Wargo, Matthew J; Szwergold, Benjamin S; Hogan, Deborah A
2008-04-01
Glycine betaine (GB), which occurs freely in the environment and is an intermediate in the catabolism of choline and carnitine, can serve as a sole source of carbon or nitrogen in Pseudomonas aeruginosa. Twelve mutants defective in growth on GB as the sole carbon source were identified through a genetic screen of a nonredundant PA14 transposon mutant library. Further growth experiments showed that strains with mutations in two genes, gbcA (PA5410) and gbcB (PA5411), were capable of growth on dimethylglycine (DMG), a catabolic product of GB, but not on GB itself. Subsequent nuclear magnetic resonance (NMR) experiments with 1,2-(13)C-labeled choline indicated that these genes are necessary for conversion of GB to DMG. Similar experiments showed that strains with mutations in the dgcAB (PA5398-PA5399) genes, which exhibit homology to genes that encode other enzymes with demethylase activity, are required for the conversion of DMG to sarcosine. Mutant analyses and (13)C NMR studies also confirmed that the soxBDAG genes, predicted to encode a sarcosine oxidase, are required for sarcosine catabolism. Our screen also identified a predicted AraC family transcriptional regulator, encoded by gbdR (PA5380), that is required for growth on GB and DMG and for the induction of gbcA, gbcB, and dgcAB in response to GB or DMG. Mutants defective in the previously described gbt gene (PA3082) grew on GB with kinetics similar to those of the wild type in both the PAO1 and PA14 strain backgrounds. These studies provided important insight into both the mechanism and the regulation of the catabolism of GB in P. aeruginosa.
Re-Factoring Glycolytic Genes for Targeted Engineering of Catabolism in Gram-Negative Bacteria
DEFF Research Database (Denmark)
Sánchez-Pascuala, Alberto; Nikel, Pablo I.; de Lorenzo, Víctor
2018-01-01
the potential applications of such a portable tool for targeted pathway engineering, in the present protocol we describe how the genes encoding all the enzymes of the linear EMP route have been individually recruited from the genome of E. coli K-12, edited in silico to remove their endogenous regulatory signals......The Embden-Meyerhof-Parnas (EMP) pathway is widely accepted to be the biochemical standard of glucose catabolism. The well-characterized glycolytic route of Escherichia coli, based on the EMP catabolism, is an example of an intricate pathway in terms of genomic organization of the genes involved...... and patterns of gene expression and regulation. This intrinsic genetic and metabolic complexity renders it difficult to engineer glycolytic activities and transfer them onto other microbial cell factories, thus limiting the biotechnological potential of bacterial hosts that lack the route. Taking into account...
Kim, K S; Farrand, S K
1996-06-01
Agrobacterium tumefaciens NT1 harboring pSaB4, which contains the 14-kb BamHI fragment 4 from the octopine/mannityl opine-type Ti plasmid pTi15955, grew well with agropine (AGR) but slowly with mannopine (MOP) as the sole carbon source. When a second plasmid encoding a dedicated transport system for MOP was introduced, these cells grew well with both AGR and MOP. Transposon insertion mutagenesis and subcloning identified a 5.7-kb region of BamHI fragment 4 that encodes functions required for the degradation of MOP. DNA sequence analysis revealed seven putative genes in this region: mocD (moc for mannityl opine catabolism) and mocE, oriented from right to left, and mocRCBAS, oriented from left to right. Significant identities exist at the nucleotide and derived amino acid sequence levels between these moc genes and the mas genes that are responsible for opine biosynthesis in crown gall tumors. MocD is a homolog of Mas2, the anabolic conjugase encoded by mas2'. MocE and MocC are related to the amino half and the carboxyl half, respectively, of Mas1 (MOP reductase), the second enzyme for MOP biosynthesis. These results indicate that the moc and mas genes evolved from a common origin. MocR and MocS are related to each other and to a putative repressor for the AGR degradation system encoded by the rhizogenic plasmid pRiA4. MocB and MocA are homologs of 6-phosphogluconate dehydratase and glucose-6-phosphate dehydrogenase, respectively. Mutations in mocD and mocE, but not mocC, are suppressed by functions encoded by the chromosome or the 450-kb megaplasmid present in many Agrobacterium isolates. We propose that moc genes derived from genes located elsewhere in the bacterial genome and that the tumor-expressed mas genes evolved from the bacterial moc genes.
Re-Factoring Glycolytic Genes for Targeted Engineering of Catabolism in Gram-Negative Bacteria.
Sánchez-Pascuala, Alberto; Nikel, Pablo I; de Lorenzo, Víctor
2018-01-01
The Embden-Meyerhof-Parnas (EMP) pathway is widely accepted to be the biochemical standard of glucose catabolism. The well-characterized glycolytic route of Escherichia coli, based on the EMP catabolism, is an example of an intricate pathway in terms of genomic organization of the genes involved and patterns of gene expression and regulation. This intrinsic genetic and metabolic complexity renders it difficult to engineer glycolytic activities and transfer them onto other microbial cell factories, thus limiting the biotechnological potential of bacterial hosts that lack the route. Taking into account the potential applications of such a portable tool for targeted pathway engineering, in the present protocol we describe how the genes encoding all the enzymes of the linear EMP route have been individually recruited from the genome of E. coli K-12, edited in silico to remove their endogenous regulatory signals, and synthesized de novo following a standard (i.e., GlucoBrick) that facilitates their grouping in the form of functional modules that can be combined at the user's will. This novel genetic tool allows for the à la carte implementation or boosting of EMP pathway activities into different Gram-negative bacteria. The potential of the GlucoBrick platform is further illustrated by engineering novel glycolytic activities in the most representative members of the Pseudomonas genus (Pseudomonas putida and Pseudomonas aeruginosa).
International Nuclear Information System (INIS)
Milcic-Terzic, J.; Saval, S.; Lopez-Vidal, Y.; Vrvic, M.M.
2001-01-01
Bioremediation is often used for in situ remediation of petroleum-contaminated sites. The primary focus of this study was on understanding the indigenous microbial community which can survive in contaminated environment and is responsible for the degradation. Diesel, toluene and naphthalene-degrading microbial consortia were isolated from diesel-contaminated soil by growing on selective hydrocarbon substrates. The presence and frequency of the catabolic genes responsible for aromatic hydrocarbon biodegradation (xylE, ndoB) within the isolated consortia were screened using polymerase chain reaction PCR and DNA-DNA colony hybridization. The diesel DNA-extract possessed both the xylE catabolic gene for toluene, and the nah catabolic gene for polynuclear aromatic hydrocarbon degradation. The toluene DNA-extract possessed only the xylE catabolic gene, while the naphthalene DNA-extract only the ndoB gene. Restriction enzyme analysis with HaeIII indicated similar restriction patterns for the xylE gene fragment between toluene DNA-extract and a type strain, Pseudomonas putida ATCC 23973. A substantial proportion (74%) of the colonies from the diesel-consortium possessed the xylE gene, and the ndoB gene (78%), while a minority (29%) of the toluene-consortium harbored the xylE gene. 59% of the colonies from the naphthalene-consortium had the ndoB gene, and did not have the xylE gene. These results indicate that the microbial population has been naturally enriched in organisms carrying genes for aromatic hydrocarbon degradation and that significant aromatic biodegradative potential exists at the site. Characterization of the population genotype constitutes a molecular diagnosis which permits the determination of the catabolic potential of the site to degrade the contaminant present. (author)
Yan, Xin; Gu, Tao; Yi, Zhongquan; Huang, Junwei; Liu, Xiaowei; Zhang, Ji; Xu, Xihui; Xin, Zhihong; Hong, Qing; He, Jian; Spain, Jim C; Li, Shunpeng; Jiang, Jiandong
2016-12-01
The worldwide use of the phenylurea herbicide, isoproturon (IPU), has resulted in considerable concern about its environmental fate. Although many microbial metabolites of IPU are known and IPU-mineralizing bacteria have been isolated, the molecular mechanism of IPU catabolism has not been elucidated yet. In this study, complete genes that encode the conserved IPU catabolic pathway were revealed, based on comparative analysis of the genomes of three IPU-mineralizing sphingomonads and subsequent experimental validation. The complete genes included a novel hydrolase gene ddhA, which is responsible for the cleavage of the urea side chain of the IPU demethylated products; a distinct aniline dioxygenase gene cluster adoQTA1A2BR, which has a broad substrate range; and an inducible catechol meta-cleavage pathway gene cluster adoXEGKLIJC. Furthermore, the initial mono-N-demethylation genes pdmAB were further confirmed to be involved in the successive N-demethylation of the IPU mono-N-demethylated product. These IPU-catabolic genes were organized into four transcription units and distributed on three plasmids. They were flanked by multiple mobile genetic elements and highly conserved among IPU-mineralizing sphingomonads. The elucidation of the molecular mechanism of IPU catabolism will enhance our understanding of the microbial mineralization of IPU and provide insights into the evolutionary scenario of the conserved IPU-catabolic pathway. © 2016 The Authors. Environmental Microbiology published by Society for Applied Microbiology and John Wiley & Sons Ltd.
Boyce, Kylie J.; McLauchlan, Alisha; Schreider, Lena; Andrianopoulos, Alex
2015-01-01
During infection, pathogens must utilise the available nutrient sources in order to grow while simultaneously evading or tolerating the host’s defence systems. Amino acids are an important nutritional source for pathogenic fungi and can be assimilated from host proteins to provide both carbon and nitrogen. The hpdA gene of the dimorphic fungus Penicillium marneffei, which encodes an enzyme which catalyses the second step of tyrosine catabolism, was identified as up-regulated in pathogenic yeast cells. As well as enabling the fungus to acquire carbon and nitrogen, tyrosine is also a precursor in the formation of two types of protective melanin; DOPA melanin and pyomelanin. Chemical inhibition of HpdA in P. marneffei inhibits ex vivo yeast cell production suggesting that tyrosine is a key nutrient source during infectious growth. The genes required for tyrosine catabolism, including hpdA, are located in a gene cluster and the expression of these genes is induced in the presence of tyrosine. A gene (hmgR) encoding a Zn(II)2-Cys6 binuclear cluster transcription factor is present within the cluster and is required for tyrosine induced expression and repression in the presence of a preferred nitrogen source. AreA, the GATA-type transcription factor which regulates the global response to limiting nitrogen conditions negatively regulates expression of cluster genes in the absence of tyrosine and is required for nitrogen metabolite repression. Deletion of the tyrosine catabolic genes in the cluster affects growth on tyrosine as either a nitrogen or carbon source and affects pyomelanin, but not DOPA melanin, production. In contrast to other genes of the tyrosine catabolic cluster, deletion of hpdA results in no growth within macrophages. This suggests that the ability to catabolise tyrosine is not required for macrophage infection and that HpdA has an additional novel role to that of tyrosine catabolism and pyomelanin production during growth in host cells. PMID:25812137
Xu, Hui; Chakrabarty, Yindrila; Philmus, Benjamin; Mehta, Angad P.; Bhandari, Dhananjay; Hohmann, Hans-Peter; Begley, Tadhg P.
2016-01-01
Riboflavin is a common cofactor, and its biosynthetic pathway is well characterized. However, its catabolic pathway, despite intriguing hints in a few distinct organisms, has never been established. This article describes the isolation of a Microbacterium maritypicum riboflavin catabolic strain, and the cloning of the riboflavin catabolic genes. RcaA, RcaB, RcaD, and RcaE were overexpressed and biochemically characterized as riboflavin kinase, riboflavin reductase, ribokinase, and riboflavin hydrolase, respectively. Based on these activities, a pathway for riboflavin catabolism is proposed. PMID:27590337
Xu, Hui; Chakrabarty, Yindrila; Philmus, Benjamin; Mehta, Angad P; Bhandari, Dhananjay; Hohmann, Hans-Peter; Begley, Tadhg P
2016-11-04
Riboflavin is a common cofactor, and its biosynthetic pathway is well characterized. However, its catabolic pathway, despite intriguing hints in a few distinct organisms, has never been established. This article describes the isolation of a Microbacterium maritypicum riboflavin catabolic strain, and the cloning of the riboflavin catabolic genes. RcaA, RcaB, RcaD, and RcaE were overexpressed and biochemically characterized as riboflavin kinase, riboflavin reductase, ribokinase, and riboflavin hydrolase, respectively. Based on these activities, a pathway for riboflavin catabolism is proposed. © 2016 by The American Society for Biochemistry and Molecular Biology, Inc.
Xu, Hui; Chakrabarty, Yindrila; Philmus, Benjamin; Mehta, Angad P.; Bhandari, Dhananjay; Hohmann, Hans-Peter; Begley, Tadhg P.
2016-01-01
Riboflavin is a common cofactor, and its biosynthetic pathway is well characterized. However, its catabolic pathway, despite intriguing hints in a few distinct organisms, has never been established. This article describes the isolation of a Microbacterium maritypicum riboflavin catabolic strain, and the cloning of the riboflavin catabolic genes. RcaA, RcaB, RcaD, and RcaE were overexpressed and biochemically characterized as riboflavin kinase, riboflavin reductase, ribokinase, and riboflavin ...
Bahar, M; de Majnik, J; Wexler, M; Fry, J; Poole, P S; Murphy, P J
1998-11-01
Rhizopines are nodule-specific compounds that confer an intraspecies competitive nodulation advantage to strains that can catabolize them. The rhizopine (3-O-methyl-scyllo-inosamine, 3-O-MSI) catabolic moc gene cluster mocCABRDE(F) in Rhizobium leguminosarum bv. viciae strain 1a is located on the Sym plasmid. MocCABR are homologous to the mocCABR gene products from Sinorhizobium meliloti. MocD and MocE contain motifs corresponding to a TOL-like oxygenase and a [2Fe-2S] Rieske-like ferredoxin, respectively. The mocF gene encodes a ferredoxin reductase that would complete the oxygenase system, but is not essential for rhizopine catabolism. We propose a rhizopine catabolic model whereby MocB transports rhizopine into the cell and MocDE and MocF (or a similar protein elsewhere in the genome), under the regulation of MocR, act in concert to form a ferredoxin oxygenase system that demethylates 3-O-MSI to form scyllo-inosamine (SI). MocA, an NAD(H)-dependent dehydrogenase, and MocC continue the catabolic process. Compounds formed then enter the inositol catabolic pathway.
Directory of Open Access Journals (Sweden)
Hamna Saleem
2016-01-01
Full Text Available Petroleum hydrocarbons are harmful to living organisms when they are exposed in natural environment. Once they come in contact, it is not an easy to remove them because many of their constituents are persistent in nature. To achieve this target, different approaches have been exploited by using plants, bacteria, and plant-bacteria together. Among them, combined use of plants and bacteria has gained tremendous attention as bacteria possess set of catabolic genes which produce catabolic enzymes to decontaminate hydrocarbons. In return, plant ooze out root exudates containing nutrients and necessary metabolites which facilitate the microbial colonization in plant rhizosphere. This results into high gene abundance and gene expression in the rhizosphere and, thus, leads to enhanced degradation. Moreover, high proportions of beneficial bacteria helps plant to gain more biomass due to their plant growth promoting activities and production of phytohromones. This review focuses functioning and mechanisms of catabolic genes responsible for degradation of straight chain and aromatic hydrocarbons with their potential of degradation in bioremediation. With the understanding of expression mechanisms, rate of degradation can be enhanced by adjusting environmental factors and acclimatizing plant associated bacteria in plant rhizosphere.
CLONING AND CHARACTERIZATION OF THE PHTHALATE CATABOLISM REGION OF PRE1 OF ARTHROBACTER KEYSERI 12B
o-Phthalate (benzene-1,2-dicarboxylate) is a central intermediate in the bacterial degradation of phthalate ester plasticizers as well as of a number of fused-ring polycyclic aromatic hydrocarbons found in fossil fuels. In Arthrobacter keyseri 12B, the genes encoding catabolism o...
Overhage, Jörg; Kresse, Andreas U.; Priefert, Horst; Sommer, Horst; Krammer, Gerhard; Rabenhorst, Jürgen; Steinbüchel, Alexander
1999-01-01
Pseudomonas sp. strain HR199 is able to utilize eugenol (4-allyl-2-methoxyphenol), vanillin (4-hydroxy-3-methoxybenzaldehyde), or protocatechuate as the sole carbon source for growth. Mutants of this strain which were impaired in the catabolism of vanillin but retained the ability to utilize eugenol or protocatechuate were obtained after nitrosoguanidine mutagenesis. One mutant (SK6169) was used as recipient of a Pseudomonas sp. strain HR199 genomic library in cosmid pVK100, and phenotypic complementation was achieved with a 5.8-kbp EcoRI fragment (E58). The amino acid sequences deduced from two corresponding open reading frames (ORF) identified on E58 revealed high degrees of homology to pcaG and pcaH, encoding the two subunits of protocatechuate 3,4-dioxygenase. Three additional ORF most probably encoded a 4-hydroxybenzoate 3-hydroxylase (PobA) and two putative regulatory proteins, which exhibited homology to PcaQ of Agrobacterium tumefaciens and PobR of Pseudomonas aeruginosa, respectively. Since mutant SK6169 was also complemented by a subfragment of E58 that harbored only pcaH, this mutant was most probably lacking a functional β subunit of the protocatechuate 3,4-dioxygenase. Since this mutant was still able to grow on protocatechuate and lacked protocatechuate 4,5-dioxygenase and protocatechuate 2,3-dioxygenase, the degradation had to be catalyzed by different enzymes. Two other mutants (SK6184 and SK6190), which were also impaired in the catabolism of vanillin, were not complemented by fragment E58. Since these mutants accumulated 3-carboxy muconolactone during cultivation on eugenol, they most probably exhibited a defect in a step of the catabolic pathway following the ortho cleavage. Moreover, in these mutants cyclization of 3-carboxymuconic acid seems to occur by a syn absolute stereochemical course, which is normally only observed for cis,cis-muconate lactonization in pseudomonads. In conclusion, vanillin is degraded through the ortho-cleavage pathway
Keebaugh, Alaine C; Thomas, James W
2010-06-01
Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.
Natural Variation in Synthesis and Catabolism Genes Influences Dhurrin Content in Sorghum
Directory of Open Access Journals (Sweden)
Chad M. Hayes
2015-07-01
Full Text Available Cyanogenic glucosides are natural compounds found in more than 1000 species of angiosperms that produce HCN and are deemed undesirable for agricultural use. However, these compounds are important components of the primary defensive mechanisms of many plant species. One of the best-studied cyanogenic glucosides is dhurrin [(--hydroxymandelonitrile-β--glucopyranoside], which is produced primarily in sorghum [ (L. Moench]. The biochemical basis for dhurrin metabolism is well established; however, little information is available on its genetic control. Here, we dissect the genetic control of leaf dhurrin content through a genome-wide association study (GWAS using a panel of 700 diverse converted sorghum lines (conversion panel previously subjected to pre-breeding and selected for short stature (∼1 m in height and photoperiod insensitivity. The conversion panel was grown for 2 yr in three environments. Wide variation for leaf dhurrin content was found in the sorghum conversion panel, with the Caudatum group exhibiting the highest dhurrin content and the Guinea group showing the lowest dhurrin content. A GWAS using a mixed linear model revealed significant associations (a false discovery rate [FDR] < 0.05 close to both UGT 185B1 in the canonical biosynthetic gene cluster on chromosome 1 and close to the catabolic dhurrinase loci on chromosome 8. Dhurrin content was associated consistently with biosynthetic genes in the two N-fertilized environments, while dhurrin content was associated with catabolic loci in the environment without supplemental N. These results suggest that genes for both biosynthesis and catabolism are important in determining natural variation for leaf dhurrin in sorghum in different environments.
Transcriptional analysis of prebiotic uptake and catabolism by Lactobacillus acidophilus NCFM.
Directory of Open Access Journals (Sweden)
Joakim Mark Andersen
Full Text Available The human gastrointestinal tract can be positively modulated by dietary supplementation of probiotic bacteria in combination with prebiotic carbohydrates. Here differential transcriptomics and functional genomics were used to identify genes in Lactobacillus acidophilus NCFM involved in the uptake and catabolism of 11 potential prebiotic compounds consisting of α- and β-linked galactosides and glucosides. These oligosaccharides induced genes encoding phosphoenolpyruvate-dependent sugar phosphotransferase systems (PTS, galactoside pentose hexuronide (GPH permease, and ATP-binding cassette (ABC transporters. PTS systems were upregulated primarily by di- and tri-saccharides such as cellobiose, isomaltose, isomaltulose, panose and gentiobiose, while ABC transporters were upregulated by raffinose, Polydextrose, and stachyose. A single GPH transporter was induced by lactitol and galactooligosaccharides (GOS. The various transporters were associated with a number of glycoside hydrolases from families 1, 2, 4, 13, 32, 36, 42, and 65, involved in the catabolism of various α- and β-linked glucosides and galactosides. Further subfamily specialization was also observed for different PTS-associated GH1 6-phospho-β-glucosidases implicated in the catabolism of gentiobiose and cellobiose. These findings highlight the broad oligosaccharide metabolic repertoire of L. acidophilus NCFM and establish a platform for selection and screening of both probiotic bacteria and prebiotic compounds that may positively influence the gastrointestinal microbiota.
International Nuclear Information System (INIS)
Wilson, M.S.; Bakermans, C.; Madsen, E.L.
1999-01-01
The authors developed procedures for isolating and characterizing in situ-transcribed mRNA from groundwater microorganisms catabolizing naphthalene at a coal tar waste-contaminated site. Groundwater was pumped through 0.22-microm-pore-size filters, which were then frozen to dry ice-ethanol. RNA was extracted from the frozen filters by boiling sodium dodecyl sulfate lysis and acidic phenol-chloroform extraction. Transcript characterization was performed with a series of PCR primers designed to amplify nahAc homologs. Several primer pairs were found to amplify nahAc homologs representing the entire diversity of the naphthalene-degrading genes. The environmental RNA extract was reverse transcribed, and the resultant mixture of cDNAs was amplified by PCR. A digoxigenin-labeled probe mixture was produced by PCR amplification of groundwater cDNA. This probe mixture hybridized under stringent conditions with the corresponding PCR products from naphthalene-degrading bacteria carrying a variety of nahAc homologs, indicating that diverse dioxygenase transcripts had been retrieved from groundwater. Diluted and undiluted cDNA preparations were independently amplified, and 28 of the resulting PCR products were cloned and sequenced. Sequence comparisons revealed two major groups related to the dioxygenase genes ndoB and dntAc, previously cloned from Pseudomonas putida NCIB 9816-4 and Burkholderia sp. strain DNT, respectively. A distinctive subgroup of sequences was found only in experiments performed with the undiluted cDNA preparation. To the authors' knowledge, these results are the first to directly document in situ transcription of genes encoding naphthalene catabolism at a contaminated site by indigenous microorganisms. The retrieved sequences represent greater diversity than has been detected at the study site by culture-based approaches
Arias-Barrau, Elsa; Olivera, Elías R; Luengo, José M; Fernández, Cristina; Galán, Beatriz; García, José L; Díaz, Eduardo; Miñambres, Baltasar
2004-08-01
Pseudomonas putida metabolizes Phe and Tyr through a peripheral pathway involving hydroxylation of Phe to Tyr (PhhAB), conversion of Tyr into 4-hydroxyphenylpyruvate (TyrB), and formation of homogentisate (Hpd) as the central intermediate. Homogentisate is then catabolized by a central catabolic pathway that involves three enzymes, homogentisate dioxygenase (HmgA), fumarylacetoacetate hydrolase (HmgB), and maleylacetoacetate isomerase (HmgC), finally yielding fumarate and acetoacetate. Whereas the phh, tyr, and hpd genes are not linked in the P. putida genome, the hmgABC genes appear to form a single transcriptional unit. Gel retardation assays and lacZ translational fusion experiments have shown that hmgR encodes a specific repressor that controls the inducible expression of the divergently transcribed hmgABC catabolic genes, and homogentisate is the inducer molecule. Footprinting analysis revealed that HmgR protects a region in the Phmg promoter that spans a 17-bp palindromic motif and an external direct repetition from position -16 to position 29 with respect to the transcription start site. The HmgR protein is thus the first IclR-type regulator that acts as a repressor of an aromatic catabolic pathway. We engineered a broad-host-range mobilizable catabolic cassette harboring the hmgABC, hpd, and tyrB genes that allows heterologous bacteria to use Tyr as a unique carbon and energy source. Remarkably, we show here that the catabolism of 3-hydroxyphenylacetate in P. putida U funnels also into the homogentisate central pathway, revealing that the hmg cluster is a key catabolic trait for biodegradation of a small number of aromatic compounds.
Regulatory role of XynR (YagI) in catabolism of xylonate in Escherichia coli K-12.
Shimada, Tomohiro; Momiyama, Eri; Yamanaka, Yuki; Watanabe, Hiroki; Yamamoto, Kaneyoshi; Ishihama, Akira
2017-12-01
The genome of Escherichia coli K-12 contains ten cryptic phages, altogether constituting about 3.6% of the genome in sequence. Among more than 200 predicted genes in these cryptic phages, 14 putative transcription factor (TF) genes exist, but their regulatory functions remain unidentified. As an initial attempt to make a breakthrough for understanding the regulatory roles of cryptic phage-encoded TFs, we tried to identify the regulatory function of CP4-6 cryptic prophage-encoded YagI with unknown function. After SELEX screening, YagI was found to bind mainly at a single site within the spacer of bidirectional transcription units, yagA (encoding another uncharacterized TF) and yagEF (encoding 2-keto-3-deoxy gluconate aldolase, and dehydratase, respectively) within this prophage region. YagEF enzymes are involved in the catabolism of xylose downstream from xylonate. We then designated YagI as XynR (regulator of xylonate catabolism), one of the rare single-target TFs. In agreement with this predicted regulatory function, the activity of XynR was suggested to be controlled by xylonate. Even though low-affinity binding sites of XynR were identified in the E. coli K-12 genome, they all were inside open reading frames, implying that the regulation network of XynR is still fixed within the CR4-6 prophage without significant influence over the host E. coli K-12. © FEMS 2017. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming
2015-03-01
Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.
Extreme expansion of NBS-encoding genes in Rosaceae.
Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui
2015-05-03
Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.
Directory of Open Access Journals (Sweden)
Pistorius Elfriede K
2007-11-01
Full Text Available Abstract Background So far very limited knowledge exists on L-arginine catabolism in cyanobacteria, although six major L-arginine-degrading pathways have been described for prokaryotes. Thus, we have performed a bioinformatic analysis of possible L-arginine-degrading pathways in cyanobacteria. Further, we chose Synechocystis sp. PCC 6803 for a more detailed bioinformatic analysis and for validation of the bioinformatic predictions on L-arginine catabolism with a transcript analysis. Results We have evaluated 24 cyanobacterial genomes of freshwater or marine strains for the presence of putative L-arginine-degrading enzymes. We identified an L-arginine decarboxylase pathway in all 24 strains. In addition, cyanobacteria have one or two further pathways representing either an arginase pathway or L-arginine deiminase pathway or an L-arginine oxidase/dehydrogenase pathway. An L-arginine amidinotransferase pathway as a major L-arginine-degrading pathway is not likely but can not be entirely excluded. A rather unusual finding was that the cyanobacterial L-arginine deiminases are substantially larger than the enzymes in non-photosynthetic bacteria and that they are membrane-bound. A more detailed bioinformatic analysis of Synechocystis sp. PCC 6803 revealed that three different L-arginine-degrading pathways may in principle be functional in this cyanobacterium. These are (i an L-arginine decarboxylase pathway, (ii an L-arginine deiminase pathway, and (iii an L-arginine oxidase/dehydrogenase pathway. A transcript analysis of cells grown either with nitrate or L-arginine as sole N-source and with an illumination of 50 μmol photons m-2 s-1 showed that the transcripts for the first enzyme(s of all three pathways were present, but that the transcript levels for the L-arginine deiminase and the L-arginine oxidase/dehydrogenase were substantially higher than that of the three isoenzymes of L-arginine decarboxylase. Conclusion The evaluation of 24
Directory of Open Access Journals (Sweden)
Ximena Escalera-Fanjul
2017-06-01
Full Text Available Gene duplication is one of the major evolutionary mechanisms providing raw material for the generation of genes with new or modified functions. The yeast Saccharomyces cerevisiae originated after an allopolyploidization event, which involved mating between two different ancestral yeast species. ScALT1 and ScALT2 codify proteins with 65% identity, which were proposed to be paralogous alanine transaminases. Further analysis of their physiological role showed that while ScALT1 encodes an alanine transaminase which constitutes the main pathway for alanine biosynthesis and the sole pathway for alanine catabolism, ScAlt2 does not display alanine transaminase activity and is not involved in alanine metabolism. Moreover, phylogenetic studies have suggested that ScALT1 and ScALT2 come from each one of the two parental strains which gave rise to the ancestral hybrid. The present work has been aimed to the understanding of the properties of the ancestral type Lacchancea kluyveri LkALT1 and Kluyveromyces lactis KlALT1, alanine transaminases in order to better understand the ScALT1 and ScALT2 evolutionary history. These ancestral -type species were chosen since they harbor ALT1 genes, which are related to ScALT2. Presented results show that, although LkALT1 and KlALT1 constitute ScALT1 orthologous genes, encoding alanine transaminases, both yeasts display LkAlt1 and KlAlt1 independent alanine transaminase activity and additional unidentified alanine biosynthetic and catabolic pathway(s. Furthermore, phenotypic analysis of null mutants uncovered the fact that KlAlt1 and LkAlt1 have an additional role, not related to alanine metabolism but is necessary to achieve wild type growth rate. Our study shows that the ancestral alanine transaminase function has been retained by the ScALT1 encoded enzyme, which has specialized its catabolic character, while losing the alanine independent role observed in the ancestral type enzymes. The fact that ScAlt2 conserves 64
Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda
The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.
Over-expression of zmarg encoding an arginase improves grain production in maize
International Nuclear Information System (INIS)
Hong, D.; Tian, Y.; Meng, X.; Zhang, P.
2016-01-01
Arginase, as one of the three key enzymes in nitrogen catabolism, the physiological role of Arg catabolism in cereal crops has not been fully clarified. Studies have shown that arginase-encoding genes play a key role in providing nitrogen to developing seedlings in many plant species.Yield is a primary trait in many crop breeding programs, which can be increased by modification of genes related to photosynthesis, nitrogen assimilation, carbon distribution, plant architecture, and transcriptional networks controlling plant development. In the present study, a maize arginase gene ZmARG was cloned and introduced into maize inbred lines by Agrobacterium tumefaciens- mediated transformation. Putative transgenic plants were confirmed by PCR, Southern blotting RT-PCR analysis. The expression of the ZmARG gene increased arginase activity in several tissues in transgenic lines. Transgenic maize plants had significantly higher ear weight and 100-seed weight as compared with wild-type control. Our results suggested that ZmARG was a potential target gene for crop yield improvement. (author)
Mern, Demissew S.; Beierfuß, Anja; Fontana, Johann; Thomé, Claudius; Hegewald, Aldemar A.
2014-01-01
Degenerative disc disease (DDD) of the cervical spine is common after middle age and can cause loss of disc height with painful nerve impingement, bone and joint inflammation. Despite the clinical importance of these problems, in current publications the pathology of cervical disc degeneration has been studied merely from a morphologic view point using magnetic resonance imaging (MRI), without addressing the issue of biological treatment approaches. So far a wide range of endogenously expressed bioactive factors in degenerative cervical disc cells has not yet been investigated, despite its importance for gene therapeutic approaches. Although degenerative lumbar disc cells have been targeted by different biological treatment approaches, the quantities of disc cells and the concentrations of gene therapeutic factors used in animal models differ extremely. These indicate lack of experimentally acquired data regarding disc cell proliferation and levels of target proteins. Therefore, we analysed proliferation and endogenous expression levels of anabolic, catabolic, ant-catabolic, inflammatory cytokines and matrix proteins of degenerative cervical disc cells in three-dimensional cultures. Preoperative MRI grading of cervical discs was used, then grade III and IV nucleus pulposus (NP) tissues were isolated from 15 patients, operated due to cervical disc herniation. NP cells were cultured for four weeks with low-glucose in collagen I scaffold. Their proliferation rates were analysed using 3-(4, 5-dimethylthiazolyl-2)-2,5-diphenyltetrazolium bromide. Their protein expression levels of 28 therapeutic targets were analysed using enzyme-linked immunosorbent assay. During progressive grades of degeneration NP cell proliferation rates were similar. Significantly decreased aggrecan and collagen II expressions (P<0.0001) were accompanied by accumulations of selective catabolic and inflammatory cytokines (disintegrin and metalloproteinase with thrombospondin motifs 4 and 5, matrix
Rozo, Zayda Lorena Corredor; Márquez-Ortiz, Ricaurte Alejandro; Castro, Betsy Esperanza; Gómez, Natasha Vanegas; Escobar-Pérez, Javier
2017-07-01
Staphylococcus aureus pandemic clone USA300 has, in addition to its constitutive arginine catabolism (arc) gene cluster, an arginine catabolism mobile element (ACME) carrying another such cluster, which gives this clone advantages in colonisation and infection. Gene arcR, which encodes an oxygen-sensitive transcriptional regulator, is inside ACME and downstream of the constitutive arc gene cluster, and this situation may have an impact on its activation. Different relative expression behaviours are proven here for arcRACME and the arcACME operon compared to the constitutive ones. We also show that the artificially expressed recombinant ArcRACME protein binds to the promoter region of the arcACME operon; this mechanism can be related to a positive feedback model, which may be responsible for increased anaerobic survival of the USA300 clone during infection-related processes.
DEFF Research Database (Denmark)
2010-01-01
dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...
Directory of Open Access Journals (Sweden)
Corinne Barbey
Full Text Available The virulence of numerous Gram-negative bacteria is under the control of a quorum sensing process based on synthesis and perception of N-acyl homoserine lactones. Rhodococcus erythropolis, a Gram-positive bacterium, has recently been proposed as a biocontrol agent for plant protection against soft-rot bacteria, including Pectobacterium. Here, we show that the γ-lactone catabolic pathway of R. erythropolis disrupts Pectobacterium communication and prevents plant soft-rot. We report the first characterization and demonstration of N-acyl homoserine lactone quenching in planta. In particular, we describe the transcription of the R. erythropolis lactonase gene, encoding the key enzyme of this pathway, and the subsequent lactone breakdown. The role of this catabolic pathway in biocontrol activity was confirmed by deletion of the lactonase gene from R. erythropolis and also its heterologous expression in Escherichia coli. The γ-lactone catabolic pathway is induced by pathogen communication rather than by pathogen invasion. This is thus a novel and unusual biocontrol pathway, differing from those previously described as protecting plants from phytopathogens. These findings also suggest the existence of an additional pathway contributing to plant protection.
Shared strategies for β-lactam catabolism in the soil microbiome
DEFF Research Database (Denmark)
Crofts, Terence S.; Wang, Bin; Spivak, Aaron
2018-01-01
The soil microbiome can produce, resist, or degrade antibiotics and even catabolize them. While resistance genes are widely distributed in the soil, there is a dearth of knowledge concerning antibiotic catabolism. Here we describe a pathway for penicillin catabolism in four isolates. Genomic......, respectively. Elucidation of additional pathways may allow bioremediation of antibiotic-contaminated soils and discovery of antibiotic-remodeling enzymes with industrial utility....
Ghosh, Swagata; Rao, K Hanumantha; Sengupta, Manjistha; Bhattacharya, Sujit K; Datta, Asis
2011-06-01
Pathogenic microorganisms like Vibrio cholerae are capable of adapting to diverse living conditions, especially when they transit from their environmental reservoirs to human host. V. cholerae attaches to N-acetylglucosamine (GlcNAc) residues in glycoproteins and lipids present in the intestinal epithelium and chitinous surface of zoo-phytoplanktons in the aquatic environment for its survival and colonization. GlcNAc utilization thus appears to be important for the pathogen to reach sufficient titres in the intestine for producing clinical symptoms of cholera. We report here the involvement of a second cluster of genes working in combination with the classical genes of GlcNAc catabolism, suggesting the occurrence of a novel variant of the process of biochemical conversion of GlcNAc to Fructose-6-phosphate as has been described in other organisms. Colonization was severely attenuated in mutants that were incapable of utilizing GlcNAc. It was also shown that N-acetylglucosamine specific repressor (NagC) performs a dual role - while the classical GlcNAc catabolic genes are under its negative control, the genes belonging to the second cluster are positively regulated by it. Further application of tandem affinity purification to NagC revealed its interaction with a novel partner. Our results provide a genetic program that probably enables V. cholerae to successfully utilize amino - sugars and also highlights a new mode of transcriptional regulation, not described in this organism. © 2011 Blackwell Publishing Ltd.
Hirooka, Kazutake; Kodoi, Yusuke; Satomura, Takenori; Fujita, Yasutaro
2015-12-28
The Bacillus subtilis rhaEWRBMA (formerly yuxG-yulBCDE) operon consists of four genes encoding enzymes for l-rhamnose catabolism and the rhaR gene encoding a DeoR-type transcriptional regulator. DNase I footprinting analysis showed that the RhaR protein specifically binds to the regulatory region upstream of the rhaEW gene, in which two imperfect direct repeats are included. Gel retardation analysis revealed that the direct repeat farther upstream is essential for the high-affinity binding of RhaR and that the DNA binding of RhaR was effectively inhibited by L-rhamnulose-1-phosphate, an intermediate of L-rhamnose catabolism. Moreover, it was demonstrated that the CcpA/P-Ser-HPr complex, primarily governing the carbon catabolite control in B. subtilis, binds to the catabolite-responsive element, which overlaps the RhaR binding site. In vivo analysis of the rhaEW promoter-lacZ fusion in the background of ccpA deletion showed that the L-rhamnose-responsive induction of the rhaEW promoter was negated by the disruption of rhaA or rhaB but not rhaEW or rhaM, whereas rhaR disruption resulted in constitutive rhaEW promoter activity. These in vitro and in vivo results clearly indicate that RhaR represses the operon by binding to the operator site, which is detached by L-rhamnulose-1-phosphate formed from L-rhamnose through a sequence of isomerization by RhaA and phosphorylation by RhaB, leading to the derepression of the operon. In addition, the lacZ reporter analysis using the strains with or without the ccpA deletion under the background of rhaR disruption supported the involvement of CcpA in the carbon catabolite repression of the operon. Since L-rhamnose is a component of various plant-derived compounds, it is a potential carbon source for plant-associating bacteria. Moreover, it is suggested that L-rhamnose catabolism plays a significant role in some bacteria-plant interactions, e.g., invasion of plant pathogens and nodulation of rhizobia. Despite the physiological
Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase
DEFF Research Database (Denmark)
Krath, Britta N.; Hove-Jensen, Bjarne
1996-01-01
The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...
Rapid duplication and loss of nbs-encoding genes in eurosids II
International Nuclear Information System (INIS)
Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.
2015-01-01
Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)
Khairy, Heba; Meinert, Christina; Wübbeler, Jan Hendrik; Poehlein, Anja; Daniel, Rolf; Voigt, Birgit; Riedel, Katharina; Steinbüchel, Alexander
2016-01-01
Rhodococcus erythropolis MI2 has the extraordinary ability to utilize the xenobiotic 4,4´-dithiodibutyric acid (DTDB). Cleavage of DTDB by the disulfide-reductase Nox, which is the only verified enzyme involved in DTDB-degradation, raised 4-mercaptobutyric acid (4MB). 4MB could act as building block of a novel polythioester with unknown properties. To completely unravel the catabolism of DTDB, the genome of R. erythropolis MI2 was sequenced, and subsequently the proteome was analyzed. The draft genome sequence consists of approximately 7.2 Mbp with an overall G+C content of 62.25% and 6,859 predicted protein-encoding genes. The genome of strain MI2 is composed of three replicons: one chromosome and two megaplasmids with sizes of 6.45, 0.4 and 0.35 Mbp, respectively. When cells of strain MI2 were cultivated with DTDB as sole carbon source and compared to cells grown with succinate, several interesting proteins with significantly higher expression levels were identified using 2D-PAGE and MALDI-TOF mass spectrometry. A putative luciferase-like monooxygenase-class F420-dependent oxidoreductase (RERY_05640), which is encoded by one of the 126 monooxygenase-encoding genes of the MI2-genome, showed a 3-fold increased expression level. This monooxygenase could oxidize the intermediate 4MB into 4-oxo-4-sulfanylbutyric acid. Next, a desulfurization step, which forms succinic acid and volatile hydrogen sulfide, is proposed. One gene coding for a putative desulfhydrase (RERY_06500) was identified in the genome of strain MI2. However, the gene product was not recognized in the proteome analyses. But, a significant expression level with a ratio of up to 7.3 was determined for a putative sulfide:quinone oxidoreductase (RERY_02710), which could also be involved in the abstraction of the sulfur group. As response to the toxicity of the intermediates, several stress response proteins were strongly expressed, including a superoxide dismutase (RERY_05600) and an osmotically induced
Directory of Open Access Journals (Sweden)
Heba Khairy
Full Text Available Rhodococcus erythropolis MI2 has the extraordinary ability to utilize the xenobiotic 4,4´-dithiodibutyric acid (DTDB. Cleavage of DTDB by the disulfide-reductase Nox, which is the only verified enzyme involved in DTDB-degradation, raised 4-mercaptobutyric acid (4MB. 4MB could act as building block of a novel polythioester with unknown properties. To completely unravel the catabolism of DTDB, the genome of R. erythropolis MI2 was sequenced, and subsequently the proteome was analyzed. The draft genome sequence consists of approximately 7.2 Mbp with an overall G+C content of 62.25% and 6,859 predicted protein-encoding genes. The genome of strain MI2 is composed of three replicons: one chromosome and two megaplasmids with sizes of 6.45, 0.4 and 0.35 Mbp, respectively. When cells of strain MI2 were cultivated with DTDB as sole carbon source and compared to cells grown with succinate, several interesting proteins with significantly higher expression levels were identified using 2D-PAGE and MALDI-TOF mass spectrometry. A putative luciferase-like monooxygenase-class F420-dependent oxidoreductase (RERY_05640, which is encoded by one of the 126 monooxygenase-encoding genes of the MI2-genome, showed a 3-fold increased expression level. This monooxygenase could oxidize the intermediate 4MB into 4-oxo-4-sulfanylbutyric acid. Next, a desulfurization step, which forms succinic acid and volatile hydrogen sulfide, is proposed. One gene coding for a putative desulfhydrase (RERY_06500 was identified in the genome of strain MI2. However, the gene product was not recognized in the proteome analyses. But, a significant expression level with a ratio of up to 7.3 was determined for a putative sulfide:quinone oxidoreductase (RERY_02710, which could also be involved in the abstraction of the sulfur group. As response to the toxicity of the intermediates, several stress response proteins were strongly expressed, including a superoxide dismutase (RERY_05600 and an
Wargo, Matthew J.; Szwergold, Benjamin S.; Hogan, Deborah A.
2008-01-01
Glycine betaine (GB), which occurs freely in the environment and is an intermediate in the catabolism of choline and carnitine, can serve as a sole source of carbon or nitrogen in Pseudomonas aeruginosa. Twelve mutants defective in growth on GB as the sole carbon source were identified through a genetic screen of a nonredundant PA14 transposon mutant library. Further growth experiments showed that strains with mutations in two genes, gbcA (PA5410) and gbcB (PA5411), were capable of growth on dimethylglycine (DMG), a catabolic product of GB, but not on GB itself. Subsequent nuclear magnetic resonance (NMR) experiments with 1,2-13C-labeled choline indicated that these genes are necessary for conversion of GB to DMG. Similar experiments showed that strains with mutations in the dgcAB (PA5398-PA5399) genes, which exhibit homology to genes that encode other enzymes with demethylase activity, are required for the conversion of DMG to sarcosine. Mutant analyses and 13C NMR studies also confirmed that the soxBDAG genes, predicted to encode a sarcosine oxidase, are required for sarcosine catabolism. Our screen also identified a predicted AraC family transcriptional regulator, encoded by gbdR (PA5380), that is required for growth on GB and DMG and for the induction of gbcA, gbcB, and dgcAB in response to GB or DMG. Mutants defective in the previously described gbt gene (PA3082) grew on GB with kinetics similar to those of the wild type in both the PAO1 and PA14 strain backgrounds. These studies provided important insight into both the mechanism and the regulation of the catabolism of GB in P. aeruginosa. PMID:17951379
Effects of lipopolysaccharide on the catabolic activity of macrophages
International Nuclear Information System (INIS)
Cluff, C.; Ziegler, H.K.
1986-01-01
The ability of macrophages to degrade and catabolize antigens is of relevance both as a means to process complex antigens prior to presentation to T cells, as well as a way to down regulate immune responses by destroying the antigenicity of polypeptides. With these considerations, the authors have investigated the regulation of macrophage catabolic activity by lipopolysaccharide (LPS). Catabolic activity was quantitated by following the distribution and molecular form of 125 -I labelled surface components of heat-killed Listeria monocytogenes (HKLM) subsequent to their uptake by macrophages. They have compared the catabolic activity of macrophages from peritoneal exudates of mice injected i.p. with saline or LPS and have found that LPS-elicited macrophages display a greatly enhanced (3 fold) rate of catabolism. This increase in catabolic activity peaks 3 days after LPS injection and steadily declines thereafter, approaching a baseline level after 3 weeks. The enhancement of catabolic activity is under LPS gene control. LPS-elicited macrophages rapidly destroy the antigenicity of bacterial antigens and function poorly as antigen presenting cells in vitro. These results suggest that LPS elicits a macrophage population specialized for antigen degradation functions with negative regulatory effects on the induction of specific immune responses
A deep auto-encoder model for gene expression prediction.
Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua
2017-11-17
Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.
Energy Technology Data Exchange (ETDEWEB)
Koivistoinen, O.
2013-11-01
The use of metabolic engineering as a tool for production of biochemicals and biofuels requires profound understanding of cell metabolism. The pathways for the most abundant and most important hexoses have already been studied quite extensively but it is also important to get a more complete picture of sugar catabolism. In this thesis, catabolic pathways of L-rhamnose and D-galactose were studied in fungi. Both of these hexoses are present in plant biomass, such as in hemicellulose and pectin. Galactoglucomannan, a type of hemicellulose that is especially rich in softwood, is an abundant source of D-galactose. As biotechnology is moving from the usage of edible and easily metabolisable carbon sources towards the increased use of lignocellulosic biomass, it is important to understand how the different sugars can be efficiently turned into valuable biobased products. Identification of the first fungal L-rhamnose 1-dehydrogenase gene, which codes for the first enzyme of the fungal catabolic L-rhamnose pathway, showed that the protein belongs to a protein family of short-chain alcohol dehydrogenases. Sugar dehydrogenases oxidising a sugar to a sugar acid are not very common in fungi and thus the identification of the L-rhamnose dehydrogenase gene provides more understanding of oxidative sugar catabolism in eukaryotic microbes. Further studies characterising the L-rhamnose cluster in the yeast Scheffersomyces stipitis including the expression of the L-rhamnonate dehydratase in Saccharomyces cerevisiae finalised the biochemical characterisation of the enzymes acting on the pathway. In addition, more understanding of the regulation and evolution of the pathway was gained. D-Galactose catabolism was studied in the filamentous fungus Aspergillus niger. Two genes coding for the enzymes of the oxido-reductive pathway were identified. Galactitol dehydrogenase is the second enzyme of the pathway converting galactitol to L-xylo-3-hexulose. The galactitol dehydrogenase encoding
Directory of Open Access Journals (Sweden)
Pratick Khara
2014-01-01
Full Text Available Sphingobium sp. PNB, like other sphingomonads, has multiple ring-hydroxylating oxygenase (RHO genes. Three different fosmid clones have been sequenced to identify the putative genes responsible for the degradation of various aromatics in this bacterial strain. Comparison of the map of the catabolic genes with that of different sphingomonads revealed a similar arrangement of gene clusters that harbors seven sets of RHO terminal components and a sole set of electron transport (ET proteins. The presence of distinctly conserved amino acid residues in ferredoxin and in silico molecular docking analyses of ferredoxin with the well characterized terminal oxygenase components indicated the structural uniqueness of the ET component in sphingomonads. The predicted substrate specificities, derived from the phylogenetic relationship of each of the RHOs, were examined based on transformation of putative substrates and their structural homologs by the recombinant strains expressing each of the oxygenases and the sole set of available ET proteins. The RHO AhdA1bA2b was functionally characterized for the first time and was found to be capable of transforming ethylbenzene, propylbenzene, cumene, p-cymene and biphenyl, in addition to a number of polycyclic aromatic hydrocarbons. Overexpression of aromatic catabolic genes in strain PNB, revealed by real-time PCR analyses, is a way forward to understand the complex regulation of degradative genes in sphingomonads.
Moreno, Maria de Lourdes; Sánchez-Porro, Cristina; Piubeli, Francine; Frias, Luciana; García, María Teresa; Mellado, Encarnación
2011-01-01
Background Extensive use of phenolic compounds in industry has resulted in the generation of saline wastewaters that produce significant environmental contamination; however, little information is available on the degradation of phenolic compounds in saline conditions. Halomonas organivorans G-16.1 (CECT 5995T) is a moderately halophilic bacterium that we isolated in a previous work from saline environments of South Spain by enrichment for growth in different pollutants, including phenolic compounds. PCR amplification with degenerate primers revealed the presence of genes encoding ring-cleaving enzymes of the β-ketoadipate pathway for aromatic catabolism in H. organivorans. Findings The gene cluster catRBCA, involved in catechol degradation, was isolated from H. organivorans. The genes catA, catB, catC and the divergently transcribed catR code for catechol 1,2-dioxygenase (1,2-CTD), cis,cis-muconate cycloisomerase, muconolactone delta-isomerase and a LysR-type transcriptional regulator, respectively. The benzoate catabolic genes (benA and benB) are located flanking the cat genes. The expression of cat and ben genes by phenol and benzoic acid was shown by RT-PCR analysis. The induction of catA gene by phenol and benzoic acid was also probed by the measurement of 1,2-CTD activity in H. organivorans growth in presence of these inducers. 16S rRNA and catA gene-based phylogenies were established among different degrading bacteria showing no phylogenetic correlation between both genes. Conclusions/Significance In this work, we isolated and determined the sequence of a gene cluster from a moderately halophilic bacterium encoding ortho-pathway genes involved in the catabolic metabolism of phenol and analyzed the gene organization, constituting the first report characterizing catabolic genes involved in the degradation of phenol in moderate halophiles, providing an ideal model system to investigate the potential use of this group of extremophiles in the decontamination of
Metz, Benjamin; de Vries, Ronald P; Polak, Stefan; Seidl, Verena; Seiboth, Bernhard
2009-01-01
The Hypocrea jecorina LXR1 was described as the first fungal L-xylulose reductase responsible for NADPH dependent reduction of L-xylulose to xylitol in L-arabinose catabolism. Phylogenetic analysis now reveals that LXR1 forms a clade with fungal D-mannitol 2-dehydrogenases. Lxr1 and the orthologous
Kudo, Toshiaki; Kobiyama, Atsushi; Rashid, Jonaira; Reza, Shaheed; Yamada, Yuichiro; Ikeda, Yuri; Ikeda, Daisuke; Mizusawa, Nanami; Ikeo, Kazuho; Sato, Shigeru; Ogata, Takehiko; Jimbo, Mitsuru; Kaga, Shinnosuke; Watanabe, Shiho; Naiki, Kimiaki; Kaga, Yoshimasa; Segawa, Satoshi; Mineta, Katsuhiko; Bajic, Vladimir B.; Gojobori, Takashi; Watabe, Shugo
2018-01-01
Ofunato Bay is located in the northeastern Pacific Ocean area of Japan, and it has the highest biodiversity of marine organisms in the world, primarily due to tidal influences from the cold Oyashio and warm Kuroshio currents. Our previous results from performing shotgun metagenomics indicated that Candidatus Pelagibacter ubique and Planktomarina temperata were the dominant bacteria (Reza et al., 2018a, 2018b). These bacteria are reportedly able to catabolize dimethylsulfoniopropionate (DMSP) produced from phytoplankton into dimethyl sulfide (DMS) or methanethiol (MeSH). This study was focused on seasonal changes in the abundances of bacterial genes (dddP, dmdA) related to DMSP catabolism in the seawater of Ofunato Bay by BLAST+ analysis using shotgun metagenomic datasets. We found seasonal changes among the Candidatus Pelagibacter ubique strains, including those of the HTCC1062 type and the Red Sea type. A good correlation was observed between the chlorophyll a concentrations and the abundances of the catabolic genes, suggesting that the bacteria directly interact with phytoplankton in the marine material cycle system and play important roles in producing DMS and MeSH from DMSP as signaling molecules for the possible formation of the scent of the tidewater or as fish attractants.
Kudo, Toshiaki
2018-04-26
Ofunato Bay is located in the northeastern Pacific Ocean area of Japan, and it has the highest biodiversity of marine organisms in the world, primarily due to tidal influences from the cold Oyashio and warm Kuroshio currents. Our previous results from performing shotgun metagenomics indicated that Candidatus Pelagibacter ubique and Planktomarina temperata were the dominant bacteria (Reza et al., 2018a, 2018b). These bacteria are reportedly able to catabolize dimethylsulfoniopropionate (DMSP) produced from phytoplankton into dimethyl sulfide (DMS) or methanethiol (MeSH). This study was focused on seasonal changes in the abundances of bacterial genes (dddP, dmdA) related to DMSP catabolism in the seawater of Ofunato Bay by BLAST+ analysis using shotgun metagenomic datasets. We found seasonal changes among the Candidatus Pelagibacter ubique strains, including those of the HTCC1062 type and the Red Sea type. A good correlation was observed between the chlorophyll a concentrations and the abundances of the catabolic genes, suggesting that the bacteria directly interact with phytoplankton in the marine material cycle system and play important roles in producing DMS and MeSH from DMSP as signaling molecules for the possible formation of the scent of the tidewater or as fish attractants.
Homocysteine and coronary heart disease : the role of polymorphic genes and hemostasis
Klerk, M.
2002-01-01
Background
Directory of Open Access Journals (Sweden)
Abd El-Latif Hesham
2014-01-01
Full Text Available Polycyclic aromatic hydrocarbons (PAHs are serious pollutants and health hazards. In this study, 15 PAHs-degrading bacteria were isolated from Egyptian oily soil. Among them, one Gram-negative strain (ASU-06 was selected and biodegradation ability and initial catabolic genes of petroleum compounds were investigated. Comparison of 16S rRNA gene sequence of strain ASU-06 to published sequences in GenBank database as well as phylogenetic analysis identified ASU-06 as Sphingomonas koreensis. Strain ASU-06 degraded 100, 99, 98, and 92.7% of 100 mg/L naphthalene, phenanthrene, anthracene, and pyrene within 15 days, respectively. When these PAHs present in a mixed form, the enhancement phenomenon appeared, particularly in the degradation of pyrene, whereas the degradation rate was 98.6% within the period. This is the first report showing the degradation of different PAHs by this species. PCR experiments with specific primers for catabolic genes alkB, alkB1, nahAc, C12O, and C23O suggested that ASU-06 might possess genes for aliphatic and PAHs degradation, while PAH-RHDαGP gene was not detected. Production of biosurfactants and increasing cell-surface hydrophobicity were investigated. GC/MS analysis of intermediate metabolites of studied PAHs concluded that this strain utilized these compounds via two main pathways, and phthalate was the major constant product that appeared in each day of the degradation period.
Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi
2014-01-03
Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome
Cloning of human genes encoding novel G protein-coupled receptors
Energy Technology Data Exchange (ETDEWEB)
Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others
1994-10-01
We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.
Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping
2012-01-01
Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp).
Nielsen, Tue Kjærgaard; Rasmussen, Morten; Demanèche, Sandrine; Cecillon, Sébastien; Vogel, Timothy M; Hansen, Lars Hestbjerg
2017-09-01
Bacterial degraders of chlorophenoxy herbicides have been isolated from various ecosystems, including pristine environments. Among these degraders, the sphingomonads constitute a prominent group that displays versatile xenobiotic-degradation capabilities. Four separate sequencing strategies were required to provide the complete sequence of the complex and plastic genome of the canonical chlorophenoxy herbicide-degrading Sphingobium herbicidovorans MH. The genome has an intricate organization of the chlorophenoxy-herbicide catabolic genes sdpA, rdpA, and cadABCD that encode the (R)- and (S)-enantiomer-specific 2,4-dichlorophenoxypropionate dioxygenases and four subunits of a Rieske non-heme iron oxygenase involved in 2-methyl-chlorophenoxyacetic acid degradation, respectively. Several major genomic rearrangements are proposed to help understand the evolution and mobility of these important genes and their genetic context. Single-strain mobilomic sequence analysis uncovered plasmids and insertion sequence-associated circular intermediates in this environmentally important bacterium and enabled the description of evolutionary models for pesticide degradation in strain MH and related organisms. The mobilome presented a complex mosaic of mobile genetic elements including four plasmids and several circular intermediate DNA molecules of insertion-sequence elements and transposons that are central to the evolution of xenobiotics degradation. Furthermore, two individual chromosomally integrated prophages were shown to excise and form free circular DNA molecules. This approach holds great potential for improving the understanding of genome plasticity, evolution, and microbial ecology. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Genome-wide identification of structural variants in genes encoding drug targets
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang
2012-01-01
The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...
Insights into the evolution of sialic acid catabolism among bacteria
Directory of Open Access Journals (Sweden)
Almagro-Moreno Salvador
2009-05-01
Full Text Available Abstract Background Sialic acids comprise a family of nine-carbon amino sugars that are prevalent in mucus rich environments. Sialic acids from the human host are used by a number of pathogens as an energy source. Here we explore the evolution of the genes involved in the catabolism of sialic acid. Results The cluster of genes encoding the enzymes N-acetylneuraminate lyase (NanA, epimerase (NanE, and kinase (NanK, necessary for the catabolism of sialic acid (the Nan cluster, are confined 46 bacterial species, 42 of which colonize mammals, 33 as pathogens and 9 as gut commensals. We found a putative sialic acid transporter associated with the Nan cluster in most species. We reconstructed the phylogenetic history of the NanA, NanE, and NanK proteins from the 46 species and compared them to the species tree based on 16S rRNA. Within the NanA phylogeny, Gram-negative and Gram-positive bacteria do not form distinct clades. NanA from Yersinia and Vibrio species was most closely related to the NanA clade from eukaryotes. To examine this further, we reconstructed the phylogeny of all NanA homologues in the databases. In this analysis of 83 NanA sequences, Bacteroidetes, a human commensal group formed a distinct clade with Verrucomicrobia, and branched with the Eukaryotes and the Yersinia/Vibrio clades. We speculate that pathogens such as V. cholerae may have acquired NanA from a commensal aiding their colonization of the human gut. Both the NanE and NanK phylogenies more closely represented the species tree but numerous incidences of incongruence are noted. We confirmed the predicted function of the sialic acid catabolism cluster in members the major intestinal pathogens Salmonella enterica, Vibrio cholerae, V. vulnificus, Yersinia enterocolitica and Y. pestis. Conclusion The Nan cluster among bacteria is confined to human pathogens and commensals conferring them the ability to utilize a ubiquitous carbon source in mucus rich surfaces of the human body
Directory of Open Access Journals (Sweden)
Radmacher Michael D
2006-10-01
B. Under oxygen limitation, however, pH regulation is reversed for genes encoding electron transport components and hydrogenases. Extreme-acid resistance requires yagU and hydrogenase production. Ribosome synthesis is down-regulated at low pH under oxygen limitation, possibly due to the restricted energy yield of catabolism. Under oxygen limitation, pH regulates metabolism and transport so as to maximize alternative catabolic options while minimizing acidification or alkalinization of the cytoplasm.
Watanabe, Takahito; Fujihara, Hidehiko; Furukawa, Kensuke
2003-01-01
Pseudomonas pseudoalcaligenes KF707 possesses a biphenyl-catabolic (bph) gene cluster consisting of bphR1A1A2-(orf3)-bphA3A4BCX0X1X2X3D. The bphR1 (formerly orf0) gene product, which belongs to the GntR family, is a positive regulator for itself and bphX0X1X2X3D. Further analysis in this study revealed that a second regulator belonging to the LysR family (designated bphR2) is involved in the regulation of the bph genes in KF707. The bphR2 gene was not located near the bph gene cluster, and it...
Directory of Open Access Journals (Sweden)
Maria de Lourdes Moreno
Full Text Available BACKGROUND: Extensive use of phenolic compounds in industry has resulted in the generation of saline wastewaters that produce significant environmental contamination; however, little information is available on the degradation of phenolic compounds in saline conditions. Halomonas organivorans G-16.1 (CECT 5995(T is a moderately halophilic bacterium that we isolated in a previous work from saline environments of South Spain by enrichment for growth in different pollutants, including phenolic compounds. PCR amplification with degenerate primers revealed the presence of genes encoding ring-cleaving enzymes of the β-ketoadipate pathway for aromatic catabolism in H. organivorans. FINDINGS: The gene cluster catRBCA, involved in catechol degradation, was isolated from H. organivorans. The genes catA, catB, catC and the divergently transcribed catR code for catechol 1,2-dioxygenase (1,2-CTD, cis,cis-muconate cycloisomerase, muconolactone delta-isomerase and a LysR-type transcriptional regulator, respectively. The benzoate catabolic genes (benA and benB are located flanking the cat genes. The expression of cat and ben genes by phenol and benzoic acid was shown by RT-PCR analysis. The induction of catA gene by phenol and benzoic acid was also probed by the measurement of 1,2-CTD activity in H. organivorans growth in presence of these inducers. 16S rRNA and catA gene-based phylogenies were established among different degrading bacteria showing no phylogenetic correlation between both genes. CONCLUSIONS/SIGNIFICANCE: In this work, we isolated and determined the sequence of a gene cluster from a moderately halophilic bacterium encoding ortho-pathway genes involved in the catabolic metabolism of phenol and analyzed the gene organization, constituting the first report characterizing catabolic genes involved in the degradation of phenol in moderate halophiles, providing an ideal model system to investigate the potential use of this group of extremophiles in
Sun, Liang; Sun, Yufei; Zhang, Mei; Wang, Ling; Ren, Jie; Cui, Mengmeng; Wang, Yanping; Ji, Kai; Li, Ping; Li, Qian; Chen, Pei; Dai, Shengjie; Duan, Chaorui; Wu, Yan; Leng, Ping
2012-01-01
Cell wall catabolism during fruit ripening is under complex control and is key for fruit quality and shelf life. To examine the role of abscisic acid (ABA) in tomato (Solanum lycopersicum) fruit ripening, we suppressed SlNCED1, which encodes 9-cis-epoxycarotenoid dioxygenase (NCED), a key enzyme in the biosynthesis of ABA. To suppress SlNCED1 specifically in tomato fruits, and thus avoid the pleiotropic phenotypes associated with ABA deficiency, we used an RNA interference construct driven by the fruit-specific E8 promoter. ABA accumulation and SlNCED1 transcript levels in the transgenic fruit were down-regulated to between 20% and 50% of the levels measured in the control fruit. This significant reduction in NCED activity led to a down-regulation in the transcription of genes encoding major cell wall catabolic enzymes, specifically polygalacturonase (SlPG), pectin methyl esterase (SlPME), β-galactosidase precursor mRNA (SlTBG), xyloglucan endotransglycosylase (SlXET), endo-1,4-β-cellulose (SlCels), and expansin (SlExp). This resulted in an increased accumulation of pectin during ripening. In turn, this led to a significant extension of the shelf life to 15 to 29 d compared with a shelf life of only 7 d for the control fruit and an enhancement of fruit firmness at the mature stage by 30% to 45%. In conclusion, ABA affects cell wall catabolism during tomato fruit ripening via down-regulation of the expression of major catabolic genes (SlPG, SlPME, SlTBG, SlXET, SlCels, and SlExp). PMID:22108525
Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman
2012-09-01
Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.
Khan, Sumia; Afzal, Muhammad; Iqbal, Samina; Mirza, Muhammad Sajjad; Khan, Qaiser M
2013-04-01
Plant-bacteria partnership is a promising approach for remediating soil contaminated with organic pollutants. The colonization and metabolic activity of an inoculated microorganism depend not only on environmental conditions but also on the physiological condition of the applied microorganisms. This study assessed the influence of different inoculum pretreatments on survival, gene abundance and catabolic gene expression of an applied strain (Pantoea sp. strain BTRH79) in the rhizosphere of ryegrass vegetated in diesel contaminated soil. Maximum bacterium survival, gene abundance and expression were observed in the soil inoculated with bacterial cells that had been pregrown on complex medium, and hydrocarbon degradation and genotoxicity reduction were also high in this soil. These findings propose that use of complex media for growing plant inocula may enhance bacterial survival and colonization and subsequently the efficiency of pollutant degradation. Copyright © 2013 Elsevier Ltd. All rights reserved.
Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus
Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.
Piscopo, Sara-Pier; Drouin, Guy
2014-05-01
Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.
The carotenoid biosynthetic and catabolic genes in wheat and their association with yellow pigments.
Colasuonno, Pasqualina; Lozito, Maria Luisa; Marcotuli, Ilaria; Nigro, Domenica; Giancaspro, Angelica; Mangini, Giacomo; De Vita, Pasquale; Mastrangelo, Anna Maria; Pecchioni, Nicola; Houston, Kelly; Simeone, Rosanna; Gadaleta, Agata; Blanco, Antonio
2017-01-31
In plants carotenoids play an important role in the photosynthetic process and photo-oxidative protection, and are the substrate for the synthesis of abscisic acid and strigolactones. In addition to their protective role as antioxidants and precursors of vitamin A, in wheat carotenoids are important as they influence the colour (whiteness vs. yellowness) of the grain. Understanding the genetic basis of grain yellow pigments, and identifying associated markers provide the basis for improving wheat quality by molecular breeding. Twenty-four candidate genes involved in the biosynthesis and catabolism of carotenoid compounds have been identified in wheat by comparative genomics. Single nucleotide polymorphisms (SNPs) found in the coding sequences of 19 candidate genes allowed their chromosomal location and accurate map position on two reference consensus maps to be determined. The genome-wide association study based on genotyping a tetraploid wheat collection with 81,587 gene-associated SNPs validated quantitative trait loci (QTLs) previously detected in biparental populations and discovered new QTLs for grain colour-related traits. Ten carotenoid genes mapped in chromosome regions underlying pigment content QTLs indicating possible functional relationships between candidate genes and the trait. The availability of linked, candidate gene-based markers can facilitate breeding wheat cultivars with desirable levels of carotenoids. Identifying QTLs linked to carotenoid pigmentation can contribute to understanding genes underlying carotenoid accumulation in the wheat kernels. Together these outputs can be combined to exploit the genetic variability of colour-related traits for the nutritional and commercial improvement of wheat products.
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...
Martins, Tiago M; Hartmann, Diego O; Planchon, Sébastien; Martins, Isabel; Renaut, Jenny; Silva Pereira, Cristina
2015-01-01
Aspergilli play major roles in the natural turnover of elements, especially through the decomposition of plant litter, but the end catabolism of lignin aromatic hydrocarbons remains largely unresolved. The 3-oxoadipate pathway of their degradation combines the catechol and the protocatechuate branches, each using a set of specific genes. However, annotation for most of these genes is lacking or attributed to poorly- or un-characterised families. Aspergillus nidulans can utilise as sole carbon/energy source either benzoate or salicylate (upstream aromatic metabolites of the protocatechuate and the catechol branches, respectively). Using this cultivation strategy and combined analyses of comparative proteomics, gene mining, gene expression and characterisation of particular gene-replacement mutants, we precisely assigned most of the steps of the 3-oxoadipate pathway to specific genes in this fungus. Our findings disclose the genetically encoded potential of saprophytic Ascomycota fungi to utilise this pathway and provide means to untie associated regulatory networks, which are vital to heightening their ecological significance. Copyright © 2014 Elsevier Inc. All rights reserved.
Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.
Directory of Open Access Journals (Sweden)
Sher L Hendrickson
2010-09-01
Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.
Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.
Jordan, I K; Sutter, B A; McClure, M A
2000-01-01
Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive
Ward, D.E.; van der Weijden, C.C.; van der Merwe, M.J.; Westerhoff, H.V.; Claiborne, A.; Snoep, J.L.
2000-01-01
Recently the bkd gene cluster from Enterococcus faecalis was sequenced, and it was shown that the gene products constitute a pathway for the catabolism of branched-chain α-keto acids. We have now investigated the regulation and physiological role of this pathway. Primer extension analysis identified
A highly divergent gene cluster in honey bees encodes a novel silk family.
Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S
2006-11-01
The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.
Flipphi, Michel; Oestreicher, Nathalie; Nicolas, Valérie; Guitton, Audrey; Vélot, Christian
2014-07-01
In Aspergillus nidulans, the utilization of acetate as sole carbon source requires several genes (acu). Most of them are also required for the utilization of fatty acids. This is the case for acuD and acuE, which encode the two glyoxylate cycle-specific enzymes, isocitrate lyase and malate synthase, respectively, but also for acuL that we have identified as AN7287, and characterized in this study. Deletion of acuL resulted in the same phenotype as the original acuL217 mutant. acuL encodes a 322-amino acid protein which displays all the structural features of a mitochondrial membrane carrier, and shares 60% identity with the Saccharomyces cerevisiae succinate/fumarate mitochondrial antiporter Sfc1p (also named Acr1p). Consistently, the AcuL protein was shown to localize in mitochondria, and partial cross-complementation was observed between the S. cerevisiae and A. nidulans homologues. Extensive phenotypic characterization suggested that the acuL gene is involved in the utilization of carbon sources that are catabolized via the TCA cycle, and therefore require gluconeogenesis. In addition, acuL proves to be co-regulated with acuD and acuE. Overall, our data suggest that AcuL could link the glyoxylate cycle to gluconeogenesis by exchanging cytoplasmic succinate for mitochondrial fumarate. Copyright © 2014 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Ley, Daniel; Pereira, Sara; Pedersen, Lasse Ebdrup
2017-01-01
CHO cells primarily utilize amino acids for three processes: biomass synthesis, recombinant protein production and catabolism. In this work, we disrupted 9 amino acid catabolic genes participating in 7 dierent catabolic pathways, to increase synthesis of biomass and recombinant protein, while red...... reducing production of growth-inhibiting metabolic by-products from amino acid catabolism....
Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis
DEFF Research Database (Denmark)
Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.
1995-01-01
Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...
Escherichia coli rpiA gene encoding ribose phosphate isomerase A
DEFF Research Database (Denmark)
Hove-Jensen, Bjarne; Maigaard, Marianne
1993-01-01
The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...
Effects of deoxycycline induced lentivirus encoding FasL gene on ...
African Journals Online (AJOL)
Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...
Directory of Open Access Journals (Sweden)
Lisa Y Stein
2013-09-01
Full Text Available Ammonia serves as the source of energy and reductant and as a signaling molecule that regulates gene expression in obligate ammonia-oxidizing chemolithotrophic microorganisms. The gammaproteobacterium, Nitrosococcus oceani, was the first obligate ammonia-oxidizer isolated from seawater and is one of the model systems for ammonia chemolithotrophy. We compared global transcriptional responses to ammonium and the catabolic intermediate, hydroxylamine, in ammonium-starved and non-starved cultures of N. oceani to discriminate transcriptional effects of ammonium from a change in overall energy and redox status upon catabolite availability. The most highly expressed genes from ammonium- or hydroxylamine-treated relative to starved cells are implicated in catabolic electron flow, carbon fixation, nitrogen assimilation, ribosome structure and stress tolerance. Catabolic inventory-encoding genes, including electron flow-terminating Complexes IV, FoF1 ATPase, transporters, and transcriptional regulators were among the most highly expressed genes in cells exposed only to ammonium relative to starved cells, although the differences compared to steady-state transcript levels were less pronounced. Reduction in steady-state mRNA levels from hydroxylamine-treated relative to starved-cells were less than five-fold. In contrast, several transcripts from ammonium-treated relative to starved cells were significantly less abundant including those for forward Complex I and a gene cluster of cytochrome c encoding proteins. Identified uneven steady-state transcript levels of co-expressed clustered genes support previously reported differential regulation at the levels of transcription and transcript stability. Our results differentiated between rapid regulation of core genes upon a change in cellular redox status versus those responsive to ammonium as a signaling molecule in N. oceani, both confirming and extending our knowledge of metabolic modules involved in ammonia
Addiction to Coupling of the Warburg Effect with Glutamine Catabolism in Cancer Cells
Directory of Open Access Journals (Sweden)
Bradley Smith
2016-10-01
Full Text Available Metabolic reprogramming is critical to oncogenesis, but the emergence and function of this profound reorganization remain poorly understood. Here we find that cooperating oncogenic mutations drive large-scale metabolic reprogramming, which is both intrinsic to cancer cells and obligatory for the transition to malignancy. This involves synergistic regulation of several genes encoding metabolic enzymes, including the lactate dehydrogenases LDHA and LDHB and mitochondrial glutamic pyruvate transaminase 2 (GPT2. Notably, GPT2 engages activated glycolysis to drive the utilization of glutamine as a carbon source for TCA cycle anaplerosis in colon cancer cells. Our data indicate that the Warburg effect supports oncogenesis via GPT2-mediated coupling of pyruvate production to glutamine catabolism. Although critical to the cancer phenotype, GPT2 activity is dispensable in cells that are not fully transformed, thus pinpointing a metabolic vulnerability specifically associated with cancer cell progression to malignancy.
DEFF Research Database (Denmark)
Sørensen, Kim I.; Hove-Jensen, Bjarne
1996-01-01
. The rpiB gene resided on a 4.6-kbp HindIII-EcoRV DNA fragment from phage lambda 10H5 (642) of the Kohara gene library and mapped at 92.85 min. Consistent with this map position, the cloned DNA fragment contained two divergent open reading frames of 149 and 296 codons, encoding ribose phosphate isomerase B...
Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.
Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P
2017-11-23
The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In
The ygeW encoded protein from Escherichia coli is a knotted ancestral catabolic transcarbamylase
Energy Technology Data Exchange (ETDEWEB)
Li, Yongdong; Jin, Zhongmin; Yu, Xiaolin; Allewell, Norma M.; Tuchman, Mendel; Shi, Dashuang (Maryland); (GWU); (Georgia)
2012-06-28
Purine degradation plays an essential role in nitrogen metabolism in most organisms. Uric acid is the final product of purine catabolism in humans, anthropoid apes, birds, uricotelic reptiles, and almost all insects. Elevated levels of uric acid in blood (hyperuricemia) cause human diseases such as gout, kidney stones, and renal failure. Although no enzyme has been identified that further degrades uric acid in humans, it can be oxidized to produce allantoin by free-radical attack. Indeed, elevated levels of allantoin are found in patients with rheumatoid arthritis, chronic lung disease, bacterial meningitis, and noninsulin-dependent diabetes mellitus. In other mammals, some insects and gastropods, uric acid is enzymatically degraded to the more soluble allantoin through the sequential action of three enzymes: urate oxidase, 5-hydroxyisourate (HIU) hydrolase and 2-oxo-4-hydroxy-4-carboxy-5-ureidoimidazoline (OHCU) decarboxylase. Therefore, an elective treatment for acute hyperuricemia is the administration of urate oxidase. Many organisms, including plants, some fungi and several bacteria, are able to catabolize allantoin to release nitrogen, carbon, and energy. In Arabidopsis thaliana and Eschrichia coli, S-allantoin has recently been shown to be degraded to glycolate and urea by four enzymes: allantoinase, allantoate amidohydrolase, ureidoglycine aminohydrolase, and ureidoglycolate amidohydrolase.
Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.
Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J
1999-01-01
Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.
D-Allose catabolism of Escherichia coli
DEFF Research Database (Denmark)
Poulsen, Tim S.; Chang, Ying-Ying; Hove-Jensen, Bjarne
1999-01-01
Genes involved in allose utilization of Escherichia coli K-12 are organized in at least two operons, alsRBACE and alsI, located next to each other on the chromosome but divergently transcribed. Mutants defective in alsI (allose 6-phosphate isomerase gene) and alsE (allulose 6-phosphate epimerase...... gene) were Als-. Transcription of the two allose operons, measured as β-galactosidase activity specified by alsI-lacZ+ or alsE-lacZ+ operon fusions, was induced by allose. Ribose also caused derepression of expression of the regulon under conditions in which ribose phosphate catabolism was impaired....
Directory of Open Access Journals (Sweden)
Christine Zawaski
Full Text Available Survival and productivity of perennial plants in temperate zones are dependent on robust responses to prolonged and seasonal cycles of unfavorable conditions. Here we report whole-genome microarray, expression, physiological, and transgenic evidence in hybrid poplar (Populus tremula × Populus alba showing that gibberellin (GA catabolism and repressive signaling mediates shoot growth inhibition and physiological adaptation in response to drought and short-day (SD induced bud dormancy. Both water deprivation and SDs elicited activation of a suite of poplar GA2ox and DELLA encoding genes. Poplar transgenics with up-regulated GA 2-oxidase (GA2ox and DELLA domain proteins showed hypersensitive growth inhibition in response to both drought and SDs. In addition, the transgenic plants displayed greater drought resistance as evidenced by increased pigment concentrations (chlorophyll and carotenoid and reductions in electrolyte leakage (EL. Comparative transcriptome analysis using whole-genome microarray showed that the GA-deficiency and GA-insensitivity, SD-induced dormancy, and drought response in poplar share a common regulon of 684 differentially-expressed genes, which suggest GA metabolism and signaling plays a role in plant physiological adaptations in response to alterations in environmental factors. Our results demonstrate that GA catabolism and repressive signaling represents a major route for control of growth and physiological adaptation in response to immediate or imminent adverse conditions.
Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.
Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu
2017-09-01
Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.
Cloning, expression and characterisation of a novel gene encoding ...
African Journals Online (AJOL)
微软用户
2012-01-12
Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...
Noguchi, Yuji; Sano, Motoaki; Kanamaru, Kyoko; Ko, Taro; Takeuchi, Michio; Kato, Masashi; Kobayashi, Tetsuo
2009-11-01
XlnR is a Zn(II)2Cys6 transcriptional activator of xylanolytic and cellulolytic genes in Aspergillus. Overexpression of the aoxlnR gene in Aspergillus oryzae (A. oryzae xlnR gene) resulted in elevated xylanolytic and cellulolytic activities in the culture supernatant, in which nearly 40 secreted proteins were detected by two-dimensional electrophoresis. DNA microarray analysis to identify the transcriptional targets of AoXlnR led to the identification of 75 genes that showed more than fivefold increase in their expression in the AoXlnR overproducer than in the disruptant. Of these, 32 genes were predicted to encode a glycoside hydrolase, highlighting the biotechnological importance of AoXlnR in biomass degradation. The 75 genes included the genes previously identified as AoXlnR targets (xynF1, xynF3, xynG2, xylA, celA, celB, celC, and celD). Thirty-six genes were predicted to be extracellular, which was consistent with the number of proteins secreted, and 61 genes possessed putative XlnR-binding sites (5'-GGCTAA-3', 5'-GGCTAG-3', and 5'-GGCTGA-3') in their promoter regions. Functional annotation of the genes revealed that AoXlnR regulated the expression of hydrolytic genes for degradation of beta-1,4-xylan, arabinoxylan, cellulose, and xyloglucan and of catabolic genes for the conversion of D-xylose to xylulose-5-phosphate. In addition, genes encoding glucose-6-phosphate 1-dehydrogenase and L-arabinitol-4- dehydrogenase involved in D-glucose and L-arabinose catabolism also appeared to be targets of AoXlnR.
Wetzel, Margaret E.; Kim, Kun-Soo; Miller, Marilyn; Olsen, Gary J.
2014-01-01
The Ti plasmid in Agrobacterium tumefaciens strain 15955 carries two alleles of traR that regulate conjugative transfer. The first is a functional allele, called traR, that is transcriptionally induced by the opine octopine. The second, trlR, is a nonfunctional, dominant-negative mutant located in an operon that is inducible by the opine mannopine (MOP). Based on these findings, we predicted that there exist wild-type agrobacterial strains harboring plasmids in which MOP induces a functional traR and, hence, conjugation. We analyzed 11 MOP-utilizing field isolates and found five where MOP induced transfer of the MOP-catabolic element and increased production of the acyl-homoserine lactone (acyl-HSL) quormone. The transmissible elements in these five strains represent a set of highly related plasmids. Sequence analysis of one such plasmid, pAoF64/95, revealed that the 176-kb element is not a Ti plasmid but carries genes for catabolism of MOP, mannopinic acid (MOA), agropinic acid (AGA), and the agrocinopines. The plasmid additionally carries all of the genes required for conjugative transfer, including the regulatory genes traR, traI, and traM. The traR gene, however, is not located in the MOP catabolism region. The gene, instead, is monocistronic and located within the tra-trb-rep gene cluster. A traR mutant failed to transfer the plasmid and produced little to no quormone even when grown with MOP, indicating that TraRpAoF64/95 is the activator of the tra regulon. A traM mutant was constitutive for transfer and acyl-HSL production, indicating that the anti-activator function of TraM is conserved. PMID:24363349
Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso
2014-03-05
The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene
Grohmann, L; Brennicke, A; Schuster, W
1992-01-01
The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526
Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.
1996-01-01
Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this
DEFF Research Database (Denmark)
Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin
2000-01-01
establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...
Lactoferricin mediates anabolic and anti-catabolic effects in the intervertebral disc.
Kim, Jae-Sung; Ellman, Michael B; An, Howard S; Yan, Dongyao; van Wijnen, Andre J; Murphy, Gillian; Hoskin, David W; Im, Hee-Jeong
2012-04-01
Lactoferricin (LfcinB) antagonizes biological effects mediated by angiogenic and catabolic growth factors, in addition to pro-inflammatory cytokines and chemokines in human endothelial cells and tumor cells. However, the effect of LfcinB on intervertebral disc (IVD) cell metabolism has not yet been investigated. Using bovine nucleus pulposus (NP) cells, we analyzed the effect of LfcinB on proteoglycan (PG) accumulation, PG synthesis, and anabolic gene expression. We assessed expression of genes for matrix-degrading enzymes such as matrix metalloproteases (MMPs) and a disintegrin-like and metalloprotease with thrombospondin motifs (ADAMTS family), as well as their endogenous inhibitors, tissue inhibitor of metalloproteases (TIMPs). In order to understand the specific molecular mechanisms by which LfcinB exerts its biological effects, we investigated intracellular signaling pathways in NP cells. LfcinB increased PG accumulation mainly via PG synthesis in a dose-dependent manner. Simultaneously, LfcinB dose-dependently downregulated catabolic enzymes. LfcinB's anti-catabolic effects were further demonstrated by a dose-dependent increase in multiple TIMP family members. Our results demonstrate that ERK and/or p38 mitogen-activated protein kinase pathways are the key signaling cascades that exert the biological effects of LfcinB in NP cells, regulating transcription of aggrecan, SOX-9, TIMP-1, TIMP-2, TIMP-3, and iNOS. Our results suggest that LfcinB has anabolic and potent anti-catabolic biological effects on bovine IVD cells that may have considerable promise in the treatment of disc degeneration in the future. Copyright © 2011 Wiley Periodicals, Inc.
Bacteriophage-encoded shiga toxin gene in atypical bacterial host
Directory of Open Access Journals (Sweden)
Casas Veronica
2011-07-01
Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.
Two alanine racemase genes in Salmonella typhimurium that differ in structure and function.
Wasserman, S A; Walsh, C T; Botstein, D
1983-01-01
Mutations were isolated in a previously undescribed Salmonella typhimurium gene encoding an alanine racemase essential for utilization of L-alanine as a source of carbon, energy, and nitrogen. This new locus, designated dadB, lies within one kilobase of the D-alanine dehydrogenase locus (dadA), which is also required for alanine catabolism. The dadA and dadB genes are coregulated. Mutants (including insertions) lacking the dadB alanine racemase do not require D-alanine for growth unless a mut...
Identification and characterization of a gene encoding a putative ...
Indian Academy of Sciences (India)
2012-10-30
Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...
Hehemann, Jan-Hendrik; Kelly, Amelia G; Pudlo, Nicholas A; Martens, Eric C; Boraston, Alisdair B
2012-11-27
Humans host an intestinal population of microbes--collectively referred to as the gut microbiome--which encode the carbohydrate active enzymes, or CAZymes, that are absent from the human genome. These CAZymes help to extract energy from recalcitrant polysaccharides. The question then arises as to if and how the microbiome adapts to new carbohydrate sources when modern humans change eating habits. Recent metagenome analysis of microbiomes from healthy American, Japanese, and Spanish populations identified putative CAZymes obtained by horizontal gene transfer from marine bacteria, which suggested that human gut bacteria evolved to degrade algal carbohydrates-for example, consumed in form of sushi. We approached this hypothesis by studying such a polysaccharide utilization locus (PUL) obtained by horizontal gene transfer by the gut bacterium Bacteroides plebeius. Transcriptomic and growth experiments revealed that the PUL responds to the polysaccharide porphyran from red algae, enabling growth on this carbohydrate but not related substrates like agarose and carrageenan. The X-ray crystallographic and biochemical analysis of two proteins encoded by this PUL, BACPLE_01689 and BACPLE_01693, showed that they are β-porphyranases belonging to glycoside hydrolase families 16 and 86, respectively. The product complex of the GH86 at 1.3 Å resolution highlights the molecular details of porphyran hydrolysis by this new porphyranase. Combined, these data establish experimental support for the argument that CAZymes and associated genes obtained from extrinsic microbes add new catabolic functions to the human gut microbiome.
Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.
Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto
2016-06-28
In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.
Transcriptional modulation of genes encoding nitrate reductase in ...
African Journals Online (AJOL)
The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...
Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T
1993-01-01
Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043
RNAi-based silencing of genes encoding the vacuolar- ATPase ...
African Journals Online (AJOL)
2016-11-09
Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...
Detection and isolation of novel rhizopine-catabolizing bacteria from the environment
Gardener; de Bruijn FJ
1998-12-01
Microbial rhizopine-catabolizing (Moc) activity was detected in serial dilutions of soil and rhizosphere washes. The activity observed generally ranged between 10(6) and 10(7) catabolic units per g, and the numbers of nonspecific culture-forming units were found to be approximately 10 times higher. A diverse set of 37 isolates was obtained by enrichment on scyllo-inosamine-containing media. However, none of the bacteria that were isolated were found to contain DNA sequences homologous to the known mocA, mocB, and mocC genes of Sinorhizobium meliloti L5-30. Twenty-one of the isolates could utilize an SI preparation as the sole carbon and nitrogen source for growth. Partial sequencing of 16S ribosomal DNAs (rDNAs) amplified from these strains indicated that five distinct bacterial genera (Arthrobacter, Sinorhizobium, Pseudomonas, Aeromonas, and Alcaligenes) were represented in this set. Only 6 of these 21 isolates could catabolize 3-O-methyl-scyllo-inosamine under standard assay conditions. Two of these, strains D1 and R3, were found to have 16S rDNA sequences very similar to those of Sinorhizobium meliloti. However, these strains are not symbiotically effective on Medicago sativa, and DNA sequences homologous to the nodB and nodC genes were not detected in strains D1 and R3 by Southern hybridization analysis.
Directory of Open Access Journals (Sweden)
Atsushi eKouzuma
2015-06-01
Full Text Available Shewanella oneidensis MR-1 is a facultative anaerobe that respires using a variety of inorganic and organic compounds. MR-1 is also capable of utilizing extracellular solid materials, including anodes in microbial fuel cells (MFCs, as electron acceptors, thereby enabling electricity generation. As MFCs have the potential to generate electricity from biomass waste and wastewater, MR-1 has been extensively studied to identify the molecular systems that are involved in electricity generation in MFCs. These studies have demonstrated the importance of extracellular electron-transfer pathways that electrically connect the quinone pool in the cytoplasmic membrane to extracellular electron acceptors. Electricity generation is also dependent on intracellular catabolic pathways that oxidize electron donors, such as lactate, and regulatory systems that control the expression of genes encoding the components of catabolic and electron-transfer pathways. In addition, recent findings suggest that cell-surface polymers, e.g., exopolysaccharides, and secreted chemicals, which function as electron shuttles, are also involved in electricity generation. Despite these advances in our knowledge on the extracellular electron-transfer processes in MR-1, further efforts are necessary to fully understand the underlying intra- and extra-cellular molecular systems for electricity generation in MFCs. We suggest that investigating how MR-1 coordinates these systems to efficiently transfer electrons to electrodes and conserve electrochemical energy for cell proliferation is important for establishing the biological bases for MFCs.
Kang, Dong-Min; Michon, Christophe; Morinaga, Tetsuro; Tanaka, Kosei; Takenaka, Shinji; Ishikawa, Shu; Yoshida, Ken-Ichi
2017-07-11
Bacillus subtilis is able to utilize at least three inositol stereoisomers as carbon sources, myo-, scyllo-, and D-chiro-inositol (MI, SI, and DCI, respectively). NAD + -dependent SI dehydrogenase responsible for SI catabolism is encoded by iolX. Even in the absence of functional iolX, the presence of SI or MI in the growth medium was found to induce the transcription of iolX through an unknown mechanism. Immediately upstream of iolX, there is an operon that encodes two genes, yisR and iolQ (formerly known as degA), each of which could encode a transcriptional regulator. Here we performed an inactivation analysis of yisR and iolQ and found that iolQ encodes a repressor of the iolX transcription. The coding sequence of iolQ was expressed in Escherichia coli and the gene product was purified as a His-tagged fusion protein, which bound to two sites within the iolX promoter region in vitro. IolQ is a transcriptional repressor of iolX. Genetic evidences allowed us to speculate that SI and MI might possibly be the intracellular inducers, however they failed to antagonize DNA binding of IolQ in in vitro experiments.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A
1995-01-01
Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant. PMID:7896694
Morris, V L; Jackson, D P; Grattan, M; Ainsworth, T; Cuppels, D A
1995-04-01
Pseudomonas syringae pv. tomato DC3481, a Tn5-induced mutant of the tomato pathogen DC3000, cannot grow and elicit disease symptoms on tomato seedlings. It also cannot grow on minimal medium containing malate, citrate, or succinate, three of the major organic acids found in tomatoes. We report here that this mutant also cannot use, as a sole carbon and/or energy source, a wide variety of hexoses and intermediates of hexose catabolism. Uptake studies have shown that DC3481 is not deficient in transport. A 3.8-kb EcoRI fragment of DC3000 DNA, which complements the Tn5 mutation, has been cloned and sequenced. The deduced amino acid sequences of two of the three open reading frames (ORFs) present on this fragment, ORF2 and ORF3, had no significant homology with sequences in the GenBank databases. However, the 510-amino-acid sequence of ORF1, the site of the Tn5 insertion, strongly resembled the deduced amino acid sequences of the Bacillus subtilis and Zea mays genes encoding 2,3-diphosphoglycerate (DPG)-independent phosphoglyceromutase (PGM) (52% identity and 72% similarity and 37% identity and 57% similarity, respectively). PGMs not requiring the cofactor DPG are usually found in plants and algae. Enzyme assays confirmed that P. syringae PGM activity required an intact ORF1. Not only is DC3481 the first PGM-deficient pseudomonad mutant to be described, but the P. syringae pgm gene is the first gram-negative bacterial gene identified that appears to code for a DPG-independent PGM. PGM activity appears essential for the growth and pathogenicity of P. syringae pv. tomato on its host plant.
Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes
Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.
Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT
Environmental cycle of antibiotic resistance encoded genes: A systematic review
Directory of Open Access Journals (Sweden)
R. ghanbari
2017-12-01
Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.
Fungicidal activity of peptides encoded by immunoglobulin genes
Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania
2017-01-01
Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...
Romagnoli, Gabriele; Knijnenburg, Theo A; Liti, Gianni; Louis, Edward J; Pronk, Jack T; Daran, Jean-Marc
2015-01-01
Phenylethanol has a characteristic rose-like aroma that makes it a popular ingredient in foods, beverages and cosmetics. Microbial production of phenylethanol currently relies on whole-cell bioconversion of phenylalanine with yeasts that harbour an Ehrlich pathway for phenylalanine catabolism. Complete biosynthesis of phenylethanol from a cheap carbon source, such as glucose, provides an economically attractive alternative for phenylalanine bioconversion. In this study, synthetic genetic array (SGA) screening was applied to identify genes involved in regulation of phenylethanol synthesis in Saccharomyces cerevisiae. The screen focused on transcriptional regulation of ARO10, which encodes the major decarboxylase involved in conversion of phenylpyruvate to phenylethanol. A deletion in ARO8, which encodes an aromatic amino acid transaminase, was found to underlie the transcriptional upregulation of ARO10 during growth, with ammonium sulphate as the sole nitrogen source. Physiological characterization revealed that the aro8Δ mutation led to substantial changes in the absolute and relative intracellular concentrations of amino acids. Moreover, deletion of ARO8 led to de novo production of phenylethanol during growth on a glucose synthetic medium with ammonium as the sole nitrogen source. The aro8Δ mutation also stimulated phenylethanol production when combined with other, previously documented, mutations that deregulate aromatic amino acid biosynthesis in S. cerevisiae. The resulting engineered S. cerevisiae strain produced >3 mm phenylethanol from glucose during growth on a simple synthetic medium. The strong impact of a transaminase deletion on intracellular amino acid concentrations opens new possibilities for yeast-based production of amino acid-derived products. Copyright © 2014 John Wiley & Sons, Ltd.
CSIR Research Space (South Africa)
Labuschagne, M
2007-01-01
Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...
Kravchenko, Alena; Citerne, Sylvie; Jéhanno, Isabelle; Bersimbaev, Rakhmetkazhi I; Veit, Bruce; Meyer, Christian; Leprince, Anne-Sophie
2015-11-27
The Target of Rapamycin (TOR) kinase regulates essential processes in plant growth and development by modulation of metabolism and translation in response to environmental signals. In this study, we show that abscisic acid (ABA) metabolism is also regulated by the TOR kinase. Indeed ABA hormone level strongly decreases in Lst8-1 and Raptor3g mutant lines as well as in wild-type (WT) Arabidopsis plants treated with AZD-8055, a TOR inhibitor. However the growth and germination of these lines are more sensitive to exogenous ABA. The diminished ABA hormone accumulation is correlated with lower transcript levels of ZEP, NCED3 and AAO3 biosynthetic enzymes, and higher transcript amount of the CYP707A2 gene encoding a key-enzyme in abscisic acid catabolism. These results suggest that the TOR signaling pathway is implicated in the regulation of ABA accumulation in Arabidopsis. Copyright © 2015 Elsevier Inc. All rights reserved.
Laing, E; Pretorius, I S
1993-05-01
A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.
Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene
Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van
1983-01-01
The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant
[Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].
Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A
2017-01-01
In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1998-01-01
The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...
A metabolic pathway for catabolizing levulinic acid in bacteria
International Nuclear Information System (INIS)
Rand, Jacqueline M.; Pisithkul, Tippapha; Clark, Ryan L.; Thiede, Joshua M.; Mehrer, Christopher R.
2017-01-01
Microorganisms can catabolize a wide range of organic compounds and therefore have the potential to perform many industrially relevant bioconversions. One barrier to realizing the potential of biorefining strategies lies in our incomplete knowledge of metabolic pathways, including those that can be used to assimilate naturally abundant or easily generated feedstocks. For instance, levulinic acid (LA) is a carbon source that is readily obtainable as a dehydration product of lignocellulosic biomass and can serve as the sole carbon source for some bacteria. Yet, the genetics and structure of LA catabolism have remained unknown. Here, we report the identification and characterization of a seven-gene operon that enables LA catabolism in Pseudomonas putida KT2440. When the pathway was reconstituted with purified proteins, we observed the formation of four acyl-CoA intermediates, including a unique 4-phosphovaleryl-CoA and the previously observed 3-hydroxyvaleryl-CoA product. Using adaptive evolution, we obtained a mutant of Escherichia coli LS5218 with functional deletions of fadE and atoC that was capable of robust growth on LA when it expressed the five enzymes from the P. putida operon. Here, this discovery will enable more efficient use of biomass hydrolysates and metabolic engineering to develop bioconversions using LA as a feedstock.
Do Carmo, A P; De Oliveira, M N V; Da Silva, D F; Castro, S B; Borges, A C; De Carvalho, A F; De Moraes, C A
2012-03-01
There are three main reasons for using lactic acid bacteria (LAB) as starter cultures in industrial food fermentation processes: food preservation due to lactic acid production; flavour formation due to a range of organic molecules derived from sugar, lipid and protein catabolism; and probiotic properties attributed to some strains of LAB, mainly of lactobacilli. The aim of this study was to identify some genes involved in lactose metabolism of the probiotic Lactobacillus delbrueckii UFV H2b20, and analyse its organic acid production during growth in skimmed milk. The following genes were identified, encoding the respective enzymes: ldh - lactate dehydrogenase, adhE - Ldb1707 acetaldehyde dehydrogenase, and ccpA-pepR1 - catabolite control protein A. It was observed that L. delbrueckii UFV H2b20 cultivated in different media has the unexpected ability to catabolyse galactose, and to produce high amounts of succinic acid, which was absent in the beginning, raising doubts about the subspecies in question. The phylogenetic analyses showed that this strain can be compared physiologically to L. delbrueckii subsp. bulgaricus and L. delbrueckii subsp. lactis, which are able to degrade lactose and can grow in milk. L. delbrueckii UFV H2b20 sequences have grouped with L. delbrueckii subsp. bulgaricus ATCC 11842 and L. delbrueckii subsp. bulgaricus ATCC BAA-365, strengthening the classification of this probiotic strain in the NCFM group proposed by a previous study. Additionally, L. delbrueckii UFV H2b20 presented an evolutionary pattern closer to that of probiotic Lactobacillus acidophilus NCFM, corroborating the suggestion that this strain might be considered as a new and unusual subspecies among L. delbrueckii subspecies, the first one identified as a probiotic. In addition, its unusual ability to metabolise galactose, which was significantly consumed in the fermentation medium, might be exploited to produce low-browning probiotic Mozzarella cheeses, a desirable property
Koivistoinen, Outi M; Richard, Peter; Penttilä, Merja; Ruohonen, Laura; Mojzita, Dominik
2012-02-17
In filamentous fungi D-galactose can be catabolised through the oxido-reductive and/or the Leloir pathway. In the oxido-reductive pathway D-galactose is converted to d-fructose in a series of steps where the last step is the oxidation of d-sorbitol by an NAD-dependent dehydrogenase. We identified a sorbitol dehydrogenase gene, sdhA (JGI53356), in Aspergillus niger encoding a medium chain dehydrogenase which is involved in D-galactose and D-sorbitol catabolism. The gene is upregulated in the presence of D-galactose, galactitol and D-sorbitol. An sdhA deletion strain showed reduced growth on galactitol and growth on D-sorbitol was completely abolished. The purified enzyme converted D-sorbitol to D-fructose with K(m) of 50±5 mM and v(max) of 80±10 U/mg. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Jeremy E Koenig
Full Text Available Integrons are genetic platforms that accelerate lateral gene transfer (LGT among bacteria. They were first detected on plasmids bearing single and multiple drug resistance determinants in human pathogens, and it is abundantly clear that integrons have played a major role in the evolution of this public health menace. Similar genetic elements can be found in nonpathogenic environmental bacteria and in metagenomic environmental DNA samples, and it is reasonable to suppose that integrons have facilitated microbial adaptation through LGT in niches outside infectious disease wards. Here we show that a heavily impacted estuary, exposed for almost a century to products of coal and steel industries, has developed a rich and unique cassette metagenome, containing genes likely to aid in the catabolism of compounds associated with industrial waste found there. In addition, we report that the most abundant cassette recovered in this study is one that encodes a putative LysR protein. This autoregulatory transcriptional regulator is known to activate transcription of linked target genes or unlinked regulons encoding diverse functions including chlorocatechol and dichlorophenol catabolism. Finally, only class 1 integrase genes were amplified in this study despite using different primer sets, and it may be that the cassettes present in the Tar Ponds will prove to be associated with class 1 integrase genes. Nevertheless, our cassette library provides a snapshot of a complex evolutionary process involving integron-meditated LGT likely to be important in natural bioremediation.
DEFF Research Database (Denmark)
Martinussen, Jan; Hammer, Karin
1994-01-01
Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...
Horse cDNA clones encoding two MHC class I genes
Energy Technology Data Exchange (ETDEWEB)
Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.
1994-12-31
Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.
Vedler, Eve; Heinaru, Eeva; Jutkina, Jekaterina; Viggor, Signe; Koressaar, Triinu; Remm, Maido; Heinaru, Ain
2013-12-01
A set of phenol-degrading strains of a collection of bacteria isolated from Baltic Sea surface water was screened for the presence of two key catabolic genes coding for phenol hydroxylases and catechol 2,3-dioxygenases. The multicomponent phenol hydroxylase (LmPH) gene was detected in 70 out of 92 strains studied, and 41 strains among these LmPH(+) phenol-degraders were found to exhibit catechol 2,3-dioxygenase (C23O) activity. Comparative phylogenetic analyses of LmPH and C23O sequences from 56 representative strains were performed. The studied strains were mostly affiliated to the genera Pseudomonas and Acinetobacter. However, the study also widened the range of phenol-degraders by including the genus Limnobacter. Furthermore, using a next generation sequencing approach, the LmPH genes of Limnobacter strains were found to be the most prevalent ones in the microbial community of the Baltic Sea surface water. Four different Limnobacter strains having almost identical 16S rRNA gene sequences (99%) and similar physiological properties formed separate phylogenetic clusters of LmPH and C23O genes in the respective phylogenetic trees. Copyright © 2013 Elsevier GmbH. All rights reserved.
Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them
International Nuclear Information System (INIS)
Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.
1988-01-01
This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated
Shen, Bin; Fang, Tao; Yang, Tianxiao; Jones, Gareth; Irwin, David M; Zhang, Shuyi
2014-01-01
Frugivorous and nectarivorous bats fuel their metabolism mostly by using carbohydrates and allocate the restricted amounts of ingested proteins mainly for anabolic protein syntheses rather than for catabolic energy production. Thus, it is possible that genes involved in protein (amino acid) catabolism may have undergone relaxed evolution in these fruit- and nectar-eating bats. The tyrosine aminotransferase (TAT, encoded by the Tat gene) is the rate-limiting enzyme in the tyrosine catabolic pathway. To test whether the Tat gene has undergone relaxed evolution in the fruit- and nectar-eating bats, we obtained the Tat coding region from 20 bat species including four Old World fruit bats (Pteropodidae) and two New World fruit bats (Phyllostomidae). Phylogenetic reconstructions revealed a gene tree in which all echolocating bats (including the New World fruit bats) formed a monophyletic group. The phylogenetic conflict appears to stem from accelerated TAT protein sequence evolution in the Old World fruit bats. Our molecular evolutionary analyses confirmed a change in the selection pressure acting on Tat, which was likely caused by a relaxation of the evolutionary constraints on the Tat gene in the Old World fruit bats. Hepatic TAT activity assays showed that TAT activities in species of the Old World fruit bats are significantly lower than those of insectivorous bats and omnivorous mice, which was not caused by a change in TAT protein levels in the liver. Our study provides unambiguous evidence that the Tat gene has undergone relaxed evolution in the Old World fruit bats in response to changes in their metabolism due to the evolution of their special diet.
International Nuclear Information System (INIS)
Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.
1988-01-01
Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment
Directory of Open Access Journals (Sweden)
Jin Nam
Full Text Available Chronic inflammation is one of the major causes of cartilage destruction in osteoarthritis. Here, we systematically analyzed the changes in gene expression associated with the progression of cartilage destruction in monoiodoacetate-induced arthritis (MIA of the rat knee. Sprague Dawley female rats were given intra-articular injection of monoiodoacetate in the knee. The progression of MIA was monitored macroscopically, microscopically and by micro-computed tomography. Grade 1 damage was observed by day 5 post-monoiodoacetate injection, progressively increasing to Grade 2 by day 9, and to Grade 3-3.5 by day 21. Affymetrix GeneChip was utilized to analyze the transcriptome-wide changes in gene expression, and the expression of salient genes was confirmed by real-time-PCR. Functional networks generated by Ingenuity Pathways Analysis (IPA from the microarray data correlated the macroscopic/histologic findings with molecular interactions of genes/gene products. Temporal changes in gene expression during the progression of MIA were categorized into five major gene clusters. IPA revealed that Grade 1 damage was associated with upregulation of acute/innate inflammatory responsive genes (Cluster I and suppression of genes associated with musculoskeletal development and function (Cluster IV. Grade 2 damage was associated with upregulation of chronic inflammatory and immune trafficking genes (Cluster II and downregulation of genes associated with musculoskeletal disorders (Cluster IV. The Grade 3 to 3.5 cartilage damage was associated with chronic inflammatory and immune adaptation genes (Cluster III. These findings suggest that temporal regulation of discrete gene clusters involving inflammatory mediators, receptors, and proteases may control the progression of cartilage destruction. In this process, IL-1β, TNF-α, IL-15, IL-12, chemokines, and NF-κB act as central nodes of the inflammatory networks, regulating catabolic processes. Simultaneously
The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots
Directory of Open Access Journals (Sweden)
LUCIA KUSUMAWATI
2013-09-01
Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.
Chen, Mingjia; Herde, Marco; Witte, Claus-Peter
2016-06-01
CYTIDINE DEAMINASE (CDA) catalyzes the deamination of cytidine to uridine and ammonia in the catabolic route of C nucleotides. The Arabidopsis (Arabidopsis thaliana) CDA gene family comprises nine members, one of which (AtCDA) was shown previously in vitro to encode an active CDA. A possible role in C-to-U RNA editing or in antiviral defense has been discussed for other members. A comprehensive bioinformatic analysis of plant CDA sequences, combined with biochemical functionality tests, strongly suggests that all Arabidopsis CDA family members except AtCDA are pseudogenes and that most plants only require a single CDA gene. Soybean (Glycine max) possesses three CDA genes, but only two encode functional enzymes and just one has very high catalytic efficiency. AtCDA and soybean CDAs are located in the cytosol. The functionality of AtCDA in vivo was demonstrated with loss-of-function mutants accumulating high amounts of cytidine but also CMP, cytosine, and some uridine in seeds. Cytidine hydrolysis in cda mutants is likely caused by NUCLEOSIDE HYDROLASE1 (NSH1) because cytosine accumulation is strongly reduced in a cda nsh1 double mutant. Altered responses of the cda mutants to fluorocytidine and fluorouridine indicate that a dual specific nucleoside kinase is involved in cytidine as well as uridine salvage. CDA mutants display a reduction in rosette size and have fewer leaves compared with the wild type, which is probably not caused by defective pyrimidine catabolism but by the accumulation of pyrimidine catabolism intermediates reaching toxic concentrations. © 2016 American Society of Plant Biologists. All Rights Reserved.
Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes
Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat
2016-11-01
In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.
Li, Shengjie; Bai, Junjie; Wang, Lin
2008-08-01
Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.
Auerbach, Raymond K; Chen, Bin; Butte, Atul J
2013-08-01
Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.
Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli
DEFF Research Database (Denmark)
Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne
1995-01-01
The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...
Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes
Directory of Open Access Journals (Sweden)
Abbas Ali Imani Fooladi
2014-02-01
Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.
Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-01-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...
Metabolic control analysis of xylose catabolism in Aspergillus
Prathumpai, W.; Gabelgaard, J.B.; Wanchanthuek, P.; Vondervoort, van de P.J.I.; Groot, de M.J.L.; McIntyre, M.; Nielsen, J.
2003-01-01
A kinetic model for xylose catabolism in Aspergillus is proposed. From a thermodynamic analysis it was found that the intermediate xylitol will accumulate during xylose catabolism. Use of the kinetic model allowed metabolic control analysis (MCA) of the xylose catabolic pathway to be carried out,
Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression
Directory of Open Access Journals (Sweden)
Leontina GURGU
2012-12-01
Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.
DEFF Research Database (Denmark)
Kjaerulff, S; Davey, William John; Nielsen, O
1994-01-01
We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...
Directory of Open Access Journals (Sweden)
R van der Geize
2011-08-01
Full Text Available Rhodococcus equi causes fatal pyogranulomatous pneumonia in foals and immunocompromised animals and humans. Despite its importance, there is currently no effective vaccine against the disease. The actinobacteria R. equi and the human pathogen Mycobacterium tuberculosis are related, and both cause pulmonary diseases. Recently, we have shown that essential steps in the cholesterol catabolic pathway are involved in the pathogenicity of M. tuberculosis. Bioinformatic analysis revealed the presence of a similar cholesterol catabolic gene cluster in R. equi. Orthologs of predicted M. tuberculosis virulence genes located within this cluster, i.e. ipdA (rv3551, ipdB (rv3552, fadA6 and fadE30, were identified in R. equi RE1 and inactivated. The ipdA and ipdB genes of R. equi RE1 appear to constitute the α-subunit and β-subunit, respectively, of a heterodimeric coenzyme A transferase. Mutant strains RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, were impaired in growth on the steroid catabolic pathway intermediates 4-androstene-3,17-dione (AD and 3aα-H-4α(3'-propionic acid-5α-hydroxy-7aβ-methylhexahydro-1-indanone (5α-hydroxy-methylhexahydro-1-indanone propionate; 5OH-HIP. Interestingly, RE1ΔipdAB and RE1ΔfadE30, but not RE1ΔfadA6, also displayed an attenuated phenotype in a macrophage infection assay. Gene products important for growth on 5OH-HIP, as part of the steroid catabolic pathway, thus appear to act as factors involved in the pathogenicity of R. equi. Challenge experiments showed that RE1ΔipdAB could be safely administered intratracheally to 2 to 5 week-old foals and oral immunization of foals even elicited a substantial protective immunity against a virulent R. equi strain. Our data show that genes involved in steroid catabolism are promising targets for the development of a live-attenuated vaccine against R. equi infections.
Metabolic signature of sun exposed skin suggests catabolic pathway overweighs anabolic pathway.
Directory of Open Access Journals (Sweden)
Manpreet Randhawa
Full Text Available Skin chronically exposed to sun results in phenotypic changes referred as photoaging. This aspect of aging has been studied extensively through genomic and proteomic tools. Metabolites, the end product are generated as a result of biochemical reactions are often studied as a culmination of complex interplay of gene and protein expression. In this study, we focused exclusively on the metabolome to study effects from sun-exposed and sun-protected skin sites from 25 human subjects. We generated a highly accurate metabolomic signature for the skin that is exposed to sun. Biochemical pathway analysis from this data set showed that sun-exposed skin resides under high oxidative stress and the chains of reactions to produce these metabolites are inclined toward catabolism rather than anabolism. These catabolic activities persuade the skin cells to generate metabolites through the salvage pathway instead of de novo synthesis pathways. Metabolomic profile suggests catabolic pathways and reactive oxygen species operate in a feed forward fashion to alter the biology of sun exposed skin.
Detailed analysis of putative genes encoding small proteins in legume genomes
Directory of Open Access Journals (Sweden)
Gabriel eGuillén
2013-06-01
Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.
Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.
Furlan, João Pedro Rueda; Stehling, Eliana Guedes
2018-01-10
β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.
Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.
Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui
2016-06-01
In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.
Gunasekera, Angelo; Alvarez, Francisco J; Douglas, Lois M; Wang, Hong X; Rosebrock, Adam P; Konopka, James B
2010-10-01
The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Nock, Adam M; Wargo, Matthew J
2016-09-15
Burkholderia thailandensis is a soil-dwelling bacterium that shares many metabolic pathways with the ecologically similar, but evolutionarily distant, Pseudomonas aeruginosa Among the diverse nutrients it can utilize is choline, metabolizable to the osmoprotectant glycine betaine and subsequently catabolized as a source of carbon and nitrogen, similar to P. aeruginosa Orthologs of genes in the choline catabolic pathway in these two bacteria showed distinct differences in gene arrangement as well as an additional orthologous transcriptional regulator in B. thailandensis In this study, we showed that multiple glutamine amidotransferase 1 (GATase 1)-containing AraC family transcription regulators (GATRs) are involved in regulation of the B. thailandensis choline catabolic pathway (gbdR1, gbdR2, and souR). Using genetic analyses and sequencing the transcriptome in the presence and absence of choline, we identified the likely regulons of gbdR1 (BTH_II1869) and gbdR2 (BTH_II0968). We also identified a functional ortholog for P. aeruginosa souR, a GATR that regulates the metabolism of sarcosine to glycine. GbdR1 is absolutely required for expression of the choline catabolic locus, similar to P. aeruginosa GbdR, while GbdR2 is important to increase expression of the catabolic locus. Additionally, the B. thailandensis SouR ortholog (BTH_II0994) is required for catabolism of choline and its metabolites as carbon sources, whereas in P. aeruginosa, SouR function can by bypassed by GbdR. The strategy employed by B. thailandensis represents a distinct regulatory solution to control choline catabolism and thus provides both an evolutionary counterpoint and an experimental system to analyze the acquisition and regulation of this pathway during environmental growth and infection. Many proteobacteria that occupy similar environmental niches have horizontally acquired orthologous genes for metabolism of compounds useful in their shared environment. The arrangement and differential
Directory of Open Access Journals (Sweden)
Seabra Ana R
2010-08-01
Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate
The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression
International Nuclear Information System (INIS)
Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.
2007-01-01
The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation
Gunasekera, Angelo; Alvarez, Francisco J.; Douglas, Lois M.; Wang, Hong X.; Rosebrock, Adam P.; Konopka, James B.
2010-01-01
The amino sugar N-acetylglucosamine (GlcNAc) is known to be an important structural component of cells from bacteria to humans, but its roles in cell signaling are less well understood. GlcNAc induces two pathways in the human fungal pathogen Candida albicans. One activates cyclic AMP (cAMP) signaling, which stimulates the formation of hyphal cells and the expression of virulence genes, and the other pathway induces genes needed to catabolize GlcNAc. Microarray analysis of gene expression was carried out under four different conditions in order to characterize the transcriptional changes induced by GlcNAc. The most highly induced genes include those that encode a GlcNAc transporter (NGT1) and the GlcNAc catabolic enzymes (HXK1, DAC1, and NAG1). GlcNAc also activated most of the genes whose expression is increased when cells are triggered with other stimuli to form hyphae. Surprisingly, GlcNAc also induced a subset of genes that are regulated by galactose (GAL1, GAL7, and GAL10), which may be due to cross talk between signaling pathways. A novel GlcNAc-induced gene, GIG1, which is not essential for GlcNAc catabolism or the induction of hyphae, was identified. However, a Gig1-green fluorescent protein (GFP) fusion protein was specifically induced by GlcNAc, and not by other sugars. Gig1-GFP localized to the cytoplasm, where GlcNAc metabolism occurs. Significantly, a gig1Δ mutant displayed increased resistance to nikkomycin Z, which inhibits chitin synthase from converting UDP-GlcNAc into cell wall chitin. Gig1 is highly conserved in fungi, especially those that contain GlcNAc catabolic genes. These results implicate Gig1 in GlcNAc metabolism. PMID:20675577
Okada, Morihiro; Miller, Thomas C; Fu, Liezhen; Shi, Yun-Bo
2015-09-01
The T3-dependent anuran metamorphosis resembles postembryonic development in mammals, the period around birth when plasma T3 levels peak. In particular, the remodeling of the intestine during metamorphosis mimics neonatal intestinal maturation in mammals when the adult intestinal epithelial self-renewing system is established. We have been using intestinal metamorphosis to investigate how the organ-specific adult stem cells are formed during vertebrate development. Early studies in Xenopus laevis have shown that this process involves complete degeneration of the larval epithelium and de novo formation of adult stem cells. A tissue-specific microarray analysis of intestinal gene expression during Xenopus laevis metamorphosis has identified a number of candidate stem cell genes. Here we have carried out detailed analyses of one such gene, amidohydrolase domain containing 1 (AMDHD1) gene, which encodes an enzyme in the histidine catabolic pathway. We show that AMDHD1 is exclusively expressed in the proliferating adult epithelial stem cells during metamorphosis with little expression in other intestinal tissues. We further provide evidence that T3 activates AMDHD1 gene expression directly at the transcription level through T3 receptor binding to the AMDHD1 gene in the intestine. In addition, we have reported earlier that histidine ammonia-lyase gene, another gene in histidine catabolic pathway, is similarly regulated by T3 in the intestine. These results together suggest that histidine catabolism plays a critical role in the formation and/or proliferation of adult intestinal stem cells during metamorphosis.
Rossbach, S; Kulpa, D A; Rossbach, U; de Bruijn, F J
1994-10-17
Rhizopine (L-3-O-methyl-scyllo-inosamine, 3-O-MSI) is a symbiosis-specific compound, which is synthesized in nitrogen-fixing nodules of Medicago sativa induced by Rhizobium meliloti strain L5-30. 3-O-MSI is thought to function as an unusual growth substrate for R. meliloti L5-30, which carries a locus (mos) responsible for its synthesis closely linked to a locus (moc) responsible for its degradation. Here, the essential moc genes were delimited by Tn5 mutagenesis and shown to be organized into two regions, separated by 3 kb of DNA. The DNA sequence of a 9-kb fragment spanning the two moc regions was determined, and four genes were identified that play an essential role in rhizopine catabolism (mocABC and mocR). The analysis of the DNA sequence and the amino acid sequence of the deduced protein products revealed that MocA resembles NADH-dependent dehydrogenases. MocB exhibits characteristic features of periplasmic-binding proteins that are components of high-affinity transport systems. MocC does not share significant homology with any protein in the database. MocR shows homology with the GntR class of bacterial regulator proteins. These results suggest that the mocABC genes are involved in the uptake and subsequent degradation of rhizopine, whereas mocR is likely to play a regulatory role.
Directory of Open Access Journals (Sweden)
Bin Shen
Full Text Available Frugivorous and nectarivorous bats fuel their metabolism mostly by using carbohydrates and allocate the restricted amounts of ingested proteins mainly for anabolic protein syntheses rather than for catabolic energy production. Thus, it is possible that genes involved in protein (amino acid catabolism may have undergone relaxed evolution in these fruit- and nectar-eating bats. The tyrosine aminotransferase (TAT, encoded by the Tat gene is the rate-limiting enzyme in the tyrosine catabolic pathway. To test whether the Tat gene has undergone relaxed evolution in the fruit- and nectar-eating bats, we obtained the Tat coding region from 20 bat species including four Old World fruit bats (Pteropodidae and two New World fruit bats (Phyllostomidae. Phylogenetic reconstructions revealed a gene tree in which all echolocating bats (including the New World fruit bats formed a monophyletic group. The phylogenetic conflict appears to stem from accelerated TAT protein sequence evolution in the Old World fruit bats. Our molecular evolutionary analyses confirmed a change in the selection pressure acting on Tat, which was likely caused by a relaxation of the evolutionary constraints on the Tat gene in the Old World fruit bats. Hepatic TAT activity assays showed that TAT activities in species of the Old World fruit bats are significantly lower than those of insectivorous bats and omnivorous mice, which was not caused by a change in TAT protein levels in the liver. Our study provides unambiguous evidence that the Tat gene has undergone relaxed evolution in the Old World fruit bats in response to changes in their metabolism due to the evolution of their special diet.
Convergent evolution of Amadori opine catabolic systems in plasmids of Agrobacterium tumefaciens.
Baek, Chang-Ho; Farrand, Stephen K; Lee, Ko-Eun; Park, Dae-Kyun; Lee, Jeong Kug; Kim, Kun-Soo
2003-01-01
Deoxyfructosyl glutamine (DFG, referred to elsewhere as dfg) is a naturally occurring Amadori compound found in rotting fruits and vegetables. DFG also is an opine and is found in tumors induced by chrysopine-type strains of Agrobacterium tumefaciens. Such strains catabolize this opine via a pathway coded for by their plasmids. NT1, a derivative of the nopaline-type A. tumefaciens strain C58 lacking pTiC58, can utilize DFG as the sole carbon source. Genes for utilization of DFG were mapped to the 543-kb accessory plasmid pAtC58. Two cosmid clones of pAtC58 allowed UIA5, a plasmid-free derivative of C58, harboring pSa-C that expresses MocC (mannopine [MOP] oxidoreductase that oxidizes MOP to DFG), to grow by using MOP as the sole carbon source. Genetic analysis of subclones indicated that the genes for utilization of DFG are located in a 6.2-kb BglII (Bg2) region adjacent to repABC-type genes probably responsible for the replication of pAtC58. This region contains five open reading frames organized into at least two transcriptional soc (santhopine catabolism) groups: socR and socABCD. Nucleotide sequence analysis and analyses of transposon-insertion mutations in the region showed that SocR negatively regulates the expression of socR itself and socABCD. SocA and SocB are responsible for transport of DFG and MOP. SocA is a homolog of known periplasmic amino acid binding proteins. The N-terminal half of SocB is a homolog of the transmembrane transporter proteins for several amino acids, and the C-terminal half is a homolog of the transporter-associated ATP-binding proteins. SocC and SocD could be responsible for the enzymatic degradation of DFG, being homologs of sugar oxidoreductases and an amadoriase from Corynebacterium sp., respectively. The protein products of socABCD are not related at the amino acid sequence level to those of the moc and mot genes of Ti plasmids responsible for utilization of DFG and MOP, indicating that these two sets of genes and their
Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko
2016-01-01
Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723
Yusuf, Y.; Hidayati, W.
2018-01-01
The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.
Diversity of beetle genes encoding novel plant cell wall degrading enzymes.
Directory of Open Access Journals (Sweden)
Yannick Pauchet
Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.
Directory of Open Access Journals (Sweden)
Kamyar Zahedi
Full Text Available Cisplatin-induced nephrotoxicity limits its use in many cancer patients. The expression of enzymes involved in polyamine catabolism, spermidine/spermine N1-acetyltransferase (SSAT and spermine oxidase (SMOX increase in the kidneys of mice treated with cisplatin. We hypothesized that enhanced polyamine catabolism contributes to tissue damage in cisplatin acute kidney injury (AKI. Using gene knockout and chemical inhibitors, the role of polyamine catabolism in cisplatin AKI was examined. Deficiency of SSAT, SMOX or neutralization of the toxic products of polyamine degradation, H2O2 and aminopropanal, significantly diminished the severity of cisplatin AKI. In vitro studies demonstrated that the induction of SSAT and elevated polyamine catabolism in cells increases the phosphorylation of eukaryotic translation initiation factor 2α (eIF2α and enhances the expression of binding immunoglobulin protein BiP/GRP78 and CCAAT-enhancer-binding protein homologous protein (CHOP/GADD153. The increased expression of these endoplasmic reticulum stress response (ERSR markers was accompanied by the activation of caspase-3. These results suggest that enhanced polyamine degradation in cisplatin AKI may lead to tubular damage through the induction of ERSR and the consequent onset of apoptosis. In support of the above, we show that the ablation of the SSAT or SMOX gene, as well as the neutralization of polyamine catabolism products modulate the onset of ERSR (e.g. lower BiP and CHOP and apoptosis (e.g. reduced activated caspase-3. These studies indicate that enhanced polyamine catabolism and its toxic products are important mediators of ERSR and critical to the pathogenesis of cisplatin AKI.
Effects of TCDD on the expression of nuclear encoded mitochondrial genes
International Nuclear Information System (INIS)
Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy
2010-01-01
Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.
van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O
1992-01-01
Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671
The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis
Energy Technology Data Exchange (ETDEWEB)
Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))
1990-01-01
Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.
Shakeri-Garakani, A; Brinkkötter, A; Schmid, K; Turgut, S; Lengeler, J W
2004-07-01
Enteric bacteria (Enteriobacteriaceae) carry on their single chromosome about 4000 genes that all strains have in common (referred to here as "obligatory genes"), and up to 1300 "facultative" genes that vary from strain to strain and from species to species. In closely related species, obligatory and facultative genes are orthologous genes that are found at similar loci. We have analyzed a set of facultative genes involved in the degradation of the carbohydrates galactitol, D-tagatose, D-galactosamine and N-acetyl-galactosamine in various pathogenic and non-pathogenic strains of these bacteria. The four carbohydrates are transported into the cell by phosphotransferase (PTS) uptake systems, and are metabolized by closely related or even identical catabolic enzymes via pathways that share several intermediates. In about 60% of Escherichia coli strains the genes for galactitol degradation map to a gat operon at 46.8 min. In strains of Salmonella enterica, Klebsiella pneumoniae and K. oxytoca, the corresponding gat genes, although orthologous to their E. coli counterparts, are found at 70.7 min, clustered in a regulon together with three tag genes for the degradation of D-tagatose, an isomer of D-fructose. In contrast, in all the E. coli strains tested, this chromosomal site was found to be occupied by an aga/kba gene cluster for the degradation of D-galactosamine and N-acetyl-galactosamine. The aga/kba and the tag genes were paralogous either to the gat cluster or to the fru genes for degradation of D-fructose. Finally, in more then 90% of strains of both Klebsiella species, and in about 5% of the E. coli strains, two operons were found at 46.8 min that comprise paralogous genes for catabolism of the isomers D-arabinitol (genes atl or dal) and ribitol (genes rtl or rbt). In these strains gat genes were invariably absent from this location, and they were totally absent in S. enterica. These results strongly indicate that these various gene clusters and metabolic
AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines
Directory of Open Access Journals (Sweden)
Clarke Robert
2006-05-01
Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.
Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua
2018-04-18
This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.
Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den
2008-01-01
Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,
Pasion, S G; Hines, J C; Aebersold, R; Ray, D S
1992-01-01
A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.
Multiple genes encode the major surface glycoprotein of Pneumocystis carinii
DEFF Research Database (Denmark)
Kovacs, J A; Powell, F; Edman, J C
1993-01-01
hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...
Zhang, Yun; Shang, Xiuling; Lai, Shujuan; Zhang, Yu; Hu, Qitiao; Chai, Xin; Wang, Bo; Liu, Shuwen; Wen, Tingyi
2018-02-16
l-Serine, the principal one-carbon source for DNA biosynthesis, is difficult for microorganisms to accumulate due to the coupling of l-serine catabolism and microbial growth. Here, we reprogrammed the one-carbon unit metabolic pathways in Corynebacterium glutamicum to decouple l-serine catabolism from cell growth. In silico model-based simulation showed a negative influence on glyA-encoding serine hydroxymethyltransferase flux with l-serine productivity. Attenuation of glyA transcription resulted in increased l-serine accumulation, and a decrease in purine pools, poor growth and longer cell shapes. The gcvTHP-encoded glycine cleavage (Gcv) system from Escherichia coli was introduced into C. glutamicum, allowing glycine-derived 13 CH 2 to be assimilated into intracellular purine synthesis, which resulted in an increased amount of one-carbon units. Gcv introduction not only restored cell viability and morphology but also increased l-serine accumulation. Moreover, comparative proteomic analysis indicated that abundance changes of the enzymes involved in one-carbon unit cycles might be responsible for maintaining one-carbon unit homeostasis. Reprogramming of the one-carbon metabolic pathways allowed cells to reach a comparable growth rate to accumulate 13.21 g/L l-serine by fed-batch fermentation in minimal medium. This novel strategy provides new insights into the regulation of cellular properties and essential metabolite accumulation by introducing an extrinsic pathway.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Sugimura; Sawabe; Ezura
2000-01-01
The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.
International Nuclear Information System (INIS)
Nebohacova, M.
2000-01-01
Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on
Iverson, Andrew; Garza, Erin; Manow, Ryan; Wang, Jinhua; Gao, Yuanyuan; Grayburn, Scott; Zhou, Shengde
2016-04-16
Anaerobic rather than aerobic fermentation is preferred for conversion of biomass derived sugars to high value redox-neutral and reduced commodities. This will likely result in a higher yield of substrate to product conversion and decrease production cost since substrate often accounts for a significant portion of the overall cost. To this goal, metabolic pathway engineering has been used to optimize substrate carbon flow to target products. This approach works well for the production of redox neutral products such as lactic acid from redox neutral sugars using the reducing power NADH (nicotinamide adenine dinucleotide, reduced) generated from glycolysis (2 NADH per glucose equivalent). Nevertheless, greater than two NADH per glucose catabolized is needed for the production of reduced products (such as xylitol) from redox neutral sugars by anaerobic fermentation. The Escherichia coli strain AI05 (ΔfrdBC ΔldhA ΔackA Δ(focA-pflB) ΔadhE ΔptsG ΔpdhR::pflBp 6-(aceEF-lpd)), previously engineered for reduction of xylose to xylitol using reducing power (NADH equivalent) of glucose catabolism, was further engineered by 1) deleting xylAB operon (encoding for xylose isomerase and xylulokinase) to prevent xylose from entering the pentose phosphate pathway; 2) anaerobically expressing the sdhCDAB-sucABCD operon (encoding for succinate dehydrogenase, α-ketoglutarate dehydrogenase and succinyl-CoA synthetase) to enable an anaerobically functional tricarboxcylic acid cycle with a theoretical 10 NAD(P)H equivalent per glucose catabolized. These reducing equivalents can be oxidized by synthetic respiration via xylose reduction, producing xylitol. The resulting strain, AI21 (pAI02), achieved a 96 % xylose to xylitol conversion, with a yield of 6 xylitol per glucose catabolized (molar yield of xylitol per glucose consumed (YRPG) = 6). This represents a 33 % improvement in xylose to xylitol conversion, and a 63 % increase in xylitol yield per glucose catabolized over
Gao, Shan; Gao, Jiong; Zhu, Xiaoyu; Song, Yi; Li, Zhongpeng; Ren, Guodong; Zhou, Xin; Kuai, Benke
2016-09-06
Chlorophyll (Chl) degradation is an integral process of leaf senescence, and NYE1/SGR1 has been demonstrated as a key regulator of Chl catabolism in diverse plant species. In this study, using yeast one-hybrid screening, we identified three abscisic acid (ABA)-responsive element (ABRE)-binding transcription factors, ABF2 (AREB1), ABF3, and ABF4 (AREB2), as the putative binding proteins of the NYE1 promoter. Through the transactivation analysis, electrophoretic mobility shift assay, and chromatin immunoprecipitation, we demonstrated that ABF2, ABF3, and ABF4 directly bound to and activated the NYE1 promoter in vitro and in vivo. ABA is a positive regulator of leaf senescence, and exogenously applied ABA can accelerate Chl degradation. The triple mutant of the ABFs, abf2abf3abf4, as well as two ABA-insensitive mutants, abi1-1 and snrk2.2/2.3/2.6, exhibited stay-green phenotypes after ABA treatment, along with decreased induction of NYE1 and NYE2 expression. In contrast, overexpression of ABF4 accelerated Chl degradation upon ABA treatment. Interestingly, ABF2/3/4 could also activate the expression of two Chl catabolic enzyme genes, PAO and NYC1, by directly binding to their promoters. In addition, abf2abf3abf4 exhibited a functional stay-green phenotype, and senescence-associated genes (SAGs), such as SAG29 (SWEET15), might be directly regulated by the ABFs. Taken together, our results suggest that ABF2, ABF3, and ABF4 likely act as key regulators in mediating ABA-triggered Chl degradation and leaf senescence in general in Arabidopsis. Copyright © 2016 The Author. Published by Elsevier Inc. All rights reserved.
ARA1 regulates not only l-arabinose but also d-galactose catabolism in Trichoderma reesei
Benocci, Tiziano; Aguilar-Pontes, Maria Victoria; Kun, Roland Sándor; Seiboth, Bernhard; de Vries, Ronald P; Daly, Paul
2017-01-01
Trichoderma reesei is used to produce saccharifying enzyme cocktails for biofuels. There is limited understanding of the transcription factors (TFs) that regulate genes involved in release and catabolism of l-arabinose and d-galactose, as the main TF XYR1 is only partially involved. Here, the T.
Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia
Directory of Open Access Journals (Sweden)
B Kazemi
2009-12-01
Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective for the treatment of patients with hemophilia A or B, who develop antibodies ( referred as inhibitors against replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains. Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.
Directory of Open Access Journals (Sweden)
Nordlund Henri R
2005-03-01
Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.
Decoding the contribution of dopaminergic genes and pathways to autism spectrum disorder (ASD).
Nguyen, Michael; Roth, Andrew; Kyzar, Evan J; Poudel, Manoj K; Wong, Keith; Stewart, Adam Michael; Kalueff, Allan V
2014-01-01
Autism spectrum disorder (ASD) is a debilitating brain illness causing social deficits, delayed development and repetitive behaviors. ASD is a heritable neurodevelopmental disorder with poorly understood and complex etiology. The central dopaminergic system is strongly implicated in ASD pathogenesis. Genes encoding various elements of this system (including dopamine receptors, the dopamine transporter or enzymes of synthesis and catabolism) have been linked to ASD. Here, we comprehensively evaluate known molecular interactors of dopaminergic genes, and identify their potential molecular partners within up/down-steam signaling pathways associated with dopamine. These in silico analyses allowed us to construct a map of molecular pathways, regulated by dopamine and involved in ASD. Clustering these pathways reveals groups of genes associated with dopamine metabolism, encoding proteins that control dopamine neurotransmission, cytoskeletal processes, synaptic release, Ca(2+) signaling, as well as the adenosine, glutamatergic and gamma-aminobutyric systems. Overall, our analyses emphasize the important role of the dopaminergic system in ASD, and implicate several cellular signaling processes in its pathogenesis. Copyright © 2014 Elsevier Ltd. All rights reserved.
Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie
2011-10-07
Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Directory of Open Access Journals (Sweden)
Bertin Stéphane
2011-10-01
Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.
Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa
2011-03-01
Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.
A role for TNFα in intervertebral disc degeneration: A non-recoverable catabolic shift
International Nuclear Information System (INIS)
Purmessur, D.; Walter, B.A.; Roughley, P.J.; Laudier, D.M.; Hecht, A.C.; Iatridis, James
2013-01-01
Highlights: ► TNFα induced catabolic changes similar to human intervertebral disc degeneration. ► The metabolic shift induced by TNFα was sustained following removal. ► TNFα induced changes suggestive of cell senescence without affecting cell viability. ► Interventions are required to stimulate anabolism and increase cell proliferation. -- Abstract: This study examines the effect of TNFα on whole bovine intervertebral discs in organ culture and its association with changes characteristic of intervertebral disc degeneration (IDD) in order to inform future treatments to mitigate the chronic inflammatory state commonly found with painful IDD. Pro-inflammatory cytokines such as TNFα contribute to disc pathology and are implicated in the catabolic phenotype associated with painful IDD. Whole bovine discs were cultured to examine cellular (anabolic/catabolic gene expression, cell viability and senescence using β-galactosidase) and structural (histology and aggrecan degradation) changes in response to TNFα treatment. Control or TNFα cultures were assessed at 7 and 21 days; the 21 day group also included a recovery group with 7 days TNFα followed by 14 days in basal media. TNFα induced catabolic and anti-anabolic shifts in the nucleus pulposus (NP) and annulus fibrosus (AF) at 7 days and this persisted until 21 days however cell viability was not affected. Data indicates that TNFα increased aggrecan degradation products and suggests increased β-galactosidase staining at 21 days without any recovery. TNFα treatment of whole bovine discs for 7 days induced changes similar to the degeneration processes that occur in human IDD: aggrecan degradation, increased catabolism, pro-inflammatory cytokines and nerve growth factor expression. TNFα significantly reduced anabolism in cultured IVDs and a possible mechanism may be associated with cell senescence. Results therefore suggest that successful treatments must promote anabolism and cell proliferation in
OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH
Directory of Open Access Journals (Sweden)
Alimuddin Alimuddin
2008-12-01
Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor
DEFF Research Database (Denmark)
Christensen, P U; Davey, William John; Nielsen, O
1997-01-01
In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...
Hernández-Arranz, Sofía; Moreno, Renata; Rojo, Fernando
2013-01-01
Metabolically versatile bacteria usually perceive aromatic compounds and hydrocarbons as non-preferred carbon sources, and their assimilation is inhibited if more preferable substrates are available. This is achieved via catabolite repression. In Pseudomonas putida, the expression of the genes allowing the assimilation of benzoate and n-alkanes is strongly inhibited by catabolite repression, a process controlled by the translational repressor Crc. Crc binds to and inhibits the translation of benR and alkS mRNAs, which encode the transcriptional activators that induce the expression of the benzoate and alkane degradation genes respectively. However, sequences similar to those recognized by Crc in benR and alkS mRNAs exist as well in the translation initiation regions of the mRNA of several structural genes of the benzoate and alkane pathways, which suggests that Crc may also regulate their translation. The present results show that some of these sites are functional, and that Crc inhibits the induction of both pathways by limiting not only the translation of their transcriptional activators, but also that of genes coding for the first enzyme in each pathway. Crc may also inhibit the translation of a gene involved in benzoate uptake. This multi-tier approach probably ensures the rapid regulation of pathway genes, minimizing the assimilation of non-preferred substrates when better options are available. A survey of possible Crc sites in the mRNAs of genes associated with other catabolic pathways suggested that targeting substrate uptake, pathway induction and/or pathway enzymes may be a common strategy to control the assimilation of non-preferred compounds. © 2012 Society for Applied Microbiology and Blackwell Publishing Ltd.
Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo
2016-12-04
Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.
Vanillin Catabolism in Rhodococcus jostii RHA1
Chen, Hao-Ping; Chow, Mindy; Liu, Chi-Chun; Lau, Alice; Liu, Jie
2012-01-01
Genes encoding vanillin dehydrogenase (vdh) and vanillate O-demethylase (vanAB) were identified in Rhodococcus jostii RHA1 using gene disruption and enzyme activities. During growth on vanillin or vanillate, vanA was highly upregulated while vdh was not. This study contributes to our understanding of lignin degradation by RHA1 and other actinomycetes. PMID:22057861
Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K
2016-02-17
Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.
Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A
2012-07-10
The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.
Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J
1997-06-01
Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E
Clarkson, Sonya M; Giannone, Richard J; Kridelbaugh, Donna M; Elkins, James G; Guss, Adam M; Michener, Joshua K
2017-09-15
The production of biofuels from lignocellulose yields a substantial lignin by-product stream that currently has few applications. Biological conversion of lignin-derived compounds into chemicals and fuels has the potential to improve the economics of lignocellulose-derived biofuels, but few microbes are able both to catabolize lignin-derived aromatic compounds and to generate valuable products. While Escherichia coli has been engineered to produce a variety of fuels and chemicals, it is incapable of catabolizing most aromatic compounds. Therefore, we engineered E. coli to catabolize protocatechuate, a common intermediate in lignin degradation, as the sole source of carbon and energy via heterologous expression of a nine-gene pathway from Pseudomonas putida KT2440. We next used experimental evolution to select for mutations that increased growth with protocatechuate more than 2-fold. Increasing the strength of a single ribosome binding site in the heterologous pathway was sufficient to recapitulate the increased growth. After optimization of the core pathway, we extended the pathway to enable catabolism of a second model compound, 4-hydroxybenzoate. These engineered strains will be useful platforms to discover, characterize, and optimize pathways for conversions of lignin-derived aromatics. IMPORTANCE Lignin is a challenging substrate for microbial catabolism due to its polymeric and heterogeneous chemical structure. Therefore, engineering microbes for improved catabolism of lignin-derived aromatic compounds will require the assembly of an entire network of catabolic reactions, including pathways from genetically intractable strains. Constructing defined pathways for aromatic compound degradation in a model host would allow rapid identification, characterization, and optimization of novel pathways. We constructed and optimized one such pathway in E. coli to enable catabolism of a model aromatic compound, protocatechuate, and then extended the pathway to a related
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
International Nuclear Information System (INIS)
Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.
1990-01-01
The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2
Directory of Open Access Journals (Sweden)
Jie Lei
2018-03-01
Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.
Glutamine alimentation in catabolic state.
Boelens, P G; Nijveldt, R J; Houdijk, A P; Meijer, S; van Leeuwen, P A
2001-09-01
Glutamine should be reclassified as a conditionally essential amino acid in the catabolic state because the body's glutamine expenditures exceed synthesis and low glutamine levels in plasma are associated with poor clinical outcome. After severe stress, several amino acids are mobilized from muscle tissue to supply energy and substrate to the host. Glutamine is one of the most important amino acids that provide this function. Glutamine acts as the preferred respiratory fuel for lymphocytes, hepatocytes and intestinal mucosal cells and is metabolized in the gut to citrulline, ammonium and other amino acids. Low concentrations of glutamine in plasma reflect reduced stores in muscle and this reduced availability of glutamine in the catabolic state seems to correlate with increased morbidity and mortality. Adding glutamine to the nutrition of clinical patients, enterally or parenterally, may reduce morbidity. Several excellent clinical trials have been performed to prove efficacy and feasibility of the use of glutamine supplementation in parenteral and enteral nutrition. The increased intake of glutamine has resulted in lower septic morbidity in certain critically ill patient populations. This review will focus on the efficacy and the importance of glutamine supplementation in diverse catabolic states.
Body Weight Independently Affects Articular Cartilage Catabolism
Directory of Open Access Journals (Sweden)
W. Matt Denning, Jason G. Winward, Michael Becker Pardo, J. Ty Hopkins, Matthew K. Seeley
2015-06-01
Full Text Available Although obesity is associated with osteoarthritis, it is unclear whether body weight (BW independently affects articular cartilage catabolism (i.e., independent from physiological factors that also accompany obesity. The primary purpose of this study was to evaluate the independent effect of BW on articular cartilage catabolism associated with walking. A secondary purpose was to determine how decreased BW influenced cardiovascular response due to walking. Twelve able-bodied subjects walked for 30 minutes on a lower-body positive pressure treadmill during three sessions: control (unadjusted BW, +40%BW, and -40%BW. Serum cartilage oligomeric matrix protein (COMP was measured immediately before (baseline and after, and 15 and 30 minutes after the walk. Heart rate (HR and rate of perceived exertion (RPE were measured every three minutes during the walk. Relative to baseline, average serum COMP concentration was 13% and 5% greater immediately after and 15 minutes after the walk. Immediately after the walk, serum COMP concentration was 14% greater for the +40%BW session than for the -40%BW session. HR and RPE were greater for the +40%BW session than for the other two sessions, but did not differ between the control and -40%BW sessions. BW independently influences acute articular cartilage catabolism and cardiovascular response due to walking: as BW increases, so does acute articular cartilage catabolism and cardiovascular response. These results indicate that lower-body positive pressure walking may benefit certain individuals by reducing acute articular cartilage catabolism, due to walking, while maintaining cardiovascular response.
DEFF Research Database (Denmark)
Kristensen, Michael; Lok, Finn; Planchot, Véronique
1999-01-01
with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...
Poelarends, GJ; Bosma, T; Kulakov, LA; Larkin, MJ; Marchesi, [No Value; Weightman, AJ; Janssen, DB; Kulakov, Leonid A.; Larkin, Michael J.; Marchesi, Julian R.; Weightman, Andrew J.
The sequences of the 16S rRNA and haloalkane dehalogenase (dhaA) genes of five gram-positive haloalkane-utilizing bacteria isolated from contaminated sites in Europe, Japan, and the United States and of the archetypal haloalkane-degrading bacterium Rhodococcus sp. strain NCIMB13064 were compared.
Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd
2015-09-01
Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.
Directory of Open Access Journals (Sweden)
Marina Kemmerer
Full Text Available AMP-activated protein kinase (AMPK maintains energy homeostasis by suppressing cellular ATP-consuming processes and activating catabolic, ATP-producing pathways such as fatty acid oxidation (FAO. The transcription factor peroxisome proliferator-activated receptor δ (PPARδ also affects fatty acid metabolism, stimulating the expression of genes involved in FAO. To question the interplay of AMPK and PPARδ in human macrophages we transduced primary human macrophages with lentiviral particles encoding for the constitutively active AMPKα1 catalytic subunit, followed by microarray expression analysis after treatment with the PPARδ agonist GW501516. Microarray analysis showed that co-activation of AMPK and PPARδ increased expression of FAO genes, which were validated by quantitative PCR. Induction of these FAO-associated genes was also observed upon infecting macrophages with an adenovirus coding for AMPKγ1 regulatory subunit carrying an activating R70Q mutation. The pharmacological AMPK activator A-769662 increased expression of several FAO genes in a PPARδ- and AMPK-dependent manner. Although GW501516 significantly increased FAO and reduced the triglyceride amount in very low density lipoproteins (VLDL-loaded foam cells, AMPK activation failed to potentiate this effect, suggesting that increased expression of fatty acid catabolic genes alone may be not sufficient to prevent macrophage lipid overload.
Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong
2016-01-01
Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Huanqiang Zhao
2016-08-01
Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.
Directory of Open Access Journals (Sweden)
Baiquan Ma
2015-11-01
Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.
Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W
2007-09-01
The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.
Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H
1994-05-03
Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)
Directory of Open Access Journals (Sweden)
Nadja Knoll
Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.
Pentose phosphates in nucleoside interconversion and catabolism.
Tozzi, Maria G; Camici, Marcella; Mascia, Laura; Sgarrella, Francesco; Ipata, Piero L
2006-03-01
Ribose phosphates are either synthesized through the oxidative branch of the pentose phosphate pathway, or are supplied by nucleoside phosphorylases. The two main pentose phosphates, ribose-5-phosphate and ribose-1-phosphate, are readily interconverted by the action of phosphopentomutase. Ribose-5-phosphate is the direct precursor of 5-phosphoribosyl-1-pyrophosphate, for both de novo and 'salvage' synthesis of nucleotides. Phosphorolysis of deoxyribonucleosides is the main source of deoxyribose phosphates, which are interconvertible, through the action of phosphopentomutase. The pentose moiety of all nucleosides can serve as a carbon and energy source. During the past decade, extensive advances have been made in elucidating the pathways by which the pentose phosphates, arising from nucleoside phosphorolysis, are either recycled, without opening of their furanosidic ring, or catabolized as a carbon and energy source. We review herein the experimental knowledge on the molecular mechanisms by which (a) ribose-1-phosphate, produced by purine nucleoside phosphorylase acting catabolically, is either anabolized for pyrimidine salvage and 5-fluorouracil activation, with uridine phosphorylase acting anabolically, or recycled for nucleoside and base interconversion; (b) the nucleosides can be regarded, both in bacteria and in eukaryotic cells, as carriers of sugars, that are made available though the action of nucleoside phosphorylases. In bacteria, catabolism of nucleosides, when suitable carbon and energy sources are not available, is accomplished by a battery of nucleoside transporters and of inducible catabolic enzymes for purine and pyrimidine nucleosides and for pentose phosphates. In eukaryotic cells, the modulation of pentose phosphate production by nucleoside catabolism seems to be affected by developmental and physiological factors on enzyme levels.
Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H
1994-01-01
Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...
Amino Acid Catabolism in Multiple Sclerosis Affects Immune Homeostasis.
Negrotto, Laura; Correale, Jorge
2017-03-01
Amino acid catabolism has been implicated in immunoregulatory mechanisms present in several diseases, including autoimmune disorders. Our aims were to assess expression and activity of enzymes involved in Trp and Arg catabolism, as well as to investigate amino acid catabolism effects on the immune system of multiple sclerosis (MS) patients. To this end, 40 MS patients, 30 healthy control subjects, and 30 patients with other inflammatory neurological diseases were studied. Expression and activity of enzymes involved in Trp and Arg catabolism (IDO1, IDO2, Trp 2,3-dioxygenase [TDO], arginase [ARG] 1, ARG2, inducible NO synthetase) were evaluated in PBMCs. Expression of general control nonrepressed 2 serine/threonine kinase and mammalian target of rapamycin (both molecules involved in sensing amino acid levels) was assessed in response to different stimuli modulating amino acid catabolism, as were cytokine secretion levels and regulatory T cell numbers. The results demonstrate that expression and activity of IDO1 and ARG1 were significantly reduced in MS patients compared with healthy control subjects and other inflammatory neurological diseases. PBMCs from MS patients stimulated with a TLR-9 agonist showed reduced expression of general control nonrepressed 2 serine/threonine kinase and increased expression of mammalian target of rapamycin, suggesting reduced amino acid catabolism in MS patients. Functionally, this reduction resulted in a decrease in regulatory T cells, with an increase in myelin basic protein-specific T cell proliferation and secretion of proinflammatory cytokines. In contrast, induction of IDO1 using CTLA-4 or a TLR-3 ligand dampened proinflammatory responses. Overall, these results highlight the importance of amino acid catabolism in the modulation of the immunological responses in MS patients. Molecules involved in these pathways warrant further exploration as potential new therapeutic targets in MS. Copyright © 2017 by The American Association of
Directory of Open Access Journals (Sweden)
Muscariello Lidia
2006-05-01
Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc
Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing
2016-10-01
Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb
Perturbation of polyamine catabolism affects grape ripening of Vitis vinifera cv. Trincadeira.
Agudelo-Romero, Patricia; Ali, Kashif; Choi, Young H; Sousa, Lisete; Verpoorte, Rob; Tiburcio, Antonio F; Fortes, Ana M
2014-01-01
Grapes are economically the most important fruit worldwide. However, the complexity of biological events that lead to ripening of nonclimacteric fruits is not fully understood, particularly the role of polyamines' catabolism. The transcriptional and metabolic profilings complemented with biochemical data were studied during ripening of Trincadeira grapes submitted to guazatine treatment, a potent inhibitor of polyamine oxidase activity. The mRNA expression profiles of one time point (EL 38) corresponding to harvest stage was compared between mock and guazatine treatments using Affymetrix GrapeGen(®) genome array. A total of 2113 probesets (1880 unigenes) were differentially expressed between these samples. Quantitative RT-PCR validated microarrays results being carried out for EL 35 (véraison berries), EL 36 (ripe berries) and EL 38 (harvest stage berries). Metabolic profiling using HPLC and (1)H NMR spectroscopy showed increase of putrescine, proline, threonine and 1-O-ethyl-β-glucoside in guazatine treated samples. Genes involved in amino acid, carbohydrate and water transport were down-regulated in guazatine treated samples suggesting that the strong dehydrated phenotype obtained in guazatine treated samples may be due to impaired transport mechanisms. Genes involved in terpenes' metabolism were differentially expressed between guazatine and mock treated samples. Altogether, results support an important role of polyamine catabolism in grape ripening namely in cell expansion and aroma development. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Biochemistry of Catabolic Reductive Dehalogenation.
Fincker, Maeva; Spormann, Alfred M
2017-06-20
A wide range of phylogenetically diverse microorganisms couple the reductive dehalogenation of organohalides to energy conservation. Key enzymes of such anaerobic catabolic pathways are corrinoid and Fe-S cluster-containing, membrane-associated reductive dehalogenases. These enzymes catalyze the reductive elimination of a halide and constitute the terminal reductases of a short electron transfer chain. Enzymatic and physiological studies revealed the existence of quinone-dependent and quinone-independent reductive dehalogenases that are distinguishable at the amino acid sequence level, implying different modes of energy conservation in the respective microorganisms. In this review, we summarize current knowledge about catabolic reductive dehalogenases and the electron transfer chain they are part of. We review reaction mechanisms and the role of the corrinoid and Fe-S cluster cofactors and discuss physiological implications.
Directory of Open Access Journals (Sweden)
Bingzhi Chen
Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.
Surger, Maximilian J; Angelov, Angel; Stier, Philipp; Übelacker, Maria; Liebl, Wolfgang
2018-01-01
Micrococcus luteus naturally produces alkenes, unsaturated aliphatic hydrocarbons, and represents a promising host to produce hydrocarbons as constituents of biofuels and lubricants. In this work, we identify the genes for key enzymes of the branched-chain amino acid catabolism in M. luteus , whose first metabolic steps lead also to the formation of primer molecules for branched-chain fatty acid and olefin biosynthesis, and demonstrate how these genes can be used to manipulate the production of specific olefins in this organism. We constructed mutants of several gene candidates involved in the branched-chain amino acid metabolism or its regulation and investigated the resulting changes in the cellular fatty acid and olefin profiles by GC/MS. The gene cluster encoding the components of the branched-chain α-keto acid dehydrogenase (BCKD) complex was identified by deletion and promoter exchange mutagenesis. Overexpression of the BCKD gene cluster resulted in about threefold increased olefin production whereas deletion of the cluster led to a drastic reduction in branched-chain fatty acid content and a complete loss of olefin production. The specificities of the acyl-CoA dehydrogenases of the branched amino acid degradation pathways were deduced from the fatty acid and olefin profiles of the respective deletion mutant strains. In addition, growth experiments with branched amino acids as the only nitrogen source were carried out with the mutants in order to confirm our annotations. Both the deletion mutant of the BCKD complex, responsible for the further degradation of all three branched-chain amino acids, as well as the deletion mutant of the proposed isovaleryl-CoA dehydrogenase (specific for leucine degradation) were not able to grow on leucine in contrast to the parental strain. In conclusion, our experiments allow the unambigous assignment of specific functions to the genes for key enzymes of the branched-chain amino acid metabolism of M. luteus . We also show how
Kim, K S; Chilton, W S; Farrand, S K
1996-06-01
The mocC gene encoded by the octopine/mannityl opine-type Ti plasmid pTi15955 is related at the nucleotide sequence level to mas1' encoded by the T region of this plasmid. While Mas1 is required for the synthesis of mannopine (MOP) by crown gall tumor cells, MocC is essential for the utilization of MOP by Agrobacterium spp. A cosmid clone of pTi15955, pYDH208, encodes mocC and confers the utilization of MOP on strain NT1 and on strain UIA5, a derivative of NT1 lacking the 450-kb cryptic plasmid pAtC58. NT1 or UIA5 harboring pYDH208 with an insertion mutation in mocC failed to utilize MOP as the sole carbon source. Plasmid pSa-C, which encodes only mocC, complemented this mutation in both strains. This plasmid also was sufficient to confer utilization of MOP on NT1 but not on UIA5. Computer analysis showed that MocC is related at the amino acid sequence level to members of the short-chain alcohol dehydrogenase family of oxidoreductases. Lysates prepared from Escherichia coli cells expressing mocC contained an enzymatic activity that oxidizes MOP to deoxyfructosyl glutamine (santhopine [SOP]) in the presence of NAD+. The reaction catalyzed by the MOP oxidoreductase is reversible; in the presence of NADH, the enzyme reduced SOP to MOP. The apparent Km values of the enzyme for MOP and SOP were 6.3 and 1.2 mM, respectively. Among analogs of MOP tested, only N-1-(1-deoxy-D-lyxityl)-L-glutamine and N-1-(1-deoxy-D-mannityl)-L-asparagine served as substrates for MOP oxidoreductase. These results indicate that mocC encodes an oxidoreductase that, as an oxidase, is essential for the catabolism of MOP. The reductase activity of this enzyme is precisely the reaction ascribed to its T-region-encoded homolog, Mas1, which is responsible for biosynthesis of mannopine in crown gall tumors.
Directory of Open Access Journals (Sweden)
Borchardt Stephanie M
2006-07-01
Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.
Transcriptome profiling of TDC cluster deletion mutant of Enterococcus faecalis V583
Directory of Open Access Journals (Sweden)
Marta Perez
2016-09-01
Full Text Available The species Enterococcus faecalis is able to catabolise the amino acid tyrosine into the biogenic amine tyramine by the tyrosine decarboxilase (TDC pathway Ladero et al. (2012 [1]. The TDC cluster comprises four genes: tyrS, an aminoacyl-tRNA synthetase-like gene; tdcA, which encodes the tyrosine decarboxylase; tyrP, a tyrosine/tyramine exchanger gene and nhaC-2, which encodes an Na+/H+ antiporter and whose role in the tyramine biosynthesis remains unknown [2]. In E. faecalis V583 the last three genes are co-transcribed as a single polycistronic mRNA forming the catabolic operon, while tyrS is transcribed independently of the catabolic genes as a monocistronic mRNA [2]. The catabolic operon is transcriptionally induced by tyrosine and acidic pH. On the opposite, the tyrS expression is repressed by tyrosine concentrations [2]. In this work we report the transcriptional profiling of the TDC cluster deletion mutant (E. faecalis V583 ΔTDC [2] compared to the wild-type strain, both grown in M17 medium supplemented with tyrosine. The transcriptional profile data of TDC cluster-regulated genes were deposited in the Gene Expression Omnibus (GEO database under accession no. GSE77864.
The Atg1-Tor pathway regulates yolk catabolism in Drosophila embryos.
Kuhn, Hallie; Sopko, Richelle; Coughlin, Margaret; Perrimon, Norbert; Mitchison, Tim
2015-11-15
Yolk provides an important source of nutrients during the early development of oviparous organisms. It is composed mainly of vitellogenin proteins packed into membrane-bound compartments called yolk platelets. Catabolism of yolk is initiated by acidification of the yolk platelet, leading to the activation of Cathepsin-like proteinases, but it is unknown how this process is triggered. Yolk catabolism initiates at cellularization in Drosophila melanogaster embryos. Using maternal shRNA technology we found that yolk catabolism depends on the Tor pathway and on the autophagy-initiating kinase Atg1. Whereas Atg1 was required for a burst of spatially regulated autophagy during late cellularization, autophagy was not required for initiating yolk catabolism. We propose that the conserved Tor metabolic sensing pathway regulates yolk catabolism, similar to Tor-dependent metabolic regulation on the lysosome. © 2015. Published by The Company of Biologists Ltd.
Directory of Open Access Journals (Sweden)
Mariana Gomes Germano
2012-05-01
Full Text Available The objective of this work was to evaluate the catabolic gene diversity for the bacterial degradation of aromatic hydrocarbons in anthropogenic dark earth of Amazonia (ADE and their biochar (BC. Functional diversity analyses in ADE soils can provide information on how adaptive microorganisms may influence the fertility of soils and what is their involvement in biogeochemical cycles. For this, clone libraries containing the gene encoding for the alpha subunit of aromatic ring-hydroxylating dioxygenases (α-ARHD bacterial gene were constructed, totaling 800 clones. These libraries were prepared from samples of an ADE soil under two different land uses, located at the Caldeirão Experimental Station - secondary forest (SF and agriculture (AG -, and the biochar (SF_BC and AG_BC, respectively. Heterogeneity estimates indicated greater diversity in BC libraries; and Venn diagrams showed more unique operational protein clusters (OPC in the SF_BC library than the ADE soil, which indicates that specific metabolic processes may occur in biochar. Phylogenetic analysis showed unidentified dioxygenases in ADE soils. Libraries containing functional gene encoding for the alpha subunit of the aromatic ring-hydroxylating dioxygenases (ARHD gene from biochar show higher diversity indices than those of ADE under secondary forest and agriculture.
International Nuclear Information System (INIS)
Woloschak, G.E.; Chang-Liu, Chin-Mei
1994-01-01
Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
Selifonov, S A; Starozoĭtov, I I
1990-12-01
It was shown that two different enzymes of aromatic ring oxidative meta-cleavage (2,3-dihydroxybiphenyl-1,2-dioxygenase), DBO and catechol-2,3-dioxygenase, C230) function in Pseudomonas strains with a plasmid and chromosomal genetic control of biphenyl and toluate catabolism. A comparative analysis of DBO's and C230's expressed by the pBS241 biphenyl degradative plasmid in P. putida BS893, pBS311 in P. putida U83, chromosomal genes in P. putida BF and C230 from P. putida PaW160 (pWWO) was carried out. It was found that the DBO's of all strains under study are highly specialized enzymes in respect of 2,3-dihydroxybiphenyl cleavage and are also able to cleave 3-methyl-catechol and catechol (but not 4-methylcatechol) at low rates. In contrast with DBO's, in Pseudomonas strains the substrate specificities of all C230's are variable. The C230's expressed by the D-plasmids pBS241 and pBC311 have a moderate affinity for catechol, 3-methyl- and 4-methylcatechol, but are unable to cleave 2,3-dihydroxybiphenyl. The C230 which is encoded by the chromosomal structure gene from P. putida BF is very similar to C230 which codes for the TOL-plasmid pWWO. These plasmid differ from C230's expressed by biphenyl D-plasmids due to their capability to cleave 2,3-dihydroxybiphenyl in addition to catechol cleavage. All DBO's and C230's under study possess a number of properties that are typical for the enzymes having an oxidative meta-cleaving effect. The different roles of these enzymes in biphenyl and toluate catabolism in Pseudomonas strains are discussed.
Do Carmo, A P; da Silva, D F; De Oliveira, M N V; Borges, A C; De Carvalho, A F; De Moraes, C A
2011-09-01
A basic requirement for the prediction of the potential use of lactic acid bacteria (LAB) in the dairy industry is the identification of specific genes involved in flavour-forming pathways. The probiotic Lactobacillus delbrueckii UFV H2b20 was submitted to a genetic characterisation and phylogenetic analysis of genes involved in protein catabolism. Eight genes belonging to this system were identified, which possess a closely phylogenetic relationship to NCFM strains representative, as it was demonstrated for oppC and oppBII, encoding oligopeptide transport system components. PepC, PepN, and PepX might be essential for growth of LAB, probiotic or not, since the correspondent genes are always present, including in L. delbrueckii UFV H2b20 genome. For pepX gene, a probable link between carbohydrate catabolism and PepX expression may exists, where it is regulated by PepR1/CcpA-like, a common feature between Lactobacillus strains and also in L. delbrueckii UFV H2b20. The well conserved evolutionary history of the ilvE gene is evidence that the pathways leading to branched-chain amino acid degradation, such as isoleucine and valine, are similar among L. delbrueckii subsp. bulgaricus strains and L. delbrueckii UFV H2b20. Thus, the involvement of succinate in flavour formation can be attributed to IlvE activity. The presence of aminopeptidase G in L. delbrueckii UFV H2b20 genome, which is absent in several strains, might improve the proteolytic activity and effectiveness. The nucleotide sequence encoding PepG revealed that it is a cysteine endopeptidase, belonging to Peptidase C1 superfamily; sequence analysis showed 99% identity with L. delbrueckii subsp. bulgaricus ATCC 11842 pepG, whereas protein sequence analysis revealed 100% similarity with PepG from the same organism. The present study proposes a schematic model to explain how the proteolytic system of the probiotic L. delbrueckii UFV H2b20 works, based on the components identified so far.
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes
Directory of Open Access Journals (Sweden)
Berkhout Ben
2006-12-01
Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.
Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.
Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M
1991-02-15
The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.
DEFF Research Database (Denmark)
Abildgaard, L; Engberg, RM; Pedersen, Karl
2009-01-01
The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...
Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato
International Nuclear Information System (INIS)
Hayat, S.; Cheng, Z.; Chen, X.
2016-01-01
The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)
Directory of Open Access Journals (Sweden)
Ghaffari Novin M.
2015-06-01
Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.
Directory of Open Access Journals (Sweden)
Jacqueline Schmuckli-Maurer
Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic
DEFF Research Database (Denmark)
Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal
2017-01-01
The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...
An evolutionarily conserved gene family encodes proton-selective ion channels.
Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R
2018-03-02
Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.
Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R
1992-01-01
Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the
Directory of Open Access Journals (Sweden)
Bryan D Moyer
Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins
Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica
Directory of Open Access Journals (Sweden)
Kouji Shimoda
2002-01-01
Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.
DEFF Research Database (Denmark)
Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.
2018-01-01
The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...
Energy Technology Data Exchange (ETDEWEB)
Clarkson, Sonya M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Giannone, Richard J. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Chemical Sciences Division; Kridelbaugh, Donna M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Elkins, James G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Guss, Adam M. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division; Michener, Joshua K. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States). Biosciences Division, BioEnergy Science Center; Vieille, Claire [Michigan State Univ., East Lansing, MI (United States)
2017-07-21
The production of biofuels from lignocellulose yields a substantial lignin by-product stream that currently has few applications. Biological conversion of lignin-derived compounds into chemicals and fuels has the potential to improve the economics of lignocellulose-derived biofuels, but few microbes are able both to catabolize lignin-derived aromatic compounds and to generate valuable products. While
Pyne, C; Bognar, A L
1992-03-01
The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.
Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John
2017-12-26
The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L
2013-01-01
The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.
Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.
Directory of Open Access Journals (Sweden)
Linda J Savage
Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles
Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.
2015-01-01
Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased
Energy Technology Data Exchange (ETDEWEB)
Posen, Paulette [School of Environmental Sciences, University of East Anglia, Earlham Road, Norwich NR4 7TJ (United Kingdom)]. E-mail: p.posen@uea.ac.uk; Lovett, Andrew [School of Environmental Sciences, University of East Anglia, Earlham Road, Norwich NR4 7TJ (United Kingdom); Hiscock, Kevin [School of Environmental Sciences, University of East Anglia, Earlham Road, Norwich NR4 7TJ (United Kingdom); Evers, Sarah [Environment Agency, Olton Court, 10 Warwick Road, Olton, Solihull, B92 7HX (United Kingdom); Ward, Rob [Environment Agency, Olton Court, 10 Warwick Road, Olton, Solihull, B92 7HX (United Kingdom); Reid, Brian [School of Environmental Sciences, University of East Anglia, Earlham Road, Norwich NR4 7TJ (United Kingdom)
2006-08-31
The catabolic activity of incumbent microorganisms in soil samples of eleven dissimilar soil series was investigated, with respect to the herbicide isoproturon. Soils were collected from a 30 x 37 km area of river catchment to the north-west of London, England. Catabolic activity in each soil type during a 500 h assay was determined by {sup 14}C-radiorespirometry. Results showed four soils that exhibited high levels of catabolic activity (33-44% mineralisation) while the remaining seven soils showed lower levels of catabolic activity (12-16% mineralisation). There was evidence to suggest that soils exhibiting high catabolic activity had low (< 22%) clay content and tended towards lower organic carbon content (< 2.7%), but that these higher levels of catabolic activity were also related to pre-exposure to isoproturon. The {sup 14}C-radiorespirometric results were used to produce a GIS layer representing levels of catabolic activity for the dissimilar soils across the study area. This layer was combined with other GIS layers relating to pesticide attenuation, including soil organic carbon content, depth to groundwater and hydrogeology, to produce a map showing risk of groundwater contamination by isoproturon. The output from this approach was compared with output from an attenuation-only approach and differences appraised. Inclusion of the catabolism layer resulted in a lowering of risk in the model in 15% of the study area. Although there appears to be limited benefit in including pesticide catabolic activity in this regional-scale groundwater risk model, this type of addition could be useful in a site-specific risk assessment.
Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.
The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and
International Nuclear Information System (INIS)
Posen, Paulette; Lovett, Andrew; Hiscock, Kevin; Evers, Sarah; Ward, Rob; Reid, Brian
2006-01-01
The catabolic activity of incumbent microorganisms in soil samples of eleven dissimilar soil series was investigated, with respect to the herbicide isoproturon. Soils were collected from a 30 x 37 km area of river catchment to the north-west of London, England. Catabolic activity in each soil type during a 500 h assay was determined by 14 C-radiorespirometry. Results showed four soils that exhibited high levels of catabolic activity (33-44% mineralisation) while the remaining seven soils showed lower levels of catabolic activity (12-16% mineralisation). There was evidence to suggest that soils exhibiting high catabolic activity had low ( 14 C-radiorespirometric results were used to produce a GIS layer representing levels of catabolic activity for the dissimilar soils across the study area. This layer was combined with other GIS layers relating to pesticide attenuation, including soil organic carbon content, depth to groundwater and hydrogeology, to produce a map showing risk of groundwater contamination by isoproturon. The output from this approach was compared with output from an attenuation-only approach and differences appraised. Inclusion of the catabolism layer resulted in a lowering of risk in the model in 15% of the study area. Although there appears to be limited benefit in including pesticide catabolic activity in this regional-scale groundwater risk model, this type of addition could be useful in a site-specific risk assessment
Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.
2005-01-01
Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691
Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.
Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G
2004-10-01
The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.
DEFF Research Database (Denmark)
Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel
2016-01-01
genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...
Zeng, Yin-Xin; Qiao, Zong-Yun; Yu, Yong; Li, Hui-Rong; Luo, Wei
2016-09-08
Dimethylsulfoniopropionate (DMSP), which is the major source of organic sulfur in the world's oceans, plays a significant role in the global sulfur cycle. This compound is rapidly degraded by marine bacteria either by cleavage to dimethylsulfide (DMS) or demethylation to 3-methylmercaptopropionate (MMPA). The diversity of genes encoding bacterial demethylation (dmdA) and DMS production (dddL and dddP) were measured in Arctic Kongsfjorden. Both dmdA and dddL genes were detected in all stations along a transect from the outer to the inner fjord, while dddP gene was only found in the outer and middle parts of the fjord. The dmdA gene was completely confined to the Roseobacter clade, while the dddL gene was confined to the genus Sulfitobacter. Although the dddP gene pool was also dominated by homologs from the Roseobacter clade, there were a few dddP genes showing close relationships to both Alphaproteobacter and Gammaproteobacter. The results of this study suggest that the Roseobacter clade may play an important role in DMSP catabolism via both demethylation and cleavage pathways in surface waters of Kongsfjorden during summer.
Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H
2015-01-01
This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.
Directory of Open Access Journals (Sweden)
Ashley L Waldron
Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.
Dai, Shengjie; Li, Ping; Chen, Pei; Li, Qian; Pei, Yuelin; He, Suihuan; Sun, Yufei; Wang, Ya; Kai, Wenbin; Zhao, Bo; Liao, Yalan; Leng, Ping
2014-09-01
To investigate the contribution of abscisic acid (ABA) in pear 'Gold Nijisseiki' during fruit ripening and under dehydration stress, two cDNAs (PpNCED1 and PpNCED2) which encode 9-cis-epoxycarotenoid dioxygenase (NCED) (a key enzyme in ABA biosynthesis), two cDNAs (PpCYP707A1 and PpCYP707A2) which encode 8'-hydroxylase (a key enzyme in the oxidative catabolism of ABA), one cDNA (PpACS3) which encodes 1-aminocyclopropane-1-carboxylic acid (ACC), and one cDNA (PpACO1) which encodes ACC oxidase involved in ethylene biosynthesis were cloned from 'Gold Nijisseiki' fruit. In the pulp, peel and seed, expressions of PpNCED1 and PpNCED2 rose in two stages which corresponded with the increase of ABA levels. The expression of PpCYP707A1 dramatically declined after 60-90 days after full bloom (DAFB) in contrast to the changes of ABA levels during this period, while PpCYP707A2 stayed low during the whole development of fruit. Application of exogenous ABA at 100 DAFB increased the soluble sugar content and the ethylene release but significantly decreased the titratable acid and chlorophyll contents in fruits. When fruits harvested at 100 DAFB were stored in the laboratory (25 °C, 50% relative humidity), the ABA content and the expressions of PpNCED1/2 and PpCYP707A1 in the pulp, peel and seed increased significantly, while ethylene reached its highest value after the maximum peak of ABA accompanied with the expressions of PpACS3 and PpACO1. In sum the endogenous ABA may play an important role in the fruit ripening and dehydration of pear 'Gold Nijisseiki' and the ABA level was regulated mainly by the dynamics of PpNCED1, PpNCED2 and PpCYP707A1 at the transcriptional level. Copyright © 2014 Elsevier Masson SAS. All rights reserved.
Immunosuppressive Tryptophan Catabolism and Gut Mucosal Dysfunction Following Early HIV Infection
Jenabian, Mohammad-Ali; El-Far, Mohamed; Vyboh, Kishanda; Kema, Ido; Costiniuk, Cecilia T.; Thomas, Rejean; Baril, Jean-Guy; LeBlanc, Roger; Kanagaratham, Cynthia; Radzioch, Danuta; Allam, Ossama; Ahmad, Ali; Lebouche, Bertrand; Tremblay, Cecile; Ancuta, Petronela; Routy, Jean-Pierre
2015-01-01
Background. Tryptophan (Trp) catabolism into kynurenine (Kyn) contributes to immune dysfunction in chronic human immunodeficiency virus (HIV) infection. To better define the relationship between Trp catabolism, inflammation, gut mucosal dysfunction, and the role of early antiretroviral therapy
van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.
1991-01-01
Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.
Characterization of the human gene (TBXAS1) encoding thromboxane synthase.
Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T
1994-09-01
The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.
Hepatic Fatty Acid Oxidation Restrains Systemic Catabolism during Starvation
Directory of Open Access Journals (Sweden)
Jieun Lee
2016-06-01
Full Text Available The liver is critical for maintaining systemic energy balance during starvation. To understand the role of hepatic fatty acid β-oxidation on this process, we generated mice with a liver-specific knockout of carnitine palmitoyltransferase 2 (Cpt2L−/−, an obligate step in mitochondrial long-chain fatty acid β-oxidation. Fasting induced hepatic steatosis and serum dyslipidemia with an absence of circulating ketones, while blood glucose remained normal. Systemic energy homeostasis was largely maintained in fasting Cpt2L−/− mice by adaptations in hepatic and systemic oxidative gene expression mediated in part by Pparα target genes including procatabolic hepatokines Fgf21, Gdf15, and Igfbp1. Feeding a ketogenic diet to Cpt2L−/− mice resulted in severe hepatomegaly, liver damage, and death with a complete absence of adipose triglyceride stores. These data show that hepatic fatty acid oxidation is not required for survival during acute food deprivation but essential for constraining adipocyte lipolysis and regulating systemic catabolism when glucose is limiting.
Directory of Open Access Journals (Sweden)
Yuepeng eHan
2015-04-01
Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.
Greenwood, I A; Yeung, S Y; Tribe, R M; Ohya, S
2009-01-01
There is a growing appreciation that ion channels encoded by the ether-à-go-go-related gene family have a functional impact in smooth muscle in addition to their accepted role in cardiac myocytes and neurones. This study aimed to assess the expression of ERG1–3 (KCNH1–3) genes in the murine myometrium (smooth muscle layer of the uterus) and determine the functional impact of the ion channels encoded by these genes in pregnant and non-pregnant animals. Quantitative RT-PCR did not detect message for ERG2 and 3 in whole myometrial tissue extracts. In contrast, message for two isoforms of mERG1 were readily detected with mERG1a more abundant than mERG1b. In isometric tension studies of non-pregnant myometrium, the ERG channel blockers dofetilide (1 μm), E4031 (1 μm) and Be-KM1 (100 nm) increased spontaneous contractility and ERG activators (PD118057 and NS1643) inhibited spontaneous contractility. In contrast, neither ERG blockade nor activation had any effect on the inherent contractility in myometrium from late pregnant (19 days gestation) animals. Moreover, dofetilide-sensitive K+ currents with distinctive ‘hooked’ kinetics were considerably smaller in uterine myocytes from late pregnant compared to non-pregnant animals. Expression of mERG1 isoforms did not alter throughout gestation or upon delivery, but the expression of genes encoding auxillary subunits (KCNE) were up-regulated considerably. This study provides the first evidence for a regulation of ERG-encoded K+ channels as a precursor to late pregnancy physiological activity. PMID:19332483
Directory of Open Access Journals (Sweden)
Catalina Sanz
Full Text Available Phycomyces carRA gene encodes a protein with two domains. Domain R is characterized by red carR mutants that accumulate lycopene. Domain A is characterized by white carA mutants that do not accumulate significant amounts of carotenoids. The carRA-encoded protein was identified as the lycopene cyclase and phytoene synthase enzyme by sequence homology with other proteins. However, no direct data showing the function of this protein have been reported so far. Different Mucor circinelloides mutants altered at the phytoene synthase, the lycopene cyclase or both activities were transformed with the Phycomyces carRA gene. Fully transcribed carRA mRNA molecules were detected by Northern assays in the transformants and the correct processing of the carRA messenger was verified by RT-PCR. These results showed that Phycomyces carRA gene was correctly expressed in Mucor. Carotenoids analysis in these transformants showed the presence of ß-carotene, absent in the untransformed strains, providing functional evidence that the Phycomyces carRA gene complements the M. circinelloides mutations. Co-transformation of the carRA cDNA in E. coli with different combinations of the carotenoid structural genes from Erwinia uredovora was also performed. Newly formed carotenoids were accumulated showing that the Phycomyces CarRA protein does contain lycopene cyclase and phytoene synthase activities. The heterologous expression of the carRA gene and the functional complementation of the mentioned activities are not very efficient in E. coli. However, the simultaneous presence of both carRA and carB gene products from Phycomyces increases the efficiency of these enzymes, presumably due to an interaction mechanism.
International Nuclear Information System (INIS)
Reynolds, P.; Weber, S.; Prakash, L.
1985-01-01
The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures
DEFF Research Database (Denmark)
Jensen, Anja T R; Magistrado, Pamela; Sharp, Sarah
2004-01-01
Parasite-encoded variant surface antigens (VSAs) like the var gene-encoded Plasmodium falciparum erythrocyte membrane protein 1 (PfEMP1) family are responsible for antigenic variation and infected red blood cell (RBC) cytoadhesion in P. falciparum malaria. Parasites causing severe malaria in noni...... genes, such as PFD1235w/MAL7P1.1, appear to be involved in the pathogenesis of severe disease and are thus attractive candidates for a vaccine against life-threatening P. falciparum malaria....
Czech Academy of Sciences Publication Activity Database
Nešvera, Jan; Rucká, Lenka; Pátek, Miroslav
2015-01-01
Roč. 93, č. 2015 (2015), s. 107-160 ISSN 0065-2164 R&D Projects: GA TA ČR TA04021212 Institutional support: RVO:61388971 Keywords : Biodegradation * Bioremediation * Phenol catabolism Subject RIV: EE - Microbiology, Virology Impact factor: 4.128, year: 2015
Variable carbon catabolism among Salmonella enterica serovar Typhi isolates.
Directory of Open Access Journals (Sweden)
Lay Ching Chai
Full Text Available BACKGROUND: Salmonella enterica serovar Typhi (S. Typhi is strictly a human intracellular pathogen. It causes acute systemic (typhoid fever and chronic infections that result in long-term asymptomatic human carriage. S. Typhi displays diverse disease manifestations in human infection and exhibits high clonality. The principal factors underlying the unique lifestyle of S. Typhi in its human host during acute and chronic infections remain largely unknown and are therefore the main objective of this study. METHODOLOGY/PRINCIPAL FINDINGS: To obtain insight into the intracellular lifestyle of S. Typhi, a high-throughput phenotypic microarray was employed to characterise the catabolic capacity of 190 carbon sources in S. Typhi strains. The success of this study lies in the carefully selected library of S. Typhi strains, including strains from two geographically distinct areas of typhoid endemicity, an asymptomatic human carrier, clinical stools and blood samples and sewage-contaminated rivers. An extremely low carbon catabolic capacity (27% of 190 carbon substrates was observed among the strains. The carbon catabolic profiles appeared to suggest that S. Typhi strains survived well on carbon subtrates that are found abundantly in the human body but not in others. The strains could not utilise plant-associated carbon substrates. In addition, α-glycerolphosphate, glycerol, L-serine, pyruvate and lactate served as better carbon sources to monosaccharides in the S. Typhi strains tested. CONCLUSION: The carbon catabolic profiles suggest that S. Typhi could survive and persist well in the nutrient depleted metabolic niches in the human host but not in the environment outside of the host. These findings serve as caveats for future studies to understand how carbon catabolism relates to the pathogenesis and transmission of this pathogen.
Lu, Y P; Li, Z S; Rea, P A
1997-07-22
Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.
Directory of Open Access Journals (Sweden)
Elías Trujillo-Esquivel
2017-09-01
Full Text Available Sporothrix schenckii is one of the causative agents of sporotrichosis, a worldwide-distributed mycosis that affects humans and other mammals. The interest in basic and clinical features of this organism has significantly increased in the last years, yet little progress in molecular aspects has been reported. Gene expression analysis is a set of powerful tools that helps to assess the cell response to changes in the extracellular environment, the genetic networks controlling metabolic pathways, and the adaptation to different growth conditions. Most of the quantitative methodologies used nowadays require data normalization, and this is achieved measuring the expression of endogenous control genes. Reference genes, whose expression is assumed to suffer minimal changes regardless the cell morphology, the stage of the cell cycle or the presence of harsh extracellular conditions are commonly used as controls in Northern blotting assays, microarrays, and semi-quantitative or quantitative RT-PCR. Since the biology of the organisms is usually species specific, it is difficult to find a reliable group of universal genes that can be used as controls for data normalization in experiments addressing the gene expression, regardless the taxonomic classification of the organism under study. Here, we compared the transcriptional stability of the genes encoding for elongation factor 1A, Tfc1, a protein involved in transcription initiation on Pol III promoters, ribosomal protein L6, histone H2A, β-actin, β-tubulin, glyceraldehyde 3-phosphate dehydrogenase, UAF30, the upstream activating factor 30, and the transcription initiation factor TFIID subunit 10, during the fungal growth in different culture media and cell morphologies. Our results indicated that only the gene encoding for the ribosomal protein L6 showed a stable and constant expression. Furthermore, it displayed not transcriptional changes when S. schenckii infected larvae of Galleria mellonella or
DEFF Research Database (Denmark)
Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel
2015-01-01
at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki
2012-01-01
We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID
Wang, Ya-Fei; Wang, Ya-Fei; Li, Hui; Li, Xiao-Bin
2013-11-01
Based on triparental mating, we isolated a total of eight broad host range (BHR) petroleum hydrocarbon catabolic plasmids from the soils, sediments, and wastewater samples in the Shen-Fu irrigation zone. The antibiotic resistance of the plasmids was tested, and then, the plasmids were transferred to Escherichia coli EC100. The plasmids carrying no antibiotic resistance were tagged by miniTn5 transposon consisting of antibiotic resistant genes. The PCR-based incompatibility test revealed that the pS3-2C and pS4-6G belonged to Inc P group, the pS3-2G, pW22-3G, and pA15-7G belonged to Inc N group, the pS7-2G was identified as Inc W plasmid, and the pA23-1G and pA10-1C were placed into Inc Q group. By adopting the reported PCR amplification methods of petroleum hydrocarbon-degrading catabolic genes, the petroleum-degrading capability of these BHR plasmids were preliminarily analyzed. The plasmids pS3-2G, pS7-2G, pA23-1G, pW22-3G, and pA10-1C carried aromatic ring- hydroxylating dioxygenase gene phdA and toluene monooxygenase gene touA; the plasmid pA15-7G carried touA and toluene dioxygenase gene tod; the plasmid pS3-2C carried ben, phdA, and tod; whereas the pS4-6G only carried ben. The host range test showed that all the isolated plasmids except pS3-2C could be transferred and maintained stably in the representative strains Agrobacterium tumefaciens C58, Cupriavidus necator JMP228, and E. coli EC100 of the alpha-, beta-, and gamma-Proteobacteria, respectively.
He, Amanda; Penix, Stephanie R; Basting, Preston J; Griffith, Jessie M; Creamer, Kaitlin E; Camperchioli, Dominic; Clark, Michelle W; Gonzales, Alexandra S; Chávez Erazo, Jorge Sebastian; George, Nadja S; Bhagwat, Arvind A; Slonczewski, Joan L
2017-06-15
Acid-adapted strains of Escherichia coli K-12 W3110 were obtained by serial culture in medium buffered at pH 4.6 (M. M. Harden, A. He, K. Creamer, M. W. Clark, I. Hamdallah, K. A. Martinez, R. L. Kresslein, S. P. Bush, and J. L. Slonczewski, Appl Environ Microbiol 81:1932-1941, 2015, https://doi.org/10.1128/AEM.03494-14). Revised genomic analysis of these strains revealed insertion sequence (IS)-driven insertions and deletions that knocked out regulators CadC (acid induction of lysine decarboxylase), GadX (acid induction of glutamate decarboxylase), and FNR (anaerobic regulator). Each acid-evolved strain showed loss of one or more amino acid decarboxylase systems, which normally help neutralize external acid (pH 5 to 6) and increase survival in extreme acid (pH 2). Strains from populations B11, H9, and F11 had an IS 5 insertion or IS-mediated deletion in cadC , while population B11 had a point mutation affecting the arginine activator adiY The cadC and adiY mutants failed to neutralize acid in the presence of exogenous lysine or arginine. In strain B11-1, reversion of an rpoC (RNA polymerase) mutation partly restored arginine-dependent neutralization. All eight strains showed deletion or downregulation of the Gad acid fitness island. Strains with the Gad deletion lost the ability to produce GABA (gamma-aminobutyric acid) and failed to survive extreme acid. Transcriptome sequencing (RNA-seq) of strain B11-1 showed upregulated genes for catabolism of diverse substrates but downregulated acid stress genes (the biofilm regulator ariR , yhiM , and Gad). Other strains showed downregulation of H 2 consumption mediated by hydrogenases ( hya and hyb ) which release acid. Strains F9-2 and F9-3 had a deletion of fnr and showed downregulation of FNR-dependent genes ( dmsABC , frdABCD , hybABO , nikABCDE , and nrfAC ). Overall, strains that had evolved in buffered acid showed loss or downregulation of systems that neutralize unbuffered acid and showed altered regulation of
Osipenkova, O V; Ermokhina, O V; Belkina, G G; Oleskina, Iu P; Fattakhov, S G; Iurina, N P
2008-01-01
The effect of melafen, a plant growth regulator of a new generation, on the growth, pigment composition, and expression of nuclear genes Elip1 and Elip2 encoding chloroplast light-stress proteins in barley (Hordeum vulgare L) seedlings was studied. It is shown that the height of seedlings treated with melafen at concentrations of 0.5 x 10(-10) and 0.5 x 10(-8) M increased by approximately 10 and 20%, respectively, as compared to the control. At high concentrations (10(-5) and 10(-3) M), melafen had no effect on the growth of seedlings. The content of chlorophylls and carotenoids in chloroplasts barely differed from the control at all melafen concentrations tested. Reverse transcription-polymerase chain reaction (RT-PCR) showed that melafen did not influence the expression of the nuclear gene encoding the low-molecular-weight plastid stress protein ELIP1. At the same time, the expression of the nuclear gene encoding the high-molecular-weight light-inducible stress protein ELIP2 in the plants treated with melafen at a concentration of 0.5 x 10(-8) M, increased by approximately 70 %. At higher concentrations, melafen suppressed the Elip2 gene expression. Thus, melafen affects the expression of the Elip2 gene, which is involved in the regulation of chlorophyll synthesis and chloroplast biogenesis, which, in turn, may lead to changes in the resistance of plants to light-induced stress.
Stricker, A.R.; Mach, R.L.; Graaff, de L.H.
2008-01-01
The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.
Directory of Open Access Journals (Sweden)
Aris Haryanto
2016-01-01
Full Text Available Aim: Avian encephalomyelitis (AE is a viral disease which can infect various types of poultry, especially chicken. In Indonesia, the incidence of AE infection in chicken has been reported since 2009, the AE incidence tends to increase from year to year. The objective of this study was to analyze viral protein 2 (VP-2 encoding gene of AE virus (AEV from various species of birds in field specimen by reverse transcription polymerase chain reaction (RT-PCR amplification using specific nucleotides primer for confirmation of AE diagnosis. Materials and Methods: A total of 13 AEV samples are isolated from various species of poultry which are serologically diagnosed infected by AEV from some areas in central Java, Indonesia. Research stage consists of virus samples collection from field specimens, extraction of AEV RNA, amplification of VP-2 protein encoding gene by RT-PCR, separation of RT-PCR product by agarose gel electrophoresis, DNA sequencing and data analysis. Results: Amplification products of the VP-2 encoding gene of AEV by RT-PCR methods of various types of poultry from field specimens showed a positive results on sample code 499/4/12 which generated DNA fragment in the size of 619 bp. Sensitivity test of RT-PCR amplification showed that the minimum concentration of RNA template is 127.75 ng/μl. The multiple alignments of DNA sequencing product indicated that positive sample with code 499/4/12 has 92% nucleotide homology compared with AEV with accession number AV1775/07 and 85% nucleotide homology with accession number ZCHP2/0912695 from Genbank database. Analysis of VP-2 gene sequence showed that it found 46 nucleotides difference between isolate 499/4/12 compared with accession number AV1775/07 and 93 nucleotides different with accession number ZCHP2/0912695. Conclusions: Analyses of the VP-2 encoding gene of AEV with RT-PCR method from 13 samples from field specimen generated the DNA fragment in the size of 619 bp from one sample with
Directory of Open Access Journals (Sweden)
Zhang Shuangyu
2012-03-01
Full Text Available Abstract Background para-Nitrophenol (PNP, a priority environmental pollutant, is hazardous to humans and animals. However, the information relating to the PNP degradation pathways and their enzymes remain limited. Results Pseudomonas sp.1-7 was isolated from methyl parathion (MP-polluted activated sludge and was shown to degrade PNP. Two different intermediates, hydroquinone (HQ and 4-nitrocatechol (4-NC were detected in the catabolism of PNP. This indicated that Pseudomonas sp.1-7 degraded PNP by two different pathways, namely the HQ pathway, and the hydroxyquinol (BT pathway (also referred to as the 4-NC pathway. A gene cluster (pdcEDGFCBA was identified in a 10.6 kb DNA fragment of a fosmid library, which cluster encoded the following enzymes involved in PNP degradation: PNP 4-monooxygenase (PdcA, p-benzoquinone (BQ reductase (PdcB, hydroxyquinol (BT 1,2-dioxygenase (PdcC, maleylacetate (MA reductase (PdcF, 4-hydroxymuconic semialdehyde (4-HS dehydrogenase (PdcG, and hydroquinone (HQ 1,2-dioxygenase (PdcDE. Four genes (pdcDEFG were expressed in E. coli and the purified pdcDE, pdcG and pdcF gene products were shown to convert HQ to 4-HS, 4-HS to MA and MA to β-ketoadipate respectively by in vitro activity assays. Conclusions The cloning, sequencing, and characterization of these genes along with the functional PNP degradation studies identified 4-NC, HQ, 4-HS, and MA as intermediates in the degradation pathway of PNP by Pseudomonas sp.1-7. This is the first conclusive report for both 4-NC and HQ- mediated degradation of PNP by one microorganism.
Alvarez, María de Fátima; Medina, Roxana; Pasteris, Sergio E; Strasser de Saad, Ana M; Sesma, Fernando
2004-01-01
Lactobacillus rhamnosus ATCC 7469 was able to grow in glycerol as the sole source of energy in aerobic conditions, producing lactate, acetate, and diacetyl. A biphasic growth was observed in the presence of glucose. In this condition, glycerol consumption began after glucose was exhausted from the culture medium. Glycerol kinase activity was detected in L. rhamnosus ATCC 7469, a characteristic of microorganisms which catabolize glycerol in aerobic conditions. Genetic analysis revealed that this strain possesses two glycerol kinase genes: gykA and glpK, that encode for two different glycerol kinases GykA and GlpK, respectively. The glpK geneis associated in an operon with alpha-glycerophosphate oxidase (glpO) and glycerol facilitator (glpF) genes. Transcriptional analysis revealed that only glpK is expressed when L. rhamnosus was grown on glycerol. Copyright 2004 S. Karger AG, Basel
Directory of Open Access Journals (Sweden)
Lukasz Michal Szafron
Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.
Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.
2015-01-01
For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.
Yin, Fugui; Yu, Hai; Lepp, Dion; Shi, Xuejiang; Yang, Xiaojian; Hu, Jielun; Leeson, Steve; Yang, Chengbo; Nie, Shaoping; Hou, Yongqing; Gong, Joshua
2016-01-01
indicated that dietary BG intervention induced 79 and 205 characterized DEGs in the jejunum and liver, respectively. In addition, 255 and 165 TSEGs were detected in the liver and jejunum of BG-fed group, while 162 and 211 TSEGs genes were observed in the liver and jejunum of BD-fed birds, respectively. Bioinformatic analysis with both IPA and DAVID-BR further revealed a significant enrichment of DEGs and TSEGs in the biological processes for reducing the synthesis, storage, transportation and secretion of lipids in the jejunum, while those in the liver were for enhancing the oxidation of ingested lipids and fatty acids. In particular, transcriptional regulators of THRSP and EGR-1 as well as several DEGs involved in the PPAR-α signaling pathway were significantly induced by dietary BG intervention for lipid catabolism. Conclusions Our results demonstrate that BG reduces body fat deposition via regulation of gene expression, which is involved in the biological events relating to the reduction of synthesis, storage, transportation and secretion, and improvement of oxidation of lipids and fatty acids. PMID:27508934
Dowd, Carola D; Chronis, Demosthenis; Radakovic, Zoran S; Siddique, Shahid; Schmülling, Thomas; Werner, Tomáš; Kakimoto, Tatsuo; Grundler, Florian M W; Mitchum, Melissa G
2017-10-01
Cyst and root-knot nematodes are obligate parasites of economic importance with a remarkable ability to reprogram root cells into unique metabolically active feeding sites. Previous studies have suggested a role for cytokinin in feeding site formation induced by these two types of nematodes, but the mechanistic details have not yet been described. Using Arabidopsis as a host plant species, we conducted a comparative analysis of cytokinin genes in response to the beet cyst nematode (BCN), Heterodera schachtii, and the root-knot nematode (RKN), Meloidogyne incognita. We identified distinct differences in the expression of cytokinin biosynthesis, catabolism and signaling genes in response to infection by BCN and RKN, suggesting differential manipulation of the cytokinin pathway by these two nematode species. Furthermore, we evaluated Arabidopsis histidine kinase receptor mutant lines ahk2/3, ahk2/4 and ahk3/4 in response to RKN infection. Similar to our previous studies with BCN, these lines were significantly less susceptible to RKN without compromising nematode penetration, suggesting a requirement of cytokinin signaling in RKN feeding site formation. Moreover, an analysis of ahk double mutants using CycB1;1:GUS/ahk introgressed lines revealed contrasting differences in the cytokinin receptors mediating cell cycle activation in feeding sites induced by BCN and RKN. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.
Directory of Open Access Journals (Sweden)
Hui-Yeng Y Yap
Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.
Santiago, Margarita; Gardner, Richard C
2015-07-01
Although cysteine desulphydrase activity has been purified and characterized from Saccharomyces cerevisiae, the gene encoding this activity in vivo has never been defined. We show that the full-length IRC7 gene, encoded by the YFR055W open reading frame, encodes a protein with cysteine desulphydrase activity. Irc7p purified to homogeneity is able to utilize l-cysteine as a substrate, producing pyruvate and hydrogen sulphide as products of the reaction. Purified Irc7p also utilized l-cystine and some other cysteine conjugates, but not l-cystathionine or l-methionine, as substrates. We further show that, in vivo, the IRC7 gene is both necessary and sufficient for yeast to grow on l-cysteine as a nitrogen source, and that overexpression of the gene results in increased H2 S production. Strains overexpressing IRC7 are also hypersensitive to a toxic analogue, S-ethyl-l-cysteine. While IRC7 has been identified as playing a critical role in converting cysteine conjugates to volatile thiols that are important in wine aroma, its biological role in yeast cells is likely to involve regulation of cysteine and redox homeostasis. Copyright © 2015 John Wiley & Sons, Ltd.
The effects of acetaldehyde and acrolein on muscle catabolism in C2 myotubes.
Rom, Oren; Kaisari, Sharon; Aizenbud, Dror; Reznick, Abraham Z
2013-12-01
The toxic aldehydes acetaldehyde and acrolein were previously suggested to damage skeletal muscle. Several conditions in which exposure to acetaldehyde and acrolein is increased were associated with muscle wasting and dysfunction. These include alcoholic myopathy, renal failure, oxidative stress, and inflammation. A main exogenous source of both acetaldehyde and acrolein is cigarette smoking, which was previously associated with increased muscle catabolism. Recently, we have shown that exposure of skeletal myotubes to cigarette smoke stimulated muscle catabolism via increased oxidative stress, activation of p38 MAPK, and upregulation of muscle-specific E3 ubiquitin ligases. In this study, we aimed to investigate the effects of acetaldehyde and acrolein on catabolism of skeletal muscle. Skeletal myotubes differentiated from the C2 myoblast cell line were exposed to acetaldehyde or acrolein and their effects on signaling pathways related to muscle catabolism were studied. Exposure of myotubes to acetaldehyde did not promote muscle catabolism. However, exposure to acrolein caused increased generation of free radicals, activation of p38 MAPK, upregulation of the muscle-specific E3 ligases atrogin-1 and MuRF1, degradation of myosin heavy chain, and atrophy of myotubes. Inhibition of p38 MAPK by SB203580 abolished acrolein-induced muscle catabolism. Our findings demonstrate that acrolein but not acetaldehyde activates a signaling cascade resulting in muscle catabolism in skeletal myotubes. Although within the limitations of an in vitro study, these findings indicate that acrolein may promote muscle wasting in conditions of increased exposure to this aldehyde. Copyright © 2013 Elsevier Inc. All rights reserved.
International Nuclear Information System (INIS)
Reid, Brian J.; Papanikolaou, Niki D.; Wilcox, Ronah K.
2005-01-01
The catabolic activity with respect to the systemic herbicide isoproturon was determined in soil samples by 14 C-radiorespirometry. The first experiment assessed levels of intrinsic catabolic activity in soil samples that represented three dissimilar soil series under arable cultivation. Results showed average extents of isoproturon mineralisation (after 240 h assay time) in the three soil series to be low. A second experiment assessed the impact of addition of isoproturon (0.05 μg kg -1 ) into these soils on the levels of catabolic activity following 28 days of incubation. Increased catabolic activity was observed in all three soils. A third experiment assessed levels of intrinsic catabolic activity in soil samples representing a single soil series managed under either conventional agricultural practice (including the use of isoproturon) or organic farming practice (with no use of isoproturon). Results showed higher (and more consistent) levels of isoproturon mineralisation in the soil samples collected from conventional land use. The final experiment assessed the impact of isoproturon addition on the levels of inducible catabolic activity in these soils. The results showed no significant difference in the case of the conventional farm soil samples while the induction of catabolic activity in the organic farm soil samples was significant. - Dissimilar levels of isoproturon catabolic activity in dissimilar soils and soils under dissimilar land use influence inferred risk
Energy Technology Data Exchange (ETDEWEB)
Reid, Brian J. [School of Environmental Sciences, University of East Anglia, Norwich NR4 7TJ (United Kingdom)]. E-mail: b.reid@uea.ac.uk; Papanikolaou, Niki D. [School of Environmental Sciences, University of East Anglia, Norwich NR4 7TJ (United Kingdom); Wilcox, Ronah K. [School of Environmental Sciences, University of East Anglia, Norwich NR4 7TJ (United Kingdom)
2005-02-01
The catabolic activity with respect to the systemic herbicide isoproturon was determined in soil samples by {sup 14}C-radiorespirometry. The first experiment assessed levels of intrinsic catabolic activity in soil samples that represented three dissimilar soil series under arable cultivation. Results showed average extents of isoproturon mineralisation (after 240 h assay time) in the three soil series to be low. A second experiment assessed the impact of addition of isoproturon (0.05 {mu}g kg{sup -1}) into these soils on the levels of catabolic activity following 28 days of incubation. Increased catabolic activity was observed in all three soils. A third experiment assessed levels of intrinsic catabolic activity in soil samples representing a single soil series managed under either conventional agricultural practice (including the use of isoproturon) or organic farming practice (with no use of isoproturon). Results showed higher (and more consistent) levels of isoproturon mineralisation in the soil samples collected from conventional land use. The final experiment assessed the impact of isoproturon addition on the levels of inducible catabolic activity in these soils. The results showed no significant difference in the case of the conventional farm soil samples while the induction of catabolic activity in the organic farm soil samples was significant. - Dissimilar levels of isoproturon catabolic activity in dissimilar soils and soils under dissimilar land use influence inferred risk.
Okamoto, Susumu; Taguchi, Takaaki; Ochi, Kozo; Ichinose, Koji
2009-02-27
All known benzoisochromanequinone (BIQ) biosynthetic gene clusters carry a set of genes encoding a two-component monooxygenase homologous to the ActVA-ORF5/ActVB system for actinorhodin biosynthesis in Streptomyces coelicolor A3(2). Here, we conducted molecular genetic and biochemical studies of this enzyme system. Inactivation of actVA-ORF5 yielded a shunt product, actinoperylone (ACPL), apparently derived from 6-deoxy-dihydrokalafungin. Similarly, deletion of actVB resulted in accumulation of ACPL, indicating a critical role for the monooxygenase system in C-6 oxygenation, a biosynthetic step common to all BIQ biosyntheses. Furthermore, in vitro, we showed a quinone-forming activity of the ActVA-ORF5/ActVB system in addition to that of a known C-6 monooxygenase, ActVA-ORF6, by using emodinanthrone as a model substrate. Our results demonstrate that the act gene cluster encodes two alternative routes for quinone formation by C-6 oxygenation in BIQ biosynthesis.
Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana
Directory of Open Access Journals (Sweden)
You Wanhui
2012-04-01
Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to
Hahn, F M; Baker, J A; Poulter, C D
1996-01-01
Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...
Fekete, Erzsébet; Orosz, Anita; Kulcsár, László; Kavalecz, Napsugár; Flipphi, Michel; Karaffa, Levente
2016-05-01
In Aspergillus nidulans, uptake rather than hydrolysis is the rate-limiting step of lactose catabolism. Deletion of the lactose permease A-encoding gene (lacpA) reduces the growth rate on lactose, while its overexpression enables faster growth than wild-type strains are capable of. We have identified a second physiologically relevant lactose transporter, LacpB. Glycerol-grown mycelia from mutants deleted for lacpB appear to take up only minute amounts of lactose during the first 60 h after a medium transfer, while mycelia of double lacpA/lacpB-deletant strains are unable to produce new biomass from lactose. Although transcription of both lacp genes was strongly induced by lactose, their inducer profiles differ markedly. lacpA but not lacpB expression was high in d-galactose cultures. However, lacpB responded strongly also to β-linked glucopyranose dimers cellobiose and sophorose, while these inducers of the cellulolytic system did not provoke any lacpA response. Nevertheless, lacpB transcript was induced to higher levels on cellobiose in strains that lack the lacpA gene than in a wild-type background. Indeed, cellobiose uptake was faster and biomass formation accelerated in lacpA deletants. In contrast, in lacpB knockout strains, growth rate and cellobiose uptake were considerably reduced relative to wild-type, indicating that the cellulose and lactose catabolic systems employ common elements. Nevertheless, our permease mutants still grew on cellobiose, which suggests that its uptake in A. nidulans prominently involves hitherto unknown transport systems.
Tornow, J; Santangelo, G M
1994-06-01
A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.
Metabolic control analysis of Aspergillus niger L-arabinose catabolism
DEFF Research Database (Denmark)
de Groot, M.J.L.; Prathumpai, Wai; Visser, J.
2005-01-01
A mathematical model of the L-arabinose/D-xylose catabolic pathway of Aspergillus niger was constructed based on the kinetic properties of the enzymes. For this purpose L-arabinose reductase, L-arabitol dehydrogenase and D-xylose reductase were purified using dye-affinity chromatography...... aiming at either flux or metabolite level optimization of the L-arabinose catabolic pathway of A. niger. Faster L-arabinose utilization may enhance utilization of readily available organic waste containing hemicelluloses to be converted into industrially interesting metabolites or valuable enzymes...
International Nuclear Information System (INIS)
Chisholm, G.E.; Summers, W.C.
1986-01-01
The ability of whole-cell extracts from unidentified HeLa cells to recognize the promoter for the herpes simplex virus type 1 late gene encoding the major capsid protein Vp5 was investigated by using both in vitro transcriptional and S1 nuclease protection analysis. This gene promoter was recognized by the cell extracts and produced abundant amounts of transcript in the absence of any other virus-encoded factors. This transcript was shown to arise, in vitro, from specific initiation at or very near the physiological mRNA start site. Thus, it appears that cell extracts from uninfected HeLa cells can efficiently recognize both early- and late-gene promoters
Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.
2002-01-01
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.
van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.
2016-01-01
Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol
Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch
2006-01-01
Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox
Almagro-Moreno, Salvador; Boyd, E. Fidelma
2009-01-01
Sialic acids comprise a family of nine-carbon ketosugars that are ubiquitous on mammalian mucous membranes. However, sialic acids have a limited distribution among Bacteria and are confined mainly to pathogenic and commensal species. Vibrio pathogenicity island 2 (VPI-2), a 57-kb region found exclusively among pathogenic strains of Vibrio cholerae, contains a cluster of genes (nan-nag) putatively involved in the scavenging (nanH), transport (dctPQM), and catabolism (nanA, nanE, nanK, and nagA) of sialic acid. The capacity to utilize sialic acid as a carbon and energy source might confer an advantage to V. cholerae in the mucus-rich environment of the gut, where sialic acid availability is extensive. In this study, we show that V. cholerae can utilize sialic acid as a sole carbon source. We demonstrate that the genes involved in the utilization of sialic acid are located within the nan-nag region of VPI-2 by complementation of Escherichia coli mutants and gene knockouts in V. cholerae N16961. We show that nanH, dctP, nanA, and nanK are highly expressed in V. cholerae grown on sialic acid. By using the infant mouse model of infection, we show that V. cholerae ΔnanA strain SAM1776 is defective in early intestinal colonization stages. In addition, SAM1776 shows a decrease in the competitive index in colonization-competition assays comparing the mutant strain with both O1 El Tor and classical strains. Our data indicate an important relationship between the catabolism of sialic acid and bacterial pathogenesis, stressing the relevance of the utilization of the resources found in the host's environment. PMID:19564383
Almagro-Moreno, Salvador; Boyd, E Fidelma
2009-09-01
Sialic acids comprise a family of nine-carbon ketosugars that are ubiquitous on mammalian mucous membranes. However, sialic acids have a limited distribution among Bacteria and are confined mainly to pathogenic and commensal species. Vibrio pathogenicity island 2 (VPI-2), a 57-kb region found exclusively among pathogenic strains of Vibrio cholerae, contains a cluster of genes (nan-nag) putatively involved in the scavenging (nanH), transport (dctPQM), and catabolism (nanA, nanE, nanK, and nagA) of sialic acid. The capacity to utilize sialic acid as a carbon and energy source might confer an advantage to V. cholerae in the mucus-rich environment of the gut, where sialic acid availability is extensive. In this study, we show that V. cholerae can utilize sialic acid as a sole carbon source. We demonstrate that the genes involved in the utilization of sialic acid are located within the nan-nag region of VPI-2 by complementation of Escherichia coli mutants and gene knockouts in V. cholerae N16961. We show that nanH, dctP, nanA, and nanK are highly expressed in V. cholerae grown on sialic acid. By using the infant mouse model of infection, we show that V. cholerae DeltananA strain SAM1776 is defective in early intestinal colonization stages. In addition, SAM1776 shows a decrease in the competitive index in colonization-competition assays comparing the mutant strain with both O1 El Tor and classical strains. Our data indicate an important relationship between the catabolism of sialic acid and bacterial pathogenesis, stressing the relevance of the utilization of the resources found in the host's environment.
Directory of Open Access Journals (Sweden)
Řičicová Markéta
2010-04-01
Full Text Available Abstract Background Candida albicans infections are often associated with biofilm formation. Previous work demonstrated that the expression of HWP1 (hyphal wall protein and of genes belonging to the ALS (agglutinin-like sequence, SAP (secreted aspartyl protease, PLB (phospholipase B and LIP (lipase gene families is associated with biofilm growth on mucosal surfaces. We investigated using real-time PCR whether genes encoding potential virulence factors are also highly expressed in biofilms associated with abiotic surfaces. For this, C. albicans biofilms were grown on silicone in microtiter plates (MTP or in the Centres for Disease Control (CDC reactor, on polyurethane in an in vivo subcutaneous catheter rat (SCR model, and on mucosal surfaces in the reconstituted human epithelium (RHE model. Results HWP1 and genes belonging to the ALS, SAP, PLB and LIP gene families were constitutively expressed in C. albicans biofilms. ALS1-5 were upregulated in all model systems, while ALS9 was mostly downregulated. ALS6 and HWP1 were overexpressed in all models except in the RHE and MTP, respectively. The expression levels of SAP1 were more pronounced in both in vitro models, while those of SAP2, SAP4 and SAP6 were higher in the in vivo model. Furthermore, SAP5 was highly upregulated in the in vivo and RHE models. For SAP9 and SAP10 similar gene expression levels were observed in all model systems. PLB genes were not considerably upregulated in biofilms, while LIP1-3, LIP5-7 and LIP9-10 were highly overexpressed in both in vitro models. Furthermore, an elevated lipase activity was detected in supernatans of biofilms grown in the MTP and RHE model. Conclusions Our findings show that HWP1 and most of the genes belonging to the ALS, SAP and LIP gene families are upregulated in C. albicans biofilms. Comparison of the fold expression between the various model systems revealed similar expression levels for some genes, while for others model-dependent expression
Directory of Open Access Journals (Sweden)
Schneider Anja
2003-01-01
Full Text Available Abstract Background Arginine and citrulline serve as nitrogen storage forms, but are also involved in biosynthetic and catabolic pathways. Metabolism of arginine, citrulline and ornithine is distributed between mitochondria and cytosol. For the shuttle of intermediates between cytosol and mitochondria transporters present on the inner mitochondrial membrane are required. Yeast contains a mitochondrial translocator for ornithine and arginine, Ort1p/Arg11p. Ort1p/Arg11p is a member of the mitochondrial carrier family (MCF essential for ornithine export from mitochondria. The yeast arg11 mutant, which is deficient in Ort1p/Arg11p grows poorly on media lacking arginine. Results High-level expression of a nuclear encoded Arabidopsis thaliana homolog (AtmBAC2 of Ort1p/Arg11p was able to suppress the growth deficiency of arg11. RT-PCR analysis demonstrated expression of AtmBAC2 in all tissues with highest levels in flowers. Promoter-GUS fusions showed preferential expression in flowers, i.e. pollen, in the vasculature of siliques and in aborted seeds. Variable expression was observed in leaf vasculature. Induction of the promoter was not observed during the first two weeks in seedlings grown on media containing NH4NO3, arginine or ornithine as sole nitrogen sources. Conclusion AtmBAC2 was isolated as a mitochondrial transporter for arginine in Arabidopsis. The absence of expression in developing seeds and in cotyledons of seedlings indicates that other transporters are responsible for storage and mobilization of arginine in seeds.
Kenyon, Johanna J; Kasimova, Anastasiya A; Shneider, Mikhail M; Shashkov, Alexander S; Arbatsky, Nikolay P; Popova, Anastasiya V; Miroshnikov, Konstantin A; Hall, Ruth M; Knirel, Yuriy A
2017-03-01
The whole-genome sequence of the multiply antibiotic resistant Acinetobacter baumannii isolate RCH51 belonging to sequence type ST103 (Institut Pasteur scheme) revealed that the set of genes at the capsule locus, KL24, includes four genes predicted to direct the synthesis of 3-acetamido-3,6-dideoxy-d-galactose (d-Fuc3NAc), and this sugar was found in the capsular polysaccharide (CPS). One of these genes, fdtE, encodes a novel bifunctional protein with an N-terminal FdtA 3,4-ketoisomerase domain and a C-terminal acetyltransferase domain. KL24 lacks a gene encoding a Wzy polymerase to link the oligosaccharide K units to form the CPS found associated with isolate RCH51, and a wzy gene was found in a small genomic island (GI) near the cpn60 gene. This GI is in precisely the same location as another GI carrying wzy and atr genes recently found in several A. baumannii isolates, but it does not otherwise resemble it. The CPS isolated from RCH51, studied by sugar analysis and 1D and 2D 1H and 13C NMR spectroscopy, revealed that the K unit has a branched pentasaccharide structure made up of Gal, GalNAc and GlcNAc residues with d-Fuc3NAc as a side branch, and the K units are linked via a β-d-GlcpNAc-(1→3)-β-d-Galp linkage formed by the Wzy encoded by the GI. The functions of the glycosyltransferases encoded by KL24 were assigned to formation of specific bonds. A correspondence between the order of the genes in KL24 and other KL and the order of the linkages they form was noted, and this may be useful in future predictions of glycosyltransferase specificities.
Seim, Inge; Jeffery, Penny L; Thomas, Patrick B; Walpole, Carina M; Maugham, Michelle; Fung, Jenny N T; Yap, Pei-Yi; O'Keeffe, Angela J; Lai, John; Whiteside, Eliza J; Herington, Adrian C; Chopin, Lisa K
2016-06-01
The peptide hormone ghrelin is a potent orexigen produced predominantly in the stomach. It has a number of other biological actions, including roles in appetite stimulation, energy balance, the stimulation of growth hormone release and the regulation of cell proliferation. Recently, several ghrelin gene splice variants have been described. Here, we attempted to identify conserved alternative splicing of the ghrelin gene by cross-species sequence comparisons. We identified a novel human exon 2-deleted variant and provide preliminary evidence that this splice variant and in1-ghrelin encode a C-terminally truncated form of the ghrelin peptide, termed minighrelin. These variants are expressed in humans and mice, demonstrating conservation of alternative splicing spanning 90 million years. Minighrelin appears to have similar actions to full-length ghrelin, as treatment with exogenous minighrelin peptide stimulates appetite and feeding in mice. Forced expression of the exon 2-deleted preproghrelin variant mirrors the effect of the canonical preproghrelin, stimulating cell proliferation and migration in the PC3 prostate cancer cell line. This is the first study to characterise an exon 2-deleted preproghrelin variant and to demonstrate sequence conservation of ghrelin gene-derived splice variants that encode a truncated ghrelin peptide. This adds further impetus for studies into the alternative splicing of the ghrelin gene and the function of novel ghrelin peptides in vertebrates.
Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine
2003-08-01
ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.
Modulation of gene expression in heart and liver of hibernating black bears (Ursus americanus
Directory of Open Access Journals (Sweden)
Yan Jun
2011-03-01
Full Text Available Abstract Background Hibernation is an adaptive strategy to survive in highly seasonal or unpredictable environments. The molecular and genetic basis of hibernation physiology in mammals has only recently been studied using large scale genomic approaches. We analyzed gene expression in the American black bear, Ursus americanus, using a custom 12,800 cDNA probe microarray to detect differences in expression that occur in heart and liver during winter hibernation in comparison to summer active animals. Results We identified 245 genes in heart and 319 genes in liver that were differentially expressed between winter and summer. The expression of 24 genes was significantly elevated during hibernation in both heart and liver. These genes are mostly involved in lipid catabolism and protein biosynthesis and include RNA binding protein motif 3 (Rbm3, which enhances protein synthesis at mildly hypothermic temperatures. Elevated expression of protein biosynthesis genes suggests induction of translation that may be related to adaptive mechanisms reducing cardiac and muscle atrophies over extended periods of low metabolism and immobility during hibernation in bears. Coordinated reduction of transcription of genes involved in amino acid catabolism suggests redirection of amino acids from catabolic pathways to protein biosynthesis. We identify common for black bears and small mammalian hibernators transcriptional changes in the liver that include induction of genes responsible for fatty acid β oxidation and carbohydrate synthesis and depression of genes involved in lipid biosynthesis, carbohydrate catabolism, cellular respiration and detoxification pathways. Conclusions Our findings show that modulation of gene expression during winter hibernation represents molecular mechanism of adaptation to extreme environments.
Modulation of gene expression in heart and liver of hibernating black bears (Ursus americanus).
Fedorov, Vadim B; Goropashnaya, Anna V; Tøien, Øivind; Stewart, Nathan C; Chang, Celia; Wang, Haifang; Yan, Jun; Showe, Louise C; Showe, Michael K; Barnes, Brian M
2011-03-31
Hibernation is an adaptive strategy to survive in highly seasonal or unpredictable environments. The molecular and genetic basis of hibernation physiology in mammals has only recently been studied using large scale genomic approaches. We analyzed gene expression in the American black bear, Ursus americanus, using a custom 12,800 cDNA probe microarray to detect differences in expression that occur in heart and liver during winter hibernation in comparison to summer active animals. We identified 245 genes in heart and 319 genes in liver that were differentially expressed between winter and summer. The expression of 24 genes was significantly elevated during hibernation in both heart and liver. These genes are mostly involved in lipid catabolism and protein biosynthesis and include RNA binding protein motif 3 (Rbm3), which enhances protein synthesis at mildly hypothermic temperatures. Elevated expression of protein biosynthesis genes suggests induction of translation that may be related to adaptive mechanisms reducing cardiac and muscle atrophies over extended periods of low metabolism and immobility during hibernation in bears. Coordinated reduction of transcription of genes involved in amino acid catabolism suggests redirection of amino acids from catabolic pathways to protein biosynthesis. We identify common for black bears and small mammalian hibernators transcriptional changes in the liver that include induction of genes responsible for fatty acid β oxidation and carbohydrate synthesis and depression of genes involved in lipid biosynthesis, carbohydrate catabolism, cellular respiration and detoxification pathways. Our findings show that modulation of gene expression during winter hibernation represents molecular mechanism of adaptation to extreme environments.
Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B
2011-01-01
Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.
Shukla, Avi; Chatterjee, Anirvan
2018-01-01
Abstract Curiously, in viruses, the virion volume appears to be predominantly driven by genome length rather than the number of proteins it encodes or geometric constraints. With their large genome and giant particle size, amoebal viruses (AVs) are ideally suited to study the relationship between genome and virion size and explore the role of genome plasticity in their evolutionary success. Different genomic regions of AVs exhibit distinct genealogies. Although the vertically transferred core genes and their functions are universally conserved across the nucleocytoplasmic large DNA virus (NCLDV) families and are essential for their replication, the horizontally acquired genes are variable across families and are lineage-specific. When compared with other giant virus families, we observed a near–linear increase in the number of genes encoding repeat domain-containing proteins (RDCPs) with the increase in the genome size of AVs. From what is known about the functions of RDCPs in bacteria and eukaryotes and their prevalence in the AV genomes, we envisage important roles for RDCPs in the life cycle of AVs, their genome expansion, and plasticity. This observation also supports the evolution of AVs from a smaller viral ancestor by the acquisition of diverse gene families from the environment including RDCPs that might have helped in host adaption. PMID:29308275
Reid, Brian J; Papanikolaou, Niki D; Wilcox, Ronah K
2005-02-01
The catabolic activity with respect to the systemic herbicide isoproturon was determined in soil samples by (14)C-radiorespirometry. The first experiment assessed levels of intrinsic catabolic activity in soil samples that represented three dissimilar soil series under arable cultivation. Results showed average extents of isoproturon mineralisation (after 240 h assay time) in the three soil series to be low. A second experiment assessed the impact of addition of isoproturon (0.05 microg kg(-1)) into these soils on the levels of catabolic activity following 28 days of incubation. Increased catabolic activity was observed in all three soils. A third experiment assessed levels of intrinsic catabolic activity in soil samples representing a single soil series managed under either conventional agricultural practice (including the use of isoproturon) or organic farming practice (with no use of isoproturon). Results showed higher (and more consistent) levels of isoproturon mineralisation in the soil samples collected from conventional land use. The final experiment assessed the impact of isoproturon addition on the levels of inducible catabolic activity in these soils. The results showed no significant difference in the case of the conventional farm soil samples while the induction of catabolic activity in the organic farm soil samples was significant.
International Nuclear Information System (INIS)
Tsai-Pflugfelder, M.; Liu, L.F.; Liu, A.A.; Tewey, K.M.; Whang-Peng, J.; Knutsen, T.; Huebner, K.; Croce, C.M.; Wang, J.C.
1988-01-01
Two overlapping cDNA clones encoding human DNA topoisomerase II were identified by two independent methods. In one, a human cDNA library in phage λ was screened by hybridization with a mixed oligonucleotide probe encoding a stretch of seven amino acids found in yeast and Drosophila DNA topoisomerase II; in the other, a different human cDNA library in a λgt11 expression vector was screened for the expression of antigenic determinants that are recognized by rabbit antibodies specific to human DNA topoisomerase II. The entire coding sequences of the human DNA topoisomerase II gene were determined from these and several additional clones, identified through the use of the cloned human TOP2 gene sequences as probes. Hybridization between the cloned sequences and mRNA and genomic DNA indicates that the human enzyme is encoded by a single-copy gene. The location of the gene was mapped to chromosome 17q21-22 by in situ hybridization of a cloned fragment to metaphase chromosomes and by hybridization analysis with a panel of mouse-human hybrid cell lines, each retaining a subset of human chromosomes
Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.
Directory of Open Access Journals (Sweden)
Mignon A Keaton
2011-03-01
Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.
Directory of Open Access Journals (Sweden)
Ricardo Vergara
2017-05-01
Full Text Available Recently, the plant hormone abscisic acid (ABA has been implicated as a key player in the regulation of endodormancy (ED in grapevine buds (Vitis vinifera L. In this study, we show that in the vine, the expression of genes related to the biosynthesis of ABA (VvNCED1; VvNCED2 and the content of ABA are significantly higher in the latent bud than at the shoot apex, while the expression of an ABA catabolic gene (VvA8H3 showed no significant difference between either organ. A negative correlation between the content of ABA and transcript levels of cell cycle genes (CCG was found in both tissues. This result suggested that ABA may negatively regulate the expression of CCG in meristematic tissues of grapevines. To test this proposition, the effect of ABA on the expression of CCG was analyzed in two meristematic tissues of the vine: somatic embryos and shoot apexes. The results indicated that cell cycle progression is repressed by ABA in both organs, since it down-regulated the expression of genes encoding cyclin-dependent kinases (VvCDKB1, VvCDKB2 and genes encoding cyclins of type A (VvCYCA1, VvCYCA2, VvCYCA3, B (VvCYCB, and D (VvCYCD3.2a and up-regulated the expression of VvICK5, a gene encoding an inhibitor of CDKs. During ED, the content of ABA increased, and the expression of CCG decreased. Moreover, the dormancy-breaking compound hydrogen cyanamide (HC reduced the content of ABA and up-regulated the expression of CCG, this last effect was abolished when HC and ABA were co-applied. Taken together, these results suggest that ABA-mediated repression of CCG transcription may be part of the mechanism through which ABA modulates the development of ED in grapevine buds.
Noens, Elke E E; Kaczmarek, Michał B; Żygo, Monika; Lolkema, Juke S
2015-01-01
The arginine deiminase pathway (ADI) gene cluster in Lactococcus lactis contains two copies of a gene encoding an L-arginine/L-ornithine exchanger, the arcD1 and arcD2 genes. The physiological function of ArcD1 and ArcD2 was studied by deleting the two genes. Deletion of arcD1 resulted in loss of
A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.
Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos
2015-07-01
The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA- mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA- mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA- mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.
Catabolic Processes in Cardiosurgical Patients
Directory of Open Access Journals (Sweden)
V. V. Lomivorotov
2007-01-01
Full Text Available Objective: to evaluate catabolic and anabolic processes in cardiosurgical patients during heart operations under extracorporeal circulation.Subjects and methods. Seventy-one patients with coronary heart disease (CHD and acquired cardiac defects (ACD, who had been operated on under extracorporeal circulation, were examined. The plasma levels of cortisol, adrenaline, insulin, growth hormone, and albumin were measured. For determination of daily nitrogen excretion, blood and diurnal urine were sampled at the following stages: 1 before surgery; 2 postoperative (PO day 1; 3 PO day 3; 4 PO day 7; 5 PO day 14; 6 PO day 21.Results. The preoperative daily nitrogen excretion in CHD patients was 10.4±1.0 g/day. By PO day 3, there was a significant increase in nitrogen excretion by 66%, up to 17.3±1.6 g/day (p<0.01. In ACD patients, the baseline daily urinary nitrogen excretion was 11.9±1.7 g/day. By PO day 3, there was a 1.4-fold increase in this index — up to 16.3±2.0 g/day. Daily nitrogen excretion significantly increased up to 17.1±1.2 g/day by the end of the first PO week (p<0.05, by exceeding the baseline values by 44%. Nitrogen excretion peaked by the end of PO days 14 (17.2±1.6 g/day (p<0.05. By hospital discharge, nitrogen excretion was 23% greater than its baseline preoperative level (p>0.05. In cardiosurgical patients, an increase in daily nitrogen excretion occurred with the elevated concentrations of the stress hormones cortisol and adrenaline.Conclusion. The magnitude of catabolic reactions after cardiosurgical interventions depends on the type of cardiac disease. In patients with CHD, the maximum catabolic reactions were recorded on PO day 3 whereas in those with ACD, they continued within three weeks postoperatively.
A Genome Sequence-directed Investigation of D-Tagatose Utilization by Kosmotoga Olearia
Butzin, N. C.; Bradnan, D. M.; Noll, K. M.
2010-04-01
The research goals are to determine the pathway that Kosmotoga olearia uses tagatose, the roles of Kole_0686, Kole_0737 and Kole_1652 in this process, and the evolutionary history of the genes that encode the proteins involved in tagatose catabolism.
Zhang, Xinhua; Shen, Lin; Li, Fujun; Meng, Demei; Sheng, Jiping
2011-09-14
The effects of methyl salicylate (MeSA) on chilling injury (CI) and gene expression levels, enzyme activities, and metabolites related to arginine catabolism in cherry tomato fruit were investigated. Freshly harvested fruits were treated with 0.05 mM MeSA vapor at 20 °C for 12 h and then stored at 2 °C for up to 28 days. MeSA reduced CI and enhanced the accumulation of putrescine, spermidine, and spermine, which was associated with increased gene expression levels and activities of arginase, arginine decarboxylase, and ornithine decarboxylase at most sampling times. MeSA also increased nitric oxide synthase activity, which at least partly contributed to the increased nitric oxide content. The results indicate that MeSA activates the different pathways of arginine catabolism in cold-stored fruit and that the reduction in CI by MeSA may be due to the coordinated metabolism of arginine and the increase in polyamines and nitric oxide levels.
Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.
O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe
2013-01-01
Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.
Muñoz-Nortes, Tamara; Pérez-Pérez, José Manuel; Ponce, María Rosa; Candela, Héctor; Micol, José Luis
2017-03-01
The characterization of mutants with altered leaf shape and pigmentation has previously allowed the identification of nuclear genes that encode plastid-localized proteins that perform essential functions in leaf growth and development. A large-scale screen previously allowed us to isolate ethyl methanesulfonate-induced mutants with small rosettes and pale green leaves with prominent marginal teeth, which were assigned to a phenotypic class that we dubbed Angulata. The molecular characterization of the 12 genes assigned to this phenotypic class should help us to advance our understanding of the still poorly understood relationship between chloroplast biogenesis and leaf morphogenesis. In this article, we report the phenotypic and molecular characterization of the angulata7-1 (anu7-1) mutant of Arabidopsis thaliana, which we found to be a hypomorphic allele of the EMB2737 gene, which was previously known only for its embryonic-lethal mutations. ANU7 encodes a plant-specific protein that contains a domain similar to the central cysteine-rich domain of DnaJ proteins. The observed genetic interaction of anu7-1 with a loss-of-function allele of GENOMES UNCOUPLED1 suggests that the anu7-1 mutation triggers a retrograde signal that leads to changes in the expression of many genes that normally function in the chloroplasts. Many such genes are expressed at higher levels in anu7-1 rosettes, with a significant overrepresentation of those required for the expression of plastid genome genes. Like in other mutants with altered expression of plastid-encoded genes, we found that anu7-1 exhibits defects in the arrangement of thylakoidal membranes, which appear locally unappressed. © 2016 The Authors The Plant Journal © 2016 John Wiley & Sons Ltd.
International Nuclear Information System (INIS)
Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.
2005-01-01
Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach
The anti-catabolic role of bovine lactoferricin in cartilage.
Ahmadinia, Kasra; Yan, Dongyao; Ellman, Michael; Im, Hee-Jeong
2013-10-01
Bovine lactoferricin (LfcinB) is a multifunctional peptide derived from bovine lactoferrin that demonstrates antibacterial, antifungal, antiviral, antitumor, and immunomodulatory activities. Recently, studies have focused on the anti-catabolic and anti-inflammatory potential of LfcinB. LfcinB is able to modulate the effects cytokines such as IL-1 and fibroblast growth factor 2 as well as promote specific cartilage anabolic factors. These properties are particularly important in maintaining cartilage homeostasis and preventing a catabolic state, which leads to clinical pathology. This review focuses on the recent literature elucidating the role of LfcinB in preventing cartilage degradation.
Directory of Open Access Journals (Sweden)
Tuffery Pierre
2009-12-01
Full Text Available Abstract Background Previous studies have established a correlation between electrophoretic polymorphism of esterase B, and virulence and phylogeny of Escherichia coli. Strains belonging to the phylogenetic group B2 are more frequently implicated in extraintestinal infections and include esterase B2 variants, whereas phylogenetic groups A, B1 and D contain less virulent strains and include esterase B1 variants. We investigated esterase B as a marker of phylogeny and/or virulence, in a thorough analysis of the esterase B-encoding gene. Results We identified the gene encoding esterase B as the acetyl-esterase gene (aes using gene disruption. The analysis of aes nucleotide sequences in a panel of 78 reference strains, including the E. coli reference (ECOR strains, demonstrated that the gene is under purifying selection. The phylogenetic tree reconstructed from aes sequences showed a strong correlation with the species phylogenetic history, based on multi-locus sequence typing using six housekeeping genes. The unambiguous distinction between variants B1 and B2 by electrophoresis was consistent with Aes amino-acid sequence analysis and protein modelling, which showed that substituted amino acids in the two esterase B variants occurred mostly at different sites on the protein surface. Studies in an experimental mouse model of septicaemia using mutant strains did not reveal a direct link between aes and extraintestinal virulence. Moreover, we did not find any genes in the chromosomal region of aes to be associated with virulence. Conclusion Our findings suggest that aes does not play a direct role in the virulence of E. coli extraintestinal infection. However, this gene acts as a powerful marker of phylogeny, illustrating the extensive divergence of B2 phylogenetic group strains from the rest of the species.
Directory of Open Access Journals (Sweden)
Moysés Elias-Neto
2013-06-01
Full Text Available Expression profile of a Laccase2 encoding gene during the metamorphic molt in Apis mellifera (Hymenoptera, Apidae. Metamorphosis in holometabolous insects occurs through two subsequent molting cycles: pupation (metamorphic molt and adult differentiation (imaginal molt. The imaginal molt in Apis mellifera L. was recently investigated in both histological and physiological-molecular approaches. Although the metamorphic molt in this model bee is extremely important to development, it is not well-known yet. In the current study we used this stage as an ontogenetic scenario to investigate the transcriptional profile of the gene Amlac2, which encodes a laccase with an essential role in cuticle differentiation. Amlac2 expression in epidermis was contrasted with the hemolymph titer of ecdysteroid hormones and with the most evident morphological events occurring during cuticle renewal. RT-PCR semiquantitative analyses using integument samples revealed increased levels of Amlac2 transcripts right after apolysis and during the subsequent pharate period, and declining levels near pupal ecdysis. Compared with the expression of a cuticle protein gene, AmelCPR14, these results highlighted the importance of the ecdysteroid-induced apolysis as an ontogenetic marker of gene reactivation in epidermis for cuticle renewal. The obtained results strengthen the comprehension of metamorphosis in Apis mellifera. In addition, we reviewed the literature about the development of A. mellifera, and emphasize the importance of revising the terminology used to describe honey bee molting cycles.
Directory of Open Access Journals (Sweden)
Utut Widyastuti Suharsono
2008-11-01
Full Text Available Isolation and Cloning of cDNA Fragment of Gene Encoding for Multidrug Resistance Associated Protein from M. affine. M. affine can grow well in acid soil with high level of soluble aluminum. One of the important proteins in the detoxifying xenobiotic stress including acid and Al stresses is a multidrug resistance associated protein (MRP encoded by mrp gene. The objective of this research is to isolate and clone the cDNA fragment of MaMrp encoding MRP from M. affine. By reverse transcription, total cDNA had been synthesized from the total RNA as template. The fragment of cDNA MaMrp had been successfully isolated by PCR by using total cDNA as template and mrp primer designed from A. thaliana, yeast, and human. This fragment was successfully inserted into pGEM-T Easy and the recombinant plasmid was successfully introduced into E. coli DH5α. Nucleotide sequence analysis showed that the lenght of MaMrp fragment is 633 bp encoding 208 amino acids. Local alignment analysis based on nucleotide of mRNA showed that MaMrp fragment is 69% identical to AtMrp1 and 63% to AtMrp from A. thaliana. Based on deduced amino acid sequence, MaMRP is 84% identical to part of AtMRP13, 77% to AtMRP12, and 73% to AtMRP1 from A. thaliana respectively. Alignment analysis with AtMRP1 showed that MaMRP fragment is located in TM1 and NBF1 domains and has a specific amino acid sequence QCKAQLQNMEEE.
Sudagidan, Mert; Aydin, Ali
2010-04-15
In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.
MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.
Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica
2006-01-24
Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The
Directory of Open Access Journals (Sweden)
Ying Wang
Full Text Available Mutations in the immunoglobulin superfamily, member 1 gene (IGSF1/Igsf1 cause an X-linked form of central hypothyroidism. The canonical form of IGSF1 is a transmembrane glycoprotein with 12 immunoglobulin (Ig loops. The protein is co-translationally cleaved into two sub-domains. The carboxyl-terminal domain (CTD, which contains the last 7 Ig loops, is trafficked to the plasma membrane. Most pathogenic mutations in IGSF1 map to the portion of the gene encoding the CTD. IGSF1/Igsf1 encodes a variety of transcripts. A little studied, but abundant splice variant encodes a truncated form of the protein, predicted to contain the first 2 Ig loops of the full-length IGSF1. The protein (hereafter referred to as IGSF1 isoform 2 or IGSF1-2 is likely retained in most individuals with IGSF1 mutations. Here, we characterized basic biochemical properties of the protein as a foray into understanding its potential function. IGSF1-2, like the IGSF1-CTD, is a glycoprotein. In both mouse and rat, the protein is N-glycosylated at a single asparagine residue in the first Ig loop. Contrary to earlier predictions, neither the murine nor rat IGSF1-2 is secreted from heterologous or homologous cells. In addition, neither protein associates with the plasma membrane. Rather, IGSF1-2 appears to be retained in the endoplasmic reticulum. Whether the protein plays intracellular functions or is trafficked through the secretory pathway under certain physiologic or pathophysiologic conditions has yet to be determined.
Directory of Open Access Journals (Sweden)
DEWI FITRIANI
2010-06-01
Full Text Available L-arabinose isomerase is an enzyme converting D-galactose to D-tagatose. D-tagatose is a potential sweetener-sucrose substitute which has low calorie. This research was to clone and sequence araA gene from marine bacterial strain Geobacillus stearothermophilus isolated from Tanjung Api Poso Indonesia. The amplified araA gene consisted of 1494 bp nucleotides encoding 497 amino acids. DNA alignment analysis showed that the gene had high homology with that of G. stearothermophilus T6. The enzyme had optimum activity at high temperature and alkalin condition.
Poly (ADP-ribose) catabolism in mammalian cells exposed to DNA-damaging agents
International Nuclear Information System (INIS)
Alvarez-Gonzalez, R.; Althaus, F.R.
1989-01-01
DNA damage inflicted by the alkylating agens N-methyl-N-nitro-N-nitrosoquanidine, or by UV stimulated the catabolism of protein-bound poly (ADP-ribose) in the chromatin of cultured hepatocytes. The stimulation was highest at the largest doses of DNA-damaging treatment. As a consequence, the half-life of ADP-ribosyl polymers may drop to less than 41 s. This rapid turnover contrasts with the slow catabolism of a constitutive fraction of polymers exhibiting a half-life of 7.7 h. These data suggest that post-incisional stimulation of poly (ADP-ribose) biosynthesis in DNA-excision repair is coupled with an adaptation of poly (ADP-ribose) catabolism in mammalian cells. (Author). 37 refs.; 3 figs
Inhibition of substrate synthesis as a strategy for glycolipid lysosomal storage disease therapy
Platt, F. M.; Jeyakumar, M.; Andersson, U.; Priestman, D. A.; Dwek, R. A.; Butters, T. D.; Cox, T. M.; Lachmann, R. H.; Hollak, C.; Aerts, J. M.; van Weely, S.; Hrebícek, M.; Moyses, C.; Gow, I.; Elstein, D.; Zimran, A.
2001-01-01
The glycosphingolipid (GSL) lysosomal storage diseases are caused by mutations in the genes encoding the glycohydrolases that catabolize GSLs within lysosomes. In these diseases the substrate for the defective enzyme accumulates in the lysosome and the stored GSL leads to cellular dysfunction and
Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping
2017-01-01
‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...
DEFF Research Database (Denmark)
Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua
2014-01-01
OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...
Directory of Open Access Journals (Sweden)
Melanie Brunsch
Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.
Solís-Guzmán, María Gloria; Argüello-Astorga, Gerardo; López-Bucio, José; Ruiz-Herrera, León Francisco; López-Meza, Joel; Sánchez-Calderón, Lenin; Carreón-Abud, Yazmín; Martínez-Trujillo, Miguel
2017-01-01
Abstract Proteins of the Split ends (Spen) family are characterized by an N-terminal domain, with one or more RNA recognition motifs and a SPOC domain. In Arabidopsis thaliana, the Spen protein FPA is involved in the control of flowering time as a component of an autonomous pathway independent of photoperiod. The A. thaliana genome encodes another gene for a putative Spen protein at the locus At4g12640, herein named AtSpen2. Bioinformatics analysis of the AtSPEN2 SPOC domain revealed low sequ...
Vouille, V; Amiche, M; Nicolas, P
1997-09-01
We cloned the genes of two members of the dermaseptin family, broad-spectrum antimicrobial peptides isolated from the skin of the arboreal frog Phyllomedusa bicolor. The dermaseptin gene Drg2 has a 2-exon coding structure interrupted by a small 137-bp intron, wherein exon 1 encoded a 22-residue hydrophobic signal peptide and the first three amino acids of the acidic propiece; exon 2 contained the 18 additional acidic residues of the propiece plus a typical prohormone processing signal Lys-Arg and a 32-residue dermaseptin progenitor sequence. The dermaseptin genes Drg2 and Drg1g2 have conserved sequences at both untranslated ends and in the first and second coding exons. In contrast, Drg1g2 comprises a third coding exon for a short version of the acidic propiece and a second dermaseptin progenitor sequence. Structural conservation between the two genes suggests that Drg1g2 arose recently from an ancestral Drg2-like gene through amplification of part of the second coding exon and 3'-untranslated region. Analysis of the cDNAs coding precursors for several frog skin peptides of highly different structures and activities demonstrates that the signal peptides and part of the acidic propieces are encoded by conserved nucleotides encompassed by the first coding exon of the dermaseptin genes. The organization of the genes that belong to this family, with the signal peptide and the progenitor sequence on separate exons, permits strikingly different peptides to be directed into the secretory pathway. The recruitment of such a homologous 'secretory' exon by otherwise non-homologous genes may have been an early event in the evolution of amphibian.
Xu, J; Johnson, R C
1995-01-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes...
PaeX, a second pectin acetylesterase of Erwinia chrysanthemi 3937.
Shevchik, Vladimir E; Hugouvieux-Cotte-Pattat, Nicole
2003-05-01
Erwinia chrysanthemi causes soft-rot diseases of various plants by enzymatic degradation of the pectin in plant cell walls. Pectin is a complex polysaccharide. The main chain is constituted of galacturonate residues, and some of them are modified by methyl and/or acetyl esterification. Esterases are necessary to remove these modifications and, thus, to facilitate the further degradation of the polysaccharidic chain. In addition to PaeY, the first pectin acetylesterase identified in the E. chrysanthemi strain 3937, we showed that this bacterium produces a second pectin acetylesterase encoded by the gene paeX. The paeX open reading frame encodes a 322-residue precursor protein of 34,940 Da, including a 21-amino-acid signal peptide. Analysis of paeX transcription, by using gene fusions, revealed that it is induced by pectic catabolic products and affected by catabolite repression. The expression of paeX is regulated by the repressor KdgR, which controls all the steps of pectin catabolism; by the repressor PecS, which controls most of the pectinase genes; and by catabolite regulatory protein, the global activator of sugar catabolism. The paeX gene is situated in a cluster of genes involved in the catabolism and transport of pectic oligomers. In induced conditions, the two contiguous genes kdgM, encoding an oligogalacturonate-specific porin, and paeX are both transcribed as an operon from a promoter proximal to kdgM, but transcription of paeX can also be uncoupled from that of kdgM in noninduced conditions. PaeX is homologous to the C-terminal domain of the Butyrivibrio fibriosolvens xylanase XynB and to a few bacterial esterases. PaeX contains the typical box (GxSxG) corresponding to the active site of the large family of serine hydrolases. Purified PaeX releases acetate from various synthetic substrates and from sugar beet pectin. The PaeX activity increased after previous depolymerization and demethylation of pectin, indicating that its preferred substrates are
Directory of Open Access Journals (Sweden)
Riley Laura M
2012-03-01
Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.
Petrusma, Mirjan; Hessels, Gerda; Dijkhuizen, Lubbert; van der Geize, Robert
2011-01-01
The well-known large catabolic potential of rhodococci is greatly facilitated by an impressive gene multiplicity. This study reports on the multiplicity of kshA, encoding the oxygenase component of 3-ketosteroid 9 alpha-hydroxylase, a key enzyme in steroid catabolism. Five kshA homologues (kshA1 to kshA5) were previously identified in Rhodococcus rhodochrous DSM43269. These KshA(DSM43269) homologues are distributed over several phylogenetic groups. The involvement of these KshA homologues in ...
Ghotaslou, Reza; Yeganeh Sefidan, Fatemeh; Akhi, Mohammad Taghi; Asgharzadeh, Mohammad; Mohammadzadeh Asl, Yalda
2017-10-01
Enzymatic inactivation is one of the most important mechanisms of resistance to aminoglycosides. The aim of this study was to investigate the prevalence of armA and diversity of the genes encoding aminoglycoside-modifying enzymes (AMEs) and their associations with resistance phenotypes in Enterobacteriaceae isolates. Three hundred and seven Enterobacteriaceae isolates were collected from five hospitals in northwest Iran. The disk diffusion method for amikacin, gentamicin, tobramycin, kanamycin, and streptomycin, as well as the minimum inhibitory concentration for amikacin, gentamicin, tobramycin, and kanamycin were done for susceptibility testing. Thirteen AME genes and armA methylase were screened using the PCR and sequencing assays. Two hundred and twenty (71.7%) of isolates were resistant to aminoglycosides and 155 (70.5%) of them were positive for aminoglycoside resistance genes. The most prevalent AME genes were ant(3″)-Ia and aph(3″)-Ib with the frequency 35.9% and 30.5%, respectively. Also, 21 (9.5%) of resistant isolates were positive for armA methylase gene. The prevalence of resistance to aminoglycoside is high and AME genes frequently are disseminated in Enterobacteriaceae isolates. There is an association between phenotypic resistance and the presence of some aminoglycoside genes.
Sakuraba, Yasuhito; Schelbert, Silvia; Park, So-Yon; Han, Su-Hyun; Lee, Byoung-Doo; Andrès, Céline Besagni; Kessler, Felix; Hörtensteiner, Stefan; Paek, Nam-Chon
2012-01-01
During leaf senescence, plants degrade chlorophyll to colorless linear tetrapyrroles that are stored in the vacuole of senescing cells. The early steps of chlorophyll breakdown occur in plastids. To date, five chlorophyll catabolic enzymes (CCEs), NONYELLOW COLORING1 (NYC1), NYC1-LIKE, pheophytinase, pheophorbide a oxygenase (PAO), and red chlorophyll catabolite reductase, have been identified; these enzymes catalyze the stepwise degradation of chlorophyll to a fluorescent intermediate, pFCC, which is then exported from the plastid. In addition, STAY-GREEN (SGR), Mendel’s green cotyledon gene encoding a chloroplast protein, is required for the initiation of chlorophyll breakdown in plastids. Senescence-induced SGR binds to light-harvesting complex II (LHCII), but its exact role remains elusive. Here, we show that all five CCEs also specifically interact with LHCII. In addition, SGR and CCEs interact directly or indirectly with each other at LHCII, and SGR is essential for recruiting CCEs in senescing chloroplasts. PAO, which had been attributed to the inner envelope, is found to localize in the thylakoid membrane. These data indicate a predominant role for the SGR-CCE-LHCII protein interaction in the breakdown of LHCII-located chlorophyll, likely to allow metabolic channeling of phototoxic chlorophyll breakdown intermediates upstream of nontoxic pFCC. PMID:22366162
Batista, Jacqueline Ellen Camelo; Ferreira, Ewerton Lucena; Nascimento, Danielle Cristina de Oliveira; Ventura, Roberta Ferreira; de Oliveira, Wagner Luis Mendes; Leal, Nilma Cintra; Lima-Filho, José Vitor
2013-12-01
The marine clam Anomalocardia brasiliana is a candidate as a sentinel animal to monitor the contamination levels of coliforms in shellfish-harvesting areas of Brazil's northeastern region. The aim of the present study was to search enterotoxin-encoding genes plus the mecA gene among coagulase-negative staphylococci (CNS) isolates from shellfish meats of A. brasiliana. The specimen clam (n=48; 40 clams per sample) was collected during low tide in the bay area of Mangue Seco from April through June 2009, and random samples of chilled and frozen shelled clam meat (n=33; 250 g per sample) were obtained from retail shops from January through March 2012. Seventy-nine CNS isolates were identified, including Staphylococcus xylosus, S. cohnii spp. urealyticus, S. sciuri, and S. lentus. A high percentage of isolates resistant to erythromycin (58.5%), penicillin (51.2%), and tetracycline (43.9%), and the fluoroquinolones levofloxacin (39%) and ciprofloxacin (34.1%) were recorded from those environmental samples. Isolates from retail shops were particularly resistant to oxacillin (55.3%) and penicillin (36.8%). All CNS resistant to oxacillin and/or cefoxitin were positive for the presence of the mecA gene, but phenotypically susceptible to vancomycin. Also, the enterotoxin-encoding genes seg and seh were detected through multiplex-polymerase chain reaction in 77.7% and 88.8% of the isolates from environmental samples, versus 90.5% and 100% of the isolates from retail shops, respectively. The data reveal the risk to public health due to consuming raw or undercooked shellfish containing enterotoxigenic plus methicillin-resistant CNS.
Directory of Open Access Journals (Sweden)
Craxton Molly
2007-07-01
Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances
Pateau, Victoire; Razafimandimby, Bienvenue; Vandeputte, Patrick; Thornton, Christopher R; Guillemette, Thomas; Bouchara, Jean-Philippe; Giraud, Sandrine
2018-02-01
Scedosporium species are opportunistic pathogens responsible for a large variety of infections in humans. An increasing occurrence was observed in patients with underlying conditions such as immunosuppression or cystic fibrosis. Indeed, the genus Scedosporium ranks the second among the filamentous fungi colonizing the respiratory tracts of the CF patients. To date, there is very scarce information on the pathogenic mechanisms, at least in part because of the limited genetic tools available. In the present study, we successfully developed an efficient transformation and targeted gene disruption approach on the species Scedosporium aurantiacum. The disruption cassette was constructed using double-joint PCR procedure, and resistance to hygromycin B as the selection marker. This proof of concept was performed on the functional gene SODC encoding the Cu,Zn-superoxide dismutase. Disruption of the SODC gene improved susceptibility of the fungus to oxidative stress. This technical advance should open new research areas and help to better understand the biology of Scedosporium species.
Steven Steven; Yoni F Syukriani; Julius B Dewanto
2016-01-01
Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...
Lin, J W; Lu, H C; Chen, H Y; Weng, S F
1997-10-09
Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.
DEFF Research Database (Denmark)
Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo
2014-01-01
The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...
Hempel, Niels; Görisch, Helmut; Mern, Demissew S
2013-09-01
Several two-component regulatory systems are known to be involved in the signal transduction pathway of the ethanol oxidation system in Pseudomonas aeruginosa ATCC 17933. These sensor kinases and response regulators are organized in a hierarchical manner. In addition, a cytoplasmic putative iron-containing alcohol dehydrogenase (Fe-ADH) encoded by ercA (PA1991) has been identified to play an essential role in this regulatory network. The gene ercA (PA1991) is located next to ercS, which encodes a sensor kinase. Inactivation of ercA (PA1991) by insertion of a kanamycin resistance cassette created mutant NH1. NH1 showed poor growth on various alcohols. On ethanol, NH1 grew only with an extremely extended lag phase. During the induction period on ethanol, transcription of structural genes exa and pqqABCDEH, encoding components of initial ethanol oxidation in P. aeruginosa, was drastically reduced in NH1, which indicates the regulatory function of ercA (PA1991). However, transcription in the extremely delayed logarithmic growth phase was comparable to that in the wild type. To date, the involvement of an Fe-ADH in signal transduction processes has not been reported.
Directory of Open Access Journals (Sweden)
Tiane Martin de Moura
2012-10-01
Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.
A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3
Energy Technology Data Exchange (ETDEWEB)
Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others
1996-03-05
We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.
Detection and Isolation of Novel Rhizopine-Catabolizing Bacteria from the Environment
Gardener, Brian B. McSpadden; de Bruijn, Frans J.
1998-01-01
Microbial rhizopine-catabolizing (Moc) activity was detected in serial dilutions of soil and rhizosphere washes. The activity observed generally ranged between 106 and 107 catabolic units per g, and the numbers of nonspecific culture-forming units were found to be approximately 10 times higher. A diverse set of 37 isolates was obtained by enrichment on scyllo-inosamine-containing media. However, none of the bacteria that were isolated were found to contain DNA sequences homologous to the know...
Long, D.L.; Ulici, V.; Chubinskaya, S.; Loeser, R.F.
2015-01-01
Objective We determined if the epidermal growth factor receptor ligand HB-EGF is produced in cartilage and if it regulates chondrocyte anabolic or catabolic activity. Methods HB-EGF expression was measured by quantitative PCR using RNA isolated from mouse knee joint tissues and from normal and OA human chondrocytes. Immunohistochemistry was performed on normal and OA human cartilage and meniscus sections. Cultured chondrocytes were treated with fibronectin fragments (FN-f) as a catabolic stimulus and osteogenic protein 1 (OP-1) as an anabolic stimulus. Effects of HB-EGF on cell signaling were analyzed by immunoblotting of selected signaling proteins. MMP-13 was measured in conditioned media, proteoglycan synthesis was measured by sulfate incorporation, and matrix gene expression by quantitative PCR. Results HB-EGF expression was increased in 12-month old mice at 8 weeks after surgery to induce OA and increased amounts of HB-EGF were noted in human articular cartilage from OA knees. FN-f stimulated chondrocyte HB-EGF expression and HB-EGF stimulated chondrocyte MMP-13 production. However, HB-EGF was not required for FN-f stimulation of MMP-13 production. HB-EGF activated the ERK and p38 MAP kinases and stimulated phosphorylation of Smad1 at an inhibitory serine site which was associated with inhibition of OP-1 mediated proteoglycan synthesis and reduced aggrecan (ACAN) but not COL2A1 expression. Conclusion HB-EGF is a new factor identified in OA cartilage that promotes chondrocyte catabolic activity while inhibiting anabolic activity suggesting it could contribute to the catabolic-anabolic imbalance seen in OA cartilage. PMID:25937027
Kheirollahi, Majid; Khosravi, Fereshteh; Ashouri, Saeideh; Ahmadi, Alireza
2016-01-01
Background: Tetralogy of Fallot (TOF), the most common cyanotic heart defect and one of the most common congenital heart diseases, occurs mostly sporadically and nonsyndromically. The underlying molecular genetic mechanism is not known. Therefore, the existence of mutations in the homeodomain-encoding region of NKX2.5 gene in Iranian patients with tetralogy of Fallot is evaluated. Materials and Methods: In the present study, we analyzed the peripheral blood samples of27 patients in order to find any mutation in the 180 bp homeodomain-encoding region of NKX2.5 gene, which is known to be involved in heart development and diseases. DNA was extracted and all the samples were amplified by polymerase chain reaction (PCR) and sequenced. Results: Twenty-seven patients were included in the study. Twenty-five of them were infants and children (6 days to 11 years of age), one was a teenager (14-years of age), and another was a 33-year-old man [mean ± standard deviation (SD): 5.80 ± 3.90 years]. Thirteen patents were males (mean ± SD: 6.587077 ± 5.02 years) and 14 were females (mean ± SD: 5.0726 ± 2.81 years). One synonymous variant, i.e., c.543G>A was identified in one patient. Conclusion: Mutations in the homeodomain-encoding region of NKX2.5 gene may not have an outstanding role in etiology of tetralogy of Fallot patients in Iran. PMID:27904570
Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade
2015-11-14
FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.
The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.
LENUS (Irish Health Repository)
Martin, Ronny
2011-04-01
The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.
Directory of Open Access Journals (Sweden)
Beatriz Moreno
2016-07-01
Full Text Available Background: In this work, we aimed to gain insights into the contribution of soil bacteria to carbon sequestration in Mediterranean habitats. In particular, we aimed to use bacterial laccase-encoding genes as molecular markers for soil organic C cycling. Using rainfed olive farming as an experimental model, we determined the stability and accumulation levels of humic substances and applied these data to bacterial laccase-encoding gene expression and diversity in soils under four different agricultural management systems (bare soils under tillage/no tillage and vegetation cover under chemical/mechanical management. Materials and Methods: Humic C (> 104 Da was subjected to isoelectric focusing. The GC-MS method was used to analyze aromatic hydrocarbons. Real-Time PCR quantification and denaturing gradient gel electrophoresis (DGGE for functional bacterial laccase-like multicopper oxidase (LMCO-encoding genes and transcripts were also carried out. Results: Soils under spontaneous vegetation, eliminated in springtime using mechanical methods for more than 30 years, showed the highest humic acid levels as well as the largest bacterial population rich in laccase genes and transcripts. The structure of the bacterial community based on LMCO genes also pointed to phylogenetic differences between these soils due to the impact of different management systems. Soils where herbicides were used to eliminate spontaneous vegetation once a year and those where pre-emergence herbicides resulted in bare soils clustered together for DNA-based DGGE analysis, which indicated a certain amount of microbial selection due to the application of herbicides. When LMCO-encoding gene expression was studied, soils where cover vegetation was managed either with herbicides or with mechanical methods showed less than 10% similarity, suggesting that the type of weed management strategy used can impact weed community composition and consequently laccase substrates derived from
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-07-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.
Energy Technology Data Exchange (ETDEWEB)
Suenaga, Hikaru [National Institute of Advanced Industrial Science and Technology (AIST), Tsukuba (Japan). Bioproduction Research Inst.; Nonaka, Kazuhiko; Goto, Masatoshi [Kyushu Univ., Fukuoka (Japan). Dept. of Bioscience and Biotechnology; Fujihara, Hidehiko; Furukawa, Kensuke [Beppu Univ. (Japan). Dept. of Fermentation and Food Science
2010-10-15
Pseudomonas pseudoalcaligenes KF707 possesses a chromosomally encoded bph gene cluster responsible for the catabolism of biphenyl and polychlorinated biphenyls. Previously, we constructed chimeric versions of the bphA1 gene, which encodes a large subunit of biphenyl dioxygenase, by using DNA shuffling between bphA1 genes from P. pseudoalcaligenes KF707 and Burkholderia xenovorans LB400. In this study, we demonstrate replacement of the bphA1 gene with chimeric bphA1 sequence within the chromosomal bph gene cluster by two-step homologous recombination. Notably, some of the hybrid strains acquired enhanced and/or expanded degradation capabilities for specific aromatic compounds, including single aromatic hydrocarbons and polychlorinated biphenyls. (orig.)
Directory of Open Access Journals (Sweden)
Peter K Busk
Full Text Available The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence. In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important feature as it provides a direct route to predict function from primary sequence. Furthermore, we used Peptide Pattern Recognition to compare the cellulose-degrading enzyme activities encoded by 39 fungal genomes. The results indicated that cellobiohydrolases and AA9 lytic polysaccharide monooxygenases are hallmarks of cellulose-degrading fungi except brown rot fungi. Furthermore, a high number of AA9, endocellulase and β-glucosidase genes were identified, not in what are known to be the strongest, specialized lignocellulose degraders but in saprophytic fungi that can use a wide variety of substrates whereas only few of these genes were found in fungi that have a limited number of natural, lignocellulotic substrates. This correlation suggests that enzymes with different properties are necessary for degradation of cellulose in different complex substrates. Interestingly, clustering of the fungi based on their predicted enzymes indicated that Ascomycota and Basidiomycota use the same enzymatic activities to degrade plant cell walls.
Motallebi, Mitra; Jabalameli, Fereshteh; Asadollahi, Kheirollah; Taherikalani, Morovat; Emaneini, Mohammad
2016-08-01
The emergence of antibiotic-resistant Staphylococcus aureus in particular methicillin-resistant S. aureus (MRSA) is an important concern in burn medical centers either in Iran or worldwide. A total of 128 S. aureus isolates were collected from wound infection of burn patients during June 2013 to June 2014. Multiplex-polymerase chain reaction (MPCR) assay was performed for the characterization of the staphylococcal cassette chromosome mec (SCCmec). Genes encoding virulence factors and biofilm were targeted by PCR. Of 128 S. aureus isolates, 77 (60.1%) isolates were MRSA. Fifty four (70.1%) isolates were identified as SCCmec type IIIA. The most frequently detected toxin genes among MRSA isolates with SCCmec type IIIA were sea (64.1%) and hla (51.8%). The rate of coexistence of sea with hla and sea with hla and hlb was 37% and12.9%, respectively. The sec, eta, tst, pvl, hla and hlb genes were not detected in any of the MRSA isolates. The most prevalent genes encoding biofilm was eno, found in 61.1% of isolates, followed by fib and icaA found in 48.1% and 38.8% of the isolates, respectively. The rate of coexistence of fib + eno + icaA + icaD and fib + eno was 20.3% and 9.2%, respectively. The ebps gene was not detected in any of the isolates. In conclusion, our study indicated that the sea, hla, fib and icaA were most frequent genes encoding virulence factors among MRSA with SCCmec type IIIA isolated from burn wound infection. Moreover, the results of this study shows that the rate of coexistence of genes encoding different virulence factor were high. Copyright © 2016 Elsevier Ltd. All rights reserved.
Molecular cloning and functional analysis of the gene encoding ...
African Journals Online (AJOL)
Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...
Directory of Open Access Journals (Sweden)
Dunham Stephen
2009-11-01
Full Text Available Abstract Background Organisms that are sensitive to nitrofurantoin express a nitroreductase. Since bacterial resistance to this compound results primarily from mutations in the gene encoding nitroreductase, the resulting loss of function of nitroreductase results in a selectable phenotype; resistance to nitrofurantoin. We exploited this direct selection for mutation to study the frequency at which spontaneous mutations arise (transitions and transversions, insertions and deletions. Results A nitroreductase- encoding gene was identified in the N. gonorrhoeae FA1090 genome by using a bioinformatic search with the deduced amino acid sequence derived from the Escherichia coli nitroreductase gene, nfsB. Cell extracts from N. gonorrhoeae were shown to possess nitroreductase activity, and activity was shown to be the result of NfsB. Spontaneous nitrofurantoin-resistant mutants arose at a frequency of ~3 × 10-6 - 8 × 10-8 among the various strains tested. The nfsB sequence was amplified from various nitrofurantoin-resistant mutants, and the nature of the mutations determined. Transition, transversion, insertion and deletion mutations were all readily detectable with this reporter gene. Conclusion We found that nfsB is a useful reporter gene for measuring spontaneous mutation frequencies. Furthermore, we found that mutations were more likely to arise in homopolymeric runs rather than as base substitutions.
Latimer, Scott; Li, Yubing; Nguyen, Thuong T H; Soubeyrand, Eric; Fatihi, Abdelhak; Elowsky, Christian G; Block, Anna; Pichersky, Eran; Basset, Gilles J
2018-05-09
The proteinogenic branched-chain amino acids (BCAAs) leucine, isoleucine and valine are essential nutrients for mammals. In plants, BCAAs double as alternative energy sources when carbohydrates become limiting, the catabolism of BCAAs providing electrons to the respiratory chain and intermediates to the tricarboxylic acid cycle. Yet, the actual architecture of the degradation pathways of BCAAs is not well understood. In this study, gene network modeling in Arabidopsis and rice, and plant-prokaryote comparative genomics detected candidates for 3-methylglutaconyl-CoA hydratase (4.2.1.18), one of the missing plant enzymes of leucine catabolism. Alignments of these protein candidates sampled from various spermatophytes revealed non-homologous N-terminal extensions that are lacking in their bacterial counterparts, and green fluorescent protein-fusion experiments demonstrated that the Arabidopsis protein, product of gene At4g16800, is targeted to mitochondria. Recombinant At4g16800 catalyzed the dehydration of 3-hydroxymethylglutaryl-CoA into 3-methylglutaconyl-CoA, and displayed kinetic features similar to those of its prokaryotic homolog. When at4g16800 knockout plants were subjected to dark-induced carbon starvation, their rosette leaves displayed accelerated senescence as compared to control plants, and this phenotype was paralleled by a marked increase in the accumulation of free and total leucine, isoleucine and valine. The seeds of the at4g16800 mutant showed a similar accumulation of free BCAAs. These data suggest that 3-methylglutaconyl-CoA hydratase is not solely involved in the degradation of leucine, but is also a significant contributor to that of isoleucine and valine. Furthermore, evidence is shown that unlike the situation observed in Trypanosomatidae, leucine catabolism does not contribute to the formation of the terpenoid precursor mevalonate. This article is protected by copyright. All rights reserved. This article is protected by copyright. All rights
Roten, C A; Brandt, C; Karamata, D
1991-04-01
Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.
Ghysels, Bart; Ochsner, Urs; Möllman, Ute; Heinisch, Lothar; Vasil, Michael; Cornelis, Pierre; Matthijs, Sandra
2005-05-15
Actively secreted iron chelating agents termed siderophores play an important role in the virulence and rhizosphere competence of fluorescent pseudomonads, including Pseudomonas aeruginosa which secretes a high affinity siderophore, pyoverdine, and the low affinity siderophore, pyochelin. Uptake of the iron-siderophore complexes is an active process that requires specific outer membrane located receptors, which are dependent of the inner membrane-associated protein TonB and two other inner membrane proteins, ExbB and ExbC. P. aeruginosa is also capable of using a remarkable variety of heterologous siderophores as sources of iron, apparently by expressing their cognate receptors. Illustrative of this feature are the 32 (of which 28 putative) siderophore receptor genes observed in the P. aeruginosa PAO1 genome. However, except for a few (pyoverdine, pyochelin, enterobactin), the vast majority of P. aeruginosa siderophore receptor genes still remain to be characterized. Ten synthetic iron chelators of catecholate type stimulated growth of a pyoverdine/pyochelin deficient P. aeruginosa PAO1 mutant under condition of severe iron limitation. Null mutants of the 32 putative TonB-dependent siderophore receptor encoding genes engineered in the same genetic background were screened for obvious deficiencies in uptake of the synthetic siderophores, but none showed decreased growth stimulation in the presence of the different siderophores. However, a double knock-out mutant of ferrienterobactin receptor encoding gene pfeA (PA 2688) and pirA (PA0931) failed to be stimulated by 4 of the tested synthetic catecholate siderophores whose chemical structures resemble enterobactin. Ferric-enterobactin also failed to stimulate growth of the double pfeA-pirA mutant although, like its synthetic analogues, it stimulated growth of the corresponding single mutants. Hence, we confirmed that pirA represents a second P. aeruginosa ferric-enterobactin receptor. The example of these two
Li, Lingxiao; Wang, Tao; Sun, Yi; Cheng, Gang; Yang, Hui; Wei, Zhiguo; Wang, Ping; Hu, Xiaoxiang; Ren, Liming; Meng, Qingyong; Zhang, Ran; Guo, Ying; Hammarström, Lennart; Li, Ning; Zhao, Yaofeng
2012-10-15
IgY(ΔFc), containing only CH1 and CH2 domains, is expressed in the serum of some birds and reptiles, such as ducks and turtles. The duck IgY(ΔFc) is produced by the same υ gene that expresses the intact IgY form (CH1-4) using different transcriptional termination sites. In this study, we show that intact IgY and IgY(ΔFc) are encoded by distinct genes in the red-eared turtle (Trachemys scripta elegans). At least eight IgY and five IgY(ΔFc) transcripts were found in a single turtle. Together with Southern blotting, our data suggest that multiple genes encoding both IgY forms are present in the turtle genome. Both of the IgY forms were detected in the serum using rabbit polyclonal Abs. In addition, we show that multiple copies of the turtle δ gene are present in the genome and that alternative splicing is extensively involved in the generation of both the secretory and membrane-bound forms of the IgD H chain transcripts. Although a single μ gene was identified, the α gene was not identified in this species.
Directory of Open Access Journals (Sweden)
Senta Heiss-Blanquet
Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.
Kast, Alene; Voges, Raphael; Schroth, Michael; Schaffrath, Raffael; Klassen, Roland; Meinhardt, Friedhelm
2015-05-01
Cytoplasmic virus like elements (VLEs) from Kluyveromyces lactis (Kl), Pichia acaciae (Pa) and Debaryomyces robertsiae (Dr) are extremely A/T-rich (>75%) and encode toxic anticodon nucleases (ACNases) along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5) results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE) as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A) site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Directory of Open Access Journals (Sweden)
Alene Kast
2015-05-01
Full Text Available Cytoplasmic virus like elements (VLEs from Kluyveromyces lactis (Kl, Pichia acaciae (Pa and Debaryomyces robertsiae (Dr are extremely A/T-rich (>75% and encode toxic anticodon nucleases (ACNases along with specific immunity proteins. Here we show that nuclear, not cytoplasmic expression of either immunity gene (PaORF4, KlORF3 or DrORF5 results in transcript fragmentation and is insufficient to establish immunity to the cognate ACNase. Since rapid amplification of 3' ends (RACE as well as linker ligation of immunity transcripts expressed in the nucleus revealed polyadenylation to occur along with fragmentation, ORF-internal poly(A site cleavage due to the high A/T content is likely to prevent functional expression of the immunity genes. Consistently, lowering the A/T content of PaORF4 to 55% and KlORF3 to 46% by gene synthesis entirely prevented transcript cleavage and permitted functional nuclear expression leading to full immunity against the respective ACNase toxin. Consistent with a specific adaptation of the immunity proteins to the cognate ACNases, cross-immunity to non-cognate ACNases is neither conferred by PaOrf4 nor KlOrf3. Thus, the high A/T content of cytoplasmic VLEs minimizes the potential of functional nuclear recruitment of VLE encoded genes, in particular those involved in autoselection of the VLEs via a toxin/antitoxin principle.
Amino acid catabolism by Lactobacillus helveticus in cheese
DEFF Research Database (Denmark)
Kananen, Soila Kaarina
Amino acid catabolism is the final step in the conversion of caseins to flavour compounds and a part of a complex combination of biochemical pathways in cheese flavour formation. Lactobacillus helveticus is a thermophilic lactic acid bacterium that is used in cheese manufacture as a primary starter...... culture or as an adjunct culture. It has shown high proteolytic activities in conversion of caseins to peptides and further to amino acids and flavour compounds. Better understanding of the enzyme activity properties and the influence of different properties on final cheese flavour is favourable...... for developing new cheese products with enhanced flavour. The aim of this Ph.D. study was to investigate the importance of strain variation of Lb. helveticus in relation flavour formation in cheese related to amino acid catabolism. Aspects of using Lb. helveticus as starter as well as adjunct culture in cheese...
Tzagoloff, A; Shtanko, A
1995-06-01
Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.
Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben
2016-03-01
The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.
Munro, Jacob E.; Liew, Elissa F.; Ly, Mai-Anh
2016-01-01
ABSTRACT 1,2-Dichloroethane (DCA) is a problematic xenobiotic groundwater pollutant. Bacteria are capable of biodegrading DCA, but the evolution of such bacteria is not well understood. In particular, the mechanisms by which bacteria acquire the key dehalogenase genes dhlA and dhlB have not been well defined. In this study, the genomic context of dhlA and dhlB was determined in three aerobic DCA-degrading bacteria (Starkeya novella strain EL1, Xanthobacter autotrophicus strain EL4, and Xanthobacter flavus strain EL8) isolated from a groundwater treatment plant (GTP). A haloalkane dehalogenase gene (dhlA) identical to the canonical dhlA gene from Xanthobacter sp. strain GJ10 was present in all three isolates, and, in each case, the dhlA gene was carried on a variant of a 37-kb circular plasmid, which was named pDCA. Sequence analysis of the repA replication initiator gene indicated that pDCA was a member of the pTAR plasmid family, related to catabolic plasmids from the Alphaproteobacteria, which enable growth on aromatics, dimethylformamide, and tartrate. Genes for plasmid replication, mobilization, and stabilization were identified, along with two insertion sequences (ISXa1 and ISPme1) which were likely to have mobilized dhlA and dhlB and played a role in the evolution of aerobic DCA-degrading bacteria. Two haloacid dehalogenase genes (dhlB1 and dhlB2) were detected in the GTP isolates; dhlB1 was most likely chromosomal and was similar to the canonical dhlB gene from strain GJ10, while dhlB2 was carried on pDCA and was not closely related to dhlB1. Heterologous expression of the DhlB2 protein confirmed that this plasmid-borne dehalogenase was capable of chloroacetate dechlorination. IMPORTANCE Earlier studies on the DCA-degrading Xanthobacter sp. strain GJ10 indicated that the key dehalogenases dhlA and dhlB were carried on a 225-kb linear plasmid and on the chromosome, respectively. The present study has found a dramatically different gene organization in more
Identification of Genes Associated with Chlorophyll Accumulation in Flower Petals
Ohmiya, Akemi; Hirashima, Masumi; Yagi, Masafumi; Tanase, Koji; Yamamizo, Chihiro
2014-01-01
Plants have an ability to prevent chlorophyll accumulation, which would mask the bright flower color, in their petals. In contrast, leaves contain substantial amounts of chlorophyll, as it is essential for photosynthesis. The mechanisms of organ-specific chlorophyll accumulation are unknown. To identify factors that determine the chlorophyll content in petals, we compared the expression of genes related to chlorophyll metabolism in different stages of non-green (red and white) petals (very low chlorophyll content), pale-green petals (low chlorophyll content), and leaves (high chlorophyll content) of carnation (Dianthus caryophyllus L.). The expression of many genes encoding chlorophyll biosynthesis enzymes, in particular Mg-chelatase, was lower in non-green petals than in leaves. Non-green petals also showed higher expression of genes involved in chlorophyll degradation, including STAY-GREEN gene and pheophytinase. These data suggest that the absence of chlorophylls in carnation petals may be caused by the low rate of chlorophyll biosynthesis and high rate of degradation. Similar results were obtained by the analysis of Arabidopsis microarray data. In carnation, most genes related to chlorophyll biosynthesis were expressed at similar levels in pale-green petals and leaves, whereas the expression of chlorophyll catabolic genes was higher in pale-green petals than in leaves. Therefore, we hypothesize that the difference in chlorophyll content between non-green and pale-green petals is due to different levels of chlorophyll biosynthesis. Our study provides a basis for future molecular and genetic studies on organ-specific chlorophyll accumulation. PMID:25470367
de Vries, Ronald P; vanKuyk, Patricia A; Kester, Harry C M; Visser, Jaap
2002-04-15
The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase. However, the encoded enzyme, feruloyl esterase B (FAEB), does not have tannase activity. Comparison of the physical characteristics and substrate specificity of FAEB with those of a cinnamoyl esterase from A. niger [Kroon, Faulds and Williamson (1996) Biotechnol. Appl. Biochem. 23, 255-262] suggests that they are in fact the same enzyme. The expression of faeB is specifically induced in the presence of certain aromatic compounds, but not in the presence of other constituents present in plant-cell-wall polysaccharides such as arabinoxylan or pectin. The expression profile of faeB in the presence of aromatic compounds was compared with the expression of A. niger faeA, encoding feruloyl esterase A (FAEA), and A. niger bphA, the gene encoding a benzoate-p-hydroxylase. All three genes have different subsets of aromatic compounds that induce their expression, indicating the presence of different transcription activating systems in A. niger that respond to aromatic compounds. Comparison of the activity of FAEA and FAEB on sugar-beet pectin and wheat arabinoxylan demonstrated that they are both involved in the degradation of both polysaccharides, but have opposite preferences for these substrates. FAEA is more active than FAEB towards wheat arabinoxylan, whereas FAEB is more active than FAEA towards sugar-beet pectin.
Directory of Open Access Journals (Sweden)
Hongle Xu
Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.
Regulation of expression of pectate lyase genes pelA, pelD, and pelE in Erwinia chrysanthemi.
Reverchon, S; Robert-Baudouy, J
1987-06-01
The regulation of pelA, pelD, and pelE genes encoding three of the five major pectate lyase isoenzymes (PLa, PLd, and PLe) in Erwinia chrysanthemi B374 was analyzed by using genetic fusions to lacZ. These three genes are clustered on a 5-kilobase DNA fragment in the order pelD-pelE-pelA and constitute three independent transcriptional units. We localized the pelDEA cluster near the pro-1 marker on the genetic map of B374 by chromosomal mobilization with RP4::mini-Mu plasmid pULB110. Three classes of regulatory mutations responsible for constitutive pectate lyase synthesis have been described (kdgR, gpiR, and cri). We studied the effects of each mutation on pelE, pelD, and pelA expression independently. The mutations kdgR and gpiR mainly affect the expression of pelE and pelD, although PLa synthesis is slightly increased. The cri mutation results in a low level of constitutive expression of the three pel genes, but it is a pleiotropic mutation since other genes not involved in pectinolysis are also affected. In addition, we demonstrated that exuR, a negative regulatory gene governing the catabolism of hexuronates, does not modify the expression of pel genes. The frequency of gpiR or cri mutations (about 10(-8)) and the resulting constitutivity of pectate lyase synthesis suggest that these genes act as negative regulatory genes in addition to kdgR, which is already known to encode a repressor. Moreover, we found that expression of pel-lac fusions carried on pBR322 derivatives was higher in E. chrysanthemi than in Escherichia coli; this fact suggests the existence of positive regulation of pectate lyase synthesis in E. chrysanthemi.
Valle-Maldonado, Marco Iván; Jácome-Galarza, Irvin Eduardo; Díaz-Pérez, Alma Laura; Martínez-Cadena, Guadalupe; Campos-García, Jesús; Ramírez-Díaz, Martha Isela; Reyes-De la Cruz, Homero; Riveros-Rosas, Héctor; Díaz-Pérez, César; Meza-Carmen, Víctor
2015-12-01
In fungi, heterotrimeric G proteins are key regulators of biological processes such as mating, virulence, morphology, among others. Mucor circinelloides is a model organism for many biological processes, and its genome contains the largest known repertoire of genes that encode putative heterotrimeric G protein subunits in the fungal kingdom: twelve Gα (McGpa1-12), three Gβ (McGpb1-3), and three Gγ (McGpg1-3). Phylogenetic analysis of fungal Gα showed that they are divided into four distinct groups as reported previously. Fungal Gβ and Gγ are also divided into four phylogenetic groups, and to our understanding this is the first report of a phylogenetic classification for fungal Gβ and Gγ subunits. Almost all genes that encode putative heterotrimeric G subunits in M. circinelloides are differentially expressed during dimorphic growth, except for McGpg1 (Gγ) that showed very low mRNA levels at all developmental stages. Moreover, several of the subunits are expressed in a similar pattern and at the same level, suggesting that they constitute discrete complexes. For example, McGpb3 (Gβ), and McGpg2 (Gγ), are co-expressed during mycelium growth, and McGpa1, McGpb2, and McGpg2, are co-expressed during yeast development. These findings provide the conceptual framework to study the biological role of these genes during M. circinelloides morphogenesis. Copyright © 2015 The British Mycological Society. Published by Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Royah Vaezi
2013-12-01
Full Text Available In order to identify novel genes encoding enzymes involved in the biosynthesis of nutritionally important omega-3 long chain polyunsaturated fatty acids, a database search was carried out in the genomes of the unicellular photoautotrophic green alga Ostreococcus RCC809 and cold-water diatom Fragilariopsis cylindrus. The search led to the identification of two putative “front-end” desaturases (Δ6 and Δ4 from Ostreococcus RCC809 and one Δ6-elongase from F. cylindrus. Heterologous expression of putative open reading frames (ORFs in yeast revealed that the encoded enzyme activities efficiently convert their respective substrates: 54.1% conversion of α-linolenic acid for Δ6-desaturase, 15.1% conversion of 22:5n-3 for Δ4-desaturase and 38.1% conversion of γ-linolenic acid for Δ6-elongase. The Δ6-desaturase from Ostreococcus RCC809 displays a very strong substrate preference resulting in the predominant synthesis of stearidonic acid (C18:4Δ6,9,12,15. These data confirm the functional characterization of omega-3 long chain polyunsaturated fatty acid biosynthetic genes from these two species which have until now not been investigated for such activities. The identification of these new genes will also serve to expand the repertoire of activities available for metabolically engineering the omega-3 trait in heterologous hosts as well as providing better insights into the synthesis of eicosapentaenoic acid (EPA and docosahexaenoic acid (DHA in marine microalgae.
DEFF Research Database (Denmark)
Demontis, Ditte; Nyegaard, Mette; Christensen, Jane H
2012-01-01
OBJECTIVE: The MCHR1 gene encoding the melanin-concentrating hormone receptor 1 is located on chromosome 22q13.2 and has previously been associated with schizophrenia in a study of cases and controls from the Faroe Islands and Scotland. Herein we report an association between variations in the MCHR...
Kaur, Simarjot; Mishra, Mukti N; Tripathi, Anil K
2010-07-04
Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (gamma-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only gamma-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one beta-CA and two gamma-CAs. One of the putative gamma-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-gamma-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a gamma-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized gamma-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Bogdanova, Vera S.; Zaytseva, Olga O.; Mglinets, Anatoliy V.; Shatskaya, Natalia V.; Kosterin, Oleg E.; Vasiliev, Gennadiy V.
2015-01-01
In crosses of wild and cultivated peas (Pisum sativum L.), nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized. PMID:25789472
Directory of Open Access Journals (Sweden)
Vera S Bogdanova
Full Text Available In crosses of wild and cultivated peas (Pisum sativum L., nuclear-cytoplasmic incompatibility frequently occurs manifested as decreased pollen fertility, male gametophyte lethality, sporophyte lethality. High-throughput sequencing of plastid genomes of one cultivated and four wild pea accessions differing in cross-compatibility was performed. Candidate genes for involvement in the nuclear-plastid conflict were searched in the reconstructed plastid genomes. In the annotated Medicago truncatula genome, nuclear candidate genes were searched in the portion syntenic to the pea chromosome region known to harbor a locus involved in the conflict. In the plastid genomes, a substantial variability of the accD locus represented by nucleotide substitutions and indels was found to correspond to the pattern of cross-compatibility among the accessions analyzed. Amino acid substitutions in the polypeptides encoded by the alleles of a nuclear locus, designated as Bccp3, with a complementary function to accD, fitted the compatibility pattern. The accD locus in the plastid genome encoding beta subunit of the carboxyltransferase of acetyl-coA carboxylase and the nuclear locus Bccp3 encoding biotin carboxyl carrier protein of the same multi-subunit enzyme were nominated as candidate genes for main contribution to nuclear-cytoplasmic incompatibility in peas. Existence of another nuclear locus involved in the accD-mediated conflict is hypothesized.
Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.
Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang
2012-02-01
In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.
International Nuclear Information System (INIS)
Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.
1988-01-01
A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors
Leiter, Éva; Bálint, Mihály; Miskei, Márton; Orosz, Erzsébet; Szabó, Zsuzsa; Pócsi, István
2016-07-01
A group of menadione stress-responsive function-unkown genes of Aspergillus nidulans (Locus IDs ANID_03987.1, ANID_06058.1, ANID_10219.1, and ANID_10260.1) was deleted and phenotypically characterized. Importantly, comparative and phylogenetic analyses of the tested A. nidulans genes and their orthologs shed light only on the presence of a TANGO2 domain with NRDE protein motif in the translated ANID_06058.1 gene but did not reveal any recognizable protein-encoding domains in other protein sequences. The gene deletion strains were subjected to oxidative, osmotic, and metal ion stress and, surprisingly, only the ΔANID_10219.1 mutant showed an increased sensitivity to 0.12 mmol l(-1) menadione sodium bisulfite. The gene deletions affected the stress sensitivities (tolerances) irregularly, for example, some strains grew more slowly when exposed to various oxidants and/or osmotic stress generating agents, meanwhile the ΔANID_10260.1 mutant possessed a wild-type tolerance to all stressors tested. Our results are in line with earlier studies demonstrating that the deletions of stress-responsive genes do not confer necessarily any stress-sensitivity phenotypes, which can be attributed to compensatory mechanisms based on other elements of the stress response system with overlapping functions. © 2015 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.
Directory of Open Access Journals (Sweden)
Haga Christopher L
2007-09-01
Full Text Available Abstract Background In mouse the cytokine interleukin-7 (IL-7 is required for generation of B lymphocytes, but human IL-7 does not appear to have this function. A bioinformatics approach was therefore used to identify IL-7 receptor related genes in the hope of identifying the elusive human cytokine. Results Our database search identified a family of nine gene candidates, which we have provisionally named fibronectin immunoglobulin leucine-rich repeat (FIGLER. The FIGLER 1–9 genes are predicted to encode type I transmembrane glycoproteins with 6–12 leucine-rich repeats (LRR, a C2 type Ig domain, a fibronectin type III domain, a hydrophobic transmembrane domain, and a cytoplasmic domain containing one to four tyrosine residues. Members of this multichromosomal gene family possess 20–47% overall amino acid identity and are differentially expressed in cell lines and primary hematopoietic lineage cells. Genes for FIGLER homologs were identified in macaque, orangutan, chimpanzee, mouse, rat, dog, chicken, toad, and puffer fish databases. The non-human FIGLER homologs share 38–99% overall amino acid identity with their human counterpart. Conclusion The extracellular domain structure and absence of recognizable cytoplasmic signaling motifs in members of the highly conserved FIGLER gene family suggest a trophic or cell adhesion function for these molecules.
Linking genes to microbial growth kinetics: an integrated biochemical systems engineering approach.
Koutinas, Michalis; Kiparissides, Alexandros; Silva-Rocha, Rafael; Lam, Ming-Chi; Martins Dos Santos, Vitor A P; de Lorenzo, Victor; Pistikopoulos, Efstratios N; Mantalaris, Athanasios
2011-07-01
The majority of models describing the kinetic properties of a microorganism for a given substrate are unstructured and empirical. They are formulated in this manner so that the complex mechanism of cell growth is simplified. Herein, a novel approach for modelling microbial growth kinetics is proposed, linking biomass growth and substrate consumption rates to the gene regulatory programmes that control these processes. A dynamic model of the TOL (pWW0) plasmid of Pseudomonas putida mt-2 has been developed, describing the molecular interactions that lead to the transcription of the upper and meta operons, known to produce the enzymes for the oxidative catabolism of m-xylene. The genetic circuit model was combined with a growth kinetic model decoupling biomass growth and substrate consumption rates, which are expressed as independent functions of the rate-limiting enzymes produced by the operons. Estimation of model parameters and validation of the model's predictive capability were successfully performed in batch cultures of mt-2 fed with different concentrations of m-xylene, as confirmed by relative mRNA concentration measurements of the promoters encoded in TOL. The growth formation and substrate utilisation patterns could not be accurately described by traditional Monod-type models for a wide range of conditions, demonstrating the critical importance of gene regulation for the development of advanced models closely predicting complex bioprocesses. In contrast, the proposed strategy, which utilises quantitative information pertaining to upstream molecular events that control the production of rate-limiting enzymes, predicts the catabolism of a substrate and biomass formation and could be of central importance for the design of optimal bioprocesses. Copyright © 2011 Elsevier Inc. All rights reserved.
DEFF Research Database (Denmark)
Hastwell, April H; de Bang, Thomas Christian; Gresshoff, Peter M
2017-01-01
these complete CLE peptide-encoding gene families with those of fellow legumes, Glycine max and Phaseolus vulgaris, in addition to the model plant Arabidopsis thaliana. This approach provided insight into the evolution of CLE peptide families and enabled us to establish putative M. truncatula and L. japonicus...
DEFF Research Database (Denmark)
Larsen, H. D.; Aarestrup, Frank Møller; Jensen, N. E.
2002-01-01
The object was to examine the geographical variation in the presence of superantigenic exotoxins and beta-hemolysin among epidemiologically independent Staphyirrcoccus aureus isolates from bovine mastitis. A total of 462 S. aureus isolates from nine European countries and USA were examined...... for the individual exotoxins. The genes encoding enterotoxin C, TSST-1, and enterotoxin D were the most common superantigens. The present and earlier studies demonstrate that the superantigenic exotoxins that were investigated in this study, do not play a role in the pathogenesis of bovine S. aureus mastitis...... regions in the beta-hemolysin encoding gene of the Norwegian isolates is suggested, and should be investigated further. The consistent presence of beta-hemolysin suggests that this factor, or a co-existing gene correlated to beta-hemolysin, may be an active virulence factor in the pathogenesis of bovine S...
Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA
2012-06-19
Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.
Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro
2007-01-01
Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed. PMID:17581118
Directory of Open Access Journals (Sweden)
Hongxia Miao
Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.
Liu, Weixin; Xu, Biyu; Jin, Zhiqiang
2014-01-01
Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384
Xiong, Huaqi; Chen, Yongxiong; Yi, Yajun; Tsuchiya, Karen; Moeckel, Gilbert; Cheung, Joseph; Liang, Dan; Tham, Kyi; Xu, Xiaohu; Chen, Xing-Zhen; Pei, York; Zhao, Zhizhuang Jeo; Wu, Guanqing
2002-07-01
Autosomal recessive polycystic kidney disease (ARPKD) is a common hereditary renal cystic disease in infants and children. By genetic linkage analyses, the gene responsible for this disease, termed polycystic kidney and hepatic disease 1 (PKHD1), was mapped on human chromosome 6p21.1-p12, and has been further localized to a 1-cM genetic interval flanked by the D6S1714/D6S243 (telomeric) and D6S1024 (centromeric) markers. We recently identified a novel gene in this genetic interval from kidney cDNA, using cloning strategies. The gene PKHD1 (PKHD1-tentative) encodes a novel 3396-amino-acid protein with no apparent homology with any known proteins. We named its gene product "tigmin" because it contains multiple TIG domains, which usually are seen in proteins containing immunoglobulin-like folds. PKHD1 encodes an 11.6-kb transcript and is composed of 61 exons spanning an approximately 365-kb genomic region on chromosome 6p12-p11.2 adjacent to the marker D6S1714. Northern blot analyses demonstrated that the gene has discrete bands with one peak signal at approximately 11 kb, indicating that PKHD1 is likely to have multiple alternative transcripts. PKHD1 is highly expressed in adult and infant kidneys and weakly expressed in liver in northern blot analysis. This expression pattern parallels the tissue involvement observed in ARPKD. In situ hybridization analysis further revealed that the expression of PKHD1 in the kidney is mainly localized to the epithelial cells of the collecting duct, the specific tubular segment involved in cyst formation in ARPKD. These features of PKHD1 make it a strong positional candidate gene for ARPKD.
Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine
2011-01-01
Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.
Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis
Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon
2013-01-01
The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971
DEFF Research Database (Denmark)
Durkin, M E; Jäger, A C; Khurana, T S
1999-01-01
The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...
DEFF Research Database (Denmark)
Huebner, K; Kastury, K; Druck, T
1994-01-01
"adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...
Neuraminidases 3 and 4 regulate neuronal function by catabolizing brain gangliosides.
Pan, Xuefang; De Aragão, Camila De Britto Pará; Velasco-Martin, Juan P; Priestman, David A; Wu, Harry Y; Takahashi, Kohta; Yamaguchi, Kazunori; Sturiale, Luisella; Garozzo, Domenico; Platt, Frances M; Lamarche-Vane, Nathalie; Morales, Carlos R; Miyagi, Taeko; Pshezhetsky, Alexey V
2017-08-01
Gangliosides (sialylated glycolipids) play an essential role in the CNS by regulating recognition and signaling in neurons. Metabolic blocks in processing and catabolism of gangliosides result in the development of severe neurologic disorders, including gangliosidoses manifesting with neurodegeneration and neuroinflammation. We demonstrate that 2 mammalian enzymes, neuraminidases 3 and 4, play important roles in catabolic processing of brain gangliosides by cleaving terminal sialic acid residues in their glycan chains. In neuraminidase 3 and 4 double-knockout mice, G M3 ganglioside is stored in microglia, vascular pericytes, and neurons, causing micro- and astrogliosis, neuroinflammation, accumulation of lipofuscin bodies, and memory loss, whereas their cortical and hippocampal neurons have lower rate of neuritogenesis in vitro Double-knockout mice also have reduced levels of G M1 ganglioside and myelin in neuronal axons. Furthermore, neuraminidase 3 deficiency drastically increased storage of G M2 in the brain tissues of an asymptomatic mouse model of Tay-Sachs disease, a severe human gangliosidosis, indicating that this enzyme is responsible for the metabolic bypass of β-hexosaminidase A deficiency. Together, our results provide the first in vivo evidence that neuraminidases 3 and 4 have important roles in CNS function by catabolizing gangliosides and preventing their storage in lipofuscin bodies.-Pan, X., De Britto Pará De Aragão, C., Velasco-Martin, J. P., Priestman, D. A., Wu, H. Y., Takahashi, K., Yamaguchi, K., Sturiale, L., Garozzo, D., Platt, F. M., Lamarche-Vane, N., Morales, C. R., Miyagi, T., Pshezhetsky, A. V. Neuraminidases 3 and 4 regulate neuronal function by catabolizing brain gangliosides. © FASEB.
Microbial catabolic activities are naturally selected by metabolic energy harvest rate.
González-Cabaleiro, Rebeca; Ofiţeru, Irina D; Lema, Juan M; Rodríguez, Jorge
2015-12-01
The fundamental trade-off between yield and rate of energy harvest per unit of substrate has been largely discussed as a main characteristic for microbial established cooperation or competition. In this study, this point is addressed by developing a generalized model that simulates competition between existing and not experimentally reported microbial catabolic activities defined only based on well-known biochemical pathways. No specific microbial physiological adaptations are considered, growth yield is calculated coupled to catabolism energetics and a common maximum biomass-specific catabolism rate (expressed as electron transfer rate) is assumed for all microbial groups. Under this approach, successful microbial metabolisms are predicted in line with experimental observations under the hypothesis of maximum energy harvest rate. Two microbial ecosystems, typically found in wastewater treatment plants, are simulated, namely: (i) the anaerobic fermentation of glucose and (ii) the oxidation and reduction of nitrogen under aerobic autotrophic (nitrification) and anoxic heterotrophic and autotrophic (denitrification) conditions. The experimentally observed cross feeding in glucose fermentation, through multiple intermediate fermentation pathways, towards ultimately methane and carbon dioxide is predicted. Analogously, two-stage nitrification (by ammonium and nitrite oxidizers) is predicted as prevailing over nitrification in one stage. Conversely, denitrification is predicted in one stage (by denitrifiers) as well as anammox (anaerobic ammonium oxidation). The model results suggest that these observations are a direct consequence of the different energy yields per electron transferred at the different steps of the pathways. Overall, our results theoretically support the hypothesis that successful microbial catabolic activities are selected by an overall maximum energy harvest rate.
Inhibition of AMPK catabolic action by GSK3
Suzuki, Tsukasa; Bridges, Dave; Nakada, Daisuke; Skiniotis, Georgios; Morrison, Sean J.; Lin, Jiandie; Saltiel, Alan R.; Inoki, Ken
2013-01-01
SUMMARY AMP-activated protein kinase (AMPK) regulates cellular energy homeostasis by inhibiting anabolic and activating catabolic processes. While AMPK activation has been extensively studied, mechanisms that inhibit AMPK remain elusive. Here we report that glycogen synthase kinase 3 (GSK3) inhibits AMPK function. GSK3 forms a stable complex with AMPK through interactions with the AMPK β regulatory subunit and phosphorylates the AMPK α catalytic subunit. This phosphorylation enhances the accessibility of the activation loop of the α subunit to phosphatases, thereby inhibiting AMPK kinase activity. Surprisingly, PI3K-Akt signaling, which is a major anabolic signaling and normally inhibits GSK3 activity, promotes GSK3 phosphorylation and inhibition of AMPK, thus revealing how AMPK senses anabolic environments in addition to cellular energy levels. Consistently, disrupting GSK3 function within the AMPK complex sustains higher AMPK activity and cellular catabolic processes even under anabolic conditions, indicating that GSK3 acts as a critical sensor for anabolic signaling to regulate AMPK. PMID:23623684
A Role of a Newly Identified Isomerase From Yarrowia lipolytica in Erythritol Catabolism
Directory of Open Access Journals (Sweden)
Aleksandra M. Mirończuk
2018-05-01
Full Text Available Erythritol is a natural sweetener produced by microorganisms as an osmoprotectant. It belongs to the group of polyols and it can be utilized by the oleaginous yeast Yarrowia lipolytica. Despite the recent identification of the transcription factor of erythritol utilization (EUF1, the metabolic pathway of erythritol catabolism remains unknown. In this study we identified a new gene, YALI0F01628g, involved in erythritol assimilation. In silico analysis showed that YALI0F01628g is a putative isomerase and it is localized in the same region as EUF1. qRT-PCR analysis of Y. lipolytica showed a significant increase in YALI0F01628g expression during growth on erythritol and after overexpression of EUF1. Moreover, the deletion strain ΔF01628 showed significantly impaired erythritol assimilation, whereas synthesis of erythritol remained unchanged. The results showed that YALI0F1628g is involved in erythritol assimilation; thus we named the gene EYI1. Moreover, we suggest the metabolic pathway of erythritol assimilation in yeast Y. lipolytica.
Garzón-Ospina, Diego; Forero-Rodríguez, Johanna; Patarroyo, Manuel A
2014-12-13
The msp-7 gene has become differentially expanded in the Plasmodium genus; Plasmodium vivax has the highest copy number of this gene, several of which encode antigenic proteins in merozoites. DNA sequences from thirty-six Colombian clinical isolates from P. vivax (pv) msp-7E, -7F and -7L genes were analysed for characterizing and studying the genetic diversity of these pvmsp-7 members which are expressed during the intra-erythrocyte stage; natural selection signals producing the variation pattern so observed were evaluated. The pvmsp-7E gene was highly polymorphic compared to pvmsp-7F and pvmsp-7L which were seen to have limited genetic diversity; pvmsp-7E polymorphism was seen to have been maintained by different types of positive selection. Even though these copies seemed to be species-specific duplications, a search in the Plasmodium cynomolgi genome (P. vivax sister taxon) showed that both species shared the whole msp-7 repertoire. This led to exploring the long-term effect of natural selection by comparing the orthologous sequences which led to finding signatures for lineage-specific positive selection. The results confirmed that the P. vivax msp-7 family has a heterogeneous genetic diversity pattern; some members are highly conserved whilst others are highly diverse. The results suggested that the 3'-end of these genes encode MSP-7 proteins' functional region whilst the central region of pvmsp-7E has evolved rapidly. The lineage-specific positive selection signals found suggested that mutations occurring in msp-7s genes during host switch may have succeeded in adapting the ancestral P. vivax parasite population to humans.
Zea mI, the maize homolog of the allergen-encoding Lol pI gene of rye grass.
Broadwater, A H; Rubinstein, A L; Chay, C H; Klapper, D G; Bedinger, P A
1993-09-15
Sequence analysis of a pollen-specific cDNA from maize has identified a homolog (Zea mI) of the gene (Lol pI) encoding the major allergen of rye-grass pollen. The protein encoded by the partial cDNA sequence is 59.3% identical and 72.7% similar to the comparable region of the reported amino acid sequence of Lol pIA. Southern analysis indicates that this cDNA represents a member of a small multigene family in maize. Northern analysis shows expression only in pollen, not in vegetative or female floral tissues. The timing of expression is developmentally regulated, occurring at a low level prior to the first pollen mitosis and at a high level after this postmeiotic division. Western analysis detects a protein in maize pollen lysates using polyclonal antiserum and monoclonal antibodies directed against purified Lolium perenne allergen.
Directory of Open Access Journals (Sweden)
David H. Dreyfus
2017-01-01
Full Text Available Epstein-Barr virus, a ubiquitous human herpesvirus, is associated through epidemiologic evidence with common autoimmune syndromes and cancers. However, specific genetic mechanisms of pathogenesis have been difficult to identify. In this review, the author summarizes evidence that recently discovered noncoding RNAs termed microRNA encoded by Epstein-Barr virus BARF (BamHI A right frame termed BART (BamHI A right transcripts are modulators of human immune response genes and genome stability in infected and bystander cells. BART expression is apparently regulated by complex feedback loops with the host immune response regulatory NF-κB transcription factors. EBV-encoded BZLF-1 (ZEBRA protein could also regulate BART since ZEBRA contains a terminal region similar to ankyrin proteins such as IκBα that regulate host NF-κB. BALF-2 (BamHI A left frame transcript, a viral homologue of the immunoglobulin and T cell receptor gene recombinase RAG-1 (recombination-activating gene-1, may also be coregulated with BART since BALF-2 regulatory sequences are located near the BART locus. Viral-encoded microRNA and viral mRNA transferred to bystander cells through vesicles, defective viral particles, or other mechanisms suggest a new paradigm in which bystander or hit-and-run mechanisms enable the virus to transiently or chronically alter human immune response genes as well as the stability of the human genome.
Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G
2014-08-28
The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.
Vera-Cabrera, Lucio; Ortiz-Lopez, Rocio; Elizondo-Gonzalez, Ramiro; Ocampo-Candiani, Jorge
2013-01-01
Nocardia brasiliensis is an important etiologic agent of mycetoma. These bacteria live as a saprobe in soil or organic material and enter the tissue via minor trauma. Mycetoma is characterized by tumefaction and the production of fistula and abscesses, with no spontaneous cure. By using mass sequencing, we determined the complete genomic nucleotide sequence of the bacteria. According to our data, the genome is a circular chromosome 9,436,348-bp long with 68% G+C content that encodes 8,414 proteins. We observed orthologs for virulence factors, a higher number of genes involved in lipid biosynthesis and catabolism, and gene clusters for the synthesis of bioactive compounds, such as antibiotics, terpenes, and polyketides. An in silico analysis of the sequence supports the conclusion that the bacteria acquired diverse genes by horizontal transfer from other soil bacteria, even from eukaryotic organisms. The genome composition reflects the evolution of bacteria via the acquisition of a large amount of DNA, which allows it to survive in new ecological niches, including humans.
Directory of Open Access Journals (Sweden)
Lucio Vera-Cabrera
Full Text Available Nocardia brasiliensis is an important etiologic agent of mycetoma. These bacteria live as a saprobe in soil or organic material and enter the tissue via minor trauma. Mycetoma is characterized by tumefaction and the production of fistula and abscesses, with no spontaneous cure. By using mass sequencing, we determined the complete genomic nucleotide sequence of the bacteria. According to our data, the genome is a circular chromosome 9,436,348-bp long with 68% G+C content that encodes 8,414 proteins. We observed orthologs for virulence factors, a higher number of genes involved in lipid biosynthesis and catabolism, and gene clusters for the synthesis of bioactive compounds, such as antibiotics, terpenes, and polyketides. An in silico analysis of the sequence supports the conclusion that the bacteria acquired diverse genes by horizontal transfer from other soil bacteria, even from eukaryotic organisms. The genome composition reflects the evolution of bacteria via the acquisition of a large amount of DNA, which allows it to survive in new ecological niches, including humans.
Loebers, Andreas; Müller-Uri, Frieder; Kreis, Wolfgang
2014-03-01
The pungent taste of horseradish is caused by isothiocyanates which are released from glucosinolates by myrosinases. These enzymes are encoded by genes belonging to one of two subfamilies, termed MYR I and MYR II, respectively. A MYR II-type myrosinase gene was identified for the first time in horseradish. The gene termed ArMY2 was only expressed in young roots. A full-length cDNA encoding a myrosinase termed ArMy2 was isolated and heterologously expressed in Pichia pastoris. The recombinant His-tagged enzyme was characterized biochemically. Substrate affinity was 5 times higher towards gluconasturtiin than towards sinigrin. Gluconasturtiin was found to be the most abundant glucosinolate in young horseradish roots while sinigrin dominated in storage roots and leaves. This indicates that a specialized glucosinolate-myrosinase defense system might be active in young roots. Copyright © 2013 Elsevier Ltd. All rights reserved.
Directory of Open Access Journals (Sweden)
Yi-Li Li
2017-11-01
Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.
A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.
Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C
1994-02-01
We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.
Assier, E; Bouzinba-Segard, H; Stolzenberg, M C; Stephens, R; Bardos, J; Freemont, P; Charron, D; Trowsdale, J; Rich, T
1999-04-16
A novel human gene RED, and the murine homologue, MuRED, were cloned. These genes were named after the extensive stretch of alternating arginine (R) and glutamic acid (E) or aspartic acid (D) residues that they contain. We term this the 'RED' repeat. The genes of both species were expressed in a wide range of tissues and we have mapped the human gene to chromosome 5q22-24. MuRED and RED shared 98% sequence identity at the amino acid level. The open reading frame of both genes encodes a 557 amino acid protein. RED fused to a fluorescent tag was expressed in nuclei of transfected cells and localised to nuclear dots. Co-localisation studies showed that these nuclear dots did not contain either PML or Coilin, which are commonly found in the POD or coiled body nuclear compartments. Deletion of the amino terminal 265 amino acids resulted in a failure to sort efficiently to the nucleus, though nuclear dots were formed. Deletion of a further 50 amino acids from the amino terminus generates a protein that can sort to the nucleus but is unable to generate nuclear dots. Neither construct localised to the nucleolus. The characteristics of RED and its nuclear localisation implicate it as a regulatory protein, possibly involved in transcription.
Komeda, Hidenobu; Yamasaki-Yashiki, Shino; Hoshino, Kazuhiro; Asano, Yasuhisa
2014-11-01
D-Xylulokinase catalyzes the phosphorylation of D-xylulose in the final step of the pentose catabolic pathway to form d-xylulose-5-phosphate. The D-xylulokinase activity was found to be induced by both D-xylose and L-arabinose, as well as some of the other enzymes involved in the pentose catabolism, in the D-xylose-fermenting zygomycetous fungus, Mucor circinelloides NBRC 4572. The putative gene, xyl3, which may encode D-xylulokinase, was detected in the genome sequence of this strain. The amino acid sequence deduced from the gene was more similar to D-xylulokinases from an animal origin than from other fungi. The recombinant enzyme was purified from the E. coli transformant expressing xyl3 and then characterized. The ATP-dependent phosphorylative activity of the enzyme was the highest toward D-xylulose. Its kinetic parameters were determined as Km (D-xylulose) = 0.29 mM and Km (ATP) = 0.51 mM, indicating that the xyl3 gene encoded D-xylulokinase (McXK). Western blot analysis revealed that McXK was induced by L-arabinose as well as D-xylose and the induction was repressed in the presence of D-glucose, suggesting that the enzyme may be involved in the catabolism of D-xylose and L-arabinose and is subject to carbon catabolite repression in this fungus. This is the first study on D-xylulokinase from zygomycetous fungi. © 2014 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.
Grimm, Frauke; Dobler, Nadine; Dahl, Christiane
2010-03-01
Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.
Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas
2013-09-01
GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.
Directory of Open Access Journals (Sweden)
Mohsen Heidary
2017-03-01
Full Text Available Abstract Background and Objectives: Increasing emergence of fluoroquinolone resistance among clinical isolates of Klebsiella pneumoniae (K. pneumoniae, has limited the treatment options for treatment of infections caused by these bacteria. The aim of this study was to investigate the dissemination of genes encoding AcrAB and QepA efflux pumps among K. pneumoniae strains. Methods: This study was carried out on 117 K. pneumoniae strains isolated from patients hospitalized in selected hospitals in Tehran city, 2015-2016, Iran. Antimicrobial susceptibility tests were performed using disk diffusion method (based on CLSI guidelines and identification of acr A, acr B and qep A genes using PCR assay. Results: In this study, colistin and tigecycline had the best effect against clinical isolates of K. pneumoniae. According to PCR results, 110 (94% isolates had acrA gene and 102 (87% isolates had acrB gene, respectively. The qepA gene was not found in any of the K. pneumoniae strains. Conclusion: According to the results of the present study, dissemination of the genes encoding AcrAB efflux pumps among K. pneumoniae strains, which cause resistance to fluoroquinolones, is a matter of concern. Therefore, infection control and prevention of the spread of drug-resistant bacteria requires careful management in drug prescription and identification of resistant isolates.
Taxon- and Site-Specific Melatonin Catabolism
Directory of Open Access Journals (Sweden)
Rüdiger Hardeland
2017-11-01
Full Text Available Melatonin is catabolized both enzymatically and nonenzymatically. Nonenzymatic processes mediated by free radicals, singlet oxygen, other reactive intermediates such as HOCl and peroxynitrite, or pseudoenzymatic mechanisms are not species- or tissue-specific, but vary considerably in their extent. Higher rates of nonenzymatic melatonin metabolism can be expected upon UV exposure, e.g., in plants and in the human skin. Additionally, melatonin is more strongly nonenzymatically degraded at sites of inflammation. Typical products are several hydroxylated derivatives of melatonin and N1-acetyl-N2-formyl-5-methoxykynuramine (AFMK. Most of these products are also formed by enzymatic catalysis. Considerable taxon- and site-specific differences are observed in the main enzymatic routes of catabolism. Formation of 6-hydroxymelatonin by cytochrome P450 subforms are prevailing in vertebrates, predominantly in the liver, but also in the brain. In pineal gland and non-mammalian retina, deacetylation to 5-methoxytryptamine (5-MT plays a certain role. This pathway is quantitatively prevalent in dinoflagellates, in which 5-MT induces cyst formation and is further converted to 5-methoxyindole-3-acetic acid, an end product released to the water. In plants, the major route is catalyzed by melatonin 2-hydroxylase, whose product is tautomerized to 3-acetamidoethyl-3-hydroxy-5-methoxyindolin-2-one (AMIO, which exceeds the levels of melatonin. Formation and properties of various secondary products are discussed.
2010-01-01
Background Carbonic anhydrase (CA) is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs) are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam) has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1). Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration. PMID:20598158
Directory of Open Access Journals (Sweden)
Mishra Mukti N
2010-07-01
Full Text Available Abstract Background Carbonic anhydrase (CA is a ubiquitous enzyme catalyzing the reversible hydration of CO2 to bicarbonate, a reaction underlying diverse biochemical and physiological processes. Gamma class carbonic anhydrases (γ-CAs are widespread in prokaryotes but their physiological roles remain elusive. At present, only γ-CA of Methanosarcina thermophila (Cam has been shown to have CA activity. Genome analysis of a rhizobacterium Azospirillum brasilense, revealed occurrence of ORFs encoding one β-CA and two γ-CAs. Results One of the putative γ-CA encoding genes of A. brasilense was cloned and overexpressed in E. coli. Electrometric assays for CA activity of the whole cell extracts overexpressing recombinant GCA1 did not show CO2 hydration activity. Reverse transcription-PCR analysis indicated that gca1 in A. brasilense is co-transcribed with its upstream gene annotated as argC, which encodes a putative N-acetyl-γ-glutamate-phosphate reductase. 5'-RACE also demonstrated that there was no transcription start site between argC and gca1, and the transcription start site located upstream of argC transcribed both the genes (argC-gca1. Using transcriptional fusions of argC-gca1 upstream region with promoterless lacZ, we further demonstrated that gca1 upstream region did not have any promoter and its transcription occurred from a promoter located in the argC upstream region. The transcription of argC-gca1 operon was upregulated in stationary phase and at elevated CO2 atmosphere. Conclusions This study shows lack of CO2 hydration activity in a recombinant protein expressed from a gene predicted to encode a γ-carbonic anhydrase in A. brasilense although it cross reacts with anti-Cam antibody raised against a well characterized γ-CA. The organization and regulation of this gene along with the putative argC gene suggests its involvement in arginine biosynthetic pathway instead of the predicted CO2 hydration.
Isolation and expression analysis of FTZ-F1 encoding gene of black rock fish ( Sebastes schlegelii)
Shafi, Muhammad; Wang, Yanan; Zhou, Xiaosu; Ma, Liman; Muhammad, Faiz; Qi, Jie; Zhang, Quanqi
2013-03-01
Sex related FTZ-F1 is a transcriptional factor regulating the expression of fushi tarazu (a member of the orphan nuclear receptors) gene. In this study, FTZ-F1 gene ( FTZ-F1) was isolated from the testis of black rockfish ( Sebastes schlegeli) by homology cloning. The full-length cDNA of S. schlegeli FTZ-F1 ( ssFTZ-F1) contained a 232bp 5' UTR, a 1449bp ORF encoding FTZ-F1 (482 amino acid residules in length) with an estimated molecular weight of 5.4kD and a 105bp 3' UTR. Sequence, tissue distribution and phylogenic analysis showed that ssFTZ-F1 belonged to FTZ group, holding highly conserved regions including I, II and III FTZ-F1 boxes and an AF-2 hexamer. Relatively high expression was observed at different larva stages. In juveniles (105 days old), the transcript of ssFTZ-F1 can be detected in all tissues and the abuncance of the gene transcript in testis, ovary, spleen and brain was higher than that in other tissues. In mature fish, the abundance of gene transcript was higher in testis, ovary, spleen and brain than that in liver (trace amount), and the gene was not transcribed in other tissues. The highest abundance of gene transcript was always observed in gonads of both juvenile and mature fish. In addition, the abundance of gene transcript in male tissues were higher than that in female tissue counterparts ( P<0.05).
Scorpio, A; Zhang, Y
1996-06-01
Naturally pyrazinamide (PZA)-resistant Mycobacterium bovis and acquired PZA-resistant M. tuberculosis strains lose pyrazinamidase (PZase). To investigate the molecular mechanism of PZA resistance, we have cloned the gene (pncA) encoding M. tuberculosis PZase. Mutations in pncA were identified in both types of PZA-resistant strains, and transformation of these strains with a functional pncA gene restored PZase activity and PZA susceptibility. These findings, besides providing the basis for understanding how PZA works, should have implications for rapid detection of PZA-resistant clinical isolates of M. tuberculosis and also for rapid differentiation of M. bovis from M. tuberculosis strains.
Hexaploid wheat (Triticum aestivum L.) contains at least 23 TaPr-1 genes encoding the group 1 pathogenesis-related (PR-1) proteins as identified in our previous work. Here we report the cloning and characterization of TaPr-1-rk1 and TaPr-1-rk2, two novel genes closely related to the wheat PR-1 famil...
DEFF Research Database (Denmark)
Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner
2014-01-01
. In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...
Alazi, Ebru; Knetsch, Tim; Di Falco, Marcos; Reid, Ian D; Arentshorst, Mark; Visser, Jaap; Tsang, Adrian; Ram, Arthur F J
2018-03-01
The transcription factor GaaR is needed for the expression of genes required for pectin degradation and transport and catabolism of the main degradation product, D-galacturonic acid (GA) in Aspergillus niger. In this study, we used the strong constitutive gpdA promoter of Aspergillus nidulans to overexpress gaaR in A. niger. Overexpression of gaaR resulted in an increased transcription of the genes encoding pectinases, (putative) GA transporters, and catabolic pathway enzymes even under non-inducing conditions, i.e., in the absence of GA. Exoproteome analysis of a strain overexpressing gaaR showed that this strain secretes highly elevated levels of pectinases when grown in fructose. The genes encoding exo-polygalacturonases were found to be subjected to CreA-mediated carbon catabolite repression, even in the presence of fructose. Deletion of creA in the strain overexpressing gaaR resulted in a further increase in pectinase production in fructose. We showed that GaaR localizes mainly in the nucleus regardless of the presence of an inducer, and that overexpression of gaaR leads to an increased concentration of GaaR in the nucleus.
The dynamic landscape of gene regulation during Bombyx mori oogenesis.
Zhang, Qiang; Sun, Wei; Sun, Bang-Yong; Xiao, Yang; Zhang, Ze
2017-09-11
Oogenesis in the domestic silkworm (Bombyx mori) is a complex process involving previtellogenesis, vitellogenesis and choriogenesis. During this process, follicles show drastic morphological and physiological changes. However, the genome-wide regulatory profiles of gene expression during oogenesis remain to be determined. In this study, we obtained time-series transcriptome data and used these data to reveal the dynamic landscape of gene regulation during oogenesis. A total of 1932 genes were identified to be differentially expressed among different stages, most of which occurred during the transition from late vitellogenesis to early choriogenesis. Using weighted gene co-expression network analysis, we identified six stage-specific gene modules that correspond to multiple regulatory pathways. Strikingly, the biosynthesis pathway of the molting hormone 20-hydroxyecdysone (20E) was enriched in one of the modules. Further analysis showed that the ecdysteroid 20-hydroxylase gene (CYP314A1) of steroidgenesis genes was mainly expressed in previtellogenesis and early vitellogenesis. However, the 20E-inactivated genes, particularly the ecdysteroid 26-hydroxylase encoding gene (Cyp18a1), were highly expressed in late vitellogenesis. These distinct expression patterns between 20E synthesis and catabolism-related genes might ensure the rapid decline of the hormone titer at the transition point from vitellogenesis to choriogenesis. In addition, we compared landscapes of gene regulation between silkworm (Lepidoptera) and fruit fly (Diptera) oogeneses. Our results show that there is some consensus in the modules of gene co-expression during oogenesis in these insects. The data presented in this study provide new insights into the regulatory mechanisms underlying oogenesis in insects with polytrophic meroistic ovaries. The results also provide clues for further investigating the roles of epigenetic reconfiguration and circadian rhythm in insect oogenesis.
Liszewska, Frantz; Gaganidze, Dali; Sirko, Agnieszka
2005-01-01
We applied the yeast two-hybrid system for screening of a cDNA library of Nicotiana plumbaginifolia for clones encoding plant proteins interacting with two proteins of Escherichia coli: serine acetyltransferase (SAT, the product of cysE gene) and O-acetylserine (thiol)lyase A, also termed cysteine synthase (OASTL-A, the product of cysK gene). Two plant cDNA clones were identified when using the cysE gene as a bait. These clones encode a probable cytosolic isoform of OASTL and an organellar isoform of SAT, respectively, as indicated by evolutionary trees. The second clone, encoding SAT, was identified independently also as a "prey" when using cysK as a bait. Our results reveal the possibility of applying the two-hybrid system for cloning of plant cDNAs encoding enzymes of the cysteine synthase complex in the two-hybrid system. Additionally, using genome walking sequences located upstream of the sat1 cDNA were identified. Subsequently, in silico analyses were performed aiming towards identification of the potential signal peptide and possible location of the deduced mature protein encoded by sat1.
Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu
2014-01-01
In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial
Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B
2012-08-01
The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.
Xue, Peipei; Zeng, Fanfan; Duan, Qiuhong; Xiao, Juanjuan; Liu, Lin; Yuan, Ping; Fan, Linni; Sun, Huimin; Malyarenko, Olesya S; Lu, Hui; Xiu, Ruijuan; Liu, Shaoqing; Shao, Chen; Zhang, Jianmin; Yan, Wei; Wang, Zhe; Zheng, Jianyong; Zhu, Feng
2017-06-01
Branched-chain amino acids catabolism plays an important role in human cancers. Colorectal cancer is the third most commonly diagnosed cancer in males and the second in females, and the new global incidence is over 1.2 million cases. The branched-chain α-keto acid dehydrogenase kinase (BCKDK) is a rate-limiting enzyme in branched-chain amino acids catabolism, which plays an important role in many serious human diseases. Here we investigated that abnormal branched-chain amino acids catabolism in colorectal cancer is a result of the disease process, with no role in disease initiation; BCKDK is widely expressed in colorectal cancer patients, and those patients that express higher levels of BCKDK have shorter survival times than those with lower levels; BCKDK promotes cell transformation or colorectal cancer ex vivo or in vivo. Mechanistically, BCKDK promotes colorectal cancer by enhancing the MAPK signaling pathway through direct MEK phosphorylation, rather than by branched-chain amino acids catabolism. And the process above could be inhibited by a BCKDK inhibitor, phenyl butyrate. Copyright © 2017 The Authors. Published by Elsevier B.V. All rights reserved.
Directory of Open Access Journals (Sweden)
Peipei Xue
2017-06-01
Full Text Available Branched-chain amino acids catabolism plays an important role in human cancers. Colorectal cancer is the third most commonly diagnosed cancer in males and the second in females, and the new global incidence is over 1.2 million cases. The branched-chain α-keto acid dehydrogenase kinase (BCKDK is a rate-limiting enzyme in branched-chain amino acids catabolism, which plays an important role in many serious human diseases. Here we investigated that abnormal branched-chain amino acids catabolism in colorectal cancer is a result of the disease process, with no role in disease initiation; BCKDK is widely expressed in colorectal cancer patients, and those patients that express higher levels of BCKDK have shorter survival times than those with lower levels; BCKDK promotes cell transformation or colorectal cancer ex vivo or in vivo. Mechanistically, BCKDK promotes colorectal cancer by enhancing the MAPK signaling pathway through direct MEK phosphorylation, rather than by branched-chain amino acids catabolism. And the process above could be inhibited by a BCKDK inhibitor, phenyl butyrate.
Manzanares, P.; Orejas, M.; Vicente Gil, J.; Graaff, de L.H.; Visser, J.; Ramon, D.
2003-01-01
The Aspergillus aculeatus rhaA gene encoding an alpha-L-rhamnosidase has been expressed in both laboratory and industrial wine yeast strains. Wines produced in microvinifications, conducted using a combination of the genetically modified industrial strain expressing rhaA and another strain
Directory of Open Access Journals (Sweden)
C Sangavai
2017-12-01
Full Text Available Model-driven systems engineering has been more fascinating process for the microbial production of biofuel and bio-refineries in chemical and pharmaceutical industries. Genome-scale modeling and simulations have been guided for metabolic engineering of Clostridium species for the production of organic solvents and organic acids. Among them, Clostridium sticklandii is one of the potential organisms to be exploited as a microbial cell factory for biofuel production. It is a hyper-ammonia producing bacterium and is able to catabolize amino acids as important carbon and energy sources via Stickland reactions and the development of the specific pathways. Current genomic and metabolic aspects of this bacterium are comprehensively reviewed herein, which provided information for learning about protein catabolism-directed biofuel production. It has a metabolic potential to drive energy and direct solventogenesis as well as acidogenesis from protein catabolism. It produces by-products such as ethanol, acetate, n-butanol, n-butyrate and hydrogen from amino acid catabolism. Model-driven systems engineering of this organism would improve the performance of the industrial sectors and enhance the industrial economy by using protein-based waste in environment-friendly ways. Keywords: Biofuel, Amino acid catabolism, Genome-scale model, Metabolic engineering, Systems biology, ABE fermentation, Clostridium sticklandii
Identification and validation of human papillomavirus encoded microRNAs.
Directory of Open Access Journals (Sweden)
Kui Qian
Full Text Available We report here identification and validation of the first papillomavirus encoded microRNAs expressed in human cervical lesions and cell lines. We established small RNA libraries from ten human papillomavirus associated cervical lesions including cancer and two human papillomavirus harboring cell lines. These libraries were sequenced using SOLiD 4 technology. We used the sequencing data to predict putative viral microRNAs and discovered nine putative papillomavirus encoded microRNAs. Validation was performed for five candidates, four of which were successfully validated by qPCR from cervical tissue samples and cell lines: two were encoded by HPV 16, one by HPV 38 and one by HPV 68. The expression of HPV 16 microRNAs was further confirmed by in situ hybridization, and colocalization with p16INK4A was established. Prediction of cellular target genes of HPV 16 encoded microRNAs suggests that they may play a role in cell cycle, immune functions, cell adhesion and migration, development, and cancer. Two putative viral target sites for the two validated HPV 16 miRNAs were mapped to the E5 gene, one in the E1 gene, two in the L1 gene and one in the LCR region. This is the first report to show that papillomaviruses encode their own microRNA species. Importantly, microRNAs were found in libraries established from human cervical disease and carcinoma cell lines, and their expression was confirmed in additional tissue samples. To our knowledge, this is also the first paper to use in situ hybridization to show the expression of a viral microRNA in human tissue.
Hinds, Terry D; Peck, Bailey; Shek, Evan; Stroup, Steven; Hinson, Jennifer; Arthur, Susan; Marino, Joseph S
2016-02-11
Unlike the glucocorticoid receptor α (GRα), GR β (GRβ) has a truncated ligand-binding domain that prevents glucocorticoid binding, implicating GRα as the mediator of glucocorticoid-induced skeletal muscle loss. Because GRβ causes glucocorticoid resistance, targeting GRβ may be beneficial in impairing muscle loss as a result of GRα activity. The purpose of this study was to determine how the overexpression of GRβ affects myotube formation and dexamethasone (Dex) responsiveness. We measured GR isoform expression in C₂C12 muscle cells in response to Dex and insulin, and through four days of myotube formation. Next, lentiviral-mediated overexpression of GRβ in C₂C12 was performed, and these cells were characterized for cell fusion and myotube formation, as well as sensitivity to Dex via the expression of ubiquitin ligases. GRβ overexpression increased mRNA levels of muscle regulatory factors and enhanced proliferation in myoblasts. GRβ overexpressing myotubes had an increased fusion index. Myotubes overexpressing GRβ had lower forkhead box O3 (Foxo3a) mRNA levels and a blunted muscle atrophy F-box/Atrogen-1 (MAFbx) and muscle ring finger 1 (MuRF1) response to Dex. We showed that GRβ may serve as a pharmacological target for skeletal muscle growth and protection from glucocorticoid-induced catabolic signaling. Increasing GRβ levels in skeletal muscle may cause a state of glucocorticoid resistance, stabilizing muscle mass during exposure to high doses of glucocorticoids.
Directory of Open Access Journals (Sweden)
Terry D. Hinds
2016-02-01
Full Text Available Unlike the glucocorticoid receptor α (GRα, GR β (GRβ has a truncated ligand-binding domain that prevents glucocorticoid binding, implicating GRα as the mediator of glucocorticoid-induced skeletal muscle loss. Because GRβ causes glucocorticoid resistance, targeting GRβ may be beneficial in impairing muscle loss as a result of GRα activity. The purpose of this study was to determine how the overexpression of GRβ affects myotube formation and dexamethasone (Dex responsiveness. We measured GR isoform expression in C2C12 muscle cells in response to Dex and insulin, and through four days of myotube formation. Next, lentiviral-mediated overexpression of GRβ in C2C12 was performed, and these cells were characterized for cell fusion and myotube formation, as well as sensitivity to Dex via the expression of ubiquitin ligases. GRβ overexpression increased mRNA levels of muscle regulatory factors and enhanced proliferation in myoblasts. GRβ overexpressing myotubes had an increased fusion index. Myotubes overexpressing GRβ had lower forkhead box O3 (Foxo3a mRNA levels and a blunted muscle atrophy F-box/Atrogen-1 (MAFbx and muscle ring finger 1 (MuRF1 response to Dex. We showed that GRβ may serve as a pharmacological target for skeletal muscle growth and protection from glucocorticoid-induced catabolic signaling. Increasing GRβ levels in skeletal muscle may cause a state of glucocorticoid resistance, stabilizing muscle mass during exposure to high doses of glucocorticoids.
Directory of Open Access Journals (Sweden)
Sandro Roselli
Full Text Available Chloromethane (CH3Cl is the most abundant volatile halocarbon in the atmosphere and contributes to the destruction of stratospheric ozone. The only known pathway for bacterial chloromethane utilization (cmu was characterized in Methylobacterium extorquens CM4, a methylotrophic bacterium able to utilize compounds without carbon-carbon bonds such as methanol and chloromethane as the sole carbon source for growth. Previous work demonstrated that tetrahydrofolate and vitamin B12 are essential cofactors of cmuA- and cmuB-encoded methyltransferases of chloromethane dehalogenase, and that the pathway for chloromethane utilization is distinct from that for methanol. This work reports genomic and proteomic data demonstrating that cognate cmu genes are located on the 380 kb pCMU01 plasmid, which drives the previously defined pathway for tetrahydrofolate-mediated chloromethane dehalogenation. Comparison of complete genome sequences of strain CM4 and that of four other M. extorquens strains unable to grow with chloromethane showed that plasmid pCMU01 harbors unique genes without homologs in the compared genomes (bluB2, btuB, cobA, cbiD, as well as 13 duplicated genes with homologs of chromosome-borne genes involved in vitamin B12-associated biosynthesis and transport, or in tetrahydrofolate-dependent metabolism (folC2. In addition, the presence of both chromosomal and plasmid-borne genes for corrinoid salvaging pathways may ensure corrinoid coenzyme supply in challenging environments. Proteomes of M. extorquens CM4 grown with one-carbon substrates chloromethane and methanol were compared. Of the 49 proteins with differential abundance identified, only five (CmuA, CmuB, PurU, CobH2 and a PaaE-like uncharacterized putative oxidoreductase are encoded by the pCMU01 plasmid. The mainly chromosome-encoded response to chloromethane involves gene clusters associated with oxidative stress, production of reducing equivalents (PntAA, Nuo complex, conversion of
Yang, Qin; He, Yijian; Kabahuma, Mercy; Chaya, Timothy; Kelly, Amy; Borrego, Eli; Bian, Yang; El Kasmi, Farid; Yang, Li; Teixeira, Paulo; Kolkman, Judith; Nelson, Rebecca; Kolomiets, Michael; L Dangl, Jeffery; Wisser, Randall; Caplan, Jeffrey; Li, Xu; Lauter, Nick; Balint-Kurti, Peter
2017-09-01
Alleles that confer multiple disease resistance (MDR) are valuable in crop improvement, although the molecular mechanisms underlying their functions remain largely unknown. A quantitative trait locus, qMdr 9.02 , associated with resistance to three important foliar maize diseases-southern leaf blight, gray leaf spot and northern leaf blight-has been identified on maize chromosome 9. Through fine-mapping, association analysis, expression analysis, insertional mutagenesis and transgenic validation, we demonstrate that ZmCCoAOMT2, which encodes a caffeoyl-CoA O-methyltransferase associated with the phenylpropanoid pathway and lignin production, is the gene within qMdr 9.02 conferring quantitative resistance to both southern leaf blight and gray leaf spot. We suggest that resistance might be caused by allelic variation at the level of both gene expression and amino acid sequence, thus resulting in differences in levels of lignin and other metabolites of the phenylpropanoid pathway and regulation of programmed cell death.
Zhu, Yongyou; Nomura, Takahito; Xu, Yonghan; Zhang, Yingying; Peng, Yu; Mao, Bizeng; Hanada, Atsushi; Zhou, Haicheng; Wang, Renxiao; Li, Peijin; Zhu, Xudong; Mander, Lewis N.; Kamiya, Yuji; Yamaguchi, Shinjiro; He, Zuhua
2006-01-01
The recessive tall rice (Oryza sativa) mutant elongated uppermost internode (eui) is morphologically normal until its final internode elongates drastically at the heading stage. The stage-specific developmental effect of the eui mutation has been used in the breeding of hybrid rice to improve the performance of heading in male sterile cultivars. We found that the eui mutant accumulated exceptionally large amounts of biologically active gibberellins (GAs) in the uppermost internode. Map-based cloning revealed that the Eui gene encodes a previously uncharacterized cytochrome P450 monooxygenase, CYP714D1. Using heterologous expression in yeast, we found that EUI catalyzed 16α,17-epoxidation of non-13-hydroxylated GAs. Consistent with the tall and dwarfed phenotypes of the eui mutant and Eui-overexpressing transgenic plants, respectively, 16α,17-epoxidation reduced the biological activity of GA4 in rice, demonstrating that EUI functions as a GA-deactivating enzyme. Expression of Eui appeared tightly regulated during plant development, in agreement with the stage-specific eui phenotypes. These results indicate the existence of an unrecognized pathway for GA deactivation by EUI during the growth of wild-type internodes. The identification of Eui as a GA catabolism gene provides additional evidence that the GA metabolism pathway is a useful target for increasing the agronomic value of crops. PMID:16399803
DEFF Research Database (Denmark)
Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven
2017-01-01
The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...
Directory of Open Access Journals (Sweden)
Wang Yu
2011-04-01
Full Text Available Abstract Background In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV, the causative agent of duck viral enteritis (DVE, the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. Results DEV UL15 consists of two exons with a 3.5 kilobases (kb inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa, whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s in the cytoplasm at 6 h post infection (h p. i. and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s in the cytoplasm in the absence of any other viral protein. Conclusions DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15
Zhu, Hongwei; Li, Huixin; Han, Zongxi; Shao, Yuhao; Wang, Yu; Kong, Xiangang
2011-04-06
In herpesviruses, UL15 homologue is a subunit of terminase complex responsible for cleavage and packaging of the viral genome into pre-assembled capsids. However, for duck enteritis virus (DEV), the causative agent of duck viral enteritis (DVE), the genomic sequence was not completely determined until most recently. There is limited information of this putative spliced gene and its encoding protein. DEV UL15 consists of two exons with a 3.5 kilobases (kb) inron and transcribes into two transcripts: the full-length UL15 and an N-terminally truncated UL15.5. The 2.9 kb UL15 transcript encodes a protein of 739 amino acids with an approximate molecular mass of 82 kiloDaltons (kDa), whereas the UL15.5 transcript is 1.3 kb in length, containing a putative 888 base pairs (bp) ORF that encodes a 32 kDa product. We also demonstrated that UL15 gene belonged to the late kinetic class as its expression was sensitive to cycloheximide and phosphonoacetic acid. UL15 is highly conserved within the Herpesviridae, and contains Walker A and B motifs homologous to the catalytic subunit of the bacteriophage terminase as revealed by sequence analysis. Phylogenetic tree constructed with the amino acid sequences of 23 herpesvirus UL15 homologues suggests a close relationship of DEV to the Mardivirus genus within the Alphaherpesvirinae. Further, the UL15 and UL15.5 proteins can be detected in the infected cell lysate but not in the sucrose density gradient-purified virion when reacting with the antiserum against UL15. Within the CEF cells, the UL15 and/or UL15.5 localize(s) in the cytoplasm at 6 h post infection (h p. i.) and mainly in the nucleus at 12 h p. i. and at 24 h p. i., while accumulate(s) in the cytoplasm in the absence of any other viral protein. DEV UL15 is a spliced gene that encodes two products encoded by 2.9 and 1.3 kb transcripts respectively. The UL15 is expressed late during infection. The coding sequences of DEV UL15 are very similar to those of alphaherpesviruses and
Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua
2017-01-01
Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.
Metabolic control analysis of Aspergillus niger L-arabinose catabolism
Groot, de M.J.L.; Prathumpai, W.; Visser, J.; Ruijter, G.J.G.
2005-01-01
A mathematical model of the L-arabinose/D-xylose catabolic pathway of Aspergillus niger was constructed based on the kinetic properties of the enzymes. For this purpose L-arabinose reductase, L-arabitol dehydrogenase and D-xylose reductase were purified using dye-affinity chromatography, and their
Regulation of crp gene expression by the catabolite repressor/activator, Cra, in Escherichia coli.
Zhang, Zhongge; Aboulwafa, Mohammad; Saier, Milton H
2014-01-01
Growth of E. coli on several carbon sources is dependent on the catabolite repressor/activator (Cra) protein although a Cra consensus DNA-binding site is not present in the control regions of the relevant catabolic operons. We show that Cra regulates growth by activating expression of the crp gene. It thereby mediates catabolite repression of catabolic operons by an indirect mechanism. © 2014 S. Karger AG, Basel.
Transcriptomic profile of aguR deletion mutant of Lactococcus lactis subsp. cremoris CECT 8666
del Rio, Beatriz; Linares, Daniel M.; Redruello, Begoña; Martin, Maria Cruz; Fernandez, Maria; de Jong, Anne; Kuipers, Oscar P.; Ladero, Victor; Alvarez, Miguel A.
2015-01-01
Lactococcus lactis subsp. cremoris CECT 8666 (formerly GE2-14) is a dairy strain that catabolizes agmatine (a decarboxylated derivative of arginine) into the biogenic amine putrescine by the agmatine deiminase (AGDI) pathway [1]. The AGDI cluster of L. lactis is composed by five genes aguR, aguB, aguD, aguA and aguC. The last four genes are responsible for the deamination of agmatine to putrescine and are co-transcribed as a single policistronic mRNA forming the catabolic operon aguBDAC[1]. aguR encodes a transmembrane protein that functions as a one-component signal transduction system that senses the agmatine concentration of the medium and accordingly regulates the transcription of aguBDAC[2], which is also transcriptionally regulated by carbon catabolic repression (CCR) via glucose, but not by other sugars such as lactose and galactose [1], [3]. Here we report the transcriptional profiling of the aguR gene deletion mutant (L. lactis subsp. cremoris CECT 8666 ∆aguR) [2] compared to the wild type strain, both grown in M17 medium with galactose as carbon source and supplemented with agmatine. The transcriptional profiling data of AguR-regulated genes were deposited in the Gene Expression Omnibus (GEO) database under accession no. GSE59514. PMID:26697381
Transcriptomic profile of aguR deletion mutant of Lactococcus lactis subsp. cremoris CECT 8666
Directory of Open Access Journals (Sweden)
Beatriz del Rio
2015-12-01
Full Text Available Lactococcus lactis subsp. cremoris CECT 8666 (formerly GE2-14 is a dairy strain that catabolizes agmatine (a decarboxylated derivative of arginine into the biogenic amine putrescine by the agmatine deiminase (AGDI pathway [1]. The AGDI cluster of L. lactis is composed by five genes aguR, aguB, aguD, aguA and aguC. The last four genes are responsible for the deamination of agmatine to putrescine and are co-transcribed as a single policistronic mRNA forming the catabolic operon aguBDAC [1]. aguR encodes a transmembrane protein that functions as a one-component signal transduction system that senses the agmatine concentration of the medium and accordingly regulates the transcription of aguBDAC [2], which is also transcriptionally regulated by carbon catabolic repression (CCR via glucose, but not by other sugars such as lactose and galactose [1,3]. Here we report the transcriptional profiling of the aguR gene deletion mutant (L. lactis subsp. cremoris CECT 8666 ∆aguR [2] compared to the wild type strain, both grown in M17 medium with galactose as carbon source and supplemented with agmatine. The transcriptional profiling data of AguR-regulated genes were deposited in the Gene Expression Omnibus (GEO database under accession no. GSE59514.
International Nuclear Information System (INIS)
Reich, N.; Evans, B.; Levy, D.; Fahey, D.; Knight, E. Jr.; Darnell, J.E. Jr.
1987-01-01
A human gene encoding an interferon-induced 15-kDa protein has been isolated from a genomic library. The gene appears to be single-copy and is composed of two exons, the first of which contains the ATG translation initiation codon. In vitro nuclear run-on assays showed that the transcription rate of the gene is stimulated after interferon treatment. To analyze transcriptional regulatory sequences, the authors constructed recombinant plasmids for use in transient transfection assays of HeLa cells. Constructs containing 115 nucleotides 5' to the transcription initiation site were found to be fully inducible by interferon. Assays of deletion mutants identified a critical element for interferon induction located between -115 and -96, just upstream of the CCAAT box. Moreover, a DNA fragment including this region can confer interferon inducibility on a heterologous promoter (thymidine kinase) when cloned in either orientation upstream of the gene or downstream of the gene. These are properties characteristic of an enhancer element that is active only after treatment with interferon. This regulatory sequence may be shared by a group of interferon-induced genes, since a very similar sequence is present within the functional region near the RNA start site of another interferon-induced gene
Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.
Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa
2005-06-01
We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.
Directory of Open Access Journals (Sweden)
Aleksandr A. Arzamasov
2018-04-01
Full Text Available Members of the genus Bifidobacterium are common inhabitants of the human gastrointestinal tract. Previously it was shown that arabino-oligosaccharides (AOS might act as prebiotics and stimulate the bifidobacterial growth in the gut. However, despite the rapid accumulation of genomic data, the precise mechanisms by which these sugars are utilized and associated transcription control still remain unclear. In the current study, we used a comparative genomic approach to reconstruct arabinose and AOS utilization pathways in over 40 bacterial species belonging to the Bifidobacteriaceae family. The results indicate that the gene repertoire involved in the catabolism of these sugars is highly diverse, and even phylogenetically close species may differ in their utilization capabilities. Using bioinformatics analysis we identified potential DNA-binding motifs and reconstructed putative regulons for the arabinose and AOS utilization genes in the Bifidobacteriaceae genomes. Six LacI-family transcriptional factors (named AbfR, AauR, AauU1, AauU2, BauR1 and BauR2 and a TetR-family regulator (XsaR presumably act as local repressors for AOS utilization genes encoding various α- or β-L-arabinofuranosidases and predicted AOS transporters. The ROK-family regulator AraU and the LacI-family regulator AraQ control adjacent operons encoding putative arabinose transporters and catabolic enzymes, respectively. However, the AraQ regulator is universally present in all Bifidobacterium species including those lacking the arabinose catabolic genes araBDA, suggesting its control of other genes. Comparative genomic analyses of prospective AraQ-binding sites allowed the reconstruction of AraQ regulons and a proposed binary repression/activation mechanism. The conserved core of reconstructed AraQ regulons in bifidobacteria includes araBDA, as well as genes from the central glycolytic and fermentation pathways (pyk, eno, gap, tkt, tal, galM, ldh. The current study expands the
Buist, Girbe; Kok, Jan; Leenhouts, Kees J.; Dabrowska, Magdalena; Venema, Gerhardus; Haandrikman, Alfred J.
A gene of Lactococcus lactis subsp, cremoris MG1363 encoding a peptidoglycan hydrolase was identified in a genomic library of the strain in pUC19 by screening Escherichia coli transformants for cell wall lysis activity on a medium containing autoclaved, lyophilized Micrococcus lysodeikticus cells,
Loughlin, J; Irven, C; Hardwick, L J; Butcher, S; Walsh, S; Wordsworth, P; Sykes, B
1995-09-01
Ehlers-Danlos syndrome (EDS) is a group of heritable disorders of connective tissue with skin, ligaments and blood vessels being the main sites affected. The commonest variant (EDS II) exhibits an autosomal dominant mode of inheritance and is characterized by joint hypermobility, cigarette paper scars, lax skin and excessive bruising. As yet no gene has been linked to EDS II, nor has linkage been established to a specific region of the genome. However, several candidate genes encoding proteins of the extracellular matrix have been excluded. Using an intragenic simple sequence repeat polymorphism, we report linkage of the COL5A1 gene, which encodes the alpha 1(V) chain of type V collagen, to EDS II. A maximum LOD score (Zmax) for linkage of 8.3 at theta = 0.00 was generated for a single large pedigree.
Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.
Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe
2016-11-15
Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide
International Nuclear Information System (INIS)
Cowan, A.K.; Railton, I.D.
1987-01-01
Excised light-grown leaves and etiolated leaves of Hordeum vulgare L. cv Dyan catabolized applied (+/-)-[2- 14 C]abscisic acid ([+/-]-[2- 14 C]ABA) to phaseic acid (PA), dihydrophaseic acid (DPA), and 2'-hydroxymethyl ABA (2'-HMABA). Identification of these catabolites was made by microchemical methods and by combined capillary gas chromatography-mass spectrometry (GC-MS) following high dose feeds of nonlabeled substrate to leaves. Circular dichroism analysis revealed that 2'-HMABA was derived from the (-) enantiomer of ABA. Refeeding studies were used to confirm the catabolic route. The methyl ester of (+/-)-[2 14 C]-ABA was hydrolyzed efficiently by light-grown leaves of H. vulgare. Leaf age played a significant role in (+/-)-ABA catabolism, with younger leaves being less able than their older counterparts to catabolize this compound. The catabolism of (+/-)-ABA was inhibited markedly in water-stressed Hordeum leaves which was characterized by a decreased incorporation of label into 2'-HMABA, DPA, and conjugates. The specific, mixed function oxidase inhibitor, ancymidol, did not inhibit, dramatically (+/-)-ABA catabolism in light-grown leaves of Hordeum whereas the 80s ribosome, translational inhibitor, cycloheximide, inhibited this process markedly. The 70s ribosome translational inhibitors, lincomycin and chloramphenicol, were less effective than cycloheximide in inhibiting (+/-)-ABA catabolism, implying that cytoplasmic protein synthesis is necessary for the catabolism of (+/-)-ABA in Hordeum leaves whereas chloroplast protein synthesis plays only a minor role. This further suggests that the enzymes involved in (+/-)-ABA catabolism in this plant are cytoplasmically synthesized and are turned-over rapidly, although the enzyme responsible for glycosylating (+/-)-ABA itself appeared to be stable
Cosson, Patrick; Sofer, Luc; Schurdi-Levraud, Valérie
2010-01-01
Restriction of long distance movement of several potyviruses in Arabidopsis thaliana is controlled by at least three dominant restricted TEV movement (RTM) genes, named RTM1, RTM2 and RTM3 and acts as a non-conventional resistance. RTM1 encodes a protein belonging to the jacalin family and RTM2 encodes a protein which has similarities to small heat shock proteins. The recent cloning of RTM3 which encodes a protein belonging to an unknown protein family of 29 members that has a meprin and TRAF homology (MATH) domain in its N-terminal region and a coiled-coil (CC) domain at its C-terminal end is an important breakthrough for a better understanding of this resistance process. Not only the third gene involved in this resistance has been identified and has allowed revealing a new gene family in plant but the discovery that the RTM3 protein interacts directly with RTM1 strongly suggests that the RTM proteins form a multimeric complex. However, these data also highlight striking similarities of the RTM resistance with the well known R-gene mediated resistance. PMID:20930558
DEFF Research Database (Denmark)
Damkjær Bartels, Mette; Hansen, Lars H.; Boye, Kit
2011-01-01
In methicillin resistant Staphylococcus aureus (MRSA), the arginine catabolic mobile element (ACME) was initially described in USA300 (t008-ST8) where it is located downstream of the staphylococcal cassette chromosome mec (SCCmec). A common health-care associated MRSA in Copenhagen, Denmark (t024......-ST8) is clonally related to USA300 and is frequently PCR positive for the ACME specific arcA-gene. This study is the first to describe an ACME element upstream of the SCCmec in MRSA. By traditional SCCmec typing schemes, the SCCmec of t024-ST8 strain M1 carries SCCmec IVa, but full sequencing...... of SCCmec, M1 had two new DR between the orfX gene and the J3 region of the SCCmec. The region between the orfX DR (DR1) and DR2 contained the ccrAB4 genes. An ACME II-like element was located between DR2 and DR3. The entire 26,468 bp sequence between DR1 and DR3 was highly similar to parts of the ACME...
Cañas-Gutiérrez, Gloria P; Angarita-Velásquez, Mónica J; Restrepo-Flórez, Juan M; Rodríguez, Paola; Moreno, Claudia X; Arango, Rafael
2009-08-01
Mycosphaerella fijiensis Morelet causes black sigatoka, the most important disease in bananas and plantains. Disease control is mainly through the application of systemic fungicides, including sterol demethylation inhibitors (DMIs). Their intensive use has favoured the appearance of resistant strains. However, no studies have been published on the possible resistance mechanisms. In this work, the CYP51 gene was isolated and sequenced in 11 M. fijiensis strains that had shown different degrees of in vitro sensitivity to propiconazole, one of the most widely used DMI fungicides. Six mutations that could be related to the loss in sensitivity to this fungicide were found: Y136F, A313G, Y461D, Y463D, Y463H and Y463N. The mutations were analysed using a homology model of the protein that was constructed from the crystallographic structure of Mycobacterium tuberculosis (Zoff.) Lehmann & Neumann. Additionally, gene expression was determined in 13 M. fijiensis strains through quantitative analysis of products obtained by RT-PCR. Several changes in the sequence of the gene encoding sterol 14alpha-demethylase were found that have been described in other fungi as being correlated with resistance to azole fungicides. No correlation was found between gene expression and propiconazole resistance.
ENGEL, H; KAZEMIER, B; KECK, W
The complete nucleotide sequence of the slt gene encoding the soluble lytic transglycosylase (Slt; EC 3.2.1.-) from Escherichia coli has been determined. The largest open reading frame identified on a 2.5-kb PvuII-SalI fragment indicates that the enzyme is translated as a preprotein of either 654 or
Energy Technology Data Exchange (ETDEWEB)
Patterson, D.; Gardiner, K.; Kao, F.T.; Tanzi, R.; Watkins, P.; Gusella, J.F. (Eleanor Roosevelt Institute for Cancer Research, Denver, CO (USA))
1988-11-01
The gene encoding the {beta}-amyloid precursor protein has been assigned to human chromosome 21, as has a gene responsible for at least some cases of familial Alzheimer disease. Linkage studies strongly suggest that the {beta}-amyloid precursor protein and the product corresponding to familial Alzheimer disease are from two genes, or at least that several million base pairs of DNA separate the markers. The precise location of the {beta}-amyloid precursor protein gene on chromosome 21 has not yet been determined. Here the authors show, by using a somatic-cell/hybrid-cell mapping panel, in situ hybridization, and transverse-alternating-field electrophoresis, that the {beta}-amyloid precursor protein gene is located on chromosome 21 very near the 21q21/21q/22 border and probably within the region of chromosome 21 that, when trisomic, results in Down syndrome.
DEFF Research Database (Denmark)
Bela-Ong, Dennis; Schyth, Brian Dall; Lorenzen, Niels
particularly to sea-farmed rainbow trout and thus necessitates strategies to mitigate potential disease outbreaks. A DNA vaccine encoding the glycoprotein gene of VHSV has been developed and shown to elicit protective immune responses in laboratory trials. It is important to identify key factors as biomarkers...
DEFF Research Database (Denmark)
Rosenkilde, M M; Waldhoer, M; Lüttichau, H R
2001-01-01
expression of this single gene in certain lymphocyte cell lineages leads to the development of lesions which are remarkably similar to Kaposi's sarcoma, a human herpesvirus 8 associated disease. Thus, this and other virally encoded 7TM receptors appear to be attractive future drug targets.......A number of herpes- and poxviruses encode 7TM G-protein coupled receptors most of which clearly are derived from their host chemokine system as well as induce high expression of certain 7TM receptors in the infected cells. The receptors appear to be exploited by the virus for either immune evasion...
International Nuclear Information System (INIS)
Menaa, F.
2003-12-01
Cells submitted to genotoxic factors -like IR- activate several and important mechanisms such as repair, cell cycle arrest or 'apoptosis' to maintain genetic integrity. So, the damaged cells will induce many and different genes. The human transcriptome analysis by 'SSH' method in a human breast carcinoma cell line MCF7 γ-irradiated versus not irradiated, allowed to identify about one hundred genes. Among of these genes, we have focused our study on a radio-induced gene encoding the p68 helicase. In the conditions of irradiation used, our results show that the kinetic and the regulation of this gene expression differs between the nature of radiations used. Indeed, in γ-irradiated mammalian cells, ATM, a protein kinase activated by DSB and IR, is required to induce quickly P68 gene via the important transcription factor p53 stabilized by IR. In the case of UVC-irradiated cells, the P68 gene induction is late and the intracellular signalling pathway that lead to this induction is independent from the p53 protein. Finally, we show that the p68 protein under-expression is responsible for an increased radiosensitivity of MCF7 cells. Consequently, we can postulate that the p68 protein is involved in cellular responses to radiations to reduce the increased radiosensitivity of cells exposed to γ-rays. (author)
Linares, Daniel M; Del Rio, Beatriz; Redruello, Begoña; Ladero, Victor; Martin, M Cruz; de Jong, Anne; Kuipers, Oscar P; Fernandez, Maria; Alvarez, Miguel A
2015-09-01
Dairy industry fermentative processes mostly use Lactococcus lactis as a starter. However, some dairy L. lactis strains produce putrescine, a biogenic amine that raises food safety and spoilage concerns, via the agmatine deiminase (AGDI) pathway. The enzymatic activities responsible for putrescine biosynthesis in this bacterium are encoded by the AGDI gene cluster. The role of the catabolic genes aguB, aguD, aguA, and aguC has been studied, but knowledge regarding the role of aguR (the first gene in the cluster) remains limited. In the present work, aguR was found to be a very low level constitutively expressed gene that is essential for putrescine biosynthesis and is transcribed independently of the polycistronic mRNA encoding the catabolic genes (aguBDAC). In response to agmatine, AguR acts as a transcriptional activator of the aguB promoter (PaguB), which drives the transcription of the aguBDAC operon. Inverted sequences required for PaguB activity were identified by deletion analysis. Further work indicated that AguR is a transmembrane protein which might function as a one-component signal transduction system that senses the agmatine concentration of the medium and, accordingly, regulates the transcription of the aguBDAC operon through a C-terminal cytoplasmic DNA-binding domain typically found in LuxR-like proteins. Copyright © 2015, American Society for Microbiology. All Rights Reserved.
O’Keeffe, Triona; Hill, Colin; Ross, R. Paul
1999-01-01
Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the
Persson, K; Aslund, L; Grahn, B; Hanke, J; Heby, O
1998-01-01
All attempts to identify ornithine decarboxylase in the human pathogen Trypanosoma cruzi have failed. The parasites have instead been assumed to depend on putrescine uptake and S-adenosylmethionine decarboxylase (AdoMetDC) for their synthesis of the polyamines spermidine and spermine. We have now identified the gene encoding AdoMetDC in T. cruzi by PCR cloning, with degenerate primers corresponding to conserved amino acid sequences in AdoMetDC proteins of other trypanosomatids. The amplified DNA fragment was used as a probe to isolate the complete AdoMetDC gene from a T. cruzi genomic library. The AdoMetDC gene was located on chromosomes with a size of approx. 1.4 Mbp, and contained a coding region of 1110 bp, specifying a sequence of 370 amino acid residues. The protein showed a sequence identity of only 25% with human AdoMetDC, the major differences being additional amino acids present in the terminal regions of the T. cruzi enzyme. As expected, a higher sequence identity (68-72%) was found in comparison with trypanosomatid AdoMetDCs. When the coding region was expressed in Escherichia coli, the recombinant protein underwent autocatalytic cleavage, generating a 33-34 kDa alpha subunit and a 9 kDa beta subunit. The encoded protein catalysed the decarboxylation of AdoMet (Km 0.21 mM) and was stimulated by putrescine but inhibited by the polyamines, weakly by spermidine and strongly by spermine. Methylglyoxal-bis(guanylhydrazone) (MGBG), a potent inhibitor of human AdoMetDC, was a poor inhibitor of the T. cruzi enzyme. This differential sensitivity to MGBG suggests that the two enzymes are sufficiently different to warrant the search for compounds that might interfere with the progression of Chagas' disease by selectively inhibiting T. cruzi AdoMetDC. PMID:9677309
Directory of Open Access Journals (Sweden)
Nandagopal Murugan
2018-02-01
Full Text Available Pseudomonas aeruginosa (P. aeruginosa is a menacing opportunistic, nosocomial pathogen; become a growing concern as conventional antimicrobial therapy is now futile against it. Multi-drug resistant P. aeruginosa (MDRPA has distinctive resistance mechanisms such as production of β-lactamases, repression of porin genes and over-expression of efflux pumps. The focus of this study is to standardize and application of multiplex PCR (mPCR to detect the presence of betalactamase genes encoding blaTem, blaOXA, blaCTX-M-15, blaVim, blaGes, blaVeb, blaDIM, AmpC and Efflux pump genes encoding Mex A,B-oprM, Mex C,D-oprJ, Mex X,Y-oprN, oprD, nfxB, MexR. A total of 200 clinical isolates of P. aeruginosa were tested for the presence of the above mentioned genes genotypically through mPCR and characterized by phenotypic methods for ESBL and MBL production. Out of 200 isolates, 163 (81.5% nfxB regulator gene, 102 (51% MexA, 96 (48% MexC, 93 (46.5% MexB, 86 (43% MexD, 81 (40.5% OprM, 74 (37% OprJ, 72 (36% OprD and MexR, 53 (26.5% Mex X and OprN, 49 (24.5% MexY gene. Betalactamase genes 145 (72.5% blaTem, 67 (33.5% blaOXA, 35 (17.5% blaVim, 25(12.50%, 23 (11.50% blaVeb, 21 (11.5% blaGes, 14 (7% Ctx-m and 10 (5% AmpC and 5 (2.5% blaDim-1 gene were tested positive by mPCR. Phenotypically 38 (19% and 29 (14.5% out of 200 tested positive for ESBL and MBL production. Application of this mPCR on clinical specimens is fast, accurate, specific and low-cost reliable tool for the screening, where culture negative Eubacterial PCR positive cases for an early molecular detection of drug resistance mechanism assisting the clinician to treat the disease with appropriate antibiotic selection.
Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A
2010-07-01
WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.
Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.
2010-01-01
WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064
Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product
Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham
2015-01-01
Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410
Lackington, William A; Raftery, Rosanne M; O'Brien, Fergal J
2018-06-07
Despite the success of tissue engineered nerve guidance conduits (NGCs) for the treatment of small peripheral nerve injuries, autografts remain the clinical gold standard for larger injuries. The delivery of neurotrophic factors from conduits might enhance repair for more effective treatment of larger injuries but the efficacy of such systems is dependent on a safe, effective platform for controlled and localised therapeutic delivery. Gene therapy might offer an innovative approach to control the timing, release and level of neurotrophic factor production by directing cells to transiently sustain therapeutic protein production in situ. In this study, a gene-activated NGC was developed by incorporating non-viral polyethyleneimine-plasmid DNA (PEI-pDNA) nanoparticles (N/P 7 ratio, 2μg dose) with the pDNA encoding for nerve growth factor (NGF), glial derived neurotrophic factor (GDNF) or the transcription factor c-Jun. The physicochemical properties of PEI-pDNA nanoparticles, morphology, size and charge, were shown to be suitable for gene delivery and demonstrated high Schwann cell transfection efficiency (60±13%) in vitro. While all three genes showed therapeutic potential in terms of enhancing neurotrophic cytokine production while promoting neurite outgrowth, delivery of the gene encoding for c-Jun showed the greatest capacity to enhance regenerative cellular processes in vitro. Ultimately, this gene-activated NGC construct was shown to be capable of transfecting both Schwann cells (S42 cells) and neuronal cells (PC12 and dorsal root ganglia) in vitro, demonstrating potential for future therapeutic applications in vivo. The basic requirements of biomaterial-based nerve guidance conduits have now been well established and include being able to bridge a nerve injury to support macroscopic guidance between nerve stumps, while being strong enough to withstand longitudinal tension and circumferential compression, in addition to being mechanically sound to facilitate
Ye, Nenghui; Li, Haoxuan; Zhu, Guohui; Liu, Yinggao; Liu, Rui; Xu, Weifeng; Jing, Yu; Peng, Xinxiang; Zhang, Jianhua
2014-11-01
Although copper (Cu) is an essential micronutrient for plants, a slight excess of Cu in soil can be harmful to plants. Unfortunately, Cu contamination is a growing problem all over the world due to human activities, and poses a soil stress to plant development. As one of the most important biological processes, seed germination is sensitive to Cu stress. However, little is known about the mechanism of Cu-induced inhibition of seed germination. In the present study, we investigated the relationship between Cu and ABA which is the predominant regulator of seed germination. Cu at a concentration of 30 µM effectively inhibited germination of rice caryopsis. ABA content in germinating seeds under copper stress was also higher than that under control conditions. Quantitative real-time PCR (qRT-PCR) revealed that Cu treatment reduced the expression of OsABA8ox2, a key gene of ABA catabolism in rice seeds. In addition, both malondialdehyde (MDA) and H2O2 contents were increased by Cu stress in the germinating seeds. Antioxidant enzyme assays revealed that only catalase activity was reduced by excess Cu, which was consistent with the mRNA profile of OsCATa during seed germination under Cu stress. Together, our results demonstrate that suppression of ABA catabolism and catalase (CAT) activity by excess Cu leads to the inhibition of seed germination of rice. © The Author 2014. Published by Oxford University Press on behalf of Japanese Society of Plant Physiologists. All rights reserved. For permissions, please email: journals.permissions@oup.com.
Bassler, B L; Wright, M; Silverman, M R
1994-07-01
Density-dependent expression of luminescence in Vibrio harveyi is regulated by the concentration of extracellular signal molecules (autoinducers) in the culture medium. One signal-response system is encoded by the luxL,M,N locus. The luxL and luxM genes are required for the production of an autoinducer (probably beta-hydroxybutyl homoserine lactone), and the luxN gene is required for the response to that autoinducer. Analysis of the phenotypes of LuxL,M and N mutants indicated that an additional signal-response system also controls density sensing. We report here the identification, cloning and analysis of luxP and luxQ, which encode functions required for a second density-sensing system. Mutants with defects in luxP and luxQ are defective in response to a second autoinducer substance. LuxQ, like LuxN, is similar to members of the family of two-component, signal transduction proteins and contains both a histidine protein kinase and a response regulator domain. Analysis of signalling mutant phenotypes indicates that there are at least two separate signal-response pathways which converge to regulate expression of luminescence in V. harveyi.
Xu, J; Johnson, R C
1995-06-01
Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.
Symonenko, Alexander V.; Roshina, Natalia V.; Krementsova, Anna V.; Pasyukova, Elena G.
2018-01-01
In recent years, several genes involved in complex neuron specification networks have been shown to control life span. However, information on these genes is scattered, and studies to discover new neuronal genes and gene cascades contributing to life span control are needed, especially because of the recognized role of the nervous system in governing homeostasis, aging, and longevity. Previously, we demonstrated that several genes that encode RNA polymerase II transcription factors and that are involved in the development of the nervous system affect life span in Drosophila melanogaster. Among other genes, escargot (esg) was demonstrated to be causally associated with an increase in the life span of male flies. Here, we present new data on the role of esg in life span control. We show that esg affects the life spans of both mated and unmated males and females to varying degrees. By analyzing the survival and locomotion of the esg mutants, we demonstrate that esg is involved in the control of aging. We show that increased longevity is caused by decreased esg transcription. In particular, we demonstrate that esg knockdown in the nervous system increased life span, directly establishing the involvement of the neuronal esg function in life span control. Our data invite attention to the mechanisms regulating the esg transcription rate, which is changed by insertions of DNA fragments of different sizes downstream of the structural part of the gene, indicating the direction of further research. Our data agree with the previously made suggestion that alterations in gene expression during development might affect adult lifespan, due to epigenetic patterns inherited in cell lineages or predetermined during the development of the structural and functional properties of the nervous system. PMID:29760717
Allignet, Jeanine; Liassine, Nadia; El Solh, Névine
1998-01-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation. PMID:9661023
Allignet, J; Liassine, N; el Solh, N
1998-07-01
We isolated and sequenced a plasmid, named pIP1714 (4,978 bp), which specifies resistance to streptogramins A and B and the mixture of these compounds. pIP1714 was isolated from a Staphylococcus cohnii subsp. cohnii strain found in the environment of a hospital where pristinamycin was extensively used. Resistance to both compounds and related antibiotics is encoded by two novel, probably cotranscribed genes, (i) vatC, encoding a 212-amino-acid (aa) acetyltransferase that inactivates streptogramin A and that exhibits 58.2 to 69.8% aa identity with the Vat, VatB, and SatA proteins, and (ii) vgbB, encoding a 295-aa lactonase that inactivates streptogramin B and that shows 67% aa identity with the Vgb lactonase. pIP1714 includes a 2,985-bp fragment also found in two rolling-circle replication and mobilizable plasmids, pUB110 and pBC16, from gram-positive bacteria. In all three plasmids, the common fragment was delimited by two direct repeats of four nucleotides (GGGC) and included (i) putative genes closely related to repB, which encodes a replication protein, and to pre(mob), which encodes a protein required for conjugative mobilization and site-specific recombination, and (ii) sequences very similar to the double- and single-strand origins (dso, ssoU) and the recombination site, RSA. The antibiotic resistance genes repB and pre(mob) carried by each of these plasmids were found in the same transcriptional orientation.
Clark, A M; Jacobsen, K R; Bostwick, D E; Dannenhoffer, J M; Skaggs, M I; Thompson, G A
1997-07-01
Sieve elements in the phloem of most angiosperms contain proteinaceous filaments and aggregates called P-protein. In the genus Cucurbita, these filaments are composed of two major proteins: PP1, the phloem filament protein, and PP2, the phloem lactin. The gene encoding the phloem filament protein in pumpkin (Cucurbita maxima Duch.) has been isolated and characterized. Nucleotide sequence analysis of the reconstructed gene gPP1 revealed a continuous 2430 bp protein coding sequence, with no introns, encoding an 809 amino acid polypeptide. The deduced polypeptide had characteristics of PP1 and contained a 15 amino acid sequence determined by N-terminal peptide sequence analysis of PP1. The sequence of PP1 was highly repetitive with four 200 amino acid sequence domains containing structural motifs in common with cysteine proteinase inhibitors. Expression of the PP1 gene was detected in roots, hypocotyls, cotyledons, stems, and leaves of pumpkin plants. PP1 and its mRNA accumulated in pumpkin hypocotyls during the period of rapid hypocotyl elongation after which mRNA levels declined, while protein levels remained elevated. PP1 was immunolocalized in slime plugs and P-protein bodies in sieve elements of the phloem. Occasionally, PP1 was detected in companion cells. PP1 mRNA was localized by in situ hybridization in companion cells at early stages of vascular differentiation. The developmental accumulation and localization of PP1 and its mRNA paralleled the phloem lactin, further suggesting an interaction between these phloem-specific proteins.
Moriau, L; Michelet, B; Bogaerts, P; Lambert, L; Michel, A; Oufattole, M; Boutry, M
1999-07-01
The plasma membrane H+-ATPase couples ATP hydrolysis to proton transport, thereby establishing the driving force for solute transport across the plasma membrane. In Nicotiana plumbaginifolia, this enzyme is encoded by at least nine pma (plasma membrane H+-ATPase) genes. Four of these are classified into two gene subfamilies, pma1-2-3 and pma4, which are the most highly expressed in plant species. We have isolated genomic clones for pma2 and pma4. Mapping of their transcript 5' end revealed the presence of a long leader that contained small open reading frames, regulatory features typical of other pma genes. The gusA reporter gene was then used to determine the expression of pma2, pma3 and pma4 in N. tabacum. These data, together with those obtained previously for pma1, led to the following conclusions. (i) The four pma-gusA genes were all expressed in root, stem, leaf and flower organs, but each in a cell-type specific manner. Expression in these organs was confirmed at the protein level, using subfamily-specific antibodies. (ii) pma4-gusA was expressed in many cell types and notably in root hair and epidermis, in companion cells, and in guard cells, indicating that in N. plumbaginifolia the same H+-ATPase isoform might be involved in mineral nutrition, phloem loading and control of stomata aperture. (iii) The second gene subfamily is composed, in N. plumbaginifolia, of a single gene (pma4) with a wide expression pattern and, in Arabidopsis thaliana, of three genes (aha1, aha2, aha3), at least two of them having a more restrictive expression pattern. (iv) Some cell types expressed pma2 and pma4 at the same time, which encode H+-ATPases with different enzymatic properties.
Increased fat catabolism sustains water balance during fasting in zebra finches.
Rutkowska, Joanna; Sadowska, Edyta T; Cichoń, Mariusz; Bauchinger, Ulf
2016-09-01
Patterns of physiological flexibility in response to fasting are well established, but much less is known about the contribution of water deprivation to the observed effects. We investigated body composition and energy and water budget in three groups of zebra finches: birds with access to food and water, food-deprived birds having access to drinking water and food-and-water-deprived birds. Animals were not stimulated by elevated energy expenditure and they were in thermoneutral conditions; thus, based on previous studies, water balance of fasting birds was expected to be maintained by increased catabolism of proteins. In contrast to this expectation, we found that access to water did not prevent reduction of proteinaceous tissue, but it saved fat reserves of the fasting birds. Thus, water balance of birds fasting without access to water seemed to be maintained by elevated fat catabolism, which generated 6 times more metabolic water compared with that in birds that had access to water. Therefore, we revise currently established views and propose fat to serve as the primary source for metabolic water production. Previously assumed increased protein breakdown for maintenance of water budget would occur if fat stores were depleted or if fat catabolism reached its upper limits due to high energy demands. © 2016. Published by The Company of Biologists Ltd.
Mun, Seulgi; Noh, Mi Young; Osanai-Futahashi, Mizuko; Muthukrishnan, Subbaratnam; Kramer, Karl J; Arakane, Yasuyuki
2014-06-01
Insect cuticle pigmentation and sclerotization (tanning) are vital physiological processes for insect growth, development and survival. We have previously identified several colorless precursor molecules as well as enzymes involved in their biosynthesis and processing to yield the mature intensely colored body cuticle pigments. A recent study indicated that the Bombyx mori (silkmoth) gene, BmMucK, which encodes a protein orthologous to a Culex pipiens quiquefasciatus (Southern house mosquito) cis,cis, muconate transporter, is a member of the "Major Facilitator Superfamily" (MFS) of transporter proteins and is associated with the appearance of pigmented body segments of naturally occurring body color mutants of B. mori. While RNA interference of the BmMucK gene failed to result in any observable phenotype, RNAi using a dsRNA for an orthologous gene from the red flour beetle, Tribolium castaneum, was reported to result in molting defects and darkening of the cuticle and some body parts, leading to the suggestion that orthologs of MucK genes may differ in their functions among insects. To verify the role and essentiality of the ortholog of this gene in development and body pigmentation function in T. castaneum we obtained cDNAs for the orthologous gene (TcMucK) from RNA isolated from the GA-1 wild-type strain of T. castaneum. The sequence of a 1524 nucleotides-long cDNA for TcMucK which encodes the putatively full-length protein, was assembled from two overlapping RT-PCR fragments and the expression profile of this gene during development was analyzed by real-time PCR. This cDNA encodes a 55.8 kDa protein consisting of 507 amino acid residues and includes 11 putative transmembrane segments. Transcripts of TcMucK were detected throughout all of the developmental stages analyzed. The function of this gene was explored by injection of two different double-stranded RNAs targeting different regions of the TcMucK gene (dsTcMucKs) into young larvae to down
Jauch, Eike; Wecklein, Heike; Stark, Felix; Jauch, Mandy; Raabe, Thomas
2006-06-07
Genes encoding for the two evolutionary highly conserved subunits of a heterotetrameric protein kinase CK2 holoenzyme are present in all examined eukaryotic genomes. Depending on the organism, multiple transcription units encoding for a catalytically active CK2alpha subunit and/or a regulatory CK2beta subunit may exist. The phosphotransferase activity of members of the protein kinase CK2alpha family is thought to be independent of second messengers but is modulated by interaction with CK2beta-like proteins. In the genome of Drosophila melanogaster, one gene encoding for a CK2alpha subunit and three genes encoding for CK2beta-like proteins are present. The X-linked DmCK2beta transcription unit encodes for several CK2beta protein isoforms due to alternative splicing of its primary transcript. We addressed the question whether CK2beta-like proteins are redundant in function. Our in vivo experiments show that variations of the very C-terminal tail of CK2beta isoforms encoded by the X-linked DmCK2beta transcription unit influence their functional properties. In addition, we find that CK2beta-like proteins encoded by the autosomal D. melanogaster genes CK2betates and CK2beta' cannot fully substitute for a loss of CK2beta isoforms encoded by DmCK2beta.
DEFF Research Database (Denmark)
Svenningsen, Nanna Bygvraa; Damgaard, Mette; Rasmussen, Maria Katrine
2017-01-01
to Cu leads to accumulation of intracellular reactive oxygen species (ROS) in some bacteria, but it is not known how Cu-derived ROS and an ensuing oxidative stress affect the degradation of PA herbicides. Based on the previously proposed paradigm that bacteria deal with environmental stress before...... that it is involved in the oxidative stress response in C. pinatubonensis. The increased ROS accumulation and increased expression of the oxidative stress defense coincided with a delay in the catabolic performance, since both expression of the catabolic tfdA gene and MCPA mineralization were delayed compared...... increased accumulation of ROS measured by the oxidant sensing probe 2,7-dichlorodihydrofluorescein diacetate and flow cytometry, and resulted in upregulation of a gene encoding a protein belong to the Ohr/OsmC protein family. The ohr/osmC gene was also highly induced by H2O2 exposure suggesting...
Draft Genome Sequences of Three β-Lactam-Catabolizing Soil Proteobacteria
DEFF Research Database (Denmark)
Crofts, Terence S.; Wang, Bin; Spivak, Aaron
2017-01-01
Most antibiotics are derived from the soil, but their catabolism there, which is necessary to close the antibiotic carbon cycle, remains uncharacterized. We report the first draft genome sequences of soil Proteobacteria identified for subsisting solely on β-lactams as their carbon sources...
Conlan, R S; Griffiths, L A; Napier, J A; Shewry, P R; Mantell, S; Ainsworth, C
1995-06-01
cDNA clones encoding dioscorins, the major tuber storage proteins (M(r) 32,000) of yam (Dioscorea cayenesis) have been isolated. Two classes of clone (A and B, based on hybrid release translation product sizes and nucleotide sequence differences) which are 84.1% similar in their protein coding regions, were identified. The protein encoded by the open reading frame of the class A cDNA insert is of M(r) 30,015. The difference in observed and calculated molecular mass might be attributed to glycosylation. Nucleotide sequencing and in vitro transcription/translation suggest that the class A dioscorin proteins are synthesised with signal peptides of 18 amino acid residues which are cleaved from the mature peptide. The class A and class B proteins are 69.6% similar with respect to each other, but show no sequence identity with other plant proteins or with the major tuber storage proteins of potato (patatin) or sweet potato (sporamin). Storage protein gene expression was restricted to developing tubers and was not induced by growth conditions known to induce expression of tuber storage protein genes in other plant species. The codon usage of the dioscorin genes suggests that the Dioscoreaceae are more closely related to dicotyledonous than to monocotyledonous plants.
Zhai, Yifan; Yang, James C.; Spiess, Paul; Nishimura, Michael I.; Overwijk, Willem W.; Roberts, Bruce; Restifo, Nicholas P.; Rosenberg, Steven A.
2008-01-01
The recent identification of genes encoding melanoma-associated antigens has opened new possibilities for the development of cancer vaccines designed to cause the rejection of established tumors. To develop a syngeneic animal model for evaluating antigen-specific vaccines in cancer therapy, the murine homologues of the human melanoma antigens MART1 and gp 100, which were specifically recognized by tumor-infiltrating lymphocytes from patients with melanoma, were cloned and sequenced from a murine B16 melanoma cDNA library. The open reading frames of murine MART1 and gp 100 encode proteins of 113- and 626-amino acids with 68.8 and 77% identity to the respective human proteins. Comparison of the DNA sequences of the murine MART1 genes, derived from normal melanocytes, the immortalized nontumorgenic melanocyte line Melan-a and the B16 melanoma, showed all to be identical. Northern and Western blot analyses confirmed that both genes encoded products that were melanocyte lineage proteins. Mice immunized with murine MART1 or gp 100 using recombinant vaccinia virus failed to produce any detectable T-cell responses or protective immunity against B16 melanoma. In contrast, immunization of mice with human gp 100 using recombinant adenoviruses elicited T cells specific for hgp100, but these T cells also cross reacted with B16 tumor in vitro and induced significant but weak protection against B16 challenge. Immunization with human and mouse gp100 together [adenovirus type 2 (Ad2)-hep100 plus recombinant vaccinia virus (rVV)-mgp100], or immunization with human gp100 (Ad2-hgp100) and boosting with heterologous vector (rVV-hgp100 or rVV-mgp100) or homologous vector (Ad2-hgp100), did not significantly enhance the protective response against B16 melanoma. These results may suggest that immunization with heterologous tumor antigen, rather than self, may be more effective as an immunotherapeutic reagent in designing antigen-specific cancer vaccines. PMID:9101410
Wang, Wei; Zhang, Fuyang; Xia, Yunlong; Zhao, Shihao; Yan, Wenjun; Wang, Helin; Lee, Yan; Li, Congye; Zhang, Ling; Lian, Kun; Gao, Erhe; Cheng, Hexiang; Tao, Ling
2016-11-01
Cardiac metabolic remodeling is a central event during heart failure (HF) development following myocardial infarction (MI). It is well known that myocardial glucose and fatty acid dysmetabolism contribute to post-MI cardiac dysfunction and remodeling. However, the role of amino acid metabolism in post-MI HF remains elusive. Branched chain amino acids (BCAAs) are an important group of essential amino acids and function as crucial nutrient signaling in mammalian animals. The present study aimed to determine the role of cardiac BCAA metabolism in post-MI HF progression. Utilizing coronary artery ligation-induced murine MI models, we found that myocardial BCAA catabolism was significantly impaired in response to permanent MI, therefore leading to an obvious elevation of myocardial BCAA abundance. In MI-operated mice, oral BCAA administration further increased cardiac BCAA levels, activated the mammalian target of rapamycin (mTOR) signaling, and exacerbated cardiac dysfunction and remodeling. These data demonstrate that BCAAs act as a direct contributor to post-MI cardiac pathologies. Furthermore, these BCAA-mediated deleterious effects were improved by rapamycin cotreatment, revealing an indispensable role of mTOR in BCAA-mediated adverse effects on cardiac function/structure post-MI. Of note, pharmacological inhibition of branched chain ketoacid dehydrogenase kinase (BDK), a negative regulator of myocardial BCAA catabolism, significantly improved cardiac BCAA catabolic disorders, reduced myocardial BCAA levels, and ameliorated post-MI cardiac dysfunction and remodeling. In conclusion, our data provide the evidence that impaired cardiac BCAA catabolism directly contributes to post-MI cardiac dysfunction and remodeling. Moreover, improving cardiac BCAA catabolic defects may be a promising therapeutic strategy against post-MI HF. Copyright © 2016 the American Physiological Society.
International Nuclear Information System (INIS)
Sayler, G.S.; Shields, M.S.; Tedford, E.T.; Breen, A.; Hooper, S.W.; Sirotkin, K.M.; Davis, J.W.
1985-01-01
The application of preexisting DNA hybridization techniques was investigated for potential in determining populations of specific gene sequences in environmental samples. Cross-hybridizations among two degradative plasmids, TOL and NAH, and two cloning vehicles, pLAFR1 and RSF1010, were determined. The detection limits for the TOL plasmid against a nonhomologous plasmid-bearing bacterial background was ascertained. The colony hybridization technique allowed detection of one colony containing TOL plasmid among 10(6) Escherichia coli colonies of nonhomologous DNA. Comparisons between population estimates derived from growth on selective substrates and from hybridizations were examined. Findings indicated that standard sole carbon source enumeration procedures for degradative populations lead to overestimations due to nonspecific growth of other bacteria on the microcontaminant carbon sources present in the media. Population estimates based on the selective growth of a microcosm population on two aromatic substrates (toluene and naphthalene) and estimates derived from DNA-DNA colony hybridizations, using the TOL or NAH plasmid as a probe, corresponded with estimates of substrate mineralization rates and past exposure to environmental contaminants. The applications of such techniques are hoped to eventually allow enumeration of any specific gene sequences in the environment, including both anabolic and catabolic genes. In addition, this procedure should prove useful in monitoring recombinant DNA clones released into environmental situations
The implications of alternative splicing in the ENCODE protein complement
DEFF Research Database (Denmark)
Tress, Michael L.; Martelli, Pier Luigi; Frankish, Adam
2007-01-01
suggested as one explanation for the discrepancy between the number of human genes and functional complexity. Here, we carry out a detailed study of the alternatively spliced gene products annotated in the ENCODE pilot project. We find that alternative splicing in human genes is more frequent than has...
Liu, Ying; Jiang, Yu-xin; Li, Chao-pin
2011-12-01
To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.
Gurav, Ranjit; Lyu, Honghong; Ma, Jianli; Tang, Jingchun; Liu, Qinglong; Zhang, Hairong
2017-04-01
In the present study, salt-tolerant strains, Dietzia sp. HRJ2, Corynebacterium variabile HRJ4, Dietzia cinnamea HRJ5 and Bacillus tequilensis HRJ6 were isolated from the Dagang oil field, China. These strains degraded n-alkanes and polycyclic aromatic hydrocarbons (PAHs) aerobically from heavy crude oil (HCO) in an experiment at 37 °C and 140 rpm. The GC/MS investigation for degradation of different chain lengths of n-alkanes (C8-C40) by individual strains showed the highest degradation of C8-C19 (HRJ5), C20-C30 (HRJ4) and C31-C40 (HRJ5), respectively. Moreover, degradation of 16 PAHs with individual strains demonstrated that the bicyclic and pentacyclic aromatic hydrocarbons (AHs) were mostly degraded by HRJ5, tricyclic and tetracyclic AHs by HRJ6 and hexacyclic AHs by HRJ2. However, the highest degradation of total petroleum hydrocarbons (TPHs), total saturated hydrocarbons (TSH), total aromatic hydrocarbons (TAH), n-alkanes (C8-C40) and 16 PAHs was achieved by a four-membered consortium (HRJ2 + 4 + 5 + 6) within 12 days, with the predominance of HRJ4 and HRJ6 strains which was confirmed by denaturing gradient gel electrophoresis. The abundance of alkB and nah genes responsible for catabolism of n-alkanes and PAHs was quantified using the qPCR. Maximum copy numbers of genes were observed in HRJ2 + 4 + 5 + 6 consortium (gene copies l -1 ) 2.53 × 10 4 (alkB) and 3.47 × 10 3 (nah) at 12 days, which corresponded to higher degradation rates of petroleum hydrocarbons. The superoxide dismutase (SOD) (total SOD (T-SOD), Cu 2+ Zn 2+ -SOD), catalase (CAT) and ascorbate peroxidase (APX) activities in Allium sativum and Triticum aestivum were lower in the HRJ2 + 4 + 5 + 6-treated HCO as compared to the plantlets exposed directly to HCO. The present results revealed the effective degradation of HCO-contaminated saline medium using the microbial consortium having greater metabolic diversity.
Anaerobic catabolism of aromatic compounds: a genetic and genomic view.
Carmona, Manuel; Zamarro, María Teresa; Blázquez, Blas; Durante-Rodríguez, Gonzalo; Juárez, Javier F; Valderrama, J Andrés; Barragán, María J L; García, José Luis; Díaz, Eduardo
2009-03-01
Aromatic compounds belong to one of the most widely distributed classes of organic compounds in nature, and a significant number of xenobiotics belong to this family of compounds. Since many habitats containing large amounts of aromatic compounds are often anoxic, the anaerobic catabolism of aromatic compounds by microorganisms becomes crucial in biogeochemical cycles and in the sustainable development of the biosphere. The mineralization of aromatic compounds by facultative or obligate anaerobic bacteria can be coupled to anaerobic respiration with a variety of electron acceptors as well as to fermentation and anoxygenic photosynthesis. Since the redox potential of the electron-accepting system dictates the degradative strategy, there is wide biochemical diversity among anaerobic aromatic degraders. However, the genetic determinants of all these processes and the mechanisms involved in their regulation are much less studied. This review focuses on the recent findings that standard molecular biology approaches together with new high-throughput technologies (e.g., genome sequencing, transcriptomics, proteomics, and metagenomics) have provided regarding the genetics, regulation, ecophysiology, and evolution of anaerobic aromatic degradation pathways. These studies revealed that the anaerobic catabolism of aromatic compounds is more diverse and widespread than previously thought, and the complex metabolic and stress programs associated with the use of aromatic compounds under anaerobic conditions are starting to be unraveled. Anaerobic biotransformation processes based on unprecedented enzymes and pathways with novel metabolic capabilities, as well as the design of novel regulatory circuits and catabolic networks of great biotechnological potential in synthetic biology, are now feasible to approach.
Effect of methyl-β-cyclodextrin on gene expression in microbial conversion of phytosterol.
Shtratnikova, Victoria Y; Schelkunov, Mikhail I; Dovbnya, Dmitry V; Bragin, Eugeny Y; Donova, Marina V
2017-06-01
Modified β-cyclodextrins are widely used for the enhancement of microbial conversions of lipophilic compounds such as steroids. Multiple mechanisms of cyclodextrin-mediated enhancement of phytosterol bioconversion by mycobacteria had previously been shown to include steroid solubilization, alterations in the cell wall permeability for both steroids and nutrients, facilitation of protein leaking, and activity suppression of some steroid-transforming enzymes.In this work, we studied whether cyclodextrins might affect expression of the genes involved in the steroid catabolic pathway. Phytosterol bioconversion with 9α-hydroxy-androst-4-ene-3,17-dione accumulation by Mycobacterium sp. VKM Ac-1817D in the presence of methylated β-cyclodextrin (MCD) was investigated. RNA sequencing of the whole transcriptomes in different combinations of phytosterol and MCD showed a similar expression level of the steroid catabolism genes related to the KstR-regulon and was responsible for side chain and initial steps of steroid core oxidation; whereas, induction levels of the genes related to the KstR2-regulon were attenuated in the presence of MCD in this strain. The data were attenuated with quantitative real-time PCR.The results contribute to the understanding of cyclodextrin effects on microbial steroid conversion and provide a basis for the use of cyclodextrins as expression enhancers for studies of sterol catabolism in actinobacteria.
DEFF Research Database (Denmark)
Schultz, Anna Charlotte; Nygaard, P.; Saxild, Hans Henrik
2001-01-01
The soil bacterium Bacillus subtilis has developed a highly controlled system for the utilization of a diverse array of low molecular-weight compounds as a nitrogen source when the preferred nitrogen sources, e.g., glutamate plus ammonia, are exhausted. We have identified such a system...... for the utilization of purines as nitrogen source in B. subtilis. Based on growth studies of strains with knockout mutations in genes, complemented with enzyme analysis, we could ascribe functions to 14 genes encoding enzymes or proteins of the purine degradation pathway. A functional xanthine dehydrogenase requires......ABCDE unit was decreased 16-fold, while expression of pucR was decreased 4-fold in the presence of allantoin. We have identified genes of the purine degradation pathway in B. subtilis and showed that their expression is subject to both general nitrogen catabolite control and pathway-specific control....
International Nuclear Information System (INIS)
Petzke, K.J.; Albrecht, V.; Przybilski, H.
1986-01-01
Male albino rats were adapted to isocaloric purified diets that differed mainly in their glycine and casein contents. Controls received a 30% casein diet. In experimental diets gelatin or gelatin hydrolysate was substituted for half of the 30% casein. An additional group was fed a glycine-supplemented diet, which corresponded in glycine level to the gelatin diet but in which the protein level was nearly the same as that of the casein control diet. Another group received a 15% casein diet. Rat liver glycine cleavage system, serine hydroxymethyltransferase and serine dehydratase activities were measured. 14 CO 2 production from the catabolism of 14 C-labeled glycine was measured in vivo and in vitro (from isolated hepatocytes). Serine dehydratase and glycine cleavage system activities were higher in animals fed 30% casein diets than in those fed 15% casein diets. Serine hydroxymethyltransferase activity of the cytosolic and mitochondrial fractions was highest when a high glycine diet (glycine administered as pure, protein bound in gelatin or peptide bound in gelatin hydrolysate) was fed. 14 CO 2 formation from [1- 14 C]- and [2- 14 C]glycine both in vivo and in isolated hepatocytes was higher when a high glycine diet was fed than when a casein diet was fed. These results suggest that glycine catabolism is dependent on and adaptable to the glycine content of the diet. Serine hydroxymethyltransferase appears to play a major role in the regulation of glycine degradation via serine and pyruvate
Development of phenanthrene catabolism in natural and artificial soils
International Nuclear Information System (INIS)
Rhodes, Angela H.; Hofman, Jakub; Semple, Kirk T.
2008-01-01
The characteristics of natural soils often vary from those of artificial soil (e.g. OECD), which may lead to substantial differences in the bioavailability of test substances. The aim of this investigation was to characterise the development of phenanthrene catabolism in both natural and artificial soils with varying total organic carbon (TOC) content after 1, 14, 42 and 84 d soil-phenanthrene contact time. Indigenous catabolic activity was measured via the addition of 14 C-phenanthrene using the respirometric soil slurry assay. Notably, the lag phases, fastest rates and total extents of 14 C-phenanthrene degradation were relatively comparable in soils with similar TOC content after 1 d contact time. However, natural soils generally exhibited significantly shorter lag phases, faster rates and higher extents of mineralisation, than their artificial counterparts after 42 and 84 d contact time. Such findings suggest that the extrapolation of results from artificial soils to real/natural soils may not be straightforward. - Natural and artificial soils display different phenanthrene mineralisation profiles suggesting that the extrapolation of results from artificial soils to real/natural soils may not be straightforward
DEFF Research Database (Denmark)
von Wettstein, Penny
2017-01-01
The primary function of the outermost, lipophilic layer of plant aerial surfaces, called the cuticle, is preventing non-stomatal water loss. Its exterior surface is often decorated with wax crystals, imparting a blue-grey color. Identification of the barley Cer-c, -q and -u genes forming the 101 kb...... Cer-cqu gene cluster encoding a novel polyketide synthase-the β-diketone synthase (DKS), a lipase/carboxyl transferase, and a P450 hydroxylase, respectively, establishes a new, major pathway for the synthesis of plant waxes. The major product is a β-diketone (14,16-hentriacontane) aliphatic that forms...
Diehl, David L; LaPara, Timothy M
2010-12-01
The objective of this research was to investigate the ability of anaerobic and aerobic digesters to reduce the quantity of antibiotic resistant bacteria in wastewater solids. Lab-scale digesters were operated at different temperatures (22 °C, 37 °C, 46 °C, and 55 °C) under both anaerobic and aerobic conditions and fed wastewater solids collected from a full-scale treatment facility. Quantitative PCR was used to track five genes encoding tetracycline resistance (tet(A), tet(L), tet(O), tet(W), and tet(X)) and the gene encoding the integrase (intI1) of class 1 integrons. Statistically significant reductions in the quantities of these genes occurred in the anaerobic reactors at 37 °C, 46 °C, and 55 °C, with the removal rates and removal efficiencies increasing as a function of temperature. The aerobic digesters, in contrast, were generally incapable of significantly decreasing gene quantities, although these digesters were operated at much shorter mean hydraulic residence times. This research suggests that high temperature anaerobic digestion of wastewater solids would be a suitable technology for eliminating various antibiotic resistance genes, an emerging pollutant of concern.
Lubys, A; Lubienè, J; Kulakauskas, S; Stankevicius, K; Timinskas, A; Janulaitis, A
1996-07-15
The genomic region encoding the type IIS restriction-modification (R-M) system HphI (enzymes recognizing the asymmetric sequence 5'-GGTGA-3'/5'-TCACC-3') from Haemophilus parahaemolyticus were cloned into Escherichia coli and sequenced. Sequence analysis of the R-M HphI system revealed three adjacent genes aligned in the same orientation: a cytosine 5 methyltransferase (gene hphIMC), an adenine N6 methyltransferase (hphIMA) and the HphI restriction endonuclease (gene hphIR). Either methyltransferase is capable of protecting plasmid DNA in vivo against the action of the cognate restriction endonuclease. hphIMA methylation renders plasmid DNA resistant to R.Hindill at overlapping sites, suggesting that the adenine methyltransferase modifies the 3'-terminal A residue on the GGTGA strand. Strong homology was found between the N-terminal part of the m6A methyltransferasease and an unidentified reading frame interrupted by an incomplete gaIE gene of Neisseria meningitidis. The HphI R-M genes are flanked by a copy of a 56 bp direct nucleotide repeat on each side. Similar sequences have also been identified in the non-coding regions of H.influenzae Rd DNA. Possible involvement of the repeat sequences in the mobility of the HphI R-M system is discussed.
Sandhoff, Konrad
2016-11-01
Glycosphingolipids and sphingolipids of cellular plasma membranes (PMs) reach luminal intra-lysosomal vesicles (LVs) for degradation mainly by pathways of endocytosis. After a sorting and maturation process (e.g. degradation of sphingomyelin (SM) and secretion of cholesterol), sphingolipids of the LVs are digested by soluble enzymes with the help of activator (lipid binding and transfer) proteins. Inherited defects of lipid-cleaving enzymes and lipid binding and transfer proteins cause manifold and fatal, often neurodegenerative diseases. The review summarizes recent findings on the regulation of sphingolipid catabolism and cholesterol secretion from the endosomal compartment by lipid modifiers, an essential stimulation by anionic membrane lipids and an inhibition of crucial steps by cholesterol and SM. Reconstitution experiments in the presence of all proteins needed, hydrolase and activator proteins, reveal an up to 10-fold increase of ganglioside catabolism just by the incorporation of anionic lipids into the ganglioside carrying membranes, whereas an additional incorporation of cholesterol inhibits GM2 catabolism substantially. It is suggested that lipid and other low molecular modifiers affect the genotype-phenotype relationship observed in patients with lysosomal diseases. Copyright © 2016 Elsevier B.V. and Société Française de Biochimie et Biologie Moléculaire (SFBBM). All rights reserved.
Xie, Ke; Wu, Suowei; Li, Ziwen; Zhou, Yan; Zhang, Danfeng; Dong, Zhenying; An, Xueli; Zhu, Taotao; Zhang, Simiao; Liu, Shuangshuang; Li, Jinping; Wan, Xiangyuan
2018-06-01
Map-based cloning of maize ms33 gene showed that ZmMs33 encodes a sn-2 glycerol-3-phosphate acyltransferase, the ortholog of rice OsGPAT3, and it is essential for male fertility in maize. Genetic male sterility has been widely studied for its biological significance and commercial value in hybrid seed production. Although many male-sterile mutants have been identified in maize (Zea mays L.), it is likely that most genes that cause male sterility are unknown. Here, we report a recessive genetic male-sterile mutant, male sterility33 (ms33), which displays small, pale yellow anthers, and complete male sterility. Using a map-based cloning approach, maize GRMZM2G070304 was identified as the ms33 gene (ZmMs33). ZmMs33 encodes a novel sn-2 glycerol-3-phosphate acyltransferase (GPAT) in maize. A functional complementation experiment showed that GRMZM2G070304 can rescue the male-sterile phenotype of the ms33-6029 mutant. GRMZM2G070304 was further confirmed to be the ms33 gene via targeted knockouts induced by the clustered regularly interspersed short palindromic repeats (CRISPR)/Cas9 system. ZmMs33 is preferentially expressed in the immature anther from the quartet to early-vacuolate microspore stages and in root tissues at the fifth leaf growth stage. Phylogenetic analysis indicated that ZmMs33 and OsGPAT3 are evolutionarily conserved for anther and pollen development in monocot species. This study reveals that the monocot-specific GPAT3 protein plays an important role in male fertility in maize, and ZmMs33 and mutants in this gene may have value in maize male-sterile line breeding and hybrid seed production.