results in distinct changes in the transcriptome and enhanced swarming activity of Haloferax cells.

    Science.gov (United States)

    Maier, Lisa-Katharina; Benz, Juliane; Fischer, Susan; Alstetter, Martina; Jaschinski, Katharina; Hilker, Rolf; Becker, Anke; Allers, Thorsten; Soppa, Jörg; Marchfelder, Anita

    2015-10-01

    Members of the Sm protein family are important for the cellular RNA metabolism in all three domains of life. The family includes archaeal and eukaryotic Lsm proteins, eukaryotic Sm proteins and archaeal and bacterial Hfq proteins. While several studies concerning the bacterial and eukaryotic family members have been published, little is known about the archaeal Lsm proteins. Although structures for several archaeal Lsm proteins have been solved already more than ten years ago, we still do not know much about their biological function, however one can confidently propose that the archaeal Lsm proteins will also be involved in RNA metabolism. Therefore, we investigated this protein in the halophilic archaeon Haloferax volcanii. The Haloferax genome encodes a single Lsm protein, the lsm gene overlaps and is co-transcribed with the gene for the ribosomal L37.eR protein. Here, we show that the reading frame of the lsm gene contains a promoter which regulates expression of the overlapping rpl37R gene. This rpl37R specific promoter ensures high expression of the rpl37R gene in exponential growth phase. To investigate the biological function of the Lsm protein we generated a lsm deletion mutant that had the coding sequence for the Sm1 motif removed but still contained the internal promoter for the downstream rpl37R gene. The transcriptome of this deletion mutant was compared to the wild type transcriptome, revealing that several genes are down-regulated and many genes are up-regulated in the deletion strain. Northern blot analyses confirmed down-regulation of two genes. In addition, the deletion strain showed a gain of function in swarming, in congruence with the up-regulation of transcripts encoding proteins required for motility. Copyright © 2015 The Authors. Published by Elsevier B.V. All rights reserved.

  6. Reactive-transport model for the prediction of the uniform corrosion behaviour of copper used fuel containers

    International Nuclear Information System (INIS)

    King, F.; Kolar, M.; Maak, P.

    2008-01-01

    Used fuel containers in a deep geological repository will be subject to various forms of corrosion. For containers made from oxygen-free, phosphorus-doped copper, the most likely corrosion processes are uniform corrosion, underdeposit corrosion, stress corrosion cracking, and microbiologically influenced corrosion. The environmental conditions within the repository are expected to evolve with time, changing from warm and oxidizing initially to cool and anoxic in the long-term. In response, the corrosion behaviour of the containers will also change with time as the repository environment evolve. A reactive-transport model has been developed to predict the time-dependent uniform corrosion behaviour of the container. The model is based on an experimentally-based reaction scheme that accounts for the various chemical, microbiological, electrochemical, precipitation/dissolution, adsorption/desorption, redox, and mass-transport processes at the container surface and in the compacted bentonite-based sealing materials within the repository. Coupling of the electrochemical interfacial reactions with processes in the bentonite buffer material allows the effect of the evolution of the repository environment on the corrosion behaviour of the container to be taken into account. The Copper Corrosion Model for Uniform Corrosion predicts the time-dependent corrosion rate and corrosion potential of the container, as well as the evolution of the near-field environment

  7. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  8. Development of high strength hot rolled low carbon copper-bearing steel containing nanometer sized carbides

    Energy Technology Data Exchange (ETDEWEB)

    Phaniraj, M.P. [High Temperature Energy Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Shin, Young-Min [High Temperature Energy Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Department of Materials Science and Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Lee, Joonho [Department of Materials Science and Engineering, Korea University, Seoul 136-701 (Korea, Republic of); Goo, Nam Hoon [Sheet Product Design Group, Hyundai Steel Co., North Industrial Street 1400, 343-823, DangJin 343-823 (Korea, Republic of); Kim, Dong-Ik; Suh, Jin-Yoo; Jung, Woo-Sang [High Temperature Energy Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Shim, Jae-Hyeok, E-mail: jhshim@kist.re.kr [High Temperature Energy Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of); Choi, In-Suk, E-mail: insukchoi@kist.re.kr [High Temperature Energy Materials Research Center, Korea Institute of Science and Technology, Seoul 136-791 (Korea, Republic of)

    2015-05-01

    A low carbon ferritic steel was alloyed with Ti, Mo and Cu with the intention of achieving greater increment in strength by multiple precipitate strengthening. The steel is hot rolled and subjected to interrupted cooling to enable precipitation of Ti–Mo carbides and copper. Thermodynamic calculations were carried out to determine equilibrium phase fractions at different temperatures. Microstructure characterization using transmission electron microscopy and composition analysis revealed that the steel contains ~5 nm size precipitates of (Ti,Mo)C. Precipitation kinetics calculations using MatCalc software showed that mainly body centered cubic copper precipitates of size < 5nm form under the cooling conditions in the present study. The steel has the high tensile strength of 853 MPa and good ductility. The yield strength increases by 420 MPa, which is more than that achieved in hot rolled low carbon ferritic steels with only copper precipitates or only carbide precipitates. The precipitation and strengthening contribution of copper and (Ti,Mo)C precipitates and their effect on the work hardening behavior is discussed.

  9. Murine homeobox-containing gene, Msx-1: analysis of genomic organization, promoter structure, and potential autoregulatory cis-acting elements.

    Science.gov (United States)

    Kuzuoka, M; Takahashi, T; Guron, C; Raghow, R

    1994-05-01

    Detailed molecular organization of the coding and upstream regulatory regions of the murine homeodomain-containing gene, Msx-1, is reported. The protein-encoding portion of the gene is contained in two exons, 590 and 1214 bp in length, separated by a 2107-bp intron; the homeodomain is located in the second exon. The two-exon organization of the murine Msx-1 gene resembles a number of other homeodomain-containing genes. The 5'-(GTAAGT) and 3'-(CCCTAG) splicing junctions and the mRNA polyadenylation signal (UAUAA) of the murine Msx-1 gene are also characteristic of other vertebrate genes. By nuclease protection and primer extension assays, the start of transcription of the Msx-1 gene was located 256 bp upstream of the first AUG. Computer analysis of the promoter proximal 1280-bp sequence revealed a number of potentially important cis-regulatory sequences; these include the recognition elements for Ap-1, Ap-2, Ap-3, Sp-1, a possible binding site for RAR:RXR, and a number of TCF-1 consensus motifs. Importantly, a perfect reverse complement of (C/G)TTAATTG, which was recently shown to be an optimal binding sequence for the homeodomain of Msx-1 protein (K.M. Catron, N. Iler, and C. Abate (1993) Mol. Cell. Biol. 13:2354-2365), was also located in the murine Msx-1 promoter. Binding of bacterially expressed Msx-1 homeodomain polypeptide to Msx-1-specific oligonucleotide was experimentally demonstrated, raising a distinct possibility of autoregulation of this developmentally regulated gene.

  10. A differential genome-wide transcriptome analysis: impact of cellular copper on complex biological processes like aging and development.

    Directory of Open Access Journals (Sweden)

    Jörg Servos

    Full Text Available The regulation of cellular copper homeostasis is crucial in biology. Impairments lead to severe dysfunctions and are known to affect aging and development. Previously, a loss-of-function mutation in the gene encoding the copper-sensing and copper-regulated transcription factor GRISEA of the filamentous fungus Podospora anserina was reported to lead to cellular copper depletion and a pleiotropic phenotype with hypopigmentation of the mycelium and the ascospores, affected fertility and increased lifespan by approximately 60% when compared to the wild type. This phenotype is linked to a switch from a copper-dependent standard to an alternative respiration leading to both a reduced generation of reactive oxygen species (ROS and of adenosine triphosphate (ATP. We performed a genome-wide comparative transcriptome analysis of a wild-type strain and the copper-depleted grisea mutant. We unambiguously assigned 9,700 sequences of the transcriptome in both strains to the more than 10,600 predicted and annotated open reading frames of the P. anserina genome indicating 90% coverage of the transcriptome. 4,752 of the transcripts differed significantly in abundance with 1,156 transcripts differing at least 3-fold. Selected genes were investigated by qRT-PCR analyses. Apart from this general characterization we analyzed the data with special emphasis on molecular pathways related to the grisea mutation taking advantage of the available complete genomic sequence of P. anserina. This analysis verified but also corrected conclusions from earlier data obtained by single gene analysis, identified new candidates of factors as part of the cellular copper homeostasis system including target genes of transcription factor GRISEA, and provides a rich reference source of quantitative data for further in detail investigations. Overall, the present study demonstrates the importance of systems biology approaches also in cases were mutations in single genes are analyzed to

  11. A genetic association study of the FXYD domain containing ion transport regulator 6 (FXYD6) gene, encoding phosphohippolin, in susceptibility to schizophrenia in a Japanese population.

    Science.gov (United States)

    Ito, Yoshihito; Nakamura, Yukako; Takahashi, Nagahide; Saito, Shinichi; Aleksic, Branko; Iwata, Nakao; Inada, Toshiya; Ozaki, Norio

    2008-06-13

    The FXYD domain containing ion transport regulator 6 (FXYD6) gene is located within a region of chromosome 11 (11q23.3) that has been shown by a number of genome scans to be one of the most well-established linkages to schizophrenia. FXYD6 encodes the protein phosphohippolin, which is primarily expressed in the brain. Phosphohippolin modulates the kinetic activity of Na,K-ATPase and has long-term physiological importance in maintaining cation homeostasis. A recent study reported that FXYD6 was associated with schizophrenia in the United Kingdom samples. Applying the gene-based association concept, we carried out an association study regarding FXYD6 and schizophrenia in a Japanese population, with a sample consisting of 2026 subjects (906 schizophrenics and 1120 controls). After linkage disequilibrium analysis, 23 single nucleotide polymorphisms (SNPs) were genotyped using 5'-exonuclease allelic discrimination assay. We found a significant association of two SNPs (rs11216573; genotypic P value: 0.022 and rs555577; genotypic P value: 0.026, allelic P value: 0.011, uncorrected). Nominal P values did not survive correction for multiple testing (rs11216573; genotypic P value: 0.47 and rs555577; genotypic P value: 0.55, allelic P value: 0.24, after SNPSpD correction). No association was observed between schizophrenia patients and controls in allelic, genotypic and haplotypic analyses. Our findings suggest that FXYD6 is unlikely to be related to the development of schizophrenia in a Japanese population.

  12. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  13. The role of insufficient copper in lipid synthesis and fatty-liver disease.

    Science.gov (United States)

    Morrell, Austin; Tallino, Savannah; Yu, Lei; Burkhead, Jason L

    2017-04-01

    The essential transition metal copper is important in lipid metabolism, redox balance, iron mobilization, and many other critical processes in eukaryotic organisms. Genetic diseases where copper homeostasis is disrupted, including Menkes disease and Wilson disease, indicate the importance of copper balance to human health. The severe consequences of insufficient copper supply are illustrated by Menkes disease, caused by mutation in the X-linked ATP7A gene encoding a protein that transports copper from intestinal epithelia into the bloodstream and across the blood-brain barrier. Inadequate copper supply to the body due to poor diet quality or malabsorption can disrupt several molecular level pathways and processes. Though much of the copper distribution machinery has been described and consequences of disrupted copper handling have been characterized in human disease as well as animal models, physiological consequences of sub-optimal copper due to poor nutrition or malabsorption have not been extensively studied. Recent work indicates that insufficient copper may be important in a number of common diseases including obesity, ischemic heart disease, and metabolic syndrome. Specifically, marginal copper deficiency (CuD) has been reported as a potential etiologic factor in diseases characterized by disrupted lipid metabolism such as non-alcoholic fatty-liver disease (NAFLD). In this review, we discuss the available data suggesting that a significant portion of the North American population may consume insufficient copper, the potential mechanisms by which CuD may promote lipid biosynthesis, and the interaction between CuD and dietary fructose in the etiology of NAFLD. © 2016 IUBMB Life, 69(4):263-270, 2017. © 2017 International Union of Biochemistry and Molecular Biology.

  14. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  15. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  16. Parasitization by Scleroderma guani influences expression of superoxide dismutase genes in Tenebrio molitor

    Science.gov (United States)

    Superoxide dismutase (SOD) is an antioxidant enzyme involved in detoxifying reactive oxygen species. In this study, we identified genes encoding the extracellular and intracellular copper-zinc SODs (ecCuZnSOD and icCuZnSOD) and a manganese SOD (MnSOD) in the yellow mealworm beetle, Tenebrio molitor....

  17. Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)

    Science.gov (United States)

    Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi

    2013-03-01

    Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).

  18. Structural organization and chromosomal assignment of the mouse embryonic TEA domain-containing factor (ETF) gene.

    Science.gov (United States)

    Suzuki, K; Yasunami, M; Matsuda, Y; Maeda, T; Kobayashi, H; Terasaki, H; Ohkubo, H

    1996-09-01

    Embryonic TEA domain-containing factor (ETF) belongs to the family of proteins structurally related to transcriptional enhancer factor-1 (TEF-1) and is implicated in neural development. Isolation and characterization of the cosmid clones encoding the mouse ETF gene (Etdf) revealed that Etdf spans approximately 17.9 kb and consists of 12 exons. The exon-intron structure of Etdf closely resembles that of the Drosophila scalloped gene, indicating that these genes may have evolved from a common ancestor. The multiple transcription initiation sites revealed by S1 protection and primer extension analyses are consistent with the absence of the canonical TATA and CAAT boxes in the 5'-flanking region, which contains many potential regulatory sequences, such as the E-box, N-box, Sp1 element, GATA-1 element, TAATGARAT element, and B2 short interspersed element (SINE) as well as several direct and inverted repeat sequences. The Etdf locus was assigned to the proximal region of mouse chromosome 7 using fluorescence in situ hybridization and linkage mapping analyses. These results provide the molecular basis for studying the regulation, in vivo function, and evolution of Etdf.

  19. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  20. KCNN Genes that Encode Small-Conductance Ca2+-Activated K+ Channels Influence Alcohol and Drug Addiction.

    Science.gov (United States)

    Padula, Audrey E; Griffin, William C; Lopez, Marcelo F; Nimitvilai, Sudarat; Cannady, Reginald; McGuier, Natalie S; Chesler, Elissa J; Miles, Michael F; Williams, Robert W; Randall, Patrick K; Woodward, John J; Becker, Howard C; Mulholland, Patrick J

    2015-07-01

    Small-conductance Ca(2+)-activated K(+) (KCa2) channels control neuronal excitability and synaptic plasticity, and have been implicated in substance abuse. However, it is unknown if genes that encode KCa2 channels (KCNN1-3) influence alcohol and drug addiction. In the present study, an integrative functional genomics approach shows that genetic datasets for alcohol, nicotine, and illicit drugs contain the family of KCNN genes. Alcohol preference and dependence QTLs contain KCNN2 and KCNN3, and Kcnn3 transcript levels in the nucleus accumbens (NAc) of genetically diverse BXD strains of mice predicted voluntary alcohol consumption. Transcript levels of Kcnn3 in the NAc negatively correlated with alcohol intake levels in BXD strains, and alcohol dependence enhanced the strength of this association. Microinjections of the KCa2 channel inhibitor apamin into the NAc increased alcohol intake in control C57BL/6J mice, while spontaneous seizures developed in alcohol-dependent mice following apamin injection. Consistent with this finding, alcohol dependence enhanced the intrinsic excitability of medium spiny neurons in the NAc core and reduced the function and protein expression of KCa2 channels in the NAc. Altogether, these data implicate the family of KCNN genes in alcohol, nicotine, and drug addiction, and identify KCNN3 as a mediator of voluntary and excessive alcohol consumption. KCa2.3 channels represent a promising novel target in the pharmacogenetic treatment of alcohol and drug addiction.

  1. The CUP2 gene product regulates the expression of the CUP1 gene, coding for yeast metallothionein.

    OpenAIRE

    Welch, J; Fogel, S; Buchman, C; Karin, M

    1989-01-01

    The yeast CUP1 gene codes for a copper-binding protein similar to metallothionein. Copper sensitive cup1s strains contain a single copy of the CUP1 locus. Resistant strains (CUP1r) carry 12 or more multiple tandem copies. We isolated 12 ethyl methane sulfonate-induced copper sensitive mutants in a wild-type CUP1r parental strain, X2180-1A. Most mutants reduce the copper resistance phenotype only slightly. However, the mutant cup2 lowers resistance by nearly two orders of magnitude. We cloned ...

  2. Structure of the human gene encoding the associated microfibrillar protein (MFAP1) and localization to chromosome 15q15-q21

    Energy Technology Data Exchange (ETDEWEB)

    Yeh, H.; Chow, M.; Abrams, W.R. [Univ. of Pennsylvania, Philadelphia, PA (United States)] [and others

    1994-09-15

    Microfibrils with a diameter of 10-12 nm, found either in assocation with elastin or independently, are an important component of the extracellular matrix of many tissues. To extend understanding of the proteins composing these microfibrils, the cDNA and gene encoding the human associated microfibril protein (MRAP1) have been cloned and characterized. The coding portion is contained in 9 exons, and the sequence is very homologous to the previously described chick cDNA, but does not appear to share homology or domain motifs with any other known protein. Interestingly, the gene has been localized to chromosome 15q15-q21 by somatic hybrid cell and chromosome in situ analyses. This is the same chromosomal region to which the fibrillin gene, FBN1, known to be defective in the Marfan syndrome, has been mapped. MFAP1 is a candidate gene for heritable diseases affecting microfibrils. 38 refs., 6 figs.

  3. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  4. Multiple signalling systems controlling expression of luminescence in Vibrio harveyi: sequence and function of genes encoding a second sensory pathway.

    Science.gov (United States)

    Bassler, B L; Wright, M; Silverman, M R

    1994-07-01

    Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.

  5. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  6. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  7. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Science.gov (United States)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  8. Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

    Science.gov (United States)

    Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

    2005-03-01

    We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

  9. The Aspergillus uvsH gene encodes a product homologous to yeast RAD18 and Neurospora UVS-2.

    Science.gov (United States)

    Yoon, J H; Lee, B J; Kang, H S

    1995-07-28

    The uvsH DNA repair gene of Aspergillus nidulans has been cloned by complementation of the uvsH77 mutation with a cosmid library containing genomic DNA inserts from a wild-type strain. Methylmethane sulfonate (MMS)-resistant transformants were obtained on medium containing 0.01% MMS, to which uvsH mutants exhibit high sensitivity. Retransformation of uvsH77 mutants with the rescued cosmids from the MMS-resistant transformants resulted in restoration of both UV and MMS resistance to wild-type levels. Nucleotide sequence analysis of the genomic DNA and cDNA of the uvsH gene shows that it has an open reading frame (ORF) of 1329 bp, interrupted by two introns of 51 and 61 bp. A 2.4 kb transcript of the uvsH gene was detected by Northern blot analysis. Primer extension analysis revealed that transcription starts at 31 bp upstream from the translation initiation codon. This gene encodes a predicted polypeptide of 443 amino acids, which has two unique zinc finger motifs. The proposed polypeptide displays 39% identity to the Neurospora crassa UVS-2 protein and 24% identity to the Saccharomyces cerevisiae RAD18 protein. The sequence similarity is particularly high in three domains. One zinc finger (RING finger) motif is located in the first domain close to the N-terminus. The other zinc finger motif is in the second domain. In the third domain, the mutation sites in both the uvsH77 and uvsH304 alleles were identified.(ABSTRACT TRUNCATED AT 250 WORDS)

  10. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  11. Gene transcript profiles of the TIA biosynthetic pathway in response to ethylene and copper reveal their interactive role in modulating TIA biosynthesis in Catharanthus roseus.

    Science.gov (United States)

    Pan, Ya-Jie; Liu, Jia; Guo, Xiao-Rui; Zu, Yuan-Gang; Tang, Zhong-Hua

    2015-05-01

    Research on transcriptional regulation of terpenoid indole alkaloid (TIA) biosynthesis of the medicinal plant, Catharanthus roseus, has largely been focused on gene function and not clustering analysis of multiple genes at the transcript level. Here, more than ten key genes encoding key enzyme of alkaloid synthesis in TIA biosynthetic pathways were chosen to investigate the integrative responses to exogenous elicitor ethylene and copper (Cu) at both transcriptional and metabolic levels. The ethylene-induced gene transcripts in leaves and roots, respectively, were subjected to principal component analysis (PCA) and the results showed the overall expression of TIA pathway genes indicated as the Q value followed a standard normal distribution after ethylene treatments. Peak gene expression was at 15-30 μM of ethephon, and the pre-mature leaf had a higher Q value than the immature or mature leaf and root. Treatment with elicitor Cu found that Cu up-regulated overall TIA gene expression more in roots than in leaves. The combined effects of Cu and ethephon on TIA gene expression were stronger than their separate effects. It has been documented that TIA gene expression is tightly regulated by the transcriptional factor (TF) ethylene responsive factor (ERF) and mitogen-activated protein kinase (MAPK) cascade. The loading plot combination with correlation analysis for the genes of C. roseus showed that expression of the MPK gene correlated with strictosidine synthase (STR) and strictosidine b-D-glucosidase(SGD). In addition, ERF expression correlated with expression of secologanin synthase (SLS) and tryptophan decarboxylase (TDC), specifically in roots, whereas MPK and myelocytomatosis oncogene (MYC) correlated with STR and SGD genes. In conclusion, the ERF regulates the upstream pathway genes in response to heavy metal Cu mainly in C. roseus roots, while the MPK mainly participates in regulating the STR gene in response to ethylene in pre-mature leaf. Interestingly, the

  12. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  13. A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

    Science.gov (United States)

    Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

    2017-01-01

    Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

  14. Creep properties of welded joints in OFHC copper for nuclear waste containment

    International Nuclear Information System (INIS)

    Ivarsson, B.; Oesterberg, J.O.

    1988-08-01

    In Sweden it has been suggested that copper canisters are used for containment of spent nuclear fuel. These canisters will be subjected to temperatures up to 100 degrees C and external pressures up to 15 MPa. Since the material is pure (OFHC) copper, creep properties must be considered when the canisters are dimensioned. The canisters are sealed by electron beam welding which will affect the creep properties. Literature data for copper - especially welded joints - at the temperatures of interest is very scare. Therefore uniaxial creep tests of parent metal, weld metal, and simulated HAZ structures have been performed at 110 degrees C. These tests revealed considerable differences in creep deformation and rupture strength. The weld metal showed creep rates and rupture times ten times higher and ten times shorter, respectively, than those of the parent metal. The simulated HAZ was equally strongen than the parent metal. These differences were to some extent verified by results from creep tests of cross-welded specimens which, however, showed even shorter rupture times. Constitutive equations were derived from the uniaxial test results. To check the applicability of these equations to multiaxial conditions, a few internal pressure creep tests of butt-welded tubes were performed. Attemps were made to simulate their creep behaviour by constitutive equations were used. These calculations failed due to too great differences in creep deformation behaviour across the welded joint. (authors)

  15. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  16. TAIL1: an isthmin-like gene, containing type 1 thrombospondin-repeat and AMOP domain, mapped to ARVD1 critical region.

    Science.gov (United States)

    Rossi, Valeria; Beffagna, Giorgia; Rampazzo, Alessandra; Bauce, Barbara; Danieli, Gian Antonio

    2004-06-23

    Isthmins represent a novel family of vertebrate secreted proteins containing one copy of the thrombospondin type 1 repeat (TSR), which in mammals is shared by several proteins with diverse biological functions, including cell adhesion, angiogenesis, and patterning of developing nervous system. We have determined the genomic organization of human TAIL1 (thrombospondin and AMOP containing isthmin-like 1), a novel isthmin-like gene encoding a protein that contains a TSR and a C-terminal AMOP domain (adhesion-associated domain in MUC4 and other proteins), characteristic of extracellular proteins involved in adhesion processes. TAIL1 gene encompasses more than 24.4 kb. Analysis of the DNA sequence surrounding the putative transcriptional start region revealed a TATA-less promoter located in a CpG island. Several consensus binding sites for the transcription factors Sp1 and MZF-1 were identified in this promoter region. In humans, TAIL1 gene is located on chromosome 14q24.3 within ARVD1 (arrhythmogenic right ventricular dysplasia/cardiomyopathy, type 1) critical region; preliminary evidence suggests that it is expressed in several tissues, showing multiple alternative splicing.

  17. Identification of copper-induced genes in Pseudomonas fluorescens and use of a reporter strain to monitor bioavailable copper in soil

    DEFF Research Database (Denmark)

    Tom-Petersen, Andreas; Hosbond, Carsten; Nybroe, Ole

    2001-01-01

    -amended soil microcosms in a concentration-dependent manner. The chelator EDTA reduced the availability of Cu to P. fluorescens in soil. This showed that complex-bound Cu is not necessarily available to bacteria, We compared chemical analysis of soluble Cu and the reporter assay on soil solutions from Cu-containing......-Cu15, the gene interrupted by the transposon encoded a protein carrying a Cu-binding domain but with low homology to known proteins. DF57-Cu15 was the most suitable Cu reporter due to its high specific response and tolerance to Cu in pure culture. DF57-Cu15 responded to soil solutions from Cu...... soil microcosms supplemented with either manure or straw. Organic matter increased the amount of soluble Cu but not the amount of bioavailable Cu. Probably, Cu binds with high affinity to organic constituents in pig manure or barley straw. Hence, determination of soluble Cu by chemical analysis cannot...

  18. Towards an all-copper redox flow battery based on a copper-containing ionic liquid.

    Science.gov (United States)

    Schaltin, Stijn; Li, Yun; Brooks, Neil R; Sniekers, Jeroen; Vankelecom, Ivo F J; Binnemans, Koen; Fransaer, Jan

    2016-01-07

    The first redox flow battery (RFB), based on the all-copper liquid metal salt [Cu(MeCN)4][Tf2N], is presented. Liquid metal salts (LMS) are a new type of ionic liquid that functions both as solvent and electrolyte. Non-aqueous electrolytes have advantages over water-based solutions, such as a larger electrochemical window and large thermal stability. The proof-of-concept is given that LMSs can be used as the electrolyte in RFBs. The main advantage of [Cu(MeCN)4][Tf2N] is the high copper concentration, and thus high charge and energy densities of 300 kC l(-1) and 75 W h l(-1) respectively, since the copper(i) ions form an integral part of the electrolyte. A Coulombic efficiency up to 85% could be reached.

  19. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  20. Thermal Properties of Polymethyl Methacrylate Composite Containing Copper Nanoparticles.

    Science.gov (United States)

    Yu, Wei; Xie, Huaqing; Xin, Sha; Yin, Junshan; Jiang, Yitong; Wang, Mingzhu

    2015-04-01

    Thermal functional Materials have wide applications in thermal management fields, and inserting highly thermal conductive materials is effective in enhancing thermal conductivity of matrix. In this paper, copper nanoparticles were selected as the additive to prepare polymethyl methacrylate (PMMA) based nanocomposite with enhanced thermal properties. Uniform copper nanoparticles with pure face-centered lattice were prepared by liquid phase reduction method. Then, they were added into PMMA/N, N-Dimethylmethanamide (DMF) solution according to the different mass fraction for uniform dispersion. After DMF was evaporated, Cu-PMMA nanocomposites were gained. The thermal analysis measurement results showed that the decomposition temperature of nanocomposites decreased gradually with the increasing particle loadings. The thermal conductivity of the Cu-PMMA nanocomposites rose with the increasing contents of copper nanoparticles. With a 20 vol.% addition, the thermal conductivity was up to 1.2 W/m · K, a 380.5% increase compared to the pure PMMA. The results demonstrate that copper nanoparticles have great potential in enhancing thermal transport properties of polymer.

  1. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  2. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  3. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  4. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  5. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  6. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  7. Alterations in Fibronectin Type III Domain Containing 1 Protein Gene Are Associated with Hypertension.

    Directory of Open Access Journals (Sweden)

    Alan Y Deng

    Full Text Available Multiple quantitative trait loci (QTLs for blood pressure (BP have been detected in rat models of human polygenic hypertension. Great challenges confronting us include molecular identifications of individual QTLs. We first defined the chromosome region harboring C1QTL1 to a segment of 1.9 megabases that carries 9 genes. Among them, we identified the gene encoding the fibronectin type III domain containing 1 protein (Fndc1/activator of G protein signaling 8 (Ags8 to be the strongest candidate for C1QTL1, since numerous non-synonymous mutations are found. Moreover, the 5' Fndc1/Ags8 putative promoter contains numerous mutations that can account for its differential expression in kidneys and the heart, prominent organs in modulating BP, although the Fndc1/Ags8 protein was not detectable in these organs under our experimental conditions. This work has provided the premier evidence that Fndc1/Ags8 is a novel and strongest candidate gene for C1QTL1 without completely excluding other 8 genes in the C1QTL1-residing interval. If proven true by future in vivo function studies such as single-gene Fndc1/Ags8 congenics, transgenesis or targeted-gene modifications, it might represent a part of the BP genetic architecture that operates in the upstream position distant from the end-phase physiology of BP control, since it activates a Gbetagamma component in a signaling pathway. Its functional role could validate the concept that a QTL in itself can influence BP 'indirectly' by regulating other genes downstream in a pathway. The elucidation of the mechanisms initiated by Fndc/Ags8 variations will reveal novel insights into the BP modulation via a regulatory hierarchy.

  8. The Popeye domain containing genes: essential elements in heart rate control.

    Science.gov (United States)

    Schindler, Roland F; Poon, Kar Lai; Simrick, Subreena; Brand, Thomas

    2012-12-01

    The Popeye domain containing (Popdc) gene family displays preferential expression in skeletal muscle and heart. Only recently a significant gain in the understanding of the function of Popdc genes in the heart has been obtained. The Popdc genes encode membrane proteins harboring an evolutionary conserved Popeye domain, which functions as a binding domain for cyclic adenosine monophosphate (cAMP). Popdc proteins interact with the two-pore channel TREK-1 and enhance its current. This protein interaction is modulated by cAMP. Null mutations of members of the Popdc gene family in zebrafish and mouse are associated with severe cardiac arrhythmia phenotypes. While in zebrafish an atrioventricular block was prevalent, in mouse a stress-induced sinus bradycardia was observed, which was due to the presence of sinus pauses. Moreover, the phenotype develops in an age-dependent manner, being absent in the young animal and becoming increasingly severe, as the animals grow older. This phenotype is reminiscent of the sick sinus syndrome (SSS), which affects mostly the elderly and is characterized by the poor ability of the cardiac pacemaker to adapt the heart rate to the physiological demand. While being a prevalent disease, which is responsible for a large fraction of pacemaker implantations in Western countries, SSS is poorly understood at the molecular level. It is therefore expected that the study of the molecular basis of the stress-induced bradycardia in Popdc mice will shed new light on the etiology of pacemaker disease.

  9. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  10. Comparison between micro- and nanosized copper oxide and water soluble copper chloride: interrelationship between intracellular copper concentrations, oxidative stress and DNA damage response in human lung cells.

    Science.gov (United States)

    Strauch, Bettina Maria; Niemand, Rebecca Katharina; Winkelbeiner, Nicola Lisa; Hartwig, Andrea

    2017-08-01

    Nano- and microscale copper oxide particles (CuO NP, CuO MP) are applied for manifold purposes, enhancing exposure and thus the potential risk of adverse health effects. Based on the pronounced in vitro cytotoxicity of CuO NP, systematic investigations on the mode of action are required. Therefore, the impact of CuO NP, CuO MP and CuCl 2 on the DNA damage response on transcriptional level was investigated by quantitative gene expression profiling via high-throughput RT-qPCR. Cytotoxicity, copper uptake and the impact on the oxidative stress response, cell cycle regulation and apoptosis were further analysed on the functional level. Cytotoxicity of CuO NP was more pronounced when compared to CuO MP and CuCl 2 in human bronchial epithelial BEAS-2B cells. Uptake studies revealed an intracellular copper overload in the soluble fractions of both cytoplasm and nucleus, reaching up to millimolar concentrations in case of CuO NP and considerably lower levels in case of CuO MP and CuCl 2 . Moreover, CuCl 2 caused copper accumulation in the nucleus only at cytotoxic concentrations. Gene expression analysis in BEAS-2B and A549 cells revealed a strong induction of uptake-related metallothionein genes, oxidative stress-sensitive and pro-inflammatory genes, anti-oxidative defense-associated genes as well as those coding for the cell cycle inhibitor p21 and the pro-apoptotic Noxa and DR5. While DNA damage inducible genes were activated, genes coding for distinct DNA repair factors were down-regulated. Modulation of gene expression was most pronounced in case of CuO NP as compared to CuO MP and CuCl 2 and more distinct in BEAS-2B cells. GSH depletion and activation of Nrf2 in HeLa S3 cells confirmed oxidative stress induction, mainly restricted to CuO NP. Also, cell cycle arrest and apoptosis induction were most distinct for CuO NP. The high cytotoxicity and marked impact on gene expression by CuO NP can be ascribed to the strong intracellular copper ion release, with subsequent

  11. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, J.; Nevrtalová, E.; Kováčová, V.; Hudzieczek, V.; Čegan, R.; Vyskot, B.; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196 ISSN 0176-1617 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.557, year: 2014

  12. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  13. 113Cd-NMR investigation of a cadmium-substituted copper, zinc-containing superoxide dismutase from yeast

    DEFF Research Database (Denmark)

    Kofod, Pauli; Bauer, Rogert; Danielsen, Eva

    1991-01-01

    113Cd nuclear magnetic resonance spectroscopy has been used to investigate the metal binding sites of cadmium-substituted copper,zinc-containing superoxide dismutase from baker's yeast. NMR signals were obtained for 113Cd(II) at the Cu site as well as for 113Cd(II) at the Zn site. The two subunits...

  14. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  15. Diversity and role of plasmids in adaptation of bacteria inhabiting the Lubin copper mine in Poland, an environment rich in heavy metals

    Directory of Open Access Journals (Sweden)

    Lukasz eDziewit

    2015-03-01

    Full Text Available The Lubin underground mine, is one of three mining divisions in the Lubin-Glogow Copper District in Lower Silesia province (Poland. It is the source of polymetallic ore that is rich in copper, silver and several heavy metals. Black shale is also significantly enriched in fossil organic matter in the form of long-chain hydrocarbons, polycyclic aromatic hydrocarbons, organic acids, esters, thiophenes and metalloporphyrins. Biological analyses have revealed that this environment is inhabited by extremophilic bacteria and fungi. Kupfershiefer black shale and samples of water, bottom and mineral sediments from the underground (below 600 m Lubin mine were taken and twenty bacterial strains were isolated and characterized. All exhibited multi-resistant and hypertolerant phenotypes to heavy metals. We analyzed the plasmidome of these strains in order to evaluate the diversity and role of mobile DNA in adaptation to the harsh conditions of the mine environment. Experimental and bioinformatic analyses of 11 extrachromosomal replicons were performed. Three plasmids, including a broad-host-range replicon containing a Tn3 family transposon, carried genes conferring resistance to arsenic, cadmium, cobalt, mercury and zinc. Functional analysis revealed that the resistance modules exhibit host specificity, i.e. they may increase or decrease tolerance to toxic ions depending on the host strain. The other identified replicons showed diverse features. Among them we identified a catabolic plasmid encoding enzymes involved in the utilization of histidine and vanillate, a putative plasmid-like prophage carrying genes responsible for NAD biosynthesis, and two repABC-type plasmids containing virulence-associated genes. These findings provide an unique molecular insight into the pool of extrachromosomal replicons and highlight their role in the biology and adaptation of extremophilic bacteria inhabiting terrestrial deep subsurface.

  16. Isolation and characterization of the genes for two small RNAs of herpesvirus papio and their comparison with Epstein-Barr virus-encoded EBER RNAs.

    Science.gov (United States)

    Howe, J G; Shu, M D

    1988-08-01

    Genes for the Epstein-Barr virus-encoded RNAs (EBERs), two low-molecular-weight RNAs encoded by the human gammaherpesvirus Epstein-Barr virus (EBV), hybridize to two small RNAs in a baboon cell line that contains a similar virus, herpesvirus papio (HVP). The genes for the HVP RNAs (HVP-1 and HVP-2) are located together in the small unique region at the left end of the viral genome and are transcribed by RNA polymerase III in a rightward direction, similar to the EBERs. There is significant similarity between EBER1 and HVP-1 RNA, except for an insert of 22 nucleotides which increases the length of HVP-1 RNA to 190 nucleotides. There is less similarity between the sequences of EBER2 and HVP-2 RNA, but both have a length of about 170 nucleotides. The predicted secondary structure of each HVP RNA is remarkably similar to that of the respective EBER, implying that the secondary structures are important for function. Upstream from the initiation sites of all four RNA genes are several highly conserved sequences which may function in the regulation of transcription. The HVP RNAs, together with the EBERs, are highly abundant in transformed cells and are efficiently bound by the cellular La protein.

  17. “Pulling the plug” on cellular copper: The role of mitochondria in copper export

    OpenAIRE

    Leary, Scot C.; Winge, Dennis R.; Cobine, Paul A.

    2008-01-01

    Mitochondria contain two enzymes, Cu, Zn superoxide dismutase (Sod1) and cytochrome c oxidase (CcO), that require copper as a cofactor for their biological activity. The copper used for their metallation originates from a conserved, bioactive pool contained within the mitochondrial matrix, the size of which changes in response to either genetic or pharmacological manipulation of cellular copper status. Its dynamic nature implies molecular mechanisms exist that functionally couple mitochondria...

  18. The Arabidopsis SKU5 gene encodes an extracellular glycosyl phosphatidylinositol-anchored glycoprotein involved in directional root growth

    Science.gov (United States)

    Sedbrook, John C.; Carroll, Kathleen L.; Hung, Kai F.; Masson, Patrick H.; Somerville, Chris R.

    2002-01-01

    To investigate how roots respond to directional cues, we characterized a T-DNA-tagged Arabidopsis mutant named sku5 in which the roots skewed and looped away from the normal downward direction of growth on inclined agar surfaces. sku5 roots and etiolated hypocotyls were slightly shorter than normal and exhibited a counterclockwise (left-handed) axial rotation bias. The surface-dependent skewing phenotype disappeared when the roots penetrated the agar surface, but the axial rotation defect persisted, revealing that these two directional growth processes are separable. The SKU5 gene belongs to a 19-member gene family designated SKS (SKU5 Similar) that is related structurally to the multiple-copper oxidases ascorbate oxidase and laccase. However, the SKS proteins lack several of the conserved copper binding motifs characteristic of copper oxidases, and no enzymatic function could be assigned to the SKU5 protein. Analysis of plants expressing SKU5 reporter constructs and protein gel blot analysis showed that SKU5 was expressed most strongly in expanding tissues. SKU5 was glycosylated and modified by glycosyl phosphatidylinositol and localized to both the plasma membrane and the cell wall. Our observations suggest that SKU5 affects two directional growth processes, possibly by participating in cell wall expansion.

  19. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  20. The interplay between siderophore secretion and coupled iron and copper transport in the heterocyst-forming cyanobacterium Anabaena sp. PCC 7120.

    Science.gov (United States)

    Nicolaisen, Kerstin; Hahn, Alexander; Valdebenito, Marianne; Moslavac, Suncana; Samborski, Anastazia; Maldener, Iris; Wilken, Corinna; Valladares, Ana; Flores, Enrique; Hantke, Klaus; Schleiff, Enrico

    2010-11-01

    Iron uptake is essential for Gram-negative bacteria including cyanobacteria. In cyanobacteria, however, the iron demand is higher than in proteobacteria due to the function of iron as a cofactor in photosynthesis and nitrogen fixation, but our understanding of iron uptake by cyanobacteria stands behind the knowledge in proteobacteria. Here, two genes involved in this process in the heterocyst-forming cyanobacterium Anabaena sp. PCC 7120 were identified. ORF all4025 encodes SchE, a putative cytoplasmic membrane-localized transporter involved in TolC-dependent siderophore secretion. Inactivation of schE resulted in an enhanced sensitivity to high metal concentrations and decreased secretion of hydroxamate-type siderophores. ORF all4026 encodes a predicted outer membrane-localized TonB-dependent iron transporter, IacT. Inactivation of iacT resulted in decreased sensitivity to elevated iron and copper levels. Expression of iacT from the artificial trc promoter (P(trc)) resulted in sensitization against tested metals. Further analysis showed that iron and copper effects are synergistic because a decreased supply of iron induced a significant decrease of copper levels in the iacT insertion mutant but an increase of those levels in the strain carrying P(trc)-iacT. Our results unravel a link between iron and copper homeostasis in Anabaena sp. PCC 7120. Copyright © 2010 Elsevier B.V. All rights reserved.

  1. Trypanosoma cruzi has not lost its S-adenosylmethionine decarboxylase: characterization of the gene and the encoded enzyme.

    Science.gov (United States)

    Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O

    1998-01-01

    All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309

  2. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  3. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  4. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, Jiří; Nevrtalová, Eva; Kováčová, Viera; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196 ISSN 0176-1617 R&D Projects: GA ČR(CZ) GBP501/12/G090; GA MŠk LO1204 Institutional support: RVO:68081707 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: BO - Biophysics Impact factor: 2.557, year: 2014

  5. Thermal conductivity of glass copper-composite

    International Nuclear Information System (INIS)

    Kinoshita, Makoto; Terai, Ryohei; Haidai, Haruki

    1980-01-01

    Glass-metal composites are to be one of the answers for promoting thermal conduction in the glassy solids containing high-level radioactive wastes. In order to investigate the effect of metal addition on thermal conductivity of glasses, glass-copper composites were selected, and the conductivities of the composites were measured and discussed in regards to copper content and microstructure. Fully densified composites were successfully prepared by pressure sintering of the powder mixtures of glass and copper at temperatures above the yield points of the constituent glasses if the copper content was not so much. The conductivity was measured by means of a comparative method, in which the thermal gradient of the specimen was compared with that of quartz glass as standard under thermally steady state. Measurements were carried out at around 50 0 C. The thermal conductivity increased with increasing content of copper depending on the kind of copper powder used. The conductivities of the composites of the same copper content differed considerably each another. Fine copper powder was effective on increasing conductivity, and the conductivity became about threefold of that of glass by mixing the fine copper powder about 10 vol%. For the composites containing the fine copper powder less than 5 vol%, the conductivity obeyed so-called logarithmic rule, one of the mixture rules of conductivity, whereas for composites containing more than 5 vol%, the conductivity remarkably increased apart from the rule. This fact suggests that copper becomes continuous in the composite when the copper content increased beyond 5 vol%. For the composites containing coarse copper powder, the conductivity was increased not significantly, and obeyed an equation derived from the model in which conductive material dispersed in less conductive one. (author)

  6. Normal-tissue radioprotection by overexpression of the copper-zinc and manganese superoxide dismutase genes

    Energy Technology Data Exchange (ETDEWEB)

    Veldwijk, Marlon R. [Dept. of Radiation Oncology, Univ. Medical Center Mannheim, Univ. of Heidelberg, Mannheim (Germany); Pharmacology of Cancer Treatment (G402), German Cancer Research Center, Heidelberg (Germany); Herskind, Carsten; Wenz, Frederik [Dept. of Radiation Oncology, Univ. Medical Center Mannheim, Univ. of Heidelberg, Mannheim (Germany); Sellner, Leopold; Zeller, W. Jens [Pharmacology of Cancer Treatment (G402), German Cancer Research Center, Heidelberg (Germany); Radujkovic, Aleksandar [Dept. of Internal Medicine V, Univ. of Heidelberg (Germany); Laufs, Stephanie [Dept. of Experimental Surgery, Univ. Medical Center Mannheim, Univ. of Heidelberg, Mannheim (Germany); Molecular Oncology of Solid Tumors (G360), German Cancer Research Center, Heidelberg (Germany); Fruehauf, Stefan [Center for Tumor Diagnostic and Therapy, Paracelsus-Klinik, Osnabrueck (Germany)

    2009-08-15

    Background and Purpose: Protection of normal tissue against radiation-induced damage may increase the therapeutic ratio of radiotherapy. A promising strategy for testing this approach is gene therapy-mediated overexpression of the copper-zinc (CuZnSOD) or manganese superoxide dismutase (MnSOD) using recombinant adeno-associated viral (rAAV2) vectors. The purpose of this study was to test the modulating effects of the SOD genes on human primary lung fibroblasts (HPLF) after irradiation. Material and Methods: HPLF were transduced with rAAV2 vectors containing cDNA for the CuZnSOD, MnSOD or a control gene. The cells were irradiated (1-6 Gy), and gene transfer efficiency, apoptosis, protein expression/activity, and radiosensitivity measured by the colony-forming assay determined. Results: After transduction, 90.0% {+-} 6.4% of the cells expressed the transgene. A significant fivefold overexpression of both SOD was confirmed by an SOD activity assay (control: 21.1 {+-} 12.6, CuZnSOD: 95.1 {+-} 17.1, MnSOD: 108.5 {+-} 36.0 U SOD/mg protein) and immunohistochemistry. CuZnSOD and MnSOD overexpression resulted in a significant radioprotection of HPLF compared to controls (surviving fraction [SF] ratio SOD/control > 1): CuZnSOD: 1.18-fold (95% confidence interval [CI]: 1.06-1.32; p = 0.005), MnSOD: 1.23-fold (95% CI: 1.07-1.43; p = 0.01). Conclusion: Overexpression of CuZnSOD and MnSOD in HPLF mediated an increase in clonogenic survival after irradiation compared to controls. In previous works, a lack of radioprotection in SOD-overexpressing tumor cells was observed. Therefore, the present results suggest that rAAV2 vectors are promising tools for the delivery of radioprotective genes in normal tissue. (orig.)

  7. Expression analysis of two gene subfamilies encoding the plasma membrane H+-ATPase in Nicotiana plumbaginifolia reveals the major transport functions of this enzyme.

    Science.gov (United States)

    Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M

    1999-07-01

    The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.

  8. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  9. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  10. Copper Deficiency Leads to Anemia, Duodenal Hypoxia, Upregulation of HIF-2α and Altered Expression of Iron Absorption Genes in Mice

    Science.gov (United States)

    Matak, Pavle; Zumerle, Sara; Mastrogiannaki, Maria; El Balkhi, Souleiman; Delga, Stephanie; Mathieu, Jacques R. R.; Canonne-Hergaux, François; Poupon, Joel; Sharp, Paul A.; Vaulont, Sophie; Peyssonnaux, Carole

    2013-01-01

    Iron and copper are essential trace metals, actively absorbed from the proximal gut in a regulated fashion. Depletion of either metal can lead to anemia. In the gut, copper deficiency can affect iron absorption through modulating the activity of hephaestin - a multi-copper oxidase required for optimal iron export from enterocytes. How systemic copper status regulates iron absorption is unknown. Mice were subjected to a nutritional copper deficiency-induced anemia regime from birth and injected with copper sulphate intraperitoneally to correct the anemia. Copper deficiency resulted in anemia, increased duodenal hypoxia and Hypoxia inducible factor 2α (HIF-2α) levels, a regulator of iron absorption. HIF-2α upregulation in copper deficiency appeared to be independent of duodenal iron or copper levels and correlated with the expression of iron transporters (Ferroportin - Fpn, Divalent Metal transporter – Dmt1) and ferric reductase – Dcytb. Alleviation of copper-dependent anemia with intraperitoneal copper injection resulted in down regulation of HIF-2α-regulated iron absorption genes in the gut. Our work identifies HIF-2α as an important regulator of iron transport machinery in copper deficiency. PMID:23555700

  11. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  12. Exome sequencing identifies variants in two genes encoding the LIM-proteins NRAP and FHL1 in an Italian patient with BAG3 myofibrillar myopathy.

    Science.gov (United States)

    D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan

    2016-06-01

    Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.

  13. Effect of chloride ions on the corrosion behavior of low-alloy steel containing copper and antimony in sulfuric acid solution

    Science.gov (United States)

    Park, Sun-Ah; Kim, Seon-Hong; Yoo, Yun-Ha; Kim, Jung-Gu

    2015-05-01

    The influence of the addition of HCl on the corrosion behavior of low-alloy steel containing copper and antimony was investigated using electrochemical (potentiodynamic and potentiostatic polarization tests, and electrochemical impedance spectroscopy) and weight loss tests in a 1.6M H2SO4 solution with different concentrations of hydrochloric acid (0.00, 0.08, 0.15 and 0.20 M HCl) at 60 °C. The result showed that the corrosion rate decreased with increasing HCl by the formation of protective layers. SEM, EDS and XPS examinations of the corroded surfaces after the immersion test indicated that the corrosion production layer formed in the solution containing HCl was highly comprised of metallic Cu, Cu chloride and metallic (Fe, Cu, Sb) compounds. The corrosion resistance was improved by the Cu-enriched layer, in which chloride ions are an accelerator for cupric ion reduction during copper deposition. Furthermore, cuprous and antimonious chloride species are complex salts for cuprous ions adsorbed on the surface during copper deposition.

  14. Surface characteristics, copper release, and toxicity of nano- and micrometer-sized copper and copper(II) oxide particles: a cross-disciplinary study.

    OpenAIRE

    Midander, Klara; Cronholm, Pontus; Karlsson, Hanna L.; Elihn, Karine; Moller, Lennart; Leygraf, Christofer; Wallinder, Inger Odnevall

    2009-01-01

    An interdisciplinary and multianalytical research effort is undertaken to assess the toxic aspects of thoroughly characterized nano- and micrometer-sized particles of oxidized metallic copper and copper(II) oxide in contact with cultivated lung cells, as well as copper release in relevant media. All particles, except micrometer-sized Cu, release more copper in serum-containing cell medium (supplemented Dulbecco's minimal essential medium) compared to identical exposures in phosphate-buffered ...

  15. The copper-transporting ATPase pump and its potential role in copper-tolerance

    Science.gov (United States)

    Katie Ohno; C.A. Clausen; Frederick Green; G. Stanosz

    2016-01-01

    Copper-tolerant brown-rot decay fungi exploit intricate mechanisms to neutralize the efficacy of copper-containing preservative formulations. The production and accumulation oxalate is the most widely recognized theory regarding the mechanism of copper-tolerance in these fungi. The role of oxalate, however, may be only one part of a series of necessary components...

  16. Medicago truncatula copper transporter 1 (MtCOPT1) delivers copper for symbiotic nitrogen fixation.

    Science.gov (United States)

    Senovilla, Marta; Castro-Rodríguez, Rosario; Abreu, Isidro; Escudero, Viviana; Kryvoruchko, Igor; Udvardi, Michael K; Imperial, Juan; González-Guerrero, Manuel

    2018-04-01

    Copper is an essential nutrient for symbiotic nitrogen fixation. This element is delivered by the host plant to the nodule, where membrane copper (Cu) transporter would introduce it into the cell to synthesize cupro-proteins. COPT family members in the model legume Medicago truncatula were identified and their expression determined. Yeast complementation assays, confocal microscopy and phenotypical characterization of a Tnt1 insertional mutant line were carried out in the nodule-specific M. truncatula COPT family member. Medicago truncatula genome encodes eight COPT transporters. MtCOPT1 (Medtr4g019870) is the only nodule-specific COPT gene. It is located in the plasma membrane of the differentiation, interzone and early fixation zones. Loss of MtCOPT1 function results in a Cu-mitigated reduction of biomass production when the plant obtains its nitrogen exclusively from symbiotic nitrogen fixation. Mutation of MtCOPT1 results in diminished nitrogenase activity in nodules, likely an indirect effect from the loss of a Cu-dependent function, such as cytochrome oxidase activity in copt1-1 bacteroids. These data are consistent with a model in which MtCOPT1 transports Cu from the apoplast into nodule cells to provide Cu for essential metabolic processes associated with symbiotic nitrogen fixation. © 2018 The Authors. New Phytologist © 2018 New Phytologist Trust.

  17. Analysis of Saprolegnia parasitica Transcriptome following Treatment with Copper Sulfate.

    Directory of Open Access Journals (Sweden)

    Kun Hu

    Full Text Available Massive infection caused by oomycete fungus Saprolegnia parasitica is detrimental to freshwater fish. Recently, we showed that copper sulfate demonstrated good efficacy for controlling S. parasitica infection in grass carp. In this study, we investigated the mechanism of inhibition of S. parasitica growth by copper sulfate by analyzing the transcriptome of copper sulfate-treated S. parasitica. To examine the mechanism of copper sulfate inhibiting S. parasitica, we utilized RNA-seq technology to compare differential gene expression in S. parasitica treated with or without copper sulfate.The total mapped rates of the reads with the reference genome were 90.50% in the control group and 73.50% in the experimental group. In the control group, annotated splice junctions, partial novel splice junctions and complete novel splice junctions were about 83%, 3% and 14%, respectively. In the treatment group, the corresponding values were about 75%, 6% and 19%. Following copper sulfate treatment, a total 310 genes were markedly upregulated and 556 genes were markedly downregulated in S. parasitica. Material metabolism related GO terms including cofactor binding (33 genes, 1,3-beta-D-glucan synthase complex (4 genes, carboxylic acid metabolic process (40 genes were the most significantly enriched. KEGG pathway analysis also determined that the metabolism-related biological pathways were significantly enriched, including the metabolic pathways (98 genes, biosynthesis of secondary metabolites pathways (42 genes, fatty acid metabolism (13 genes, phenylalanine metabolism (7 genes, starch and sucrose metabolism pathway (12 genes. The qRT-PCR results were largely consistent with the RNA-Seq results.Our results indicate that copper sulfate inhibits S. parasitica growth by affecting multiple biological functions, including protein synthesis, energy biogenesis, and metabolism.

  18. Copper electrodeposition from an acidic plating bath containing accelerating and inhibiting organic additives

    International Nuclear Information System (INIS)

    Pasquale, M.A.; Gassa, L.M.; Arvia, A.J.

    2008-01-01

    Copper electrodeposition on copper from still plating solutions of different compositions was investigated utilising electrochemical impedance spectroscopy (EIS), cyclic voltammetry, and scanning electron microscopy (SEM). An acid copper sulphate plating base solution was employed either with or without sodium chloride in the presence of a single additive, either polyethylene glycol (PEG) or 3-mercapto-2-propanesulphonic acid (MPSA), and their mixture. Thallium underpotential deposition/anodic stripping was employed to determine the adsorption capability of additives on copper. In the absence of chloride ions, MPSA shows a moderate adsorption on copper, whereas PEG is slightly adsorbed. At low cathodic overpotentials, the simultaneous presence of MPSA and chloride ions accelerates copper electrodeposition through the formation of an MPSA-chloride ion complex in the solution, particularly for about 220 μM sodium chloride. The reverse effect occurs in PEG-sodium chloride plating solutions. In this case, from EIS data the formation of a film that interferes with copper electrodeposition can be inferred. At higher cathodic overpotentials, when copper electrodeposition is under mass transport control, the cathode coverage by a PEG-copper chloride-mediated film becomes either partially or completely detached as the concentration of chloride ions at the negatively charged copper surface diminishes. The copper cathode grain topography at the μm scale depends on the cathodic overpotential, plating solution composition and average current density. Available data about the solution constituents and their adsorption on copper make it possible to propose a likely complex mechanism to understand copper electrodeposition from these media, including the accelerating effect of MPSA and the dynamics of PEG-copper chloride complex adsorbate interfering with the surface mobility of depositing copper ad-ions/ad-atoms

  19. Electroforming copper targets for RTNS-II

    International Nuclear Information System (INIS)

    Kelley, W.K.; Dini, J.W.; Logan, C.M.

    1981-01-01

    Copper targets used in RTNS II, which is the world's most intense 14-MeV neutron source, contain water cooling channels for temperature control. There are two methods for fabricating these targets: (1) diffusion bonding a copper panel containing photoetched channels to another copper panel, and (2) an electroforming technique which involves filling the photoetched channels with wax, plating thick copper to seal over the channels and then removing the wax. Development of this latter process and results obtained with it are described

  20. Exosomes released in vitro from Epstein-Barr virus (EBV)-infected cells contain EBV-encoded latent phase mRNAs.

    Science.gov (United States)

    Canitano, Andrea; Venturi, Giulietta; Borghi, Martina; Ammendolia, Maria Grazia; Fais, Stefano

    2013-09-01

    EBV is a human herpesvirus associated with a number of malignancies. Both lymphoblastoid cell lines (LCLs), and EBV-infected nasopharyngeal carcinoma (NPC) cells have been demonstrated to release exosomes containing the EBV-encoded latent membrane protein 1 (LMP1), and mature micro-RNAs (EBV-miRNAs). Here we analyze the EBV protein and nucleic acid content of exosomes from different EBV-infected cells (LCL, 721 and Daudi) and we show for the first time that exosomes released from LCLs and 721 also contain EBV-encoded latent phase mRNAs. This confirms and strengthens exosomes pathogenetic potential, and might provide insights for development of novel diagnostic and therapeutic strategies. Copyright © 2013 Elsevier Ireland Ltd. All rights reserved.

  1. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  2. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  3. Using an Inducible Promoter of a Gene Encoding Penicillium verruculosum Glucoamylase for Production of Enzyme Preparations with Enhanced Cellulase Performance.

    Directory of Open Access Journals (Sweden)

    Alexander G Bulakhov

    Full Text Available Penicillium verruculosum is an efficient producer of highly active cellulase multienzyme system. One of the approaches for enhancing cellulase performance in hydrolysis of cellulosic substrates is to enrich the reaction system with β -glucosidase and/or accessory enzymes, such as lytic polysaccharide monooxygenases (LPMO displaying a synergism with cellulases.Genes bglI, encoding β-glucosidase from Aspergillus niger (AnBGL, and eglIV, encoding LPMO (formerly endoglucanase IV from Trichoderma reesei (TrLPMO, were cloned and expressed by P. verruculosum B1-537 strain under the control of the inducible gla1 gene promoter. Content of the heterologous AnBGL in the secreted multienzyme cocktails (hBGL1, hBGL2 and hBGL3 varied from 4 to 10% of the total protein, while the content of TrLPMO in the hLPMO sample was ~3%. The glucose yields in 48-h hydrolysis of Avicel and milled aspen wood by the hBGL1, hBGL2 and hBGL3 preparations increased by up to 99 and 80%, respectively, relative to control enzyme preparations without the heterologous AnBGL (at protein loading 5 mg/g substrate for all enzyme samples. The heterologous TrLPMO in the hLPMO preparation boosted the conversion of the lignocellulosic substrate by 10-43%; however, in hydrolysis of Avicel the hLPMO sample was less effective than the control preparations. The highest product yield in hydrolysis of aspen wood was obtained when the hBGL2 and hLPMO preparations were used at the ratio 1:1.The enzyme preparations produced by recombinant P. verruculosum strains, expressing the heterologous AnBGL or TrLPMO under the control of the gla1 gene promoter in a starch-containing medium, proved to be more effective in hydrolysis of a lignocellulosic substrate than control enzyme preparations without the heterologous enzymes. The enzyme composition containing both AnBGL and TrLPMO demonstrated the highest performance in lignocellulose hydrolysis, providing a background for developing a fungal strain capable

  4. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  5. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Science.gov (United States)

    Sahoo, Dipak K; Abeysekara, Nilwala S; Cianzio, Silvia R; Robertson, Alison E; Bhattacharyya, Madan K

    2017-01-01

    Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs) (F7 families) were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR)-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  6. A Novel Phytophthora sojae Resistance Rps12 Gene Mapped to a Genomic Region That Contains Several Rps Genes.

    Directory of Open Access Journals (Sweden)

    Dipak K Sahoo

    Full Text Available Phytophthora sojae Kaufmann and Gerdemann, which causes Phytophthora root rot, is a widespread pathogen that limits soybean production worldwide. Development of Phytophthora resistant cultivars carrying Phytophthora resistance Rps genes is a cost-effective approach in controlling this disease. For this mapping study of a novel Rps gene, 290 recombinant inbred lines (RILs (F7 families were developed by crossing the P. sojae resistant cultivar PI399036 with the P. sojae susceptible AR2 line, and were phenotyped for responses to a mixture of three P. sojae isolates that overcome most of the known Rps genes. Of these 290 RILs, 130 were homozygous resistant, 12 heterzygous and segregating for Phytophthora resistance, and 148 were recessive homozygous and susceptible. From this population, 59 RILs homozygous for Phytophthora sojae resistance and 61 susceptible to a mixture of P. sojae isolates R17 and Val12-11 or P7074 that overcome resistance encoded by known Rps genes mapped to Chromosome 18 were selected for mapping novel Rps gene. A single gene accounted for the 1:1 segregation of resistance and susceptibility among the RILs. The gene encoding the Phytophthora resistance mapped to a 5.8 cM interval between the SSR markers BARCSOYSSR_18_1840 and Sat_064 located in the lower arm of Chromosome 18. The gene is mapped 2.2 cM proximal to the NBSRps4/6-like sequence that was reported to co-segregate with the Phytophthora resistance genes Rps4 and Rps6. The gene is mapped to a highly recombinogenic, gene-rich genomic region carrying several nucleotide binding site-leucine rich repeat (NBS-LRR-like genes. We named this novel gene as Rps12, which is expected to be an invaluable resource in breeding soybeans for Phytophthora resistance.

  7. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  8. Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.

    Science.gov (United States)

    Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya

    2009-06-01

    A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.

  9. Molecular cloning, expression, and functional analysis of the copper amine oxidase gene in the endophytic fungus Shiraia sp. Slf14 from Huperzia serrata.

    Science.gov (United States)

    Yang, Huilin; Peng, Silu; Zhang, Zhibin; Yan, Riming; Wang, Ya; Zhan, Jixun; Zhu, Du

    2016-12-01

    Huperzine A (HupA) is a drug used for the treatment of Alzheimer's disease. However, the biosynthesis of this medicinally important compound is not well understood. The HupA biosynthetic pathway is thought to be initiated by the decarboxylation of lysine to form cadaverine, which is then converted to 5-aminopentanal by copper amine oxidase (CAO). In this study, we cloned and expressed an SsCAO gene from a HupA-producing endophytic fungus, Shiraia sp. Slf14. Analysis of the deduced protein amino acid sequence showed that it contained the Asp catalytic base, conserved motif Asn-Tyr-Asp/Glu, and three copper-binding histidines. The cDNA of SsCAO was amplified and expressed in Escherichia coli BL21(DE3), from which a 76 kDa protein was obtained. The activity of this enzyme was tested, which provided more information about the SsCAO gene in the endophytic fungus. Gas Chromatograph-Mass Spectrometry (GC-MS) revealed that this SsCAO could accept cadaverine as a substrate to produce 5-aminopentanal, the precursor of HupA. Phylogenetic tree analysis indicated that the SsCAO from Shiraia sp. Slf14 was closely related to Stemphylium lycopersici CAO. This is the first report on the cloning and expression of a CAO gene from HupA-producing endophytic fungi. Functional characterization of this enzyme provides new insights into the biosynthesis of the HupA an anti-Alzheimer's drug. Copyright © 2016 Elsevier Inc. All rights reserved.

  10. Characterization of cDNAs encoding human leukosialin and localization of the leukosialin gene to chromosome 16

    International Nuclear Information System (INIS)

    Pallant, A.; Eskenazi, A.; Frelinger, J.G.; Mattei, M.G.; Fournier, R.E.K.; Carlsson, S.R.; Fukuda, M.

    1989-01-01

    The authors describe the isolation and characterization of cDNA clones encoding human leukosialin, a major sialoglycoprotein of human leukocytes. Leukosialin is very closely related or identical to the sialophorin molecule, which is involved in T-cell proliferation and whose expression is altered in Wiskott-Aldrich syndrome (WAS), an X-chromosome-linked immunodeficiency disease. Using a rabbit antiserum to leukosialin, a cDNA clone was isolated from a λgt11 cDNA library constructed from human peripheral blood cells. The λgt11 clone was used to isolate longer cDNA clones that correspond to the entire coding sequence of leukosialin. DNA sequence analysis reveals three domains in the predicted mature protein. The extracellular domain is enriched for Ser, Thr, and Pro and contains four contiguous 18-amino acid repeats. The transmembrane and intracellular domains of the human leukosialin molecule are highly homologous to the rat W3/13 molecule. RNA gel blot analysis reveals two polyadenylylated species of 2.3 and 8 kilobases. Southern blot analysis suggests that human leukosialin is a single-copy gene. Analysis of monochromosomal cell hybrids indicates that the leukosialin gene is not X chromosome linked and in situ hybridization shows leukosialin is located on chromosome 16. These findings demonstrate that the primary mutation in WAS is not a defect in the structural gene for leukosialin

  11. Speciation and leachability of copper in mine tailings from porphyry copper mining: influence of particle size.

    Science.gov (United States)

    Hansen, Henrik K; Yianatos, Juan B; Ottosen, Lisbeth M

    2005-09-01

    Mine tailing from the El Teniente-Codelco copper mine situated in VI Region of Chile was analysed in order to evaluate the mobility and speciation of copper in the solid material. Mine tailing was sampled after the rougher flotation circuits, and the copper content was measured to 1150 mg kg (-1) dry matter. This tailing was segmented into fractions of different size intervals: 0-38, 38-45, 45-53, 53-75, 75-106, 106-150, 150-212, and >212 microm, respectively. Copper content determination, sequential chemical extraction, and desorption experiments were carried out for each size interval in order to evaluate the speciation of copper. It was found that the particles of smallest size contained 50-60% weak acid leachable copper, whereas only 32% of the copper found in largest particles could be leached in weak acid. Copper oxides and carbonates were the dominating species in the smaller particles, and the larger particles contained considerable amounts of sulphides.

  12. Putative recombination events and evolutionary history of five economically important viruses of fruit trees based on coat protein-encoding gene sequence analysis.

    Science.gov (United States)

    Boulila, Moncef

    2010-06-01

    To enhance the knowledge of recombination as an evolutionary process, 267 accessions retrieved from GenBank were investigated, all belonging to five economically important viruses infecting fruit crops (Plum pox, Apple chlorotic leaf spot, Apple mosaic, Prune dwarf, and Prunus necrotic ringspot viruses). Putative recombinational events were detected in the coat protein (CP)-encoding gene using RECCO and RDP version 3.31beta algorithms. Based on RECCO results, all five viruses were shown to contain potential recombination signals in the CP gene. Reconstructed trees with modified topologies were proposed. Furthermore, RECCO performed better than the RDP package in detecting recombination events and exhibiting their evolution rate along the sequences of the five viruses. RDP, however, provided the possible major and minor parents of the recombinants. Thus, the two methods should be considered complementary.

  13. Exogenous addition of histidine reduces copper availability in the yeast Saccharomyces cerevisiae

    Directory of Open Access Journals (Sweden)

    Daisuke Watanabe

    2014-07-01

    Full Text Available The basic amino acid histidine inhibited yeast cell growth more severely than lysine and arginine. Overexpression of CTR1, which encodes a high-affinity copper transporter on the plasma membrane, or addition of copper to the medium alleviated this cytotoxicity. However, the intracellular level of copper ions was not decreased in the presence of excess histidine. These results indicate that histidine cytotoxicity is associated with low copper availability inside cells, not with impaired copper uptake. Furthermore, histidine did not affect cell growth under limited respiration conditions, suggesting that histidine cytotoxicity is involved in deficiency of mitochondrial copper.

  14. Exogenous addition of histidine reduces copper availability in the yeast Saccharomyces cerevisiae.

    Science.gov (United States)

    Watanabe, Daisuke; Kikushima, Rie; Aitoku, Miho; Nishimura, Akira; Ohtsu, Iwao; Nasuno, Ryo; Takagi, Hiroshi

    2014-07-07

    The basic amino acid histidine inhibited yeast cell growth more severely than lysine and arginine. Overexpression of CTR1 , which encodes a high-affinity copper transporter on the plasma membrane, or addition of copper to the medium alleviated this cytotoxicity. However, the intracellular level of copper ions was not decreased in the presence of excess histidine. These results indicate that histidine cytotoxicity is associated with low copper availability inside cells, not with impaired copper uptake. Furthermore, histidine did not affect cell growth under limited respiration conditions, suggesting that histidine cytotoxicity is involved in deficiency of mitochondrial copper.

  15. Fingerprinting and diversity of bacterial copA genes in response to soil types, soil organic status and copper contamination.

    Science.gov (United States)

    Lejon, David P H; Nowak, Virginie; Bouko, Sabrina; Pascault, Noémie; Mougel, Christophe; Martins, Jean M F; Ranjard, Lionel

    2007-09-01

    A molecular fingerprinting assay was developed to assess the diversity of copA genes, one of the genetic determinants involved in bacterial resistance to copper. Consensus primers of the copA genes were deduced from an alignment of sequences from proteobacterial strains. A PCR detection procedure was optimized for bacterial strains and allowed the description of a novel copA genetic determinant in Pseudomonas fluorescens. The copA DNA fingerprinting procedure was optimized for DNA directly extracted from soils differing in their physico-chemical characteristics and in their organic status (SOS). Particular copA genetic structures were obtained for each studied soil and a coinertia analysis with soil physico-chemical characteristics revealed the strong influence of pH, soil texture and the quality of soil organic matter. The molecular phylogeny of copA gene confirmed that specific copA genes clusters are specific for each SOS. Furthermore, this study demonstrates that this approach was sensitive to short-term responses of copA gene diversity to copper additions to soil samples, suggesting that community adaptation is preferentially controlled by the diversity of the innate copA genes rather than by the bioavailability of the metal.

  16. Native copper as a natural analogue for copper canisters

    International Nuclear Information System (INIS)

    Marcos, N.

    1989-12-01

    This paper discusses the occurrence of native copper as found in geological formations as a stability analogue of copper canisters that are planned to be used for the disposal of spent nuclear fuel in the Finnish bedrock. A summary of several publications on native copper occurrences is presented. The present geochemical and geohydrological conditions in which copper is met with in its metallic state show that metallic copper is stable in a wide range of temperatures. At low temperatures native copper is found to be stable where groundwater has moderate pH (about 7), low Eh (< +100 mV), and low total dissolved solids, especially chloride. Microscopical and microanalytical studies were carried out on a dozen of rock samples containing native copper. The results reveal that the metal shows no significant alteration. Only the surface of copper grains is locally coated. In the oldest samples there exist small corrosion cracks; the age of the oldest samples is over 1,000 million years. A review of several Finnish groundwater studies suggests that there are places in Finland where the geohydrological conditions are favourable for native copper stability. (orig.)

  17. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  18. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  19. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  20. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  1. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  2. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  3. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  4. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  5. Use of copper radioisotopes in investigating disorders of copper metabolism

    International Nuclear Information System (INIS)

    Camakaris, J.; Voskoboinik, I.; Brooks, H.; Greenough, M.; Smith, S.; Mercer, J.

    1998-01-01

    Full text: Copper is an essential trace element for life as a number of vital enzymes require it. Copper deficiency can lead to neurological disorders, osteoporosis and weakening of arteries. However Cu is also highly toxic and homeostatic mechanisms have evolved to maintain Cu at levels which satisfy requirements but do not cause toxicity. Toxicity is mediated by the oxidative capacity of Cu and its ability to generate toxic free radicals. There are several acquired and inherited diseases due to either Cu toxicity or Cu deficiency. The study of these diseases facilitates identification of genes and proteins involved in copper homeostasis, and this in turn will provide rational therapeutic approaches. Our studies have focused on Menkes disease in humans which is an inherited and usually lethal copper deficiency. Using copper radioisotopes 64 Cu (t 1/2 = 12.8 hr) and 67 Cu (t 1/2 = 61 hr) we have studied the protein which is mutated in Menkes disease. This is a transmembrane copper pump which is responsible for absorption of copper into the body and also functions to pump out excess Cu from cells when Cu is elevated. It is therefore a vital component of normal Cu homeostasis. We have provided the first biochemical evidence that the Menkes protein functions as a P-type ATPase Cu pump (Voskoboinik et al., FEBS Letters, in press) and these data will be discussed. The assay involved pumping of radiocopper into purified membrane vesicles. Furthermore we have transfected normal and mutant Menkes genes into cells and are carrying out structure-function studies. We are also studying the role of amyloid precursor protein (APP) as a Cu transport protein in order to determine how Cu regulates this protein and its cleavage products. These studies will provide vital information on the relationship between Cu and APP and processes which lead to Alzheimers disease

  6. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  7. Aquatic Life Criteria - Copper

    Science.gov (United States)

    Documents pertain to Aquatic Life Ambient Water Quality criteria for Copper (2007 Freshwater, 2016 Estuarine/marine). These documents contain the safe levels of Copper in water that should protect to the majority of species.

  8. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  9. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  10. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  11. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  12. Survey of the rubber tree genome reveals a high number of cysteine protease-encoding genes homologous to Arabidopsis SAG12.

    Science.gov (United States)

    Zou, Zhi; Liu, Jianting; Yang, Lifu; Xie, Guishui

    2017-01-01

    Arabidopsis thaliana SAG12, a senescence-specific gene encoding a cysteine protease, is widely used as a molecular marker for the study of leaf senescence. To date, its potential orthologues have been isolated from several plant species such as Brassica napus and Nicotiana tabacum. However, little information is available in rubber tree (Hevea brasiliensis), a rubber-producing plant of the Euphorbiaceae family. This study presents the identification of SAG12-like genes from the rubber tree genome. Results showed that an unexpected high number of 17 rubber orthologues with a single intron were found, contrasting the single copy with two introns in Arabidopsis. The gene expansion was also observed in another two Euphorbiaceae plants, castor bean (Ricinus communis) and physic nut (Jatropha curcas), both of which contain 8 orthologues. In accordance with no occurrence of recent whole-genome duplication (WGD) events, most duplicates in castor and physic nut were resulted from tandem duplications. In contrast, the duplicated HbSAG12H genes were derived from tandem duplications as well as the recent WGD. Expression analysis showed that most HbSAG12H genes were lowly expressed in examined tissues except for root and male flower. Furthermore, HbSAG12H1 exhibits a strictly senescence-associated expression pattern in rubber tree leaves, and thus can be used as a marker gene for the study of senescence mechanism in Hevea.

  13. Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

    Science.gov (United States)

    Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

    2005-01-01

    Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

  14. Effects of Copper on Hemocyte Apoptosis, ROS Production, and Gene Expression in White Shrimp Litopenaeus vannamei.

    Science.gov (United States)

    Guo, Hui; Li, Kexu; Wang, Wei; Wang, Chenggui; Shen, Yuchun

    2017-10-01

    Copper, a common chemical contaminant in aquatic environment, is known to be toxic to aquatic life at high concentrations. In the present study, we evaluated the apoptotic cell ratio and ROS production in hemocytes of the white shrimp Litopenaeus vannamei exposed to 1 or 5 mg L -1 Cu for 0, 3, 6, 12, 24, and 48 h. The expression changes of antioxidant biomarker genes, i.e., copper-zinc superoxide dismutase (Cu-Zn SOD) and catalase (CAT), apoptosis-related genes, i.e., caspase-3 and inhibitor of apoptosis protein (IAP), and a specific biomarker gene of heavy metal pollution, i.e., metallothionein (MT), were also determined in hemocytes. Significant increases in ROS production were observed in both treatment groups at each time points. The apoptotic cell ratios were significantly increased at 6-48 h among shrimp exposed to 1 mg L -1 Cu and at each time points in 5 mg L -1 Cu group. These results indicated that Cu would induce oxidative stress and apoptosis in the hemocyte of L. vannamei. Quantitative real-time PCR analysis revealed that the relative expression levels of Cu-Zn SOD, CAT, caspase-3, IAP, and MT were upregulated in a dose-dependent and time-dependent manner, suggesting the involvement of these genes in stress response against Cu exposure.

  15. Divergent regulation of Arabidopsis SAUR genes

    NARCIS (Netherlands)

    Mourik, van Hilda; Dijk, van Aalt D.J.; Stortenbeker, Niek; Angenent, Gerco C.; Bemer, Marian

    2017-01-01

    Background: Small Auxin-Upregulated RNA (SAUR) genes encode growth regulators that induce cell elongation. Arabidopsis contains more than 70 SAUR genes, of which the growth-promoting function has been unveiled in seedlings, while their role in other tissues remained largely unknown. Here, we

  16. Molecular cloning and characterization of a novel salt-inducible gene encoding an acidic isoform of PR-5 protein in soybean (Glycine max [L.] Merr.).

    Science.gov (United States)

    Onishi, M; Tachi, H; Kojima, T; Shiraiwa, M; Takahara, H

    2006-10-01

    We identified a novel salt-inducible soybean gene encoding an acidic-isoform of pathogenesis-related protein group 5 (PR-5 protein). The soybean PR-5-homologous gene, designated as Glycine max osmotin-like protein, acidic isoform (GmOLPa)), encodes a putative polypeptide having an N-terminal signal peptide. The mature GmOLPa protein without the signal peptide has a calculated molecular mass of 21.5 kDa and a pI value of 4.4, and was distinguishable from a known PR-5-homologous gene of soybean (namely P21 protein) through examination of the structural features. A comparison with two intracellular salt-inducible PR-5 proteins, tobacco osmotin and tomato NP24, revealed that GmOLPa did not have a C-terminal extension sequence functioning as a vacuole-targeting motif. The GmOLPa gene was transcribed constitutively in the soybean root and was induced almost exclusively in the root during 24 h of high-salt stress (300 mM NaCl). Interestingly, GmOLPa gene expression in the stem and leaf, not observed until 24 h, was markedly induced at 48 and 72 h after commencement of the high-salt stress. Abscisic acid (ABA) and dehydration also induced expression of the GmOLPa gene in the root; additionally, dehydration slightly induced expression in the stem and leaf. In fact, the 5'-upstream sequence of the GmOLPa gene contained several putative cis-elements known to be involved in responsiveness to ABA and dehydration, e.g. ABA-responsive element (ABRE), MYB/MYC, and low temperature-responsive element (LTRE). These results suggested that GmOLPa may function as a protective PR-5 protein in the extracellular space of the soybean root in response to high-salt stress and dehydration.

  17. Different patterns of gene expression in rice varieties undergoing a ...

    African Journals Online (AJOL)

    Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...

  18. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  19. Cavity size and copper root pruning affect production and establishment of container-grown longleaf pine seedlings

    Science.gov (United States)

    Marry Anne Sword Sayer; James D. Haywood; Shi-Jean Susana Sung

    2009-01-01

    With six container types, we tested the effects of cavity size (i.e., 60, 93, and 170 ml) and copper root pruning on the root system development of longleaf pine (Pinus palustris Mill.) seedlings grown in a greenhouse. We then evaluated root egress during a root growth potential test and assessed seedling morphology and root system development 1 year after planting in...

  20. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  1. Speciation and leachability of copper in mine tailings from porphyry copper mining

    DEFF Research Database (Denmark)

    Hansen, Henrik K.; Yianatos, Juan B; Ottosen, Lisbeth M.

    2005-01-01

    Mine tailing from the El Teniente-Codelco copper mine situated in VI Region of Chile was analysed in order to evaluate the mobility and speciation of copper in the solid material. Mine tailing was sampled after the rougher flotation circuits, and the copper content was measured to 1150mgkg^-^1 dry...... matter. This tailing was segmented into fractions of different size intervals: 0-38, 38-45, 45-53, 53-75, 75-106, 106-150, 150-212, and >212@mm, respectively. Copper content determination, sequential chemical extraction, and desorption experiments were carried out for each size interval in order...... to evaluate the speciation of copper. It was found that the particles of smallest size contained 50-60% weak acid leachable copper, whereas only 32% of the copper found in largest particles could be leached in weak acid. Copper oxides and carbonates were the dominating species in the smaller particles...

  2. IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

    International Nuclear Information System (INIS)

    Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.

    2006-01-01

    The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions

  3. Effectiveness acidic pre-cleaning for copper-gold ore

    Directory of Open Access Journals (Sweden)

    Antonio Clareti Pereira

    Full Text Available Abstract The presence of copper-bearing minerals is known to bring on many challenges during the cyanidation of gold ore, like high consumption of cyanide and low extraction of metal, which are undesirable impacts on the auriferous recovery in the subsequent process step. The high copper solubility in cyanide prevents the direct use of classical hydrometallurgical processes for the extraction of gold by cyanidation. Additionally, the application of a conventional flotation process to extract copper is further complicated when it is oxidized. As a result, an acid pre-leaching process was applied in order to clean the ore of these copper minerals that are cyanide consumers. The objective was to evaluate the amount of soluble copper in cyanide before and after acidic cleaning. From a gold ore containing copper, the study selected four samples containing 0.22%, 0.55%, 1.00% and 1.36% of copper. For direct cyanidation of the ore without pre-treatment, copper extraction by cyanide complexing ranged from 8 to 83%. In contrast, the pre-treatment carried out with sulfuric acid extracted 24% to 99% of initial copper and subsequent cyanidation extracted 0.13 to 1.54% of initial copper. The study also showed that the copper contained in the secondary minerals is more easily extracted by cyanide (83%, being followed by the copper oxy-hydroxide minerals (60%, while the copper contained in the manganese oxide is less complexed by cyanide (8% a 12%. It was possible to observe that minerals with low acid solubility also have low solubility in cyanide. Cyanide consumption decreased by about 2.5 times and gold recovery increased to above 94% after acidic pre-cleaning.

  4. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  5. Characterization of Timed Changes in Hepatic Copper Concentrations, Methionine Metabolism, Gene Expression, and Global DNA Methylation in the Jackson Toxic Milk Mouse Model of Wilson Disease

    Directory of Open Access Journals (Sweden)

    Anh Le

    2014-05-01

    Full Text Available Background: Wilson disease (WD is characterized by hepatic copper accumulation with progressive liver damage to cirrhosis. This study aimed to characterize the toxic milk mouse from The Jackson Laboratory (Bar Harbor, ME, USA (tx-j mouse model of WD according to changes over time in hepatic copper concentrations, methionine metabolism, global DNA methylation, and gene expression from gestational day 17 (fetal to adulthood (28 weeks. Methods: Included liver histology and relevant biochemical analyses including hepatic copper quantification, S-adenosylmethionine (SAM and S-adenosylhomocysteine (SAH liver levels, qPCR for transcript levels of genes relevant to methionine metabolism and liver damage, and DNA dot blot for global DNA methylation. Results: Hepatic copper was lower in tx-j fetuses but higher in weanling (three weeks and adult tx-j mice compared to controls. S-adenosylhomocysteinase transcript levels were significantly lower at all time points, except at three weeks, correlating negatively with copper levels and with consequent changes in the SAM:SAH methylation ratio and global DNA methylation. Conclusion: Compared to controls, methionine metabolism including S-adenosylhomocysteinase gene expression is persistently different in the tx-j mice with consequent alterations in global DNA methylation in more advanced stages of liver disease. The inhibitory effect of copper accumulation on S-adenosylhomocysteinase expression is associated with progressively abnormal methionine metabolism and decreased methylation capacity and DNA global methylation.

  6. Stereospecific hydroxylation of indan by Escherichia coli containing the cloned toluene dioxygenase genes from Pseudomonas putida F1.

    Science.gov (United States)

    Brand, J M; Cruden, D L; Zylstra, G J; Gibson, D T

    1992-01-01

    Escherichia coli JM109(pDTG601), containing the todC1C2BA genes encoding toluene dioxygenase from Pseudomonas putida F1, oxidizes indan to (-)-(1R)-indanol (83% R) and trans-1,3-indandiol. Under similar conditions, P. putida F39/D oxidizes indan to (-)-(1R)-indanol (96% R), 1-indanone, and trans-1,3-indandiol. The differences in the enantiomeric composition of the 1-indanols formed by the two organisms are due to the presence of a 1-indanol dehydrogenase in P. putida F39/D that preferentially oxidizes (+)-(1S)-indanol. PMID:1444374

  7. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.

  8. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  9. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    The results of SDS-PAGE and Western blot showed that the recombinant protein was induced by methanol and stably expressed in P. pastoris, while it has specific reaction with the serum containing anti-HbsAg or anti-Ag85B. However, the successful construction of a recombinant yeast expression vector containing gene ...

  10. Key gene regulating cell wall biosynthesis and recalcitrance in Populus, gene Y

    Science.gov (United States)

    Chen, Jay; Engle, Nancy; Gunter, Lee E.; Jawdy, Sara; Tschaplinski, Timothy J.; Tuskan, Gerald A.

    2015-12-08

    This disclosure provides methods and transgenic plants for improved production of renewable biofuels and other plant-derived biomaterials by altering the expression and/or activity of Gene Y, an O-acetyltransferase. This disclosure also provides expression vectors containing a nucleic acid (Gene Y) which encodes the polypeptide of SEQ ID NO: 1 and is operably linked to a heterologous promoter.

  11. A genetic screen reveals a periplasmic copper chaperone required for nitrite reductase activity in pathogenic Neisseria.

    Science.gov (United States)

    Jen, Freda E-C; Djoko, Karrera Y; Bent, Stephen J; Day, Christopher J; McEwan, Alastair G; Jennings, Michael P

    2015-09-01

    Under conditions of low oxygen availability, Neisseria meningitidis and Neisseria gonorrhoeae are able to respire via a partial denitrification pathway in which nitrite is converted to nitrous oxide. In this process, nitrite reductase (AniA), a copper (Cu)-containing protein converts nitrite to NO, and this product is converted to nitrous oxide by nitric oxide reductase (NorB). NorB also confers protection against toxic NO, and so we devised a conditional lethal screen, using a norB mutant, to identify mutants that were resistant to nitrite-dependent killing. After random-deletion mutagenesis of N. meningitidis, this genetic screen identified a gene encoding a Cu chaperone that is essential for AniA function, AccA. Purified AccA binds one Cu (I) ion and also possesses a second binding site for Cu (II). This novel periplasmic Cu chaperone (AccA) appears to be essential for provision of Cu ions to AniA of pathogenic Neisseria to generate an active nitrite reductase. Apart from the Neisseria genus, AccA is distributed across a wide range of environmental Proteobacteria species. © FASEB.

  12. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  13. Identification and Characterization of Putative Integron-Like Elements of the Heavy-Metal-Hypertolerant Strains of Pseudomonas spp.

    Science.gov (United States)

    Ciok, Anna; Adamczuk, Marcin; Bartosik, Dariusz; Dziewit, Lukasz

    2016-11-28

    Pseudomonas strains isolated from the heavily contaminated Lubin copper mine and Zelazny Most post-flotation waste reservoir in Poland were screened for the presence of integrons. This analysis revealed that two strains carried homologous DNA regions composed of a gene encoding a DNA_BRE_C domain-containing tyrosine recombinase (with no significant sequence similarity to other integrases of integrons) plus a three-component array of putative integron gene cassettes. The predicted gene cassettes encode three putative polypeptides with homology to (i) transmembrane proteins, (ii) GCN5 family acetyltransferases, and (iii) hypothetical proteins of unknown function (homologous proteins are encoded by the gene cassettes of several class 1 integrons). Comparative sequence analyses identified three structural variants of these novel integron-like elements within the sequenced bacterial genomes. Analysis of their distribution revealed that they are found exclusively in strains of the genus Pseudomonas .

  14. Loss of functional K+ channels encoded by ether-à-go-go-related genes in mouse myometrium prior to labour onset

    Science.gov (United States)

    Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S

    2009-01-01

    There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483

  15. Molecular Cloning and Characteristic Features of a Novel Extracellular Tyrosinase from Aspergillus niger PA2.

    Science.gov (United States)

    Agarwal, Pragati; Singh, Jyoti; Singh, R P

    2017-05-01

    Aspergillus niger PA2, a novel strain isolated from waste effluents of food industry, is a potential extracellular tyrosinase producer. Enzyme activity and L-DOPA production were maximum when glucose and peptone were employed as C source and nitrogen source respectively in the medium and enhanced notably when the copper was supplemented, thus depicting the significance of copper in tyrosinase activity. Tyrosinase-encoding gene from the fungus was cloned, and amplification of the tyrosinase gene yielded a 1127-bp DNA fragment and 374 amino acid residue long product that encoded for a predicted protein of 42.3 kDa with an isoelectric point of 4.8. Primary sequence analysis of A. niger PA2 tyrosinase had shown that it had approximately 99% identity with that of A. niger CBS 513.88, which was further confirmed by phylogenetic analysis. The inferred amino acid sequence of A. niger tyrosinase contained two putative copper-binding sites comprising of six histidines, a characteristic feature for type-3 copper proteins, which were highly conserved in all tyrosinases throughout the Aspergillus species. When superimposed onto the tertiary structure of A. oryzae tyrosinase, the conserved residues from both the organisms occupied same spatial positions to provide a di-copper-binding peptide groove.

  16. Synthesis and characterization of αzirconium (IV) hydrogenphosphate containing metallic copper clusters

    International Nuclear Information System (INIS)

    Souza, Alexilda Oliveira de; Rangel, Maria do Carmo; Alves, Oswaldo Luiz

    2005-01-01

    The α-zirconium (IV) hydrogenphosphate (α-ZrP) has received great attention in the last years due to its properties like ion exchange, intercalation, ionic conductivity and catalytic activity. This work reports a method to produce metallic copper clusters on α-ZrP to be used as catalysts in petrochemical processes. It was found that the solids were non-crystalline regardless of the uptake of copper and the reduction. The specific surface area increased as a consequence of the increase of the interlayer distance to accept the copper ions between the layers. During the reduction, big clusters of copper (0,5-11μ) with different sizes and shapes were produced. (author)

  17. Human major histocompatibility complex contains a minimum of 19 genes between the complement cluster and HLA-B

    International Nuclear Information System (INIS)

    Spies, T.; Bresnahan, M.; Strominger, J.L.

    1989-01-01

    A 600-kilobase (kb) DNA segment from the human major histocompatibility complex (MHC) class III region was isolated by extension of a previous 435-kb chromosome walk. The contiguous series of cloned overlapping cosmids contains the entire 555-kb interval between C2 in the complement gene cluster and HLA-B. This region is known to encode the tumor necrosis factors (TNFs) α and β, B144, and the major heat shock protein HSP70. Moreover, a cluster of genes, BAT1-BAT5 (HLA-B-associated transcripts) have been localized in the vicinity of the genes for TNFα and TNFβ. An additional four genes were identified by isolation of corresponding cDNA clones with cosmid DNA probes. These genes for BAT6-BAT9 were mapped near the gene for C2 within a 120-kb region that includes a HSP70 gene pair. These results, together with complementary data from a similar recent study, indicated the presence of a minimum of 19 genes within the C2-HLA-B interval of the MHC class III region. Although the functional properties of most of these genes are yet unknown, they may be involved in some aspects of immunity. This idea is supported by the genetic mapping of the hematopoietic histocompatibility locus-1 (Hh-1) in recombinant mice between TNFα and H-2S, which is homologous to the complement gene cluster in humans

  18. Method for producing superconductive wires of multifilaments which are encased in copper or a copper alloy and contain niobium and aluminium

    International Nuclear Information System (INIS)

    Flukiger, R.

    1983-01-01

    A method is disclosed for producing a superconductive wire of multifilaments having components comprising niobium and aluminum encased in copper or a copper alloy, wherein the multifilament configuration and the formation of a superconductive A15 phase are positively developed from the components disposed in a copper or copper alloy tube having an interior metallic coating serving as a diffusion barrier, by cold forming and subsequent heat treatment

  19. Plasmodium falciparum associated with severe childhood malaria preferentially expresses PfEMP1 encoded by group A var genes

    DEFF Research Database (Denmark)

    Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah

    2004-01-01

    Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....

  20. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  1. The Sporothrix schenckii Gene Encoding for the Ribosomal Protein L6 Has Constitutive and Stable Expression and Works as an Endogenous Control in Gene Expression Analysis

    Directory of Open Access Journals (Sweden)

    Elías Trujillo-Esquivel

    2017-09-01

    Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or

  2. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  3. cDNA for the human β2-adrenergic receptor: a protein with multiple membrane-spanning domains and encoded by a gene whose chromosomal location is shared with that of the receptor for platelet-derived growth factor

    International Nuclear Information System (INIS)

    Kobilka, B.K.; Dixon, R.A.F.; Frielle, T.

    1987-01-01

    The authors have isolated and sequenced a cDNA encoding the human β 2 -adrenergic receptor. The deduced amino acid sequence (413 residues) is that of a protein containing seven clusters of hydrophobic amino acids suggestive of membrane-spanning domains. While the protein is 87% identical overall with the previously cloned hamster β 2 -adrenergic receptor, the most highly conserved regions are the putative transmembrane helices (95% identical) and cytoplasmic loops (93% identical), suggesting that these regions of the molecule harbor important functional domains. Several of the transmembrane helices also share lesser degrees of identity with comparable regions of select members of the opsin family of visual pigments. They have localized the gene for the β 2 -adrenergic receptor to q31-q32 on chromosome 5. This is the same position recently determined for the gene encoding the receptor for platelet-derived growth factor and is adjacent to that for the FMS protooncogene, which encodes the receptor for the macrophage colony-stimulating factor

  4. Human TRMU encoding the mitochondrial 5-methylaminomethyl-2-thiouridylate-methyltransferase is a putative nuclear modifier gene for the phenotypic expression of the deafness-associated 12S rRNA mutations

    International Nuclear Information System (INIS)

    Yan Qingfeng; Bykhovskaya, Yelena; Li Ronghua; Mengesha, Emebet; Shohat, Mordechai; Estivill, Xavier; Fischel-Ghodsian, Nathan; Guan Minxin

    2006-01-01

    Nuclear modifier genes have been proposed to modulate the phenotypic manifestation of human mitochondrial 12S rRNA A1491G mutation associated with deafness in many families world-wide. Here we identified and characterized the putative nuclear modifier gene TRMU encoding a highly conserved mitochondrial protein related to tRNA modification. A 1937 bp TRMU cDNA has been isolated and the genomic organization of TRMU has been elucidated. The human TRMU gene containing 11 exons encodes a 421 residue protein with a strong homology to the TRMU-like proteins of bacteria and other homologs. TRMU is ubiquitously expressed in various tissues, but abundantly in tissues with high metabolic rates including heart, liver, kidney, and brain. Immunofluorescence analysis of human 143B cells expressing TRMU-GFP fusion protein demonstrated that the human Trmu localizes and functions in mitochondrion. Furthermore, we show that in families with the deafness-associated 12S rRNA A1491G mutation there is highly suggestive linkage and linkage disequilibrium between microsatellite markers adjacent to TRMU and the presence of deafness. These observations suggest that human TRMU may modulate the phenotypic manifestation of the deafness-associated mitochondrial 12S rRNA mutations

  5. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman

    2014-01-01

    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  6. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  7. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  8. The Popeye Domain Containing Genes and Their Function in Striated Muscle

    Science.gov (United States)

    Schindler, Roland F. R.; Scotton, Chiara; French, Vanessa; Ferlini, Alessandra; Brand, Thomas

    2016-01-01

    The Popeye domain containing (POPDC) genes encode a novel class of cAMP effector proteins, which are abundantly expressed in heart and skeletal muscle. Here, we will review their role in striated muscle as deduced from work in cell and animal models and the recent analysis of patients carrying a missense mutation in POPDC1. Evidence suggests that POPDC proteins control membrane trafficking of interacting proteins. Furthermore, we will discuss the current catalogue of established protein-protein interactions. In recent years, the number of POPDC-interacting proteins has been rising and currently includes ion channels (TREK-1), sarcolemma-associated proteins serving functions in mechanical stability (dystrophin), compartmentalization (caveolin 3), scaffolding (ZO-1), trafficking (NDRG4, VAMP2/3) and repair (dysferlin) or acting as a guanine nucleotide exchange factor for Rho-family GTPases (GEFT). Recent evidence suggests that POPDC proteins might also control the cellular level of the nuclear proto-oncoprotein c-Myc. These data suggest that this family of cAMP-binding proteins probably serves multiple roles in striated muscle. PMID:27347491

  9. [Effect of melafen on expression of Elip1 and Elip2 genes encoding chloroplast light-induced stress proteins in barley].

    Science.gov (United States)

    Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P

    2008-01-01

    The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.

  10. The Popeye Domain Containing Genes and cAMP Signaling

    Directory of Open Access Journals (Sweden)

    Thomas Brand

    2014-05-01

    Full Text Available 3'-5'-cyclic adenosine monophosphate (cAMP is a second messenger, which plays an important role in the heart. It is generated in response to activation of G-protein-coupled receptors (GPCRs. Initially, it was thought that protein kinase A (PKA exclusively mediates cAMP-induced cellular responses such as an increase in cardiac contractility, relaxation, and heart rate. With the identification of the exchange factor directly activated by cAMP (EPAC and hyperpolarizing cyclic nucleotide-gated (HCN channels as cAMP effector proteins it became clear that a protein network is involved in cAMP signaling. The Popeye domain containing (Popdc genes encode yet another family of cAMP-binding proteins, which are prominently expressed in the heart. Loss-of-function mutations in mice are associated with cardiac arrhythmia and impaired skeletal muscle regeneration. Interestingly, the cardiac phenotype, which is present in both, Popdc1 and Popdc2 null mutants, is characterized by a stress-induced sinus bradycardia, suggesting that Popdc proteins participate in cAMP signaling in the sinuatrial node. The identification of the two-pore channel TREK-1 and Caveolin 3 as Popdc-interacting proteins represents a first step into understanding the mechanisms of heart rate modulation triggered by Popdc proteins.

  11. Unprecedented loss of ammonia assimilation capability in a urease-encoding bacterial mutualist

    Directory of Open Access Journals (Sweden)

    Wernegreen Jennifer J

    2010-12-01

    Full Text Available Abstract Background Blochmannia are obligately intracellular bacterial mutualists of ants of the tribe Camponotini. Blochmannia perform key nutritional functions for the host, including synthesis of several essential amino acids. We used Illumina technology to sequence the genome of Blochmannia associated with Camponotus vafer. Results Although Blochmannia vafer retains many nutritional functions, it is missing glutamine synthetase (glnA, a component of the nitrogen recycling pathway encoded by the previously sequenced B. floridanus and B. pennsylvanicus. With the exception of Ureaplasma, B. vafer is the only sequenced bacterium to date that encodes urease but lacks the ability to assimilate ammonia into glutamine or glutamate. Loss of glnA occurred in a deletion hotspot near the putative replication origin. Overall, compared to the likely gene set of their common ancestor, 31 genes are missing or eroded in B. vafer, compared to 28 in B. floridanus and four in B. pennsylvanicus. Three genes (queA, visC and yggS show convergent loss or erosion, suggesting relaxed selection for their functions. Eight B. vafer genes contain frameshifts in homopolymeric tracts that may be corrected by transcriptional slippage. Two of these encode DNA replication proteins: dnaX, which we infer is also frameshifted in B. floridanus, and dnaG. Conclusions Comparing the B. vafer genome with B. pennsylvanicus and B. floridanus refines the core genes shared within the mutualist group, thereby clarifying functions required across ant host species. This third genome also allows us to track gene loss and erosion in a phylogenetic context to more fully understand processes of genome reduction.

  12. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  13. Adsorption of copper from the sulphate solution of low copper contents using the cationic resin Amberlite IR 120

    International Nuclear Information System (INIS)

    Jha, Manis Kumar; Nghiem Van Nguyen; Lee, Jae-chun; Jeong, Jinki; Yoo, Jae-Min

    2009-01-01

    In view of the increasing importance of the waste processing and recycling to meet the strict environmental regulations, the present investigation reports an adsorption process using the cationic exchanger Amberlite IR 120 for the recovery/removal of copper from the synthetic sulphate solution containing copper ≤0.7 mg/mL similar to the CMP waste effluent of electronic industry. Various process parameters, viz. contact time, solution pH, resin dose, and acid concentration of eluant were investigated for the adsorption of copper from the effluents. The 99.99% copper was found to be adsorbed from the sulphate solution containing copper 0.3-0.7 mg/mL of solution (feed pH 5) at A/R ratio 100 and eq. pH 2.5 in contact time 14 min. The mechanism for the adsorption of copper was found to follow Langmuir isotherm and second order rate. From the loaded organic, copper was eluted effectively by 1.8 M sulphuric acid at A/R ratio 25. The raffinate obtained after the recovery copper could be disposed safely without affecting the environment.

  14. Analysis of viral protein-2 encoding gene of avian encephalomyelitis virus from field specimens in Central Java region, Indonesia

    Directory of Open Access Journals (Sweden)

    Aris Haryanto

    2016-01-01

    Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with

  15. Molecular characterization of the Jatropha curcas JcR1MYB1 gene encoding a putative R1-MYB transcription factor

    Directory of Open Access Journals (Sweden)

    Hui-Liang Li

    2014-09-01

    Full Text Available The cDNA encoding the R1-MYB transcription factor, designated as JcR1MYB1, was isolated from Jatropha curcas using rapid amplification of cDNA ends. JcR1MYB1 contains a 951 bp open reading frame that encodes 316 amino acids. The deduced JcR1MYB1 protein was predicted to possess the conserved, 56-amino acid-long DNA-binding domain, which consists of a single helix-turn-helix module and usually occurs in R1-MYBs. JcR1MYB1 is a member of the R1-MYB transcription factor subfamily. A subcellular localization study confirmed the nuclear localization of JcR1MYB1. Expression analysis showed that JcR1MYB1 transcripts accumulated in various examined tissues, with high expression levels in the root and low levels in the stem. JcR1MYB1 transcription was up-regulated by polyethylene glycol, NaCl, and cold treatments, as well as by abscisic acid, jasmonic acid, and ethylene treatment. Analysis of transgenic tobacco plants over-expressing JcR1MYB1 indicates an inportant function for this gene in salt stress.

  16. The Arabidopsis thaliana REDUCED EPIDERMAL FLUORESCENCE1 gene encodes an aldehyde dehydrogenase involved in ferulic acid and sinapic acid biosynthesis.

    Science.gov (United States)

    Nair, Ramesh B; Bastress, Kristen L; Ruegger, Max O; Denault, Jeff W; Chapple, Clint

    2004-02-01

    Recent research has significantly advanced our understanding of the phenylpropanoid pathway but has left in doubt the pathway by which sinapic acid is synthesized in plants. The reduced epidermal fluorescence1 (ref1) mutant of Arabidopsis thaliana accumulates only 10 to 30% of the sinapate esters found in wild-type plants. Positional cloning of the REF1 gene revealed that it encodes an aldehyde dehydrogenase, a member of a large class of NADP(+)-dependent enzymes that catalyze the oxidation of aldehydes to their corresponding carboxylic acids. Consistent with this finding, extracts of ref1 leaves exhibit low sinapaldehyde dehydrogenase activity. These data indicate that REF1 encodes a sinapaldehyde dehydrogenase required for sinapic acid and sinapate ester biosynthesis. When expressed in Escherichia coli, REF1 was found to exhibit both sinapaldehyde and coniferaldehyde dehydrogenase activity, and further phenotypic analysis of ref1 mutant plants showed that they contain less cell wall-esterified ferulic acid. These findings suggest that both ferulic acid and sinapic acid are derived, at least in part, through oxidation of coniferaldehyde and sinapaldehyde. This route is directly opposite to the traditional representation of phenylpropanoid metabolism in which hydroxycinnamic acids are instead precursors of their corresponding aldehydes.

  17. Lampreys, the jawless vertebrates, contain only two ParaHox gene clusters.

    Science.gov (United States)

    Zhang, Huixian; Ravi, Vydianathan; Tay, Boon-Hui; Tohari, Sumanty; Pillai, Nisha E; Prasad, Aravind; Lin, Qiang; Brenner, Sydney; Venkatesh, Byrappa

    2017-08-22

    ParaHox genes ( Gsx , Pdx , and Cdx ) are an ancient family of developmental genes closely related to the Hox genes. They play critical roles in the patterning of brain and gut. The basal chordate, amphioxus, contains a single ParaHox cluster comprising one member of each family, whereas nonteleost jawed vertebrates contain four ParaHox genomic loci with six or seven ParaHox genes. Teleosts, which have experienced an additional whole-genome duplication, contain six ParaHox genomic loci with six ParaHox genes. Jawless vertebrates, represented by lampreys and hagfish, are the most ancient group of vertebrates and are crucial for understanding the origin and evolution of vertebrate gene families. We have previously shown that lampreys contain six Hox gene loci. Here we report that lampreys contain only two ParaHox gene clusters (designated as α- and β-clusters) bearing five ParaHox genes ( Gsxα , Pdxα , Cdxα , Gsxβ , and Cdxβ ). The order and orientation of the three genes in the α-cluster are identical to that of the single cluster in amphioxus. However, the orientation of Gsxβ in the β-cluster is inverted. Interestingly, Gsxβ is expressed in the eye, unlike its homologs in jawed vertebrates, which are expressed mainly in the brain. The lamprey Pdxα is expressed in the pancreas similar to jawed vertebrate Pdx genes, indicating that the pancreatic expression of Pdx was acquired before the divergence of jawless and jawed vertebrate lineages. It is likely that the lamprey Pdxα plays a crucial role in pancreas specification and insulin production similar to the Pdx of jawed vertebrates.

  18. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  19. Characterization and metal-induced gene transcription of two new copper zinc superoxide dismutases in the solitary ascidian Ciona intestinalis

    International Nuclear Information System (INIS)

    Ferro, Diana; Franchi, Nicola; Mangano, Valentina; Bakiu, Rigers; Cammarata, Matteo; Parrinello, Nicolò; Santovito, Gianfranco; Ballarin, Loriano

    2013-01-01

    Highlights: •Ciona intestinalis express two copper-zinc superoxide dismutases (Cu,Zn SODs), one extracellular (Ci-SODa) and one intracellular isoform (Ci-SODb). •Promoters contain consensus sequences similar to mammalian MRE. •Metal exposure results in a significant increase of gene transcription: ci-soda is induced especially by copper and zinc, the increase of ci-sodb transcription is more evident after cadmium exposure. •Genes are mostly transcribed in circulating hemocytes and in ovarian follicular cells. -- Abstract: Antioxidant enzymes are known to protect living organisms against the oxidative stress risk, also induced by metals. In the present study, we describe the purification and molecular characterization of two Cu,Zn superoxide dismutases (SODs), referred to as Ci-SODa and Ci-SODb, from Ciona intestinalis, a basal chordate widely distributed in temperate shallow seawater. The putative amino acid sequences were compared with Cu,Zn SODs from other metazoans and phylogenetic analyses indicate that the two putative Ci-SODs are more related to invertebrate SODs than vertebrate ones. Both phylogenetic and preliminary homology modeling analyses suggest that Ci-SODa and Ci-SODb are extracellular and intracellular isoform, respectively. The mRNA of the two Cu,Zn SODs was localized in hemocytes and in ovarian follicular cells, as revealed by in situ hybridization. The time course of SOD mRNA levels in the presence of three different metals showed upregulation of ci-soda and inhibition of ci-sodb. Spectrophotometric analysis confirms the presence of SOD activity in Ciona tissues. Our in silico analyses of the ci-soda promoter region revealed putative consensus sequences similar to mammalian metal-responsive elements (MRE), suggesting that the transcription of these genes directly depends on metals. These data emphasize the importance of complex metal regulation of ci-soda and ci-sodb transcription, as components of an efficient detoxification pathway

  20. Characterization and metal-induced gene transcription of two new copper zinc superoxide dismutases in the solitary ascidian Ciona intestinalis

    Energy Technology Data Exchange (ETDEWEB)

    Ferro, Diana [Department of Biology, University of Padova, Padova (Italy); Institute for Evolution and Biodiversity, Westfälische Wilhelms-Universität, Münster (Germany); Franchi, Nicola [Department of Biology, University of Padova, Padova (Italy); Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Mangano, Valentina [Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Bakiu, Rigers [Department of Crop Production, Agricultural University of Tirana, Tirana (Albania); Cammarata, Matteo; Parrinello, Nicolò [Department of Biological, Chemical, Pharmaceutical Science and Technology, University of Palermo, Palermo (Italy); Santovito, Gianfranco, E-mail: gianfranco.santovito@unipd.it [Department of Biology, University of Padova, Padova (Italy); Ballarin, Loriano [Department of Biology, University of Padova, Padova (Italy)

    2013-09-15

    Highlights: •Ciona intestinalis express two copper-zinc superoxide dismutases (Cu,Zn SODs), one extracellular (Ci-SODa) and one intracellular isoform (Ci-SODb). •Promoters contain consensus sequences similar to mammalian MRE. •Metal exposure results in a significant increase of gene transcription: ci-soda is induced especially by copper and zinc, the increase of ci-sodb transcription is more evident after cadmium exposure. •Genes are mostly transcribed in circulating hemocytes and in ovarian follicular cells. -- Abstract: Antioxidant enzymes are known to protect living organisms against the oxidative stress risk, also induced by metals. In the present study, we describe the purification and molecular characterization of two Cu,Zn superoxide dismutases (SODs), referred to as Ci-SODa and Ci-SODb, from Ciona intestinalis, a basal chordate widely distributed in temperate shallow seawater. The putative amino acid sequences were compared with Cu,Zn SODs from other metazoans and phylogenetic analyses indicate that the two putative Ci-SODs are more related to invertebrate SODs than vertebrate ones. Both phylogenetic and preliminary homology modeling analyses suggest that Ci-SODa and Ci-SODb are extracellular and intracellular isoform, respectively. The mRNA of the two Cu,Zn SODs was localized in hemocytes and in ovarian follicular cells, as revealed by in situ hybridization. The time course of SOD mRNA levels in the presence of three different metals showed upregulation of ci-soda and inhibition of ci-sodb. Spectrophotometric analysis confirms the presence of SOD activity in Ciona tissues. Our in silico analyses of the ci-soda promoter region revealed putative consensus sequences similar to mammalian metal-responsive elements (MRE), suggesting that the transcription of these genes directly depends on metals. These data emphasize the importance of complex metal regulation of ci-soda and ci-sodb transcription, as components of an efficient detoxification pathway

  1. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  2. On the mechanism of action of combination of thionocarbamates with xanthate during flotation of copper-molybdenum pyrite contained ores

    International Nuclear Information System (INIS)

    Nedosekina, T.V.; Glembotskij, A.V.; Bekhtle, G.A.; Novgorodova, Eh.Z.

    1985-01-01

    Investigation results of action mechanism of thionocarbamates combination with xanthate are described. It is established that these collectors are capable of co-adsorbing on pyrite surface, that is the reason for sharp increase of the floatability and disturbs the selectivity of copper-molybdenum pyrite-containing ore flotation

  3. Study of genes induced by ionizing radiations at Arabidopsis thaliana: identification and molecular characterization of the ATGR1 gene, a new gene encoding a protein involved in plant cell division

    International Nuclear Information System (INIS)

    Deveaux, Yves

    1999-01-01

    DNA damage, that can be experimentally introduced by ionizing radiation (IR), induces complex signal transduction pathways leading to cell recovery or, alternatively to programmed cell death if damages are too severe. To identify the inducible components of the response to genotoxic stress in plants, we have screened by Differential Display for mRNAs that rapidly and strongly accumulate after IR treatment in A. thaliana cells. We have characterized ATGR1, a new single copy Arabidopsis gene encoding a PEST-box protein of unknown function. In unstressed plant organs the ATGR1 mRNA is hardly detectable, whereas the protein is present in extracts prepared from roots, shoot meristems and inflorescences, that all contain large amounts of actively dividing cells. This pattern is confirmed by immuno localisation on tissue sections that shows constitutive ATGR1 protein expression covering the root elongation zone, the shoot meristem, leaf primordial and the ovules of developing flowers. Histochemical analysis of transgenic plants expressing the GUS reporter gene under the control of the ATGR1 promoter, demonstrate that the developmental and tissue-specific profile of ATGR1 protein expression is conferred by the gene promoter. The massive, transient and dose-dependent accumulation of ATGR1 transcripts after IR treatment observed in all plant organs does not lead to significant changes in ATGR1 protein pattern. Stable ATGR1 protein overexpression, as exemplified by transgenic A. thaliana plants that contain a 35S promoter-ATGR1 gene fusion, does not induce notable changes of the overall ATGR1 protein level, but leads to male and female sterility. The cause of sterility is a lack of correct chromosome assembly and distribution at the stage metaphase II of meiosis. Taken together our results show that i) ATGR1 gene expression is associated to cell division during plant development ii) the ATGR1 protein level is regulated at the transcriptional and post-transcriptional level iii

  4. Nuclear fuel element and container

    International Nuclear Information System (INIS)

    Grubb, W.T.; King, L.H.

    1981-01-01

    The invention is based on the discovery that a substantial reduction in metal embrittlement or stress corrosion cracking from fuel pellet-cladding interaction can be achieved by the use of a copper layer or liner in proximity to the nuclear fuel, and an intermediate zirconium oxide barrier layer between the copper layer and the zirconium cladding substrate. The intermediate zirconia layer is a good copper diffusion barrier; also, if the zirconium cladding surface is modified prior to oxidation, copper can be deposited by electroless plating. A nuclear fuel element is described which comprises a central core of fuel material and an elongated container using the system outlined above. The method for making the container is again described. It comprises roughening or etching the surface of the zirconium or zirconium alloy container, oxidizing the resulting container, activating the oxidized surface to allow for the metallic coating of such surfaces by electroless deposition and further coating the activated-oxidized surface of the zirconium or zirconium alloy container with copper, iron or nickel or an alloy thereof. (U.K.)

  5. Study of the Effect of Sulfide Ions on the Corrosion Resistance of Copper for Use in Containers for High Level radioactive waste

    International Nuclear Information System (INIS)

    Urbal Espinoza, Andrea Elizabeth

    2000-01-01

    The work 'Study of sulfide ion on Resisting Copper Corrosion' is part of the project 'Study of Copper Corrosion in Underground Water Solution in Reducer Conditions', which the Department of Nuclear Materials, Chilean Nuclear Energy Commission is carrying out. These activities are important because of this metal's potential applications for handling and controlling contaminating wastes that are a product of using nuclear energy in electric generation. Copper has important mechanical properties and is also resistant to disintegration in corrosive environments, which is an important condition for its use in manufacturing of high level radioactive waste containers. This work is based on a study of cyclic volta metric curves, anodic and cathodic polarization and potentiostatic measurements, with which the potential range, sweep speed system, electrochemical reactions involved and corrosion speed could be defined. The microstructural characterization of the films was done by Scanning Electron Microscopy (SEM), and the chemical composition and surface contamination of the film were studied by photoelectron spectroscopy induced by X- rays (XPS), and the crystalline structure by X- ray Diffraction (XRD). Some noticeable results, such as low potentials (less than .7 V, in cathode direction) and high concentrations of sulfur make the formation of copper sulfides (I) and (II) possible; unlike the potential over .6 V, in anodic direction, where copper oxides (I) and (II) are formed, but they are inhibited by high sulfur concentrations. The morphological study of the copper surface has shown that the film that forms is more abundant and granular at higher cathodic potentials, forming small pits on the surface. The effect of the presence of sulfur ions is minimal, and the metal's deterioration is inhibited by other ions in the groundwater. The corrosion rate is greater as the sulfur concentration rises, and a time period of 20,000 years can be predicted for the total corrosion of

  6. Examining mechanism of toxicity of copper oxide nanoparticles to Saccharomyces cerevisiae and Caenorhabditis elegans

    Science.gov (United States)

    Mashock, Michael J.

    mutant strains containing gene knockouts in the divalent-metal transporters smf-1 and smf-2 showed increased tolerance to copper exposure. These results lend credence to the hypothesis that some toxicological effects to eukaryotic organisms from copper oxide nanoparticle exposure may be due to properties specific to the nanoparticles and not solely from the released copper ions.

  7. Ubiquitin--conserved protein or selfish gene?

    Science.gov (United States)

    Catic, André; Ploegh, Hidde L

    2005-11-01

    The posttranslational modifier ubiquitin is encoded by a multigene family containing three primary members, which yield the precursor protein polyubiquitin and two ubiquitin moieties, Ub(L40) and Ub(S27), that are fused to the ribosomal proteins L40 and S27, respectively. The gene encoding polyubiquitin is highly conserved and, until now, those encoding Ub(L40) and Ub(S27) have been generally considered to be equally invariant. The evolution of the ribosomal ubiquitin moieties is, however, proving to be more dynamic. It seems that the genes encoding Ub(L40) and Ub(S27) are actively maintained by homologous recombination with the invariant polyubiquitin locus. Failure to recombine leads to deterioration of the sequence of the ribosomal ubiquitin moieties in several phyla, although this deterioration is evidently constrained by the structural requirements of the ubiquitin fold. Only a few amino acids in ubiquitin are vital for its function, and we propose that conservation of all three ubiquitin genes is driven not only by functional properties of the ubiquitin protein, but also by the propensity of the polyubiquitin locus to act as a 'selfish gene'.

  8. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  9. The IRC7 gene encodes cysteine desulphydrase activity and confers on yeast the ability to grow on cysteine as a nitrogen source.

    Science.gov (United States)

    Santiago, Margarita; Gardner, Richard C

    2015-07-01

    Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.

  10. Primary structure of the tms and prs genes of Bacillus subtilis

    DEFF Research Database (Denmark)

    Nilsson, Dan; Hove-Jensen, Bjarne; Arnvig, Kirsten

    1989-01-01

    The nucleotide sequence was determined of a 3211 nucleotide pair EcoRI-PvuII DNA fragment containing the tms and prs genes as well as a part of the ctc gene of Bacillus subtilis. The prs gene encodes phosphoribosylpyrophosphate (PRPP) synthetase, whereas the functioning of the tms and ctc gene...... products remains to be established. The prs gene contains an open reading frame of 317 codons resulting in a subunit Mr of 34828. An open reading frame comprising the tms gene contained 456 codons resulting in a putative translation product with an Mr of 49,554. Comparison of the deduced B. subtilis PRPP...

  11. Sexual selection, genetic conflict, selfish genes, and the atypical patterns of gene expression in spermatogenic cells.

    Science.gov (United States)

    Kleene, Kenneth C

    2005-01-01

    This review proposes that the peculiar patterns of gene expression in spermatogenic cells are the consequence of powerful evolutionary forces known as sexual selection. Sexual selection is generally characterized by intense competition of males for females, an enormous variety of the strategies to maximize male reproductive success, exaggerated male traits at all levels of biological organization, co-evolution of sexual traits in males and females, and conflict between the sexual advantage of the male trait and the reproductive fitness of females and the individual fitness of both sexes. In addition, spermatogenesis is afflicted by selfish genes that promote their transmission to progeny while causing deleterious effects. Sexual selection, selfish genes, and genetic conflict provide compelling explanations for many atypical features of gene expression in spermatogenic cells including the gross overexpression of certain mRNAs, transcripts encoding truncated proteins that cannot carry out basic functions of the proteins encoded by the same genes in somatic cells, the large number of gene families containing paralogous genes encoding spermatogenic cell-specific isoforms, the large number of testis-cancer-associated genes that are expressed only in spermatogenic cells and malignant cells, and the overbearing role of Sertoli cells in regulating the number and quality of spermatozoa.

  12. Copper tolerance and virulence in bacteria

    Science.gov (United States)

    Ladomersky, Erik; Petris, Michael J.

    2015-01-01

    Copper (Cu) is an essential trace element for all aerobic organisms. It functions as a cofactor in enzymes that catalyze a wide variety of redox reactions due to its ability to cycle between two oxidation states, Cu(I) and Cu(II). This same redox property of copper has the potential to cause toxicity if copper homeostasis is not maintained. Studies suggest that the toxic properties of copper are harnessed by the innate immune system of the host to kill bacteria. To counter such defenses, bacteria rely on copper tolerance genes for virulence within the host. These discoveries suggest bacterial copper intoxication is a component of host nutritional immunity, thus expanding our knowledge of the roles of copper in biology. This review summarizes our current understanding of copper tolerance in bacteria, and the extent to which these pathways contribute to bacterial virulence within the host. PMID:25652326

  13. Nucleotide sequence of the human N-myc gene

    International Nuclear Information System (INIS)

    Stanton, L.W.; Schwab, M.; Bishop, J.M.

    1986-01-01

    Human neuroblastomas frequently display amplification and augmented expression of a gene known as N-myc because of its similarity to the protooncogene c-myc. It has therefore been proposed that N-myc is itself a protooncogene, and subsequent tests have shown that N-myc and c-myc have similar biological activities in cell culture. The authors have now detailed the kinship between N-myc and c-myc by determining the nucleotide sequence of human N-myc and deducing the amino acid sequence of the protein encoded by the gene. The topography of N-myc is strikingly similar to that of c-myc: both genes contain three exons of similar lengths; the coding elements of both genes are located in the second and third exons; and both genes have unusually long 5' untranslated regions in their mRNAs, with features that raise the possibility that expression of the genes may be subject to similar controls of translation. The resemblance between the proteins encoded by N-myc and c-myc sustains previous suspicions that the genes encode related functions

  14. Recombinant DNA specifying the human amyloid. beta. precursor protein (ABPP) encodes a 95-kDa polypeptide

    Energy Technology Data Exchange (ETDEWEB)

    Mita, S; Sadlock, J; Herbert, J; Schon, E A

    1988-10-11

    Although the ABPP gene give rise to multiple mRNAs, the primary translation product of this gene is unknown. The longest published cDNA sequences predict a 770-aa polypeptide of 87 kDa. However, in immunoblots, ABPP migrated as a single species of >92 kDa in rat brain, and in human, as a species of 95-100 kDa in non-membrane bound form, as multiple species of 110-135 kDa in membrane-associated form and as a 130-kDa species in fibroblasts. The sizes of these larger species relative to the MW of ABPP predicted from the cDNA sequences have been attributed to postranslational modification. However, the authors have isolated a cDNA (lambdaHAP2) from a human fetal muscle lambdagt11 cDNA library encoding an 843-aa polypeptide with a deduced MW of 94,642. This cDNA contains both exons encoding an 843-aa polypeptide with a deduced MW of 94.642. This cDNA contains both exons encoding the protease inhibitor domains. Primer extension analysis indicates that the 5' terminus of this cDNA is 14 nt from a transcriptional start site. This cDNA, encoding the longest ABPP described to date, may explain some of the observations on the sizes of tissue-derived ABPP.

  15. [The Effect of Introduction of the Heterologous Gene Encoding the N-acyl-homoserine Lactonase (aiiA) on the Properties of Burkholderia cenocepacia 370].

    Science.gov (United States)

    Plyuta, V A; Lipasova, V A; Koksharova, O A; Veselova, M A; Kuznetsov, A E; Khmel, I A

    2015-08-01

    To study the role of Quorum Sensing (QS) regulation in the control of the cellular processes of Burkholderia cenocepacia 370, plasmid pME6863 was transferred into its cells. The plasmid contains a heterologous gene encoding for AiiA N-acyl-homoserine lactonase, which degrades the signaling molecules of the QS system of N-acyl-homoserine lactones (AHL). An absence or reduction of AHL in the culture was revealed with the biosensors Chromobacterium violaceum CV026 and Agrobacterium tumifaciens NT1/pZLR4, respectively. The presence of the aiiA gene, which was cloned from Bacillus sp. A24 in the cells of B. cenocepacia 370, resulted in a lack of hemolytic activity, which reduced the extracellular proteolytic activity and decreased the cells' ability to migration in swarms on the surface of the agar medium. The introduction of the aiiA gene did not affect lipase activity, fatty acids synthesis, HCN synthesis, or biofilm formation. Hydrogen peroxide was shown to stimulate biofilm formation by B. cenocepacia 370 in concentrations that inhibited or weakly suppressed bacterial growth. The introduction of the aiiA gene into the cells did not eliminate this effect but it did reduce it.

  16. Biosynthesis of actinorhodin and related antibiotics: discovery of alternative routes for quinone formation encoded in the act gene cluster.

    Science.gov (United States)

    Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji

    2009-02-27

    All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.

  17. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  18. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  19. Colloidal and electrochemical aspects of copper-CMP

    Science.gov (United States)

    Sun, Yuxia

    Copper based interconnects with low dielectric constant layers are currently used to increase interconnect densities and reduce interconnect time delays in integrated circuits. The technology used to develop copper interconnects involves Chemical Mechanical Planarization (CMP) of copper films deposited on low-k layers (silica or silica based films), which is carried out using slurries containing abrasive particles. One issue using such a structure is copper contamination over dielectric layers (SiO2 film), if not reduced, this contamination will cause current leakage. In this study, the conditions conducive to copper contamination onto SiO2 films during Cu-CMP process were studied, and a post-CMP cleaning technique was discussed based on experimental results. It was found that the adsorption of copper onto a silica surface is kinetically fast (electrocoagulation was investigated to remove both copper and abrasive slurry particles simultaneously. For effluent containing ˜40 ppm dissolved copper, it was found that ˜90% dissolved copper was removed from the waste streams through electroplating and in-situ chemical precipitation. The amount of copper removed through plating is impacted by membrane surface charge, type/amount of complexing agents, and solid content in the slurry suspension. The slurry particles can be removed ˜90% within 2 hours of EC through multiple mechanisms.

  20. Promoter for the late gene encoding Vp5 of herpes simplex virus type 1 is recognized by cell extracts derived from uninfected cells

    International Nuclear Information System (INIS)

    Chisholm, G.E.; Summers, W.C.

    1986-01-01

    The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters

  1. Twenty putative palmitoyl-acyl transferase genes with distinct ...

    African Journals Online (AJOL)

    There are 20 genes containing DHHC domain predicted to encode putative palmitoyltransferase in Arabidopsis thaliana genome. However, little is known about their characteristics such as genetic relationship and expression profile. Here, we present an overview of the putative PAT genes in A. thaliana focusing on their ...

  2. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  3. Novel octanuclear copper(I) metallomacrocycles and their transformation into hexanuclear 2-dimensional grids of copper(i) coordination polymers containing cyclodiphosphazanes, [(micro-NtBuP)2(NC4H8X)2] (X = NMe, O).

    Science.gov (United States)

    Suresh, D; Balakrishna, Maravanji S; Mague, Joel T

    2008-07-07

    Novel octanuclear copper(I) macrocyclic complexes and hexanuclear 2-dimensional grid-like polymers containing [P(micro-NR)](2) scaffold in which the anionic moieties are trapped inside the cationic macrocyclic cavities are reported.

  4. The effect of geosphere conditions on the lifetimes of copper containers

    International Nuclear Information System (INIS)

    King, F.; Kolar, M.

    1997-12-01

    The effects of variations in geosphere conditions and of the properties of the backfill material on the performance of the engineered barriers have been examined using a numerical Cu container failure model. The thickness of the exclusion zone between the vault and the nearest major water-bearing fracture has been varied between 1 and 50 m. The groundwater [O 2 ] has been varied between limits of 1 and 7360 ng·g -1 , the latter value being equivalent to the hypothetical situation of aerated saline groundwater at the ambient rock temperature of 17 degrees C. The properties of the excavation-disturbed zone (EDZ) have been varied to simulate both blast-induced and stress-induced damage. Finally, the effect of the particle size of crushed granite, of reduced heat output from the container and the effect of substituting pyrite for biotite on the performance of the backfill material has been determined. The impact of these variables on the corrosion rate, the extent of the four O 2 -consumption reactions and the fate of FE(II) dissolved from the biotite (or pyrite) in the backfill and EDZ has been examined. The results of the various simulations suggest that the engineered barriers (the container and the buffer and backfill materials) can isolate the fuel almost indefinitely, regardless of the geosphere conditions. Copper containers are predicted not to fail by corrosion within the analysis period of ∼10 5 a. The robustness of the engineered barriers is a result of (i) the low rates of mass transport in saturated buffer and backfill materials and (ii) the presence of an excess of redox-buffering FE(II) minerals in the backfill. (author)

  5. Real-time PCR expression profiling of genes encoding potential virulence factors in Candida albicans biofilms: identification of model-dependent and -independent gene expression

    Directory of Open Access Journals (Sweden)

    Řičicová Markéta

    2010-04-01

    Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression

  6. Copper-resistant halophilic bacterium isolated from the polluted Maruit Lake, Egypt.

    Science.gov (United States)

    Osman, O; Tanguichi, H; Ikeda, K; Park, P; Tanabe-Hosoi, S; Nagata, S

    2010-04-01

    To isolate and characterize copper-resistant halophilic bacteria from the polluted Maruit Lake, Egypt and identify the role of plasmids in toxic metal resistance. We isolated strain MA2, showing high copper resistance up to the 1.5 mmol l(-1) concentration; it was also resistant to other metals such as nickel, cobalt and zinc and a group of antibiotics. Partial 16S rRNA analysis revealed that strain MA2 belonged to the genus Halomonas. Copper uptake, measured by atomic absorption spectrophotometery, was higher in the absence of NaCl than in the presence of 0.5-1.0 mol l(-1) NaCl during 5-15 min of incubation. Cell fractionation and electron microscopic observation clarified that most of the copper accumulated in the outer membrane and periplasmic fractions of the cells. Plasmid screening yielded two plasmids: pMA21 (11 kb) and pMA22 (5 kb). Plasmid curing resulted in a strain that lost both the plasmids and was sensitive to cobalt and chromate but not copper, nickel and zinc. This cured strain also showed weak growth in the presence of 0.5-1.0 mol l(-1) NaCl. Partial sequencing of both plasmids led to the identification of different toxic metals transporters but copper transporters were not identified. The highest cell viability was found in the presence of 1.0 mol l(-1) NaCl at different copper concentrations, and copper uptake was optimal in the absence of NaCl. Plasmid pMA21 encoded chromate, cobalt, zinc and cadmium transporters, whereas pMA22 encoded specific zinc and RND (resistance, nodulation, cell division) efflux transporters as well as different kinds of metabolic enzymes. Copper resistance was mainly incorporated in the chromosome. Strain MA2 is a fast and efficient tool for copper bioremediation and the isolated plasmids show significant characteristics of both toxic metal and antibiotic resistance.

  7. The KL24 gene cluster and a genomic island encoding a Wzy polymerase contribute genes needed for synthesis of the K24 capsular polysaccharide by the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51.

    Science.gov (United States)

    Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A

    2017-03-01

    The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.

  8. Multi-species sequence comparison reveals conservation of ghrelin gene-derived splice variants encoding a truncated ghrelin peptide.

    Science.gov (United States)

    Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K

    2016-06-01

    The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.

  9. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  10. Construction of a fusion gene containing hepatitis B virus L gene ...

    African Journals Online (AJOL)

    Jane

    2011-10-05

    Oct 5, 2011 ... the successful construction of a recombinant yeast expression vector containing gene coding L protein and Ag85B ..... the production of memory T cells, promote cytokine secretion and ... Dual DNA vaccination of rainbow trout.

  11. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  12. Primary structure and mapping of the hupA gene of Salmonella typhimurium.

    OpenAIRE

    Higgins, N P; Hillyard, D

    1988-01-01

    In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. C...

  13. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile

    Directory of Open Access Journals (Sweden)

    Shuiyuan Cheng

    2016-03-01

    Full Text Available Roman chamomile (Chamaemelum nobile L. is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969 was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  14. Cloning, Expression Profiling and Functional Analysis of CnHMGS, a Gene Encoding 3-hydroxy-3-Methylglutaryl Coenzyme A Synthase from Chamaemelum nobile.

    Science.gov (United States)

    Cheng, Shuiyuan; Wang, Xiaohui; Xu, Feng; Chen, Qiangwen; Tao, Tingting; Lei, Jing; Zhang, Weiwei; Liao, Yongling; Chang, Jie; Li, Xingxiang

    2016-03-08

    Roman chamomile (Chamaemelum nobile L.) is renowned for its production of essential oils, which major components are sesquiterpenoids. As the important enzyme in the sesquiterpenoid biosynthesis pathway, 3-hydroxy-3-methylglutaryl coenzyme A synthase (HMGS) catalyze the crucial step in the mevalonate pathway in plants. To isolate and identify the functional genes involved in the sesquiterpene biosynthesis of C. nobile L., a HMGS gene designated as CnHMGS (GenBank Accession No. KU529969) was cloned from C. nobile. The cDNA sequence of CnHMGS contained a 1377 bp open reading frame encoding a 458-amino-acid protein. The sequence of the CnHMGS protein was highly homologous to those of HMGS proteins from other plant species. Phylogenetic tree analysis revealed that CnHMGS clustered with the HMGS of Asteraceae in the dicotyledon clade. Further functional complementation of CnHMGS in the mutant yeast strain YSC6274 lacking HMGS activity demonstrated that the cloned CnHMGS cDNA encodes a functional HMGS. Transcript profile analysis indicated that CnHMGS was preferentially expressed in flowers and roots of C. nobile. The expression of CnHMGS could be upregulated by exogenous elicitors, including methyl jasmonate and salicylic acid, suggesting that CnHMGS was elicitor-responsive. The characterization and expression analysis of CnHMGS is helpful to understand the biosynthesis of sesquiterpenoid in C. nobile at the molecular level and also provides molecular wealth for the biotechnological improvement of this important medicinal plant.

  15. Methanobactin from Methylocystis sp. strain SB2 affects gene expression and methane monooxygenase activity in Methylosinus trichosporium OB3b.

    Science.gov (United States)

    Farhan Ul-Haque, Muhammad; Kalidass, Bhagyalakshmi; Vorobev, Alexey; Baral, Bipin S; DiSpirito, Alan A; Semrau, Jeremy D

    2015-04-01

    Methanotrophs can express a cytoplasmic (soluble) methane monooxygenase (sMMO) or membrane-bound (particulate) methane monooxygenase (pMMO). Expression of these MMOs is strongly regulated by the availability of copper. Many methanotrophs have been found to synthesize a novel compound, methanobactin (Mb), that is responsible for the uptake of copper, and methanobactin produced by Methylosinus trichosporium OB3b plays a key role in controlling expression of MMO genes in this strain. As all known forms of methanobactin are structurally similar, it was hypothesized that methanobactin from one methanotroph may alter gene expression in another. When Methylosinus trichosporium OB3b was grown in the presence of 1 μM CuCl2, expression of mmoX, encoding a subunit of the hydroxylase component of sMMO, was very low. mmoX expression increased, however, when methanobactin from Methylocystis sp. strain SB2 (SB2-Mb) was added, as did whole-cell sMMO activity, but there was no significant change in the amount of copper associated with M. trichosporium OB3b. If M. trichosporium OB3b was grown in the absence of CuCl2, the mmoX expression level was high but decreased by several orders of magnitude if copper prebound to SB2-Mb (Cu-SB2-Mb) was added, and biomass-associated copper was increased. Exposure of Methylosinus trichosporium OB3b to SB2-Mb had no effect on expression of mbnA, encoding the polypeptide precursor of methanobactin in either the presence or absence of CuCl2. mbnA expression, however, was reduced when Cu-SB2-Mb was added in both the absence and presence of CuCl2. These data suggest that methanobactin acts as a general signaling molecule in methanotrophs and that methanobactin "piracy" may be commonplace. Copyright © 2015, American Society for Microbiology. All Rights Reserved.

  16. Cloning and sequencing of cDNA encoding human DNA topoisomerase II and localization of the gene to chromosome region 17q21-22

    International Nuclear Information System (INIS)

    Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.

    1988-01-01

    Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes

  17. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  18. A murC gene in Porphyromonas gingivalis 381.

    Science.gov (United States)

    Ansai, T; Yamashita, Y; Awano, S; Shibata, Y; Wachi, M; Nagai, K; Takehara, T

    1995-09-01

    The gene encoding a 51 kDa polypeptide of Porphyromonas gingivalis 381 was isolated by immunoblotting using an antiserum raised against P. gingivalis alkaline phosphatase. DNA sequence analysis of a 2.5 kb DNA fragment containing a gene encoding the 51 kDa protein revealed one complete and two incomplete ORFs. Database searches using the FASTA program revealed significant homology between the P. gingivalis 51 kDa protein and the MurC protein of Escherichia coli, which functions in peptidoglycan synthesis. The cloned 51 kDa protein encoded a functional product that complemented an E. coli murC mutant. Moreover, the ORF just upstream of murC coded for a protein that was 31% homologous with the E. coli MurG protein. The ORF just downstream of murC coded for a protein that was 17% homologous with the Streptococcus pneumoniae penicillin-binding protein 2B (PBP2B), which functions in peptidoglycan synthesis and is responsible for antibiotic resistance. These results suggest that P. gingivalis contains a homologue of the E. coli peptidoglycan synthesis gene murC and indicate the possibility of a cluster of genes responsible for cell division and cell growth, as in the E. coli mra region.

  19. Transcriptome sequencing of Mycosphaerella fijiensis during association with Musa acuminata reveals candidate pathogenicity genes.

    Science.gov (United States)

    Noar, Roslyn D; Daub, Margaret E

    2016-08-30

    Mycosphaerella fijiensis, causative agent of the black Sigatoka disease of banana, is considered the most economically damaging banana disease. Despite its importance, the genetics of pathogenicity are poorly understood. Previous studies have characterized polyketide pathways with possible roles in pathogenicity. To identify additional candidate pathogenicity genes, we compared the transcriptome of this fungus during the necrotrophic phase of infection with that during saprophytic growth in medium. Transcriptome analysis was conducted, and the functions of differentially expressed genes were predicted by identifying conserved domains, Gene Ontology (GO) annotation and GO enrichment analysis, Carbohydrate-Active EnZymes (CAZy) annotation, and identification of genes encoding effector-like proteins. The analysis showed that genes commonly involved in secondary metabolism have higher expression in infected leaf tissue, including genes encoding cytochrome P450s, short-chain dehydrogenases, and oxidoreductases in the 2-oxoglutarate and Fe(II)-dependent oxygenase superfamily. Other pathogenicity-related genes with higher expression in infected leaf tissue include genes encoding salicylate hydroxylase-like proteins, hydrophobic surface binding proteins, CFEM domain-containing proteins, and genes encoding secreted cysteine-rich proteins characteristic of effectors. More genes encoding amino acid transporters, oligopeptide transporters, peptidases, proteases, proteinases, sugar transporters, and proteins containing Domain of Unknown Function (DUF) 3328 had higher expression in infected leaf tissue, while more genes encoding inhibitors of peptidases and proteinases had higher expression in medium. Sixteen gene clusters with higher expression in leaf tissue were identified including clusters for the synthesis of a non-ribosomal peptide. A cluster encoding a novel fusicoccane was also identified. Two putative dispensable scaffolds were identified with a large proportion of

  20. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  1. Biocomposites of copper-containing mesoporous bioactive glass and nanofibrillated cellulose: Biocompatibility and angiogenic promotion in chronic wound healing application.

    Science.gov (United States)

    Wang, Xiaoju; Cheng, Fang; Liu, Jun; Smått, Jan-Henrik; Gepperth, David; Lastusaari, Mika; Xu, Chunlin; Hupa, Leena

    2016-12-01

    Biocomposites of copper-containing mesoporous bioactive glass (Cu-MBG) and nanofibrillated cellulose (NFC) were designated as potential dressing material for chronic wound healing. The phase composition and mesoporous micro-structure of the synthesized Cu-MBGs were elaborately characterized by combining several techniques, including TEM, SEM, XRD, SXAS and N 2 physisorption. High bioactivity of the Cu-MBG was confirmed in stimulated body fluids in vitro. A controlled dissolution of Cu from the glass suggests Cu-MBG a suitable source for Cu release in wound healing dressings. Depending on the content of Cu-MBG in the composite formulation, the composites were fabricated as membranes and aerogels. In biocompatibility assessment of the composites, a dose-dependent cytotoxicity of Cu 2+ on 3T3 fibroblasts was found. Importantly, a critical biological level of Cu 2+ below 10mg/L was suggested for the survival and growth of 3T3 fibroblasts. The Cu 2+ released from the composite aerogel of NFC and Cu-MBG showed a profound angiogenic effect in the 3D spheroid culture system of human umbilical vein endothelial cells. Moreover, the angiogenic gene expression of 3T3 fibroblast was upregulated in the real-time quantitative PCR analysis, which also confirms that the incorporation of Cu-MBG into NFC matrix enhances the proangiogenic potential of the biocomposites. In addition, composites of NFC and Cu-MBG also showed an inhibiting effect on the growth of E. coli. To address an urgent need in clinics on developing a new generation of therapeutic dressings with advanced functionalities, this study has exploited the utilization of Cu-containing mesoporous bioactive glass in the nanocellulose matrix to release Cu 2+ as therapeutic ions for its angiogenic effect on promoting wound healing. This manuscript reports research work on biomaterial design, fabrication development, material characterizations and bioassessments in 2D cellular studies. To utilize nanocellulose derived from the

  2. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Science.gov (United States)

    Alvarez, Rene; Seal, Bruce S

    2005-01-01

    Background Avian metapneumoviruses (aMPV) cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C) of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV). The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N) amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N) gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1) encoded from the first open reading frame (ORF) was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2) was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among members of the

  3. Identification of a truncated nucleoprotein in avian metapneumovirus-infected cells encoded by a second AUG, in-frame to the full-length gene

    Directory of Open Access Journals (Sweden)

    Alvarez Rene

    2005-04-01

    Full Text Available Abstract Background Avian metapneumoviruses (aMPV cause an upper respiratory disease with low mortality, but high morbidity primarily in commercial turkeys. There are three types of aMPV (A, B, C of which the C type is found only in the United States. Viruses related to aMPV include human, bovine, ovine, and caprine respiratory syncytial viruses and pneumonia virus of mice, as well as the recently identified human metapneumovirus (hMPV. The aMPV and hMPV have become the type viruses of a new genus within the Metapneumovirus. The aMPV nucleoprotein (N amino acid sequences of serotypes A, B, and C were aligned for comparative analysis. Based on predicted antigenicity of consensus protein sequences, five aMPV-specific N peptides were synthesized for development of peptide-antigens and antisera. Results The presence of two aMPV nucleoprotein (N gene encoded polypeptides was detected in aMPV/C/US/Co and aMPV/A/UK/3b infected Vero cells. Nucleoprotein 1 (N1 encoded from the first open reading frame (ORF was predicted to be 394 amino acids in length for aMPV/C/US/Co and 391 amino acids in length for aMPV/A/UK/3b with approximate molecular weights of 43.3 kilodaltons and 42.7 kilodaltons, respectively. Nucleoprotein 2 (N2 was hypothesized to be encoded by a second downstream ORF in-frame with ORF1 and encoded a protein predicted to contain 328 amino acids for aMPV/C/US/Co or 259 amino acids for aMPV/A/UK/3b with approximate molecular weights of 36 kilodaltons and 28.3 kilodaltons, respectively. Peptide antibodies to the N-terminal and C-terminal portions of the aMPV N protein confirmed presence of these products in both aMPV/C/US/Co- and aMPV/A/UK/3b-infected Vero cells. N1 and N2 for aMPV/C/US/Co ORFs were molecularly cloned and expressed in Vero cells utilizing eukaryotic expression vectors to confirm identity of the aMPV encoded proteins. Conclusion This is the first reported identification of potential, accessory in-frame N2 ORF gene products among

  4. [Cloning and expression analysis of a zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein encoding gene in Dendrobium officinale].

    Science.gov (United States)

    Zhang, Gang; Li, Yi-Min; Li, Biao; Zhang, Da-Wei; Guo, Shun-Xing

    2015-01-01

    The zinc-regulated transporters (ZRT), iron-regulated transporter (IRT)-like protein (ZIP) plays an important role in the growth and development of plant. In this study, a full length cDNA of ZIP encoding gene, designed as DoZIP1 (GenBank accession KJ946203), was identified from Dendrobium officinale using RT-PCR and RACE. Bioinformatics analysis showed that DoZIP1 consisted of a 1,056 bp open reading frame (ORF) encoded a 351-aa protein with a molecular weight of 37.57 kDa and an isoelectric point (pI) of 6.09. The deduced DoZIP1 protein contained the conserved ZIP domain, and its secondary structure was composed of 50.71% alpha helix, 11.11% extended strand, 36.18% random coil, and beta turn 1.99%. DoZIP1 protein exhibited a signal peptide and eight transmembrane domains, presumably locating in cell membrane. The amino acid sequence had high homology with ZIP proteins from Arabidopsis, alfalfa and rice. A phylogenetic tree analysis demonstrated that DoZIP1 was closely related to AtZIP10 and OsZIP3, and they were clustered into one clade. Real time quantitative PCR analysis demonstrated that the transcription level of DoZIP1 in D. officinale roots was the highest (4.19 fold higher than that of stems), followed by that of leaves (1.12 fold). Molecular characters of DoZIP1 will be useful for further functional determination of the gene involving in the growth and development of D. officinale.

  5. GHK-Cu may Prevent Oxidative Stress in Skin by Regulating Copper and Modifying Expression of Numerous Antioxidant Genes

    Directory of Open Access Journals (Sweden)

    Loren Pickart

    2015-07-01

    Full Text Available The copper binding tripeptide GHK (glycyl-l-histidyl-l-lysine is a naturally occurring plasma peptide that significantly declines during human aging. It has been established that GHK:Copper(2+ improves wound healing and tissue regeneration and stimulates collagen and decorin production. GHK-Cu also supports angiogenesis and nerve outgrowth, improves the condition of aging skin and hair, and possesses antioxidant and anti-inflammatory effects. In addition, it increases cellular stemness and secretion of trophic factors by mesenchymal stem cells. GHK’s antioxidant actions have been demonstrated in vitro and in animal studies. They include blocking the formation of reactive oxygen and carbonyl species, detoxifying toxic products of lipid peroxidation such as acrolein, protecting keratinocytes from lethal Ultraviolet B (UVB radiation, and blocking hepatic damage by dichloromethane radicals. In recent studies, GHK has been found to switch gene expression from a diseased state to a healthier state for certain cancers and for chronic obstructive pulmonary disease (COPD. The Broad Institute’s Connectivity Map indicated that GHK induces a 50% or greater change of expression in 31.2% of human genes. This paper reviews biological data demonstrating positive effects of GHK in skin and proposes interaction with antioxidant-related genes as a possible explanation of its antioxidant activity.

  6. Construction of expression vector containing glnA gene and detection of NPT II activity in the transgenic rice calli using 32P-labelled compound

    International Nuclear Information System (INIS)

    Su Jin; Zhang Xueqin; Yan Qiusheng; Chen Zhangliang; You Chongbiao

    1993-08-01

    The glnA gene encoding glutamine synthetase (GS) was amplified from Azospirillum brasilense Sp7 by PCR technique. the amplified 1.4 kb DNA fragment was cloned at the EcoRV site of Bluescript-SK. Both sequencing and restriction digestion data showed that the 1.4 kb DNA fragment flanked with BamHI site at each end was really the glnA gene of A. brasilense Sp7. The glnA gene was ligated with Bg1 II site of pCo24. As a result, an expression vector pGSC35 with CaMV35S promoter was obtained. Using colony in situ hybridization with α- 32 P-dATP labelled probes to screen the positive clones, another glnA gene expression vector pAGNB92 with rice actin 1 promoter was constructed after three rounds of ligation and transformation. Protoplasts isolated from rice cell suspension line cv. T986 were transformed with glnA expression vectors pGSC35 and pAGNB92 containing neomycin phosphotransferase II (NPTII) gene by using PEG fusion and electroporation. Transformed microcalli were selected on media containing G418 disulfate salt. NPT II activity was detected in 37% of G418 resistant calli by using dot blot hybridization with γ- 32 P-ATP and kanamycin as substrate

  7. Bovine proteins containing poly-glutamine repeats are often polymorphic and enriched for components of transcriptional regulatory complexes

    LENUS (Irish Health Repository)

    Whan, Vicki

    2010-11-23

    Abstract Background About forty human diseases are caused by repeat instability mutations. A distinct subset of these diseases is the result of extreme expansions of polymorphic trinucleotide repeats; typically CAG repeats encoding poly-glutamine (poly-Q) tracts in proteins. Polymorphic repeat length variation is also apparent in human poly-Q encoding genes from normal individuals. As these coding sequence repeats are subject to selection in mammals, it has been suggested that normal variations in some of these typically highly conserved genes are implicated in morphological differences between species and phenotypic variations within species. At present, poly-Q encoding genes in non-human mammalian species are poorly documented, as are their functions and propensities for polymorphic variation. Results The current investigation identified 178 bovine poly-Q encoding genes (Q ≥ 5) and within this group, 26 genes with orthologs in both human and mouse that did not contain poly-Q repeats. The bovine poly-Q encoding genes typically had ubiquitous expression patterns although there was bias towards expression in epithelia, brain and testes. They were also characterised by unusually large sizes. Analysis of gene ontology terms revealed that the encoded proteins were strongly enriched for functions associated with transcriptional regulation and many contributed to physical interaction networks in the nucleus where they presumably act cooperatively in transcriptional regulatory complexes. In addition, the coding sequence CAG repeats in some bovine genes impacted mRNA splicing thereby generating unusual transcriptional diversity, which in at least one instance was tissue-specific. The poly-Q encoding genes were prioritised using multiple criteria for their likelihood of being polymorphic and then the highest ranking group was experimentally tested for polymorphic variation within a cattle diversity panel. Extensive and meiotically stable variation was identified

  8. Incorporation of copper ions into crystals of T2 copper-depleted laccase from Botrytis aclada

    International Nuclear Information System (INIS)

    Osipov, E. M.; Polyakov, K. M.; Tikhonova, T. V.; Kittl, R.; Dorovatovskii, P.V.; Shleev, S. V.; Popov, V. O.; Ludwig, R.

    2015-01-01

    The restoration of the native form of laccase from B. aclada from the type 2 copper-depleted form of the enzyme was investigated. Copper ions were found to be incorporated into the active site after soaking the depleted enzyme in a Cu + -containing solution. Laccases belong to the class of multicopper oxidases catalyzing the oxidation of phenols accompanied by the reduction of molecular oxygen to water without the formation of hydrogen peroxide. The activity of laccases depends on the number of Cu atoms per enzyme molecule. The structure of type 2 copper-depleted laccase from Botrytis aclada has been solved previously. With the aim of obtaining the structure of the native form of the enzyme, crystals of the depleted laccase were soaked in Cu + - and Cu 2+ -containing solutions. Copper ions were found to be incorporated into the active site only when Cu + was used. A comparative analysis of the native and depleted forms of the enzymes was performed

  9. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  10. Ammonia leaching of copper smelter dust and precipitation as copper sulphide; Lixiviacion amoniacal de polvos de fundicion de cobre y precipitacion como sulfuro de cobre

    Energy Technology Data Exchange (ETDEWEB)

    Morales, A.; Hevia, J. F.; Cifuentes, G.

    2009-07-01

    The effect of ammonia on the leaching of copper smelter dust and copper precipitation from these solutions as sulphide using sulfur and sulfur dioxide was studied. The precipitation was done in ammoniacal media because this solution produced more satisfactory results at room temperature that a sulphuric media. A solid was precipitated containing 60 % of copper of the dust smelter. The other waste generated contained around 80 % of the arsenic of the original copper smelter dust. Based on the preliminary results obtained in this work it will propose a procedure for the recovery of copper as sulphide from copper smelter dust with parallel confinement of arsenic. (Author) 14 refs.

  11. Properties of the simian virus 40 (SV40) large T antigens encoded by SV40 mutants with deletions in gene A.

    Science.gov (United States)

    Cole, C N; Tornow, J; Clark, R; Tjian, R

    1986-01-01

    The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional

  12. Cop-like operon: Structure and organization in species of the Lactobacillale order

    Directory of Open Access Journals (Sweden)

    ANGÉLICA REYES

    2006-01-01

    Full Text Available Copper is an essential and toxic trace metal for bacteria and, therefore, must be tightly regulated in the cell. Enterococcus hirae is a broadly studied model for copper homeostasis. The intracellular copper levels in E. hirae are regulated by the cop operon, which is formed by four genes: copA and copB that encode ATPases for influx and efflux of copper, respectively; copZ that encodes a copper chaperone; and copY, a copper responsive repressor. Since the complete genome sequence for E. hirae is not available, it is possible that other genes may encode proteins involved in copper homeostasis. Here, we identified a cop-like operon in nine species of Lactobacillale order with a known genome sequence. All of them always encoded a CopY-like repressor and a copper ATPase. The alignment of the cop-like operon promoter region revealed two CopY binding sites, one of which was conserved in all strains, and the second was only present in species of Streptococcus genus and L. johnsonii. Additional proteins associated to copper metabolism, CutC and Cupredoxin, also were detected. This study allowed for the description of the structure and organization of the cop operon and discussion of a phylogenetic hypothesis based on the differences observed in this operon's organization and its regulation in Lactobacillale order.

  13. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  14. Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2 in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues

    Directory of Open Access Journals (Sweden)

    Hyun Uk Kim

    2014-01-01

    Full Text Available The LEAFY COTYLEDON2 (LEC2 gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis, and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1, LEAFY COTYLEDON1-LIKE (L1L, FUSCA3 (FUS3, and ABSCISIC ACID INSENSITIVE 3 (ABI3 transcripts for seed maturation, and WRINKELED1 (WRI1 transcripts for fatty acid biosynthesis, as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1 and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11, in vegetative tissues.

  15. Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2) in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues.

    Science.gov (United States)

    Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum

    2013-01-01

    The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1(Δ11)), in vegetative tissues.

  16. Ectopic overexpression of castor bean LEAFY COTYLEDON2 (LEC2) in Arabidopsis triggers the expression of genes that encode regulators of seed maturation and oil body proteins in vegetative tissues☆

    Science.gov (United States)

    Kim, Hyun Uk; Jung, Su-Jin; Lee, Kyeong-Ryeol; Kim, Eun Ha; Lee, Sang-Min; Roh, Kyung Hee; Kim, Jong-Bum

    2013-01-01

    The LEAFY COTYLEDON2 (LEC2) gene plays critically important regulatory roles during both early and late embryonic development. Here, we report the identification of the LEC2 gene from the castor bean plant (Ricinus communis), and characterize the effects of its overexpression on gene regulation and lipid metabolism in transgenic Arabidopsis plants. LEC2 exists as a single-copy gene in castor bean, is expressed predominantly in embryos, and encodes a protein with a conserved B3 domain, but different N- and C-terminal domains to those found in LEC2 from Arabidopsis. Ectopic overexpression of LEC2 from castor bean under the control of the cauliflower mosaic virus (CaMV) 35S promoter in Arabidopsis plants induces the accumulation of transcripts that encodes five major transcription factors (the LEAFY COTYLEDON1 (LEC1), LEAFY COTYLEDON1-LIKE (L1L), FUSCA3 (FUS3), and ABSCISIC ACID INSENSITIVE 3 (ABI3) transcripts for seed maturation, and WRINKELED1 (WRI1) transcripts for fatty acid biosynthesis), as well as OLEOSIN transcripts for the formation of oil bodies in vegetative tissues. Transgenic Arabidopsis plants that express the LEC2 gene from castor bean show a range of dose-dependent morphological phenotypes and effects on the expression of LEC2-regulated genes during seedling establishment and vegetative growth. Expression of castor bean LEC2 in Arabidopsis increased the expression of fatty acid elongase 1 (FAE1) and induced the accumulation of triacylglycerols, especially those containing the seed-specific fatty acid, eicosenoic acid (20:1Δ11), in vegetative tissues. PMID:24363987

  17. Thin-layer heap bioleaching of copper flotation tailings containing high levels of fine grains and microbial community succession analysis

    Science.gov (United States)

    Hao, Xiao-dong; Liang, Yi-li; Yin, Hua-qun; Liu, Hong-wei; Zeng, Wei-min; Liu, Xue-duan

    2017-04-01

    Thin-layer heap bioleaching of copper flotation tailings containing high levels of fine grains was carried out by mixed cultures on a small scale over a period of 210 d. Lump ores as a framework were loaded at the bottom of the ore heap. The overall copper leaching rates of tailings and lump ores were 57.10wt% and 65.52wt%, respectively. The dynamic shifts of microbial community structures about attached microorganisms were determined using the Illumina MiSeq sequencing platform based on 16S rRNA amplification strategy. The results indicated that chemolithotrophic genera Acidithiobacillus and Leptospirillum were always detected and dominated the microbial community in the initial and middle stages of the heap bioleaching process; both genera might be responsible for improving the copper extraction. However, Thermogymnomonas and Ferroplasma increased gradually in the final stage. Moreover, the effects of various physicochemical parameters and microbial community shifts on the leaching efficiency were further investigated and these associations provided some important clues for facilitating the effective application of bioleaching.

  18. Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera,Apidae

    Directory of Open Access Journals (Sweden)

    Moysés Elias-Neto

    2013-06-01

    Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.

  19. Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine.

    Directory of Open Access Journals (Sweden)

    Utut Widyastuti Suharsono

    2008-11-01

    Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.

  20. Two pheromone precursor genes are transcriptionally expressed in the homothallic ascomycete Sordaria macrospora.

    Science.gov (United States)

    Pöggeler, S

    2000-06-01

    In order to analyze the involvement of pheromones in cell recognition and mating in a homothallic fungus, two putative pheromone precursor genes, named ppg1 and ppg2, were isolated from a genomic library of Sordaria macrospora. The ppg1 gene is predicted to encode a precursor pheromone that is processed by a Kex2-like protease to yield a pheromone that is structurally similar to the alpha-factor of the yeast Saccharomyces cerevisiae. The ppg2 gene encodes a 24-amino-acid polypeptide that contains a putative farnesylated and carboxy methylated C-terminal cysteine residue. The sequences of the predicted pheromones display strong structural similarity to those encoded by putative pheromones of heterothallic filamentous ascomycetes. Both genes are expressed during the life cycle of S. macrospora. This is the first description of pheromone precursor genes encoded by a homothallic fungus. Southern-hybridization experiments indicated that ppg1 and ppg2 homologues are also present in other homothallic ascomycetes.

  1. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  2. Moderate Dilution of Copper Slag by Natural Gas

    Science.gov (United States)

    Zhang, Bao-jing; Zhang, Ting-an; Niu, Li-ping; Liu, Nan-song; Dou, Zhi-he; Li, Zhi-qiang

    2018-01-01

    To enable use of copper slag and extract the maximum value from the contained copper, an innovative method of reducing moderately diluted slag to smelt copper-containing antibacterial stainless steel is proposed. This work focused on moderate dilution of copper slag using natural gas. The thermodynamics of copper slag dilution and ternary phase diagrams of the slag system were calculated. The effects of blowing time, temperature, matte settling time, and calcium oxide addition were investigated. The optimum reaction conditions were identified to be blowing time of 20 min, reaction temperature of 1250°C, settling time of 60 min, CaO addition of 4% of mass of slag, natural gas flow rate of 80 mL/min, and outlet pressure of 0.1 MPa. Under these conditions, the Fe3O4 and copper contents of the residue were 7.36% and 0.50%, respectively.

  3. glucuronidase gene in indica and japonica rice (Oryza sativa L.)

    African Journals Online (AJOL)

    Plasmid pUCGUS containing the uidA gene encoding β- lucuronidase was used to optimize transformation conditions using various combinations of helium pressure, target distance and gap distance. Plasmid pHX4 carrying hygromycin phosphotransferase (hph) gene and pUCGUS was used for co bombardment.

  4. A Purple Cupredoxin from Nitrosopumilus maritimus Containing a Mononuclear Type 1 Copper Center with an Open Binding Site

    Energy Technology Data Exchange (ETDEWEB)

    Hosseinzadeh, Parisa; Tian, Shiliang; Marshall, Nicholas M.; Hemp, James; Mullen, Timothy; Nilges, Mark J.; Gao, Yi-Gui; Robinson, Howard; Stahl, David A.; Gennis, Robert B.; Lu, Yi

    2016-05-25

    Mononuclear cupredoxin proteins usually contain a coordinately saturated type 1 copper (T1Cu) center and function exclusively as electron carriers. Here we report a cupredoxin isolated from the nitrifying archaeon Nitrosopumilus maritimus SCM1, called Nmar1307, that contains a T1Cu center with an open binding site containing water. It displays a deep purple color due to strong absorptions around 413 nm (1880 M–1 cm–1) and 558 nm (2290 M–1 cm–1) in the UV–vis electronic spectrum. EPR studies suggest the protein contains two Cu(II) species of nearly equal population, one nearly axial, with hyperfine constant A∥ = 98 × 10–4 cm–1, and another more rhombic, with a smaller A∥ value of 69 × 10–4 cm–1. The X-ray crystal structure at 1.6 Å resolution confirms that it contains a Cu atom coordinated by two His and one Cys in a trigonal plane, with an axial H2O at 2.25 Å. Both UV–vis absorption and EPR spectroscopic studies suggest that the Nmar1307 can oxidize NO to nitrite, an activity that is attributable to the high reduction potential (354 mV vs SHE) of the copper site. These results suggest that mononuclear cupredoxins can have a wide range of structural features, including an open binding site containing water, making this class of proteins even more versatile.

  5. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B.; Lévesque, Céline M.

    2015-01-01

    ABSTRACT In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans

  6. The copYAZ Operon Functions in Copper Efflux, Biofilm Formation, Genetic Transformation, and Stress Tolerance in Streptococcus mutans.

    Science.gov (United States)

    Singh, Kamna; Senadheera, Dilani B; Lévesque, Céline M; Cvitkovitch, Dennis G

    2015-08-01

    In bacteria, copper homeostasis is closely monitored to ensure proper cellular functions while avoiding cell damage. Most Gram-positive bacteria utilize the copYABZ operon for copper homeostasis, where copA and copB encode copper-transporting P-type ATPases, whereas copY and copZ regulate the expression of the cop operon. Streptococcus mutans is a biofilm-forming oral pathogen that harbors a putative copper-transporting copYAZ operon. Here, we characterized the role of copYAZ operon in the physiology of S. mutans and delineated the mechanisms of copper-induced toxicity in this bacterium. We observed that copper induced toxicity in S. mutans cells by generating oxidative stress and disrupting their membrane potential. Deletion of the copYAZ operon in S. mutans strain UA159 resulted in reduced cell viability under copper, acid, and oxidative stress relative to the viability of the wild type under these conditions. Furthermore, the ability of S. mutans to form biofilms and develop genetic competence was impaired under copper stress. Briefly, copper stress significantly reduced cell adherence and total biofilm biomass, concomitantly repressing the transcription of the gtfB, gtfC, gtfD, gbpB, and gbpC genes, whose products have roles in maintaining the structural and/or functional integrity of the S. mutans biofilm. Furthermore, supplementation with copper or loss of copYAZ resulted in significant reductions in transformability and in the transcription of competence-associated genes. Copper transport assays revealed that the ΔcopYAZ strain accrued significantly large amounts of intracellular copper compared with the amount of copper accumulation in the wild-type strain, thereby demonstrating a role for CopYAZ in the copper efflux of S. mutans. The complementation of the CopYAZ system restored copper expulsion, membrane potential, and stress tolerance in the copYAZ-null mutant. Taking these results collectively, we have established the function of the S. mutans Cop

  7. Copper oxide nanoparticles induce the transcriptional modulation of oxidative stress-related genes in Arbacia lixula embryos.

    Science.gov (United States)

    Giannetto, Alessia; Cappello, Tiziana; Oliva, Sabrina; Parrino, Vincenzo; De Marco, Giuseppe; Fasulo, Salvatore; Mauceri, Angela; Maisano, Maria

    2018-06-14

    Copper oxide nanoparticles (CuO NPs) are widely used in various industrial applications, i.e. semiconductor devices, batteries, solar energy converter, gas sensor, microelectronics, heat transfer fluids, and have been recently recognized as emerging pollutants of increasing concern for human and marine environmental health. Therefore, the toxicity of CuO NPs needs to be thoroughly understood. In this study, we evaluated the potential role of oxidative stress in CuO NP toxicity by exploring the molecular response of Arbacia lixula embryos to three CuO NP concentrations (0.7, 10, 20 ppb) by investigating the transcriptional patterns of oxidative stress-related genes (catalase and superoxide dismutase) and metallothionein, here cloned and characterized for the first time. Time- and concentration-dependent changes in gene expression were detected in A. lixula embryos exposed to CuO NPs, up to pluteus stage (72 h post-fertilization, hpf), indicating that oxidative stress is one of the toxicity mechanisms for CuO NPs. These findings provide new insights into the comprehension of the molecular mechanisms underlying copper nanoparticle toxicity in A. lixula sea urchin and give new tools for monitoring of aquatic areas, thus corroborating the suitability of this embryotoxicity assay for future evaluation of impacted sites. Copyright © 2018 Elsevier B.V. All rights reserved.

  8. Evaluation of copper, aluminum bronze, and copper-nickel for YMP [Yucca Mountain Project] container material

    International Nuclear Information System (INIS)

    Kass, J.N.

    1989-05-01

    In this presentation, I will discuss our evaluation of the materials copper, 7% aluminum bronze, and 70/30 copper-nickel. These are three of the six materials currently under consideration as potential waste-packaging materials. I should mention that we are also considering alternatives to these six materials. This work is part of the Yucca Mountain Project (YMP), formerly known as the Nevada Nuclear Waste Storage Investigations (NNWSI) Project. The expected-case environment in our proposed vault is quite different from that encountered at the WIPP site or that expected in a Canadian vault. Our proposed site is under a desert mountain, Yucca Mountain, in southern Nevada. The repository itself will be located approximately 700 feet above the water table and 300 to 1200 feet below the surface of the mountain. The variations in these numbers are due to the variations in mountain topography

  9. Arabidopsis EMB1990 Encoding a Plastid-Targeted YlmG Protein Is Required for Chloroplast Biogenesis and Embryo Development

    Directory of Open Access Journals (Sweden)

    Hongyu Chen

    2018-02-01

    Full Text Available In higher plants, embryo development originated from fertilized egg cell is the first step of the life cycle. The chloroplast participates in many essential metabolic pathways, and its function is highly associated with embryo development. However, the mechanisms and relevant genetic components by which the chloroplast functions in embryogenesis are largely uncharacterized. In this paper, we describe the Arabidopsis EMB1990 gene, encoding a plastid-targeted YlmG protein which is required for chloroplast biogenesis and embryo development. Loss of the EMB1990/YLMG1-1 resulted in albino seeds containing abortive embryos, and the morphological development of homozygous emb1990 embryos was disrupted after the globular stage. Our results showed that EMB1990/YLMG1-1 was expressed in the primordia and adaxial region of cotyledon during embryogenesis, and the encoded protein was targeted to the chloroplast. TEM observation of cellular ultrastructure showed that chloroplast biogenesis was impaired in emb1990 embryo cells. Expression of certain plastid genes was also affected in the loss-of-function mutants, including genes encoding core protein complex subunits located in the thylakoid membrane. Moreover, the tissue-specific genes of embryo development were misexpressed in emb1990 mutant, including genes known to delineate cell fate decisions in the SAM (shoot apical meristem, cotyledon and hypophysis. Taken together, we propose that the nuclear-encoded YLMG1-1 is targeted to the chloroplast and required for normal plastid gene expression. Hence, YLMG1-1 plays a critical role in Arabidopsis embryogenesis through participating in chloroplast biogenesis.

  10. The Populus superoxide dismutase gene family and its responses to drought stress in transgenic poplar overexpressing a pine cytosolic glutamine synthetase (GS1a.

    Directory of Open Access Journals (Sweden)

    Juan Jesús Molina-Rueda

    Full Text Available BACKGROUND: Glutamine synthetase (GS plays a central role in plant nitrogen assimilation, a process intimately linked to soil water availability. We previously showed that hybrid poplar (Populus tremula X alba, INRA 717-1B4 expressing ectopically a pine cytosolic glutamine synthetase gene (GS1a display enhanced tolerance to drought. Preliminary transcriptome profiling revealed that during drought, members of the superoxide dismutase (SOD family were reciprocally regulated in GS poplar when compared with the wild-type control, in all tissues examined. SOD was the only gene family found to exhibit such patterns. RESULTS: In silico analysis of the Populus genome identified 12 SOD genes and two genes encoding copper chaperones for SOD (CCSs. The poplar SODs form three phylogenetic clusters in accordance with their distinct metal co-factor requirements and gene structure. Nearly all poplar SODs and CCSs are present in duplicate derived from whole genome duplication, in sharp contrast to their predominantly single-copy Arabidopsis orthologs. Drought stress triggered plant-wide down-regulation of the plastidic copper SODs (CSDs, with concomitant up-regulation of plastidic iron SODs (FSDs in GS poplar relative to the wild type; this was confirmed at the activity level. We also found evidence for coordinated down-regulation of other copper proteins, including plastidic CCSs and polyphenol oxidases, in GS poplar under drought conditions. CONCLUSIONS: Both gene duplication and expression divergence have contributed to the expansion and transcriptional diversity of the Populus SOD/CCS families. Coordinated down-regulation of major copper proteins in drought-tolerant GS poplars supports the copper cofactor economy model where copper supply is preferentially allocated for plastocyanins to sustain photosynthesis during drought. Our results also extend previous findings on the compensatory regulation between chloroplastic CSDs and FSDs, and suggest that this

  11. Cloning of araA Gene Encoding L-Arabinose Isomerase from Marine Geobacillus stearothermophilus Isolated from Tanjung Api, Poso, Indonesia

    Directory of Open Access Journals (Sweden)

    DEWI FITRIANI

    2010-06-01

    Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.

  12. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  13. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  14. The human thyroglobulin gene is over 300 kb long and contains introns of up to 64 kb

    NARCIS (Netherlands)

    Baas, F.; van Ommen, G. J.; Bikker, H.; Arnberg, A. C.; de Vijlder, J. J.

    1986-01-01

    Thyroglobulin (Tg), the precursor of thyroid hormones, is a 660.000 Da dimeric glycoprotein synthesized exclusively in the thyroid gland. We have cloned the human thyroglobulin gene from cosmid and phage libraries and constructed a complete restriction map. The gene encodes an 8.7 kb mRNA, covers at

  15. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  16. Expression analysis of the Arabidopsis thaliana AtSpen2 gene, and its relationship with other plant genes encoding Spen proteins

    OpenAIRE

    Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel

    2017-01-01

    Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...

  17. Fresh and mechanical properties of self compacting concrete containing copper slag as fine aggregates

    Directory of Open Access Journals (Sweden)

    Rahul Sharma

    2017-03-01

    Full Text Available An investigation is carried out on the development of Self Compacting Concrete (SCC using copper slag (CS as fine aggregates with partial and full replacement of sand. Six different SCC mixes (60% OPC and 40% Fly Ash with 0% as control mix, 20%, 40%, 60%, 80% and 100% of copper slag substituting sand with constant w/b ratio of 0.45 were cast and tested for fresh properties of SCC. Compressive strength and splitting tensile strength were evaluated at different ages and microstructural analysis was observed at 120 days. It has been observed that the fluidity of SCC mixes was significantly enhanced with the increment of copper slag. The test results showed that the compressive strength increases up to 60% copper slag as replacement of sand, beyond which decrease in strength was observed. The highest compressive strength was obtained at 20% copper slag substitution at different curing ages among all the mixes, except for 7 days curing. The splitting tensile strength of the CS substituted mixes in comparison to control concrete was found to increase at all the curing ages but the remarkable achievement of strength was detected at 60% copper slag replacement. The microscopic view from Scanning electron microscopy (SEM demonstrated more voids, capillary channels, and micro cracks with the increment of copper slag as substitution of sand as compared to the control mix.

  18. Copper Recycling in the United States in 2004

    Science.gov (United States)

    Goonan, Thomas G.

    2009-01-01

    As one of a series of reports that describe the recycling of metal commodities in the United States, this report discusses the flow of copper from production through distribution and use, with particular emphasis on the recycling of industrial scrap (new scrap1) and used products (old scrap) in the year 2004. This materials flow study includes a description of copper supply and demand for the United States to illustrate the extent of copper recycling and to identify recycling trends. Understanding how materials flow from a source through disposition can aid in improving the management of natural resource delivery systems. In 2004, the U.S. refined copper supply was 2.53 million metric tons (Mt) of refined unalloyed copper. With adjustment for refined copper exports of 127,000 metric tons (t) of copper, the net U.S. refined copper supply was 2.14 Mt of copper. With this net supply and a consumer inventory decrease of 9,000 t of refined copper, 2.42 Mt of refined copper was consumed by U.S. semifabricators (brass mills, wire rod mills, ingot makers, and foundries and others) in 2004. In addition to the 2.42 Mt of refined copper consumed in 2004, U.S. copper semifabricators consumed 853,000 t of copper contained in recycled scrap. Furthermore, 61,000 t of copper contained in scrap was consumed by noncopper alloy makers, for example, steelmakers and aluminum alloy makers. Old scrap recycling efficiency for copper was estimated to be 43 percent of theoretical old scrap supply, the recycling rate for copper was 30 percent of apparent supply, and the new-scrap-to-old-scrap ratio for U.S. copper product production was 3.2 (76:24).

  19. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  20. A plasmid-encoded nicotinamidase (PncA) is essential for infectivity of Borrelia burgdorferi in a mammalian host.

    Science.gov (United States)

    Purser, Joye E; Lawrenz, Matthew B; Caimano, Melissa J; Howell, Jerrilyn K; Radolf, Justin D; Norris, Steven J

    2003-05-01

    Borrelia burgdorferi, a spirochaete that causes Lyme borreliosis, contains 21 linear and circular plasmids thought to be important for survival in mammals or ticks. Our results demonstrate that the gene BBE22 encoding a nicotinamidase is capable of replacing the requirement for the 25 kb linear plasmid lp25 during mammalian infection. Transformation of B. burgdorferi lacking lp25 with a shuttle vector containing the lp25 gene BBE22 (pBBE22) restored infectivity in mice to a level comparable to that of wild-type Borrelia. This complementation also restored the growth and host adaptation of lp25-B. burgdorferi in dialysis membrane chambers (DMCs) implanted in rats. A single Cys to Ala conversion at the putative active site of BBE22 abrogated the ability of pBBE22 to re-establish infectivity or growth in DMCs. Additional Salmonella typhimurium complementation studies and enzymatic analysis demonstrated that the BBE22 gene product has nicotinamidase activity and is most probably required for the biosynthesis of NAD. These results indicate that some plasmid-encoded products fulfil physiological functions required in the enzootic cycle of pathogenic Borrelia.

  1. A DNMT3B alternatively spliced exon and encoded peptide are novel biomarkers of human pluripotent stem cells.

    Directory of Open Access Journals (Sweden)

    Sailesh Gopalakrishna-Pillai

    Full Text Available A major obstacle in human stem cell research is the limited number of reagents capable of distinguishing pluripotent stem cells from partially differentiated or incompletely reprogrammed derivatives. Although human embryonic stem cells (hESCs and induced pluripotent stem cells (iPSCs express numerous alternatively spliced transcripts, little attention has been directed at developing splice variant-encoded protein isoforms as reagents for stem cell research. In this study, several genes encoding proteins involved in important signaling pathways were screened to detect alternatively spliced transcripts that exhibited differential expression in pluripotent stem cells (PSCs relative to spontaneously differentiated cells (SDCs. Transcripts containing the alternatively spliced exon 10 of the de novo DNA methyltransferase gene, DNMT3B, were identified that are expressed in PSCs. To demonstrate the utility and superiority of splice variant specific reagents for stem cell research, a peptide encoded by DNMT3B exon 10 was used to generate an antibody, SG1. The SG1 antibody detects a single DNMT3B protein isoform that is expressed only in PSCs but not in SDCs. The SG1 antibody is also demonstrably superior to other antibodies at distinguishing PSCs from SDCs in mixed cultures containing both pluripotent stem cells and partially differentiated derivatives. The tightly controlled down regulation of DNMT3B exon 10 containing transcripts (and exon 10 encoded peptide upon spontaneous differentiation of PSCs suggests that this DNMT3B splice isoform is characteristic of the pluripotent state. Alternatively spliced exons, and the proteins they encode, represent a vast untapped reservoir of novel biomarkers that can be used to develop superior reagents for stem cell research and to gain further insight into mechanisms controlling stem cell pluripotency.

  2. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    OpenAIRE

    Xu, J; Johnson, R C

    1995-01-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...

  3. Exon organization of the mouse entactin gene corresponds to the structural domains of the polypeptide and has regional homology to the low-density lipoprotein receptor gene

    DEFF Research Database (Denmark)

    Durkin, M E; Wewer, U M; Chung, A E

    1995-01-01

    of the mouse entactin gene closely corresponds to the organization of the polypeptide into distinct structural and functional domains. The two amino-terminal globular domains are encoded by three exons each. Single exons encode the two protease-sensitive, O-glycosylated linking regions. The six EGF......Entactin is a widespread basement membrane protein of 150 kDa that binds to type IV collagen and laminin. The complete exon-intron structure of the mouse entactin gene has been determined from lambda genomic DNA clones. The gene spans at least 65 kb and contains 20 exons. The exon organization...

  4. Tetrahymena thermophila acidic ribosomal protein L37 contains an archaebacterial type of C-terminus

    DEFF Research Database (Denmark)

    Hansen, T S; Andreasen, P H; Dreisig, H

    1991-01-01

    We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63 ...... by protein sequencing. The T. thermophila L37 clearly belongs to the P1-type family of eukaryotic A-proteins, but the C-terminal region has the hallmarks of archaebacterial A-proteins.......We have cloned and characterized a Tetrahymena thermophila macronuclear gene (L37) encoding the acidic ribosomal protein (A-protein) L37. The gene contains a single intron located in the 3'-part of the coding region. Two major and three minor transcription start points (tsp) were mapped 39 to 63...... nucleotides upstream from the translational start codon. The uppermost tsp mapped to the first T in a putative T. thermophila RNA polymerase II initiator element, TATAA. The coding region of L37 predicts a protein of 109 amino acid (aa) residues. A substantial part of the deduced aa sequence was verified...

  5. LETM1, a novel gene encoding a putative EF-hand Ca(2+)-binding protein, flanks the Wolf-Hirschhorn syndrome (WHS) critical region and is deleted in most WHS patients.

    Science.gov (United States)

    Endele, S; Fuhry, M; Pak, S J; Zabel, B U; Winterpacht, A

    1999-09-01

    Deletions within human chromosome 4p16.3 cause Wolf-Hirschhorn syndrome (WHS), which is characterized by severe mental and developmental defects. It is thought that haploinsufficiency of more than one gene contributes to the complex phenotype. We have cloned and characterized a novel gene (LETM1) that is deleted in nearly all WHS patients. LETM1 encodes a putative member of the EF-hand family of Ca(2+)-binding proteins. The protein contains two EF-hands, a transmembrane domain, a leucine zipper, and several coiled-coil domains. On the basis of its possible Ca(2+)-binding property and involvement in Ca(2+) signaling and/or homeostasis, we propose that haploinsufficiency of LETM1 may contribute to the neuromuscular features of WHS patients. Copyright 1999 Academic Press.

  6. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  7. Dissemination of Genes Encoding Aminoglycoside-Modifying Enzymes and armA Among Enterobacteriaceae Isolates in Northwest Iran.

    Science.gov (United States)

    Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda

    2017-10-01

    Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.

  8. Electrochemical behaviour of alkaline copper complexes

    Indian Academy of Sciences (India)

    Abstract. A search for non-cyanide plating baths for copper resulted in the development of alkaline copper complex baths containing trisodium citrate [TSC] and triethanolamine [TEA]. Voltammetric studies were carried out on platinum to understand the electrochemical behaviour of these complexes. In TSC solutions, the.

  9. Disease Modeling and Gene Therapy of Copper Storage Disease in Canine Hepatic Organoids

    Directory of Open Access Journals (Sweden)

    Sathidpak Nantasanti

    2015-11-01

    Full Text Available The recent development of 3D-liver stem cell cultures (hepatic organoids opens up new avenues for gene and/or stem cell therapy to treat liver disease. To test safety and efficacy, a relevant large animal model is essential but not yet established. Because of its shared pathologies and disease pathways, the dog is considered the best model for human liver disease. Here we report the establishment of a long-term canine hepatic organoid culture allowing undifferentiated expansion of progenitor cells that can be differentiated toward functional hepatocytes. We show that cultures can be initiated from fresh and frozen liver tissues using Tru-Cut or fine-needle biopsies. The use of Wnt agonists proved important for canine organoid proliferation and inhibition of differentiation. Finally, we demonstrate that successful gene supplementation in hepatic organoids of COMMD1-deficient dogs restores function and can be an effective means to cure copper storage disease.

  10. Copper metabolism: a multicompartmental model of copper kinetics in the rat

    International Nuclear Information System (INIS)

    Dunn, M.A.

    1985-01-01

    A qualitative multicompartmental model was developed that describes the whole-body kinetics of copper metabolism in the adult rat. The model was developed from radiocopper percent dose vs. time data measured over a three day period in plasma, liver, skin, skeletal muscle, bile and feces after the intravenous injection of 10 μg copper labeled with 64 Cu. Plasma radiocopper was separated into ceruloplasmin (Cp) and nonceruloplasmin (NCp) fractions. Liver cytosolic radiocopper was fractionated into void volume superoxide dismutase (SOD) containing and metallothionein fractions by gel filtration. Liver particulate fractions were isolated by differential centrifugation. The SAAM and CONSAM modeling programs were used to develop the model. The sizes of compartments, fractional rate constants and mass transfer rates between compartments were evaluated. The intracellular metabolism of copper was similar in hepatic and extrahepatic tissues being comprised of a faster turning over compartment (FTC) exchanging copper with NCp and a slower turning over compartment (STC) with input from Cp. Output from the STC was into the FTC. In the liver the STC was postulated to represent SOD copper which unlike the extrahepatic tissues received much of its input from the FTC. A small amount of biliary copper (9%) was postulated to return to plasma NCp by enterohepatic recycling. The model developed was contrasted and compared with two previous models of copper metabolism

  11. Engineering drought tolerant tomato plants over-expressing BcZAT12 gene encoding a C₂H₂ zinc finger transcription factor.

    Science.gov (United States)

    Rai, Avinash Chandra; Singh, Major; Shah, Kavita

    2013-01-01

    Efficient genetic transformation of cotyledonary explants of tomato (Solanum lycopersicum, cv. H-86, Kashi vishesh) was obtained. Disarmed Agrobacterium tumifaciens strain GV 3101 was used in conjugation with binary vector pBinAR containing a construct consisting of the coding sequence of the BcZAT12 gene under the regulatory control of the stress inducible Bclea1a promoter. ZAT12 encodes a C₂H₂ zinc finger protein which confers multiple abiotic stress tolerance to plants. Integration of ZAT12 gene into nuclear genome of individual kanamycin resistant transformed T₀ tomato lines was confirmed by Southern blot hybridization with segregation analysis of T(1) plants showing Mendelian inheritance of the transgene. Expression of ZAT12 in drought-stressed transformed tomato lines was verified in T₂ generation plants using RT-PCR. Of the six transformed tomato lines (ZT1-ZT6) the transformants ZT1 and ZT5 showed maximum expression of BcZAT12 gene transcripts when exposed to 7 days drought stress. Analysis of relative water content (RWC), electrolyte leakage (EL), chlorophyll colour index (CCI), H₂O₂ level and catalase activity suggested that tomato BcZAT12 transformants ZT1 and ZT5 have significantly increased levels of drought tolerance. These results suggest that BcZAT12 transformed tomato cv. H-86 has real potential for molecular breeding programs aimed at augmenting yield of tomato in regions affected with drought stress. Copyright © 2012 Elsevier Ltd. All rights reserved.

  12. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  13. Evaluation of low copper content antifouling paints containing natural phenolic compounds as bioactive additives.

    Science.gov (United States)

    Pérez, Miriam; García, Mónica; Blustein, Guillermo

    2015-08-01

    Cuprous oxide is the most commonly used biocide in antifouling paints. However, copper has harmful effects not only on the fouling community but also on non-target species. In the current study, we investigated the use of thymol, eugenol and guaiacol in this role combined with small quantities of copper. Phenolic compounds were tested for anti-settlement activity against cyprid larvae of the barnacle Balanus amphitrite and for their toxicity to nauplius larvae. Thymol, eugenol and guaiacol were active for anti-settlement but guaiacol had the disadvantage of being toxic to nauplius larvae. However, all of them showed therapeutic ratio>1. Antifouling paints with thymol (low copper content/thymol, LCP/T), eugenol (low copper content/eugenol, LCP/E) and guaiacol (low copper content/guaiacol, LCP/G) combined with small copper content were formulated for field trials. After 12 months exposure in the sea, statistical analysis revealed that LCP/T and LCP/E paints were the most effective combinations and had similar performances to control paints with high copper content (traditional cuprous oxide based paints). In contrast, LCP/G paint was only partially effective in preventing and inhibiting biofouling and was colonized by some hard and soft foulers. However, this antifouling paint was effective against calcareous tubeworm Hydroides elegans. In the light of various potential applications, thymol, eugenol and guaiacol have thus to be considered in future antifouling formulations. Copyright © 2015 Elsevier Ltd. All rights reserved.

  14. Gene Disruption in Scedosporium aurantiacum: Proof of Concept with the Disruption of SODC Gene Encoding a Cytosolic Cu,Zn-Superoxide Dismutase.

    Science.gov (United States)

    Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine

    2018-02-01

    Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.

  15. Imbalance of morphofunctional responses of Jurkat T lymphoblasts at short-term culturing with relief zinc- or copper-containing calcium phosphate coating on titanium.

    Science.gov (United States)

    Litvinova, L S; Shupletsova, V V; Dunets, N A; Khaziakhmatova, O G; Yurova, K A; Khlusova, M Yu; Slepchenko, G B; Cherempey, E G; Sharkeev, Yu P; Komarova, E G; Sedelnikova, M B; Khlusov, I A

    2017-01-01

    Morphofunctional response of Jurkat T cells that were cultured for 24 h on substrates prepared from commercially pure titanium with relief microarc bilateral calcium phosphate coating containing copper or zinc was studied. Changes in the concentration of essential trace elements contained in this coating can cause significant imbalance of molecular processes of differentiation, secretion, apoptosis, and necrosis and reduce tumor cell survival.

  16. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  17. Production of Recombinant Adenovirus Containing Human Interlukin-4 Gene

    OpenAIRE

    Mojarrad, Majid; Abdolazimi, Yassan; Hajati, Jamshid; Modarressi, Mohammad Hossein

    2011-01-01

    Objective(s) Recombinant adenoviruses are currently used for a variety of purposes, including in vitro gene transfer, in vivo vaccination, and gene therapy. Ability to infect many cell types, high efficiency in gene transfer, entering both dividing and non dividing cells, and growing to high titers make this virus a good choice for using in various experiments. In the present experiment, a recombinant adenovirus containing human IL-4 coding sequence was made. IL-4 has several characteristics ...

  18. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  19. Cloning, sequencing and expression of a xylanase gene from the maize pathogen Helminthosporium turcicum

    DEFF Research Database (Denmark)

    Degefu, Y.; Paulin, L.; Lübeck, Peter Stephensen

    2001-01-01

    A gene encoding an endoxylanase from the phytopathogenic fungus Helminthosporium turcicum Pass. was cloned and sequenced. The entire nucleotide sequence of a 1991 bp genomic fragment containing an endoxylanase gene was determined. The xylanase gene of 795 bp, interrupted by two introns of 52 and ...

  20. Lack of specific hybridization between the lep genes of Salmonella typhimurium and Bacillus licheniformis

    NARCIS (Netherlands)

    van Dijl, J M; Jong, de Anne; Smith, H; Bron, Sierd; Venema, G

    1991-01-01

    This paper describes an attempt to clone the Bacillus licheniformis lep gene, encoding signal peptidase, using the Salmonella typhimurium lep gene as a hybridization probe. Although a hybridizing fragment was obtained, DNA sequence analysis indicated that it did not contain the lep gene. Instead,