WorldWideScience

Sample records for genes encoding calmodulin-binding

  1. MUTATIONS IN CALMODULIN GENES

    DEFF Research Database (Denmark)

    2013-01-01

    The present invention relates to an isolated polynucleotide encoding at least a part of calmodulin and an isolated polypeptide comprising at least a part of a calmodulin protein, wherein the polynucleotide and the polypeptide comprise at least one mutation associated with a cardiac disorder. The ...... the binding of calmodulin to ryanodine receptor 2 and use of such compound in a treatment of an individual having a cardiac disorder. The invention further provides a kit that can be used to detect specific mutations in calmodulin encoding genes....

  2. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  3. Functional, genetic and bioinformatic characterization of a calcium/calmodulin kinase gene in Sporothrix schenckii

    Directory of Open Access Journals (Sweden)

    Rodriguez-del Valle Nuri

    2007-11-01

    Full Text Available Abstract Background Sporothrix schenckii is a pathogenic, dimorphic fungus, the etiological agent of sporotrichosis, a subcutaneous lymphatic mycosis. Dimorphism in S. schenckii responds to second messengers such as cAMP and calcium, suggesting the possible involvement of a calcium/calmodulin kinase in its regulation. In this study we describe a novel calcium/calmodulin-dependent protein kinase gene in S. schenckii, sscmk1, and the effects of inhibitors of calmodulin and calcium/calmodulin kinases on the yeast to mycelium transition and the yeast cell cycle. Results Using the PCR homology approach a new member of the calcium/calmodulin kinase family, SSCMK1, was identified in this fungus. The cDNA sequence of sscmk1 revealed an open reading frame of 1,221 nucleotides encoding a 407 amino acid protein with a predicted molecular weight of 45.6 kDa. The genomic sequence of sscmk1 revealed the same ORF interrupted by five introns. Bioinformatic analyses of SSCMK1 showed that this protein had the distinctive features that characterize a calcium/calmodulin protein kinase: a serine/threonine protein kinase domain and a calmodulin-binding domain. When compared to homologues from seven species of filamentous fungi, SSCMK1 showed substantial similarities, except for a large and highly variable region that encompasses positions 330 – 380 of the multiple sequence alignment. Inhibition studies using calmodulin inhibitor W-7, and calcium/calmodulin kinase inhibitors, KN-62 and lavendustin C, were found to inhibit budding by cells induced to re-enter the yeast cell cycle and to favor the yeast to mycelium transition. Conclusion This study constitutes the first evidence of the presence of a calcium/calmodulin kinase-encoding gene in S. schenckii and its possible involvement as an effector of dimorphism in this fungus. These results suggest that a calcium/calmodulin dependent signaling pathway could be involved in the regulation of dimorphism in this fungus

  4. Calmodulin Mutations Associated with Recurrent Cardiac Arrest in Infants

    Science.gov (United States)

    Crotti, Lia; Johnson, Christopher N.; Graf, Elisabeth; De Ferrari, Gaetano M.; Cuneo, Bettina F.; Ovadia, Marc; Papagiannis, John; Feldkamp, Michael D.; Rathi, Subodh G.; Kunic, Jennifer D.; Pedrazzini, Matteo; Wieland, Thomas; Lichtner, Peter; Beckmann, Britt-Maria; Clark, Travis; Shaffer, Christian; Benson, D. Woodrow; Kääb, Stefan; Meitinger, Thomas; Strom, Tim M.; Chazin, Walter J.; Schwartz, Peter J.; George, Alfred L.

    2013-01-01

    Background Life-threatening disorders of heart rhythm may arise during infancy and can result in the sudden and tragic death of a child. We performed exome sequencing on two unrelated infants presenting with recurrent cardiac arrest to discover a genetic cause. Methods and Results We ascertained two unrelated infants (probands) with recurrent cardiac arrest and dramatically prolonged QTc interval who were both born to healthy parents. The two parent-child trios were investigated using exome sequencing to search for de novo genetic variants. We then performed follow-up candidate gene screening on an independent cohort of 82 subjects with congenital long-QT syndrome without an identified genetic cause. Biochemical studies were performed to determine the functional consequences of mutations discovered in two genes encoding calmodulin. We discovered three heterozygous de novo mutations in either CALM1 or CALM2, two of the three human genes encoding calmodulin, in the two probands and in two additional subjects with recurrent cardiac arrest. All mutation carriers were infants who exhibited life-threatening ventricular arrhythmias combined variably with epilepsy and delayed neurodevelopment. Mutations altered residues in or adjacent to critical calcium binding loops in the calmodulin carboxyl-terminal domain. Recombinant mutant calmodulins exhibited several fold reductions in calcium binding affinity. Conclusions Human calmodulin mutations disrupt calcium ion binding to the protein and are associated with a life-threatening condition in early infancy. Defects in calmodulin function will disrupt important calcium signaling events in heart affecting membrane ion channels, a plausible molecular mechanism for potentially deadly disturbances in heart rhythm during infancy. PMID:23388215

  5. Interaction of calmodulin with the calmodulin binding domain of the plasma membrane Ca2+ pump

    International Nuclear Information System (INIS)

    Vorherr, T.; James, P.; Krebs, J.; Carafoli, E.; McCormick, D.J.; Penniston, J.T.; Enyedi, A.

    1990-01-01

    Peptides corresponding to the calmodulin binding domain of the plasma membrane Ca 2+ pump were synthesized, and their interaction with calmodulin was studied with circular dichroism, infrared spectroscopy, nuclear magnetic resonance, and fluorescence techniques. They corresponded to the complete calmodulin binding domain (28 residues), to its first 15 or 20 amino acids, and to its C-terminal 14 amino acids. The first three peptides interacted with calmodulin. The K value was similar to that of the intact enzyme in the 28 and 20 amino acid peptides, but increased substantially in the shorter 15 amino acid peptide. The 14 amino acid peptide corresponding to the C-terminal portion of the domain failed to bind calmodulin. 2D NMR experiments on the 20 amino acid peptides have indicated that the interaction occurred with the C-terminal half of calmodulin. A tryptophan that is conserved in most calmodulin binding domains of proteins was replaced by other amino acids, giving rise to modified peptides which had lower affinity for calmodulin. An 18 amino acid peptide corresponding to an acidic sequence immediately N-terminal to the calmodulin binding domain which is likely to be a Ca 2+ binding site in the pump was also synthesized. Circular dichroism experiments have shown that it interacted with calmodulin binding domain, supporting the suggestion that the latter, or a portion of it, may act as a natural inhibitor of the pump

  6. Cloning and expression of calmodulin gene in Scoparia dulcis.

    Science.gov (United States)

    Saitoh, Daisuke; Asakura, Yuki; Nkembo, Marguerite Kasidimoko; Shite, Masato; Sugiyama, Ryuji; Lee, Jung-Bum; Hayashi, Toshimitsu; Kurosaki, Fumiya

    2007-06-01

    A homology-based cloning strategy yielded a cDNA clone, designated Sd-cam, encoding calmodulin protein from Scoparia dulcis. The restriction digests of genomic DNA of S. dulcis showed a single hybridized signal when probed with the fragment of this gene in Southern blot analyses, suggesting that Sd-cam occurs as a sole gene encoding calmodulin in the plant. The reverse-transcription polymerase chain reaction analysis revealed that Sd-cam was appreciably expressed in leaf, root and stem tissues. It appeared that transcription of this gene increased transiently when the leaf cultures of S. dulcis were treated with methyl jasmonate and calcium ionophore A23187. These results suggest that transcriptional activation of Sd-cam is one of the early cellular events of the methyl jasmonate-induced responses of S. dulcis.

  7. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  8. MIPS: a calmodulin-binding protein of Gracilaria lemaneiformis under heat shock.

    Science.gov (United States)

    Zhang, Xuan; Zhou, Huiyue; Zang, Xiaonan; Gong, Le; Sun, Hengyi; Zhang, Xuecheng

    2014-08-01

    To study the Ca(2+)/Calmodulin (CaM) signal transduction pathway of Gracilaria lemaneiformis under heat stress, myo-inositol-1-phosphate synthase (MIPS), a calmodulin-binding protein, was isolated using the yeast two-hybrid system. cDNA and DNA sequences of mips were cloned from G. lemaneiformis by using 5'RACE and genome walking procedures. The MIPS DNA sequence was 2,067 nucleotides long, containing an open reading frame (ORF) of 1,623 nucleotides with no intron. The mips ORF was predicted to encode 540 amino acids, which included the conserved MIPS domain and was 61-67 % similar to that of other species. After analyzing the amino acid sequence of MIPS, the CaM-Binding Domain (CaMBD) was inferred to be at a site spanning from amino acid 212 to amino acid 236. The yeast two-hybrid results proved that MIPS can interact with CaM and that MIPS is a type of calmodulin-binding protein. Next, the expression of CaM and MIPS in wild-type G. lemaneiformis and a heat-tolerant G. lemaneiformis cultivar, "981," were analyzed using real-time PCR under a heat shock of 32 °C. The expression level displayed a cyclical upward trend. Compared with wild type, the CaM expression levels of cultivar 981 were higher, which might directly relate to its resistance to high temperatures. This paper indicates that MIPS and CaM may play important roles in the high-temperature resistance of G. lemaneiformis.

  9. Mutations in calmodulin cause ventricular tachycardia and sudden cardiac death

    DEFF Research Database (Denmark)

    Nyegaard, Mette; Overgaard, Michael Toft; Sondergaard, M.T.

    2012-01-01

    a substantial part of sudden cardiac deaths in young individuals. Mutations in RYR2, encoding the cardiac sarcoplasmic calcium channel, have been identified as causative in approximately half of all dominantly inherited CPVT cases. Applying a genome-wide linkage analysis in a large Swedish family with a severe......Catecholaminergic polymorphic ventricular tachycardia (CPVT) is a devastating inherited disorder characterized by episodic syncope and/or sudden cardiac arrest during exercise or acute emotion in individuals without structural cardiac abnormalities. Although rare, CPVT is suspected to cause...... calmodulin-binding-domain peptide at low calcium concentrations. We conclude that calmodulin mutations can cause severe cardiac arrhythmia and that the calmodulin genes are candidates for genetic screening of individual cases and families with idiopathic ventricular tachycardia and unexplained sudden cardiac...

  10. Tau regulates the subcellular localization of calmodulin

    Energy Technology Data Exchange (ETDEWEB)

    Barreda, Elena Gomez de [Centro de Biologia Molecular ' Severo Ochoa' , CSIC/UAM, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); Avila, Jesus, E-mail: javila@cbm.uam.es [Centro de Biologia Molecular ' Severo Ochoa' , CSIC/UAM, Universidad Autonoma de Madrid, Cantoblanco, 28049 Madrid (Spain); CIBER de Enfermedades Neurodegenerativas, 28031 Madrid (Spain)

    2011-05-13

    Highlights: {yields} In this work we have tried to explain how a cytoplasmic protein could regulate a cell nuclear function. We have tested the role of a cytoplasmic protein (tau) in regulating the expression of calbindin gene. We found that calmodulin, a tau-binding protein with nuclear and cytoplasmic localization, increases its nuclear localization in the absence of tau. Since nuclear calmodulin regulates calbindin expression, a decrease in nuclear calmodulin, due to the presence of tau that retains it at the cytoplasm, results in a change in calbindin expression. -- Abstract: Lack of tau expression in neuronal cells results in a change in the expression of few genes. However, little is known about how tau regulates gene expression. Here we show that the presence of tau could alter the subcellular localization of calmodulin, a protein that could be located at the cytoplasm or in the nucleus. Nuclear calmodulin binds to co-transcription factors, regulating the expression of genes like calbindin. In this work, we have found that in neurons containing tau, a higher proportion of calmodulin is present in the cytoplasm compared with neurons lacking tau and that an increase in cytoplasmic calmodulin correlates with a higher expression of calbindin.

  11. Tau regulates the subcellular localization of calmodulin

    International Nuclear Information System (INIS)

    Barreda, Elena Gomez de; Avila, Jesus

    2011-01-01

    Highlights: → In this work we have tried to explain how a cytoplasmic protein could regulate a cell nuclear function. We have tested the role of a cytoplasmic protein (tau) in regulating the expression of calbindin gene. We found that calmodulin, a tau-binding protein with nuclear and cytoplasmic localization, increases its nuclear localization in the absence of tau. Since nuclear calmodulin regulates calbindin expression, a decrease in nuclear calmodulin, due to the presence of tau that retains it at the cytoplasm, results in a change in calbindin expression. -- Abstract: Lack of tau expression in neuronal cells results in a change in the expression of few genes. However, little is known about how tau regulates gene expression. Here we show that the presence of tau could alter the subcellular localization of calmodulin, a protein that could be located at the cytoplasm or in the nucleus. Nuclear calmodulin binds to co-transcription factors, regulating the expression of genes like calbindin. In this work, we have found that in neurons containing tau, a higher proportion of calmodulin is present in the cytoplasm compared with neurons lacking tau and that an increase in cytoplasmic calmodulin correlates with a higher expression of calbindin.

  12. New human erythrocyte protein with binding sites for both spectrin and calmodulin

    International Nuclear Information System (INIS)

    Gardner, K.; Bennett, V.

    1986-01-01

    A new cytoskeletal protein that binds calmodulin has been purified to greater than 95% homogeneity from human erythrocyte cytoskeletons. The protein is a heterodimer with subunits of 103,000 and 97,000 and M/sub r/ = 197,000 calculated from its Stokes radius of 6.9 nm and sedimentation coefficient of 6.8. A binding affinity of this protein for calmodulin has been estimated to be 230 nM by displacement of two different concentrations of 125 I-azidocalmodulin with increasing concentrations of unmodified calmodulin followed by Dixon plot analysis. This protein is present in red cells at approximately 30,000 copies per cell and contains a very tight binding site(s) on cytoskeletons. The protein can be only partially solubilized from isolated cytoskeletons in buffers containing high salt, but can be totally solubilized from red cell ghost membranes by extraction in low ionic strength buffers. Affinity purified IgG against this calmodulin-binding protein identifies crossreacting polypeptide(s) in brain, kidney, testes and retina. Visualization of the calmodulin-binding protein by negative staining, rotary shadowing and unidirectional shadowing indicate that it is a flattened circular molecule with molecular height of 5.4 nm and a diameter of 12.4 nm. Preliminary cosedimentation studies with purified spectrin and F-actin indicate that the site of interaction of this calmodulin-binding protein with the cytoskeleton resides on spectrin

  13. A calmodulin-like protein (LCALA) is a new Leishmania amazonensis candidate for telomere end-binding protein.

    Science.gov (United States)

    Morea, Edna G O; Viviescas, Maria Alejandra; Fernandes, Carlos A H; Matioli, Fabio F; Lira, Cristina B B; Fernandez, Maribel F; Moraes, Barbara S; da Silva, Marcelo S; Storti, Camila B; Fontes, Marcos R M; Cano, Maria Isabel N

    2017-11-01

    Leishmania spp. telomeres are composed of 5'-TTAGGG-3' repeats associated with proteins. We have previously identified LaRbp38 and LaRPA-1 as proteins that bind the G-rich telomeric strand. At that time, we had also partially characterized a protein: DNA complex, named LaGT1, but we could not identify its protein component. Using protein-DNA interaction and competition assays, we confirmed that LaGT1 is highly specific to the G-rich telomeric single-stranded DNA. Three protein bands, with LaGT1 activity, were isolated from affinity-purified protein extracts in-gel digested, and sequenced de novo using mass spectrometry analysis. In silico analysis of the digested peptide identified them as a putative calmodulin with sequences identical to the T. cruzi calmodulin. In the Leishmania genome, the calmodulin ortholog is present in three identical copies. We cloned and sequenced one of the gene copies, named it LCalA, and obtained the recombinant protein. Multiple sequence alignment and molecular modeling showed that LCalA shares homology to most eukaryotes calmodulin. In addition, we demonstrated that LCalA is nuclear, partially co-localizes with telomeres and binds in vivo the G-rich telomeric strand. Recombinant LCalA can bind specifically and with relative affinity to the G-rich telomeric single-strand and to a 3'G-overhang, and DNA binding is calcium dependent. We have described a novel candidate component of Leishmania telomeres, LCalA, a nuclear calmodulin that binds the G-rich telomeric strand with high specificity and relative affinity, in a calcium-dependent manner. LCalA is the first reported calmodulin that binds in vivo telomeric DNA. Copyright © 2017 Elsevier B.V. All rights reserved.

  14. CaMELS: In silico prediction of calmodulin binding proteins and their binding sites.

    Science.gov (United States)

    Abbasi, Wajid Arshad; Asif, Amina; Andleeb, Saiqa; Minhas, Fayyaz Ul Amir Afsar

    2017-09-01

    Due to Ca 2+ -dependent binding and the sequence diversity of Calmodulin (CaM) binding proteins, identifying CaM interactions and binding sites in the wet-lab is tedious and costly. Therefore, computational methods for this purpose are crucial to the design of such wet-lab experiments. We present an algorithm suite called CaMELS (CalModulin intEraction Learning System) for predicting proteins that interact with CaM as well as their binding sites using sequence information alone. CaMELS offers state of the art accuracy for both CaM interaction and binding site prediction and can aid biologists in studying CaM binding proteins. For CaM interaction prediction, CaMELS uses protein sequence features coupled with a large-margin classifier. CaMELS models the binding site prediction problem using multiple instance machine learning with a custom optimization algorithm which allows more effective learning over imprecisely annotated CaM-binding sites during training. CaMELS has been extensively benchmarked using a variety of data sets, mutagenic studies, proteome-wide Gene Ontology enrichment analyses and protein structures. Our experiments indicate that CaMELS outperforms simple motif-based search and other existing methods for interaction and binding site prediction. We have also found that the whole sequence of a protein, rather than just its binding site, is important for predicting its interaction with CaM. Using the machine learning model in CaMELS, we have identified important features of protein sequences for CaM interaction prediction as well as characteristic amino acid sub-sequences and their relative position for identifying CaM binding sites. Python code for training and evaluating CaMELS together with a webserver implementation is available at the URL: http://faculty.pieas.edu.pk/fayyaz/software.html#camels. © 2017 Wiley Periodicals, Inc.

  15. Characterization and Functional Analysis of the Calmodulin-Binding Domain of Rac1 GTPase

    Science.gov (United States)

    Xu, Bing; Chelikani, Prashen; Bhullar, Rajinder P.

    2012-01-01

    Rac1, a member of the Rho family of small GTPases, has been shown to promote formation of lamellipodia at the leading edge of motile cells and affect cell migration. We previously demonstrated that calmodulin can bind to a region in the C-terminal of Rac1 and that this interaction is important in the activation of platelet Rac1. Now, we have analyzed amino acid residue(s) in the Rac1-calmodulin binding domain that are essential for the interaction and assessed their functional contribution in Rac1 activation. The results demonstrated that region 151–164 in Rac1 is essential for calmodulin binding. Within the 151–164 region, positively-charged amino acids K153 and R163 were mutated to alanine to study impact on calmodulin binding. Mutant form of Rac1 (K153A) demonstrated significantly reduced binding to calmodulin while the double mutant K153A/R163A demonstrated complete lack of binding to calmodulin. Thrombin or EGF resulted in activation of Rac1 in CHRF-288-11 or HeLa cells respectively and W7 inhibited this activation. Immunoprecipitation studies demonstrated that higher amount of CaM was associated with Rac1 during EGF dependent activation. In cells expressing mutant forms of Rac1 (K153A or K153A/R163A), activation induced by EGF was significantly decreased in comparison to wild type or the R163A forms of Rac1. The lack of Rac1 activation in mutant forms was not due to an inability of GDP-GTP exchange or a change in subcelllular distribution. Moreover, Rac1 activation was decreased in cells where endogenous level of calmodulin was reduced using shRNA knockdown and increased in cells where calmodulin was overexpressed. Docking analysis and modeling demonstrated that K153 in Rac1 interacts with Q41 in calmodulin. These results suggest an important role for calmodulin in the activation of Rac1 and thus, in cytoskeleton reorganization and cell migration. PMID:22905193

  16. Characterization and functional analysis of the calmodulin-binding domain of Rac1 GTPase.

    Directory of Open Access Journals (Sweden)

    Bing Xu

    Full Text Available Rac1, a member of the Rho family of small GTPases, has been shown to promote formation of lamellipodia at the leading edge of motile cells and affect cell migration. We previously demonstrated that calmodulin can bind to a region in the C-terminal of Rac1 and that this interaction is important in the activation of platelet Rac1. Now, we have analyzed amino acid residue(s in the Rac1-calmodulin binding domain that are essential for the interaction and assessed their functional contribution in Rac1 activation. The results demonstrated that region 151-164 in Rac1 is essential for calmodulin binding. Within the 151-164 region, positively-charged amino acids K153 and R163 were mutated to alanine to study impact on calmodulin binding. Mutant form of Rac1 (K153A demonstrated significantly reduced binding to calmodulin while the double mutant K153A/R163A demonstrated complete lack of binding to calmodulin. Thrombin or EGF resulted in activation of Rac1 in CHRF-288-11 or HeLa cells respectively and W7 inhibited this activation. Immunoprecipitation studies demonstrated that higher amount of CaM was associated with Rac1 during EGF dependent activation. In cells expressing mutant forms of Rac1 (K153A or K153A/R163A, activation induced by EGF was significantly decreased in comparison to wild type or the R163A forms of Rac1. The lack of Rac1 activation in mutant forms was not due to an inability of GDP-GTP exchange or a change in subcelllular distribution. Moreover, Rac1 activation was decreased in cells where endogenous level of calmodulin was reduced using shRNA knockdown and increased in cells where calmodulin was overexpressed. Docking analysis and modeling demonstrated that K153 in Rac1 interacts with Q41 in calmodulin. These results suggest an important role for calmodulin in the activation of Rac1 and thus, in cytoskeleton reorganization and cell migration.

  17. Distinct Calcium Signaling Pathways Regulate Calmodulin Gene Expression in Tobacco1

    Science.gov (United States)

    van der Luit, Arnold H.; Olivari, Claudio; Haley, Ann; Knight, Marc R.; Trewavas, Anthony J.

    1999-01-01

    Cold shock and wind stimuli initiate Ca2+ transients in transgenic tobacco (Nicotiana plumbaginifolia) seedlings (named MAQ 2.4) containing cytoplasmic aequorin. To investigate whether these stimuli initiate Ca2+ pathways that are spatially distinct, stress-induced nuclear and cytoplasmic Ca2+ transients and the expression of a stress-induced calmodulin gene were compared. Tobacco seedlings were transformed with a construct that encodes a fusion protein between nucleoplasmin (a major oocyte nuclear protein) and aequorin. Immunocytochemical evidence indicated targeting of the fusion protein to the nucleus in these plants, which were named MAQ 7.11. Comparison between MAQ 7.11 and MAQ 2.4 seedlings confirmed that wind stimuli and cold shock invoke separate Ca2+ signaling pathways. Partial cDNAs encoding two tobacco calmodulin genes, NpCaM-1 and NpCaM-2, were identified and shown to have distinct nucleotide sequences that encode identical polypeptides. Expression of NpCaM-1, but not NpCaM-2, responded to wind and cold shock stimulation. Comparison of the Ca2+ dynamics with NpCaM-1 expression after stimulation suggested that wind-induced NpCaM-1 expression is regulated by a Ca2+ signaling pathway operational predominantly in the nucleus. In contrast, expression of NpCaM-1 in response to cold shock is regulated by a pathway operational predominantly in the cytoplasm. PMID:10557218

  18. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  19. Cloning and analysis of calmodulin gene from Porphyra yezoensis Ueda (Bangiales, Rhodophyta)

    Science.gov (United States)

    Wang, Mengqiang; Mao, Yunxiang; Zhuang, Yunyun; Kong, Fanna; Sui, Zhenghong

    2009-09-01

    In order to understand the mechanisms of signal transduction and anti-desiccation mechanisms of Porphyra yezoensis, cDNA and its genomic sequence of Calmodulin gene (CaM) was cloned by the technique of polymerase chain reaction (PCR) based on the analysis of P. yezoensis ESTs from dbEST database. The result shows that the full-length cDNA of CaM consists of 603 bps including an ORF encoding for 151 amino acids and a terminate codon UGA, while the length of genomic sequence is 1231 bps including 2 exons and 1 intron. The average GC content of the coding region is 58.77%, while the GC content of the third position of this gene is as high as 82.23%. Four Ca2+ binding sites (EF-hand) are found in this gene. The predicted molecular mass of the deduced peptide is 16688.72 Da and the pI is 4.222. By aligning with known CaM genes, the similarity of CaM gene sequence with homologous genes in Chlamydomonas incerta and Chlamydomonas reinhardtii is 72.7% and 72.2% respectively, and the similarity of the deduced amino acid sequence of CaM gene with homologous genes in C. incerta and C. reinhardtii are both 71.5%. This is the first report on CaM from a species of Rhodophyta.

  20. Structure and expression of the chicken calmodulin I gene

    DEFF Research Database (Denmark)

    Ye, Q; Berchtold, M W

    1997-01-01

    The chicken calmodulin I (CaMI) gene has been isolated and characterized on the level of cDNA and genomic DNA. The deduced amino acid (aa) sequence is identical to the one of chicken CaMII which consists of 148 aa. The CaMI gene contains six exons. Its intron/exon organization is identical...... to that of the chicken CaMII and the CaMI and CaMIII genes of rat and human. Expression of the CaMI gene was detected in all chicken tissues examined, although at varying levels. The gene is transcribed into four mRNAs of 0.8, 1.4, 1.7 and 4.4 kb as determined by Northern blot analysis. Our results demonstrate...... that the "multigene-one-protein" principle of CaM synthesis is not only applicable to mammals whose CaM is encoded by three different genes, but also to chickens....

  1. Significance of calcium binding, tyrosine phosphorylation, and lysine trimethylation for the essential function of calmodulin in vertebrate cells analyzed in a novel gene replacement system

    DEFF Research Database (Denmark)

    Panina, Svetlana; Stephan, Alexander; la Cour, Jonas Marstrand

    2012-01-01

    Calmodulin (CaM) was shown to be essential for survival of lower eukaryotes by gene deletion experiments. So far, no CaM gene deletion was reported in higher eukaryotes. In vertebrates, CaM is expressed from several genes, which encode an identical protein, making it difficult to generate a model...... system to study the effect ofCaMgene deletion. Here, we present a novel genetic system based on the chicken DT40 cell line, in which the two functional CaM genes were deleted and one allele replaced with a CaM transgene that can be artificially regulated.Weshow that CaM is essential for survival...

  2. Down-regulation of a calmodulin-related gene during transformation of human mammary epithelial cells

    International Nuclear Information System (INIS)

    Yaswen, P.; Smoll, A.; Stampfer, M.R.; Peehl, D.M.; Trask, D.K.; Sager, R.

    1990-01-01

    A human cDNA library obtained from cultured normal mammary epithelial cells (HMECs) was searched by subtractive hybridization for genes whose decrease in expression might be relevant to epithelial transformation. One clone identified by this procedure corresponded to a 1.4 kilobase mRNA, designated NB-1, whose expression was decreased >50-fold in HMECs tumorigenically transformed in vitro after exposure to benzo[α]pyrene and Kirsten sarcoma virus. Sequence analysis of NB-1 cDNA revealed an open reading frame with a high degree of homology to calmodulin. NB-1 expression could be demonstrated by polymerase chain reaction amplification in normal breast, prostate, cervix, and epidermal tissues. The presence of NB-1 transcripts was variable in primary breast carcinoma tissues and undetectable in tumor-derived cell lines of breast, prostate, or other origins. NB-1 mRNA expression could be down-regulated in cultured HMECs by exposure to reconstituted extracellular matrix material, while exposure to transforming growth factor type β increased its relative abundance. The protein encoded by NB-1 may have Ca 2 plus binding properties and perform functions similar to those of authentic calmodulin. Its possible roles in differentiation and/or suppression of tumorigenicity in epithelial tissues remain to be examined

  3. Molecular characterisation of a calmodulin gene, VcCaM1, that is differentially expressed under aluminium stress in highbush blueberry.

    Science.gov (United States)

    Inostroza-Blancheteau, C; Aquea, F; Loyola, R; Slovin, J; Josway, S; Rengel, Z; Reyes-Díaz, M; Alberdi, M; Arce-Johnson, P

    2013-11-01

    Calmodulin (CaM), a small acidic protein, is one of the best characterised Ca(2+) sensors in eukaryotes. This Ca(2+) -regulated protein plays a critical role in decoding and transducing environmental stress signals by activating specific targets. Many environmental stresses elicit changes in intracellular Ca(2+) activity that could initiate adaptive responses under adverse conditions. We report the first molecular cloning and characterisation of a calmodulin gene, VcCaM1 (Vaccinium corymbosum Calmodulin 1), in the woody shrub, highbush blueberry. VcCaM1 was first identified as VCAL19, a gene induced by aluminium stress in V. corymbosum L. A full-length cDNA of VcCaM1 containing a 766-bp open reading frame (ORF) encoding 149 amino acids was cloned from root RNA. The sequence encodes four Ca(2+) -binding motifs (EF-hands) and shows high similarity (99%) with the isoform CaM 201 of Daucus carota. Expression analyses showed that following Al treatment, VcCaM1 message level decreased in roots of Brigitta, an Al-resistant cultivar, and after 48 h, was lower than in Bluegold, an Al-sensitive cultivar. VcCAM1 message also decreased in leaves of both cultivars within 2 h of treatment. Message levels in leaves then increased by 24 h to control levels in Brigitta, but not in Bluegold, but then decreased again by 48 h. In conclusion, VcCaM1 does not appear to be directly involved in Al resistance, but may be involved in improved plant performance under Al toxicity conditions through regulation of Ca(2+) homeostasis and antioxidant systems in leaves. © 2013 German Botanical Society and The Royal Botanical Society of the Netherlands.

  4. Altered binding of 125I-labeled calmodulin to a 46.5-kilodalton protein in skin fibroblasts cultured from patients with cystic fibrosis

    International Nuclear Information System (INIS)

    Tallant, E.A.; Wallace, R.W.

    1987-01-01

    The levels of calmodulin and calmodulin-binding proteins have been determined in cultured skin fibroblasts from patients with cystic fibrosis (CF) and age- and sex-matched controls. Calmodulin ranged from 0.20 to 0.76 microgram/mg protein; there was no difference between calmodulin concentration in fibroblasts from CF patients and controls. Calmodulin-binding proteins of 230, 212, 204, 164, 139, 70, 59, 46.5, and 41 kD were identified. A protein with a mobility identical to the 59-kD calmodulin-binding protein was labeled by antiserum against calmodulin-dependent phosphatase. Although Ca 2+ /calmodulin-dependent phosphatase activity was detected, there was no different in activity between control and CF fibroblasts or in the level of phosphatase protein as determined by radioimmunoassay. Lower amounts of 125 I-calmodulin were bound to the 46.5-kD calmodulin-binding protein in CF fibroblasts as compared with controls. The 46.5-kD calmodulin-binding protein may be reduced in CF fibroblasts or its structure may be altered resulting in a reduced binding capacity and/or affinity for calmodulin and perhaps reflecting, either directly or indirectly, the genetic defect responsible for cystic fibrosis

  5. Structure and mechanism of calmodulin binding to a signaling sphingolipid reveal new aspects of lipid-protein interactions

    Science.gov (United States)

    Kovacs, Erika; Harmat, Veronika; Tóth, Judit; Vértessy, Beáta G.; Módos, Károly; Kardos, József; Liliom, Károly

    2010-01-01

    Lipid-protein interactions are rarely characterized at a structural molecular level due to technical difficulties; however, the biological significance of understanding the mechanism of these interactions is outstanding. In this report, we provide mechanistic insight into the inhibitory complex formation of the lipid mediator sphingosylphosphorylcholine with calmodulin, the most central and ubiquitous regulator protein in calcium signaling. We applied crystallographic, thermodynamic, kinetic, and spectroscopic approaches using purified bovine calmodulin and bovine cerebral microsomal fraction to arrive at our conclusions. Here we present 1) a 1.6-Å resolution crystal structure of their complex, in which the sphingolipid occupies the conventional hydrophobic binding site on calmodulin; 2) a peculiar stoichiometry-dependent binding process: at low or high protein-to-lipid ratio calmodulin binds lipid micelles or a few lipid molecules in a compact globular conformation, respectively, and 3) evidence that the sphingolipid displaces calmodulin from its targets on cerebral microsomes. We have ascertained the specificity of the interaction using structurally related lipids as controls. Our observations reveal the structural basis of selective calmodulin inhibition by the sphingolipid. On the basis of the crystallographic and biophysical characterization of the calmodulin–sphingosylphosphorylcholine interaction, we propose a novel lipid-protein binding model, which might be applicable to other interactions as well.—Kovacs, E., Harmat, V., Tóth, J., Vértessy, B. G., Módos, K., Kardos, J., Liliom, K. Structure and mechanism of calmodulin binding to a signaling sphingolipid reveal new aspects of lipid-protein interactions. PMID:20522785

  6. Two distinct calmodulin binding sites in the third intracellular loop and carboxyl tail of angiotensin II (AT(1A receptor.

    Directory of Open Access Journals (Sweden)

    Renwen Zhang

    Full Text Available In this study, we present data that support the presence of two distinct calmodulin binding sites within the angiotensin II receptor (AT(1A, at juxtamembrane regions of the N-terminus of the third intracellular loop (i3, amino acids 214-231 and carboxyl tail of the receptor (ct, 302-317. We used bioluminescence resonance energy transfer assays to document interactions of calmodulin with the AT(1A holo-receptor and GST-fusion protein pull-downs to demonstrate that i3 and ct interact with calmodulin in a Ca²⁺-dependent fashion. The former is a 1-12 motif and the latter belongs to 1-5-10 calmodulin binding motif. The apparent Kd of calmodulin for i3 is 177.0±9.1 nM, and for ct is 79.4±7.9 nM as assessed by dansyl-calmodulin fluorescence. Replacement of the tryptophan (W219 for alanine in i3, and phenylalanine (F309 or F313 for alanine in ct reduced their binding affinities for calmodulin, as predicted by computer docking simulations. Exogenously applied calmodulin attenuated interactions between G protein βγ subunits and i3 and ct, somewhat more so for ct than i3. Mutations W219A, F309A, and F313A did not alter Gβγ binding, but reduced the ability of calmodulin to compete with Gβγ, suggesting that calmodulin and Gβγ have overlapping, but not identical, binding requirements for i3 and ct. Calmodulin interference with the Gβγ binding to i3 and ct regions of the AT(1A receptor strongly suggests that calmodulin plays critical roles in regulating Gβγ-dependent signaling of the receptor.

  7. Two Distinct Calmodulin Binding Sites in the Third Intracellular Loop and Carboxyl Tail of Angiotensin II (AT1A) Receptor

    Science.gov (United States)

    Zhang, Renwen; Liu, Zhijie; Qu, Youxing; Xu, Ying; Yang, Qing

    2013-01-01

    In this study, we present data that support the presence of two distinct calmodulin binding sites within the angiotensin II receptor (AT1A), at juxtamembrane regions of the N-terminus of the third intracellular loop (i3, amino acids 214–231) and carboxyl tail of the receptor (ct, 302–317). We used bioluminescence resonance energy transfer assays to document interactions of calmodulin with the AT1A holo-receptor and GST-fusion protein pull-downs to demonstrate that i3 and ct interact with calmodulin in a Ca2+-dependent fashion. The former is a 1–12 motif and the latter belongs to 1-5-10 calmodulin binding motif. The apparent Kd of calmodulin for i3 is 177.0±9.1 nM, and for ct is 79.4±7.9 nM as assessed by dansyl-calmodulin fluorescence. Replacement of the tryptophan (W219) for alanine in i3, and phenylalanine (F309 or F313) for alanine in ct reduced their binding affinities for calmodulin, as predicted by computer docking simulations. Exogenously applied calmodulin attenuated interactions between G protein βγ subunits and i3 and ct, somewhat more so for ct than i3. Mutations W219A, F309A, and F313A did not alter Gβγ binding, but reduced the ability of calmodulin to compete with Gβγ, suggesting that calmodulin and Gβγ have overlapping, but not identical, binding requirements for i3 and ct. Calmodulin interference with the Gβγ binding to i3 and ct regions of the AT1A receptor strongly suggests that calmodulin plays critical roles in regulating Gβγ-dependent signaling of the receptor. PMID:23755207

  8. Changes in the structure of calmodulin induced by a peptide based on the calmodulin-binding domain of myosin light chain kinase

    International Nuclear Information System (INIS)

    Heidorn, D.B.; Seeger, P.A.; Rokop, S.E.; Blumenthal, D.K.; Means, A.R.; Crespi, H.; Trewhella, J.

    1989-01-01

    Small-angle X-ray and neutron scattering data were used to study the solution structure of calmodulin complexed with a synthetic peptide corresponding to residues 577-603 of rabbit skeletal muscle myosin light chain kinase. The X-ray data indicate that, in the presence of Ca 2+ , the calmodulin-peptide complex has a structure that is considerably more compact than uncomplexed calmodulin. The radius of gyration, R g , for the complex is approximately 20% smaller than that of uncomplexed Ca 2+ ·calmodulin, and the maximum dimension, d max , for the complex is also about 20% smaller. The peptide-induced conformational rearrangement of calmodulin is [Ca 2+ ] dependent. The length distribution function for the complex is more symmetric than that for uncomplexed Ca 2+ ·calmodulin, indicating that more of the mass is distributed toward the center of mass for the complex, compared with the dumbbell-shaped Ca 2+ ·calmodulin. The solvent contrast dependence of R g for neutron scattering indicates that the peptide is located more toward the center of the complex, while the calmodulin is located more peripherally, and that the centers of mass of the calmodulin and the peptide are not coincident. The scattering data support the hypothesis that the interconnecting helix region observed in the crystal structure for calmodulin is quite flexible in solution, allowing the two lobes of calmodulin to form close contacts on binding the peptide. This flexibility of the central helix may play a critical role in activating target enzymes such as myosin light chain kinase

  9. Structure of calmodulin complexed with an olfactory CNG channel fragment and role of the central linker: Residual dipolar couplings to evaluate calmodulin binding modes outside the kinase family

    International Nuclear Information System (INIS)

    Contessa, Gian Marco; Orsale, Maria; Melino, Sonia; Torre, Vincent; Paci, Maurizio; Desideri, Alessandro; Cicero, Daniel O.

    2005-01-01

    The NMR high-resolution structure of calmodulin complexed with a fragment of the olfactory cyclic-nucleotide gated channel is described. This structure shows features that are unique for this complex, including an active role of the linker connecting the N- and C-lobes of calmodulin upon binding of the peptide. Such linker is not only involved in the formation of an hydrophobic pocket to accommodate a bulky peptide residue, but it also provides a positively charged region complementary to a negative charge of the target. This complex of calmodulin with a target not belonging to the kinase family was used to test the residual dipolar coupling (RDC) approach for the determination of calmodulin binding modes to peptides. Although the complex here characterized belongs to the (1--14) family, high Q values were obtained with all the 1:1 complexes for which crystalline structures are available. Reduction of the RDC data set used for the correlation analysis to structured regions of the complex allowed a clear identification of the binding mode. Excluded regions comprise calcium binding loops and loops connecting the EF-hand motifs

  10. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  11. Identification of the divergent calmodulin binding motif in yeast Ssb1/Hsp75 protein and in other HSP70 family members.

    Science.gov (United States)

    Heinen, R C; Diniz-Mendes, L; Silva, J T; Paschoalin, V M F

    2006-11-01

    Yeast soluble proteins were fractionated by calmodulin-agarose affinity chromatography and the Ca2+/calmodulin-binding proteins were analyzed by SDS-PAGE. One prominent protein of 66 kDa was excised from the gel, digested with trypsin and the masses of the resultant fragments were determined by MALDI/MS. Twenty-one of 38 monoisotopic peptide masses obtained after tryptic digestion were matched to the heat shock protein Ssb1/Hsp75, covering 37% of its sequence. Computational analysis of the primary structure of Ssb1/Hsp75 identified a unique potential amphipathic alpha-helix in its N-terminal ATPase domain with features of target regions for Ca2+/calmodulin binding. This region, which shares 89% similarity to the experimentally determined calmodulin-binding domain from mouse, Hsc70, is conserved in near half of the 113 members of the HSP70 family investigated, from yeast to plant and animals. Based on the sequence of this region, phylogenetic analysis grouped the HSP70s in three distinct branches. Two of them comprise the non-calmodulin binding Hsp70s BIP/GR78, a subfamily of eukaryotic HSP70 localized in the endoplasmic reticulum, and DnaK, a subfamily of prokaryotic HSP70. A third heterogeneous group is formed by eukaryotic cytosolic HSP70s containing the new calmodulin-binding motif and other cytosolic HSP70s whose sequences do not conform to those conserved motif, indicating that not all eukaryotic cytosolic Hsp70s are target for calmodulin regulation. Furthermore, the calmodulin-binding domain found in eukaryotic HSP70s is also the target for binding of Bag-1 - an enhancer of ADP/ATP exchange activity of Hsp70s. A model in which calmodulin displaces Bag-1 and modulates Ssb1/Hsp75 chaperone activity is discussed.

  12. Identification of the divergent calmodulin binding motif in yeast Ssb1/Hsp75 protein and in other HSP70 family members

    Directory of Open Access Journals (Sweden)

    R.C. Heinen

    2006-11-01

    Full Text Available Yeast soluble proteins were fractionated by calmodulin-agarose affinity chromatography and the Ca2+/calmodulin-binding proteins were analyzed by SDS-PAGE. One prominent protein of 66 kDa was excised from the gel, digested with trypsin and the masses of the resultant fragments were determined by MALDI/MS. Twenty-one of 38 monoisotopic peptide masses obtained after tryptic digestion were matched to the heat shock protein Ssb1/Hsp75, covering 37% of its sequence. Computational analysis of the primary structure of Ssb1/Hsp75 identified a unique potential amphipathic alpha-helix in its N-terminal ATPase domain with features of target regions for Ca2+/calmodulin binding. This region, which shares 89% similarity to the experimentally determined calmodulin-binding domain from mouse, Hsc70, is conserved in near half of the 113 members of the HSP70 family investigated, from yeast to plant and animals. Based on the sequence of this region, phylogenetic analysis grouped the HSP70s in three distinct branches. Two of them comprise the non-calmodulin binding Hsp70s BIP/GR78, a subfamily of eukaryotic HSP70 localized in the endoplasmic reticulum, and DnaK, a subfamily of prokaryotic HSP70. A third heterogeneous group is formed by eukaryotic cytosolic HSP70s containing the new calmodulin-binding motif and other cytosolic HSP70s whose sequences do not conform to those conserved motif, indicating that not all eukaryotic cytosolic Hsp70s are target for calmodulin regulation. Furthermore, the calmodulin-binding domain found in eukaryotic HSP70s is also the target for binding of Bag-1 - an enhancer of ADP/ATP exchange activity of Hsp70s. A model in which calmodulin displaces Bag-1 and modulates Ssb1/Hsp75 chaperone activity is discussed.

  13. IQCJ-SCHIP1, a novel fusion transcript encoding a calmodulin-binding IQ motif protein

    International Nuclear Information System (INIS)

    Kwasnicka-Crawford, Dorota A.; Carson, Andrew R.; Scherer, Stephen W.

    2006-01-01

    The existence of transcripts that span two adjacent, independent genes is considered rare in the human genome. This study characterizes a novel human fusion gene named IQCJ-SCHIP1. IQCJ-SCHIP1 is the longest isoform of a complex transcriptional unit that bridges two separate genes that encode distinct proteins, IQCJ, a novel IQ motif containing protein and SCHIP1, a schwannomin interacting protein that has been previously shown to interact with the Neurofibromatosis type 2 (NF2) protein. IQCJ-SCHIP1 is located on the chromosome 3q25 and comprises a 1692-bp transcript encompassing 11 exons spanning 828 kb of the genomic DNA. We show that IQCJ-SCHIP1 mRNA is highly expressed in the brain. Protein encoded by the IQCJ-SCHIP1 gene was localized to cytoplasm and actin-rich regions and in differentiated PC12 cells was also seen in neurite extensions

  14. Dual Regulation of a Chimeric Plant Serine/Threonine Kinase by Calcium and Calcium/Calmodulin

    Science.gov (United States)

    Takezawa, D.; Ramachandiran, S.; Paranjape, V.; Poovaiah, B. W.

    1996-01-01

    A chimeric Ca(2+)/calmodulin-dependent protein kinase (CCaMK) gene characterized by a catalytic domain, a calmodulin-binding domain, and a neural visinin-like Ca(2+)-binding domain was recently cloned from plants. The Escherichia coli-expressed CCaMK phosphorylates various protein and peptide substrates in a Ca(2+)/calmodulin-dependent manner. The calmodulin-binding region of CCAMK has similarity to the calmodulin-binding region of the alpha-subunit of multifunctional Ca(2+)/calmodulin-dependent protein kinase (CaMKII). CCaMK exhibits basal autophosphorylation at the threonine residue(s) (0.098 mol of P-32/mol) that is stimulated 3.4-fold by Ca(2+) (0.339 mol of P-32/mol), while calmodulin inhibits Ca(2+)-stimulated autophosphorylation to the basal level. A deletion mutant lacking the visinin-like domain did not show Ca(2+)-simulated autophosphorylation activity but retained Ca(2+)/calmodulin-dependent protein kinase activity at a reduced level. Ca(2+)-dependent mobility shift assays using E.coli-expressed protein from residues 358-520 revealed that Ca(2+) binds to the visinin-like domain. Studies with site-directed mutants of the visinin-like domain indicated that EF-hands II and III are crucial for Ca(2+)-induced conformational changes in the visinin-like domain. Autophosphorylation of CCaMK increases Ca(2+)/calmodulin-dependent protein kinase activity by about 5-fold, whereas it did not affect its C(2+)-independent activity. This report provides evidence for the existence of a protein kinase in plants that is modulated by Ca(2+) and Ca(2+)/calmodulin. The presence of a visinin-like Ca(2+)-binding domain in CCaMK adds an additional Ca(2+)-sensing mechanism not previously known to exist in the Ca(2+)/calmodulin-mediated signaling cascade in plants.

  15. Hydrogen peroxide-mediated oxidative stress disrupts calcium binding on calmodulin: More evidence for oxidative stress in vitiligo

    International Nuclear Information System (INIS)

    Schallreuter, K.U.; Gibbons, N.C.J.; Zothner, C.; Abou Elloof, M.M.; Wood, J.M.

    2007-01-01

    Patients with acute vitiligo have low epidermal catalase expression/activities and accumulate 10 -3 M H 2 O 2 . One consequence of this severe oxidative stress is an altered calcium homeostasis in epidermal keratinocytes and melanocytes. Here, we show decreased epidermal calmodulin expression in acute vitiligo. Since 10 -3 M H 2 O 2 oxidises methionine and tryptophan residues in proteins, we examined calcium binding to calmodulin in the presence and absence of H 2 O 2 utilising 45 calcium. The results showed that all four calcium atoms exchanged per molecule of calmodulin. Since oxidised calmodulin looses its ability to activate calcium ATPase, enzyme activities were followed in full skin biopsies from lesional skin of patients with acute vitiligo (n = 6) and healthy controls (n = 6). The results yielded a 4-fold decrease of ATPase activities in the patients. Computer simulation of native and oxidised calmodulin confirmed the loss of all four calcium ions from their specific EF-hand domains. Taken together H 2 O 2 -mediated oxidation affects calcium binding in calmodulin leading to perturbed calcium homeostasis and perturbed L-phenylalanine-uptake in the epidermis of acute vitiligo

  16. Characterization and functional analysis of Calmodulin and Calmodulin-like genes in Fragaria vesca

    Directory of Open Access Journals (Sweden)

    Kai Zhang

    2016-12-01

    Full Text Available Calcium is a universal messenger that is involved in the modulation of diverse developmental and adaptive processes in response to various stimuli. Calmodulin (CaM and calmodulin-like (CML proteins are major calcium sensors in all eukaryotes, and they have been extensively investigated for many years in plants and animals. However, little is known about CaMs and CMLs in woodland strawberry (Fragaria vesca. In this study, we performed a genome-wide analysis of the strawberry genome and identified 4 CaM and 36 CML genes. Bioinformatics analyses, including gene structure, phylogenetic tree, synteny and three-dimensional model assessments, revealed the conservation and divergence of FvCaMs and FvCMLs, thus providing insight regarding their functions. In addition, the transcript abundance of four FvCaM genes and the four most related FvCML genes were examined in different tissues and in response to multiple stress and hormone treatments. Moreover, we investigated the subcellular localization of several FvCaMs and FvCMLs, revealing their potential interactions based on the localizations and potential functions. Furthermore, overexpression of five FvCaM and FvCML genes could not induce a hypersensitive response, but four of the five genes could increase resistance to Agrobacterium tumefaciens in Nicotiana benthamiana leaves. This study provides evidence for the biological roles of FvCaM and CML genes, and the results lay the foundation for future functional studies of these genes.

  17. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  18. A novel calmodulin-regulated Ca2+-ATPase (ACA2) from Arabidopsis with an N-terminal autoinhibitory domain

    Science.gov (United States)

    Harper, J. F.; Hong, B.; Hwang, I.; Guo, H. Q.; Stoddard, R.; Huang, J. F.; Palmgren, M. G.; Sze, H.; Evans, M. L. (Principal Investigator)

    1998-01-01

    To study transporters involved in regulating intracellular Ca2+, we isolated a full-length cDNA encoding a Ca2+-ATPase from a model plant, Arabidopsis, and named it ACA2 (Arabidopsis Ca2+-ATPase, isoform 2). ACA2p is most similar to a "plasma membrane-type" Ca2+-ATPase, but is smaller (110 kDa), contains a unique N-terminal domain, and is missing a long C-terminal calmodulin-binding regulatory domain. In addition, ACA2p is localized to an endomembrane system and not the plasma membrane, as shown by aqueous-two phase fractionation of microsomal membranes. ACA2p was expressed in yeast as both a full-length protein (ACA2-1p) and an N-terminal truncation mutant (ACA2-2p; Delta residues 2-80). Only the truncation mutant restored the growth on Ca2+-depleted medium of a yeast mutant defective in both endogenous Ca2+ pumps, PMR1 and PMC1. Although basal Ca2+-ATPase activity of the full-length protein was low, it was stimulated 5-fold by calmodulin (50% activation around 30 nM). In contrast, the truncated pump was fully active and insensitive to calmodulin. A calmodulin-binding sequence was identified within the first 36 residues of the N-terminal domain, as shown by calmodulin gel overlays on fusion proteins. Thus, ACA2 encodes a novel calmodulin-regulated Ca2+-ATPase distinguished by a unique N-terminal regulatory domain and a non-plasma membrane localization.

  19. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas.

    Science.gov (United States)

    Li, Xing-Xia; Yu, Wen-Chao; Cai, Zhong-Qiang; He, Cheng; Wei, Na; Wang, Xiao-Tong; Yue, Xi-Qing

    2016-01-01

    The shell of the pearl oyster ( Pinctada fucata ) mainly comprises aragonite whereas that of the Pacific oyster ( Crassostrea gigas ) is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM) is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM) and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  20. Molecular Cloning and Characterization of Full-Length cDNA of Calmodulin Gene from Pacific Oyster Crassostrea gigas

    Directory of Open Access Journals (Sweden)

    Xing-Xia Li

    2016-01-01

    Full Text Available The shell of the pearl oyster (Pinctada fucata mainly comprises aragonite whereas that of the Pacific oyster (Crassostrea gigas is mainly calcite, thereby suggesting the different mechanisms of shell formation between above two mollusks. Calmodulin (CaM is an important gene for regulating the uptake, transport, and secretion of calcium during the process of shell formation in pearl oyster. It is interesting to characterize the CaM in oysters, which could facilitate the understanding of the different shell formation mechanisms among mollusks. We cloned the full-length cDNA of Pacific oyster CaM (cgCaM and found that the cgCaM ORF encoded a peptide of 113 amino acids containing three EF-hand calcium-binding domains, its expression level was highest in the mantle, hinting that the cgCaM gene is probably involved in shell formation of Pacific oyster, and the common ancestor of Gastropoda and Bivalvia may possess at least three CaM genes. We also found that the numbers of some EF hand family members in highly calcified species were higher than those in lowly calcified species and the numbers of these motifs in oyster genome were the highest among the mollusk species with whole genome sequence, further hinting the correlation between CaM and biomineralization.

  1. Calcium ion binding properties of Medicago truncatula calcium/calmodulin-dependent protein kinase.

    Science.gov (United States)

    Swainsbury, David J K; Zhou, Liang; Oldroyd, Giles E D; Bornemann, Stephen

    2012-09-04

    A calcium/calmodulin-dependent protein kinase (CCaMK) is essential in the interpretation of calcium oscillations in plant root cells for the establishment of symbiotic relationships with rhizobia and mycorrhizal fungi. Some of its properties have been studied in detail, but its calcium ion binding properties and subsequent conformational change have not. A biophysical approach was taken with constructs comprising either the visinin-like domain of Medicago truncatula CCaMK, which contains EF-hand motifs, or this domain together with the autoinhibitory domain. The visinin-like domain binds three calcium ions, leading to a conformational change involving the exposure of hydrophobic surfaces and a change in tertiary but not net secondary or quaternary structure. The affinity for calcium ions of visinin-like domain EF-hands 1 and 2 (K(d) = 200 ± 50 nM) was appropriate for the interpretation of calcium oscillations (~125-850 nM), while that of EF-hand 3 (K(d) ≤ 20 nM) implied occupancy at basal calcium ion levels. Calcium dissociation rate constants were determined for the visinin-like domain of CCaMK, M. truncatula calmodulin 1, and the complex between these two proteins (the slowest of which was 0.123 ± 0.002 s(-1)), suggesting the corresponding calcium association rate constants were at or near the diffusion-limited rate. In addition, the dissociation of calmodulin from the protein complex was shown to be on the same time scale as the dissociation of calcium ions. These observations suggest that the formation and dissociation of the complex between calmodulin and CCaMK would substantially mirror calcium oscillations, which typically have a 90 s periodicity.

  2. Calmodulin Gene Expression in Response to Mechanical Wounding and Botrytis cinerea Infection in Tomato Fruit

    Directory of Open Access Journals (Sweden)

    Hui Peng

    2014-08-01

    Full Text Available Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen inoculation triggered expression of all those genes, with SlCaM2 being the most responsive one to both treatments. Furthermore, all calmodulin genes were upregulated by salicylic acid and methyl jasmonate, two signaling molecules involved in plant immunity. In addition to SlCaM2, SlCaM1 was highly responsive to salicylic acid and methyl jasmonate. However, SlCaM2 exhibited a more rapid and stronger response than SlCaM1. Overexpression of SlCaM2 in tomato fruit enhanced resistance to Botrytis-induced decay, whereas reducing its expression resulted in increased lesion development. These results indicate that calmodulin is a positive regulator of plant defense in fruit by activating defense pathways including salicylate- and jasmonate-signaling pathways, and SlCaM2 is the major calmodulin gene responsible for this event.

  3. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  4. Kv7 channels can function without constitutive calmodulin tethering.

    Directory of Open Access Journals (Sweden)

    Juan Camilo Gómez-Posada

    Full Text Available M-channels are voltage-gated potassium channels composed of Kv7.2-7.5 subunits that serve as important regulators of neuronal excitability. Calmodulin binding is required for Kv7 channel function and mutations in Kv7.2 that disrupt calmodulin binding cause Benign Familial Neonatal Convulsions (BFNC, a dominantly inherited human epilepsy. On the basis that Kv7.2 mutants deficient in calmodulin binding are not functional, calmodulin has been defined as an auxiliary subunit of Kv7 channels. However, we have identified a presumably phosphomimetic mutation S511D that permits calmodulin-independent function. Thus, our data reveal that constitutive tethering of calmodulin is not required for Kv7 channel function.

  5. The Saccharomyces cerevisiae RAD18 gene encodes a protein that contains potential zinc finger domains for nucleic acid binding and a putative nucleotide binding sequence

    Energy Technology Data Exchange (ETDEWEB)

    Jones, J.S.; Prakash, L. (Univ. of Rochester School of Medicine, NY (USA)); Weber, S. (Kodak Research Park, Rochester, NY (USA))

    1988-07-25

    The RAD18 gene of Saccharomyces cerevisiae is required for postreplication repair of UV damaged DNA. The authors have isolated the RAD18 gene, determined its nucleotide sequence and examined if deletion mutations of this gene show different or more pronounced phenotypic effects than the previously described point mutations. The RAD18 gene open reading frame encodes a protein of 487 amino acids, with a calculated molecular weight of 55,512. The RAD18 protein contains three potential zinc finger domains for nucleic acid binding, and a putative nucleotide binding sequence that is present in many proteins that bind and hydrolyze ATP. The DNA binding and nucleotide binding activities could enable the RAD18 protein to bind damaged sites in the template DNA with high affinity. Alternatively, or in addition, RAD18 protein may be a transcriptional regulator. The RAD18 deletion mutation resembles the previously described point mutations in its effects on viability, DNA repair, UV mutagenesis, and sporulation.

  6. Arabidopsis IQM4, a Novel Calmodulin-Binding Protein, Is Involved With Seed Dormancy and Germination in Arabidopsis

    Directory of Open Access Journals (Sweden)

    Yu Ping Zhou

    2018-06-01

    Full Text Available Seed dormancy and germination are regulated by complex mechanisms controlled by diverse hormones and environmental cues. Abscisic acid (ABA promotes seed dormancy and inhibits seed germination and post-germination growth. Calmodulin (CaM signals are involved with the inhibition of ABA during seed germination and seedling growth. In this study, we showed that Arabidopsis thaliana IQM4 could bind with calmodulin 5 (CaM5 both in vitro and in vivo, and that the interaction was the Ca2+-independent type. The IQM4 protein was localized in the chloroplast and the IQM4 gene was expressed in most tissues, especially the embryo and germinated seedlings. The T-DNA insertion mutants of IQM4 exhibited the reduced primary seed dormancy and lower ABA levels compared with wild type seeds. Moreover, IQM4 plays key roles in modulating the responses to ABA, salt, and osmotic stress during seed germination and post-germination growth. T-DNA insertion mutants exhibited ABA-insensitive and salt-hypersensitive phenotypes during seed germination and post-germination growth, whereas IQM4-overexpressing lines had ABA- and osmotic-hypersensitive, and salt-insensitive phenotypes. Gene expression analyses showed that mutation of IQM4 inhibited the expression of ABA biosynthetic genes NCED6 and NCED9, and seed maturation regulators LEC1, LEC2, ABI3, and ABI5 during the silique development, as well as promoted the expression of WRKY40 and inhibited that of ABI5 in ABA-regulated seed germination. These observations suggest that IQM4 is a novel Ca2+-independent CaM-binding protein, which is positively involved with seed dormancy and germination in Arabidopsis.

  7. Characterization of a calcium/calmodulin-dependent protein kinase homolog from maize roots showing light-regulated gravitropism

    Science.gov (United States)

    Lu, Y. T.; Hidaka, H.; Feldman, L. J.

    1996-01-01

    Roots of many species respond to gravity (gravitropism) and grow downward only if illuminated. This light-regulated root gravitropism is phytochrome-dependent, mediated by calcium, and inhibited by KN-93, a specific inhibitor of calcium/calmodulin-dependent protein kinase II (CaMK II). A cDNA encoding MCK1, a maize homolog of mammalian CaMK, has been isolated from roots of maize (Zea mays L.). The MCK1 gene is expressed in root tips, the site of perception for both light and gravity. Using the [35S]CaM gel-overlay assay we showed that calmodulin-binding activity of the MCK1 is abolished by 50 microM KN-93, but binding is not affected by 5 microM KN-93, paralleling physiological findings that light-regulated root gravitropism is inhibited by 50 microM KN-93, but not by 5 microM KN-93. KN-93 inhibits light-regulated gravitropism by interrupting transduction of the light signal, not light perception, suggesting that MCK1 may play a role in transducing light. This is the first report suggesting a physiological function for a CaMK homolog in light signal transduction.

  8. Investigations into the binding of 125I-calmodulin to CA++ transport ATPase of human erythrocytes

    International Nuclear Information System (INIS)

    Sterk, V.

    1983-01-01

    The study described was carried out in order to investigate the binding of 125 I-calmodulin to Ca ++ transport ATPase using different Ca ++ concentrations and temperatures. The data obtained from these experiments were subsequently analysed in such as a way as to yield meaningful information relating to the mechanisms underlying the attachment of calmodulin to Ca ++ transport ATPase, the % proportion of membrane protein that was attributable to the enzyme as well as the number of calmodulin receptor sites on the individual erythrocytes, etc. Comparisons with data from the relevant literature permitted conclusions to be drawn concerning the mode of Ca ++ transport at the level of the erythrocytes. A new methodology and processing technique had to be developed prior to the beginning of the experiments. (orig./MG) [de

  9. Extracellular calmodulin regulates growth and cAMP-mediated chemotaxis in Dictyostelium discoideum

    International Nuclear Information System (INIS)

    O’Day, Danton H.; Huber, Robert J.; Suarez, Andres

    2012-01-01

    Highlights: ► Extracellular calmodulin is present throughout growth and development in Dictyostelium. ► Extracellular calmodulin localizes within the ECM during development. ► Extracellular calmodulin inhibits cell proliferation and increases chemotaxis. ► Extracellular calmodulin exists in eukaryotic microbes. ► Extracellular calmodulin may be functionally as important as intracellular calmodulin. -- Abstract: The existence of extracellular calmodulin (CaM) has had a long and controversial history. CaM is a ubiquitous calcium-binding protein that has been found in every eukaryotic cell system. Calcium-free apo-CaM and Ca 2+ /CaM exert their effects by binding to and regulating the activity of CaM-binding proteins (CaMBPs). Most of the research done to date on CaM and its CaMBPs has focused on their intracellular functions. The presence of extracellular CaM is well established in a number of plants where it functions in proliferation, cell wall regeneration, gene regulation and germination. While CaM has been detected extracellularly in several animal species, including frog, rat, rabbit and human, its extracellular localization and functions are less well established. In contrast the study of extracellular CaM in eukaryotic microbes remains to be done. Here we show that CaM is constitutively expressed and secreted throughout asexual development in Dictyostelium where the presence of extracellular CaM dose-dependently inhibits cell proliferation but increases cAMP mediated chemotaxis. During development, extracellular CaM localizes within the slime sheath where it coexists with at least one CaMBP, the matricellular CaM-binding protein CyrA. Coupled with previous research, this work provides direct evidence for the existence of extracellular CaM in the Dictyostelium and provides insight into its functions in this model amoebozoan.

  10. Reconstruction of calmodulin single-molecule FRET states, dye interactions, and CaMKII peptide binding by MultiNest and classic maximum entropy

    Science.gov (United States)

    DeVore, Matthew S.; Gull, Stephen F.; Johnson, Carey K.

    2013-08-01

    We analyzed single molecule FRET burst measurements using Bayesian nested sampling. The MultiNest algorithm produces accurate FRET efficiency distributions from single-molecule data. FRET efficiency distributions recovered by MultiNest and classic maximum entropy are compared for simulated data and for calmodulin labeled at residues 44 and 117. MultiNest compares favorably with maximum entropy analysis for simulated data, judged by the Bayesian evidence. FRET efficiency distributions recovered for calmodulin labeled with two different FRET dye pairs depended on the dye pair and changed upon Ca2+ binding. We also looked at the FRET efficiency distributions of calmodulin bound to the calcium/calmodulin dependent protein kinase II (CaMKII) binding domain. For both dye pairs, the FRET efficiency distribution collapsed to a single peak in the case of calmodulin bound to the CaMKII peptide. These measurements strongly suggest that consideration of dye-protein interactions is crucial in forming an accurate picture of protein conformations from FRET data.

  11. Reconstruction of Calmodulin Single-Molecule FRET States, Dye-Interactions, and CaMKII Peptide Binding by MultiNest and Classic Maximum Entropy.

    Science.gov (United States)

    Devore, Matthew S; Gull, Stephen F; Johnson, Carey K

    2013-08-30

    We analyze single molecule FRET burst measurements using Bayesian nested sampling. The MultiNest algorithm produces accurate FRET efficiency distributions from single-molecule data. FRET efficiency distributions recovered by MultiNest and classic maximum entropy are compared for simulated data and for calmodulin labeled at residues 44 and 117. MultiNest compares favorably with maximum entropy analysis for simulated data, judged by the Bayesian evidence. FRET efficiency distributions recovered for calmodulin labeled with two different FRET dye pairs depended on the dye pair and changed upon Ca 2+ binding. We also looked at the FRET efficiency distributions of calmodulin bound to the calcium/calmodulin dependent protein kinase II (CaMKII) binding domain. For both dye pairs, the FRET efficiency distribution collapsed to a single peak in the case of calmodulin bound to the CaMKII peptide. These measurements strongly suggest that consideration of dye-protein interactions is crucial in forming an accurate picture of protein conformations from FRET data.

  12. Differential inhibition of calmodulin-sensitive phosphodiesterase and Ca++-adenosine triphosphatase by chlorpromazine-linked calmodulin

    International Nuclear Information System (INIS)

    Prozialeck, W.C.; Wallace, T.L.; Weiss, B.

    1987-01-01

    Upon irradiation with UV light, chlorpromazine binds irreversibly to calmodulin and inactivates it. To determine whether this chlorpromazine-calmodulin (CPZ-CaM) complex can inhibit the actions of native calmodulin, we examined its effects on the activity of calmodulin-sensitive cyclic nucleotide phosphodiesterase from rat brain and on the Ca++-adenosine triphosphatase (ATPase) of human erythrocyte membranes. The CPZ-CaM complex was prepared by irradiating purified bovine brain calmodulin in the presence of chlorpromazine and Ca++. The sample was then dialyzed extensively to remove reversibly bound chlorpromazine and then assayed for its ability to activate calmodulin-sensitive phosphodiesterase and Ca++-ATPase, and for its ability to block the stimulatory effects of native calmodulin on these enzymes. The CPZ-CaM complex had no effect on the basal activity of either enzyme; it neither activated nor inhibited the enzymes when assayed in the absence of calmodulin. However, it affected differentially the activation of the two enzymes by native calmodulin. The CPZ-CaM complex totally inhibited calmodulin-stimulated phosphodiesterase but had no effect on the activation of the ATPase by calmodulin. Other studies showed that CPZ-CaM increased the activation constant (Ka) for the interaction of calmodulin with phosphodiesterase but did not affect the maximal activation (Vmax) of the enzyme by calmodulin. Neither calmodulin nor CPZ-CaM altered the Km for the interaction between phosphodiesterase and cyclic AMP. These results suggest that CPZ-CaM inhibits the calmodulin-induced activation of phosphodiesterase by competing with calmodulin for regulatory sites on the enzyme and not by interacting with calmodulin itself or by blocking the interaction of cyclic AMP with the enzyme

  13. Calmodulin Gene Expression in Response to Mechanical Wounding and Botrytis cinerea Infection in Tomato Fruit

    OpenAIRE

    Peng, Hui; Yang, Tianbao; Jurick, Wayne M.

    2014-01-01

    Calmodulin, a ubiquitous calcium sensor, plays an important role in decoding stress-triggered intracellular calcium changes and regulates the functions of numerous target proteins involved in various plant physiological responses. To determine the functions of calmodulin in fleshy fruit, expression studies were performed on a family of six calmodulin genes (SlCaMs) in mature-green stage tomato fruit in response to mechanical injury and Botrytis cinerea infection. Both wounding and pathogen in...

  14. Structure of Calmodulin Bound to a Calcineurin Peptide: A New Way of Making an Old Binding Mode

    International Nuclear Information System (INIS)

    Ye, Q.; Li, X.; Wong, A.; Wei, Q.; Jia, Z.

    2006-01-01

    Calcineurin is a calmodulin-binding protein in brain and the only serine/threonine protein phosphatase under the control of Ca 2+ /calmodulin (CaM), which plays a critical role in coupling Ca 2+ signals to cellular responses. CaM up-regulates the phosphatase activity of calcineurin by binding to the CaM-binding domain (CBD) of calcineurin subunit A. Here, we report crystal structural studies of CaM bound to a CBD peptide. The chimeric protein containing CaM and the CBD peptide forms an intimate homodimer, in which CaM displays a native-like extended conformation and the CBD peptide shows -helical structure. Unexpectedly, the N-terminal lobe from one CaM and the C-terminal lobe from the second molecule form a combined binding site to trap the peptide. Thus, the dimer provides two binding sites, each of which is reminiscent of the fully collapsed conformation of CaM commonly observed in complex with, for example, the myosin light chain kinase (MLCK) peptide. The interaction between the peptide and CaM is highly specific and similar to MLCK

  15. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  16. Characterization of CoPK02, a Ca2+/calmodulin-dependent protein kinase in mushroom Coprinopsis cinerea.

    Science.gov (United States)

    Yamashita, Masashi; Sueyoshi, Noriyuki; Yamada, Hiroki; Katayama, Syouichi; Senga, Yukako; Takenaka, Yasuhiro; Ishida, Atsuhiko; Kameshita, Isamu; Shigeri, Yasushi

    2018-04-20

    We surveyed genome sequences from the basidiomycetous mushroom Coprinopsis cinerea and isolated a cDNA homologous to CMKA, a calmodulin-dependent protein kinase (CaMK) in Aspergillus nidulans. We designated this sequence, encoding 580 amino acids with a molecular weight of 63,987, as CoPK02. CoPK02 possessed twelve subdomains specific to protein kinases and exhibited 43, 35, 40% identity with rat CaMKI, CaMKII, CaMKIV, respectively, and 40% identity with CoPK12, one of the CaMK orthologs in C. cinerea. CoPK02 showed significant autophosphorylation activity and phosphorylated exogenous proteins in the presence of Ca 2+ /CaM. By the CaM-overlay assay we confirmed that the C-terminal sequence (Trp346-Arg358) was the calmodulin-binding site, and that the binding of Ca 2+ /CaM to CoPK02 was reduced by the autophosphorylation of CoPK02. Since CoPK02 evolved in a different clade from CoPK12, and showed different gene expression compared to that of CoPK32, which is homologous to mitogen-activated protein kinase-activated protein kinase, CoPK02 and CoPK12 might cooperatively regulate Ca 2+ -signaling in C. cinerea.

  17. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  18. Nitric Oxide Synthases Reveal a Role for Calmodulin in Controlling Electron Transfer

    Science.gov (United States)

    Abu-Soud, Husam M.; Stuehr, Dennis J.

    1993-11-01

    Nitric oxide (NO) is synthesized within the immune, vascular, and nervous systems, where it acts as a wide-ranging mediator of mammalian physiology. The NO synthases (EC 1.14.13.39) isolated from neurons or endothelium are calmodulin dependent. Calmodulin binds reversibly to neuronal NO synthase in response to elevated Ca2+, triggering its NO production by an unknown mechanism. Here we show that calmodulin binding allows NADPH-derived electrons to pass onto the heme group of neuronal NO synthase. Calmodulin-triggered electron transfer to heme was independent of substrate binding, caused rapid enzymatic oxidation of NADPH in the presence of O_2, and was required for NO synthesis. An NO synthase isolated from cytokine-induced macrophages that contains tightly bound calmodulin catalyzed spontaneous electron transfer to its heme, consistent with bound calmodulin also enabling electron transfer within this isoform. Together, these results provide a basis for how calmodulin may regulate NO synthesis. The ability of calmodulin to trigger electron transfer within an enzyme is unexpected and represents an additional function for calcium-binding proteins in biology.

  19. Structural characterization of the interactions between calmodulin and skeletal muscle myosin light chain kinase: Effect of peptide (576-594)G binding on the Ca2+-binding domains

    International Nuclear Information System (INIS)

    Seeholzer, S.H.; Wand, A.J.

    1989-01-01

    Calcium-containing calmodulin (CaM) and its complex with a peptide corresponding to the calmodulin-binding domain of skeletal muscle myosin light chain kinase [skMLCK(576-594)G] have been studied by one- and two-dimensional 1 H NMR techniques. Resonances arising from the antiparallel β-sheet structures associated with the calcium-binding domains of CaM and their counterparts in the CaM-skMLCK(576-594)G complex have been assigned. The assignments were initiated by application of the main chain directed assignment strategy. It is found that, despite significant changes in chemical shifts of resonances arising from amino acid residues in this region upon binding of the peptide, the β-sheets have virtually the same structure in the complex as in CaM. Hydrogen exchange rates of amide NH within the β-sheet structures are significantly slowed upon binding of peptide. These data, in conjunction with the observed nuclear Overhauser effect (NOE) patterns and relative intensities and the downfield shifts of associated amide and α resonances upon binding of peptide, show that the peptide stabilizes the Ca 2+ -bound state of calmodulin. The observed pattern of NOEs within the β-sheets and their structural similarity correspond closely to those predicted by the crystal structure. These findings imply that the apparent inconsistency of the crystal structure with recently reported low-angle X-ray scattering profiles of CaM may lie within the putative central helix bridging the globular domains

  20. Molecular cloning and expression of the calmodulin gene from guinea pig hearts.

    Science.gov (United States)

    Feng, Rui; Liu, Yan; Sun, Xuefei; Wang, Yan; Hu, Huiyuan; Guo, Feng; Zhao, Jinsheng; Hao, Liying

    2015-06-01

    The aim of the present study was to isolate and characterize a complementary DNA (cDNA) clone encoding the calmodulin (CaM; GenBank accession no. FJ012165) gene from guinea pig hearts. The CaM gene was amplified from cDNA collected from guinea pig hearts and inserted into a pGEM®-T Easy vector. Subsequently, CaM nucleotide and protein sequence similarity analysis was conducted between guinea pigs and other species. In addition, reverse transcription-polymerase chain reaction (RT-PCR) was performed to investigate the CaM 3 expression patterns in different guinea pig tissues. Sequence analysis revealed that the CaM gene isolated from the guinea pig heart had ∼90% sequence identity with the CaM 3 genes in humans, mice and rats. Furthermore, the deduced peptide sequences of CaM 3 in the guinea pig showed 100% homology to the CaM proteins from other species. In addition, the RT-PCR results indicated that CaM 3 was widely and differentially expressed in guinea pigs. In conclusion, the current study provided valuable information with regard to the cloning and expression of CaM 3 in guinea pig hearts. These findings may be helpful for understanding the function of CaM3 and the possible role of CaM3 in cardiovascular diseases.

  1. Deletion of the calmodulin-binding domain of Grb7 impairs cell attachment to the extracellular matrix and migration

    Energy Technology Data Exchange (ETDEWEB)

    García-Palmero, Irene; Villalobo, Antonio, E-mail: antonio.villalobo@iib.uam.es

    2013-06-28

    Highlights: •Grb7 is a calmodulin (CaM)-binding protein. •Deleting the CaM-binding site impairs cell attachment and migration. •CaM antagonists inhibit Grb7-mediated cell migration. •We conclude that CaM controls Grb7-mediated cell migration. -- Abstract: The adaptor Grb7 is a calmodulin (CaM)-binding protein that participates in signaling pathways involved in cell migration, proliferation and the control of angiogenesis, and plays a significant role in tumor growth, its metastatic spread and tumor-associated neo-vasculature formation. In this report we show that deletion of the CaM-binding site of Grb7, located in the proximal region of its pleckstrin homology (PH) domain, impairs cell migration, cell attachment to the extracellular matrix, and the reorganization of the actin cytoskeleton occurring during this process. Moreover, we show that the cell-permeable CaM antagonists N-(6-aminohexyl)-5-chloro-1-naphthalenesulfonamide (W-7) and N-(4-aminobutyl)-5-chloro-2-naphthalenesulfonamide (W-13) both retard the migration of cells expressing wild type Grb7, but not the migration of cells expressing the mutant protein lacking the CaM-binding site (Grb7Δ), underscoring the proactive role of CaM binding to Grb7 during this process.

  2. Modulating uranium binding affinity in engineered calmodulin EF-hand peptides: effect of phosphorylation.

    Directory of Open Access Journals (Sweden)

    Romain Pardoux

    Full Text Available To improve our understanding of uranium toxicity, the determinants of uranyl affinity in proteins must be better characterized. In this work, we analyzed the contribution of a phosphoryl group on uranium binding affinity in a protein binding site, using the site 1 EF-hand motif of calmodulin. The recombinant domain 1 of calmodulin from A. thaliana was engineered to impair metal binding at site 2 and was used as a structured template. Threonine at position 9 of the loop was phosphorylated in vitro, using the recombinant catalytic subunit of protein kinase CK2. Hence, the T(9TKE(12 sequence was substituted by the CK2 recognition sequence TAAE. A tyrosine was introduced at position 7, so that uranyl and calcium binding affinities could be determined by following tyrosine fluorescence. Phosphorylation was characterized by ESI-MS spectrometry, and the phosphorylated peptide was purified to homogeneity using ion-exchange chromatography. The binding constants for uranyl were determined by competition experiments with iminodiacetate. At pH 6, phosphorylation increased the affinity for uranyl by a factor of ∼5, from K(d = 25±6 nM to K(d = 5±1 nM. The phosphorylated peptide exhibited a much larger affinity at pH 7, with a dissociation constant in the subnanomolar range (K(d = 0.25±0.06 nM. FTIR analyses showed that the phosphothreonine side chain is partly protonated at pH 6, while it is fully deprotonated at pH 7. Moreover, formation of the uranyl-peptide complex at pH 7 resulted in significant frequency shifts of the ν(as(P-O and ν(s(P-O IR modes of phosphothreonine, supporting its direct interaction with uranyl. Accordingly, a bathochromic shift in ν(as(UO(2(2+ vibration (from 923 cm(-1 to 908 cm(-1 was observed upon uranyl coordination to the phosphorylated peptide. Together, our data demonstrate that the phosphoryl group plays a determining role in uranyl binding affinity to proteins at physiological pH.

  3. Modulating uranium binding affinity in engineered Calmodulin EF-hand peptides: effect of phosphorylation

    International Nuclear Information System (INIS)

    Pardoux, Romain; Sauge-Merle, Sandrine; Lemaire, David; Guilloreau, Luc; Berthomieu, Catherine; Delangle, Pascale; Adriano, Jean-Marc

    2012-01-01

    To improve our understanding of uranium toxicity, the determinants of uranyl affinity in proteins must be better characterized. In this work, we analyzed the contribution of a phosphoryl group on uranium binding affinity in a protein binding site, using the site 1 EF-hand motif of calmodulin. The recombinant domain 1 of calmodulin from A. thaliana was engineered to impair metal binding at site 2 and was used as a structured template. Threonine at position 9 of the loop was phosphorylated in vitro, using the recombinant catalytic subunit of protein kinase CK2. Hence, the T 9 TKE 12 sequence was substituted by the CK2 recognition sequence TAAE. A tyrosine was introduced at position 7, so that uranyl and calcium binding affinities could be determined by following tyrosine fluorescence. Phosphorylation was characterized by ESI-MS spectrometry, and the phosphorylated peptide was purified to homogeneity using ion-exchange chromatography. The binding constants for uranyl were determined by competition experiments with iminodiacetate. At pH 6, phosphorylation increased the affinity for uranyl by a factor of ∼5, from K d =25±6 nM to K d =5±1 nM. The phosphorylated peptide exhibited a much larger affinity at pH 7, with a dissociation constant in the sub-nanomolar range (K d = 0.25±0.06 nM). FTIR analyses showed that the phospho-threonine side chain is partly protonated at pH 6, while it is fully deprotonated at pH 7. Moreover, formation of the uranyl-peptide complex at pH 7 resulted in significant frequency shifts of the ν as (P-O) and ν s (P-O) IR modes of phospho-threonine, supporting its direct interaction with uranyl. Accordingly, a bathochromic shift in ν as (UO 2 ) 2+ vibration (from 923 cm -1 to 908 cm -1 ) was observed upon uranyl coordination to the phosphorylated peptide. Together, our data demonstrate that the phosphoryl group plays a determining role in uranyl binding affinity to proteins at physiological pH. (authors)

  4. Identification of high-affinity calmodulin-binding proteins in rat liver

    International Nuclear Information System (INIS)

    Hanley, R.M.; Dedman, J.R.; Shenolikar, S.

    1987-01-01

    The Ca 2+ -dependent binding of [ 125 I] calmodulin (CaM) to hepatic proteins separated by sodium dodecyl sulfate-polyacrylamide gel electrophoresis (SDS-PAGE) was utilized to identify CaM binding or acceptor proteins or CAPs. Two proteins of apparent molecular weight of 60,000 (CAP-60) and 45,000 (CAP-45) comprised > 80% of the Ca 2+ -dependent CaM binding in rat liver cytosol. CAP-60 and CAP-45 were partially purified by a variety of chromatographic steps, including affinity chromatography on CaM Sepharose. CAP-60 possessed a native molecular size of 400,000, indicating it to be the CaM-binding subunit of a larger oligomeric complex. In contrast, CAP-45 was monomeric as judged by gel filtration. Neither CAP-60 nor CAP-45 possessed chromatographic properties consistent with known CaM-dependent enzymes reported in the literature. Two-dimensional peptide mapping provided convincing evidence that CAP-60 and CAP-45 were unrelated to other well-characterized CAPs, namely Ca 2+ (CaM)-dependent protein kinase II, calcineurin, or the CaM-dependent cyclic nucleotide phosphodiesterase. The relative abundance and high affinity for CaM could suggest that these novel target proteins, CAP-60 and CAP-45, represent a dominant pathway for CaM action in the mammalian liver

  5. Calcium-dependent regulation of SNARE-mediated membrane fusion by calmodulin.

    Science.gov (United States)

    Di Giovanni, Jerome; Iborra, Cécile; Maulet, Yves; Lévêque, Christian; El Far, Oussama; Seagar, Michael

    2010-07-30

    Neuroexocytosis requires SNARE proteins, which assemble into trans complexes at the synaptic vesicle/plasma membrane interface and mediate bilayer fusion. Ca(2+) sensitivity is thought to be conferred by synaptotagmin, although the ubiquitous Ca(2+)-effector calmodulin has also been implicated in SNARE-dependent membrane fusion. To examine the molecular mechanisms involved, we examined the direct action of calmodulin and synaptotagmin in vitro, using fluorescence resonance energy transfer to assay lipid mixing between target- and vesicle-SNARE liposomes. Ca(2+)/calmodulin inhibited SNARE assembly and membrane fusion by binding to two distinct motifs located in the membrane-proximal regions of VAMP2 (K(D) = 500 nm) and syntaxin 1 (K(D) = 2 microm). In contrast, fusion was increased by full-length synaptotagmin 1 anchored in vesicle-SNARE liposomes. When synaptotagmin and calmodulin were combined, synaptotagmin overcame the inhibitory effects of calmodulin. Furthermore, synaptotagmin displaced calmodulin binding to target-SNAREs. These findings suggest that two distinct Ca(2+) sensors act antagonistically in SNARE-mediated fusion.

  6. NRIP is newly identified as a Z-disc protein, activating calmodulin signaling for skeletal muscle contraction and regeneration.

    Science.gov (United States)

    Chen, Hsin-Hsiung; Chen, Wen-Pin; Yan, Wan-Lun; Huang, Yuan-Chun; Chang, Szu-Wei; Fu, Wen-Mei; Su, Ming-Jai; Yu, I-Shing; Tsai, Tzung-Chieh; Yan, Yu-Ting; Tsao, Yeou-Ping; Chen, Show-Li

    2015-11-15

    Nuclear receptor interaction protein (NRIP, also known as DCAF6 and IQWD1) is a Ca(2+)-dependent calmodulin-binding protein. In this study, we newly identify NRIP as a Z-disc protein in skeletal muscle. NRIP-knockout mice were generated and found to have reduced muscle strength, susceptibility to fatigue and impaired adaptive exercise performance. The mechanisms of NRIP-regulated muscle contraction depend on NRIP being downstream of Ca(2+) signaling, where it stimulates activation of both 'calcineurin-nuclear factor of activated T-cells, cytoplasmic 1' (CaN-NFATc1; also known as NFATC1) and calmodulin-dependent protein kinase II (CaMKII) through interaction with calmodulin (CaM), resulting in the induction of mitochondrial activity and the expression of genes encoding the slow class of myosin, and in the regulation of Ca(2+) homeostasis through the internal Ca(2+) stores of the sarcoplasmic reticulum. Moreover, NRIP-knockout mice have a delayed regenerative capacity. The amount of NRIP can be enhanced after muscle injury and is responsible for muscle regeneration, which is associated with the increased expression of myogenin, desmin and embryonic myosin heavy chain during myogenesis, as well as for myotube formation. In conclusion, NRIP is a novel Z-disc protein that is important for skeletal muscle strength and regenerative capacity. © 2015. Published by The Company of Biologists Ltd.

  7. Beauvericin synthetase contains a calmodulin binding motif in the entomopathogenic fungus Beauveria bassiana.

    Science.gov (United States)

    Kim, Jiyoung; Sung, Gi-Ho

    2018-03-19

    Beauvericin is a mycotoxin which has insecticidal, anti-microbial, anti-viral and anti-cancer activities. Beauvericin biosynthesis is rapidly catalyzed by the beauvericin synthetase (BEAS) in Beauveria bassiana. Ca 2+ plays crucial roles in multiple signaling pathways in eukaryotic cells. These Ca 2+ signals are partially decoded by Ca 2+ sensor calmodulin (CaM). In this report, we describe that B. bassiana BEAS (BbBEAS) can interact with CaM in a Ca 2+ -dependent manner. A synthetic BbBEAS peptide, corresponding to the putative CaM-binding motif, formed a stable complex with CaM in the presence of Ca 2+ . In addition, in vitro CaM-binding assay revealed that the His-tagged BbBEAS (amino acids 2421-2538) binds to CaM in a Ca 2+ -dependent manner. Therefore, this work suggests that BbBEAS is a novel CaM-binding protein in B. bassiana.

  8. Functional domains of plant chimeric calcium/calmodulin-dependent protein kinase: regulation by autoinhibitory and visinin-like domains

    Science.gov (United States)

    Ramachandiran, S.; Takezawa, D.; Wang, W.; Poovaiah, B. W.

    1997-01-01

    A novel calcium-binding calcium/calmodulin-dependent protein kinase (CCaMK) with a catalytic domain, calmodulin-binding domain, and a neural visinin-like domain was cloned and characterized from plants [Patil et al., (1995) Proc. Natl. Acad. Sci. USA 92, 4797-4801; Takezawa et al. (1996) J. Biol. Chem. 271, 8126-8132]. The mechanisms of CCaMK activation by calcium and calcium/calmodulin were investigated using various deletion mutants. The use of deletion mutants of CCaMK lacking either one, two, or all three calcium-binding EF hands indicated that all three calcium-binding sites in the visinin-like domain were crucial for the full calcium/calmodulin-dependent kinase activity. As each calcium-binding EF hand was deleted, there was a gradual reduction in calcium/calmodulin-dependent kinase activity from 100 to 4%. Another mutant (amino acids 1-322) which lacks both the visinin-like domain containing three EF hands and the calmodulin-binding domain was constitutively active, indicating the presence of an autoinhibitory domain around the calmodulin-binding domain. By using various synthetic peptides and the constitutively active mutant, we have shown that CCaMK contains an autoinhibitory domain within the residues 322-340 which overlaps its calmodulin-binding domain. Kinetic studies with both ATP and the GS peptide substrate suggest that the autoinhibitory domain of CCaMK interacts only with the peptide substrate binding motif of the catalytic domain, but not with the ATP-binding motif.

  9. AtMRP1 gene of Arabidopsis encodes a glutathione S-conjugate pump: isolation and functional definition of a plant ATP-binding cassette transporter gene.

    Science.gov (United States)

    Lu, Y P; Li, Z S; Rea, P A

    1997-07-22

    Because plants produce cytotoxic compounds to which they, themselves, are susceptible and are exposed to exogenous toxins (microbial products, allelochemicals, and agrochemicals), cell survival is contingent on mechanisms for detoxifying these agents. One detoxification mechanism is the glutathione S-transferase-catalyzed glutathionation of the toxin, or an activated derivative, and transport of the conjugate out of the cytosol. We show here that a transporter responsible for the removal of glutathione S-conjugates from the cytosol, a specific Mg2+-ATPase, is encoded by the AtMRP1 gene of Arabidopsis thaliana. The sequence of AtMRP1 and the transport capabilities of membranes prepared from yeast cells transformed with plasmid-borne AtMRP1 demonstrate that this gene encodes an ATP-binding cassette transporter competent in the transport of glutathione S-conjugates of xenobiotics and endogenous substances, including herbicides and anthocyanins.

  10. The predominant WT1 isoform (+KTS) encodes a DNA-binding protein targeting the planar cell polarity gene Scribble in renal podocytes.

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A

    2010-07-01

    WT1 encodes a tumor suppressor first identified by its inactivation in Wilms' Tumor. Although one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three-amino acid (KTS) insertion. Using cells that conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning analysis to identify candidate WT1(+KTS)-regulated promoters. We identified the planar cell polarity gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33-nucleotide region within the Scribble promoter in mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway.

  11. The predominant WT1 isoform (+KTS) encodes a DNA binding protein targeting the planar cell polarity gene Scribble in renal podocytes

    Science.gov (United States)

    Wells, Julie; Rivera, Miguel N.; Kim, Woo Jae; Starbuck, Kristen; Haber, Daniel A.

    2010-01-01

    WT1 encodes a tumor suppressor, first identified by its inactivation in Wilms Tumor. While one WT1 splicing variant encodes a well-characterized zinc finger transcription factor, little is known about the function of the most prevalent WT1 isoform, whose DNA binding domain is disrupted by a three amino acid (KTS) insertion. Using cells which conditionally express WT1(+KTS), we undertook a genome-wide chromatin immunoprecipitation and cloning (ChIP-cloning) analysis to identify candidate WT1(+KTS) regulated promoters. We identified the planar cell polarity (PCP) gene Scribble (SCRB) as the first WT1(+KTS) target gene in podocytes of the kidney. WT1 and SCRB expression patterns overlap precisely in developing renal glomeruli of mice, and WT1(+KTS) binds to a 33 nucleotide region within the Scribble promoter in both mouse and human cell lines and kidneys. Together, our results support a role for the predominant WT1(+KTS) isoform in transcriptional regulation and suggest a link between the WT1-dependent tumor suppressor pathway and a key component of the planar cell polarity pathway. PMID:20571064

  12. Calmodulin-lanthanide ion exchange kinetics

    International Nuclear Information System (INIS)

    Buccigross, J.; O'Donnell, C.; Nelson, D.

    1985-01-01

    A flow dialysis apparatus suitable for the study of high affinity metal binding proteins has been utilized to study calmodulin-metal exchange kinetics. Calmodulin labeled with Eu-155 and Gd-153 was dialyzed against buffer containing various competing metal ions. The rate of metal exchange was monitored by a gamma-ray scintillation detector. The kinetics of exchange are first order, and the rates fall into two categories: Ca (II) and CD (II) in one, and the lanthanides Eu (III), Gd (III), and La (III) in the other

  13. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  14. Neurogranin alters the structure and calcium binding properties of calmodulin.

    Science.gov (United States)

    Hoffman, Laurel; Chandrasekar, Anuja; Wang, Xu; Putkey, John A; Waxham, M Neal

    2014-05-23

    Neurogranin (Ng) is a member of the IQ motif class of calmodulin (CaM)-binding proteins, and interactions with CaM are its only known biological function. In this report we demonstrate that the binding affinity of Ng for CaM is weakened by Ca(2+) but to a lesser extent (2-3-fold) than that previously suggested from qualitative observations. We also show that Ng induced a >10-fold decrease in the affinity of Ca(2+) binding to the C-terminal domain of CaM with an associated increase in the Ca(2+) dissociation rate. We also discovered a modest, but potentially important, increase in the cooperativity in Ca(2+) binding to the C-lobe of CaM in the presence of Ng, thus sharpening the threshold for the C-domain to become Ca(2+)-saturated. Domain mapping using synthetic peptides indicated that the IQ motif of Ng is a poor mimetic of the intact protein and that the acidic sequence just N-terminal to the IQ motif plays an important role in reproducing Ng-mediated decreases in the Ca(2+) binding affinity of CaM. Using NMR, full-length Ng was shown to make contacts largely with residues in the C-domain of CaM, although contacts were also detected in residues in the N-terminal domain. Together, our results can be consolidated into a model where Ng contacts residues in the N- and C-lobes of both apo- and Ca(2+)-bound CaM and that although Ca(2+) binding weakens Ng interactions with CaM, the most dramatic biochemical effect is the impact of Ng on Ca(2+) binding to the C-terminal lobe of CaM. © 2014 by The American Society for Biochemistry and Molecular Biology, Inc.

  15. Calcium-dependent but calmodulin-independent protein kinase from soybean

    International Nuclear Information System (INIS)

    Harmon, A.C.; Putnam-Evans, C.; Cormier, M.J.

    1987-01-01

    A calcium-dependent protein kinase activity from suspension-cultured soybean cells (Glycine max L. Wayne) was shown to be dependent on calcium but not calmodulin. The concentrations of free calcium required for half-maximal histone H1 phosphorylation and autophosphorylation were similar (≥ 2 micromolar). The protein kinase activity was stimulated 100-fold by ≥ 10 micromolar-free calcium. When exogenous soybean or bovine brain calmodulin was added in high concentration (1 micromolar) to the purified kinase, calcium-dependent and -independent activities were weakly stimulated (≤ 2-fold). Bovine serum albumin had a similar effect on both activities. The kinase was separated from a small amount of contaminating calmodulin by sodium dodecyl sulfate polyacrylamide gel electrophoresis. After renaturation the protein kinase autophosphorylated and phosphorylated histone H1 in a calcium-dependent manner. Following electroblotting onto nitrocellulose, the kinase bound 45 Ca 2+ in the presence of KCl and MgCl 2 , which indicated that the kinase itself is a high-affinity calcium-binding protein. Also, the mobility of one of two kinase bands in SDS gels was dependent on the presence of calcium. Autophosphorylation of the calmodulin-free kinase was inhibited by the calmodulin-binding compound N-(6-aminohexyl)-5-chloro-1-naphthalene sulfonamide (W-7), showing that the inhibition of activity by W-7 is independent of calmodulin. These results show that soybean calcium-dependent protein kinase represents a new class of protein kinase which requires calcium but not calmodulin for activity

  16. Application of plug-plug technique to ACE experiments for discovery of peptides binding to a larger target protein: a model study of calmodulin-binding fragments selected from a digested mixture of reduced BSA.

    Science.gov (United States)

    Saito, Kazuki; Nakato, Mamiko; Mizuguchi, Takaaki; Wada, Shinji; Uchimura, Hiromasa; Kataoka, Hiroshi; Yokoyama, Shigeyuki; Hirota, Hiroshi; Kiso, Yoshiaki

    2014-03-01

    To discover peptide ligands that bind to a target protein with a higher molecular mass, a concise screening methodology has been established, by applying a "plug-plug" technique to ACE experiments. Exploratory experiments using three mixed peptides, mastoparan-X, β-endorphin, and oxytocin, as candidates for calmodulin-binding ligands, revealed that the technique not only reduces the consumption of the protein sample, but also increases the flexibility of the experimental conditions, by allowing the use of MS detection in the ACE experiments. With the plug-plug technique, the ACE-MS screening methodology successfully selected calmodulin-binding peptides from a random library with diverse constituents, such as protease digests of BSA. Three peptides with Kd values between 8-147 μM for calmodulin were obtained from a Glu-C endoprotease digest of reduced BSA, although the digest showed more than 70 peaks in its ACE-MS electropherogram. The method established here will be quite useful for the screening of peptide ligands, which have only low affinities due to their flexible chain structures but could potentially provide primary information for designing inhibitors against the target protein. © 2013 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  17. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  18. Interaction between the C-terminal region of human myelin basic protein and calmodulin: analysis of complex formation and solution structure

    Directory of Open Access Journals (Sweden)

    Hayashi Nobuhiro

    2008-02-01

    Full Text Available Abstract Background The myelin sheath is a multilamellar membrane structure wrapped around the axon, enabling the saltatory conduction of nerve impulses in vertebrates. Myelin basic protein, one of the most abundant myelin-specific proteins, is an intrinsically disordered protein that has been shown to bind calmodulin. In this study, we focus on a 19-mer synthetic peptide from the predicted calmodulin-binding segment near the C-terminus of human myelin basic protein. Results The interaction of native human myelin basic protein with calmodulin was confirmed by affinity chromatography. The binding of the myelin basic protein peptide to calmodulin was tested with isothermal titration calorimetry (ITC in different temperatures, and Kd was observed to be in the low μM range, as previously observed for full-length myelin basic protein. Surface plasmon resonance showed that the peptide bound to calmodulin, and binding was accompanied by a conformational change; furthermore, gel filtration chromatography indicated a decrease in the hydrodynamic radius of calmodulin in the presence of the peptide. NMR spectroscopy was used to map the binding area to reside mainly within the hydrophobic pocket of the C-terminal lobe of calmodulin. The solution structure obtained by small-angle X-ray scattering indicates binding of the myelin basic protein peptide into the interlobal groove of calmodulin, while calmodulin remains in an extended conformation. Conclusion Taken together, our results give a detailed structural insight into the interaction of calmodulin with a C-terminal segment of a major myelin protein, the myelin basic protein. The used 19-mer peptide interacts mainly with the C-terminal lobe of calmodulin, and a conformational change accompanies binding, suggesting a novel mode of calmodulin-target protein interaction. Calmodulin does not collapse and wrap around the peptide tightly; instead, it remains in an extended conformation in the solution structure

  19. TOM9.2 Is a Calmodulin-Binding Protein Critical for TOM Complex Assembly but Not for Mitochondrial Protein Import in Arabidopsis thaliana.

    Science.gov (United States)

    Parvin, Nargis; Carrie, Chris; Pabst, Isabelle; Läßer, Antonia; Laha, Debabrata; Paul, Melanie V; Geigenberger, Peter; Heermann, Ralf; Jung, Kirsten; Vothknecht, Ute C; Chigri, Fatima

    2017-04-03

    The translocon on the outer membrane of mitochondria (TOM) facilitates the import of nuclear-encoded proteins. The principal machinery of mitochondrial protein transport seems conserved in eukaryotes; however, divergence in the composition and structure of TOM components has been observed between mammals, yeast, and plants. TOM9, the plant homolog of yeast Tom22, is significantly smaller due to a truncation in the cytosolic receptor domain, and its precise function is not understood. Here we provide evidence showing that TOM9.2 from Arabidopsis thaliana is involved in the formation of mature TOM complex, most likely by influencing the assembly of the pore-forming subunit TOM40. Dexamethasone-induced RNAi gene silencing of TOM9.2 results in a severe reduction in the mature TOM complex, and the assembly of newly imported TOM40 into the complex is impaired. Nevertheless, mutant plants are fully viable and no obvious downstream effects of the loss of TOM complex, i.e., on mitochondrial import capacity, were observed. Furthermore, we found that TOM9.2 can bind calmodulin (CaM) in vitro and that CaM impairs the assembly of TOM complex in the isolated wild-type mitochondria, suggesting a regulatory role of TOM9.2 and a possible integration of TOM assembly into the cellular calcium signaling network. Copyright © 2017 The Author. Published by Elsevier Inc. All rights reserved.

  20. A mutation in the Arabidopsis HYL1 gene encoding a dsRNA binding protein affects responses to abscisic acid, auxin, and cytokinin

    Science.gov (United States)

    Lu, C.; Fedoroff, N.

    2000-01-01

    Both physiological and genetic evidence indicate interconnections among plant responses to different hormones. We describe a pleiotropic recessive Arabidopsis transposon insertion mutation, designated hyponastic leaves (hyl1), that alters the plant's responses to several hormones. The mutant is characterized by shorter stature, delayed flowering, leaf hyponasty, reduced fertility, decreased rate of root growth, and an altered root gravitropic response. It also exhibits less sensitivity to auxin and cytokinin and hypersensitivity to abscisic acid (ABA). The auxin transport inhibitor 2,3,5-triiodobenzoic acid normalizes the mutant phenotype somewhat, whereas another auxin transport inhibitor, N-(1-naph-thyl)phthalamic acid, exacerbates the phenotype. The gene, designated HYL1, encodes a 419-amino acid protein that contains two double-stranded RNA (dsRNA) binding motifs, a nuclear localization motif, and a C-terminal repeat structure suggestive of a protein-protein interaction domain. We present evidence that the HYL1 gene is ABA-regulated and encodes a nuclear dsRNA binding protein. We hypothesize that the HYL1 protein is a regulatory protein functioning at the transcriptional or post-transcriptional level.

  1. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  2. Modulation of calmodulin lobes by different targets: an allosteric model with hemiconcerted conformational transitions.

    Directory of Open Access Journals (Sweden)

    Massimo Lai

    2015-01-01

    Full Text Available Calmodulin is a calcium-binding protein ubiquitous in eukaryotic cells, involved in numerous calcium-regulated biological phenomena, such as synaptic plasticity, muscle contraction, cell cycle, and circadian rhythms. It exibits a characteristic dumbell shape, with two globular domains (N- and C-terminal lobe joined by a linker region. Each lobe can take alternative conformations, affected by the binding of calcium and target proteins. Calmodulin displays considerable functional flexibility due to its capability to bind different targets, often in a tissue-specific fashion. In various specific physiological environments (e.g. skeletal muscle, neuron dendritic spines several targets compete for the same calmodulin pool, regulating its availability and affinity for calcium. In this work, we sought to understand the general principles underlying calmodulin modulation by different target proteins, and to account for simultaneous effects of multiple competing targets, thus enabling a more realistic simulation of calmodulin-dependent pathways. We built a mechanistic allosteric model of calmodulin, based on an hemiconcerted framework: each calmodulin lobe can exist in two conformations in thermodynamic equilibrium, with different affinities for calcium and different affinities for each target. Each lobe was allowed to switch conformation on its own. The model was parameterised and validated against experimental data from the literature. In spite of its simplicity, a two-state allosteric model was able to satisfactorily represent several sets of experiments, in particular the binding of calcium on intact and truncated calmodulin and the effect of different skMLCK peptides on calmodulin's saturation curve. The model can also be readily extended to include multiple targets. We show that some targets stabilise the low calcium affinity T state while others stabilise the high affinity R state. Most of the effects produced by calmodulin targets can be

  3. PURA, the gene encoding Pur-alpha, member of an ancient nucleic acid-binding protein family with mammalian neurological functions.

    Science.gov (United States)

    Daniel, Dianne C; Johnson, Edward M

    2018-02-15

    The PURA gene encodes Pur-alpha, a 322 amino acid protein with repeated nucleic acid binding domains that are highly conserved from bacteria through humans. PUR genes with a single copy of this domain have been detected so far in spirochetes and bacteroides. Lower eukaryotes possess one copy of the PUR gene, whereas chordates possess 1 to 4 PUR family members. Human PUR genes encode Pur-alpha (Pura), Pur-beta (Purb) and two forms of Pur-gamma (Purg). Pur-alpha is a protein that binds specific DNA and RNA sequence elements. Human PURA, located at chromosome band 5q31, is under complex control of three promoters. The entire protein coding sequence of PURA is contiguous within a single exon. Several studies have found that overexpression or microinjection of Pura inhibits anchorage-independent growth of oncogenically transformed cells and blocks proliferation at either G1-S or G2-M checkpoints. Effects on the cell cycle may be mediated by interaction of Pura with cellular proteins including Cyclin/Cdk complexes and the Rb tumor suppressor protein. PURA knockout mice die shortly after birth with effects on brain and hematopoietic development. In humans environmentally induced heterozygous deletions of PURA have been implicated in forms of myelodysplastic syndrome and progression to acute myelogenous leukemia. Pura plays a role in AIDS through association with the HIV-1 protein, Tat. In the brain Tat and Pura association in glial cells activates transcription and replication of JC polyomavirus, the agent causing the demyelination disease, progressive multifocal leukoencephalopathy. Tat and Pura also act to stimulate replication of the HIV-1 RNA genome. In neurons Pura accompanies mRNA transcripts to sites of translation in dendrites. Microdeletions in the PURA locus have been implicated in several neurological disorders. De novo PURA mutations have been related to a spectrum of phenotypes indicating a potential PURA syndrome. The nucleic acid, G-rich Pura binding

  4. Characterization of Novel Calmodulin Binding Domains within IQ Motifs of IQGAP1

    Science.gov (United States)

    Jang, Deok-Jin; Ban, Byungkwan; Lee, Jin-A

    2011-01-01

    IQ motif-containing GTPase-activating protein 1 (IQGAP1), which is a well-known calmodulin (CaM) binding protein, is involved in a wide range of cellular processes including cell proliferation, tumorigenesis, adhesion, and migration. Interaction of IQGAP1 with CaM is important for its cellular functions. Although each IQ domain of IQGAP1 for CaM binding has been characterized in a Ca2+-dependent or -independent manner, it was not clear which IQ motifs are physiologically relevant for CaM binding in the cells. In this study, we performed immunoprecipitation using 3xFLAGhCaM in mammalian cell lines to characterize the domains of IQGAP1 that are key for CaM binding under physiological conditions. Interestingly, using this method, we identified two novel domains, IQ(2.7-3) and IQ(3.5-4.4), within IQGAP1 that were involved in Ca2+-independent or -dependent CaM binding, respectively. Mutant analysis clearly showed that the hydrophobic regions within IQ(2.7-3) were mainly involved in apoCaM binding, while the basic amino acids and hydrophobic region of IQ(3.5-4.4) were required for Ca2+/CaM binding. Finally, we showed that IQ(2.7-3) was the main apoCaM binding domain and both IQ(2.7-3) and IQ(3.5-4.4) were required for Ca2+/CaM binding within IQ(1- 2-3-4). Thus, we identified and characterized novel direct CaM binding motifs essential for IQGAP1. This finding indicates that IQGAP1 plays a dynamic role via direct interactions with CaM in a Ca2+-dependent or -independent manner. PMID:22080369

  5. Nucleic acids encoding phloem small RNA-binding proteins and transgenic plants comprising them

    Science.gov (United States)

    Lucas, William J.; Yoo, Byung-Chun; Lough, Tony J.; Varkonyi-Gasic, Erika

    2007-03-13

    The present invention provides a polynucleotide sequence encoding a component of the protein machinery involved in small RNA trafficking, Cucurbita maxima phloem small RNA-binding protein (CmPSRB 1), and the corresponding polypeptide sequence. The invention also provides genetic constructs and transgenic plants comprising the polynucleotide sequence encoding a phloem small RNA-binding protein to alter (e.g., prevent, reduce or elevate) non-cell autonomous signaling events in the plants involving small RNA metabolism. These signaling events are involved in a broad spectrum of plant physiological and biochemical processes, including, for example, systemic resistance to pathogens, responses to environmental stresses, e.g., heat, drought, salinity, and systemic gene silencing (e.g., viral infections).

  6. Detection of calmodulin binding protein at 170 KDA in BALB, AKR, DON and chicken granulosa cells

    International Nuclear Information System (INIS)

    Selinfreund, R.; Lin, P.H.; Marrone, B.; Wharton, W.

    1987-01-01

    Calmodulin (CAM) has been shown to bind to the epidermal growth factor (EGF) receptor (170 kDa) and is phosphorylated in a EGF dependent manner in the A431 human epidermoid carcinoma cells. In the present study, they report 125 I-CAM binding to a 170 kDa protein detected in cell membrane vesicles of Balb/3T3, AKR, DON and chicken granulosa cells. Purified plasma membranes from these cells were resolved via electrophoresis (without heat denaturation) and electroblotted onto nictrocellulose paper. Upon hybridizing against 125 I-CAM, a distinct autoradiographic band occurred at 170 kDa for all the cells lines under study. The binding of CAM is specific and can be displaced with the addition of excess unlabeled CAM. The result suggest that 125 I-CAM may bind to the 170 kDa EGF receptor in BALB, AKR, DON and chicken granulosa cells

  7. A Potato cDNA Encoding a Homologue of Mammalian Multidrug Resistant P-Glycoprotein

    Science.gov (United States)

    Wang, W.; Takezawa, D.; Poovaiah, B. W.

    1996-01-01

    A homologue of the multidrug resistance (MDR) gene was obtained while screening a potato stolon tip cDNA expression library with S-15-labeled calmodulin. The mammalian MDR gene codes for a membrane-bound P-glycoprotein (170-180 kDa) which imparts multidrug resistance to cancerous cells. The potato cDNA (PMDR1) codes for a polypeptide of 1313 amino acid residues (ca. 144 kDa) and its structural features are very similar to the MDR P-glycoprotein. The N-terminal half of the PMDR1-encoded protein shares striking homology with its C-terminal half, and each half contains a conserved ATP-binding site and six putative transmembrane domains. Southern blot analysis indicated that potato has one or two MDR-like genes. PMDR1 mRNA is constitutively expressed in all organs studied with higher expression in the stem and stolon tip. The PMDR1 expression was highest during tuber initiation and decreased during tuber development.

  8. Identification of the Calmodulin-Binding Domains of Fas Death Receptor.

    Directory of Open Access Journals (Sweden)

    Bliss J Chang

    Full Text Available The extrinsic apoptotic pathway is initiated by binding of a Fas ligand to the ectodomain of the surface death receptor Fas protein. Subsequently, the intracellular death domain of Fas (FasDD and that of the Fas-associated protein (FADD interact to form the core of the death-inducing signaling complex (DISC, a crucial step for activation of caspases that induce cell death. Previous studies have shown that calmodulin (CaM is recruited into the DISC in cholangiocarcinoma cells and specifically interacts with FasDD to regulate the apoptotic/survival signaling pathway. Inhibition of CaM activity in DISC stimulates apoptosis significantly. We have recently shown that CaM forms a ternary complex with FasDD (2:1 CaM:FasDD. However, the molecular mechanism by which CaM binds to two distinct FasDD motifs is not fully understood. Here, we employed mass spectrometry, nuclear magnetic resonance (NMR, biophysical, and biochemical methods to identify the binding regions of FasDD and provide a molecular basis for the role of CaM in Fas-mediated apoptosis. Proteolytic digestion and mass spectrometry data revealed that peptides spanning residues 209-239 (Fas-Pep1 and 251-288 (Fas-Pep2 constitute the two CaM-binding regions of FasDD. To determine the molecular mechanism of interaction, we have characterized the binding of recombinant/synthetic Fas-Pep1 and Fas-Pep2 peptides with CaM. Our data show that both peptides engage the N- and C-terminal lobes of CaM simultaneously. Binding of Fas-Pep1 to CaM is entropically driven while that of Fas-Pep2 to CaM is enthalpically driven, indicating that a combination of electrostatic and hydrophobic forces contribute to the stabilization of the FasDD-CaM complex. Our data suggest that because Fas-Pep1 and Fas-Pep2 are involved in extensive intermolecular contacts with the death domain of FADD, binding of CaM to these regions may hinder its ability to bind to FADD, thus greatly inhibiting the initiation of apoptotic signaling

  9. Calmodulin and calmodulin-binding proteins in cystic fibrosis and normal human fibroblasts

    International Nuclear Information System (INIS)

    Tallant, E.A.; Wallace, R.W.

    1986-01-01

    The authors have investigated the possibility that a lesion in a calmodulin (CaM)-dependent regulatory mechanism may be involved in cystic fibrosis (CF). The level of CaM, CaM-binding proteins (CaM-BP) and a CaM-dependent phosphatase (CaM-Ptase) have been compared in cultured fibroblasts from CF patients versus age- and sex-matched control subjects. The CaM concentration, measured by radioimmunoassay, ranged from 0.20 to 0.76 μg/mg protein (n=8); there was no significant difference in the average CaM concentration from CF patients vs controls. Using Western blotting techniques with 125 I-CaM, they detected at least ten distinct CaM-BPs in fibroblasts with molecular weights ranging from 230K to 37K; the only consistent difference between control and CF cell lines was in a 46.5K CaM-BP, which was depressed in all three CF samples. The 46.5 K CaM-BP was found only in the particulate fraction. A 59K CaM-BP was identified as a CaM-Ptase by its crossreactivity with an antibody against a brain CaM-Ptase. There was no significant difference in CaM-Ptase activity or in the amount of the phosphatase as determined by radioimmunoassay in CF vs. normal samples (n=8). Thus, the level of CaM as well as its various enzymes and proteins do not appear to be altered in CF fibroblasts except for a CaM-BP of 46.5K, the identity of which is currently being investigated

  10. Nonenzymatic glucosylation of neuronal calmodulin and its functional consequences

    International Nuclear Information System (INIS)

    Kowluru, R.A.; Kowluru, A.; Bitensky, M.W.

    1986-01-01

    Glucosylation (NEG) (nonenzymatic) of proteins is a posttranslational protein modification that occurs readily in the diabetic environment. As a consequence of NEG some proteins are known to undergo a change in function. Their studies of red blood cell (RBC) cytoskeletal proteins indicate that calmodulin is glucosylated in the diabetic RBC and this is followed by a change in function. Here they present new data in support of their earlier findings. Purified bovine brain calmodulin was glucosylated in vitro in the presence of 28 mM glucose. After six days of incubation at room temperature 2.75 moles of glucose were incorporated per mole of calmodulin. Glucosylated calmodulin exhibited a marked reduction in calcium dependent functions. Its ability to stimulate neuronal phosphodiesterase (PDE) and adenylate cyclase was reduced by 65 and 80% respectively. Its ability to stimulate rat brain protein kinase was reduced by 40%. Glucosylated calmodulin exhibited a 56% drop in its 45 Ca binding as compared with unmodified calmodulin. These data provide an additional example in which NEG markedly alters protein function

  11. Clicked bis-PEG-peptide conjugates for studying calmodulin-Kv7.2 channel binding.

    Science.gov (United States)

    Bonache, M Angeles; Alaimo, Alessandro; Malo, Covadonga; Millet, Oscar; Villarroel, Alvaro; González-Muñiz, Rosario

    2014-11-28

    The recombinant Kv7.2 calmodulin (CaM) binding site (Q2AB CaMBD) shows a high tendency to aggregate, thus complicating biochemical and structural studies. To facilitate these studies we have conceived bis-PEG-peptide CaMBD-mimetics linking helices A and B in single, easy to handle molecules. Short PEG chains were selected as spacers between the two peptide molecules, and a Cu(i)-catalyzed cycloaddition (CuAAC) protocol was used to assemble the final bis-PEG-peptide conjugate, by the convenient functionalization of PEG arms with azide and alkyne groups. The resulting conjugates, with a certain helical character in TFE solutions (CD), showed nanomolar affinity in a fluorescence CaM binding in vitro assay, higher than just the sum of the precursor PEG-peptide affinities, thus validating our design. The approach to these first described examples of Kv7.2 CaMBD-mimetics could pave the way to chimeric conjugates merging helices A and B from different Kv7 subunits.

  12. W342F Mutation in CCaMK Enhances Its Affinity to Calmodulin But Compromises Its Role in Supporting Root Nodule Symbiosis in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    Edgard Jauregui

    2017-11-01

    Full Text Available The calcium/calmodulin-dependent protein kinase (CCaMK is regulated by free Ca2+ and Ca2+-loaded calmodulin. This dual binding is believed to be involved in its regulation and associated physiological functions, although direct experimental evidence for this is lacking. Here we document that site-directed mutations in the calmodulin-binding domain of CCaMK alters its binding capacity to calmodulin, providing an effective approach to study how calmodulin regulates CCaMK in terms of kinase activity and regulation of rhizobial symbiosis in Medicago truncatula. We observed that mutating the tryptophan at position 342 to phenylalanine (W342F markedly increased the calmodulin-binding capability of the mutant. The mutant CCaMK underwent autophosphorylation and catalyzed substrate phosphorylation in the absence of calcium and calmodulin. When the mutant W342F was expressed in ccamk-1 roots, the transgenic roots exhibited an altered nodulation phenotype. These results indicate that altering the calmodulin-binding domain of CCaMK could generate a constitutively activated kinase with a negative role in the physiological function of CCaMK.

  13. Pivoting between calmodulin lobes triggered by calcium in the Kv7.2/calmodulin complex.

    Science.gov (United States)

    Alaimo, Alessandro; Alberdi, Araitz; Gomis-Perez, Carolina; Fernández-Orth, Juncal; Bernardo-Seisdedos, Ganeko; Malo, Covadonga; Millet, Oscar; Areso, Pilar; Villarroel, Alvaro

    2014-01-01

    Kv7.2 (KCNQ2) is the principal molecular component of the slow voltage gated M-channel, which strongly influences neuronal excitability. Calmodulin (CaM) binds to two intracellular C-terminal segments of Kv7.2 channels, helices A and B, and it is required for exit from the endoplasmic reticulum. However, the molecular mechanisms by which CaM controls channel trafficking are currently unknown. Here we used two complementary approaches to explore the molecular events underlying the association between CaM and Kv7.2 and their regulation by Ca(2+). First, we performed a fluorometric assay using dansylated calmodulin (D-CaM) to characterize the interaction of its individual lobes to the Kv7.2 CaM binding site (Q2AB). Second, we explored the association of Q2AB with CaM by NMR spectroscopy, using (15)N-labeled CaM as a reporter. The combined data highlight the interdependency of the N- and C-lobes of CaM in the interaction with Q2AB, suggesting that when CaM binds Ca(2+) the binding interface pivots between the N-lobe whose interactions are dominated by helix B and the C-lobe where the predominant interaction is with helix A. In addition, Ca(2+) makes CaM binding to Q2AB more difficult and, reciprocally, the channel weakens the association of CaM with Ca(2+).

  14. Pivoting between calmodulin lobes triggered by calcium in the Kv7.2/calmodulin complex.

    Directory of Open Access Journals (Sweden)

    Alessandro Alaimo

    Full Text Available Kv7.2 (KCNQ2 is the principal molecular component of the slow voltage gated M-channel, which strongly influences neuronal excitability. Calmodulin (CaM binds to two intracellular C-terminal segments of Kv7.2 channels, helices A and B, and it is required for exit from the endoplasmic reticulum. However, the molecular mechanisms by which CaM controls channel trafficking are currently unknown. Here we used two complementary approaches to explore the molecular events underlying the association between CaM and Kv7.2 and their regulation by Ca(2+. First, we performed a fluorometric assay using dansylated calmodulin (D-CaM to characterize the interaction of its individual lobes to the Kv7.2 CaM binding site (Q2AB. Second, we explored the association of Q2AB with CaM by NMR spectroscopy, using (15N-labeled CaM as a reporter. The combined data highlight the interdependency of the N- and C-lobes of CaM in the interaction with Q2AB, suggesting that when CaM binds Ca(2+ the binding interface pivots between the N-lobe whose interactions are dominated by helix B and the C-lobe where the predominant interaction is with helix A. In addition, Ca(2+ makes CaM binding to Q2AB more difficult and, reciprocally, the channel weakens the association of CaM with Ca(2+.

  15. Effect of Ca2+ on the promiscuous target-protein binding of calmodulin.

    Directory of Open Access Journals (Sweden)

    Annie M Westerlund

    2018-04-01

    Full Text Available Calmodulin (CaM is a calcium sensing protein that regulates the function of a large number of proteins, thus playing a crucial part in many cell signaling pathways. CaM has the ability to bind more than 300 different target peptides in a Ca2+-dependent manner, mainly through the exposure of hydrophobic residues. How CaM can bind a large number of targets while retaining some selectivity is a fascinating open question. Here, we explore the mechanism of CaM selective promiscuity for selected target proteins. Analyzing enhanced sampling molecular dynamics simulations of Ca2+-bound and Ca2+-free CaM via spectral clustering has allowed us to identify distinct conformational states, characterized by interhelical angles, secondary structure determinants and the solvent exposure of specific residues. We searched for indicators of conformational selection by mapping solvent exposure of residues in these conformational states to contacts in structures of CaM/target peptide complexes. We thereby identified CaM states involved in various binding classes arranged along a depth binding gradient. Binding Ca2+ modifies the accessible hydrophobic surface of the two lobes and allows for deeper binding. Apo CaM indeed shows shallow binding involving predominantly polar and charged residues. Furthermore, binding to the C-terminal lobe of CaM appears selective and involves specific conformational states that can facilitate deep binding to target proteins, while binding to the N-terminal lobe appears to happen through a more flexible mechanism. Thus the long-ranged electrostatic interactions of the charged residues of the N-terminal lobe of CaM may initiate binding, while the short-ranged interactions of hydrophobic residues in the C-terminal lobe of CaM may account for selectivity. This work furthers our understanding of the mechanism of CaM binding and selectivity to different target proteins and paves the way towards a comprehensive model of CaM selectivity.

  16. Specific nuclear localizing sequence directs two myosin isoforms to the cell nucleus in calmodulin-sensitive manner.

    Science.gov (United States)

    Dzijak, Rastislav; Yildirim, Sukriye; Kahle, Michal; Novák, Petr; Hnilicová, Jarmila; Venit, Tomáš; Hozák, Pavel

    2012-01-01

    Nuclear myosin I (NM1) was the first molecular motor identified in the cell nucleus. Together with nuclear actin, they participate in crucial nuclear events such as transcription, chromatin movements, and chromatin remodeling. NM1 is an isoform of myosin 1c (Myo1c) that was identified earlier and is known to act in the cytoplasm. NM1 differs from the "cytoplasmic" myosin 1c only by additional 16 amino acids at the N-terminus of the molecule. This amino acid stretch was therefore suggested to direct NM1 into the nucleus. We investigated the mechanism of nuclear import of NM1 in detail. Using over-expressed GFP chimeras encoding for truncated NM1 mutants, we identified a specific sequence that is necessary for its import to the nucleus. This novel nuclear localization sequence is placed within calmodulin-binding motif of NM1, thus it is present also in the Myo1c. We confirmed the presence of both isoforms in the nucleus by transfection of tagged NM1 and Myo1c constructs into cultured cells, and also by showing the presence of the endogenous Myo1c in purified nuclei of cells derived from knock-out mice lacking NM1. Using pull-down and co-immunoprecipitation assays we identified importin beta, importin 5 and importin 7 as nuclear transport receptors that bind NM1. Since the NLS sequence of NM1 lies within the region that also binds calmodulin we tested the influence of calmodulin on the localization of NM1. The presence of elevated levels of calmodulin interfered with nuclear localization of tagged NM1. We have shown that the novel specific NLS brings to the cell nucleus not only the "nuclear" isoform of myosin I (NM1 protein) but also its "cytoplasmic" isoform (Myo1c protein). This opens a new field for exploring functions of this molecular motor in nuclear processes, and for exploring the signals between cytoplasm and the nucleus.

  17. Ginseng gintonin activates the human cardiac delayed rectifier K+ channel: involvement of Ca2+/calmodulin binding sites.

    Science.gov (United States)

    Choi, Sun-Hye; Lee, Byung-Hwan; Kim, Hyeon-Joong; Jung, Seok-Won; Kim, Hyun-Sook; Shin, Ho-Chul; Lee, Jun-Hee; Kim, Hyoung-Chun; Rhim, Hyewhon; Hwang, Sung-Hee; Ha, Tal Soo; Kim, Hyun-Ji; Cho, Hana; Nah, Seung-Yeol

    2014-09-01

    Gintonin, a novel, ginseng-derived G protein-coupled lysophosphatidic acid (LPA) receptor ligand, elicits [Ca(2+)]i transients in neuronal and non-neuronal cells via pertussis toxin-sensitive and pertussis toxin-insensitive G proteins. The slowly activating delayed rectifier K(+) (I(Ks)) channel is a cardiac K(+) channel composed of KCNQ1 and KCNE1 subunits. The C terminus of the KCNQ1 channel protein has two calmodulin-binding sites that are involved in regulating I(Ks) channels. In this study, we investigated the molecular mechanisms of gintonin-mediated activation of human I(Ks) channel activity by expressing human I(Ks) channels in Xenopus oocytes. We found that gintonin enhances IKs channel currents in concentration- and voltage-dependent manners. The EC50 for the I(Ks) channel was 0.05 ± 0.01 μg/ml. Gintonin-mediated activation of the I(Ks) channels was blocked by an LPA1/3 receptor antagonist, an active phospholipase C inhibitor, an IP3 receptor antagonist, and the calcium chelator BAPTA. Gintonin-mediated activation of both the I(Ks) channel was also blocked by the calmodulin (CaM) blocker calmidazolium. Mutations in the KCNQ1 [Ca(2+)]i/CaM-binding IQ motif sites (S373P, W392R, or R539W)blocked the action of gintonin on I(Ks) channel. However, gintonin had no effect on hERG K(+) channel activity. These results show that gintonin-mediated enhancement of I(Ks) channel currents is achieved through binding of the [Ca(2+)]i/CaM complex to the C terminus of KCNQ1 subunit.

  18. Crystallization and preliminary X-ray characterization of the genetically encoded fluorescent calcium indicator protein GCaMP2

    International Nuclear Information System (INIS)

    Rodríguez Guilbe, María M.; Alfaro Malavé, Elisa C.; Akerboom, Jasper; Marvin, Jonathan S.; Looger, Loren L.; Schreiter, Eric R.

    2008-01-01

    The genetically encoded fluorescent calcium-indicator protein GCaMP2 was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution and the structure was solved by molecular replacement. Fluorescent proteins and their engineered variants have played an important role in the study of biology. The genetically encoded calcium-indicator protein GCaMP2 comprises a circularly permuted fluorescent protein coupled to the calcium-binding protein calmodulin and a calmodulin target peptide, M13, derived from the intracellular calmodulin target myosin light-chain kinase and has been used to image calcium transients in vivo. To aid rational efforts to engineer improved variants of GCaMP2, this protein was crystallized in the calcium-saturated form. X-ray diffraction data were collected to 2.0 Å resolution. The crystals belong to space group C2, with unit-cell parameters a = 126.1, b = 47.1, c = 68.8 Å, β = 100.5° and one GCaMP2 molecule in the asymmetric unit. The structure was phased by molecular replacement and refinement is currently under way

  19. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  20. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  1. Identification and Characterization of the Interaction Site between cFLIPL and Calmodulin.

    Directory of Open Access Journals (Sweden)

    Gabriel Gaidos

    Full Text Available Overexpression of the cellular FLICE-like inhibitory protein (cFLIP has been reported in a number of tumor types. As an inactive procaspase-8 homologue, cFLIP is recruited to the intracellular assembly known as the Death Inducing Signaling Complex (DISC where it inhibits apoptosis, leading to cancer cell proliferation. Here we characterize the molecular details of the interaction between cFLIPL and calmodulin, a ubiquitous calcium sensing protein. By expressing the individual domains of cFLIPL, we demonstrate that the interaction with calmodulin is mediated by the N-terminal death effector domain (DED1 of cFLIPL. Additionally, we mapped the interaction to a specific region of the C-terminus of DED1, referred to as DED1 R4. By designing DED1/DED2 chimeric constructs in which the homologous R4 regions of the two domains were swapped, calmodulin binding properties were transferred to DED2 and removed from DED1. Furthermore, we show that the isolated DED1 R4 peptide binds to calmodulin and solve the structure of the peptide-protein complex using NMR and computational refinement. Finally, we demonstrate an interaction between cFLIPL and calmodulin in cancer cell lysates. In summary, our data implicate calmodulin as a potential player in DISC-mediated apoptosis and provide evidence for a specific interaction with the DED1 of cFLIPL.

  2. Molecular and biochemical evidence for the involvement of calcium/calmodulin in auxin action

    Science.gov (United States)

    Yang, T.; Poovaiah, B. W.

    2000-01-01

    The use of (35)S-labeled calmodulin (CaM) to screen a corn root cDNA expression library has led to the isolation of a CaM-binding protein, encoded by a cDNA with sequence similarity to small auxin up RNAs (SAURs), a class of early auxin-responsive genes. The cDNA designated as ZmSAUR1 (Zea mays SAURs) was expressed in Escherichia coli, and the recombinant protein was purified by CaM affinity chromatography. The CaM binding assay revealed that the recombinant protein binds to CaM in a calcium-dependent manner. Deletion analysis revealed that the CaM binding site was located at the NH(2)-terminal domain. A synthetic peptide of amino acids 20-45, corresponding to the potential CaM binding region, was used for calcium-dependent mobility shift assays. The synthetic peptide formed a stable complex with CaM only in the presence of calcium. The CaM affinity assay indicated that ZmSAUR1 binds to CaM with high affinity (K(d) approximately 15 nM) in a calcium-dependent manner. Comparison of the NH(2)-terminal portions of all of the characterized SAURs revealed that they all contain a stretch of the basic alpha-amphiphilic helix similar to the CaM binding region of ZmSAUR1. CaM binds to the two synthetic peptides from the NH(2)-terminal regions of Arabidopsis SAUR-AC1 and soybean 10A5, suggesting that this is a general phenomenon for all SAURs. Northern analysis was carried out using the total RNA isolated from auxin-treated corn coleoptile segments. ZmSAUR1 gene expression began within 10 min, increased rapidly between 10 and 60 min, and peaked around 60 min after 10 microM alpha-naphthaleneacetic acid treatment. These results indicate that ZmSAUR1 is an early auxin-responsive gene. The CaM antagonist N-(6-aminohexyl)5-chloro-1-naphthalenesulfonamide hydrochloride inhibited the auxin-induced cell elongation but not the auxin-induced expression of ZmSAUR1. This suggests that calcium/CaM do not regulate ZmSAUR1 at the transcriptional level. CaM binding to ZmSAUR1 in a calcium

  3. Anti-calmodulins and tricyclic adjuvants in pain therapy block the TRPV1 channel.

    Directory of Open Access Journals (Sweden)

    Zoltán Oláh

    2007-06-01

    Full Text Available Ca(2+-loaded calmodulin normally inhibits multiple Ca(2+-channels upon dangerous elevation of intracellular Ca(2+ and protects cells from Ca(2+-cytotoxicity, so blocking of calmodulin should theoretically lead to uncontrolled elevation of intracellular Ca(2+. Paradoxically, classical anti-psychotic, anti-calmodulin drugs were noted here to inhibit Ca(2+-uptake via the vanilloid inducible Ca(2+-channel/inflamatory pain receptor 1 (TRPV1, which suggests that calmodulin inhibitors may block pore formation and Ca(2+ entry. Functional assays on TRPV1 expressing cells support direct, dose-dependent inhibition of vanilloid-induced (45Ca(2+-uptake at microM concentrations: calmidazolium (broad range > or = trifluoperazine (narrow range chlorpromazine/amitriptyline>fluphenazine>>W-7 and W-13 (only partially. Most likely a short acidic domain at the pore loop of the channel orifice functions as binding site either for Ca(2+ or anti-calmodulin drugs. Camstatin, a selective peptide blocker of calmodulin, inhibits vanilloid-induced Ca(2+-uptake in intact TRPV1(+ cells, and suggests an extracellular site of inhibition. TRPV1(+, inflammatory pain-conferring nociceptive neurons from sensory ganglia, were blocked by various anti-psychotic and anti-calmodulin drugs. Among them, calmidazolium, the most effective calmodulin agonist, blocked Ca(2+-entry by a non-competitive kinetics, affecting the TRPV1 at a different site than the vanilloid binding pocket. Data suggest that various calmodulin antagonists dock to an extracellular site, not found in other Ca(2+-channels. Calmodulin antagonist-evoked inhibition of TRPV1 and NMDA receptors/Ca(2+-channels was validated by microiontophoresis of calmidazolium to laminectomised rat monitored with extracellular single unit recordings in vivo. These unexpected findings may explain empirically noted efficacy of clinical pain adjuvant therapy that justify efforts to develop hits into painkillers, selective to sensory Ca(2

  4. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  5. Cloning and characterization of Sdga gene encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex in Scoparia dulcis.

    Science.gov (United States)

    Shite, Masato; Yamamura, Yoshimi; Hayashi, Toshimitsu; Kurosaki, Fumiya

    2008-11-01

    A homology-based cloning strategy yielded Sdga, a cDNA clone presumably encoding alpha-subunit of heterotrimeric guanosine 5'-triphosphate-binding protein complex, from leaf tissues of Scoparia dulcis. Phylogenetic tree analysis of G-protein alpha-subunits from various biological sources suggested that, unlike in animal cells, classification of Galpha-proteins into specific subfamilies could not be applicable to the proteins from higher plants. Restriction digests of genomic DNA of S. dulcis showed a single hybridized signal in Southern blot analysis, suggesting that Sdga is a sole gene encoding Galpha-subunit in this plant. The expression level of Sdga appeared to be maintained at almost constant level after exposure of the leaves to methyl jasmonate as analyzed by reverse-transcription polymerase chain reaction. These results suggest that Sdga plays roles in methyl jasmonate-induced responses of S. dulcis without a notable change in the transcriptional level.

  6. Small-angle scattering studies show distinct conformations of calmodulin in its complexes with two peptides based on the regulatory domain of the catalytic subunit of phosphorylase kinase

    International Nuclear Information System (INIS)

    Trewhella, J.; Blumenthal, D.K.; Rokop, S.E.; Seeger, P.A.

    1990-01-01

    Small-angle X-ray and neutron scattering have been used to study the solution structures of calmodulin complexed with synthetic peptides corresponding to residues 342-366 and 301-326, designated PhK5 and PhK13, respectively, in the regulatory domain of the catalytic subunit of skeletal muscle phosphorylase kinase. The scattering data show that binding of PhK5 to calmodulin induces a dramatic contraction of calmodulin, similar to that previously observed when calmodulin is complexed with the calmodulin-binding domain peptide from rabbit skeletal muscle myosin light chain kinase. In contrast, calmodulin remains extended upon binding PhK13. In the presence of both peptides, calmodulin also remains extended. Apparently, the presence of PhK13 inhibits calmodulin from undergoing the PhK5-induced contraction. These data indicate that there is a fundamentally different type of calmodulin-target enzyme interaction in the case of the catalytic subunit of phosphorylase kinase compared with that for myosin light chain kinase

  7. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  8. Apo calmodulin binding to the L-type voltage-gated calcium channel Cav1.2 IQ peptide

    International Nuclear Information System (INIS)

    Lian Luyun; Myatt, Daniel; Kitmitto, Ashraf

    2007-01-01

    The influx of calcium through the L-type voltage-gated calcium channels (LTCCs) is the trigger for the process of calcium-induced calcium release (CICR) from the sarcoplasmic recticulum, an essential step for cardiac contraction. There are two feedback mechanisms that regulate LTCC activity: calcium-dependent inactivation (CDI) and calcium-dependent facilitation (CDF), both of which are mediated by calmodulin (CaM) binding. The IQ domain (aa 1645-1668) housed within the cytoplasmic domain of the LTCC Ca v 1.2 subunit has been shown to bind both calcium-loaded (Ca 2+ CaM ) and calcium-free CaM (apoCaM). Here, we provide new data for the structural basis for the interaction of apoCaM with the IQ peptide using NMR, revealing that the apoCaM C-lobe residues are most significantly perturbed upon complex formation. In addition, we have employed transmission electron microscopy of purified LTCC complexes which shows that both apoCaM and Ca 2+ CaM can bind to the intact channel

  9. Cloning and characterization of a gene encoding Rac/Rop-like monomeric guanosine 5'-triphosphate-binding protein from Scoparia dulcis.

    Science.gov (United States)

    Mitamura, Toshiaki; Shite, Masato; Yamamura, Yoshimi; Kurosaki, Fumiya

    2009-06-01

    A cDNA clone, designated Sd-racrop (969 bp), was isolated from seedlings of Scoparia dulcis. This gene contains an open reading frame encoding the protein of 197 amino acid residues with high homology to Rac/Rop small guanosine 5'-triphosphate-binding proteins from various plant sources. In Southern hybridization analysis, the restriction digests prepared from genomic DNA of S. dulcis showed a main signal together with a few weakly hybridized bands. The transcriptional level of Sd-racrop showed a transient decrease by exposure of the leaf tissues of S. dulcis to the ethylene-generating reagent 2-chloroethylphosphonic acid. However, an appreciable increase in gene expression was reproducibly observed upon treatment of the plant with methyl jasmonate. These results suggest that the Sd-racrop product plays roles in ethylene- and methyl jasmonate-induced responses of S. dulcis accompanying the change in the transcriptional level, however, the cellular events mediated by this protein toward these external stimuli would be regulated by various mechanisms.

  10. Immunoselection of cDNAs to avian intestinal calcium binding protein 28K and a novel calmodulin-like protein: assessment of mRNA regulation by the Vitamin D hormone

    International Nuclear Information System (INIS)

    Mangelsdorf, D.J.; Komm, B.S.; McDonnell, D.P.; Pike, J.W.; Haussler, M.R.

    1987-01-01

    Calcium's role in a variety of cellular processes has been well documented. The storage, distribution, and delivery of calcium are regulated by a family of binding proteins including troponin C, calmodulin, parvalbumin, and vitamin D dependent calcium binding protein (CaBP-28), all of which have evolved from a common ancestral gene. To evaluate vitamin D regulation of gene transcription, a CaBP-28 cDNA (767 base pairs) was isolated from a chicken intestine λgt11 library utilizing a polyvalent CaBP-28 antibody as a probe. Coincident with the identification of the CaBP-28 cDNA, a group of cDNAs also was isolated (with the anti-CaBP-28 antibody) that demonstrated 84% nucleotide homology and 99% deduced amino acid homology with chicken brain calmodulin (CaM). This new CaM-like cDNA was named neoCaM. There is little nucleotide homology between the CaBP-28 cDNA and neoCaM. The CaBP-28 cDNA hybridizes with three transcripts of 2000, 2900, and 3300 bases which are dramatically induced by 1,25-dihydroxyvitamin D 3 [1,25(OH) 2 D 3 ], while the neoCaM cDNA recognizes three distinct (from CaBP-28) transcripts. Two of these mRNAs are 1400 and 1800 bases as described for brain CaM, but another large 4000-base transcript is detected with neoCaM. Neither the CaM nor the neoCaM transcript reveals any modulation by 1,25(OH) 2 D 3 . Herein, the authors discuss the possible significance of not only the isolation of both cDNAs with a single antibody but also the relation of neoCaM to other well-characterized CaM cDNAs

  11. The Binding Sites of miR-619-5p in the mRNAs of Human and Orthologous Genes.

    Science.gov (United States)

    Atambayeva, Shara; Niyazova, Raigul; Ivashchenko, Anatoliy; Pyrkova, Anna; Pinsky, Ilya; Akimniyazova, Aigul; Labeit, Siegfried

    2017-06-01

    Normally, one miRNA interacts with the mRNA of one gene. However, there are miRNAs that can bind to many mRNAs, and one mRNA can be the target of many miRNAs. This significantly complicates the study of the properties of miRNAs and their diagnostic and medical applications. The search of 2,750 human microRNAs (miRNAs) binding sites in 12,175 mRNAs of human genes using the MirTarget program has been completed. For the binding sites of the miR-619-5p the hybridization free energy of the bonds was equal to 100% of the maximum potential free energy. The mRNAs of 201 human genes have complete complementary binding sites of miR-619-5p in the 3'UTR (214 sites), CDS (3 sites), and 5'UTR (4 sites). The mRNAs of CATAD1, ICA1L, GK5, POLH, and PRR11 genes have six miR-619-5p binding sites, and the mRNAs of OPA3 and CYP20A1 genes have eight and ten binding sites, respectively. All of these miR-619-5p binding sites are located in the 3'UTRs. The miR-619-5p binding site in the 5'UTR of mRNA of human USP29 gene is found in the mRNAs of orthologous genes of primates. Binding sites of miR-619-5p in the coding regions of mRNAs of C8H8orf44, C8orf44, and ISY1 genes encode the WLMPVIP oligopeptide, which is present in the orthologous proteins. Binding sites of miR-619-5p in the mRNAs of transcription factor genes ZNF429 and ZNF429 encode the AHACNP oligopeptide in another reading frame. Binding sites of miR-619-5p in the 3'UTRs of all human target genes are also present in the 3'UTRs of orthologous genes of mammals. The completely complementary binding sites for miR-619-5p are conservative in the orthologous mammalian genes. The majority of miR-619-5p binding sites are located in the 3'UTRs but some genes have miRNA binding sites in the 5'UTRs of mRNAs. Several genes have binding sites for miRNAs in the CDSs that are read in different open reading frames. Identical nucleotide sequences of binding sites encode different amino acids in different proteins. The binding sites of miR-619-5p

  12. A maize gene encoding an NADPH binding enzyme highly homologous to isoflavone reductases is activated in response to sulfur starvation.

    Science.gov (United States)

    Petrucco, S; Bolchi, A; Foroni, C; Percudani, R; Rossi, G L; Ottonello, S

    1996-01-01

    we isolated a novel gene that is selectively induced both in roots and shoots in response to sulfur starvation. This gene encodes a cytosolic, monomeric protein of 33 kD that selectively binds NADPH. The predicted polypeptide is highly homologous ( > 70%) to leguminous isoflavone reductases (IFRs), but the maize protein (IRL for isoflavone reductase-like) belongs to a novel family of proteins present in a variety of plants. Anti-IRL antibodies specifically recognize IFR polypeptides, yet the maize protein is unable to use various isoflavonoids as substrates. IRL expression is correlated closely to glutathione availability: it is persistently induced in seedlings whose glutathione content is about fourfold lower than controls, and it is down-regulated rapidly when control levels of glutathione are restored. This glutathione-dependent regulation indicates that maize IRL may play a crucial role in the establishment of a thiol-independent response to oxidative stress under glutathione shortage conditions.

  13. Fesselin is a target protein for calmodulin in a calcium-dependent manner

    International Nuclear Information System (INIS)

    KoIakowski, Janusz; Wrzosek, Antoni; Dabrowska, Renata

    2004-01-01

    Fesselin is a basic protein isolated from smooth muscle which binds G-actin and accelerates its polymerization as well as cross-links assembled filaments [J. Muscle Res. Cell Motil. 20 (1999) 539; Biochemistry 40 (2001) 14252]. In this report experimental evidence is provided for the first time proving that fesselin can interact with calmodulin in a Ca 2+ -dependent manner in vitro. Using ion exchange, followed by calmodulin-affinity chromatography, enabled us to simplify and shorten the fesselin preparation procedure and increase its yield by about three times in comparison to the procedure described by Leinweber et al. [J. Muscle Res. Cell Motil. 20 (1999) 539]. Fesselin interaction with dansyl-labelled calmodulin causes a 2-fold increase in maximum fluorescence intensity of the fluorophore and a 21 nm blue shift of the spectrum. The transition of complex formation between fesselin and calmodulin occurs at submicromolar concentration of calcium ions. The dissociation constant of fesselin Ca 2+ /calmodulin complexes amounted to 10 -8 M. The results suggest the existence of a direct link between Ca 2+ /calmodulin and fesselin at the level of actin cytoskeleton dynamics in smooth muscle

  14. Engineering of specific uranyl-coordination sites in the calcium-binding motif of Calmodulin

    International Nuclear Information System (INIS)

    Beccia, M.; Pardoux, R.; Sauge-Merle, S.; Bremond, N.; Lemaire, D.; Berthomieu, C.; Delangle, P.; Guilbaud, P.

    2014-01-01

    Complete text of publication follows: Characterization of heavy metals interactions with proteins is fundamental for understanding the molecular factors and mechanisms governing ions toxicity and speciation in cells. This line of research will also help in developing new molecules able to selectively and efficiently bind toxic metal ions, which could find application for bio-detection or bioremediation purposes. We have used the regulatory calcium-binding protein Calmodulin (CaM) from A. thaliana as a structural model and, starting from it, we have designed various mutants by site-directed mutagenesis. We have analysed thermodynamics of uranyl ion binding to both sites I and II of CaM N-terminal domain and we have identified structural factors governing this interaction. Selectivity for uranyl ion has been tested by studying reactions of the investigated peptides with Ca 2+ , in the same conditions used for UO 2 2+ . Spectro-fluorimetric titrations and FTIR analysis have shown that the affinity for uranyl increases by phosphorylation of a threonine in site I, especially approaching the physiological pH, where the phospho-threonine side chain is deprotonated. Based on structural models obtained by Molecular Dynamics, we tested the effect of a two residues deletion on site I properties. We obtained an almost two orders of magnitude increase in affinity for uranyl, with a sub-nanomolar dissociation constant for the uranyl complex with the non phosphorylated peptide, and an improved uranyl/calcium selectivity. Allosteric effects depending on Ca 2+ and UO 2 2+ binding have been investigated by comparing thermodynamic parameters obtained for mutants having both sites I and II able to chelate metal ions with those of mutants consisting of just one active site

  15. Resistance to β-Lactams in Neisseria ssp Due to Chromosomally Encoded Penicillin-Binding Proteins.

    Science.gov (United States)

    Zapun, André; Morlot, Cécile; Taha, Muhamed-Kheir

    2016-09-28

    Neisseria meningitidis and Neisseria gonorrhoeae are human pathogens that cause a variety of life-threatening systemic and local infections, such as meningitis or gonorrhoea. The treatment of such infection is becoming more difficult due to antibiotic resistance. The focus of this review is on the mechanism of reduced susceptibility to penicillin and other β-lactams due to the modification of chromosomally encoded penicillin-binding proteins (PBP), in particular PBP2 encoded by the penA gene. The variety of penA alleles and resulting variant PBP2 enzymes is described and the important amino acid substitutions are presented and discussed in a structural context.

  16. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  17. Intrinsically disordered caldesmon binds calmodulin via the “buttons on a string” mechanism

    Directory of Open Access Journals (Sweden)

    Sergei E. Permyakov

    2015-09-01

    Full Text Available We show here that chicken gizzard caldesmon (CaD and its C-terminal domain (residues 636–771, CaD136 are intrinsically disordered proteins. The computational and experimental analyses of the wild type CaD136 and series of its single tryptophan mutants (W674A, W707A, and W737A and a double tryptophan mutant (W674A/W707A suggested that although the interaction of CaD136 with calmodulin (CaM can be driven by the non-specific electrostatic attraction between these oppositely charged molecules, the specificity of CaD136-CaM binding is likely to be determined by the specific packing of important CaD136 tryptophan residues at the CaD136-CaM interface. It is suggested that this interaction can be described as the “buttons on a charged string” model, where the electrostatic attraction between the intrinsically disordered CaD136 and the CaM is solidified in a “snapping buttons” manner by specific packing of the CaD136 “pliable buttons” (which are the short segments of fluctuating local structure condensed around the tryptophan residues at the CaD136-CaM interface. Our data also show that all three “buttons” are important for binding, since mutation of any of the tryptophans affects CaD136-CaM binding and since CaD136 remains CaM-buttoned even when two of the three tryptophans are mutated to alanines.

  18. Genome Wide Analysis of Nucleotide-Binding Site Disease Resistance Genes in Brachypodium distachyon

    Directory of Open Access Journals (Sweden)

    Shenglong Tan

    2012-01-01

    Full Text Available Nucleotide-binding site (NBS disease resistance genes play an important role in defending plants from a variety of pathogens and insect pests. Many R-genes have been identified in various plant species. However, little is known about the NBS-encoding genes in Brachypodium distachyon. In this study, using computational analysis of the B. distachyon genome, we identified 126 regular NBS-encoding genes and characterized them on the bases of structural diversity, conserved protein motifs, chromosomal locations, gene duplications, promoter region, and phylogenetic relationships. EST hits and full-length cDNA sequences (from Brachypodium database of 126 R-like candidates supported their existence. Based on the occurrence of conserved protein motifs such as coiled-coil (CC, NBS, leucine-rich repeat (LRR, these regular NBS-LRR genes were classified into four subgroups: CC-NBS-LRR, NBS-LRR, CC-NBS, and X-NBS. Further expression analysis of the regular NBS-encoding genes in Brachypodium database revealed that these genes are expressed in a wide range of libraries, including those constructed from various developmental stages, tissue types, and drought challenged or nonchallenged tissue.

  19. LETM1, a novel gene encoding a putative EF-hand Ca(2+)-binding protein, flanks the Wolf-Hirschhorn syndrome (WHS) critical region and is deleted in most WHS patients.

    Science.gov (United States)

    Endele, S; Fuhry, M; Pak, S J; Zabel, B U; Winterpacht, A

    1999-09-01

    Deletions within human chromosome 4p16.3 cause Wolf-Hirschhorn syndrome (WHS), which is characterized by severe mental and developmental defects. It is thought that haploinsufficiency of more than one gene contributes to the complex phenotype. We have cloned and characterized a novel gene (LETM1) that is deleted in nearly all WHS patients. LETM1 encodes a putative member of the EF-hand family of Ca(2+)-binding proteins. The protein contains two EF-hands, a transmembrane domain, a leucine zipper, and several coiled-coil domains. On the basis of its possible Ca(2+)-binding property and involvement in Ca(2+) signaling and/or homeostasis, we propose that haploinsufficiency of LETM1 may contribute to the neuromuscular features of WHS patients. Copyright 1999 Academic Press.

  20. Ca(2+)-calmodulin-dependent phosphorylation of islet secretory granule proteins

    International Nuclear Information System (INIS)

    Watkins, D.T.

    1991-01-01

    The effect of Ca2+ and calmodulin on phosphorylation of islet secretory granule proteins was studied. Secretory granules were incubated in a phosphorylation reaction mixture containing [32P]ATP and test reagents. The 32P-labeled proteins were resolved by sodium dodecyl sulfate-polyacrylamide gel electrophoresis, the 32P content was visualized by autoradiography, and the relative intensities of specific bands were quantitated. When the reaction mixture contained EGTA and no added Ca2+, 32P was incorporated into two proteins with molecular weights of 45,000 and 13,000. When 10(-4) M Ca2+ was added without EGTA, two additional proteins (58,000 and 48,000 Mr) were phosphorylated, and the 13,000-Mr protein was absent. The addition of 2.4 microM calmodulin markedly enhanced the phosphorylation of the 58,000- and 48,000-Mr proteins and resulted in the phosphorylation of a major protein whose molecular weight (64,000 Mr) is identical to that of one of the calmodulin binding proteins located on the granule surface. Calmodulin had no effect on phosphorylation in the absence of Ca2+ but was effective in the presence of calcium between 10 nM and 50 microM. Trifluoperazine and calmidazolium, calmodulin antagonists, produced a dose-dependent inhibition of the calmodulin effect. 12-O-tetradecanoylphorbol 13-acetate, a phorbol ester that activates protein kinase C, produced no increase in phosphorylation, and 1-(5-isoquinoline sulfonyl)-2-methyl piperazine dihydrochloride, an inhibitor of protein kinase C, had no effect. These results indicate that Ca(2+)-calmodulin-dependent protein kinases and endogenous substrates are present in islet secretory granules

  1. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  2. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  3. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  4. Polarized axonal surface expression of neuronal KCNQ potassium channels is regulated by calmodulin interaction with KCNQ2 subunit.

    Directory of Open Access Journals (Sweden)

    John P Cavaretta

    Full Text Available KCNQ potassium channels composed of KCNQ2 and KCNQ3 subunits give rise to the M-current, a slow-activating and non-inactivating voltage-dependent potassium current that limits repetitive firing of action potentials. KCNQ channels are enriched at the surface of axons and axonal initial segments, the sites for action potential generation and modulation. Their enrichment at the axonal surface is impaired by mutations in KCNQ2 carboxy-terminal tail that cause benign familial neonatal convulsion and myokymia, suggesting that their correct surface distribution and density at the axon is crucial for control of neuronal excitability. However, the molecular mechanisms responsible for regulating enrichment of KCNQ channels at the neuronal axon remain elusive. Here, we show that enrichment of KCNQ channels at the axonal surface of dissociated rat hippocampal cultured neurons is regulated by ubiquitous calcium sensor calmodulin. Using immunocytochemistry and the cluster of differentiation 4 (CD4 membrane protein as a trafficking reporter, we demonstrate that fusion of KCNQ2 carboxy-terminal tail is sufficient to target CD4 protein to the axonal surface whereas inhibition of calmodulin binding to KCNQ2 abolishes axonal surface expression of CD4 fusion proteins by retaining them in the endoplasmic reticulum. Disruption of calmodulin binding to KCNQ2 also impairs enrichment of heteromeric KCNQ2/KCNQ3 channels at the axonal surface by blocking their trafficking from the endoplasmic reticulum to the axon. Consistently, hippocampal neuronal excitability is dampened by transient expression of wild-type KCNQ2 but not mutant KCNQ2 deficient in calmodulin binding. Furthermore, coexpression of mutant calmodulin, which can interact with KCNQ2/KCNQ3 channels but not calcium, reduces but does not abolish their enrichment at the axonal surface, suggesting that apo calmodulin but not calcium-bound calmodulin is necessary for their preferential targeting to the axonal

  5. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    Science.gov (United States)

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A; Rubin, P; Kemp, J; Israel, E; Busse, W; Ledford, D; Murray, J J; Segal, A; Tinkleman, D; Drazen, J M

    1997-03-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, deletion of two, or addition of one zinc finger (Sp1/Egr-1) binding sites in the region 176 to 147 bp upstream from the ATG translation start site where there are normally 5 Sp1 binding motifs in tandem. Reporter gene activity directed by any of the mutant forms of the transcription factor binding region was significantly (P < 0.05) less effective than the activity driven by the wild type transcription factor binding region. Electrophoretic mobility shift assays (EMSAs) demonstrated the capacity of wild type and mutant transcription factor binding regions to bind nuclear extracts from human umbilical vein endothelial cells (HUVECs). These data are consistent with a family of mutations in the 5-LO gene that can modify reporter gene transcription possibly through differences in Sp1 and Egr-1 transactivation.

  6. Triple-resonance multidimensional NMR study of calmodulin complexed with the binding domain of skeletal muscle myosin light-chain kinase: Indication of a conformational change in the central helix

    International Nuclear Information System (INIS)

    Ikura, Mitsuhiko; Kay, L.E.; Bax, A.; Krinks, M.

    1991-01-01

    Heteronuclear 3D and 4D NMR experiments have been used to obtain 1 H, 13 C, and 15 N backbone chemical shift assignments in Ca 2+ -loaded clamodulin complexed with a 26-residue synthetic peptide (M13) corresponding to the calmodulin-bionding domain (residues 577-602) of rabbit skeletal muscle muosin light-chain kinase. Comparison of the chemical shift values with those observed in peptide-free calmodulin shows that binding of M13 peptide induces substantial chemical shift changes that are not localized in one particular region of the protein. The largest changes are found in the first helix of the Ca 2+ -binding site 1 (E11-E14), the N-terminal portion of the central helix (M72-D78), and the second helix of the Ca 2+ -binding site 4 (F141-M145). Analysis of backbone NOE connectivities indicates a change from α-helical to an extended conformation for residues 75-77 upon complexation with M13. Upon complexation with M13, a significant decrease in the amide exchange rate is observed for residues T110, L112, G113, and E114 at the end of the second helix of site 3

  7. Systematic Analysis and Comparison of Nucleotide-Binding Site Disease Resistance Genes in a Diploid Cotton Gossypium raimondii

    Science.gov (United States)

    Wei, Hengling; Li, Wei; Sun, Xiwei; Zhu, Shuijin; Zhu, Jun

    2013-01-01

    Plant disease resistance genes are a key component of defending plants from a range of pathogens. The majority of these resistance genes belong to the super-family that harbors a Nucleotide-binding site (NBS). A number of studies have focused on NBS-encoding genes in disease resistant breeding programs for diverse plants. However, little information has been reported with an emphasis on systematic analysis and comparison of NBS-encoding genes in cotton. To fill this gap of knowledge, in this study, we identified and investigated the NBS-encoding resistance genes in cotton using the whole genome sequence information of Gossypium raimondii. Totally, 355 NBS-encoding resistance genes were identified. Analyses of the conserved motifs and structural diversity showed that the most two distinct features for these genes are the high proportion of non-regular NBS genes and the high diversity of N-termini domains. Analyses of the physical locations and duplications of NBS-encoding genes showed that gene duplication of disease resistance genes could play an important role in cotton by leading to an increase in the functional diversity of the cotton NBS-encoding genes. Analyses of phylogenetic comparisons indicated that, in cotton, the NBS-encoding genes with TIR domain not only have their own evolution pattern different from those of genes without TIR domain, but also have their own species-specific pattern that differs from those of TIR genes in other plants. Analyses of the correlation between disease resistance QTL and NBS-encoding resistance genes showed that there could be more than half of the disease resistance QTL associated to the NBS-encoding genes in cotton, which agrees with previous studies establishing that more than half of plant resistance genes are NBS-encoding genes. PMID:23936305

  8. Differential binding of calmodulin-related proteins to their targets revealed through high-density Arabidopsis protein microarrays

    Science.gov (United States)

    Popescu, Sorina C.; Popescu, George V.; Bachan, Shawn; Zhang, Zimei; Seay, Montrell; Gerstein, Mark; Snyder, Michael; Dinesh-Kumar, S. P.

    2007-01-01

    Calmodulins (CaMs) are the most ubiquitous calcium sensors in eukaryotes. A number of CaM-binding proteins have been identified through classical methods, and many proteins have been predicted to bind CaMs based on their structural homology with known targets. However, multicellular organisms typically contain many CaM-like (CML) proteins, and a global identification of their targets and specificity of interaction is lacking. In an effort to develop a platform for large-scale analysis of proteins in plants we have developed a protein microarray and used it to study the global analysis of CaM/CML interactions. An Arabidopsis thaliana expression collection containing 1,133 ORFs was generated and used to produce proteins with an optimized medium-throughput plant-based expression system. Protein microarrays were prepared and screened with several CaMs/CMLs. A large number of previously known and novel CaM/CML targets were identified, including transcription factors, receptor and intracellular protein kinases, F-box proteins, RNA-binding proteins, and proteins of unknown function. Multiple CaM/CML proteins bound many binding partners, but the majority of targets were specific to one or a few CaMs/CMLs indicating that different CaM family members function through different targets. Based on our analyses, the emergent CaM/CML interactome is more extensive than previously predicted. Our results suggest that calcium functions through distinct CaM/CML proteins to regulate a wide range of targets and cellular activities. PMID:17360592

  9. A calcium-dependent protein kinase can inhibit a calmodulin-stimulated Ca2+ pump (ACA2) located in the endoplasmic reticulum of Arabidopsis

    Science.gov (United States)

    Hwang, I.; Sze, H.; Harper, J. F.; Evans, M. L. (Principal Investigator)

    2000-01-01

    The magnitude and duration of a cytosolic Ca(2+) release can potentially be altered by changing the rate of Ca(2+) efflux. In plant cells, Ca(2+) efflux from the cytoplasm is mediated by H(+)/Ca(2+)-antiporters and two types of Ca(2+)-ATPases. ACA2 was recently identified as a calmodulin-regulated Ca(2+)-pump located in the endoplasmic reticulum. Here, we show that phosphorylation of its N-terminal regulatory domain by a Ca(2+)-dependent protein kinase (CDPK isoform CPK1), inhibits both basal activity ( approximately 10%) and calmodulin stimulation ( approximately 75%), as shown by Ca(2+)-transport assays with recombinant enzyme expressed in yeast. A CDPK phosphorylation site was mapped to Ser(45) near a calmodulin binding site, using a fusion protein containing the N-terminal domain as an in vitro substrate for a recombinant CPK1. In a full-length enzyme, an Ala substitution for Ser(45) (S45/A) completely blocked the observed CDPK inhibition of both basal and calmodulin-stimulated activities. An Asp substitution (S45/D) mimicked phosphoinhibition, indicating that a negative charge at this position is sufficient to account for phosphoinhibition. Interestingly, prior binding of calmodulin blocked phosphorylation. This suggests that, once ACA2 binds calmodulin, its activation state becomes resistant to phosphoinhibition. These results support the hypothesis that ACA2 activity is regulated as the balance between the initial kinetics of calmodulin stimulation and CDPK inhibition, providing an example in plants for a potential point of crosstalk between two different Ca(2+)-signaling pathways.

  10. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  11. Trichoderma genes

    Science.gov (United States)

    Foreman, Pamela [Los Altos, CA; Goedegebuur, Frits [Vlaardingen, NL; Van Solingen, Pieter [Naaldwijk, NL; Ward, Michael [San Francisco, CA

    2012-06-19

    Described herein are novel gene sequences isolated from Trichoderma reesei. Two genes encoding proteins comprising a cellulose binding domain, one encoding an arabionfuranosidase and one encoding an acetylxylanesterase are described. The sequences, CIP1 and CIP2, contain a cellulose binding domain. These proteins are especially useful in the textile and detergent industry and in pulp and paper industry.

  12. Characterization and expression of calmodulin gene during larval settlement and metamorphosis of the polychaete Hydroides elegans

    KAUST Repository

    Chen, Zhangfan

    2012-08-01

    The polychaete . Hydroides elegans (Serpulidae, Lophotrochozoa) is a problematic marine fouling organism in most tropical and subtropical coastal environment. Competent larvae of . H. elegans undergo the transition from the swimming larval stage to the sessile juvenile stage with substantial morphological, physiological, and behavior changes. This transition is often referred to as larval settlement and metamorphosis. In this study, we examined the possible involvement of calmodulin (CaM) - a multifunctional calcium metabolism regulator, in the larval settlement and metamorphosis of . H. elegans. A full-length . CaM cDNA was successfully cloned from . H. elegans (. He-CaM) and it contained an open reading frame of 450. bp, encoding 149 amino acid residues. It was highly expressed in 12. h post-metamorphic juveniles, and remained high in adults. . In situ hybridization conducted in competent larvae and juveniles revealed that . He-CaM gene was continuously expressed in the putative growth zones, branchial rudiments, and collar region, suggesting that . He-CaM might be involved in tissue differentiation and development. Our subsequent bioassay revealed that the CaM inhibitor W7 could effectively inhibit larval settlement and metamorphosis, and cause some morphological defects of unsettled larvae. In conclusion, our results revealed that CaM has important functions in the larval settlement and metamorphosis of . H. elegans. © 2012 Elsevier Inc..

  13. Proteomic Analysis of Calcium- and Phosphorylation-dependentCalmodulin Complexes in Mammalian Cells

    Energy Technology Data Exchange (ETDEWEB)

    Jang, Deok-Jin; Wang, Daojing

    2006-05-26

    Protein conformational changes due to cofactor binding (e.g. metal ions, heme) and/or posttranslational modifications (e.g. phosphorylation) modulate dynamic protein complexes. Calmodulin (CaM) plays an essential role in regulating calcium (Ca{sup 2+}) signaling and homeostasis. No systematic approach on the identification of phosphorylation-dependent Ca{sup 2+}/CaM binding proteins has been published. Herein, we report a proteome-wide study of phosphorylation-dependent CaM binding proteins from mammalian cells. This method, termed 'Dynamic Phosphoprotein Complex Trapping', 'DPPC Trapping' for short, utilizes a combination of in vivo and in vitro assays. The basic strategy is to drastically shift the equilibrium towards endogenous phosphorylation of Ser, Thr, and Tyr at the global scale by inhibiting corresponding phosphatases in vivo. The phosphorylation-dependent calmodulin-binding proteins are then trapped in vitro in a Ca{sup 2+}-dependent manner by CaM-Sepharose chromatography. Finally, the isolated calmodulin-binding proteins are separated by SDS-PAGE and identified by LC/MS/MS. In parallel, the phosphorylation-dependent binding is visualized by silver staining and/or Western blotting. Using this method, we selectively identified over 120 CaM-associated proteins including many previously uncharacterized. We verified ubiquitin-protein ligase EDD1, inositol 1, 4, 5-triphosphate receptor type 1 (IP{sub 3}R1), and ATP-dependent RNA helicase DEAD box protein 3 (DDX3), as phosphorylation-dependent CaM binding proteins. To demonstrate the utilities of our method in understanding biological pathways, we showed that pSer/Thr of IP{sub 3}R1 in vivo by staurosporine-sensitive kinase(s), but not by PKA/PKG/PKC, significantly reduced the affinity of its Ca{sup 2+}-dependent CaM binding. However, pSer/Thr of IP{sub 3}R1 did not substantially affect its Ca{sup 2+}-independent CaM binding. We further showed that phosphatase PP1, but not PP2A or PP2B

  14. Expression of Calmodulin and Myosin Light Chain Kinase during Larval Settlement of the Barnacle Balanus amphitrite

    KAUST Repository

    Chen, Zhang-Fan; Wang, Hao; Matsumura, Kiyotaka; Qian, Pei-Yuan

    2012-01-01

    Barnacles are one of the most common organisms in intertidal areas. Their life cycle includes seven free-swimming larval stages and sessile juvenile and adult stages. The transition from the swimming to the sessile stages, referred to as larval settlement, is crucial for their survivor success and subsequent population distribution. In this study, we focused on the involvement of calmodulin (CaM) and its binding proteins in the larval settlement of the barnacle, Balanus (= Amphibalanus) amphitrite. The full length of CaM gene was cloned from stage II nauplii of B. amphitrite (referred to as Ba-CaM), encoding 149 amino acid residues that share a high similarity with published CaMs in other organisms. Quantitative real-time PCR showed that Ba-CaM was highly expressed in cyprids, the stage at which swimming larvae are competent to attach and undergo metamorphosis. In situ hybridization revealed that the expressed Ba-CaM gene was localized in compound eyes, posterior ganglion and cement glands, all of which may have essential functions during larval settlement. Larval settlement assays showed that both the CaM inhibitor compound 48/80 and the CaM-dependent myosin light chain kinase (MLCK) inhibitor ML-7 effectively blocked barnacle larval settlement, whereas Ca 2+/CaM-dependent kinase II (CaMKII) inhibitors did not show any clear effects. The subsequent real-time PCR assay showed a higher expression level of Ba-MLCK gene in larval stages than in adults, suggesting an important role of Ba-MLCK gene in larval development and competency. Overall, the results suggest that CaM and CaM-dependent MLCK function during larval settlement of B. amphitrite. © 2012 Chen et al.

  15. Expression of Calmodulin and Myosin Light Chain Kinase during Larval Settlement of the Barnacle Balanus amphitrite

    KAUST Repository

    Chen, Zhang-Fan

    2012-02-13

    Barnacles are one of the most common organisms in intertidal areas. Their life cycle includes seven free-swimming larval stages and sessile juvenile and adult stages. The transition from the swimming to the sessile stages, referred to as larval settlement, is crucial for their survivor success and subsequent population distribution. In this study, we focused on the involvement of calmodulin (CaM) and its binding proteins in the larval settlement of the barnacle, Balanus (= Amphibalanus) amphitrite. The full length of CaM gene was cloned from stage II nauplii of B. amphitrite (referred to as Ba-CaM), encoding 149 amino acid residues that share a high similarity with published CaMs in other organisms. Quantitative real-time PCR showed that Ba-CaM was highly expressed in cyprids, the stage at which swimming larvae are competent to attach and undergo metamorphosis. In situ hybridization revealed that the expressed Ba-CaM gene was localized in compound eyes, posterior ganglion and cement glands, all of which may have essential functions during larval settlement. Larval settlement assays showed that both the CaM inhibitor compound 48/80 and the CaM-dependent myosin light chain kinase (MLCK) inhibitor ML-7 effectively blocked barnacle larval settlement, whereas Ca 2+/CaM-dependent kinase II (CaMKII) inhibitors did not show any clear effects. The subsequent real-time PCR assay showed a higher expression level of Ba-MLCK gene in larval stages than in adults, suggesting an important role of Ba-MLCK gene in larval development and competency. Overall, the results suggest that CaM and CaM-dependent MLCK function during larval settlement of B. amphitrite. © 2012 Chen et al.

  16. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues

    OpenAIRE

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents ...

  17. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  18. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  19. The transient receptor potential, TRP4, cation channel is a novel member of the family of calmodulin binding proteins.

    OpenAIRE

    Trost, C; Bergs, C; Himmerkus, N; Flockerzi, V

    2001-01-01

    The mammalian gene products, transient receptor potential (trp)1 to trp7, are related to the Drosophila TRP and TRP-like ion channels, and are candidate proteins underlying agonist-activated Ca(2+)-permeable ion channels. Recently, the TRP4 protein has been shown to be part of native store-operated Ca(2+)-permeable channels. These channels, most likely, are composed of other proteins in addition to TRP4. In the present paper we report the direct interaction of TRP4 and calmodulin (CaM) by: (1...

  20. Gene expression profiles in adenosine-treated human mast cells ...

    African Journals Online (AJOL)

    Gene expression profiles in adenosine-treated human mast cells. ... SW Kang, JE Jeong, CH Kim, SH Choi, SH Chae, SA Jun, HJ Cha, JH Kim, YM Lee, YS ... beta 4, ring finger protein, high-mobility group, calmodulin 2, RAN binding protein, ...

  1. Tlys, a newly identified Sulfolobus spindle-shaped virus 1 transcript expressed in the lysogenic state, encodes a DNA-binding protein interacting at the promoters of the early genes

    DEFF Research Database (Denmark)

    Fusco, Salvatore; She, Qunxin; Bartolucci, Simonetta

    2013-01-01

    -binding motif. DNA-binding assays demonstrated that the recombinant F55, purified from Escherichia coli, is indeed a putative transcription factor able to recognize site specifically target sequences in the promoters of the early induced T5, T6, and Tind transcripts, as well as of its own promoter. Binding...... the growth of the lysogenic host. The correponding gene f55 lies between two transcriptional units (T6 and Tind) that are upregulated upon UV irradiation. The open reading frame f55 encodes a 6.3-kDa protein which shows sequence identity with negative regulators that fold into the ribbon-helix-helix DNA....... Taking together the transcriptional analysis data and the biochemical evidences, we surmise that the protein F55 is involved in the regulation of the lysogenic state of SSV1....

  2. Calmodulin interacts with PAC1 and VPAC2 receptors and regulates PACAP-induced FOS expression in human neuroblastoma cells

    DEFF Research Database (Denmark)

    Falktoft, B.; Georg, B.; Fahrenkrug, J.

    2009-01-01

    is a well-known marker of neuronal activation, so we used a human neuroblastoma cell line NB-1 to explore the role of calmodulin in PACAP-induced FOS gene expression. We observed both short-term and prolonged altered PACAP-mediated activation of the FOS gene in the presence of the calmodulin-antagonist W-7...

  3. Naturally occurring mutations in the human 5-lipoxygenase gene promoter that modify transcription factor binding and reporter gene transcription.

    OpenAIRE

    In, K H; Asano, K; Beier, D; Grobholz, J; Finn, P W; Silverman, E K; Silverman, E S; Collins, T; Fischer, A R; Keith, T P; Serino, K; Kim, S W; De Sanctis, G T; Yandava, C; Pillari, A

    1997-01-01

    Five lipoxygenase (5-LO) is the first committed enzyme in the metabolic pathway leading to the synthesis of the leukotrienes. We examined genomic DNA isolated from 25 normal subjects and 31 patients with asthma (6 of whom had aspirin-sensitive asthma) for mutations in the known transcription factor binding regions and the protein encoding region of the 5-LO gene. A family of mutations in the G + C-rich transcription factor binding region was identified consisting of the deletion of one, delet...

  4. A dynamic model of interactions of Ca2+, calmodulin, and catalytic subunits of Ca2+/calmodulin-dependent protein kinase II.

    Directory of Open Access Journals (Sweden)

    Shirley Pepke

    2010-02-01

    Full Text Available During the acquisition of memories, influx of Ca2+ into the postsynaptic spine through the pores of activated N-methyl-D-aspartate-type glutamate receptors triggers processes that change the strength of excitatory synapses. The pattern of Ca2+influx during the first few seconds of activity is interpreted within the Ca2+-dependent signaling network such that synaptic strength is eventually either potentiated or depressed. Many of the critical signaling enzymes that control synaptic plasticity,including Ca2+/calmodulin-dependent protein kinase II (CaMKII, are regulated by calmodulin, a small protein that can bindup to 4 Ca2+ ions. As a first step toward clarifying how the Ca2+-signaling network decides between potentiation or depression, we have created a kinetic model of the interactions of Ca2+, calmodulin, and CaMKII that represents our best understanding of the dynamics of these interactions under conditions that resemble those in a postsynaptic spine. We constrained parameters of the model from data in the literature, or from our own measurements, and then predicted time courses of activation and autophosphorylation of CaMKII under a variety of conditions. Simulations showed that species of calmodulin with fewer than four bound Ca2+ play a significant role in activation of CaMKII in the physiological regime,supporting the notion that processing of Ca2+ signals in a spine involves competition among target enzymes for binding to unsaturated species of CaM in an environment in which the concentration of Ca2+ is fluctuating rapidly. Indeed, we showed that dependence of activation on the frequency of Ca2+ transients arises from the kinetics of interaction of fluctuating Ca2+with calmodulin/CaMKII complexes. We used parameter sensitivity analysis to identify which parameters will be most beneficial to measure more carefully to improve the accuracy of predictions. This model provides a quantitative base from which to build more complex dynamic

  5. Characterization of dacC, which encodes a new low-molecular-weight penicillin-binding protein in Bacillus subtilis

    DEFF Research Database (Denmark)

    Pedersen, Lotte Bang; Murray, T; Popham, D L

    1998-01-01

    The pbp gene (renamed dacC), identified by the Bacillus subtilis genome sequencing project, encodes a putative 491-residue protein with sequence homology to low-molecular-weight penicillin-binding proteins. Use of a transcriptional dacC-lacZ fusion revealed that dacC expression (i) is initiated...... at the end of stationary phase; (ii) depends strongly on transcription factor sigmaH; and (iii) appears to be initiated from a promoter located immediately upstream of yoxA, a gene of unknown function located upstream of dacC on the B. subtilis chromosome. A B. subtilis dacC insertional mutant grew...

  6. Differential trace labeling of calmodulin: investigation of binding sites and conformational states by individual lysine reactivities. Effects of beta-endorphin, trifluoperazine, and ethylene glycol bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid

    Energy Technology Data Exchange (ETDEWEB)

    Giedroc, D.P.; Sinha, S.K.; Brew, K.; Puett, D.

    1985-11-05

    The CaS -dependent association of beta-endorphin and trifluoperazine with porcine testis calmodulin, as well as the effects of removing CaS by ethylene glycol bis(beta-aminoethyl ether)-N,N,N',N'-tetraacetic acid (EGTA) treatment, were investigated by the procedure of differential kinetic labeling. This technique permitted determination of the relative rates of acylation of each of the epsilon-amino groups of the seven lysyl residues on calmodulin by (TH)acetic anhydride under the different conditions. In all cases, less than 0.52 mol of lysyl residue/mol of calmodulin was modified, thus ensuring that the labeling pattern reflects the microenvironments of these groups in the native protein. Lysines 75 and 94 were found to be the most reactive amino groups in CaS -saturated calmodulin. In the presence of CaS and under conditions where beta-endorphin and calmodulin were present at a molar ratio of 2.5:1, the amino groups of lysines 75 and 148 were significantly reduced in reactivity compared to calmodulin alone. At equimolar concentrations of peptides and proteins, essentially the same result was obtained except that the magnitudes of the perturbation of these two lysines were less pronounced. With trifluoperazine, at a molar ratio to calmodulin of 2.5:1, significant perturbations of lysines 75 and 148, as well as Lys 77, were also found. These results further substantiate previous observations of a commonality between phenothiazine and peptide binding sites on calmodulin. Lastly, an intriguing difference in CaS -mediated reactivities between lysines 75 and 77 of calmodulin is demonstrated. In the CaS -saturated form of the protein, both lysines are part of the long connecting helix between the two homologous halves of the protein.

  7. 43. Calmodulin regulating calcium sensitivity of Na channels

    Directory of Open Access Journals (Sweden)

    R. Vegiraju

    2016-07-01

    Full Text Available By extrapolating information from existing research and observing previous assumptions regarding the structure of the Na Channel, this experiment was conducted under the hypothesis that the Na Channel is in part regulated by the calmodulin protein, as a result proving calcium sensitivity of the Na Channel. Furthermore, we assume that there is a one to one stoichiometry between the Na Channel and the Calmodulin. There has been extensive research into the functionality and structure of sodium ion channels (Na channels, as several diseases are associated with the lack of regulation of sodium ions, that is caused by the disfunction of these Na channels. However, one highly controversial matter in the field is the importance of the protein calmodulin (CaM and calcium in Na channel function. Calmodulin is a protein that is well known for its role as a calcium binding messenger protein, and that association is believed to play an indirect role in regulating the Na channel through the Na channel’s supposed calcium sensitivity. While there are proponents for both sides, there has been relatively little research that provides strong evidence for either case. In this experiment, the effect of calmodulin on NaV 1.5 is tested by preparing a set of cardiac cells (of the human specie with the NaV 1.5 C-Termini and CaM protein, which were then to be placed in solutions with varying concentrations of calcium. We took special care to test multiple concentrations of calcium, as previous studies have tested very low concentrations, with Manu Ben-Johny’s team from the John Hopkins laboratory in particular testing up to a meager 50 micromolar, despite producing a well-respected paper (By comparison, the average Na channel can naturally sustain a concentration of almost 1-2 millimolar and on some occasions, reaching even higher concentrations. After using light scattering and observing the signals given off by the calcium interacting with these Nav1.5/Ca

  8. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  9. Expression of cbsA encoding the collagen-binding S-protein of Lactobacillus crispatus JCM5810 in Lactobacillus casei ATCC 393T

    NARCIS (Netherlands)

    Martínez, B.; Sillanpää, J.; Smit, E.; Korhonen, T.K.; Pouwels, P.H.

    2000-01-01

    The cbsA gene encoding the collagen-binding S-layer protein of Lactobacillus crispatus JCM5810 was expressed in L. casei ATCC 393T. The S-protein was not retained on the surface of the recombinant bacteria but was secreted into the medium. By translational fusion of CbsA to the cell wall sorting

  10. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  11. Developmental differences in posttranslational calmodulin methylation in pea plants

    International Nuclear Information System (INIS)

    Oh, Sukheung; Roberts, D.M.

    1990-01-01

    A calmodulin-N-methyltransferase was used to analyze the degree of lysine-115 methylation of pea calmodulin. Calmodulin was isolated from segments of developing roots of young etiolated and green pea plants and was tested for its ability to be methylated by the calmodulin methyltransferase in the presence of 3 H-methyl-S-adenosylmethionine. Calmodulin methylation levels were lower in apical root segments and in the young lateral roots compared with the mature, differentiated root tissues. The methylation of these calmodulin samples occurs specifically at lysine 115 since site-directed mutants of calmodulin with substitutions at this position were not methylated and competitively inhibited methylation. The present findings, combined with previous data showing differences in NAD kinase activation by methylated and unmethylated calmodulins, raise the possibility that posttranslational methylation could affect calmodulin action

  12. A Central Nervous System-Dependent Intron-Embedded Gene Encodes a Novel Murine Fyn Binding Protein.

    Science.gov (United States)

    Ben Khalaf, Noureddine; Taha, Safa; Bakhiet, Moiz; Fathallah, M Dahmani

    2016-01-01

    The interplay between the nervous and immune systems is gradually being unraveled. We previously reported in the mouse the novel soluble immune system factor ISRAA, whose activation in the spleen is central nervous system-dependent. We also showed that ISRAA plays a role in modulating anti-infection immunity. Herein, we report the genomic description of the israa locus, along with some insights into the structure-function relationship of the protein. Our findings revealed that israa is nested within intron 6 of the mouse zmiz1 gene. Protein sequence analysis revealed a typical SH2 binding motif (Y102TEV), with Fyn being the most likely binding partner. Docking simulation showed a favorable conformation for the ISRAA-Fyn complex, with a specific binding mode for the binding of the YTEV motif to the SH2 domain. Experimental studies showed that in vitro, recombinant ISRAA is phosphorylated by Fyn at tyrosine 102. Cell transfection and pull-down experiments revealed Fyn as a binding partner of ISRAA in the EL4 mouse T-cell line. Indeed, we demonstrated that ISRAA downregulates T-cell activation and the phosphorylation of an activation tyrosine (Y416) of Src-family kinases in mouse splenocytes. Our observations highlight ISRAA as a novel Fyn binding protein that is likely to be involved in a signaling pathway driven by the nervous system.

  13. A Central Nervous System-Dependent Intron-Embedded Gene Encodes a Novel Murine Fyn Binding Protein.

    Directory of Open Access Journals (Sweden)

    Noureddine Ben Khalaf

    Full Text Available The interplay between the nervous and immune systems is gradually being unraveled. We previously reported in the mouse the novel soluble immune system factor ISRAA, whose activation in the spleen is central nervous system-dependent. We also showed that ISRAA plays a role in modulating anti-infection immunity. Herein, we report the genomic description of the israa locus, along with some insights into the structure-function relationship of the protein. Our findings revealed that israa is nested within intron 6 of the mouse zmiz1 gene. Protein sequence analysis revealed a typical SH2 binding motif (Y102TEV, with Fyn being the most likely binding partner. Docking simulation showed a favorable conformation for the ISRAA-Fyn complex, with a specific binding mode for the binding of the YTEV motif to the SH2 domain. Experimental studies showed that in vitro, recombinant ISRAA is phosphorylated by Fyn at tyrosine 102. Cell transfection and pull-down experiments revealed Fyn as a binding partner of ISRAA in the EL4 mouse T-cell line. Indeed, we demonstrated that ISRAA downregulates T-cell activation and the phosphorylation of an activation tyrosine (Y416 of Src-family kinases in mouse splenocytes. Our observations highlight ISRAA as a novel Fyn binding protein that is likely to be involved in a signaling pathway driven by the nervous system.

  14. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  15. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  16. The artificial zinc finger coding gene 'Jazz' binds the utrophin promoter and activates transcription.

    Science.gov (United States)

    Corbi, N; Libri, V; Fanciulli, M; Tinsley, J M; Davies, K E; Passananti, C

    2000-06-01

    Up-regulation of utrophin gene expression is recognized as a plausible therapeutic approach in the treatment of Duchenne muscular dystrophy (DMD). We have designed and engineered new zinc finger-based transcription factors capable of binding and activating transcription from the promoter of the dystrophin-related gene, utrophin. Using the recognition 'code' that proposes specific rules between zinc finger primary structure and potential DNA binding sites, we engineered a new gene named 'Jazz' that encodes for a three-zinc finger peptide. Jazz belongs to the Cys2-His2 zinc finger type and was engineered to target the nine base pair DNA sequence: 5'-GCT-GCT-GCG-3', present in the promoter region of both the human and mouse utrophin gene. The entire zinc finger alpha-helix region, containing the amino acid positions that are crucial for DNA binding, was specifically chosen on the basis of the contacts more frequently represented in the available list of the 'code'. Here we demonstrate that Jazz protein binds specifically to the double-stranded DNA target, with a dissociation constant of about 32 nM. Band shift and super-shift experiments confirmed the high affinity and specificity of Jazz protein for its DNA target. Moreover, we show that chimeric proteins, named Gal4-Jazz and Sp1-Jazz, are able to drive the transcription of a test gene from the human utrophin promoter.

  17. Calcium modulates calmodulin/α-actinin 1 interaction with and agonist-dependent internalization of the adenosine A2A receptor.

    Science.gov (United States)

    Piirainen, Henni; Taura, Jaume; Kursula, Petri; Ciruela, Francisco; Jaakola, Veli-Pekka

    2017-04-01

    Adenosine receptors are G protein-coupled receptors that sense extracellular adenosine to transmit intracellular signals. One of the four adenosine receptor subtypes, the adenosine A 2A receptor (A 2A R), has an exceptionally long intracellular C terminus (A 2A R-ct) that mediates interactions with a large array of proteins, including calmodulin and α-actinin. Here, we aimed to ascertain the α-actinin 1/calmodulin interplay whilst binding to A 2A R and the role of Ca 2+ in this process. First, we studied the A 2A R-α-actinin 1 interaction by means of native polyacrylamide gel electrophoresis, isothermal titration calorimetry, and surface plasmon resonance, using purified recombinant proteins. α-Actinin 1 binds the A 2A R-ct through its distal calmodulin-like domain in a Ca 2+ -independent manner with a dissociation constant of 5-12μM, thus showing an ~100 times lower affinity compared to the A 2A R-calmodulin/Ca 2+ complex. Importantly, calmodulin displaced α-actinin 1 from the A 2A R-ct in a Ca 2+ -dependent fashion, disrupting the A 2A R-α-actinin 1 complex. Finally, we assessed the impact of Ca 2+ on A 2A R internalization in living cells, a function operated by the A 2A R-α-actinin 1 complex. Interestingly, while Ca 2+ influx did not affect constitutive A 2A R endocytosis, it abolished agonist-dependent internalization. In addition, we demonstrated that the A 2A R/α-actinin interaction plays a pivotal role in receptor internalization and function. Overall, our results suggest that the interplay of A 2A R with calmodulin and α-actinin 1 is fine-tuned by Ca 2+ , a fact that might power agonist-mediated receptor internalization and function. Copyright © 2017 Elsevier B.V. All rights reserved.

  18. Molecular and biochemical characterization of calmodulin from Echinococcus granulosus.

    Science.gov (United States)

    Wang, Ning; Zhong, Xiuqin; Song, Xingju; Gu, Xiaobin; Lai, Weiming; Xie, Yue; Peng, Xuerong; Yang, Guangyou

    2017-12-04

    Echinococcus granulosus is a harmful cestode parasite that causes cystic echinococcosis in humans as well as various livestock species and wild animals. Calmodulin (CaM), a Ca 2+ sensor protein, is widely expressed in eukaryotes and mediates a variety of cellular signaling activities. In the present study, the cDNA encoding CaM in Echinococcus granulosus (rEgCaM) was successfully cloned and the molecular and biochemical characterizations carried out. The antigenicity and immunoreactivity of rEgCaM was detected and the preliminary enzyme-linked immunosorbent assay (ELISA)-based serodiagnostic potential of EgCaM was assessed. The locations of this protein in the adult worm and larval stage, and the mRNA expression in different states of E. granulosus protoscoleces (PSCs) were defined clearly. Moreover, the Ca 2+ -binding properties of EgCaM were measured. rEgCaM is a highly conserved calcium-binding protein, consisting of 149 amino acids. Immunoblotting analysis revealed that rEgCaM could be identified using E. granulosus infected sheep serum. The use of rEgCaM as an antigen was evaluated by indirect ELISA which exhibited a high sensitivity (90.3%), but low specificity (47.1%). rEgCaM was ubiquitously expressed in protoscoleces and adults of E. granulosus, as well as in the germinal layer of the cyst wall. The mRNA expression level of rEgCaM was increased from the start of H 2 O 2 exposure and then gradually decreased because of the increased apoptosis of PSCs. In electrophoretic mobility tests and 1-anilinonaphthalene-8-sulfonic acid assays, rEgCaM showed a typical characteristic of a calcium-binding protein. To our knowledge, this is the first report on CaM from E. granulosus and rEgCaM is likely to be involved in some important biological function of E. granulosus as a calcium-binding protein.

  19. Low nucleosome occupancy is encoded around functional human transcription factor binding sites

    Directory of Open Access Journals (Sweden)

    Daenen Floris

    2008-07-01

    Full Text Available Abstract Background Transcriptional regulation of genes in eukaryotes is achieved by the interactions of multiple transcription factors with arrays of transcription factor binding sites (TFBSs on DNA and with each other. Identification of these TFBSs is an essential step in our understanding of gene regulatory networks, but computational prediction of TFBSs with either consensus or commonly used stochastic models such as Position-Specific Scoring Matrices (PSSMs results in an unacceptably high number of hits consisting of a few true functional binding sites and numerous false non-functional binding sites. This is due to the inability of the models to incorporate higher order properties of sequences including sequences surrounding TFBSs and influencing the positioning of nucleosomes and/or the interactions that might occur between transcription factors. Results Significant improvement can be expected through the development of a new framework for the modeling and prediction of TFBSs that considers explicitly these higher order sequence properties. It would be particularly interesting to include in the new modeling framework the information present in the nucleosome positioning sequences (NPSs surrounding TFBSs, as it can be hypothesized that genomes use this information to encode the formation of stable nucleosomes over non-functional sites, while functional sites have a more open chromatin configuration. In this report we evaluate the usefulness of the latter feature by comparing the nucleosome occupancy probabilities around experimentally verified human TFBSs with the nucleosome occupancy probabilities around false positive TFBSs and in random sequences. Conclusion We present evidence that nucleosome occupancy is remarkably lower around true functional human TFBSs as compared to non-functional human TFBSs, which supports the use of this feature to improve current TFBS prediction approaches in higher eukaryotes.

  20. Extreme heterogeneity of polyadenylation sites in mRNAs encoding chloroplast RNA-binding proteins in Nicotiana plumbaginifolia.

    Science.gov (United States)

    Klahre, U; Hemmings-Mieszczak, M; Filipowicz, W

    1995-06-01

    We have previously characterized nuclear cDNA clones encoding two RNA binding proteins, CP-RBP30 and CP-RBP-31, which are targeted to chloroplasts in Nicotiana plumbaginifolia. In this report we describe the analysis of the 3'-untranslated regions (3'-UTRs) in 22 CP-RBP30 and 8 CP-RBP31 clones which reveals that mRNAs encoding both proteins have a very complex polyadenylation pattern. Fourteen distinct poly(A) sites were identified among CP-RBP30 clones and four sites among the CP-RBP31 clones. The authenticity of the sites was confirmed by RNase A/T1 mapping of N. plumbaginifolia RNA. CP-RBP30 provides an extreme example of the heterogeneity known to be a feature of mRNA polyadenylation in higher plants. Using PCR we have demonstrated that CP-RBP genes in N. plumbaginifolia and N. sylvestris, in addition to the previously described introns interrupting the coding region, contain an intron located in the 3' non-coding part of the gene. In the case of the CP-RBP31, we have identified one polyadenylation event occurring in this intron.

  1. Spatially conserved regulatory elements identified within human and mouse Cd247 gene using high-throughput sequencing data from the ENCODE project

    DEFF Research Database (Denmark)

    Pundhir, Sachin; Hannibal, Tine Dahlbæk; Bang-Berthelsen, Claus Heiner

    2014-01-01

    . In this study, we have utilized the wealth of high-throughput sequencing data produced during the Encyclopedia of DNA Elements (ENCODE) project to identify spatially conserved regulatory elements within the Cd247 gene from human and mouse. We show the presence of two transcription factor binding sites...

  2. Interaction between attentional systems and episodic memory encoding: the impact of conflict on binding of information.

    Science.gov (United States)

    Sperduti, Marco; Armougum, Allan; Makowski, Dominique; Blondé, Philippe; Piolino, Pascale

    2017-12-01

    Episodic memory (EM) is defined as a long-term memory system that stores information that can be retrieved along with details of the context of the original events (binding). Several studies have shown that manipulation of attention during encoding can impact subsequent memory performance. An influential model of attention distinguishes between three partially independent attentional networks: the alerting, the orienting and the executive or conflict resolution component. To date, the impact of the engagement of these sub-systems during encoding on item and relational context binding has not been investigated. Here, we developed a new task combining the Attentional Network Test and an incidental episodic memory encoding task to study this issue. We reported that when the alerting network was not solicited, resolving conflict hindered item encoding. Moreover, resolving conflict, independently of the cueing condition, had a negative impact on context binding. These novel findings could have a potential impact in the understanding EM formation, and memory disorders in different populations, including healthy elderly people.

  3. Identification of cis-elements for ethylene and circadian regulation of the Solanum melongena gene encoding cysteine proteinase.

    Science.gov (United States)

    Rawat, Reetika; Xu, Zeng-Fu; Yao, Kwok-Ming; Chye, Mee-Len

    2005-03-01

    We have previously shown that the expression of SmCP which encodes Solanum melongena cysteine proteinase is ethylene-inducible and is under circadian control. To understand the regulation of SmCP, a 1.34-kb SmCP 5'-flanking region and its deletion derivatives were analyzed for cis-elements using GUS and luc fusions and by in vitro binding assays. Analysis of transgenic tobacco transformed with SmCP promoter-GUS constructs confirmed that the promoter region -415/+54 containing Ethylene Responsive Element ERE(-355/-348) conferred threefold ethylene-induction of GUS expression, while -827/+54 which also contains ERE(-683/-676), produced fivefold induction. Using gel mobility shift assays, we demonstrated that each ERE binds nuclear proteins from both ethephon-treated and untreated 5-week-old seedlings, suggesting that different transcriptions factors bind each ERE under varying physiological conditions. Binding was also observed in extracts from senescent, but not young, fruits. The variation in binding at the EREs in fruits and seedlings imply that organ-specific factors may participate in binding. Analysis of transgenic tobacco expressing various SmCP promoter-luc constructs containing wild-type or mutant Evening Elements (EEs) confirmed that both conserved EEs at -795/-787 and -785/-777 are important in circadian control. We confirmed the binding of total nuclear proteins to EEs in gel mobility shift assays and in DNase I footprinting. Our results suggest that multiple proteins bind the EEs which are conserved in plants other than Arabidopsis and that functional EEs and EREs are present in the 5'-flanking region of a gene encoding cysteine proteinase.

  4. Acyl-CoA-binding protein/diazepam-binding inhibitor gene and pseudogenes

    DEFF Research Database (Denmark)

    Mandrup, S; Hummel, R; Ravn, S

    1992-01-01

    Acyl-CoA-binding protein (ACBP) is a 10 kDa protein isolated from bovine liver by virtue of its ability to bind and induce the synthesis of medium-chain acyl-CoA esters. Surprisingly, it turned out to be identical to a protein named diazepam-binding Inhibitor (DBI) claimed to be an endogenous mod...... have molecularly cloned and characterized the ACBP/DBI gene family in rat. The rat ACBP/DBI gene family comprises one expressed gene and four processed pseudogenes of which one was shown to exist in two allelic forms. The expressed gene is organized into four exons and three introns...

  5. Silencing of the major family of NBS-LRR-encoding genes in lettuce results in the loss of multiple resistance specificities.

    Science.gov (United States)

    Wroblewski, Tadeusz; Piskurewicz, Urszula; Tomczak, Anna; Ochoa, Oswaldo; Michelmore, Richard W

    2007-09-01

    The RGC2 gene cluster in lettuce (Lactuca sativa) is one of the largest known families of genes encoding nucleotide binding site-leucine-rich repeat (NBS-LRR) proteins. One of its members, RGC2B, encodes Dm3 which determines resistance to downy mildew caused by the oomycete Bremia lactucae carrying the cognate avirulence gene, Avr3. We developed an efficient strategy for analysis of this large family of low expressed genes using post-transcriptional gene silencing (PTGS). We transformed lettuce cv. Diana (carrying Dm3) using chimeric gene constructs designed to simultaneously silence RGC2B and the GUS reporter gene via the production of interfering hairpin RNA (ihpRNA). Transient assays of GUS expression in leaves accurately predicted silencing of both genes and were subsequently used to assay silencing in transgenic T(1) plants and their offspring. Levels of mRNA were reduced not only for RGC2B but also for all seven diverse RGC2 family members tested. We then used the same strategy to show that the resistance specificity encoded by the genetically defined Dm18 locus in lettuce cv. Mariska is the result of two resistance specificities, only one of which was silenced by ihpRNA derived from RGC2B. Analysis of progeny from crosses between transgenic, silenced tester stocks and lettuce accessions carrying other resistance genes previously mapped to the RGC2 locus indicated that two additional resistance specificities to B. lactucae, Dm14 and Dm16, as well as resistance to lettuce root aphid (Pemphigus bursarius L.), Ra, are encoded by RGC2 family members.

  6. Identification of DNA-binding proteins that interact with the 5'-flanking region of the human D-amino acid oxidase gene by pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry.

    Science.gov (United States)

    Tran, Diem Hong; Shishido, Yuji; Chung, Seong Pil; Trinh, Huong Thi Thanh; Yorita, Kazuko; Sakai, Takashi; Fukui, Kiyoshi

    2015-12-10

    D-Amino acid oxidase (DAO) is a flavoenzyme that metabolizes D-amino acids and is expected to be a promising therapeutic target of schizophrenia and glioblastoma. The study of DNA-binding proteins has yielded much information in the regulation of transcription and other biological processes. However, proteins interacting with DAO gene have not been elucidated. Our assessment of human DAO promoter activity using luciferase reporter system indicated the 5'-flanking region of this gene (-4289 bp from transcription initiation site) has a regulatory sequence for gene expression, which is regulated by multi-protein complexes interacting with this region. By using pull-down assay coupled with two-dimensional gel electrophoresis and mass spectrometry, we identified six proteins binding to the 5'-flanking region of the human DAO gene (zinc finger C2HC domain-containing protein 1A; histidine-tRNA ligase, cytoplasmic; molybdenum cofactor biosynthesis protein; 60S ribosomal protein L37; calponin-1; calmodulin binding protein and heterogeneous nuclear ribonucleoprotein A2/B1). These preliminary results will contribute to the advance in the understanding of the potential factors associated with the regulatory mechanism of DAO expression. Copyright © 2015 Elsevier B.V. All rights reserved.

  7. Versatile protein recognition by the encoded display of multiple chemical elements on a constant macrocyclic scaffold

    Science.gov (United States)

    Li, Yizhou; De Luca, Roberto; Cazzamalli, Samuele; Pretto, Francesca; Bajic, Davor; Scheuermann, Jörg; Neri, Dario

    2018-03-01

    In nature, specific antibodies can be generated as a result of an adaptive selection and expansion of lymphocytes with suitable protein binding properties. We attempted to mimic antibody-antigen recognition by displaying multiple chemical diversity elements on a defined macrocyclic scaffold. Encoding of the displayed combinations was achieved using distinctive DNA tags, resulting in a library size of 35,393,112. Specific binders could be isolated against a variety of proteins, including carbonic anhydrase IX, horseradish peroxidase, tankyrase 1, human serum albumin, alpha-1 acid glycoprotein, calmodulin, prostate-specific antigen and tumour necrosis factor. Similar to antibodies, the encoded display of multiple chemical elements on a constant scaffold enabled practical applications, such as fluorescence microscopy procedures or the selective in vivo delivery of payloads to tumours. Furthermore, the versatile structure of the scaffold facilitated the generation of protein-specific chemical probes, as illustrated by photo-crosslinking.

  8. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  9. Alpha-crystallins are involved in specific interactions with the murine gamma D/E/F-crystallin-encoding gene.

    Science.gov (United States)

    Pietrowski, D; Durante, M J; Liebstein, A; Schmitt-John, T; Werner, T; Graw, J

    1994-07-08

    The promoter of the murine gamma E-crystallin (gamma E-Cry) encoding gene (gamma E-cry) was analyzed for specific interactions with lenticular proteins in a gel-retardation assay. A 21-bp fragment immediately downstream of the transcription initiation site (DOTIS) is demonstrated to be responsible for specific interactions with lens extracts. The DOTIS-binding protein(s) accept only the sense DNA strand as target; anti-sense or double-stranded DNA do not interact with these proteins. The DOTIS sequence element is highly conserved among the murine gamma D-, gamma E- and gamma F-cry and is present at comparable positions in the orthologous rat genes. Only a weak or even no protein-binding activity is observed if a few particular bases are changed, as in the rat gamma A-, gamma C- and gamma E-cry elements. DOTIS-binding proteins were found in commercially available bovine alpha-Cry preparations. The essential participation of alpha-Cry in the DNA-binding protein complex was confirmed using alpha-Cry-specific monoclonal antibody. The results reported here point to a novel function of alpha-Cry besides the structural properties in the lens.

  10. Cloning and molecular characterization of the salt-regulated jojoba ScRab cDNA encoding a small GTP-binding protein.

    Science.gov (United States)

    Mizrahi-Aviv, Ela; Mills, David; Benzioni, Aliza; Bar-Zvi, Dudy

    2002-10-01

    Salt stress results in a massive change in gene expression. An 837 bp cDNA designated ScRab was cloned from shoot cultures of the salt tolerant jojoba (Simmondsia chinesis). The cloned cDNA encodes a full length 200 amino acid long polypeptide that bears high homology to the Rab subfamily of small GTP binding proteins, particularly, the Rab5 subfamily. ScRab expression is reduced in shoots grown in the presence of salt compared to shoots from non-stressed cultures. His6-tagged ScRAB protein was expressed in E. coli, and purified to homogeneity. The purified protein bound radiolabelled GTP. The unlabelled guanine nucleotides GTP, GTP gamma S and GDP but not ATP, CTP or UTP competed with GTP binding.

  11. dependent/calmodulin- stimulated protein kinase from moss

    Indian Academy of Sciences (India)

    Unknown

    stimulated protein kinase; CDPK, calmodulin domain-like protein kinase; KM14, 14 amino acid synthetic peptide; .... used were obtained from Sigma Chemical Company, USA, ..... Plant chimeric Ca2+/Calmodulin-dependent protein kinase.

  12. A primary survey on bryophyte species reveals two novel classes of nucleotide-binding site (NBS genes.

    Directory of Open Access Journals (Sweden)

    Jia-Yu Xue

    Full Text Available Due to their potential roles in pathogen defense, genes encoding nucleotide-binding site (NBS domain have been particularly surveyed in many angiosperm genomes. Two typical classes were found: one is the TIR-NBS-LRR (TNL class and the other is the CC-NBS-LRR (CNL class. It is seldom known, however, what kind of NBS-encoding genes are mainly present in other plant groups, especially the most ancient groups of land plants, that is, bryophytes. To fill this gap of knowledge, in this study, we mainly focused on two bryophyte species: the moss Physcomitrella patens and the liverwort Marchantia polymorpha, to survey their NBS-encoding genes. Surprisingly, two novel classes of NBS-encoding genes were discovered. The first novel class is identified from the P. patens genome and a typical member of this class has a protein kinase (PK domain at the N-terminus and a LRR domain at the C-terminus, forming a complete structure of PK-NBS-LRR (PNL, reminiscent of TNL and CNL classes in angiosperms. The second class is found from the liverwort genome and a typical member of this class possesses an α/β-hydrolase domain at the N-terminus and also a LRR domain at the C-terminus (Hydrolase-NBS-LRR, HNL. Analysis on intron positions and phases also confirmed the novelty of HNL and PNL classes, as reflected by their specific intron locations or phase characteristics. Phylogenetic analysis covering all four classes of NBS-encoding genes revealed a closer relationship among the HNL, PNL and TNL classes, suggesting the CNL class having a more divergent status from the others. The presence of specific introns highlights the chimerical structures of HNL, PNL and TNL genes, and implies their possible origin via exon-shuffling during the quick lineage separation processes of early land plants.

  13. TmiRUSite and TmiROSite scripts: searching for mRNA fragments with miRNA binding sites with encoded amino acid residues.

    Science.gov (United States)

    Berillo, Olga; Régnier, Mireille; Ivashchenko, Anatoly

    2014-01-01

    microRNAs are small RNA molecules that inhibit the translation of target genes. microRNA binding sites are located in the untranslated regions as well as in the coding domains. We describe TmiRUSite and TmiROSite scripts developed using python as tools for the extraction of nucleotide sequences for miRNA binding sites with their encoded amino acid residue sequences. The scripts allow for retrieving a set of additional sequences at left and at right from the binding site. The scripts presents all received data in table formats that are easy to analyse further. The predicted data finds utility in molecular and evolutionary biology studies. They find use in studying miRNA binding sites in animals and plants. TmiRUSite and TmiROSite scripts are available for free from authors upon request and at https: //sites.google.com/site/malaheenee/downloads for download.

  14. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  15. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  16. Molecular cloning and expression of cDNA encoding a lumenal calcium binding glycoprotein from sarcoplasmic reticulum

    International Nuclear Information System (INIS)

    Leberer, E.; Charuk, J.H.M.; MacLennan, D.H.; Green, N.M.

    1989-01-01

    Antibody screening was used to isolate a cDNA encoding the 160-kDa glycoprotein of rabbit skeletal muscle sarcoplasmic reticulum. The cDNA is identical to that encoding the 53-kDa glycoprotein except that it contains an in-frame insertion of 1,308 nucleotides near its 5' end, apparently resulting from alternative splicing. The protein encoded by the cDNA would contain a 19-residue NH 2 -terminal signal sequence and a 453-residue COOH-terminal sequence identical to the 53-kDa glycoprotein. It would also contain a 436-amino acid insert between these sequences. This insert would be highly acidic, suggesting that it might bind Ca 2+ . The purified 160-kDa glycoprotein and the glycoprotein expressed in COS-1 cells transfected with cDNA encoding the 160-kDa glycoprotein were shown to bind 45 C 2+ in a gel overlay assay. The protein was shown to be located in the lumen of the sarcoplasmic reticulum and to be associated through Ca 2+ with the membrane. The authors propose that this lumenal Ca 2+ binding glycoprotein of the sarcoplasmic reticulum be designated sarcalumenin

  17. Lactobacillus plantarum gene clusters encoding putative cell-surface protein complexes for carbohydrate utilization are conserved in specific gram-positive bacteria

    Directory of Open Access Journals (Sweden)

    Muscariello Lidia

    2006-05-01

    Full Text Available Abstract Background Genomes of gram-positive bacteria encode many putative cell-surface proteins, of which the majority has no known function. From the rapidly increasing number of available genome sequences it has become apparent that many cell-surface proteins are conserved, and frequently encoded in gene clusters or operons, suggesting common functions, and interactions of multiple components. Results A novel gene cluster encoding exclusively cell-surface proteins was identified, which is conserved in a subgroup of gram-positive bacteria. Each gene cluster generally has one copy of four new gene families called cscA, cscB, cscC and cscD. Clusters encoding these cell-surface proteins were found only in complete genomes of Lactobacillus plantarum, Lactobacillus sakei, Enterococcus faecalis, Listeria innocua, Listeria monocytogenes, Lactococcus lactis ssp lactis and Bacillus cereus and in incomplete genomes of L. lactis ssp cremoris, Lactobacillus casei, Enterococcus faecium, Pediococcus pentosaceus, Lactobacillius brevis, Oenococcus oeni, Leuconostoc mesenteroides, and Bacillus thuringiensis. These genes are neither present in the genomes of streptococci, staphylococci and clostridia, nor in the Lactobacillus acidophilus group, suggesting a niche-specific distribution, possibly relating to association with plants. All encoded proteins have a signal peptide for secretion by the Sec-dependent pathway, while some have cell-surface anchors, novel WxL domains, and putative domains for sugar binding and degradation. Transcriptome analysis in L. plantarum shows that the cscA-D genes are co-expressed, supporting their operon organization. Many gene clusters are significantly up-regulated in a glucose-grown, ccpA-mutant derivative of L. plantarum, suggesting catabolite control. This is supported by the presence of predicted CRE-sites upstream or inside the up-regulated cscA-D gene clusters. Conclusion We propose that the CscA, CscB, CscC and Csc

  18. Identification of the gene encoding a type 1 RNase H with an N-terminal double-stranded RNA binding domain from a psychrotrophic bacterium.

    Science.gov (United States)

    Tadokoro, Takashi; Chon, Hyongi; Koga, Yuichi; Takano, Kazufumi; Kanaya, Shigenori

    2007-07-01

    The gene encoding a bacterial type 1 RNase H, termed RBD-RNase HI, was cloned from the psychrotrophic bacterium Shewanella sp. SIB1, overproduced in Escherichia coli, and the recombinant protein was purified and biochemically characterized. SIB1 RBD-RNase HI consists of 262 amino acid residues and shows amino acid sequence identities of 26% to SIB1 RNase HI, 17% to E. coli RNase HI, and 32% to human RNase H1. SIB1 RBD-RNase HI has a double-stranded RNA binding domain (RBD) at the N-terminus, which is commonly present at the N-termini of eukaryotic type 1 RNases H. Gel mobility shift assay indicated that this domain binds to an RNA/DNA hybrid in an isolated form, suggesting that this domain is involved in substrate binding. SIB1 RBD-RNase HI exhibited the enzymatic activity both in vitro and in vivo. Its optimum pH and metal ion requirement were similar to those of SIB1 RNase HI, E. coli RNase HI, and human RNase H1. The specific activity of SIB1 RBD-RNase HI was comparable to that of E. coli RNase HI and was much higher than those of SIB1 RNase HI and human RNase H1. SIB1 RBD-RNase HI showed poor cleavage-site specificity for oligomeric substrates. SIB1 RBD-RNase HI was less stable than E. coli RNase HI but was as stable as human RNase H1. Database searches indicate that several bacteria and archaea contain an RBD-RNase HI. This is the first report on the biochemical characterization of RBD-RNase HI.

  19. Expression, purification, crystallization and preliminary X-ray analysis of calmodulin in complex with the regulatory domain of the plasma-membrane Ca2+-ATPase ACA8

    International Nuclear Information System (INIS)

    Tidow, Henning; Hein, Kim L.; Baekgaard, Lone; Palmgren, Michael G.; Nissen, Poul

    2010-01-01

    Plant plasma-membrane Ca 2+ -ATPase is regulated via binding of calmodulin to its autoinhibitory N-terminal domain. In this study, the expression, purification, crystallization and preliminary X-ray diffraction analysis of this protein complex from A. thaliana are reported. Plasma-membrane Ca 2+ -ATPases (PMCAs) are calcium pumps that expel Ca 2+ from eukaryotic cells to maintain overall Ca 2+ homoeostasis and to provide local control of intracellular Ca 2+ signalling. They are of major physiological importance, with different isoforms being essential, for example, for presynaptic and postsynaptic Ca 2+ regulation in neurons, feedback signalling in the heart and sperm motility. In the resting state, PMCAs are autoinhibited by binding of their C-terminal (in mammals) or N-terminal (in plants) tail to two major intracellular loops. Activation requires the binding of calcium-bound calmodulin (Ca 2+ -CaM) to this tail and a conformational change that displaces the autoinhibitory tail from the catalytic domain. The complex between calmodulin and the regulatory domain of the plasma-membrane Ca 2+ -ATPase ACA8 from Arabidopsis thaliana has been crystallized. The crystals belonged to space group C2, with unit-cell parameters a = 176.8, b = 70.0, c = 69.8 Å, β = 113.2°. A complete data set was collected to 3.0 Å resolution and structure determination is in progress in order to elucidate the mechanism of PMCA activation by calmodulin

  20. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  1. A high-affinity inhibitor of yeast carboxypeptidase Y is encoded by TFS1 and shows homology to a family of lipid binding proteins

    DEFF Research Database (Denmark)

    Bruun, A W; Svendsen, I; Sørensen, S O

    1998-01-01

    signals for transport into the endoplasmic reticulum. Surprisingly, Ic is encoded by TFS1, which has previously been isolated as a high-copy suppressor of cdc25-1. CDC25 encodes the putative GTP exchange factor for Ras1p/Ras2p in yeast. In an attempt to rationalize this finding, we looked...... degree of specificity, showing a 200-fold higher Ki toward a carboxypeptidase from Candida albicans which is highly homologous to carboxypeptidase Y. The TFS1 gene product shows extensive similarity to a class of proteins termed "21-23-kDa lipid binding proteins", members of which are found in several...

  2. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  3. An HIV-1 encoded peptide mimics the DNA binding loop of NF-κB and binds thioredoxin with high affinity

    International Nuclear Information System (INIS)

    Su Guoping; Wang Min; Taylor, Ethan Will

    2005-01-01

    Pro-fs is a human immunodeficiency virus type 1 (HIV-l)-encoded putative selenoprotein, predicted by a theoretical analysis of the viral genome; it is potentially expressed by a -1 frameshift from the protease coding region. Pro-fs has significant sequence similarity to the DNA binding loop of nuclear factor kappa B (NF-κB), which is known to bind thioredoxin (Trx). We hypothesize that the putative HIV-1 pro-fs gene product functions by mimicry of NF-κB via binding to Trx. The hypothesis was tested in vitro by co-immunoprecipitation and GST-pull down assays, using a purified mutant pro-fs protein, in which the two potential selenocysteine residues were mutated to cysteines, in order to permit expression in bacteria. Both experiments showed that pro-fs binds to human wild type Trx (Trx-wt) with high affinity. Mutation of the two conserved cysteine residues in the Trx active site redox center to serine (Ser) (Trx-CS) weakened but failed to abolish the interaction. In pro-fs-transfected 293T cells, using confocal microscopy and fluorescence resonance energy transfer (FRET), we have observed that pro-fs localizes in cell nuclei and forms oligomers. Upon stimulation by phorbol 12-myristate 13-acetate (PMA), Trx translocates into cell nuclei. Significant FRET efficiency was detected in the nuclei of PMA-stimulated 293T cells co-expressing fluorescence-tagged pro-fs and Trx-wt or Trx-CS. These results indicate that in living cells the double cysteine mutant of pro-fs binds to both Trx and Trx-CS with high affinity, suggesting that Trx-pro-fs binding is a structurally-specific interaction, involving more of the Trx molecule than just its active site cysteine residues. These results establish the capacity for functional mimicry of the Trx binding ability of the NF-κB/Rel family of transcription factors by the putative HIV-1 pro-fs protein

  4. An ion-current mutant of Paramecium tetraurelia with defects in the primary structure and post-translational N-methylation of calmodulin

    International Nuclear Information System (INIS)

    Wallen-Friedman, M.A.

    1988-01-01

    My work on pantophobiac A 2 (pntA 2 ), a behavioral mutant of Paramecium tetraurelia, suggest that the Ca ++ -binding protein calmodulin (CaM), and post-translation N-methylation of CaM, are important for Ca ++ -related ion-current function. Calmodulin from wild-type Paramecium has two sites of lysine-N-methylation. Both of these sites are almost fully methylated in vivo; thus wild-type calmodulin is a poor substrate for N-methylation in vitro. In contrast, pntA/ 2 CaM can be heavily N-methylated in vitro, suggesting that the mutant calmodulin is under-methylated in vivo. Amino-acid composition analysis showed that CaM lysine 115 is undermethylated in pntA 2 . Once pntA 2 CaM is N-methylated, the [methyl- 3 H] group does not turn over in either wild-type or pntA 2 cytoplasmic fractions. The methylating enzymes in pntA 2 high-speed supernatant fractions are active, but may be less robust than those of the wild type, suggesting a possible control of these enzymes by CaM

  5. Dystrobrevin-binding protein 1 gene (DTNBP1) variants associated with cerebrospinal fluid homovanillic acid and 5-hydroxyindoleacetic acid concentrations in healthy volunteers

    DEFF Research Database (Denmark)

    Andreou, Dimitrios; Saetre, Peter; Kähler, Anna K

    2011-01-01

    The dystrobrevin binding protein-1 (DTNBP1) gene encodes dysbindin-1, a protein involved in neurodevelopmental and neurochemical processes related mainly to the monoamine dopamine. We investigated possible associations between eleven DTNBP1 polymorphisms and cerebrospinal fluid (CSF) concentratio...

  6. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  7. aldB, an RpoS-dependent gene in Escherichia coli encoding an aldehyde dehydrogenase that is repressed by Fis and activated by Crp.

    Science.gov (United States)

    Xu, J; Johnson, R C

    1995-06-01

    Escherichia coli aldB was identified as a gene that is negatively regulated by Fis but positively regulated by RpoS. The complete DNA sequence determined in this study indicates that aldB encodes a 56.3-kDa protein which shares a high degree of homology with an acetaldehyde dehydrogenase encoded by acoD of Alcaligenes eutrophus and an aldehyde dehydrogenase encoded by aldA of Vibrio cholerae and significant homology with a group of other aldehyde dehydrogenases from prokaryotes and eukaryotes. Expression of aldB is maximally induced during the transition from exponential phase to stationary phase. Its message levels are elevated three- to fourfold by a fis mutation and abolished by an rpoS mutation. In addition, the expression of an aldB-lacZ fusion was decreased about 20-fold in the absence of crp. DNase I footprinting analysis showed that five Fis binding sites and one Crp binding site are located within the aldB promoter region, suggesting that Fis and Crp are acting directly to control aldB transcription. AldB expression is induced by ethanol, but in contrast to that of most of the RpoS-dependent genes, the expression of aldB is not altered by an increase in medium osmolarity.

  8. Transcriptome Analysis Revealed Highly Expressed Genes Encoding Secondary Metabolite Pathways and Small Cysteine-Rich Proteins in the Sclerotium of Lignosus rhinocerotis.

    Directory of Open Access Journals (Sweden)

    Hui-Yeng Y Yap

    Full Text Available Lignosus rhinocerotis (Cooke Ryvarden (tiger milk mushroom has long been known for its nutritional and medicinal benefits among the local communities in Southeast Asia. However, the molecular and genetic basis of its medicinal and nutraceutical properties at transcriptional level have not been investigated. In this study, the transcriptome of L. rhinocerotis sclerotium, the part with medicinal value, was analyzed using high-throughput Illumina HiSeqTM platform with good sequencing quality and alignment results. A total of 3,673, 117, and 59,649 events of alternative splicing, novel transcripts, and SNP variation were found to enrich its current genome database. A large number of transcripts were expressed and involved in the processing of gene information and carbohydrate metabolism. A few highly expressed genes encoding the cysteine-rich cerato-platanin, hydrophobins, and sugar-binding lectins were identified and their possible roles in L. rhinocerotis were discussed. Genes encoding enzymes involved in the biosynthesis of glucans, six gene clusters encoding four terpene synthases and one each of non-ribosomal peptide synthetase and polyketide synthase, and 109 transcribed cytochrome P450 sequences were also identified in the transcriptome. The data from this study forms a valuable foundation for future research in the exploitation of this mushroom in pharmacological and industrial applications.

  9. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  10. Analysis of the state of posttranslational calmodulin methylation in developing pea plants

    International Nuclear Information System (INIS)

    Oh, Sukheung; Roberts, D.M.

    1990-01-01

    A specific calmodulin-N-methyltransferase was used in a radiometric assay to analyze the degree of methylation of lysine-115 in pea (Pisum sativum) plants. Calmodulin was isolated from dissected segments of developing roots of young etiolated and green pea plants and was tested for its ability to be methylated by incubation with the calmodulin methyltransferase in the presence of [ 3 H]methyl-S-adenosylmethionine. By this approach, the presence of unmethylated calmodulins were demonstrated in pea tissues, and the levels of methylation varied depending on the developmental state of the tissue tested. Calmodulin methylation levels were lower in apical root segments of both etiolated and green plants, and in the young lateral roots compared with the mature, differentiated root tissues. The incorporation of methyl groups into these calmodulin samples appears to be specific for position 115 since site-directed mutants of calmodulin with substitutions at this position competitively inhibited methyl group incorporation. The present findings, combined with previous data showing differences in the ability of methylated and unmethylated calmodulins to activate pea NAD kinase raise the possibility that posttranslational methylation of calmodulin could be another mechanism for regulating calmodulin activity

  11. Structure of the CaMKIIdelta/calmodulin complex reveals the molecular mechanism of CaMKII kinase activation.

    Directory of Open Access Journals (Sweden)

    Peter Rellos

    2010-07-01

    Full Text Available Long-term potentiation (LTP, a long-lasting enhancement in communication between neurons, is considered to be the major cellular mechanism underlying learning and memory. LTP triggers high-frequency calcium pulses that result in the activation of Calcium/Calmodulin (CaM-dependent kinase II (CaMKII. CaMKII acts as a molecular switch because it remains active for a long time after the return to basal calcium levels, which is a unique property required for CaMKII function. Here we describe the crystal structure of the human CaMKIIdelta/Ca2+/CaM complex, structures of all four human CaMKII catalytic domains in their autoinhibited states, as well as structures of human CaMKII oligomerization domains in their tetradecameric and physiological dodecameric states. All four autoinhibited human CaMKIIs were monomeric in the determined crystal structures but associated weakly in solution. In the CaMKIIdelta/Ca2+/CaM complex, the inhibitory region adopted an extended conformation and interacted with an adjacent catalytic domain positioning T287 into the active site of the interacting protomer. Comparisons with autoinhibited CaMKII structures showed that binding of calmodulin leads to the rearrangement of residues in the active site to a conformation suitable for ATP binding and to the closure of the binding groove for the autoinhibitory helix by helix alphaD. The structural data, together with biophysical interaction studies, reveals the mechanism of CaMKII activation by calmodulin and explains many of the unique regulatory properties of these two essential signaling molecules.This article can also be viewed as an enhanced version in which the text of the article is integrated with interactive 3-D representations and animated transitions. Please note that a web plugin is required to access this enhanced functionality. Instructions for the installation and use of the Web plugin are available in Text S1.

  12. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  13. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  14. Calmodulin 2 Mutation N98S Is Associated with Unexplained Cardiac Arrest in Infants Due to Low Clinical Penetrance Electrical Disorders.

    Directory of Open Access Journals (Sweden)

    Juan Jiménez-Jáimez

    Full Text Available Calmodulin 1, 2 and 3 (CALM mutations have been found to cause cardiac arrest in children at a very early age. The underlying aetiology described is long QT syndrome (LQTS, catecholaminergic polymorphic ventricular tachycardia (CPVT and idiopathic ventricular fibrillation (IVF. Little phenotypical data about CALM2 mutations is available.The aim of this paper is to describe the clinical manifestations of the Asn98Ser mutation in CALM2 in two unrelated children in southern Spain with apparently unexplained cardiac arrest/death.Two unrelated children aged 4 and 7, who were born to healthy parents, were studied. Both presented with sudden cardiac arrest. The first was resuscitated after a VF episode, and the second died suddenly. In both cases the baseline QTc interval was within normal limits. Peripheral blood DNA was available to perform targeted gene sequencing.The surviving 4-year-old girl had a positive epinephrine test for LQTS, and polymorphic ventricular ectopic beats were seen on a previous 24-hour Holter recording from the deceased 7-year-old boy, suggestive of a possible underlying CPVT phenotype. A p.Asn98Ser mutation in CALM2 was detected in both cases. This affected a highly conserved across species residue, and the location in the protein was adjacent to critical calcium binding loops in the calmodulin carboxyl-terminal domain, predicting a high pathogenic effect.Human calmodulin 2 mutation p.Asn98Ser is associated with sudden cardiac death in childhood with a variable clinical penetrance. Our results provide new phenotypical information about clinical behaviour of this mutation.

  15. A Rice CaMBP Gene is Induced in Organ-Specific Manner by Both Chilling and Heat-Shock Treatments

    Directory of Open Access Journals (Sweden)

    Jia WAN

    2008-09-01

    Full Text Available A rice CaMBP gene, OsCaMBP (AB363406, was isolated from a chilling treated rice using the fluorescent differential display (FDD screening method. Its cDNA sequence (2094 bp contains an opening reading frame (ORF encoding a 569 amino acids protein (63.2 kD. OsCaMBP has the typical structural features of the CaMBP family, including the conserved IQ calmodulin-binding motif at the N-terminus. Homology analysis revealed 38.25%–47.28% identities of OsCaMBP with other CaMBPs in plants. RT-PCR analysis showed that the expression of OsCaMBP was remarkably inducible under the chilling (8°C and heat-shock (42°C treatments. OsCaMBP was undetectable under the normal conditions, and induced under the chilling treatment for 1 h, as well as the heat-shock treatment for 15 min, suggesting that the gene plays important roles in the signaling pathway in rice under both chilling and heat-shock stresses.

  16. A Root-Preferential DFR-Like Gene Encoding Dihydrokaempferol Reductase Involved in Anthocyanin Biosynthesis of Purple-Fleshed Sweet Potato.

    Science.gov (United States)

    Liu, Xiaoqiang; Xiang, Min; Fan, Yufang; Yang, Chunxian; Zeng, Lingjiang; Zhang, Qitang; Chen, Min; Liao, Zhihua

    2017-01-01

    Purple-fleshed sweet potato is good for health due to rich anthocyanins in tubers. Although the anthocyanin biosynthetic pathway is well understood in up-ground organs of plants, the knowledge on anthocyanin biosynthesis in underground tubers is limited. In the present study, we isolated and functionally characterized a root-preferential gene encoding dihydrokaempferol reductase ( IbDHKR ) from purple-fleshed sweet potato. IbDHKR showed highly similarity with the reported dihydroflavonol reductases in other plant species at the sequence levels and the NADPH-binding motif and the substrate-binding domain were also found in IbDHKR. The tissue profile showed that IbDHKR was expressed in all the tested organs, but with much higher level in tuber roots. The expression level of IbDHKR was consistent with the anthocyanin content in sweet potato organs, suggesting that tuber roots were the main organs to synthesize anthocyanins. The recombinant 44 kD IbDHKR was purified and fed by three different dihydroflavonol substrates including dihydrokaempferol (DHK), dihydroquerctin, and dihydromyrecetin. The substrate feeding assay indicated that only DHK could be accepted as substrate by IbDHKR, which was reduced to leucopelargonidin confirmed by LC-MS. Finally, IbDHKR was overexpressed in transgenic tobacco. The IbDHKR-overexpression tobacco corolla was more highly pigmented and contained higher level of anthocyanins than the wild-type tobacco corolla. In summary, IbDHKR was a root-preferential gene involved in anthocyanin biosynthesis and its encoding protein, specifically catalyzing DHK reduction to yield leucopelargonidin, was a candidate gene for engineering anthocyanin biosynthetic pathway.

  17. Dynein Heavy Chain, Encoded by Two Genes in Agaricomycetes, Is Required for Nuclear Migration in Schizophyllum commune.

    Directory of Open Access Journals (Sweden)

    Melanie Brunsch

    Full Text Available The white-rot fungus Schizophyllum commune (Agaricomycetes was used to study the cell biology of microtubular trafficking during mating interactions, when the two partners exchange nuclei, which are transported along microtubule tracks. For this transport activity, the motor protein dynein is required. In S. commune, the dynein heavy chain is encoded in two parts by two separate genes, dhc1 and dhc2. The N-terminal protein Dhc1 supplies the dimerization domain, while Dhc2 encodes the motor machinery and the microtubule binding domain. This split motor protein is unique to Basidiomycota, where three different sequence patterns suggest independent split events during evolution. To investigate the function of the dynein heavy chain, the gene dhc1 and the motor domain in dhc2 were deleted. Both resulting mutants were viable, but revealed phenotypes in hyphal growth morphology and mating behavior as well as in sexual development. Viability of strain Δdhc2 is due to the higher expression of kinesin-2 and kinesin-14, which was proven via RNA sequencing.

  18. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  19. batman Interacts with polycomb and trithorax group genes and encodes a BTB/POZ protein that is included in a complex containing GAGA factor.

    Science.gov (United States)

    Faucheux, M; Roignant, J-Y; Netter, S; Charollais, J; Antoniewski, C; Théodore, L

    2003-02-01

    Polycomb and trithorax group genes maintain the appropriate repressed or activated state of homeotic gene expression throughout Drosophila melanogaster development. We have previously identified the batman gene as a Polycomb group candidate since its function is necessary for the repression of Sex combs reduced. However, our present genetic analysis indicates functions of batman in both activation and repression of homeotic genes. The 127-amino-acid Batman protein is almost reduced to a BTB/POZ domain, an evolutionary conserved protein-protein interaction domain found in a large protein family. We show that this domain is involved in the interaction between Batman and the DNA binding GAGA factor encoded by the Trithorax-like gene. The GAGA factor and Batman codistribute on polytene chromosomes, coimmunoprecipitate from nuclear embryonic and larval extracts, and interact in the yeast two-hybrid assay. Batman, together with the GAGA factor, binds to MHS-70, a 70-bp fragment of the bithoraxoid Polycomb response element. This binding, like that of the GAGA factor, requires the presence of d(GA)n sequences. Together, our results suggest that batman belongs to a subset of the Polycomb/trithorax group of genes that includes Trithorax-like, whose products are involved in both activation and repression of homeotic genes.

  20. Uncovering the functional constraints underlying the genomic organization of the odorant-binding protein genes.

    Science.gov (United States)

    Librado, Pablo; Rozas, Julio

    2013-01-01

    Animal olfactory systems have a critical role for the survival and reproduction of individuals. In insects, the odorant-binding proteins (OBPs) are encoded by a moderately sized gene family, and mediate the first steps of the olfactory processing. Most OBPs are organized in clusters of a few paralogs, which are conserved over time. Currently, the biological mechanism explaining the close physical proximity among OBPs is not yet established. Here, we conducted a comprehensive study aiming to gain insights into the mechanisms underlying the OBP genomic organization. We found that the OBP clusters are embedded within large conserved arrangements. These organizations also include other non-OBP genes, which often encode proteins integral to plasma membrane. Moreover, the conservation degree of such large clusters is related to the following: 1) the promoter architecture of the confined genes, 2) a characteristic transcriptional environment, and 3) the chromatin conformation of the chromosomal region. Our results suggest that chromatin domains may restrict the location of OBP genes to regions having the appropriate transcriptional environment, leading to the OBP cluster structure. However, the appropriate transcriptional environment for OBP and the other neighbor genes is not dominated by reduced levels of expression noise. Indeed, the stochastic fluctuations in the OBP transcript abundance may have a critical role in the combinatorial nature of the olfactory coding process.

  1. Molecular Cloning of a cDNA Encoding for Taenia solium TATA-Box Binding Protein 1 (TsTBP1) and Study of Its Interactions with the TATA-Box of Actin 5 and Typical 2-Cys Peroxiredoxin Genes.

    Science.gov (United States)

    Rodríguez-Lima, Oscar; García-Gutierrez, Ponciano; Jiménez, Lucía; Zarain-Herzberg, Ángel; Lazzarini, Roberto; Landa, Abraham

    2015-01-01

    TATA-box binding protein (TBP) is an essential regulatory transcription factor for the TATA-box and TATA-box-less gene promoters. We report the cloning and characterization of a full-length cDNA that encodes a Taenia solium TATA-box binding protein 1 (TsTBP1). Deduced amino acid composition from its nucleotide sequence revealed that encodes a protein of 238 residues with a predicted molecular weight of 26.7 kDa, and a theoretical pI of 10.6. The NH2-terminal domain shows no conservation when compared with to pig and human TBP1s. However, it shows high conservation in size and amino acid identity with taeniids TBP1s. In contrast, the TsTBP1 COOH-terminal domain is highly conserved among organisms, and contains the amino acids involved in interactions with the TATA-box, as well as with TFIIA and TFIIB. In silico TsTBP1 modeling reveals that the COOH-terminal domain forms the classical saddle structure of the TBP family, with one α-helix at the end, not present in pig and human. Native TsTBP1 was detected in T. solium cysticerci´s nuclear extract by western blot using rabbit antibodies generated against two synthetic peptides located in the NH2 and COOH-terminal domains of TsTBP1. These antibodies, through immunofluorescence technique, identified the TBP1 in the nucleus of cells that form the bladder wall of cysticerci of Taenia crassiceps, an organism close related to T. solium. Electrophoretic mobility shift assays using nuclear extracts from T. solium cysticerci and antibodies against the NH2-terminal domain of TsTBP1 showed the interaction of native TsTBP1 with the TATA-box present in T. solium actin 5 (pAT5) and 2-Cys peroxiredoxin (Ts2-CysPrx) gene promoters; in contrast, when antibodies against the anti-COOH-terminal domain of TsTBP1 were used, they inhibited the binding of TsTBP1 to the TATA-box of the pAT5 promoter gene.

  2. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  3. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  4. Calmodulin and CaMKII modulate ENaC activity by regulating the association of MARCKS and the cytoskeleton with the apical membrane.

    Science.gov (United States)

    Alli, Abdel A; Bao, Hui-Fang; Liu, Bing-Chen; Yu, Ling; Aldrugh, Summer; Montgomery, Darrice S; Ma, He-Ping; Eaton, Douglas C

    2015-09-01

    Phosphatidylinositol bisphosphate (PIP2) regulates epithelial sodium channel (ENaC) open probability. In turn, myristoylated alanine-rich C kinase substrate (MARCKS) protein or MARCKS-like protein 1 (MLP-1) at the plasma membrane regulates the delivery of PIP2 to ENaC. MARCKS and MLP-1 are regulated by changes in cytosolic calcium; increasing calcium promotes dissociation of MARCKS from the membrane, but the calcium-regulatory mechanisms are unclear. However, it is known that increased intracellular calcium can activate calmodulin and we show that inhibition of calmodulin with calmidazolium increases ENaC activity presumably by regulating MARCKS and MLP-1. Activated calmodulin can regulate MARCKS and MLP-1 in two ways. Calmodulin can bind to the effector domain of MARCKS or MLP-1, inactivating both proteins by causing their dissociation from the membrane. Mutations in MARCKS that prevent calmodulin association prevent dissociation of MARCKS from the membrane. Calmodulin also activates CaM kinase II (CaMKII). An inhibitor of CaMKII (KN93) increases ENaC activity, MARCKS association with ENaC, and promotes MARCKS movement to a membrane fraction. CaMKII phosphorylates filamin. Filamin is an essential component of the cytoskeleton and promotes association of ENaC, MARCKS, and MLP-1. Disruption of the cytoskeleton with cytochalasin E reduces ENaC activity. CaMKII phosphorylation of filamin disrupts the cytoskeleton and the association of MARCKS, MLP-1, and ENaC, thereby reducing ENaC open probability. Taken together, these findings suggest calmodulin and CaMKII modulate ENaC activity by destabilizing the association between the actin cytoskeleton, ENaC, and MARCKS, or MLP-1 at the apical membrane. Copyright © 2015 the American Physiological Society.

  5. Streptomyces coelicolor encodes a urate-responsive transcriptional regulator with homology to PecS from plant pathogens.

    Science.gov (United States)

    Huang, Hao; Mackel, Brian J; Grove, Anne

    2013-11-01

    Many transcriptional regulators control gene activity by responding to specific ligands. Members of the multiple-antibiotic resistance regulator (MarR) family of transcriptional regulators feature prominently in this regard, and they frequently function as repressors in the absence of their cognate ligands. Plant pathogens such as Dickeya dadantii encode a MarR homolog named PecS that controls expression of a gene encoding the efflux pump PecM in addition to other virulence genes. We report here that the soil bacterium Streptomyces coelicolor also encodes a PecS homolog (SCO2647) that regulates a pecM gene (SCO2646). S. coelicolor PecS, which exists as a homodimer, binds the intergenic region between pecS and pecM genes with high affinity. Several potential PecS binding sites were found in this intergenic region. The binding of PecS to its target DNA can be efficiently attenuated by the ligand urate, which also quenches the intrinsic fluorescence of PecS, indicating a direct interaction between urate and PecS. In vivo measurement of gene expression showed that activity of pecS and pecM genes is significantly elevated after exposure of S. coelicolor cultures to urate. These results indicate that S. coelicolor PecS responds to the ligand urate by attenuated DNA binding in vitro and upregulation of gene activity in vivo. Since production of urate is associated with generation of reactive oxygen species by xanthine dehydrogenase, we propose that PecS functions under conditions of oxidative stress.

  6. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  7. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  8. Interaction between actinides and protein: the calmodulin

    International Nuclear Information System (INIS)

    Brulfert, Florian

    2016-01-01

    Considering the environmental impact of the Fukushima nuclear accident, it is fundamental to study the mechanisms governing the effects of the released radionuclides on the biosphere and thus identify the molecular processes generating the transport and deposition of actinides, such as neptunium and uranium. However, the information about the microscopic aspect of the interaction between actinides and biological molecules (peptides, proteins...) is scarce. The data being mostly reported from a physiological point of view, the structure of the coordination sites remains largely unknown. These microscopic data are indeed essential for the understanding of the interdependency between structural aspect, function and affinity.The Calmodulin (CaM) (abbreviation for Calcium-Modulated protein), also known for its affinity towards actinides, acts as a metabolic regulator of calcium. This protein is a Ca carrier, which is present ubiquitously in the human body, may also bind other metals such as actinides. Thus, in case of a contamination, actinides that bind to CaM could avoid the protein to perform properly and lead to repercussions on a large range of vital functions.The complexation of Np and U was studied by EXAFS spectroscopy which showed that actinides were incorporated in a calcium coordination site. Once the thermodynamical and structural aspects studied, the impact of the coordination site distortion on the biological efficiency was analyzed. In order to evaluate these consequences, a calorimetric method based on enzyme kinetics was developed. This experiment, which was conducted with both uranium (50 - 500 nM) and neptunium (30 - 250 nM) showed a decrease of the heat produced by the enzymatic reaction with an increasing concentration of actinides in the medium. Our findings showed that the Calmodulin actinide complex works as an enzymatic inhibitor. Furthermore, at higher neptunium (250 nM) and uranium (500 nM) concentration the metals seem to have a poison

  9. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  10. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  11. Characterization of the retinoblastoma binding proteins RBP1 and RBP2

    DEFF Research Database (Denmark)

    Fattaey, A R; Helin, K; Dembski, M S

    1993-01-01

    The retinoblastoma gene product, pRB, regulates cell proliferation by binding to and inhibiting the activity of key growth promoting proteins. Several cellular proteins have been shown to bind directly to pRB and the genes encoding a number of them have been isolated. The protein product of one...

  12. DNA repair in human cells: Methods for the determination of calmodulin involvement

    International Nuclear Information System (INIS)

    Charp, P.A.

    1987-01-01

    Exposure of DNA to either physical or chemical agents can result in the formation of a number of different lesions which must be repaired enzymatically in order for DNA to carry on normal replication and transcription. In most cases, the enzymes involved in this repair of damaged DNA include endonucleases, exonucleases, glycosylases, polymerases, and ligases. Each group of enzymes is involved in precise steps in DNA repair. Exposure to physical agents such as ultraviolet light (UV) at a wavelength of 254 nm is repaired by two distinct and different mechanisms. One mode of enzymatic repair of pyrimidine dimers is accomplished in situ by photoreactivation of UV-induced pyrimidine dimers by photoreactivating light. The second mode of enzymatic repair is the excision repair of pyrimidine dimers involving several different enzymes including endonuclease, exonuclease, and DNA ligase. A summary of the sequence of enzymatic steps involved is shown. It has been observed that specific drugs which bind to and alter the action of calmodulin in cells block DNA synthesis. This suggests that calmodulin may play a role both in normal DNA replication and repair. Others using an indirect method measuring the degree of DNA nucleoid sedimentation, showed that the specific anti-calmodulin agent W-13 slowed the rate of DNA repair. Others showed that DNA synthesis in T51B rat liver cells could be blocked with the addition of either chlorpromazine or trifluoperazine

  13. Molecular cloning and expression of the human homologue of the murine gene encoding myeloid leukemia-inhibitory factor

    International Nuclear Information System (INIS)

    Gough, N.M.; Gearing, D.P.; King, J.A.; Willson, T.A.; Hilton, D.J.; Nicola, N.A.; Metcalf, D.

    1988-01-01

    A human homologue of the recently cloned murine leukemia-inhibitory factor (LIF) gene was isolated from a genomic library by using the marine cDNA as a hybridization probe. The nucleotide sequence of the human gene indicated that human LIF has 78% amino acid sequence identity with murine LIF, with no insertions or deletions, and that the region of the human gene encoding the mature protein has one intervening sequence. After oligonucleotide-mediated mutagenesis, the mature protein-coding region of the LIF gene was introduced into the yeast expression vector YEpsec1. Yeast cells transformed with the resulting recombinant could be induced with galactose to produce high levels of a factor that induced the differentiation of murine M1 leukemic cells in a manner analogous to murine LIF. This factor competed with 125 I-labeled native murine LIF for binding to specific cellular receptors on murine cells, compatible with a high degree of structural similarity between the murine and human factors

  14. Evolution of RLSB, a nuclear-encoded S1 domain RNA binding protein associated with post-transcriptional regulation of plastid-encoded rbcL mRNA in vascular plants.

    Science.gov (United States)

    Yerramsetty, Pradeep; Stata, Matt; Siford, Rebecca; Sage, Tammy L; Sage, Rowan F; Wong, Gane Ka-Shu; Albert, Victor A; Berry, James O

    2016-06-29

    RLSB, an S-1 domain RNA binding protein of Arabidopsis, selectively binds rbcL mRNA and co-localizes with Ribulose-1,5-bisphosphate carboxylase/oxygenase (Rubisco) within chloroplasts of C3 and C4 plants. Previous studies using both Arabidopsis (C3) and maize (C4) suggest RLSB homologs are post-transcriptional regulators of plastid-encoded rbcL mRNA. While RLSB accumulates in all Arabidopsis leaf chlorenchyma cells, in C4 leaves RLSB-like proteins accumulate only within Rubisco-containing bundle sheath chloroplasts of Kranz-type species, and only within central compartment chloroplasts in the single cell C4 plant Bienertia. Our recent evidence implicates this mRNA binding protein as a primary determinant of rbcL expression, cellular localization/compartmentalization, and photosynthetic function in all multicellular green plants. This study addresses the hypothesis that RLSB is a highly conserved Rubisco regulatory factor that occurs in the chloroplasts all higher plants. Phylogenetic analysis has identified RLSB orthologs and paralogs in all major plant groups, from ancient liverworts to recent angiosperms. RLSB homologs were also identified in algae of the division Charophyta, a lineage closely related to land plants. RLSB-like sequences were not identified in any other algae, suggesting that it may be specific to the evolutionary line leading to land plants. The RLSB family occurs in single copy across most angiosperms, although a few species with two copies were identified, seemingly randomly distributed throughout the various taxa, although perhaps correlating in some cases with known ancient whole genome duplications. Monocots of the order Poales (Poaceae and Cyperaceae) were found to contain two copies, designated here as RLSB-a and RLSB-b, with only RLSB-a implicated in the regulation of rbcL across the maize developmental gradient. Analysis of microsynteny in angiosperms revealed high levels of conservation across eudicot species and for both paralogs in

  15. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  16. Involvement of Calmodulin and Calmodulin-like Proteins in Plant Responses to Abiotic Stresses

    Directory of Open Access Journals (Sweden)

    B W Poovaiah

    2015-08-01

    Full Text Available Transient changes in intracellular Ca2+ concentration have been well recognized to act as cell signals coupling various environmental stimuli to appropriate physiological responses with accuracy and specificity in plants. Calmodulin (CaM and calmodulin-like proteins (CMLs are major Ca2+ sensors, playing critical roles in interpreting encrypted Ca2+ signals. Ca2+-loaded CaM/CMLs interact and regulate a broad spectrum of target proteins such as channels/pumps/antiporters for various ions, transcription factors, protein kinases, protein phosphatases, metabolic enzymes and proteins with unknown biochemical functions. Many of the target proteins of CaM/CMLs directly or indirectly regulate plant responses to environmental stresses. Basic information about stimulus-induced Ca2+ signal and overview of Ca2+ signal perception and transduction are briefly discussed in the beginning of this review. How CaM/CMLs are involved in regulating plant responses to abiotic stresses are emphasized in this review. Exciting progress has been made in the past several years, such as the elucidation of Ca2+/CaM-mediated regulation of AtSR1/CAMTA3 and plant responses to chilling and freezing stresses, Ca2+/CaM-mediated regulation of CAT3, MAPK8 and MKP1 in homeostasis control of ROS signals, discovery of CaM7 as a DNA-binding transcription factor regulating plant response to light signals. However, many key questions in Ca2+/CaM-mediated signaling warrant further investigation. Ca2+/CaM-mediated regulation of most of the known target proteins is presumed based on their interaction. The downstream targets of CMLs are mostly unknown, and how specificity of Ca2+ signaling could be realized through the actions of CaM/CMLs and their target proteins is largely unknown. Future breakthroughs in Ca2+/CaM-mediated signaling will not only improve our understanding of how plants respond to environmental stresses, but also provide the knowledge base to improve stress-tolerance of crops.

  17. Unfolded Protein Response (UPR Regulator Cib1 Controls Expression of Genes Encoding Secreted Virulence Factors in Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Martin Hampel

    Full Text Available The unfolded protein response (UPR, a conserved eukaryotic signaling pathway to ensure protein homeostasis in the endoplasmic reticulum (ER, coordinates biotrophic development in the corn smut fungus Ustilago maydis. Exact timing of UPR activation is required for virulence and presumably connected to the elevated expression of secreted effector proteins during infection of the host plant Zea mays. In the baker's yeast Saccharomyces cerevisiae, expression of UPR target genes is induced upon binding of the central regulator Hac1 to unfolded protein response elements (UPREs in their promoters. While a role of the UPR in effector secretion has been described previously, we investigated a potential UPR-dependent regulation of genes encoding secreted effector proteins. In silico prediction of UPREs in promoter regions identified the previously characterized effector genes pit2 and tin1-1, as bona fide UPR target genes. Furthermore, direct binding of the Hac1-homolog Cib1 to the UPRE containing promoter fragments of both genes was confirmed by quantitative chromatin immunoprecipitation (qChIP analysis. Targeted deletion of the UPRE abolished Cib1-dependent expression of pit2 and significantly affected virulence. Furthermore, ER stress strongly increased Pit2 expression and secretion. This study expands the role of the UPR as a signal hub in fungal virulence and illustrates, how biotrophic fungi can coordinate cellular physiology, development and regulation of secreted virulence factors.

  18. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  19. Evolution of plant P-type ATPases

    Directory of Open Access Journals (Sweden)

    Christian N.S. Pedersen

    2012-02-01

    Full Text Available Five organisms having completely sequenced genomes and belonging to all major branches of green plants (Viridiplantae were analyzed with respect to their content of P-type ATPases encoding genes. These were the chlorophytes Ostreococcus tauria and Chlamydomonas reinhardtii, and the streptophytes Physcomitrella patens (a moss, Selaginella moellendorffii (a primitive vascular plant, and Arabidopsis thaliana (a model flowering plant. Each organism contained sequences for all five subfamilies of P-type ATPases. Our analysis demonstrates when specific subgroups of P-type ATPases disappeared in the evolution of Angiosperms. Na/K-pump related P2C ATPases were lost with the evolution of streptophytes whereas Na+ or K+ pumping P2D ATPases and secretory pathway Ca2+-ATPases remained until mosses. An N-terminally located calmodulin binding domain in P2B ATPases can only be detected in pumps from Streptophytae, whereas, like in animals, a C-terminally localized calmodulin binding domain might be present in chlorophyte P2B Ca2+-ATPases. Chlorophyte genomes encode P3A ATPases resembling protist plasma membrane H+-ATPases and a C-terminal regulatory domain is missing. The complete inventory of P-type ATPases in the major branches of Viridiplantae is an important starting point for elucidating the evolution in plants of these important pumps.

  20. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  1. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  2. Non-equilibrium repressor binding kinetics link DNA damage dose to transcriptional timing within the SOS gene network.

    Science.gov (United States)

    Culyba, Matthew J; Kubiak, Jeffrey M; Mo, Charlie Y; Goulian, Mark; Kohli, Rahul M

    2018-06-01

    Biochemical pathways are often genetically encoded as simple transcription regulation networks, where one transcription factor regulates the expression of multiple genes in a pathway. The relative timing of each promoter's activation and shut-off within the network can impact physiology. In the DNA damage repair pathway (known as the SOS response) of Escherichia coli, approximately 40 genes are regulated by the LexA repressor. After a DNA damaging event, LexA degradation triggers SOS gene transcription, which is temporally separated into subsets of 'early', 'middle', and 'late' genes. Although this feature plays an important role in regulating the SOS response, both the range of this separation and its underlying mechanism are not experimentally defined. Here we show that, at low doses of DNA damage, the timing of promoter activities is not separated. Instead, timing differences only emerge at higher levels of DNA damage and increase as a function of DNA damage dose. To understand mechanism, we derived a series of synthetic SOS gene promoters which vary in LexA-operator binding kinetics, but are otherwise identical, and then studied their activity over a large dose-range of DNA damage. In distinction to established models based on rapid equilibrium assumptions, the data best fit a kinetic model of repressor occupancy at promoters, where the drop in cellular LexA levels associated with higher doses of DNA damage leads to non-equilibrium binding kinetics of LexA at operators. Operators with slow LexA binding kinetics achieve their minimal occupancy state at later times than operators with fast binding kinetics, resulting in a time separation of peak promoter activity between genes. These data provide insight into this remarkable feature of the SOS pathway by demonstrating how a single transcription factor can be employed to control the relative timing of each gene's transcription as a function of stimulus dose.

  3. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  4. Mannan-binding lectin MBL2 gene polymorphism in chronic hepatitis C: association with the severity of liver fibrosis and response to interferon therapy

    DEFF Research Database (Denmark)

    Alves Pedroso, ML; Boldt, AB; Pereira-Ferrari, L

    2008-01-01

    Hepatitis C virus (HCV) is a major cause of hepatic disease and of liver transplantation worldwide. Mannan-binding lectin (MBL), encoded by the MBL2 gene, can have an important role as an opsonin and complement activating molecule in HCV persistence and liver injury. We assessed the MBL2...

  5. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  6. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  7. Calmodulin-regulated adenylyl cyclases and neuromodulation.

    Science.gov (United States)

    Xia, Z; Storm, D R

    1997-06-01

    Coincidence detection and crosstalk between signal transduction systems play very important regulatory roles in the nervous system, particularly in the regulation of transcription. Coupling of the Ca2+ and cAMP regulatory systems by calmodulin-regulated adenylyl cyclases is hypothesized to be important for some forms of synaptic plasticity, neuroendocrine function, and olfactory detection. Recent studies of a mutant mouse deficient in type I calmodulin-sensitive adenylyl cyclase have provided the first evidence that adenylyl cyclases are important for synaptic plasticity, as well as for learning and memory in vertebrates.

  8. Characterization of the human laminin beta2 chain locus (LAMB2): linkage to a gene containing a nonprocessed, transcribed LAMB2-like pseudogene (LAMB2L) and to the gene encoding glutaminyl tRNA synthetase (QARS)

    DEFF Research Database (Denmark)

    Durkin, M E; Jäger, A C; Khurana, T S

    1999-01-01

    The laminin beta2 chain is an important constituent of certain kidney and muscle basement membranes. We have generated a detailed physical map of a 110-kb genomic DNA segment surrounding the human laminin beta2 chain gene (LAMB2) on chromosome 3p21.3-->p21.2, a region paralogous with the chromosome...... 7q22-->q31 region that contains the laminin beta1 chain gene locus (LAMB1). Several CpG islands and a novel polymorphic microsatellite marker (D3S4594) were identified. The 3' end of LAMB2 lies 16 kb from the 5' end of the glutaminyl tRNA synthetase gene (QARS). About 20 kb upstream of LAMB2 we...... found a gene encoding a transcribed, non-processed LAMB2-like pseudogene (LAMB2L). The sequence of 1.75 kb of genomic DNA at the 3' end of LAMB2L was similar to exons 8-12 of the laminin beta2 chain gene. The LAMB2L-LAMB2-QARS cluster lies telomeric to the gene encoding the laminin-binding protein...

  9. Induced effect of Ca2+ on dalesconols A and B biosynthesis in the culture of Daldinia eschscholzii via calcium/calmodulin signaling.

    Science.gov (United States)

    Lu, Yanhua; Pan, Zhenghua; Tao, Jun; An, Faliang

    2018-02-01

    Dalesconols (dalesconols A and B) were isolated from Daldinia eschscholzii and have remarkable immunosuppressive activity. In this study, the response of fungal growth, intra- and extracellular Ca 2+ , and dalesconols production after CaCl 2 addition were reported for the first time. After supplementation with 5 mM Ca 2+ at 24 h, dalesconols production reached 84.33 mg/L, which resulted in a 1.57-fold enhancement compared to the control. The key role of calcium/calmodulin signaling in dalesconols biosynthesis was confirmed by treatment with Ca 2+ channel and calmodulin inhibitors. The transcriptional levels of dalesconols biosynthetic genes were up-regulated after CaCl 2 addition and down-regulated after inhibitors were added. The results demonstrated that Ca 2+ addition induces dalesconols biosynthesis through up-regulation of dalesconols biosynthesis genes via regulation of calcium/calmodulin signaling. This study provided an efficient strategy for improving dalesconols production and would facilitate further research on the biosynthesis and regulation of dalesconols. Copyright © 2017 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Calmodulin-mediated activation of Akt regulates survival of c-Myc-overexpressing mouse mammary carcinoma cells.

    Science.gov (United States)

    Deb, Tushar B; Coticchia, Christine M; Dickson, Robert B

    2004-09-10

    c-Myc-overexpressing mammary epithelial cells are proapoptotic; their survival is strongly promoted by epidermal growth factor (EGF). We now demonstrate that EGF-induced Akt activation and survival in transgenic mouse mammary tumor virus-c-Myc mouse mammary carcinoma cells are both calcium/calmodulin-dependent. Akt activation is abolished by the phospholipase C-gamma inhibitor U-73122, by the intracellular calcium chelator BAPTA-AM, and by the specific calmodulin antagonist W-7. These results implicate calcium/calmodulin in the activation of Akt in these cells. In addition, Akt activation by serum and insulin is also inhibited by W-7. EGF-induced and calcium/calmodulin-mediated Akt activation occurs in both tumorigenic and non-tumorigenic mouse and human mammary epithelial cells, independent of their overexpression of c-Myc. These results imply that calcium/calmodulin may be a common regulator of Akt activation, irrespective of upstream receptor activator, mammalian species, and transformation status in mammary epithelial cells. However, only c-Myc-overexpressing mouse mammary carcinoma cells (but not normal mouse mammary epithelial cells) undergo apoptosis in the presence of the calmodulin antagonist W-7, indicating the vital selective role of calmodulin for survival of these cells. Calcium/calmodulin-regulated Akt activation is mediated directly by neither calmodulin kinases nor phosphatidylinositol 3-kinase (PI-3 kinase). Pharmacological inhibitors of calmodulin kinase kinase and calmodulin kinases II and III do not inhibit EGF-induced Akt activation, and calmodulin antagonist W-7 does not inhibit phosphotyrosine-associated PI-3 kinase activation. Akt is, however, co-immunoprecipitated with calmodulin in an EGF-dependent manner, which is inhibited by calmodulin antagonist W-7. We conclude that calmodulin may serve a vital regulatory function to direct the localization of Akt to the plasma membrane for its activation by PI-3 kinase.

  11. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  12. Composting-Like Conditions Are More Efficient for Enrichment and Diversity of Organisms Containing Cellulase-Encoding Genes than Submerged Cultures.

    Directory of Open Access Journals (Sweden)

    Senta Heiss-Blanquet

    Full Text Available Cost-effective biofuel production from lignocellulosic biomass depends on efficient degradation of the plant cell wall. One of the major obstacles for the development of a cost-efficient process is the lack of resistance of currently used fungal enzymes to harsh conditions such as high temperature. Adapted, thermophilic microbial communities provide a huge reservoir of potentially interesting lignocellulose-degrading enzymes for improvement of the cellulose hydrolysis step. In order to identify such enzymes, a leaf and wood chip compost was enriched on a mixture of thermo-chemically pretreated wheat straw, poplar and Miscanthus under thermophile conditions, but in two different set-ups. Unexpectedly, metagenome sequencing revealed that incubation of the lignocellulosic substrate with compost as inoculum in a suspension culture resulted in an impoverishment of putative cellulase- and hemicellulase-encoding genes. However, mimicking composting conditions without liquid phase yielded a high number and diversity of glycoside hydrolase genes and an enrichment of genes encoding cellulose binding domains. These identified genes were most closely related to species from Actinobacteria, which seem to constitute important players of lignocellulose degradation under the applied conditions. The study highlights that subtle changes in an enrichment set-up can have an important impact on composition and functions of the microcosm. Composting-like conditions were found to be the most successful method for enrichment in species with high biomass degrading capacity.

  13. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  14. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  15. DNA binding-independent transcriptional activation of the vascular endothelial growth factor gene (VEGF) by the Myb oncoprotein

    International Nuclear Information System (INIS)

    Lutwyche, Jodi K.; Keough, Rebecca A.; Hunter, Julie; Coles, Leeanne S.; Gonda, Thomas J.

    2006-01-01

    Myb is a key transcription factor that can regulate proliferation, differentiation, and apoptosis, predominantly in the haemopoietic system. Abnormal expression of Myb is associated with a number of cancers, both haemopoietic and non-haemopoietic. In order to better understand the role of Myb in normal and tumorigenic processes, we undertook a cDNA array screen to identify genes that are regulated by this factor. In this way, we identified the gene encoding vascular endothelial growth factor (VEGF) as being potentially regulated by the Myb oncoprotein in myeloid cells. To determine whether this was a direct effect on VEGF gene transcription, we examined the activity of the murine VEGF promoter in the presence of either wild-type (WT) or mutant forms of Myb. It was found that WT Myb was able to activate the VEGF promoter and that a minimal promoter region of 120 bp was sufficient to confer Myb responsiveness. Surprisingly, activation of the VEGF promoter was independent of DNA binding by Myb. This was shown by the use of DNA binding-defective Myb mutants and by mutagenesis of a potential Myb-binding site in the minimal promoter. Mutation of Sp1 sites within this region abolished Myb-mediated regulation of a reporter construct, suggesting that Myb DNA binding-independent activation of VEGF expression occurs via these Sp1 binding elements. Regulation of VEGF production by Myb has implications for the potential role of Myb in myeloid leukaemias and in solid tumours where VEGF may be functioning as an autocrine growth factor

  16. Size-dependent impact of CNTs on dynamic properties of calmodulin.

    Science.gov (United States)

    Gao, Jian; Wang, Liming; Kang, Seung-gu; Zhao, Lina; Ji, Mingjuan; Chen, Chunying; Zhao, Yuliang; Zhou, Ruhong; Li, Jingyuan

    2014-11-07

    There are growing concerns about the biosafety of nanomaterials such as carbon nanotubes (CNTs) as their applications become more widespread. We report here a theoretical and experimental study of the binding of various sizes of CNTs [CNT (4,4), (5,5), (6,6) and (7,7)] to calmodulin (CaM) protein and, in particular, their impact on the Ca(2+)-dependent dynamic properties of CaM. Our simulations show that all the CNTs can plug into the hydrophobic binding pocket of Ca(2+)-bound CaM with binding affinities comparable with the native substrate M13 peptide. Even though CNT (4,4) shows a similar behavior to the M13 peptide in its dissociation from Ca(2+)-free CaM, wider CNTs still bind firmly to CaM, indicating a potential failure of Ca(2+) regulation. Such a size-dependent impact of CNTs on the dynamic properties of CaM is a result of the excessively strong hydrophobic interactions between the wider CNTs and CaM. These simulation results were confirmed by circular dichroism spectroscopy, which showed that the secondary structures of CaM become insensitive to Ca(2+) concentrations after the addition of CNTs. Our findings indicate that the cytotoxicity of nanoparticles to proteins arises not only from the inhibition of static protein structures (binding pockets), but also from impacts on their dynamic properties.

  17. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  18. Differential expression of calcium/calmodulin-regulated SlSRs in response to abiotic and biotic stresses in tomato fruit.

    Science.gov (United States)

    Yang, Tianbao; Peng, Hui; Whitaker, Bruce D; Jurick, Wayne M

    2013-07-01

    Calcium has been shown to enhance stress tolerance, maintain firmness and reduce decay in fruits. Previously we reported that seven tomato SlSRs encode calcium/calmodulin-regulated proteins, and that their expressions are developmentally regulated during fruit development and ripening, and are also responsive to ethylene. To study their expressions in response to stresses encountered during postharvest handling, tomato fruit at the mature-green stage was subjected to chilling and wounding injuries, infected with Botrytis cinerea and treated with salicylic acid or methyl jasmonate. Gene expression studies revealed that the seven SlSRs differentially respond to different stress signals. SlSR2 was the only gene upregulated by all the treatments. SlSR4 acted as a late pathogen-induced gene; it was upregulated by salicylic acid and methyl jasmonate, but downregulated by cold treatment. SlSR3L was cold- and wound-responsive and was also induced by salicylic acid. SlSR1 and SlSR1L were repressed by cold, wounding and pathogen infection, but were upregulated by salicylic acid and methyl jasmonate. Overall, results of these expression studies indicate that individual SlSRs have distinct roles in responses to the specific stress signals, and SlSRs may act as a coordinator(s) connecting calcium-mediated signaling with other stress signal transduction pathways during fruit ripening and storage. © 2013 Scandinavian Plant Physiology Society.

  19. DC8 and DC13 var genes associated with severe malaria bind avidly to diverse endothelial cells.

    Directory of Open Access Journals (Sweden)

    Marion Avril

    Full Text Available During blood stage infection, Plasmodium falciparum infected erythrocytes (IE bind to host blood vessels. This virulence determinant enables parasites to evade spleen-dependent killing mechanisms, but paradoxically in some cases may reduce parasite fitness by killing the host. Adhesion of infected erythrocytes is mediated by P. falciparum erythrocyte membrane protein 1 (PfEMP1, a family of polymorphic adhesion proteins encoded by var genes. Whereas cerebral binding and severe malaria are associated with parasites expressing DC8 and DC13 var genes, relatively little is known about the non-brain endothelial selection on severe malaria adhesive types. In this study, we selected P. falciparum-IEs on diverse endothelial cell types and demonstrate that DC8 and DC13 var genes were consistently among the major var transcripts selected on non-brain endothelial cells (lung, heart, bone marrow. To investigate the molecular basis for this avid endothelial binding activity, recombinant proteins were expressed from the predominant upregulated DC8 transcript, IT4var19. In-depth binding comparisons revealed that multiple extracellular domains from this protein bound brain and non-brain endothelial cells, and individual domains largely did not discriminate between different endothelial cell types. Additionally, we found that recombinant DC8 and DC13 CIDR1 domains exhibited a widespread endothelial binding activity and could compete for DC8-IE binding to brain endothelial cells, suggesting they may bind the same host receptor. Our findings provide new insights into the interaction of severe malaria adhesive types and host blood vessels and support the hypothesis that parasites causing severe malaria express PfEMP1 variants with a superior ability to adhere to diverse endothelial cell types, and may therefore endow these parasites with a growth and transmission advantage.

  20. Surface dynamics in allosteric regulation of protein-protein interactions: modulation of calmodulin functions by Ca2+.

    Directory of Open Access Journals (Sweden)

    Yosef Y Kuttner

    2013-04-01

    Full Text Available Knowledge of the structural basis of protein-protein interactions (PPI is of fundamental importance for understanding the organization and functioning of biological networks and advancing the design of therapeutics which target PPI. Allosteric modulators play an important role in regulating such interactions by binding at site(s orthogonal to the complex interface and altering the protein's propensity for complex formation. In this work, we apply an approach recently developed by us for analyzing protein surfaces based on steered molecular dynamics simulation (SMD to the study of the dynamic properties of functionally distinct conformations of a model protein, calmodulin (CaM, whose ability to interact with target proteins is regulated by the presence of the allosteric modulator Ca(2+. Calmodulin is a regulatory protein that acts as an intracellular Ca(2+ sensor to control a wide variety of cellular processes. We demonstrate that SMD analysis is capable of pinpointing CaM surfaces implicated in the recognition of both the allosteric modulator Ca(2+ and target proteins. Our analysis of changes in the dynamic properties of the CaM backbone elicited by Ca(2+ binding yielded new insights into the molecular mechanism of allosteric regulation of CaM-target interactions.

  1. Novel Calmodulin (CALM2) Mutations Associated with Congenital Arrhythmia Susceptibility

    Science.gov (United States)

    Makita, Naomasa; Yagihara, Nobue; Crotti, Lia; Johnson, Christopher N.; Beckmann, Britt-Maria; Roh, Michelle S.; Shigemizu, Daichi; Lichtner, Peter; Ishikawa, Taisuke; Aiba, Takeshi; Homfray, Tessa; Behr, Elijah R.; Klug, Didier; Denjoy, Isabelle; Mastantuono, Elisa; Theisen, Daniel; Tsunoda, Tatsuhiko; Satake, Wataru; Toda, Tatsushi; Nakagawa, Hidewaki; Tsuji, Yukiomi; Tsuchiya, Takeshi; Yamamoto, Hirokazu; Miyamoto, Yoshihiro; Endo, Naoto; Kimura, Akinori; Ozaki, Kouichi; Motomura, Hideki; Suda, Kenji; Tanaka, Toshihiro; Schwartz, Peter J.; Meitinger, Thomas; Kääb, Stefan; Guicheney, Pascale; Shimizu, Wataru; Bhuiyan, Zahurul A.; Watanabe, Hiroshi; Chazin, Walter J.; George, Alfred L.

    2014-01-01

    Background Genetic predisposition to life-threatening cardiac arrhythmias such as in congenital long-QT syndrome (LQTS) and catecholaminergic polymorphic ventricular tachycardia (CPVT) represent treatable causes of sudden cardiac death in young adults and children. Recently, mutations in calmodulin (CALM1, CALM2) have been associated with severe forms of LQTS and CPVT, with life-threatening arrhythmias occurring very early in life. Additional mutation-positive cases are needed to discern genotype-phenotype correlations associated with calmodulin mutations. Methods and Results We employed conventional and next-generation sequencing approaches including exome analysis in genotype-negative LQTS probands. We identified five novel de novo missense mutations in CALM2 in three subjects with LQTS (p.N98S, p.N98I, p.D134H) and two subjects with clinical features of both LQTS and CPVT (p.D132E, p.Q136P). Age of onset of major symptoms (syncope or cardiac arrest) ranged from 1–9 years. Three of five probands had cardiac arrest and one of these subjects did not survive. Although all probands had LQTS, two subjects also exhibited electrocardiographic features consistent with CPVT. The clinical severity among subjects in this series was generally less than that originally reported for CALM1 and CALM2 associated with recurrent cardiac arrest during infancy. Four of five probands responded to β-blocker therapy whereas one subject with mutation p.Q136P died suddenly during exertion despite this treatment. Mutations affect conserved residues located within calcium binding loops III (p.N98S, p.N98I) or IV (p.D132E, p.D134H, p.Q136P) and caused reduced calcium binding affinity. Conclusions CALM2 mutations can be associated with LQTS and with overlapping features of LQTS and CPVT. PMID:24917665

  2. A Venom Gland Extracellular Chitin-Binding-Like Protein from Pupal Endoparasitoid Wasps, Pteromalus Puparum, Selectively Binds Chitin

    Directory of Open Access Journals (Sweden)

    Yu Zhu

    2015-11-01

    Full Text Available Chitin-binding proteins (CBPs are present in many species and they act in a variety of biological processes. We analyzed a Pteromalus puparum venom apparatus proteome and transcriptome and identified a partial gene encoding a possible CBP. Here, we report cloning a full-length cDNA of a sequence encoding a chitin-binding-like protein (PpCBP from P. puparum, a pupal endoparasitoid of Pieris rapae. The cDNA encoded a 96-amino-acid protein, including a secretory signal peptide and a chitin-binding peritrophin-A domain. Phylogenetic analysis of chitin binding domains (CBDs of cuticle proteins and peritrophic matrix proteins in selected insects revealed that the CBD of PpCBP clustered with the CBD of Nasonia vitripennis. The PpCBP is specifically expressed in the venom apparatus of P. puparum, mostly in the venom gland. PpCBP expression was highest at day one after adult eclosion and much lower for the following five days. We produced a recombinant PpCBP and binding assays showed the recombinant protein selectively binds chitin but not cellulose in vitro. We infer that PpCBP serves a structural role in the venom reservoir, or may be injected into the host to help wound healing of the host exoskeleton.

  3. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  4. Specific reduction of calcium-binding protein (28-kilodalton calbindin-D) gene expression in aging and neurodegenerative diseases

    International Nuclear Information System (INIS)

    Iacopino, A.M.; Christakos, S.

    1990-01-01

    The present studies establish that there are specific, significant decreases in the neuronal calcium-binding protein (28-kDa calbindin-D) gene expression in aging and in neurodegenerative diseases. The specificity of the changes observed in calbindin mRNA levels was tested by reprobing blots with calmodulin, cyclophilin, and B-actin cDNAs. Gross brain regions of the aging rat exhibited specific, significant decreases in calbindin·mRNA and protein levels in the cerebellum, corpus striatum, and brain-stem region but not in the cerebral cortex or hippocampus. Discrete areas of the aging human brain exhibited significant decreases in calbindin protein and mRNA in the cerebellum, corpus striatum, and nucleus basalis but not in the neocortex, hippocampus, amygdala, locus ceruleus, or nucleus raphe dorsalis. Comparison of diseased human brain tissue with age- and sex-matched controls yielded significant decreases calbindin protein and mRNA in the substantia nigra (Parkinson disease), in the corpus striatum (Huntington disease), in the nucleus basalis (Alzheimer disease), and in the hippocampus and nucleus raphe dorsalis (Parkinson, Huntington, and Alzheimer diseases) but not in the cerebellum, neocortex, amygdala, or locus ceruleus. These findings suggest that decreased calbindin gene expression may lead to a failure of calcium buffering or intraneuronal calcium homeostasis, which contributes to calcium-mediated cytotoxic events during aging and in the pathogenesis of neurodegenerative diseases

  5. Calmodulin-like protein 3 is an estrogen receptor alpha coregulator for gene expression and drug response in a SNP, estrogen, and SERM-dependent fashion.

    Science.gov (United States)

    Qin, Sisi; Ingle, James N; Liu, Mohan; Yu, Jia; Wickerham, D Lawrence; Kubo, Michiaki; Weinshilboum, Richard M; Wang, Liewei

    2017-08-18

    We previously performed a case-control genome-wide association study in women treated with selective estrogen receptor modulators (SERMs) for breast cancer prevention and identified single nucleotide polymorphisms (SNPs) in ZNF423 as potential biomarkers for response to SERM therapy. The ZNF423rs9940645 SNP, which is approximately 200 bp away from the estrogen response elements, resulted in the SNP, estrogen, and SERM-dependent regulation of ZNF423 expression and, "downstream", that of BRCA1. Electrophoretic mobility shift assay-mass spectrometry was performed to identify proteins binding to the ZNF423 SNP and coordinating with estrogen receptor alpha (ERα). Clustered, regularly interspaced short palindromic repeats (CRISPR)/Cas9 genome editing was applied to generate ZR75-1 breast cancer cells with different ZNF423 SNP genotypes. Both cultured cells and mouse xenograft models with different ZNF423 SNP genotypes were used to study the cellular responses to SERMs and poly(ADP-ribose) polymerase (PARP) inhibitors. We identified calmodulin-like protein 3 (CALML3) as a key sensor of this SNP and a coregulator of ERα, which contributes to differential gene transcription regulation in an estrogen and SERM-dependent fashion. Furthermore, using CRISPR/Cas9-engineered ZR75-1 breast cancer cells with different ZNF423 SNP genotypes, striking differences in cellular responses to SERMs and PARP inhibitors, alone or in combination, were observed not only in cells but also in a mouse xenograft model. Our results have demonstrated the mechanism by which the ZNF423 rs9940645 SNP might regulate gene expression and drug response as well as its potential role in achieving more highly individualized breast cancer therapy.

  6. Genetic analysis of RPA single-stranded DNA binding protein in Haloferax volcanii

    OpenAIRE

    Stroud, A. L.

    2012-01-01

    Replication protein A (RPA) is a single-stranded DNA-binding protein that is present in all three domains of life. The roles of RPA include stabilising and protecting single- stranded DNA from nuclease degradation during DNA replication and repair. To achieve this, RPA uses an oligosaccharide-binding fold (OB fold) to bind single- stranded DNA. Haloferax volcanii encodes three RPAs – RPA1, RPA2 and RPA3, of which rpa1 and rpa3 are in operons with genes encoding associated proteins (APs). ...

  7. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  8. The Compass-like locus, exclusive to the Ambulacrarians, encodes a chromatin insulator binding protein in the sea urchin embryo.

    Directory of Open Access Journals (Sweden)

    Vincenzo Cavalieri

    Full Text Available Chromatin insulators are eukaryotic genome elements that upon binding of specific proteins display barrier and/or enhancer-blocking activity. Although several insulators have been described throughout various metazoans, much less is known about proteins that mediate their functions. This article deals with the identification and functional characterization in Paracentrotus lividus of COMPASS-like (CMPl, a novel echinoderm insulator binding protein. Phylogenetic analysis shows that the CMPl factor, encoded by the alternative spliced Cmp/Cmpl transcript, is the founder of a novel ambulacrarian-specific family of Homeodomain proteins containing the Compass domain. Specific association of CMPl with the boxB cis-element of the sns5 chromatin insulator is demonstrated by using a yeast one-hybrid system, and further corroborated by ChIP-qPCR and trans-activation assays in developing sea urchin embryos. The sns5 insulator lies within the early histone gene cluster, basically between the H2A enhancer and H1 promoter. To assess the functional role of CMPl within this locus, we challenged the activity of CMPl by two distinct experimental strategies. First we expressed in the developing embryo a chimeric protein, containing the DNA-binding domain of CMPl, which efficiently compete with the endogenous CMPl for the binding to the boxB sequence. Second, to titrate the embryonic CMPl protein, we microinjected an affinity-purified CMPl antibody. In both the experimental assays we congruently observed the loss of the enhancer-blocking function of sns5, as indicated by the specific increase of the H1 expression level. Furthermore, microinjection of the CMPl antiserum in combination with a synthetic mRNA encoding a forced repressor of the H2A enhancer-bound MBF1 factor restores the normal H1 mRNA abundance. Altogether, these results strongly support the conclusion that the recruitment of CMPl on sns5 is required for buffering the H1 promoter from the H2A enhancer

  9. Regulation of brain adenylate cyclase by calmodulin

    International Nuclear Information System (INIS)

    Harrison, J.K.

    1988-01-01

    This thesis examined the interaction between the Ca 2+ -binding protein, calmodulin (CaM), and the cAMP synthesizing enzyme, adenylate cyclase. The regulation of guanyl nucleotide-dependent adenylate cyclase by CaM was examined in a particulate fraction from bovine striatum. CaM stimulated basal adenylate cyclase activity and enhanced the stimulation of the enzyme by GTP and dopamine (DA). The potentiation of GTP- and DA-stimulated adenylate cyclase activities by CaM was more sensitive to the concentration of CaM than was the stimulation of basal activity. A photoreactive CaM derivative was developed in order to probe the interactions between CaM and the adenylate cyclase components of bovine brain. Iodo-[ 125 I]-CaM-diazopyruvamide ( 125 I-CAM-DAP) behaved like native CaM with respect to Ca 2+ -enhanced mobility on sodium dodecyl sulfate-polyacrylamide gels and Ca 2+ -dependent stimulation of adenylate cyclase. 125 I-CaM-DAP cross-linked to CaM-binding proteins in a Ca 2+ -dependent, concentration-dependent, and CaM-specific manner. Photolysis of 125 I-CaM-DAP and forskolin-agarose purified CaM-sensitive adenylate cyclase produced an adduct with a molecular weight of 140,000

  10. An adenovirus vector incorporating carbohydrate binding domains utilizes glycans for gene transfer.

    Directory of Open Access Journals (Sweden)

    Julius W Kim

    Full Text Available Vectors based on human adenovirus serotype 5 (HAdV-5 continue to show promise as delivery vehicles for cancer gene therapy. Nevertheless, it has become clear that therapeutic benefit is directly linked to tumor-specific vector localization, highlighting the need for tumor-targeted gene delivery. Aberrant glycosylation of cell surface glycoproteins and glycolipids is a central feature of malignant transformation, and tumor-associated glycoforms are recognized as cancer biomarkers. On this basis, we hypothesized that cancer-specific cell-surface glycans could be the basis of a novel paradigm in HAdV-5-based vector targeting.As a first step toward this goal, we constructed a novel HAdV-5 vector encoding a unique chimeric fiber protein that contains the tandem carbohydrate binding domains of the fiber protein of the NADC-1 strain of porcine adenovirus type 4 (PAdV-4. This glycan-targeted vector displays augmented CAR-independent gene transfer in cells with low CAR expression. Further, we show that gene transfer is markedly decreased in cells with genetic glycosylation defects and by inhibitors of glycosylation in normal cells.These data provide the initial proof-of-concept for HAdV-5 vector-mediated gene delivery based on the presence of cell-surface carbohydrates. Further development of this new targeting paradigm could provide targeted gene delivery based on vector recognition of disease-specific glycan biomarkers.

  11. The Arg233Lys AQP0 mutation disturbs aquaporin0-calmodulin interaction causing polymorphic congenital cataract.

    Directory of Open Access Journals (Sweden)

    Shanshan Hu

    Full Text Available Calmodulin (CaM directly interacts with the aquaporin 0 (AQP0 C-terminus in a calcium dependent manner to regulate the water permeability of AQP0. We previously identified a missense mutation (p.R233K in the putative CaM binding domain of AQP0 C-terminus in a congenital cataract family. This study was aimed at exploring the potential pathogenesis of this mutation causative of cataract and mainly identifying how it influenced the binding of AQP0 to CaM. Wild type and R233K mutant AQP0 with EGFP-tag were transfected separately into Hela cells to determine the expression and subcellular localizations. The co-immunoprecipitation (CoIP assay was used to detect the interaction between AQP0 and CaM. AQP0 C-terminus peptides were synthesized with and without R233K, and the binding abilities of these peptides to CaM were assessed using a fluorescence binding assay. Localizations of wild type and R233K mutant AQP0 were determined from EGFP fluorescence, and the chimeric proteins were both localized abundantly in the plasma membrane. Protein expression levels of the culture cells showed no significant difference between them. The results from CoIP assay implied that R233K mutant presented more weakly in association with CaM than wild type AQP0. The AQP0 C-terminal mutant peptide was found to have 2.5-fold lower binding affinity to CaM than wild type peptide. These results suggested that R233K mutation did not affect the expression, location and trafficking of the protein but did influence the interaction between AQP0 and CaM. The binding affinity of AQP0 C-terminus to CaM was significantly reduced. Due to lack of the modulation of the Ca2+-calmodulin complex, the water permeability of AQP0 was subsequently augmented, which might lead to the development of this cataract.

  12. Functional role of oppA encoding an oligopeptide-binding protein from Lactobacillus salivarius Ren in bile tolerance.

    Science.gov (United States)

    Wang, Guohong; Li, Dan; Ma, Xiayin; An, Haoran; Zhai, Zhengyuan; Ren, Fazheng; Hao, Yanling

    2015-08-01

    Lactobacillus salivarius is a member of the indigenous microbiota of the human gastrointestinal tract (GIT), and some L. salivarius strains are considered as probiotics. Bile tolerance is a crucial property for probiotic bacteria to survive the transit through the GIT and exert their beneficial effects. In this work, the functional role of oppA encoding an oligopeptide transporter substrate-binding protein from L. salivarius Ren in bile salt tolerance was investigated. In silico analysis revealed that the oppA gene encodes a 61.7-kDa cell surface-anchored hydrophilic protein with a canonical lipoprotein signal peptide. Homologous overexpression of OppA was shown to confer 20-fold higher tolerance to 0.5 % oxgall in L. salivarius Ren. Furthermore, the recombinant strain exhibited 1.8-fold and 3.6-fold higher survival when exposed to the sublethal concentration of sodium taurocholate and sodium taurodeoxycholate, respectively, while no significant change was observed when exposed to sodium glycocholate and sodium glycodeoxycholate (GDCA). Our results indicate that OppA confers specific resistance to taurine-conjugated bile salts in L. salivarius Ren. In addition, the OppA overexpression strain also showed significant increased resistance to heat and salt stresses, suggesting the protective role of OppA against multiple stresses in L. salivarius Ren.

  13. A damage-responsive DNA binding protein regulates transcription of the yeast DNA repair gene PHR1

    International Nuclear Information System (INIS)

    Sebastian, J.; Sancar, G.B.

    1991-01-01

    The PHR1 gene of Saccharomyces cerevisiae encodes the DNA repair enzyme photolyase. Transcription of PHR1 increases in response to treatment of cells with 254-nm radiation and chemical agents that damage DNA. The authors here the identification of a damage-responsive DNA binding protein, termed photolyase regulatory protein (PRP), and its cognate binding site, termed the PHR1 transcription after DNA damage. PRP activity, monitored by electrophoretic-mobility-shift assay, was detected in cells during normal growth but disappeared within 30 min after irradiation. Copper-phenanthroline footprinting of PRP-DNA complexes revealed that PRP protects a 39-base-pair region of PHR1 5' flanking sequence beginning 40 base pairs upstream from the coding sequence. Thus these observations establish that PRP is a damage-responsive repressor of PHR1 transcription

  14. Primary structure and mapping of the hupA gene of Salmonella typhimurium.

    OpenAIRE

    Higgins, N P; Hillyard, D

    1988-01-01

    In bacteria, the complex nucleoid structure is folded and maintained by negative superhelical tension and a set of type II DNA-binding proteins, also called histonelike proteins. The most abundant type II DNA-binding protein is HU. Southern blot analysis showed that Salmonella typhimurium contained two HU genes that corresponded to Escherichia coli genes hupA (encoding HU-2 protein) and hupB (encoding HU-1). Salmonella hupA was cloned, and the nucleotide sequence of the gene was determined. C...

  15. Uncoupling PIP2-calmodulin regulation of Kv7.2 channels by an assembly destabilizing epileptogenic mutation.

    Science.gov (United States)

    Alberdi, Araitz; Gomis-Perez, Carolina; Bernardo-Seisdedos, Ganeko; Alaimo, Alessandro; Malo, Covadonga; Aldaregia, Juncal; Lopez-Robles, Carlos; Areso, Pilar; Butz, Elisabeth; Wahl-Schott, Christian; Villarroel, Alvaro

    2015-11-01

    We show that the combination of an intracellular bi-partite calmodulin (CaM)-binding site and a distant assembly region affect how an ion channel is regulated by a membrane lipid. Our data reveal that regulation by phosphatidylinositol(4,5)bisphosphate (PIP2) and stabilization of assembled Kv7.2 subunits by intracellular coiled-coil regions far from the membrane are coupled molecular processes. Live-cell fluorescence energy transfer measurements and direct binding studies indicate that remote coiled-coil formation creates conditions for different CaM interaction modes, each conferring different PIP2 dependency to Kv7.2 channels. Disruption of coiled-coil formation by epilepsy-causing mutation decreases apparent CaM-binding affinity and interrupts CaM influence on PIP2 sensitivity. © 2015. Published by The Company of Biologists Ltd.

  16. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  17. Presenilins Regulate Neurotrypsin Gene Expression and Neurotrypsin-dependent Agrin Cleavage via Cyclic AMP Response Element-binding Protein (CREB) Modulation*

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N.; Benner, Christopher; Herrera, Cheryl M.; Kang, David E.; Garcia-Bassets, Ivan; Goldstein, Lawrence S. B.

    2013-01-01

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment. PMID:24145027

  18. Presenilins regulate neurotrypsin gene expression and neurotrypsin-dependent agrin cleavage via cyclic AMP response element-binding protein (CREB) modulation.

    Science.gov (United States)

    Almenar-Queralt, Angels; Kim, Sonia N; Benner, Christopher; Herrera, Cheryl M; Kang, David E; Garcia-Bassets, Ivan; Goldstein, Lawrence S B

    2013-12-06

    Presenilins, the catalytic components of the γ-secretase complex, are upstream regulators of multiple cellular pathways via regulation of gene transcription. However, the underlying mechanisms and the genes regulated by these pathways are poorly characterized. In this study, we identify Tequila and its mammalian ortholog Prss12 as genes negatively regulated by presenilins in Drosophila larval brains and mouse embryonic fibroblasts, respectively. Prss12 encodes the serine protease neurotrypsin, which cleaves the heparan sulfate proteoglycan agrin. Altered neurotrypsin activity causes serious synaptic and cognitive defects; despite this, the molecular processes regulating neurotrypsin expression and activity are poorly understood. Using γ-secretase drug inhibitors and presenilin mutants in mouse embryonic fibroblasts, we found that a mature γ-secretase complex was required to repress neurotrypsin expression and agrin cleavage. We also determined that PSEN1 endoproteolysis or processing of well known γ-secretase substrates was not essential for this process. At the transcriptional level, PSEN1/2 removal induced cyclic AMP response element-binding protein (CREB)/CREB-binding protein binding, accumulation of activating histone marks at the neurotrypsin promoter, and neurotrypsin transcriptional and functional up-regulation that was dependent on GSK3 activity. Upon PSEN1/2 reintroduction, this active epigenetic state was replaced by a methyl CpG-binding protein 2 (MeCP2)-containing repressive state and reduced neurotrypsin expression. Genome-wide analysis revealed hundreds of other mouse promoters in which CREB binding is similarly modulated by the presence/absence of presenilins. Our study thus identifies Tequila and neurotrypsin as new genes repressed by presenilins and reveals a novel mechanism used by presenilins to modulate CREB signaling based on controlling CREB recruitment.

  19. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  20. Divergent mechanisms underlie Smad4-mediated positive regulation of the three genes encoding the basement membrane component laminin-332 (laminin-5)

    International Nuclear Information System (INIS)

    Zboralski, Dirk; Böckmann, Miriam; Zapatka, Marc; Hoppe, Sabine; Schöneck, Anna; Hahn, Stephan A; Schmiegel, Wolff; Schwarte-Waldhoff, Irmgard

    2008-01-01

    Functional inactivation of the tumor suppressor Smad4 in colorectal and pancreatic carcinogenesis occurs coincident with the transition to invasive growth. Breaking the basement membrane (BM) barrier, a prerequisite for invasive growth, can be due to tumor induced proteolytic tissue remodeling or to reduced synthesis of BM molecules by incipient tumor cells. Laminin-332 (laminin-5), a heterotrimeric BM component composed of α3-, β3- and γ2-chains, has recently been identified as a target structure of Smad4 and represents the first example for expression control of an essential BM component by a tumor and invasion suppressor. Biochemically Smad4 is a transmitter of signals of the TGFβ superfamily of cytokines. We have reported previously, that Smad4 functions as a positive transcriptional regulator of constitutive and of TGFβ-induced transcription of all three genes encoding Laminin-332, LAMA3, LAMB3 and LAMC2. Promoter-reporter constructs harboring 4 kb upstream regions, each of the three genes encoding Laminin-322 as well as deletion and mutations constructs were established. Promoter activities and TGFβ induction were assayed through transient transfections in Smad4-negative human cancer cells and their stable Smad4-positive derivatives. Functionally relevant binding sites were subsequently confirmed through chromatin immunoprecipitation. Herein, we report that Smad4 mediates transcriptional regulation through three different mechanisms, namely through Smad4 binding to a functional SBE site exclusively in the LAMA3 promoter, Smad4 binding to AP1 (and Sp1) sites presumably via interaction with AP1 family components and lastly a Smad4 impact on transcription of AP1 factors. Whereas Smad4 is essential for positive regulation of all three genes, the molecular mechanisms are significantly divergent between the LAMA3 promoter as compared to the LAMB3 and LAMC2 promoters. We hypothesize that this divergence in modular regulation of the three promoters may lay the

  1. An N-terminal nuclear localization sequence but not the calmodulin-binding domain mediates nuclear localization of nucleomorphin, a protein that regulates nuclear number in Dictyostelium

    International Nuclear Information System (INIS)

    Myre, Michael A.; O'Day, Danton H.

    2005-01-01

    Nucleomorphin is a novel nuclear calmodulin (CaM)-binding protein (CaMBP) containing an extensive DEED (glu/asp repeat) domain that regulates nuclear number. GFP-constructs of the 38 kDa NumA1 isoform localize as intranuclear patches adjacent to the inner nuclear membrane. The translocation of CaMBPs into nuclei has previously been shown by others to be mediated by both classic nuclear localization sequences (NLSs) and CaM-binding domains (CaMBDs). Here we show that NumA1 possesses a CaMBD ( 171 EDVSRFIKGKLLQKQQKIYKDLERF 195 ) containing both calcium-dependent-binding motifs and an IQ-like motif for calcium-independent binding. GFP-constructs containing only NumA1 residues 1-129, lacking the DEED and CaMBDs, still localized as patches at the internal periphery of nuclei thus ruling out a direct role for the CaMBD in nuclear import. These constructs contained the amino acid residues 48 KKSYQDPEIIAHSRPRK 64 that include both a putative bipartite and classical NLS. GFP-bipartite NLS constructs localized uniformly within nuclei but not as patches. As with previous work, removal of the DEED domain resulted in highly multinucleate cells. However as shown here, multinuclearity only occurred when the NLS was present allowing the protein to enter nuclei. Site-directed mutation analysis in which the NLS was changed to 48 EF 49 abolished the stability of the GFP fusion at the protein but not RNA level preventing subcellular analyses. Cells transfected with the 48 EF 49 construct exhibited slowed growth when compared to parental AX3 cells and other GFP-NumA1 deletion mutants. In addition to identifying an NLS that is sufficient for nuclear translocation of nucleomorphin and ruling out CaM-binding in this event, this work shows that the nuclear localization of NumA1 is crucial to its ability to regulate nuclear number in Dictyostelium

  2. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  3. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  4. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  5. Genome-scale study of the importance of binding site context for transcription factor binding and gene regulation

    Directory of Open Access Journals (Sweden)

    Ronne Hans

    2008-11-01

    Full Text Available Abstract Background The rate of mRNA transcription is controlled by transcription factors that bind to specific DNA motifs in promoter regions upstream of protein coding genes. Recent results indicate that not only the presence of a motif but also motif context (for example the orientation of a motif or its location relative to the coding sequence is important for gene regulation. Results In this study we present ContextFinder, a tool that is specifically aimed at identifying cases where motif context is likely to affect gene regulation. We used ContextFinder to examine the role of motif context in S. cerevisiae both for DNA binding by transcription factors and for effects on gene expression. For DNA binding we found significant patterns of motif location bias, whereas motif orientations did not seem to matter. Motif context appears to affect gene expression even more than it affects DNA binding, as biases in both motif location and orientation were more frequent in promoters of co-expressed genes. We validated our results against data on nucleosome positioning, and found a negative correlation between preferred motif locations and nucleosome occupancy. Conclusion We conclude that the requirement for stable binding of transcription factors to DNA and their subsequent function in gene regulation can impose constraints on motif context.

  6. Characterization of a gene family encoding SEA (sea-urchin sperm protein, enterokinase and agrin-domain proteins with lectin-like and heme-binding properties from Schistosoma japonicum.

    Directory of Open Access Journals (Sweden)

    Evaristus Chibunna Mbanefo

    Full Text Available BACKGROUND: We previously identified a novel gene family dispersed in the genome of Schistosoma japonicum by retrotransposon-mediated gene duplication mechanism. Although many transcripts were identified, no homolog was readily identifiable from sequence information. METHODOLOGY/PRINCIPAL FINDINGS: Here, we utilized structural homology modeling and biochemical methods to identify remote homologs, and characterized the gene products as SEA (sea-urchin sperm protein, enterokinase and agrin-domain containing proteins. A common extracellular domain in this family was structurally similar to SEA-domain. SEA-domain is primarily a structural domain, known to assist or regulate binding to glycans. Recombinant proteins from three members of this gene family specifically interacted with glycosaminoglycans with high affinity, with potential implication in ligand acquisition and immune evasion. Similar approach was used to identify a heme-binding site on the SEA-domain. The heme-binding mode showed heme molecule inserted into a hydrophobic pocket, with heme iron putatively coordinated to two histidine axial ligands. Heme-binding properties were confirmed using biochemical assays and UV-visible absorption spectroscopy, which showed high affinity heme-binding (K D = 1.605×10(-6 M and cognate spectroscopic attributes of hexa-coordinated heme iron. The native proteins were oligomers, antigenic, and are localized on adult worm teguments and gastrodermis; major host-parasite interfaces and site for heme detoxification and acquisition. CONCLUSIONS: The results suggest potential role, at least in the nucleation step of heme crystallization (hemozoin formation, and as receptors for heme uptake. Survival strategies exploited by parasites, including heme homeostasis mechanism in hemoparasites, are paramount for successful parasitism. Thus, assessing prospects for application in disease intervention is warranted.

  7. Characterization of a Gene Family Encoding SEA (Sea-urchin Sperm Protein, Enterokinase and Agrin)-Domain Proteins with Lectin-Like and Heme-Binding Properties from Schistosoma japonicum

    Science.gov (United States)

    Mbanefo, Evaristus Chibunna; Kikuchi, Mihoko; Huy, Nguyen Tien; Shuaibu, Mohammed Nasir; Cherif, Mahamoud Sama; Yu, Chuanxin; Wakao, Masahiro; Suda, Yasuo; Hirayama, Kenji

    2014-01-01

    Background We previously identified a novel gene family dispersed in the genome of Schistosoma japonicum by retrotransposon-mediated gene duplication mechanism. Although many transcripts were identified, no homolog was readily identifiable from sequence information. Methodology/Principal Findings Here, we utilized structural homology modeling and biochemical methods to identify remote homologs, and characterized the gene products as SEA (sea-urchin sperm protein, enterokinase and agrin)-domain containing proteins. A common extracellular domain in this family was structurally similar to SEA-domain. SEA-domain is primarily a structural domain, known to assist or regulate binding to glycans. Recombinant proteins from three members of this gene family specifically interacted with glycosaminoglycans with high affinity, with potential implication in ligand acquisition and immune evasion. Similar approach was used to identify a heme-binding site on the SEA-domain. The heme-binding mode showed heme molecule inserted into a hydrophobic pocket, with heme iron putatively coordinated to two histidine axial ligands. Heme-binding properties were confirmed using biochemical assays and UV-visible absorption spectroscopy, which showed high affinity heme-binding (K D = 1.605×10−6 M) and cognate spectroscopic attributes of hexa-coordinated heme iron. The native proteins were oligomers, antigenic, and are localized on adult worm teguments and gastrodermis; major host-parasite interfaces and site for heme detoxification and acquisition. Conclusions The results suggest potential role, at least in the nucleation step of heme crystallization (hemozoin formation), and as receptors for heme uptake. Survival strategies exploited by parasites, including heme homeostasis mechanism in hemoparasites, are paramount for successful parasitism. Thus, assessing prospects for application in disease intervention is warranted. PMID:24416467

  8. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  9. Interaction of a plant pseudo-response regulator with a calmodulin-like protein

    International Nuclear Information System (INIS)

    Perochon, Alexandre; Dieterle, Stefan; Pouzet, Cecile; Aldon, Didier; Galaud, Jean-Philippe; Ranty, Benoit

    2010-01-01

    Research highlights: → The pseudo-response regulator PRR2 specifically binds CML9, a calmodulin-like protein → The interaction is confirmed in plant cell nuclei → The interaction requires an intact PRR2 protein. -- Abstract: Calmodulin (CaM) plays a crucial role in the regulation of diverse cellular processes by modulating the activities of numerous target proteins. Plants possess an extended CaM family including numerous CaM-like proteins (CMLs), most of which appear to be unique to plants. We previously demonstrated a role for CML9 in abiotic stress tolerance and seed germination in Arabidopsis thaliana. We report here the isolation of PRR2, a pseudo-response regulator as a CML9 interacting protein by screening an expression library prepared from Arabidopsis seedlings with CML9 as bait in a yeast two-hybrid system. PRR2 is similar to the response regulators of the two-component system, but lacks the invariant residue required for phosphorylation by which response regulators switch their output response, suggesting the existence of alternative regulatory mechanisms. PRR2 was found to bind CML9 and closely related CMLs but not a canonical CaM. Mapping analyses indicate that an almost complete form of PRR2 is required for interaction with CML9, suggesting a recognition mode different from the classical CaM-target peptide complex. PRR2 contains several features that are typical of transcription factors, including a GARP DNA recognition domain, a Pro-rich region and a Golden C-terminal box. PRR2 and CML9 as fusion proteins with fluorescent tags co-localized in the nucleus of plant cells, and their interaction in the nuclear compartment was validated in planta by using a fluorophore-tagged protein interaction assay. These findings suggest that binding of PRR2 to CML9 may be an important mechanism to modulate the physiological role of this transcription factor in plants.

  10. Interaction of a plant pseudo-response regulator with a calmodulin-like protein

    Energy Technology Data Exchange (ETDEWEB)

    Perochon, Alexandre; Dieterle, Stefan; Pouzet, Cecile; Aldon, Didier; Galaud, Jean-Philippe [UMR 5546 CNRS/Universite Toulouse 3, Pole de Biotechnologie vegetale, BP 42617 Auzeville, 31326 Castanet-Tolosan cedex (France); Ranty, Benoit, E-mail: ranty@scsv.ups-tlse.fr [UMR 5546 CNRS/Universite Toulouse 3, Pole de Biotechnologie vegetale, BP 42617 Auzeville, 31326 Castanet-Tolosan cedex (France)

    2010-08-06

    Research highlights: {yields} The pseudo-response regulator PRR2 specifically binds CML9, a calmodulin-like protein {yields} The interaction is confirmed in plant cell nuclei {yields} The interaction requires an intact PRR2 protein. -- Abstract: Calmodulin (CaM) plays a crucial role in the regulation of diverse cellular processes by modulating the activities of numerous target proteins. Plants possess an extended CaM family including numerous CaM-like proteins (CMLs), most of which appear to be unique to plants. We previously demonstrated a role for CML9 in abiotic stress tolerance and seed germination in Arabidopsis thaliana. We report here the isolation of PRR2, a pseudo-response regulator as a CML9 interacting protein by screening an expression library prepared from Arabidopsis seedlings with CML9 as bait in a yeast two-hybrid system. PRR2 is similar to the response regulators of the two-component system, but lacks the invariant residue required for phosphorylation by which response regulators switch their output response, suggesting the existence of alternative regulatory mechanisms. PRR2 was found to bind CML9 and closely related CMLs but not a canonical CaM. Mapping analyses indicate that an almost complete form of PRR2 is required for interaction with CML9, suggesting a recognition mode different from the classical CaM-target peptide complex. PRR2 contains several features that are typical of transcription factors, including a GARP DNA recognition domain, a Pro-rich region and a Golden C-terminal box. PRR2 and CML9 as fusion proteins with fluorescent tags co-localized in the nucleus of plant cells, and their interaction in the nuclear compartment was validated in planta by using a fluorophore-tagged protein interaction assay. These findings suggest that binding of PRR2 to CML9 may be an important mechanism to modulate the physiological role of this transcription factor in plants.

  11. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  12. Tau-Induced Ca2+/Calmodulin-Dependent Protein Kinase-IV Activation Aggravates Nuclear Tau Hyperphosphorylation.

    Science.gov (United States)

    Wei, Yu-Ping; Ye, Jin-Wang; Wang, Xiong; Zhu, Li-Ping; Hu, Qing-Hua; Wang, Qun; Ke, Dan; Tian, Qing; Wang, Jian-Zhi

    2018-04-01

    Hyperphosphorylated tau is the major protein component of neurofibrillary tangles in the brains of patients with Alzheimer's disease (AD). However, the mechanism underlying tau hyperphosphorylation is not fully understood. Here, we demonstrated that exogenously expressed wild-type human tau40 was detectable in the phosphorylated form at multiple AD-associated sites in cytoplasmic and nuclear fractions from HEK293 cells. Among these sites, tau phosphorylated at Thr205 and Ser214 was almost exclusively found in the nuclear fraction at the conditions used in the present study. With the intracellular tau accumulation, the Ca 2+ concentration was significantly increased in both cytoplasmic and nuclear fractions. Further studies using site-specific mutagenesis and pharmacological treatment demonstrated that phosphorylation of tau at Thr205 increased nuclear Ca 2+ concentration with a simultaneous increase in the phosphorylation of Ca 2+ /calmodulin-dependent protein kinase IV (CaMKIV) at Ser196. On the other hand, phosphorylation of tau at Ser214 did not significantly change the nuclear Ca 2+ /CaMKIV signaling. Finally, expressing calmodulin-binding protein-4 that disrupts formation of the Ca 2+ /calmodulin complex abolished the okadaic acid-induced tau hyperphosphorylation in the nuclear fraction. We conclude that the intracellular accumulation of phosphorylated tau, as detected in the brains of AD patients, can trigger nuclear Ca 2+ /CaMKIV signaling, which in turn aggravates tau hyperphosphorylation. Our findings provide new insights for tauopathies: hyperphosphorylation of intracellular tau and an increased Ca 2+ concentration may induce a self-perpetuating harmful loop to promote neurodegeneration.

  13. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  14. Cooperative binding mitigates the high-dose hook effect.

    Science.gov (United States)

    Roy, Ranjita Dutta; Rosenmund, Christian; Stefan, Melanie I

    2017-08-14

    The high-dose hook effect (also called prozone effect) refers to the observation that if a multivalent protein acts as a linker between two parts of a protein complex, then increasing the amount of linker protein in the mixture does not always increase the amount of fully formed complex. On the contrary, at a high enough concentration range the amount of fully formed complex actually decreases. It has been observed that allosterically regulated proteins seem less susceptible to this effect. The aim of this study was two-fold: First, to investigate the mathematical basis of how allostery mitigates the prozone effect. And second, to explore the consequences of allostery and the high-dose hook effect using the example of calmodulin, a calcium-sensing protein that regulates the switch between long-term potentiation and long-term depression in neurons. We use a combinatorial model of a "perfect linker protein" (with infinite binding affinity) to mathematically describe the hook effect and its behaviour under allosteric conditions. We show that allosteric regulation does indeed mitigate the high-dose hook effect. We then turn to calmodulin as a real-life example of an allosteric protein. Using kinetic simulations, we show that calmodulin is indeed subject to a hook effect. We also show that this effect is stronger in the presence of the allosteric activator Ca 2+ /calmodulin-dependent kinase II (CaMKII), because it reduces the overall cooperativity of the calcium-calmodulin system. It follows that, surprisingly, there are conditions where increased amounts of allosteric activator actually decrease the activity of a protein. We show that cooperative binding can indeed act as a protective mechanism against the hook effect. This will have implications in vivo where the extent of cooperativity of a protein can be modulated, for instance, by allosteric activators or inhibitors. This can result in counterintuitive effects of decreased activity with increased concentrations of

  15. Update of the human secretoglobin (SCGB gene superfamily and an example of 'evolutionary bloom' of androgen-binding protein genes within the mouse Scgb gene superfamily

    Directory of Open Access Journals (Sweden)

    Jackson Brian C

    2011-10-01

    Full Text Available Abstract The secretoglobins (SCGBs comprise a family of small, secreted proteins found in animals exclusively of mammalian lineage. There are 11 human SCGB genes and five pseudogenes. Interestingly, mice have 68 Scgb genes, four of which are highly orthologous to human SCGB genes; the remainder represent an 'evolutionary bloom' and make up a large gene family represented by only six counterparts in humans. SCGBs are found in high concentrations in many mammalian secretions, including fluids of the lung, lacrimal gland, salivary gland, prostate and uterus. Whereas the biological activities of most individual SCGBs have not been fully characterised, what already has been discovered suggests that this family has an important role in the modulation of inflammation, tissue repair and tumorigenesis. In mice, the large Scgb1b and Scgb2b gene families encode the androgen-binding proteins, which have been shown to play a role in mate selection. Although much has been learned about SCGBs in recent years, clearly more research remains to be done to allow a better understanding of the roles of these proteins in human health and disease. Such information is predicted to reveal valuable novel drug targets for the treatment of inflammation, as well as designing biomarkers that might identify tissue damage or cancer.

  16. Mapping to mouse chromosome 3 of the gene encoding latexin (Lxn) expressed in neocortical neurons in a region-specific manner

    Energy Technology Data Exchange (ETDEWEB)

    Jin, Ming-hao; Uratani, Yoshihiko; Arimatsu, Yasuyoshi [Mitsubishi Kasei Institute of Life Sciences, Tokyo (Japan)

    1997-02-01

    Latexin was first found as a 29-kDa antigen expressed in a subset of neurons in infragranular layers of lateral, but not dorsal, neocortical areas in the rat using a monoclonal antibody PC3.1. It was found that the vast majority of latexin-expressing neurons in both layers V and VI within the lateral neocortex were generated concurrently at Embryonic Day 15, demonstrating a strict correlation between the molecular identity of neurons and the time of their generation. Since neurons expressing latexin are located in the restricted part of the neocortex, latexin has been used as a useful molecular marker to elucidate the mechanism underlying cortical regional specification. The latexin cDNA isolated from a cDNA library of the rat cerebral cortex encodes a protein composed of 223-amino-acid residues containing two potential Ca{sup 2+}/calmodulin-dependent protein kinase sites and one cGMP-dependent protein kinase phosphorylation site. The absence of any signal peptide or potential transmembrane domain is consistent with the apparent cytosolic localization of latexin in the rat brain. The transcripts of latexin were expressed in not only neutral but also nonneural tissues (e.g., lung, spleen, kidney, heart, and digestive tracts). Recently, it has been demonstrated that latexin purified from the rat brain has inhibitory activity against carboxypeptidase A1, carboxypeptidase A2, and mast cell carboxypeptidase A, with less carboxypeptidase B-inhibiting activity. The amino acid sequence deduced from the rat latexin cDNA has no strict homology to any sequences so far known. Genomic Southern blot analysis using a cDNA probe of rat latexin suggested that the gene encoding latexin in the rat has homologues in other mammalian species and in the chicken, but not in the nematode, fly, or frog. 9 refs., 1 fig.

  17. Genetic and biochemical identification of a novel single-stranded DNA binding complex in Haloferax volcanii

    Directory of Open Access Journals (Sweden)

    Amy eStroud

    2012-06-01

    Full Text Available Single-stranded DNA binding proteins play an essential role in DNA replication and repair. They use oligosaccharide-binding folds, a five-stranded ß-sheet coiled into a closed barrel, to bind to single-stranded DNA thereby protecting and stabilizing the DNA. In eukaryotes the single-stranded DNA binding protein is known as replication protein A (RPA and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed single-stranded DNA-binding protein (SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3 exist in operons with a novel gene specific to Euryarchaeota, this gene encodes a protein that we have termed rpa-associated protein (RPAP. The rpap genes encode proteins belonging to COG3390 group and feature oligosaccharide-binding folds, suggesting that they might cooperate with RPA in binding to single-stranded DNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only ∆rpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins. We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA binding complex that is unique to Euryarchaeota.

  18. CC1, a novel crenarchaeal DNA binding protein.

    Science.gov (United States)

    Luo, Xiao; Schwarz-Linek, Uli; Botting, Catherine H; Hensel, Reinhard; Siebers, Bettina; White, Malcolm F

    2007-01-01

    The genomes of the related crenarchaea Pyrobaculum aerophilum and Thermoproteus tenax lack any obvious gene encoding a single-stranded DNA binding protein (SSB). SSBs are essential for DNA replication, recombination, and repair and are found in all other genomes across the three domains of life. These two archaeal genomes also have only one identifiable gene encoding a chromatin protein (the Alba protein), while most other archaea have at least two different abundant chromatin proteins. We performed a biochemical screen for novel nucleic acid binding proteins present in cell extracts of T. tenax. An assay for proteins capable of binding to a single-stranded DNA oligonucleotide resulted in identification of three proteins. The first protein, Alba, has been shown previously to bind single-stranded DNA as well as duplex DNA. The two other proteins, which we designated CC1 (for crenarchaeal chromatin protein 1), are very closely related to one another, and homologs are restricted to the P. aerophilum and Aeropyrum pernix genomes. CC1 is a 6-kDa, monomeric, basic protein that is expressed at a high level in T. tenax. This protein binds single- and double-stranded DNAs with similar affinities. These properties are consistent with a role for CC1 as a crenarchaeal chromatin protein.

  19. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  20. Neighboring genes for DNA-binding proteins rescue male sterility in Drosophila hybrids.

    Science.gov (United States)

    Liénard, Marjorie A; Araripe, Luciana O; Hartl, Daniel L

    2016-07-19

    Crosses between closely related animal species often result in male hybrids that are sterile, and the molecular and functional basis of genetic factors for hybrid male sterility is of great interest. Here, we report a molecular and functional analysis of HMS1, a region of 9.2 kb in chromosome 3 of Drosophila mauritiana, which results in virtually complete hybrid male sterility when homozygous in the genetic background of sibling species Drosophila simulans. The HMS1 region contains two strong candidate genes for the genetic incompatibility, agt and Taf1 Both encode unrelated DNA-binding proteins, agt for an alkyl-cysteine-S-alkyltransferase and Taf1 for a subunit of transcription factor TFIID that serves as a multifunctional transcriptional regulator. The contribution of each gene to hybrid male sterility was assessed by means of germ-line transformation, with constructs containing complete agt and Taf1 genomic sequences as well as various chimeric constructs. Both agt and Taf1 contribute about equally to HMS1 hybrid male sterility. Transgenes containing either locus rescue sterility in about one-half of the males, and among fertile males the number of offspring is in the normal range. This finding suggests compensatory proliferation of the rescued, nondysfunctional germ cells. Results with chimeric transgenes imply that the hybrid incompatibilities result from interactions among nucleotide differences residing along both agt and Taf1 Our results challenge a number of preliminary generalizations about the molecular and functional basis of hybrid male sterility, and strongly reinforce the role of DNA-binding proteins as a class of genes contributing to the maintenance of postzygotic reproductive isolation.

  1. Visually Relating Gene Expression and in vivo DNA Binding Data

    Energy Technology Data Exchange (ETDEWEB)

    Huang, Min-Yu; Mackey, Lester; Ker?,; nen, Soile V. E.; Weber, Gunther H.; Jordan, Michael I.; Knowles, David W.; Biggin, Mark D.; Hamann, Bernd

    2011-09-20

    Gene expression and in vivo DNA binding data provide important information for understanding gene regulatory networks: in vivo DNA binding data indicate genomic regions where transcription factors are bound, and expression data show the output resulting from this binding. Thus, there must be functional relationships between these two types of data. While visualization and data analysis tools exist for each data type alone, there is a lack of tools that can easily explore the relationship between them. We propose an approach that uses the average expression driven by multiple of ciscontrol regions to visually relate gene expression and in vivo DNA binding data. We demonstrate the utility of this tool with examples from the network controlling early Drosophila development. The results obtained support the idea that the level of occupancy of a transcription factor on DNA strongly determines the degree to which the factor regulates a target gene, and in some cases also controls whether the regulation is positive or negative.

  2. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  3. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  4. Data for the co-expression and purification of human recombinant CaMKK2 in complex with calmodulin in Escherichia coli

    Directory of Open Access Journals (Sweden)

    Lisa Gerner

    2016-09-01

    Full Text Available Calcium/calmodulin-dependent kinase kinase 2 (CaMKK2 has been implicated in a range of conditions and pathologies from prostate to hepatic cancer. Here, we describe the expression in Escherichia coli and the purification protocol for the following constructs: full-length CaMKK2 in complex with CaM, CaMKK2 ‘apo’, CaMKK2 (165-501 in complex with CaM, and the CaMKK2 F267G mutant. The protocols described have been optimized for maximum yield and purity with minimal purification steps required and the proteins subsequently used to develop a fluorescence-based assay for drug binding to the kinase, “Using the fluorescent properties of STO-609 as a tool to assist structure-function analyses of recombinant CaMKK2” [1]. Keywords: CaMKK2, Calmodulin, Fermentation

  5. Structural and thermodynamic studies of the tobacco calmodulin-like rgs-CaM protein.

    Science.gov (United States)

    Makiyama, Rodrigo K; Fernandes, Carlos A H; Dreyer, Thiago R; Moda, Bruno S; Matioli, Fabio F; Fontes, Marcos R M; Maia, Ivan G

    2016-11-01

    The tobacco calmodulin-like protein rgs-CaM is involved in host defense against virus and is reported to possess an associated RNA silencing suppressor activity. Rgs-CaM is also believed to act as an antiviral factor by interacting and targeting viral silencing suppressors for autophagic degradation. Despite these functional data, calcium interplay in the modulation of rgs-CaM is still poorly understood. Here we show that rgs-CaM displays a prevalent alpha-helical conformation and possesses three functional Ca 2+ -binding sites. Using computational modeling and molecular dynamics simulation, we demonstrate that Ca 2+ binding to rgs-CaM triggers expansion of its tertiary structure with reorientation of alpha-helices within the EF-hands. This conformational change leads to the exposure of a large negatively charged region that may be implicated in the electrostatic interactions between rgs-CaM and viral suppressors. Moreover, the k d values obtained for Ca 2+ binding to the three functional sites are not within the affinity range of a typical Ca 2+ sensor. Copyright © 2016 Elsevier B.V. All rights reserved.

  6. The Adsorption of Calmoduline via Nicotinamide Immobilized Poly(HEMA-GMA Cryogels

    Directory of Open Access Journals (Sweden)

    Kadir Erol

    2016-12-01

    Full Text Available The separation and purification methods for the isolation of an important biomolecule calmoduline protein is extremely important. Among these methods, the adsorption technique is extremely popular, and the cryogels as adsorbents with the macro porous structure and interconnected flow channels cryogel they have are preferred in this field. In this study, the adsorption of calmoduline via Ca(II immobilized poly (2-hydroxyethyl methacrylate-glycidyl methacrylate, poly (HEMA-GMA, cryogels through changing interaction time, calmoduline initial concentration and temperature conditions. For the characterization of cryogels, the swelling test, Fourier Transform Infrared (FT-IR Spectroscopy, Scanning Electron Microscopy (SEM, surface area (BET, elemental analysis and ICP-OES methods were performed. Nicotinamide molecule was used as Ca (II chelating agent and the adsorption capacity of the cryogels was estimated as 1.812 mg calmoduline / g cryogel. The adsorption models of the adsorption reaction were examined by the Langmuir and Freundlich isotherm models and was determined to be more appropriate for Langmuir isotherm model.

  7. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  8. Identification of a mammalian nuclear factor and human cDNA-encoded proteins that recognize DNA containing apurinic sites

    International Nuclear Information System (INIS)

    Lenz, J.; Okenquist, S.A.; LoSardo, J.E.; Hamilton, K.K.; Doetsch, P.W.

    1990-01-01

    Damage to DNA can have lethal or mutagenic consequences for cells unless it is detected and repaired by cellular proteins. Repair depends on the ability of cellular factors to distinguish the damaged sites. Electrophoretic binding assays were used to identify a factor from the nuclei of mammalian cells that bound to DNA containing apurinic sites. A binding assay based on the use of β-galactosidase fusion proteins was subsequently used to isolate recombinant clones of human cDNAs that encoded apurinic DNA-binding proteins. Two distinct human cDNAs were identified that encoded proteins that bound apurinic DNA preferentially over undamaged, methylated, or UV-irradiated DNA. These approaches may offer a general method for the detection of proteins that recognize various types of DNA damage and for the cloning of genes encoding such proteins

  9. Calmodulin-activated cyclic nucleotide phosphodiesterase from brain. Relationship of subunit structure to activity assessed by radiation inactivation

    International Nuclear Information System (INIS)

    Kincaid, R.L.; Kemdner, E.; Manganiello, V.C.; Osborne, J.C.; Vaughan, M.

    1981-01-01

    The apparent target sizes of the basal and calmodulin-dependent activities of calmodulin-activated phosphodiesterase from bovine brain were estimated using target theory analysis of data from radiation inactivation experiments. Whether crude or highly purified samples were irradiated, the following results were obtained. Low doses of radiation caused a 10 to 15% increase in basal activity, which, with further irradiation, decayed with an apparent target size of approx.60,000 daltons. Calmodulin-dependent activity decayed with an apparent target size of approx.105,000 daltons. The percentage stimulation of enzyme activity by calmodulin decreased markedly as a function of radiation dosage. These observations are consistent with results predicted by computer-assisted modeling based on the assumptions that: 1) the calmodulin-activated phosphodiesterase exists as a mixture of monomers which are fully active in the absence of calmodulin and dimers which are inactive in the absence of calmodulin; 2) in the presence of calmodulin, a dimer exhibits activity equal to that of two monomers; 3) on radiation destruction of a dimer, an active monomer is generated. This monomer-dimer hypothesis provides a plausible explanation for and definition of basal and calmodulin-dependent phosphodiesterase activity

  10. Characterization of the dextran-binding domain in the glucan-binding protein C of Streptococcus mutans.

    Science.gov (United States)

    Takashima, Y; Fujita, K; Ardin, A C; Nagayama, K; Nomura, R; Nakano, K; Matsumoto-Nakano, M

    2015-10-01

    Streptococcus mutans produces multiple glucan-binding proteins (Gbps), among which GbpC encoded by the gbpC gene is known to be a cell-surface-associated protein involved in dextran-induced aggregation. The purpose of the present study was to characterize the dextran-binding domain of GbpC using bioinformatics analysis and molecular techniques. Bioinformatics analysis specified five possible regions containing molecular binding sites termed GB1 through GB5. Next, truncated recombinant GbpC (rGbpC) encoding each region was produced using a protein expression vector and five deletion mutant strains were generated, termed CDGB1 through CDGB5 respectively. The dextran-binding rates of truncated rGbpC that included the GB1, GB3, GB4 and GB5 regions in the upstream sequences were higher than that of the construct containing GB2 in the downstream region. In addition, the rates of dextran-binding for strains CDGB4 and CD1, which was entire gbpC deletion mutant, were significantly lower than for the other strains, while those of all other deletion mutants were quite similar to that of the parental strain MT8148. Biofilm structures formed by CDGB4 and CD1 were not as pronounced as that of MT8148, while those formed by other strains had greater density as compared to that of CD1. Our results suggest that the dextran-binding domain may be located in the GB4 region in the interior of the gbpC gene. Bioinformatics analysis is useful for determination of functional domains in many bacterial species. © 2015 The Society for Applied Microbiology.

  11. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    OpenAIRE

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-01-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, bu...

  12. Genome-wide identification, sequence characterization, and protein-protein interaction properties of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat family members in Solanum lycopersicum.

    Science.gov (United States)

    Zhu, Yunye; Huang, Shengxiong; Miao, Min; Tang, Xiaofeng; Yue, Junyang; Wang, Wenjie; Liu, Yongsheng

    2015-06-01

    One hundred DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family genes were identified in the S. lycopersicum genome. The DWD genes encode proteins presumably functioning as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. These findings provide candidate genes and a research platform for further gene functionality and molecular breeding study. A subclass of DDB1 (damaged DNA binding protein-1)-binding WD40-repeat domain (DWD) family proteins has been demonstrated to function as the substrate recognition subunits of the cullin4-ring ubiquitin E3 ligase complex. However, little information is available about the cognate subfamily genes in tomato (S. lycopersicum). In this study, based on the recently released tomato genome sequences, 100 tomato genes encoding DWD proteins that potentially interact with DDB1 were identified and characterized, including analyses of the detailed annotations, chromosome locations and compositions of conserved amino acid domains. In addition, a phylogenetic tree, which comprises of three main groups, of the subfamily genes was constructed. The physical interaction between tomato DDB1 and 14 representative DWD proteins was determined by yeast two-hybrid and co-immunoprecipitation assays. The subcellular localization of these 14 representative DWD proteins was determined. Six of them were localized in both nucleus and cytoplasm, seven proteins exclusively in cytoplasm, and one protein either in nucleus and cytoplasm, or exclusively in cytoplasm. Comparative genomic analysis demonstrated that the expansion of these subfamily members in tomato predominantly resulted from two whole-genome triplication events in the evolution history.

  13. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  14. Mapping the Binding Site for Escitalopram and Paroxetine in the Human Serotonin Transporter Using Genetically Encoded Photo-Cross-Linkers

    DEFF Research Database (Denmark)

    Rannversson, Hafsteinn; Andersen, Jacob; Bang-Andersen, Benny

    2017-01-01

    amber codon suppression in hSERT to encode the photo-cross-linking unnatural amino acid p-azido-l-phenylalanine into the suggested high- and low-affinity binding sites. We then employ UV-induced cross-linking with azF to map the binding site of escitalopram and paroxetine, two prototypical selective...... serotonin reuptake inhibitors (SSRIs). We find that the two antidepressant drugs exclusively cross-link to azF incorporated at the high-affinity binding site of hSERT, while cross-linking is not observed at the low-affinity binding site. Combined with previous homology models and recent structural data on h...

  15. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  16. Prevention of adverse events of interferon γ gene therapy by gene delivery of interferon γ-heparin-binding domain fusion protein in mice

    Directory of Open Access Journals (Sweden)

    Mitsuru Ando

    2014-01-01

    Full Text Available Sustained gene delivery of interferon (IFN γ can be an effective treatment, but our previous study showed high levels of IFNγ-induced adverse events, including the loss of body weight. These unwanted events could be reduced by target-specific delivery of IFNγ after in vivo gene transfer. To achieve this, we selected the heparin-binding domain (HBD of extracellular superoxide dismutase as a molecule to anchor IFNγ to the cell surface. We designed three IFNγ derivatives, IFNγ-HBD1, IFNγ-HBD2, and IFNγ-HBD3, each of which had 1, 2, or 3 HBDs, respectively. Each plasmid-encoding fusion proteins was delivered to the liver, a model target in this study, by hydrodynamic tail vein injection. The serum concentration of IFNγ-HBD2 and IFNγ-HBD3 after gene delivery was lower than that of IFNγ or IFNγ-HBD1. Gene delivery of IFNγ-HBD2, but not of IFNγ-HBD3, effectively increased the mRNA expression of IFNγ-inducible genes in the liver, suggesting liver-specific distribution of IFNγ-HBD2. Gene delivery of IFNγ-HBD2-suppressed tumor growth in the liver as efficiently as that of IFNγ with much less symptoms of adverse effects. These results indicate that the adverse events of IFNγ gene transfer can be prevented by gene delivery of IFNγ-HBD2, a fusion protein with high cell surface affinity.

  17. Targeting cell migration and the endoplasmic reticulum stress response with calmodulin antagonists: a clinically tested small molecule phenocopy of SEC62 gene silencing in human tumor cells

    International Nuclear Information System (INIS)

    Linxweiler, Maximilian; Greiner, Markus; Schorr, Stefan; Schäuble, Nico; Jung, Martin; Linxweiler, Johannes; Langer, Frank; Schäfers, Hans-Joachim; Cavalié, Adolfo; Zimmermann, Richard

    2013-01-01

    Tumor cells benefit from their ability to avoid apoptosis and invade other tissues. The endoplasmic reticulum (ER) membrane protein Sec62 is a key player in these processes. Sec62 is essential for cell migration and protects tumor cells against thapsigargin-induced ER stress, which are both linked to cytosolic Ca 2+ . SEC62 silencing leads to elevated cytosolic Ca 2+ and increased ER Ca 2+ leakage after thapsigargin treatment. Sec62 protein levels are significantly increased in different tumors, including prostate, lung and thyroid cancer. In lung cancer, the influence of Sec62 protein levels on patient survival was analyzed using the Kaplan-Meier method and log-rank test. To elucidate the underlying pathophysiological functions of Sec62, Ca 2+ imaging techniques, real-time cell analysis and cell migration assays were performed. The effects of treatment with the calmodulin antagonists, trifluoperazine (TFP) and ophiobolin A, on cellular Ca 2+ homeostasis, cell growth and cell migration were compared with the effects of siRNA-mediated Sec62 depletion or the expression of a mutated SEC62 variant in vitro. Using Biacore analysis we examined the Ca 2+ -sensitive interaction of Sec62 with the Sec61 complex. Sec62 overproduction significantly correlated with reduced patient survival. Therefore, Sec62 is not only a predictive marker for this type of tumor, but also an interesting therapeutic target. The present study suggests a regulatory function for Sec62 in the major Ca 2+ leakage channel in the ER, Sec61, by a direct and Ca 2+ -sensitive interaction. A Ca 2+ -binding motif in Sec62 is essential for its molecular function. Treatment of cells with calmodulin antagonists mimicked Sec62 depletion by inhibiting cell migration and rendering the cells sensitive to thapsigargin treatment. Targeting tumors that overproduce Sec62 with calmodulin antagonists in combination with targeted thapsigargin analogues may offer novel personalized therapeutic options

  18. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  19. Cortisol-binding globulin and meat quality in five European lines of pigs

    NARCIS (Netherlands)

    Geverink, N.A.; Foury, A.; Plastow, G.S.; Gil, L.; Gispert, M.; Hortós, M.; Font I Furnols, M.; Gort, G.; Moisan, M.P.; Mormède, P.

    2006-01-01

    The gene (Cbg) encoding cortisol-binding globulin (CBG) has been proposed as a candidate gene to explain genetic variation in cortisol secretion and carcass composition in pigs. The objective of this study was to evaluate the association between CBG and pork quality in 5 European breeding lines,

  20. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  1. Characterization of TRZ1, a yeast homolog of the human candidate prostate cancer susceptibility gene ELAC2 encoding tRNase Z

    Directory of Open Access Journals (Sweden)

    Chen Yuan

    2005-05-01

    Full Text Available Abstract Background In humans, mutation of ELAC2 is associated with an increased risk of prostate cancer. ELAC2 has been shown to have tRNase Z activity and is associated with the γ-tubulin complex. Results In this work, we show that the yeast homolog of ELAC2, encoded by TRZ1 (tRNase Z 1, is involved genetically in RNA processing. The temperature sensitivity of a trz1 mutant can be rescued by multiple copies of REX2, which encodes a protein with RNA 3' processing activity, suggesting a role of Trz1p in RNA processing in vivo. Trz1p has two putative nucleotide triphosphate-binding motifs (P-loop and a conserved histidine motif. The histidine motif and the putative nucleotide binding motif at the C-domain are important for Trz1p function because mutant proteins bearing changes to the critical residues in these motifs are unable to rescue deletion of TRZ1. The growth defect exhibited by trz1 yeast is not complemented by the heterologous ELAC2, suggesting that Trz1p may have additional functions in yeast. Conclusion Our results provide genetic evidence that prostate cancer susceptibility gene ELAC2 may be involved in RNA processing, especially rRNA processing and mitochondrial function.

  2. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  3. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  4. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  5. Identification of Plagl1/Zac1 binding sites and target genes establishes its role in the regulation of extracellular matrix genes and the imprinted gene network.

    Science.gov (United States)

    Varrault, Annie; Dantec, Christelle; Le Digarcher, Anne; Chotard, Laëtitia; Bilanges, Benoit; Parrinello, Hugues; Dubois, Emeric; Rialle, Stéphanie; Severac, Dany; Bouschet, Tristan; Journot, Laurent

    2017-10-13

    PLAGL1/ZAC1 undergoes parental genomic imprinting, is paternally expressed, and is a member of the imprinted gene network (IGN). It encodes a zinc finger transcription factor with anti-proliferative activity and is a candidate tumor suppressor gene on 6q24 whose expression is frequently lost in various neoplasms. Conversely, gain of PLAGL1 function is responsible for transient neonatal diabetes mellitus, a rare genetic disease that results from defective pancreas development. In the present work, we showed that Plagl1 up-regulation was not associated with DNA damage-induced cell cycle arrest. It was rather associated with physiological cell cycle exit that occurred with contact inhibition, growth factor withdrawal, or cell differentiation. To gain insights into Plagl1 mechanism of action, we identified Plagl1 target genes by combining chromatin immunoprecipitation and genome-wide transcriptomics in transfected cell lines. Plagl1-elicited gene regulation correlated with multiple binding to the proximal promoter region through a GC-rich motif. Plagl1 target genes included numerous genes involved in signaling, cell adhesion, and extracellular matrix composition, including collagens. Plagl1 targets also included 22% of the 409 genes that make up the IGN. Altogether, this work identified Plagl1 as a transcription factor that coordinated the regulation of a subset of IGN genes and controlled extracellular matrix composition. © The Author(s) 2017. Published by Oxford University Press on behalf of Nucleic Acids Research.

  6. Neural correlates of binding lyrics and melodies for the encoding of new songs.

    Science.gov (United States)

    Alonso, Irene; Davachi, Lila; Valabrègue, Romain; Lambrecq, Virginie; Dupont, Sophie; Samson, Séverine

    2016-02-15

    Songs naturally bind lyrics and melody into a unified representation. Using a subsequent memory paradigm, we examined the neural processes associated with binding lyrics and melodies during song encoding. Participants were presented with songs in two conditions: a unified condition (melodies sung with lyrics), and a separate condition (melodies sung with the syllable "la"). In both cases, written lyrics were displayed and participants were instructed to memorize them by repeating them covertly or by generating mental images of the songs. We expected the unified condition to recruit the posterior superior temporal gyrus, known to be involved in perceptual integration of songs, as well as the left inferior frontal gyrus (IFG). Conversely, we hypothesized that the separate condition would engage a larger network including the hippocampus to bind lyrics and melodies of songs, and the basal ganglia and the cerebellum to ensure the correct sequence coupling of verbal and musical information in time. Binding lyrics and melodies in the unified condition revealed activation of the left IFG, bilateral middle temporal gyrus (MTG), and left motor cortex, suggesting a strong linguistic processing for this condition. Binding in the separate compared to the unified condition revealed greater activity in the right hippocampus as well as other areas including the left caudate, left cerebellum, and right IFG. This study provides novel evidence for the role of the right hippocampus in binding lyrics and melodies in songs. Results are discussed in light of studies of binding in the visual domain and highlight the role of regions involved in timing and synchronization such as the basal ganglia and the cerebellum. Copyright © 2015. Published by Elsevier Inc.

  7. Myosin Light Chain Kinase and the Role of Myosin Light Chain Phosphorylation in Skeletal Muscle

    OpenAIRE

    Stull, James T.; Kamm, Kristine E.; Vandenboom, Rene

    2011-01-01

    Skeletal muscle myosin light chain kinase (skMLCK) is a dedicated Ca2+/calmodulin-dependent serine-threonine protein kinase that phosphorylates the regulatory light chain (RLC) of sarcomeric myosin. It is expressed from the MYLK2 gene specifically in skeletal muscle fibers with most abundance in fast contracting muscles. Biochemically, activation occurs with Ca2+ binding to calmodulin forming a (Ca2+)4•calmodulin complex sufficient for activation with a diffusion limited, stoichiometic bindin...

  8. Isolation and characterization of major histocompatibility complex class IIB genes from the nurse shark.

    Science.gov (United States)

    Bartl, S; Weissman, I L

    1994-01-04

    The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse shark, Ginglymostoma cirratum. Two clones, most probably alleles, encode proteins which differ by 13 amino acids located in the putative antigen-binding cleft. The protein structure and the location of polymorphic residues are similar to their mammalian counterparts. Although these genes appear to encode a typical MHC protein, no T-cell-mediated responses have been demonstrated in cartilaginous fish. The nurse shark represents the most phylogenetically primitive organism in which both class IIA [Kasahara, M., Vazquez, M., Sato, K., McKinney, E.C. & Flajnik, M.F. (1992) Proc. Natl. Acad. Sci USA 89, 6688-6692] and class IIB genes, presumably encoding the alpha/beta heterodimer, have been isolated.

  9. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  10. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals.

    Science.gov (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C

    2008-02-12

    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  11. Effects of EGTA and antioxidants on the interaction of phenothiazine free radicals with calmodulin

    International Nuclear Information System (INIS)

    Prozialeck, W.C.

    1986-01-01

    Upon irradiation with UV light or treatment with horseradish peroxidase (HRP), phenothiazines generate free radicals that bind irreversibly to calmodulin (CaM). The purpose of the present studies was to examine the effects of the Ca 2+ -chelator EGTA and various antioxidants on the binding of these phenothiazine radicals to CaM. Solutions containing 2 μM CaM, 10 μM 3 H-chlorpromazine, 10 μM CaCl 2 , and either EGTA or the antioxidants (2mM), were irradiated with UV light or treated with HRP-H 2 O 2 . Samples were dialyzed to remove free chlorpromazine and counted for radioactivity. The antioxidants (ascorbic acid, dithiothreitol and glutathione) inhibited the HRP-induced irreversible binding by 95-100% but had little effect on the UV-induced binding. EGTA inhibited the HRP-induced binding by 100% but reduced the UV-induced binding by only 70%. The inhibition of the UV-induced binding by EGTA could be prevented by incubating the samples in the presence of excess Ca 2+ . By contrast, Ca 2+ did not prevent the inhibition of the HRP-induced binding by EGTA. These findings indicate that EGTA and antioxidants inhibit the HRP-induced irreversible binding of chlorpromazine to CaM by interacting with the chlorpromazine free radical and not by modifying CaM or chelating Ca 2+ . The fact that the UV-induced binding is resistant to inhibition by the antioxidants suggests that chlorpromazine binds to the Ca 2+ -CaM complex before photoactivation causes the formation of the free radical

  12. Antisense expression of a gene encoding a calcium-binding protein ...

    Indian Academy of Sciences (India)

    PRAKASH

    using the transgenic approach. The transformation of ... methods using EhCaBP or AtCaM3 gene-specific primers in ... acetone) was added, mixed and incubated for 15–18 h in the dark at .... as expected from the design of the AtCaM3 antisense construct .... Thus, there seems to be a positive qualitative correlation between ...

  13. Impact of recombination on polymorphism of genes encoding Kunitz-type protease inhibitors in the genus Solanum.

    Science.gov (United States)

    Speranskaya, Anna S; Krinitsina, Anastasia A; Kudryavtseva, Anna V; Poltronieri, Palmiro; Santino, Angelo; Oparina, Nina Y; Dmitriev, Alexey A; Belenikin, Maxim S; Guseva, Marina A; Shevelev, Alexei B

    2012-08-01

    The group of Kunitz-type protease inhibitors (KPI) from potato is encoded by a polymorphic family of multiple allelic and non-allelic genes. The previous explanations of the KPI variability were based on the hypothesis of random mutagenesis as a key factor of KPI polymorphism. KPI-A genes from the genomes of Solanum tuberosum cv. Istrinskii and the wild species Solanum palustre were amplified by PCR with subsequent cloning in plasmids. True KPI sequences were derived from comparison of the cloned copies. "Hot spots" of recombination in KPI genes were independently identified by DnaSP 4.0 and TOPALi v2.5 software. The KPI-A sequence from potato cv. Istrinskii was found to be 100% identical to the gene from Solanum nigrum. This fact illustrates a high degree of similarity of KPI genes in the genus Solanum. Pairwise comparison of KPI A and B genes unambiguously showed a non-uniform extent of polymorphism at different nt positions. Moreover, the occurrence of substitutions was not random along the strand. Taken together, these facts contradict the traditional hypothesis of random mutagenesis as a principal source of KPI gene polymorphism. The experimentally found mosaic structure of KPI genes in both plants studied is consistent with the hypothesis suggesting recombination of ancestral genes. The same mechanism was proposed earlier for other resistance-conferring genes in the nightshade family (Solanaceae). Based on the data obtained, we searched for potential motifs of site-specific binding with plant DNA recombinases. During this work, we analyzed the sequencing data reported by the Potato Genome Sequencing Consortium (PGSC), 2011 and found considerable inconsistence of their data concerning the number, location, and orientation of KPI genes of groups A and B. The key role of recombination rather than random point mutagenesis in KPI polymorphism was demonstrated for the first time. Copyright © 2012 Elsevier Masson SAS. All rights reserved.

  14. Hydrogen peroxide homeostasis: activation of plant catalase by calcium/calmodulin

    Science.gov (United States)

    Yang, T.; Poovaiah, B. W.

    2002-01-01

    Environmental stimuli such as UV, pathogen attack, and gravity can induce rapid changes in hydrogen peroxide (H(2)O(2)) levels, leading to a variety of physiological responses in plants. Catalase, which is involved in the degradation of H(2)O(2) into water and oxygen, is the major H(2)O(2)-scavenging enzyme in all aerobic organisms. A close interaction exists between intracellular H(2)O(2) and cytosolic calcium in response to biotic and abiotic stresses. Studies indicate that an increase in cytosolic calcium boosts the generation of H(2)O(2). Here we report that calmodulin (CaM), a ubiquitous calcium-binding protein, binds to and activates some plant catalases in the presence of calcium, but calcium/CaM does not have any effect on bacterial, fungal, bovine, or human catalase. These results document that calcium/CaM can down-regulate H(2)O(2) levels in plants by stimulating the catalytic activity of plant catalase. Furthermore, these results provide evidence indicating that calcium has dual functions in regulating H(2)O(2) homeostasis, which in turn influences redox signaling in response to environmental signals in plants.

  15. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  16. Genome-wide identification, characterization and phylogenetic analysis of 50 catfish ATP-binding cassette (ABC) transporter genes.

    Science.gov (United States)

    Liu, Shikai; Li, Qi; Liu, Zhanjiang

    2013-01-01

    Although a large set of full-length transcripts was recently assembled in catfish, annotation of large gene families, especially those with duplications, is still a great challenge. Most often, complexities in annotation cause mis-identification and thereby much confusion in the scientific literature. As such, detailed phylogenetic analysis and/or orthology analysis are required for annotation of genes involved in gene families. The ATP-binding cassette (ABC) transporter gene superfamily is a large gene family that encodes membrane proteins that transport a diverse set of substrates across membranes, playing important roles in protecting organisms from diverse environment. In this work, we identified a set of 50 ABC transporters in catfish genome. Phylogenetic analysis allowed their identification and annotation into seven subfamilies, including 9 ABCA genes, 12 ABCB genes, 12 ABCC genes, 5 ABCD genes, 2 ABCE genes, 4 ABCF genes and 6 ABCG genes. Most ABC transporters are conserved among vertebrates, though cases of recent gene duplications and gene losses do exist. Gene duplications in catfish were found for ABCA1, ABCB3, ABCB6, ABCC5, ABCD3, ABCE1, ABCF2 and ABCG2. The whole set of catfish ABC transporters provide the essential genomic resources for future biochemical, toxicological and physiological studies of ABC drug efflux transporters. The establishment of orthologies should allow functional inferences with the information from model species, though the function of lineage-specific genes can be distinct because of specific living environment with different selection pressure.

  17. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  18. Genetic and Biochemical Identification of a Novel Single-Stranded DNA-Binding Complex in Haloferax volcanii.

    Science.gov (United States)

    Stroud, Amy; Liddell, Susan; Allers, Thorsten

    2012-01-01

    Single-stranded DNA (ssDNA)-binding proteins play an essential role in DNA replication and repair. They use oligonucleotide/oligosaccharide-binding (OB)-folds, a five-stranded β-sheet coiled into a closed barrel, to bind to ssDNA thereby protecting and stabilizing the DNA. In eukaryotes the ssDNA-binding protein (SSB) is known as replication protein A (RPA) and consists of three distinct subunits that function as a heterotrimer. The bacterial homolog is termed SSB and functions as a homotetramer. In the archaeon Haloferax volcanii there are three genes encoding homologs of RPA. Two of the rpa genes (rpa1 and rpa3) exist in operons with a novel gene specific to Euryarchaeota; this gene encodes a protein that we have termed RPA-associated protein (rpap). The rpap genes encode proteins belonging to COG3390 group and feature OB-folds, suggesting that they might cooperate with RPA in binding to ssDNA. Our genetic analysis showed that rpa1 and rpa3 deletion mutants have differing phenotypes; only Δrpa3 strains are hypersensitive to DNA damaging agents. Deletion of the rpa3-associated gene rpap3 led to similar levels of DNA damage sensitivity, as did deletion of the rpa3 operon, suggesting that RPA3 and RPAP3 function in the same pathway. Protein pull-downs involving recombinant hexahistidine-tagged RPAs showed that RPA3 co-purifies with RPAP3, and RPA1 co-purifies with RPAP1. This indicates that the RPAs interact only with their respective associated proteins; this was corroborated by the inability to construct rpa1 rpap3 and rpa3 rpap1 double mutants. This is the first report investigating the individual function of the archaeal COG3390 RPA-associated proteins (RPAPs). We have shown genetically and biochemically that the RPAPs interact with their respective RPAs, and have uncovered a novel single-stranded DNA-binding complex that is unique to Euryarchaeota.

  19. Calmodulin and calcium differentially regulate the neuronal Nav1.1 voltage-dependent sodium channel

    Energy Technology Data Exchange (ETDEWEB)

    Gaudioso, Christelle; Carlier, Edmond; Youssouf, Fahamoe [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Clare, Jeffrey J. [Eaton Pharma Consulting, Eaton Socon, Cambridgeshire PE19 8EF (United Kingdom); Debanne, Dominique [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France); Alcaraz, Gisele, E-mail: gisele.alcaraz@univmed.fr [INSERM U641, Institut Jean Roche, Marseille F-13344 (France); Universite de la Mediterranee, Faculte de Medecine Secteur Nord, IFR 11, Marseille F-13344 (France)

    2011-07-29

    Highlights: {yields} Both Ca{sup ++}-Calmodulin (CaM) and Ca{sup ++}-free CaM bind to the C-terminal region of Nav1.1. {yields} Ca{sup ++} and CaM have both opposite and convergent effects on I{sub Nav1.1}. {yields} Ca{sup ++}-CaM modulates I{sub Nav1.1} amplitude. {yields} CaM hyperpolarizes the voltage-dependence of activation, and increases the inactivation rate. {yields} Ca{sup ++} alone antagonizes CaM for both effects, and depolarizes the voltage-dependence of inactivation. -- Abstract: Mutations in the neuronal Nav1.1 voltage-gated sodium channel are responsible for mild to severe epileptic syndromes. The ubiquitous calcium sensor calmodulin (CaM) bound to rat brain Nav1.1 and to the human Nav1.1 channel expressed by a stably transfected HEK-293 cell line. The C-terminal region of the channel, as a fusion protein or in the yeast two-hybrid system, interacted with CaM via a consensus C-terminal motif, the IQ domain. Patch clamp experiments on HEK1.1 cells showed that CaM overexpression increased peak current in a calcium-dependent way. CaM had no effect on the voltage-dependence of fast inactivation, and accelerated the inactivation kinetics. Elevating Ca{sup ++} depolarized the voltage-dependence of fast inactivation and slowed down the fast inactivation kinetics, and for high concentrations this effect competed with the acceleration induced by CaM alone. Similarly, the depolarizing action of calcium antagonized the hyperpolarizing shift of the voltage-dependence of activation due to CaM overexpression. Fluorescence spectroscopy measurements suggested that Ca{sup ++} could bind the Nav1.1 C-terminal region with micromolar affinity.

  20. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  1. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  2. Promoter Engineering Reveals the Importance of Heptameric Direct Repeats for DNA Binding by Streptomyces Antibiotic Regulatory Protein-Large ATP-Binding Regulator of the LuxR Family (SARP-LAL) Regulators in Streptomyces natalensis.

    Science.gov (United States)

    Barreales, Eva G; Vicente, Cláudia M; de Pedro, Antonio; Santos-Aberturas, Javier; Aparicio, Jesús F

    2018-05-15

    The biosynthesis of small-size polyene macrolides is ultimately controlled by a couple of transcriptional regulators that act in a hierarchical way. A Streptomyces antibiotic regulatory protein-large ATP-binding regulator of the LuxR family (SARP-LAL) regulator binds the promoter of a PAS-LuxR regulator-encoding gene and activates its transcription, and in turn, the gene product of the latter activates transcription from various promoters of the polyene gene cluster directly. The primary operator of PimR, the archetype of SARP-LAL regulators, contains three heptameric direct repeats separated by four-nucleotide spacers, but the regulator can also bind a secondary operator with only two direct repeats separated by a 3-nucleotide spacer, both located in the promoter region of its unique target gene, pimM A similar arrangement of operators has been identified for PimR counterparts encoded by gene clusters for different antifungal secondary metabolites, including not only polyene macrolides but peptidyl nucleosides, phoslactomycins, or cycloheximide. Here, we used promoter engineering and quantitative transcriptional analyses to determine the contributions of the different heptameric repeats to transcriptional activation and final polyene production. Optimized promoters have thus been developed. Deletion studies and electrophoretic mobility assays were used for the definition of DNA-binding boxes formed by 22-nucleotide sequences comprising two conserved heptameric direct repeats separated by four-nucleotide less conserved spacers. The cooperative binding of PimR SARP appears to be the mechanism involved in the binding of regulator monomers to operators, and at least two protein monomers are required for efficient binding. IMPORTANCE Here, we have shown that a modulation of the production of the antifungal pimaricin in Streptomyces natalensis can be accomplished via promoter engineering of the PAS-LuxR transcriptional activator pimM The expression of this gene is

  3. Conservation of transcription factor binding events predicts gene expression across species

    Science.gov (United States)

    Hemberg, Martin; Kreiman, Gabriel

    2011-01-01

    Recent technological advances have made it possible to determine the genome-wide binding sites of transcription factors (TFs). Comparisons across species have suggested a relatively low degree of evolutionary conservation of experimentally defined TF binding events (TFBEs). Using binding data for six different TFs in hepatocytes and embryonic stem cells from human and mouse, we demonstrate that evolutionary conservation of TFBEs within orthologous proximal promoters is closely linked to function, defined as expression of the target genes. We show that (i) there is a significantly higher degree of conservation of TFBEs when the target gene is expressed in both species; (ii) there is increased conservation of binding events for groups of TFs compared to individual TFs; and (iii) conserved TFBEs have a greater impact on the expression of their target genes than non-conserved ones. These results link conservation of structural elements (TFBEs) to conservation of function (gene expression) and suggest a higher degree of functional conservation than implied by previous studies. PMID:21622661

  4. Role of calmodulin and calcineurin in regulating flagellar motility and wave polarity in Leishmania.

    Science.gov (United States)

    Mukhopadhyay, Aakash Gautam; Dey, Chinmoy Sankar

    2017-11-01

    We have previously reported the involvement of cyclic AMP in regulating flagellar waveforms in Leishmania. Here, we investigated the roles of calcium, calmodulin, and calcineurin in flagellar motility regulation in L. donovani. Using high-speed videomicroscopy, we show that calcium-independent calmodulin and calcineurin activity is necessary for motility in Leishmania. Inhibition of calmodulin and calcineurin induced ciliary beats interrupting flagellar beating in both live (in vivo) and ATP-reactivated (in vitro) parasites. Our results indicate that signaling mediated by calmodulin and calcineurin operates antagonistically to cAMP signaling in regulating the waveforms of Leishmania flagellum. These two pathways are possibly involved in maintaining the balance between the two waveforms, essential for responding to environmental cues, survival, and infectivity.

  5. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  6. The ACBP gene family in Rhodnius prolixus

    DEFF Research Database (Denmark)

    Majerowicz, David; Hannibal-Bach, Hans K; Castro, Rodolfo S C

    2016-01-01

    The acyl-CoA-binding proteins (ACBP) constitute a family of conserved proteins that bind acyl-CoA with high affinity and protect it from hydrolysis. Thus, ACBPs may have essential roles in basal cellular lipid metabolism. The genome of the insect Rhodnius prolixus encodes five ACBP genes similar...

  7. Discovery of a Potent Class of PI3Kα Inhibitors with Unique Binding Mode via Encoded Library Technology (ELT).

    Science.gov (United States)

    Yang, Hongfang; Medeiros, Patricia F; Raha, Kaushik; Elkins, Patricia; Lind, Kenneth E; Lehr, Ruth; Adams, Nicholas D; Burgess, Joelle L; Schmidt, Stanley J; Knight, Steven D; Auger, Kurt R; Schaber, Michael D; Franklin, G Joseph; Ding, Yun; DeLorey, Jennifer L; Centrella, Paolo A; Mataruse, Sibongile; Skinner, Steven R; Clark, Matthew A; Cuozzo, John W; Evindar, Ghotas

    2015-05-14

    In the search of PI3K p110α wild type and H1047R mutant selective small molecule leads, an encoded library technology (ELT) campaign against the desired target proteins was performed which led to the discovery of a selective chemotype for PI3K isoforms from a three-cycle DNA encoded library. An X-ray crystal structure of a representative inhibitor from this chemotype demonstrated a unique binding mode in the p110α protein.

  8. 1H-NMR studies on the interaction of calmodulin with melittin

    International Nuclear Information System (INIS)

    Seeholzer, S.H.; Cohn, M.; Wand, A.J.

    1986-01-01

    Melittin (Mel), a basic amphipathic peptide from bee venom binds to Ca ++ -calmodulin (CaM) with high affinity and competitively inhibits the activation of enzymes by CaM. The CaM:Mel complex is being studied as a model system for understanding the nature of CaM's interaction with other tight binding peptides and target enzymes. The authors report here some preliminary results. Gel filtration experiments have shown that CaM binds 2 Mels with high affinity at pH 6.5 in the absence of salt yet it binds only 1 Mel in the presence of 0.15 M KC1. Hence, electrostatic forces may dominate the binding of the second Mel. The titration of CaM with from 0 to 2 Mels/CaM was followed by 1 H-NMR spectroscopy. The major changes in chemical shift of CaM resonances occur upon binding of the first Mel. Relatively fewer and smaller effects attend binding of the second Mel. Titration of CaM with from 0 through 1 Mel/CaM shifts the relative proportion of the His107-H2 resonance from 8.07 to 7.92 ppm. These two resonances are in slow exchange, the titration is complete at 1 Mel/CaM, and pH titrations are planned to see if these data are consistent with a Mel-induced pK shift of 0.5 pH units. The trimethyllysine resonance is shifted from 3.104 to 3.092 ppm by Mel. The relative proportion of these slowly exchanging peaks continuously changes during the titration from 0 to 2 Mels/CaM, being about 50% of each at 1 Mel/CaM. Data regarding the assignment and structure of Mel in various model solvent systems will also be reported

  9. [Abnormal floral meristem development in transgenic tomato plants do not depend on the expression of genes encoding defense-related PR-proteins and antimicrobial peptides].

    Science.gov (United States)

    Khaliluev, M R; Chaban, I A; Kononenko, N V; Baranova, E N; Dolgov, S V; Kharchenko, P N; Poliakov, V Iu

    2014-01-01

    In this study, the morphological and cytoembryological analyses of the tomato plants transformed with the genes encoding chitin-binding proteins (ac and RS-intron-Shir) from Amaranthus caudatus L. andA. retroflexus L., respectively, as well as the gene amp2 encoding hevein-like antimicrobial peptides from Stellaria media L., have been performed. The transgenic lines were adapted to soil and grown the greenhouse. The analysis of putative transgenic tomato plants revealed several lines that did not differ phenotypically from the wild type plants and three lines with disruption in differentiation of the inflorescence shoot and the flower, as well as the fruit formation (modified plants of each line were transformed with a single gene as noted before). Abnormalities in the development of the generative organs were maintained for at least six vegetative generations. These transgenic plants were shown to be defective in the mail gametophyte formation, fertilization, and, consequently, led to parthenocarpic fruits. The detailed analysis of growing ovules in the abnormal transgenic plants showed that the replacement tissue was formed and proliferated instead of unfertilized embryo sac. The structure of the replacement tissue differed from both embryonic and endosperm tissue of the normal ovule. The formation of the replacement tissue occurred due to continuing proliferation of the endothelial cells that lost their ability for differentiation. The final step in the development of the replacement tissue was its death, which resulted in the cell lysis. The expression of the genes used was confirmed by RT-PCR in all three lines with abnormal phenotype, as well as in several lines that did not phenotypically differ from the untransformed control. This suggests that abnormalities in the organs of the generative sphere in the transgenic plants do not depend on the expression of the foreign genes that were introduced in the tomato genome. Here, we argue that agrobacterial

  10. Regulation of the alpha-glucuronidase-encoding gene (aguA) from Aspergillus niger

    NARCIS (Netherlands)

    Vries, de R.P.; Vondervoort, van de P.J.I.; Hendriks, L.; Belt, van de M.; Visser, J.

    2002-01-01

    The !-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR.

  11. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  12. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  13. A Synthetic Oligo Library and Sequencing Approach Reveals an Insulation Mechanism Encoded within Bacterial σ54 Promoters

    Directory of Open Access Journals (Sweden)

    Lior Levy

    2017-10-01

    Full Text Available We use an oligonucleotide library of >10,000 variants to identify an insulation mechanism encoded within a subset of σ54 promoters. Insulation manifests itself as reduced protein expression for a downstream gene that is expressed by transcriptional readthrough. It is strongly associated with the presence of short CT-rich motifs (3–5 bp, positioned within 25 bp upstream of the Shine-Dalgarno (SD motif of the silenced gene. We provide evidence that insulation is triggered by binding of the ribosome binding site (RBS to the upstream CT-rich motif. We also show that, in E. coli, insulator sequences are preferentially encoded within σ54 promoters, suggesting an important regulatory role for these sequences in natural contexts. Our findings imply that sequence-specific regulatory effects that are sparsely encoded by short motifs may not be easily detected by lower throughput studies. Such sequence-specific phenomena can be uncovered with a focused oligo library (OL design that mitigates sequence-related variance, as exemplified herein.

  14. Properties of the simian virus 40 (SV40) large T antigens encoded by SV40 mutants with deletions in gene A.

    Science.gov (United States)

    Cole, C N; Tornow, J; Clark, R; Tjian, R

    1986-01-01

    The biochemical properties of the large T antigens encoded by simian virus 40 (SV40) mutants with deletions at DdeI sites in the SV40 A gene were determined. Mutant large T antigens containing only the first 138 to 140 amino acids were unable to bind to the SV40 origin of DNA replication as were large T antigens containing at their COOH termini 96 or 97 amino acids encoded by the long open reading frame located between 0.22 and 0.165 map units (m.u.). All other mutant large T antigens were able to bind to the SV40 origin of replication. Mutants with in-phase deletions at 0.288 and 0.243 m.u. lacked ATPase activity, but ATPase activity was normal in mutants lacking origin-binding activity. The 627-amino acid large T antigen encoded by dlA2465, with a deletion at 0.219 m.u., was the smallest large T antigen displaying ATPase activity. Mutant large T antigens with the alternate 96- or 97-amino acid COOH terminus also lacked ATPase activity. All mutant large T antigens were found in the nuclei of infected cells; a small amount of large T with the alternate COOH terminus was also located in the cytoplasm. Mutant dlA2465 belonged to the same class of mutants as dlA2459. It was unable to form plaques on CV-1p cells at 37 or 32 degrees C but could form plaques on BSC-1 monolayers at 37 degrees C but not at 32 degrees C. It was positive for viral DNA replication and showed intracistronic complementation with any group A mutant whose large T antigen contained a normal carboxyl terminus. These findings and those of others suggest that both DNA binding and ATPase activity are required for the viral DNA replication function of large T antigen, that these two activities must be located on the same T antigen monomer, and that these two activities are performed by distinct domains of the polypeptide. These domains are distinct and separable from the domain affected by the mutation of dlA2465 and indicate that SV40 large T antigen is made up of at least three separate functional

  15. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  16. Computational analysis of a novel mutation in ETFDH gene highlights its long-range effects on the FAD-binding motif

    Directory of Open Access Journals (Sweden)

    Chang Jan-Gowth

    2011-10-01

    Full Text Available Abstract Background Multiple acyl-coenzyme A dehydrogenase deficiency (MADD is an autosomal recessive disease caused by the defects in the mitochondrial electron transfer system and the metabolism of fatty acids. Recently, mutations in electron transfer flavoprotein dehydrogenase (ETFDH gene, encoding electron transfer flavoprotein:ubiquinone oxidoreductase (ETF:QO have been reported to be the major causes of riboflavin-responsive MADD. To date, no studies have been performed to explore the functional impact of these mutations or their mechanism of disrupting enzyme activity. Results High resolution melting (HRM analysis and sequencing of the entire ETFDH gene revealed a novel mutation (p.Phe128Ser and the hotspot mutation (p.Ala84Thr from a patient with MADD. According to the predicted 3D structure of ETF:QO, the two mutations are located within the flavin adenine dinucleotide (FAD binding domain; however, the two residues do not have direct interactions with the FAD ligand. Using molecular dynamics (MD simulations and normal mode analysis (NMA, we found that the p.Ala84Thr and p.Phe128Ser mutations are most likely to alter the protein structure near the FAD binding site as well as disrupt the stability of the FAD binding required for the activation of ETF:QO. Intriguingly, NMA revealed that several reported disease-causing mutations in the ETF:QO protein show highly correlated motions with the FAD-binding site. Conclusions Based on the present findings, we conclude that the changes made to the amino acids in ETF:QO are likely to influence the FAD-binding stability.

  17. Genome-wide identification and tissue-specific expression analysis of nucleotide binding site-leucine rich repeat gene family in Cicer arietinum (kabuli chickpea).

    Science.gov (United States)

    Sharma, Ranu; Rawat, Vimal; Suresh, C G

    2017-12-01

    The nucleotide binding site-leucine rich repeat (NBS-LRR) proteins play an important role in the defense mechanisms against pathogens. Using bioinformatics approach, we identified and annotated 104 NBS-LRR genes in chickpea. Phylogenetic analysis points to their diversification into two families namely TIR-NBS-LRR and non-TIR-NBS-LRR. Gene architecture revealed intron gain/loss events in this resistance gene family during their independent evolution into two families. Comparative genomics analysis elucidated its evolutionary relationship with other fabaceae species. Around 50% NBS-LRRs reside in macro-syntenic blocks underlining positional conservation along with sequence conservation of NBS-LRR genes in chickpea. Transcriptome sequencing data provided evidence for their transcription and tissue-specific expression. Four cis -regulatory elements namely WBOX, DRE, CBF, and GCC boxes, that commonly occur in resistance genes, were present in the promoter regions of these genes. Further, the findings will provide a strong background to use candidate disease resistance NBS-encoding genes and identify their specific roles in chickpea.

  18. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  19. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  20. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  1. Exome sequencing identifies variants in two genes encoding the LIM-proteins NRAP and FHL1 in an Italian patient with BAG3 myofibrillar myopathy.

    Science.gov (United States)

    D'Avila, Francesca; Meregalli, Mirella; Lupoli, Sara; Barcella, Matteo; Orro, Alessandro; De Santis, Francesca; Sitzia, Clementina; Farini, Andrea; D'Ursi, Pasqualina; Erratico, Silvia; Cristofani, Riccardo; Milanesi, Luciano; Braga, Daniele; Cusi, Daniele; Poletti, Angelo; Barlassina, Cristina; Torrente, Yvan

    2016-06-01

    Myofibrillar myopathies (MFMs) are genetically heterogeneous dystrophies characterized by the disintegration of Z-disks and myofibrils and are associated with mutations in genes encoding Z-disk or Z-disk-related proteins. The c.626 C > T (p.P209L) mutation in the BAG3 gene has been described as causative of a subtype of MFM. We report a sporadic case of a 26-year-old Italian woman, affected by MFM with axonal neuropathy, cardiomyopathy, rigid spine, who carries the c.626 C > T mutation in the BAG3 gene. The patient and her non-consanguineous healthy parents and brother were studied with whole exome sequencing (WES) to further investigate the genetic basis of this complex phenotype. In the patient, we found that the BAG3 mutation is associated with variants in the NRAP and FHL1 genes that encode muscle-specific, LIM domain containing proteins. Quantitative real time PCR, immunohistochemistry and Western blot analysis of the patient's muscular biopsy showed the absence of NRAP expression and FHL1 accumulation in aggregates in the affected skeletal muscle tissue. Molecular dynamic analysis of the mutated FHL1 domain showed a modification in its surface charge, which could affect its capability to bind its target proteins. To our knowledge this is the first study reporting, in a BAG3 MFM, the simultaneous presence of genetic variants in the BAG3 and FHL1 genes (previously described as independently associated with MFMs) and linking the NRAP gene to MFM for the first time.

  2. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  3. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  4. Capping of the N-terminus of PSD-95 by calmodulin triggers its postsynaptic release

    Science.gov (United States)

    Zhang, Yonghong; Matt, Lucas; Patriarchi, Tommaso; Malik, Zulfiqar A; Chowdhury, Dhrubajyoti; Park, Deborah K; Renieri, Alessandra; Ames, James B; Hell, Johannes W

    2014-01-01

    Postsynaptic density protein-95 (PSD-95) is a central element of the postsynaptic architecture of glutamatergic synapses. PSD-95 mediates postsynaptic localization of AMPA receptors and NMDA receptors and plays an important role in synaptic plasticity. PSD-95 is released from postsynaptic membranes in response to Ca2+ influx via NMDA receptors. Here, we show that Ca2+/calmodulin (CaM) binds at the N-terminus of PSD-95. Our NMR structure reveals that both lobes of CaM collapse onto a helical structure of PSD-95 formed at its N-terminus (residues 1–16). This N-terminal capping of PSD-95 by CaM blocks palmitoylation of C3 and C5, which is required for postsynaptic PSD-95 targeting and the binding of CDKL5, a kinase important for synapse stability. CaM forms extensive hydrophobic contacts with Y12 of PSD-95. The PSD-95 mutant Y12E strongly impairs binding to CaM and Ca2+-induced release of PSD-95 from the postsynaptic membrane in dendritic spines. Our data indicate that CaM binding to PSD-95 serves to block palmitoylation of PSD-95, which in turn promotes Ca2+-induced dissociation of PSD-95 from the postsynaptic membrane. PMID:24705785

  5. Selenium Pretreatment Alleviated LPS-Induced Immunological Stress Via Upregulation of Several Selenoprotein Encoding Genes in Murine RAW264.7 Cells.

    Science.gov (United States)

    Wang, Longqiong; Jing, Jinzhong; Yan, Hui; Tang, Jiayong; Jia, Gang; Liu, Guangmang; Chen, Xiaoling; Tian, Gang; Cai, Jingyi; Shang, Haiying; Zhao, Hua

    2018-04-18

    This study was conducted to profile selenoprotein encoding genes in mouse RAW264.7 cells upon lipopolysaccharide (LPS) challenge and integrate their roles into immunological regulation in response to selenium (Se) pretreatment. LPS was used to develop immunological stress in macrophages. Cells were pretreated with different levels of Se (0, 0.5, 1.0, 1.5, 2.0 μmol Se/L) for 2 h, followed by LPS (100 ng/mL) stimulation for another 3 h. The mRNA expression of 24 selenoprotein encoding genes and 9 inflammation-related genes were investigated. The results showed that LPS (100 ng/mL) effectively induced immunological stress in RAW264.7 cells with induced inflammation cytokines, IL-6 and TNF-α, mRNA expression, and cellular secretion. LPS increased (P immunological stress in RAW264.7 cells accompanied with the global downregulation of selenoprotein encoding genes and Se pretreatment alleviated immunological stress via upregulation of a subset of selenoprotein encoding genes.

  6. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  7. CERKL, a retinal disease gene, encodes an mRNA-binding protein that localizes in compact and untranslated mRNPs associated with microtubules.

    Directory of Open Access Journals (Sweden)

    Alihamze Fathinajafabadi

    Full Text Available The function of CERKL (CERamide Kinase Like, a causative gene of retinitis pigmentosa and cone-rod dystrophy, still awaits characterization. To approach its cellular role we have investigated the subcellular localization and interaction partners of the full length CERKL isoform, CERKLa of 532 amino acids, in different cell lines, including a photoreceptor-derived cell line. We demonstrate that CERKLa is a main component of compact and untranslated mRNPs and that associates with other RNP complexes such as stress granules, P-bodies and polysomes. CERKLa is a protein that binds through its N-terminus to mRNAs and interacts with other mRNA-binding proteins like eIF3B, PABP, HSP70 and RPS3. Except for eIF3B, these interactions depend on the integrity of mRNAs but not of ribosomes. Interestingly, the C125W CERKLa pathological mutant does not interact with eIF3B and is absent from these complexes. Compact mRNPs containing CERKLa also associate with microtubules and are found in neurites of neural differentiated cells. These localizations had not been reported previously for any member of the retinal disorders gene family and should be considered when investigating the pathogenic mechanisms and therapeutical approaches in these diseases.

  8. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  9. Response and binding elements for ligand-dependent positive transcription factors integrate positive and negative regulation of gene expression

    International Nuclear Information System (INIS)

    Rosenfeld, M.G.; Glass, C.K.; Adler, S.; Crenshaw, E.B. III; He, X.; Lira, S.A.; Elsholtz, H.P.; Mangalam, H.J.; Holloway, J.M.; Nelson, C.; Albert, V.R.; Ingraham, H.A.

    1988-01-01

    Accurate, regulated initiation of mRNA transcription by RNA polymerase II is dependent on the actions of a variety of positive and negative trans-acting factors that bind cis-acting promoter and enhancer elements. These transcription factors may exert their actions in a tissue-specific manner or function under control of plasma membrane or intracellular ligand-dependent receptors. A major goal in the authors' laboratory has been to identify the molecular mechanisms responsible for the serial activation of hormone-encoding genes in the pituitary during development and the positive and negative regulation of their transcription. The anterior pituitary gland contains phenotypically distinct cell types, each of which expresses unique trophic hormones: adrenocorticotropic hormone, thyroid-stimulating hormone, prolactin, growth hormone, and follicle-stimulating hormone/luteinizing hormone. The structurally related prolactin and growth hormone genes are expressed in lactotrophs and somatotrophs, respectively, with their expression virtually limited to the pituitary gland. The reported transient coexpression of these two structurally related neuroendocrine genes raises the possibility that the prolactin and growth hormone genes are developmentally controlled by a common factor(s)

  10. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  11. Stream specificity and asymmetries in feature binding and content-addressable access in visual encoding and memory.

    Science.gov (United States)

    Huynh, Duong L; Tripathy, Srimant P; Bedell, Harold E; Ögmen, Haluk

    2015-01-01

    Human memory is content addressable-i.e., contents of the memory can be accessed using partial information about the bound features of a stored item. In this study, we used a cross-feature cuing technique to examine how the human visual system encodes, binds, and retains information about multiple stimulus features within a set of moving objects. We sought to characterize the roles of three different features (position, color, and direction of motion, the latter two of which are processed preferentially within the ventral and dorsal visual streams, respectively) in the construction and maintenance of object representations. We investigated the extent to which these features are bound together across the following processing stages: during stimulus encoding, sensory (iconic) memory, and visual short-term memory. Whereas all features examined here can serve as cues for addressing content, their effectiveness shows asymmetries and varies according to cue-report pairings and the stage of information processing and storage. Position-based indexing theories predict that position should be more effective as a cue compared to other features. While we found a privileged role for position as a cue at the stimulus-encoding stage, position was not the privileged cue at the sensory and visual short-term memory stages. Instead, the pattern that emerged from our findings is one that mirrors the parallel processing streams in the visual system. This stream-specific binding and cuing effectiveness manifests itself in all three stages of information processing examined here. Finally, we find that the Leaky Flask model proposed in our previous study is applicable to all three features.

  12. The calmodulin-binding, short linear motif, NSCaTE is conserved in L-type channel ancestors of vertebrate Cav1.2 and Cav1.3 channels.

    Directory of Open Access Journals (Sweden)

    Valentina Taiakina

    Full Text Available NSCaTE is a short linear motif of (xWxxx(I or Lxxxx, composed of residues with a high helix-forming propensity within a mostly disordered N-terminus that is conserved in L-type calcium channels from protostome invertebrates to humans. NSCaTE is an optional, lower affinity and calcium-sensitive binding site for calmodulin (CaM which competes for CaM binding with a more ancient, C-terminal IQ domain on L-type channels. CaM bound to N- and C- terminal tails serve as dual detectors to changing intracellular Ca(2+ concentrations, promoting calcium-dependent inactivation of L-type calcium channels. NSCaTE is absent in some arthropod species, and is also lacking in vertebrate L-type isoforms, Cav1.1 and Cav1.4 channels. The pervasiveness of a methionine just downstream from NSCaTE suggests that L-type channels could generate alternative N-termini lacking NSCaTE through the choice of translational start sites. Long N-terminus with an NSCaTE motif in L-type calcium channel homolog LCav1 from pond snail Lymnaea stagnalis has a faster calcium-dependent inactivation than a shortened N-termini lacking NSCaTE. NSCaTE effects are present in low concentrations of internal buffer (0.5 mM EGTA, but disappears in high buffer conditions (10 mM EGTA. Snail and mammalian NSCaTE have an alpha-helical propensity upon binding Ca(2+-CaM and can saturate both CaM N-terminal and C-terminal domains in the absence of a competing IQ motif. NSCaTE evolved in ancestors of the first animals with internal organs for promoting a more rapid, calcium-sensitive inactivation of L-type channels.

  13. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  14. Regulation Mechanism of the ald Gene Encoding Alanine Dehydrogenase in Mycobacterium smegmatis and Mycobacterium tuberculosis by the Lrp/AsnC Family Regulator AldR.

    Science.gov (United States)

    Jeong, Ji-A; Hyun, Jaekyung; Oh, Jeong-Il

    2015-10-01

    In the presence of alanine, AldR, which belongs to the Lrp/AsnC family of transcriptional regulators and regulates ald encoding alanine dehydrogenase in Mycobacterium smegmatis, changes its quaternary structure from a homodimer to an octamer with an open-ring conformation. Four AldR-binding sites (O2, O1, O4, and O3) with a consensus sequence of GA/T-N2-NWW/WWN-N2-A/TC were identified upstream of the M. smegmatis ald gene by means of DNase I footprinting analysis. O2, O1, and O4 are required for the induction of ald expression by alanine, while O3 is directly involved in the repression of ald expression. In addition to O3, both O1 and O4 are also necessary for full repression of ald expression in the absence of alanine, due to cooperative binding of AldR dimers to O1, O4, and O3. Binding of a molecule of the AldR octamer to the ald control region was demonstrated to require two AldR-binding sites separated by three helical turns between their centers and one additional binding site that is in phase with the two AldR-binding sites. The cooperative binding of AldR dimers to DNA requires three AldR-binding sites that are aligned with a periodicity of three helical turns. The aldR gene is negatively autoregulated independently of alanine. Comparative analysis of ald expression of M. smegmatis and Mycobacterium tuberculosis in conjunction with sequence analysis of both ald control regions led us to suggest that the expression of the ald genes in both mycobacterial species is regulated by the same mechanism. In mycobacteria, alanine dehydrogenase (Ald) is the enzyme required both to utilize alanine as a nitrogen source and to grow under hypoxic conditions by maintaining the redox state of the NADH/NAD(+) pool. Expression of the ald gene was reported to be regulated by the AldR regulator that belongs to the Lrp/AsnC (feast/famine) family, but the underlying mechanism was unknown. This study revealed the regulation mechanism of ald in Mycobacterium smegmatis and

  15. /sup 1/H-NMR studies on the interaction of calmodulin with melittin

    Energy Technology Data Exchange (ETDEWEB)

    Seeholzer, S.H.; Cohn, M.; Wand, A.J.

    1986-05-01

    Melittin (Mel), a basic amphipathic peptide from bee venom binds to Ca/sup + +/-calmodulin (CaM) with high affinity and competitively inhibits the activation of enzymes by CaM. The CaM:Mel complex is being studied as a model system for understanding the nature of CaM's interaction with other tight binding peptides and target enzymes. The authors report here some preliminary results. Gel filtration experiments have shown that CaM binds 2 Mels with high affinity at pH 6.5 in the absence of salt yet it binds only 1 Mel in the presence of 0.15 M KC1. Hence, electrostatic forces may dominate the binding of the second Mel. The titration of CaM with from 0 to 2 Mels/CaM was followed by /sup 1/H-NMR spectroscopy. The major changes in chemical shift of CaM resonances occur upon binding of the first Mel. Relatively fewer and smaller effects attend binding of the second Mel. Titration of CaM with from 0 through 1 Mel/CaM shifts the relative proportion of the His107-H2 resonance from 8.07 to 7.92 ppm. These two resonances are in slow exchange, the titration is complete at 1 Mel/CaM, and pH titrations are planned to see if these data are consistent with a Mel-induced pK shift of 0.5 pH units. The trimethyllysine resonance is shifted from 3.104 to 3.092 ppm by Mel. The relative proportion of these slowly exchanging peaks continuously changes during the titration from 0 to 2 Mels/CaM, being about 50% of each at 1 Mel/CaM. Data regarding the assignment and structure of Mel in various model solvent systems will also be reported.

  16. Dissociation of Calmodulin-Target Peptide Complexes by the Lipid Mediator Sphingosylphosphorylcholine

    Science.gov (United States)

    Kovacs, Erika; Tóth, Judit; Vértessy, Beáta G.; Liliom, Károly

    2010-01-01

    Previously we have identified the lipid mediator sphingosylphosphorylcholine (SPC) as the first potentially endogenous inhibitor of the ubiquitous Ca2+ sensor calmodulin (CaM) (Kovacs, E., and Liliom, K. (2008) Biochem. J. 410, 427–437). Here we give mechanistic insight into CaM inhibition by SPC, based on fluorescence stopped-flow studies with the model CaM-binding domain melittin. We demonstrate that both the peptide and SPC micelles bind to CaM in a rapid and reversible manner with comparable affinities. Furthermore, we present kinetic evidence that both species compete for the same target site on CaM, and thus SPC can be considered as a competitive inhibitor of CaM-target peptide interactions. We also show that SPC disrupts the complex of CaM and the CaM-binding domain of ryanodine receptor type 1, inositol 1,4,5-trisphosphate receptor type 1, and the plasma membrane Ca2+ pump. By interfering with these interactions, thus inhibiting the negative feedback that CaM has on Ca2+ signaling, we hypothesize that SPC could lead to Ca2+ mobilization in vivo. Hence, we suggest that the action of the sphingolipid on CaM might explain the previously recognized phenomenon that SPC liberates Ca2+ from intracellular stores. Moreover, we demonstrate that unlike traditional synthetic CaM inhibitors, SPC disrupts the complex between not only the Ca2+-saturated but also the apo form of the protein and the target peptide, suggesting a completely novel regulation for target proteins that constitutively bind CaM, such as ryanodine receptors. PMID:19910470

  17. Functional Analysis of an ATP-Binding Cassette Transporter Gene in Botrytis cinerea by Gene Disruption

    OpenAIRE

    Masami, NAKAJIMA; Junko, SUZUKI; Takehiko, HOSAKA; Tadaaki, HIBI; Katsumi, AKUTSU; School of Agriculture, Ibaraki University; School of Agriculture, Ibaraki University; School of Agriculture, Ibaraki University; Department of Agriculture and Environmental Biology, The University of Tokyo; School of Agriculture, Ibaraki University

    2001-01-01

    The BMR1 gene encoding an ABC transporter was cloned from Botrytis cinerea. To examine the function of BMR1 in B.cinerea, we isolated BMR1-deficient mutants after gene disruption. Disruption vector pBcDF4 was constructed by replacing the BMR1-coding region with a hygromycin B phosphotransferase gene(hph)cassette. The BMR1 disruptants had an increased sensitivity to polyoxin and iprobenfos. Polyoxin and iprobenfos, structurally unrelated compounds, may therefore be substrates of BMR1.

  18. Genetic variations in insulin-like growth factor binding protein acid labile subunit gene associated with growth traits in beef cattle (Bos taurus) in China.

    Science.gov (United States)

    Liu, Yu; Duan, Xiaoyan; Liu, Xiaolin; Guo, Jiazhong; Wang, Hongliang; Li, Zhixiong; Yang, Jing

    2014-05-01

    The insulin-like growth factor binding protein acid labile subunit (IGFALS) gene encodes a serum protein that binds to IGFs and regulates growth, development, and other physiological processes. We have found that sequencing of the IGFALS gene in Chinese Qinchuan beef cattle (n=300) revealed four SNP loci in exon two of the gene (g1219: T>C, g1893: T>C, g2612: G>A, and g2696: A>G). The SNP g2696: A>G resulted in a change from asparagine to aspartic acid (p. N574D) in the leucine-rich repeat region in the carboxyl-terminal domain of IGFALS. Four SNPs were in low linkage disequilibrium, and 12 different haplotypes were identified in the population. Association analysis suggested that SNP g1219: T>C had a significant association with hip width (PG displayed a significant association with stature (Pgrowth traits of bovine, and may serve as a genetic marker for selection of beef cattle for growth traits, including stature. Copyright © 2014 Elsevier B.V. All rights reserved.

  19. A cDNA encoding a pRB-binding protein with properties of the transcription factor E2F

    DEFF Research Database (Denmark)

    Helin, K; Lees, J A; Vidal, M

    1992-01-01

    The retinoblastoma protein (pRB) plays an important role in the control of cell proliferation, apparently by binding to and regulating cellular transcription factors such as E2F. Here we describe the characterization of a cDNA clone that encodes a protein with properties of E2F. This clone, RBP3...

  20. Identification of the functional binding pocket for compounds targeting small-conductance Ca2+-activated potassium channels

    Science.gov (United States)

    Zhang, Miao; Pascal, John M.; Schumann, Marcel; Armen, Roger S.; Zhang, Ji-fang

    2012-01-01

    Small- and intermediate-conductance Ca2+-activated potassium channels, activated by Ca2+-bound calmodulin, play an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potentials for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-EBIO class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class. PMID:22929778

  1. Misidentification of Aspergillus nomius and Aspergillus tamarii as Aspergillus flavus: characterization by internal transcribed spacer, β-Tubulin, and calmodulin gene sequencing, metabolic fingerprinting, and matrix-assisted laser desorption ionization-time of flight mass spectrometry.

    Science.gov (United States)

    Tam, Emily W T; Chen, Jonathan H K; Lau, Eunice C L; Ngan, Antonio H Y; Fung, Kitty S C; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung; Lau, Susanna K P; Woo, Patrick C Y

    2014-04-01

    Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization-time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability.

  2. Misidentification of Aspergillus nomius and Aspergillus tamarii as Aspergillus flavus: Characterization by Internal Transcribed Spacer, β-Tubulin, and Calmodulin Gene Sequencing, Metabolic Fingerprinting, and Matrix-Assisted Laser Desorption Ionization–Time of Flight Mass Spectrometry

    Science.gov (United States)

    Tam, Emily W. T.; Chen, Jonathan H. K.; Lau, Eunice C. L.; Ngan, Antonio H. Y.; Fung, Kitty S. C.; Lee, Kim-Chung; Lam, Ching-Wan; Yuen, Kwok-Yung

    2014-01-01

    Aspergillus nomius and Aspergillus tamarii are Aspergillus species that phenotypically resemble Aspergillus flavus. In the last decade, a number of case reports have identified A. nomius and A. tamarii as causes of human infections. In this study, using an internal transcribed spacer, β-tubulin, and calmodulin gene sequencing, only 8 of 11 clinical isolates reported as A. flavus in our clinical microbiology laboratory by phenotypic methods were identified as A. flavus. The other three isolates were A. nomius (n = 2) or A. tamarii (n = 1). The results corresponded with those of metabolic fingerprinting, in which the A. flavus, A. nomius, and A. tamarii strains were separated into three clusters based on ultra-high-performance liquid chromatography-tandem mass spectrometry (UHPLC MS) analysis. The first two patients with A. nomius infections had invasive aspergillosis and chronic cavitary and fibrosing pulmonary and pleural aspergillosis, respectively, whereas the third patient had A. tamarii colonization of the airway. Identification of the 11 clinical isolates and three reference strains by matrix-assisted laser desorption ionization–time of flight mass spectrometry (MALDI-TOF MS) showed that only six of the nine strains of A. flavus were identified correctly. None of the strains of A. nomius and A. tamarii was correctly identified. β-Tubulin or the calmodulin gene should be the gene target of choice for identifying A. flavus, A. nomius, and A. tamarii. To improve the usefulness of MALDI-TOF MS, the number of strains for each species in MALDI-TOF MS databases should be expanded to cover intraspecies variability. PMID:24452174

  3. Cloning and expression of a nuclear encoded plastid specific 33 kDa ribonucleoprotein gene (33RNP) from pea that is light stimulated.

    Science.gov (United States)

    Reddy, M K; Nair, S; Singh, B N; Mudgil, Y; Tewari, K K; Sopory, S K

    2001-01-24

    We report the cloning and sequencing of both cDNA and genomic DNA of a 33 kDa chloroplast ribonucleoprotein (33RNP) from pea. The analysis of the predicted amino acid sequence of the cDNA clone revealed that the encoded protein contains two RNA binding domains, including the conserved consensus ribonucleoprotein sequences CS-RNP1 and CS-RNP2, on the C-terminus half and the presence of a putative transit peptide sequence in the N-terminus region. The phylogenetic and multiple sequence alignment analysis of pea chloroplast RNP along with RNPs reported from the other plant sources revealed that the pea 33RNP is very closely related to Nicotiana sylvestris 31RNP and 28RNP and also to 31RNP and 28RNP of Arabidopsis and spinach, respectively. The pea 33RNP was expressed in Escherichia coli and purified to homogeneity. The in vitro import of precursor protein into chloroplasts confirmed that the N-terminus putative transit peptide is a bona fide transit peptide and 33RNP is localized in the chloroplast. The nucleic acid-binding properties of the recombinant protein, as revealed by South-Western analysis, showed that 33RNP has higher binding affinity for poly (U) and oligo dT than for ssDNA and dsDNA. The steady state transcript level was higher in leaves than in roots and the expression of this gene is light stimulated. Sequence analysis of the genomic clone revealed that the gene contains four exons and three introns. We have also isolated and analyzed the 5' flanking region of the pea 33RNP gene.

  4. Poly-dipeptides encoded by the C9orf72 repeats bind nucleoli, impede RNA biogenesis, and kill cells.

    Science.gov (United States)

    Kwon, Ilmin; Xiang, Siheng; Kato, Masato; Wu, Leeju; Theodoropoulos, Pano; Wang, Tao; Kim, Jiwoong; Yun, Jonghyun; Xie, Yang; McKnight, Steven L

    2014-09-05

    Many RNA regulatory proteins controlling pre-messenger RNA splicing contain serine:arginine (SR) repeats. Here, we found that these SR domains bound hydrogel droplets composed of fibrous polymers of the low-complexity domain of heterogeneous ribonucleoprotein A2 (hnRNPA2). Hydrogel binding was reversed upon phosphorylation of the SR domain by CDC2-like kinases 1 and 2 (CLK1/2). Mutated variants of the SR domains changing serine to glycine (SR-to-GR variants) also bound to hnRNPA2 hydrogels but were not affected by CLK1/2. When expressed in mammalian cells, these variants bound nucleoli. The translation products of the sense and antisense transcripts of the expansion repeats associated with the C9orf72 gene altered in neurodegenerative disease encode GRn and PRn repeat polypeptides. Both peptides bound to hnRNPA2 hydrogels independent of CLK1/2 activity. When applied to cultured cells, both peptides entered cells, migrated to the nucleus, bound nucleoli, and poisoned RNA biogenesis, which caused cell death. Copyright © 2014, American Association for the Advancement of Science.

  5. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  6. Characterization and Heterologous Expression of the Genes Encoding Enterocin A Production, Immunity, and Regulation in Enterococcus faecium DPC1146

    Science.gov (United States)

    O’Keeffe, Triona; Hill, Colin; Ross, R. Paul

    1999-01-01

    Enterocin A is a small, heat-stable, antilisterial bacteriocin produced by Enterococcus faecium DPC1146. The sequence of a 10,879-bp chromosomal region containing at least 12 open reading frames (ORFs), 7 of which are predicted to play a role in enterocin biosynthesis, is presented. The genes entA, entI, and entF encode the enterocin A prepeptide, the putative immunity protein, and the induction factor prepeptide, respectively. The deduced proteins EntK and EntR resemble the histidine kinase and response regulator proteins of two-component signal transducing systems of the AgrC-AgrA type. The predicted proteins EntT and EntD are homologous to ABC (ATP-binding cassette) transporters and accessory factors, respectively, of several other bacteriocin systems and to proteins implicated in the signal-sequence-independent export of Escherichia coli hemolysin A. Immediately downstream of the entT and entD genes are two ORFs, the product of one of which, ORF4, is very similar to the product of the yteI gene of Bacillus subtilis and to E. coli protease IV, a signal peptide peptidase known to be involved in outer membrane lipoprotein export. Another potential bacteriocin is encoded in the opposite direction to the other genes in the enterocin cluster. This putative bacteriocin-like peptide is similar to LafX, one of the components of the lactacin F complex. A deletion which included one of two direct repeats upstream of the entA gene abolished enterocin A activity, immunity, and ability to induce bacteriocin production. Transposon insertion upstream of the entF gene also had the same effect, but this mutant could be complemented by exogenously supplied induction factor. The putative EntI peptide was shown to be involved in the immunity to enterocin A. Cloning of a 10.5-kb amplicon comprising all predicted ORFs and regulatory regions resulted in heterologous production of enterocin A and induction factor in Enterococcus faecalis, while a four-gene construct (entAITD) under the

  7. Characterization of the Holliday junction resolving enzyme encoded by the Bacillus subtilis bacteriophage SPP1.

    Directory of Open Access Journals (Sweden)

    Lisa Zecchi

    Full Text Available Recombination-dependent DNA replication, which is a central component of viral replication restart, is poorly understood in Firmicutes bacteriophages. Phage SPP1 initiates unidirectional theta DNA replication from a discrete replication origin (oriL, and when replication progresses, the fork might stall by the binding of the origin binding protein G38P to the late replication origin (oriR. Replication restart is dependent on viral recombination proteins to synthesize a linear head-to-tail concatemer, which is the substrate for viral DNA packaging. To identify new functions involved in this process, uncharacterized genes from phage SPP1 were analyzed. Immediately after infection, SPP1 transcribes a number of genes involved in recombination and replication from P(E2 and P(E3 promoters. Resequencing the region corresponding to the last two hypothetical genes transcribed from the P(E2 operon (genes 44 and 45 showed that they are in fact a single gene, re-annotated here as gene 44, that encodes a single polypeptide, named gene 44 product (G44P, 27.5 kDa. G44P shares a low but significant degree of identity in its C-terminal region with virus-encoded RusA-like resolvases. The data presented here demonstrate that G44P, which is a dimer in solution, binds with high affinity but without sequence specificity to several double-stranded DNA recombination intermediates. G44P preferentially cleaves Holliday junctions, but also, with lower efficiency, replicated D-loops. It also partially complemented the loss of RecU resolvase activity in B. subtilis cells. These in vitro and in vivo data suggest a role for G44P in replication restart during the transition to concatemeric viral replication.

  8. The L locus, one of complementary genes required for anthocyanin production in onions (Allium cepa), encodes anthocyanidin synthase.

    Science.gov (United States)

    Kim, Sunggil; Jones, Rick; Yoo, Kil-Sun; Pike, Leonard M

    2005-06-01

    Bulb color in onions (Allium cepa) is an important trait, but its complex, unclear mechanism of inheritance has been a limiting factor in onion cultivar improvement. The identity of the L locus, which is involved in the color difference between Brazilian yellow and red onions, is revealed in this study. A cross was made between a US-type yellow breeding line and a Brazilian yellow cultivar. The segregation ratio of nine red to seven yellow onions in the F(2) population supports the involvement of two complementary genes in anthocyanin production in the F(1) hybrids. The high-performance liquid chromatography (HPLC) and reverse-transcriptase (RT)-PCR analysis of the Brazilian yellow onions indicated that the genes are involved late in the anthocyanin synthesis pathway. The genomic sequence of the anthocyanidin synthase (ANS) gene in Brazilian yellow onions showed a point mutation, which results in an amino acid change of a glycine to an arginine at residue 229. Because this residue is located adjacent to a highly conserved iron-binding active site, this mutation is likely responsible for the inactivation of the ANS gene in Brazilian yellow onions. Following the isolation of the promoter sequence of the mutant allele, a PCR-based marker for allelic selection of the ANS gene was designed. This assay is based on an insertion (larger than 3 kb) mutation. The marker perfectly co-segregated with the color phenotypes in the F(2) populations, thereby indicating that the L locus encodes ANS.

  9. Cross talk among calcium, hydrogen peroxide, and nitric oxide and activation of gene expression involving calmodulins and calcium-dependent protein kinases in Ulva compressa exposed to copper excess.

    Science.gov (United States)

    González, Alberto; Cabrera, M de Los Ángeles; Henríquez, M Josefa; Contreras, Rodrigo A; Morales, Bernardo; Moenne, Alejandra

    2012-03-01

    To analyze the copper-induced cross talk among calcium, nitric oxide (NO), and hydrogen peroxide (H(2)O(2)) and the calcium-dependent activation of gene expression, the marine alga Ulva compressa was treated with the inhibitors of calcium channels, ned-19, ryanodine, and xestospongin C, of chloroplasts and mitochondrial electron transport chains, 3-(3,4-dichlorophenyl)-1,1-dimethylurea and antimycin A, of pyruvate dehydrogenase, moniliformin, of calmodulins, N-(6-aminohexyl)-5-chloro-1-naphtalene sulfonamide, and of calcium-dependent protein kinases, staurosporine, as well as with the scavengers of NO, 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide, and of H(2)O(2), ascorbate, and exposed to a sublethal concentration of copper (10 μm) for 24 h. The level of NO increased at 2 and 12 h. The first peak was inhibited by ned-19 and 3-(2,3-dichlorophenyl)-1,1-dimethylurea and the second peak by ned-19 and antimycin A, indicating that NO synthesis is dependent on calcium release and occurs in organelles. The level of H(2)O(2) increased at 2, 3, and 12 h and was inhibited by ned-19, ryanodine, xestospongin C, and moniliformin, indicating that H(2)O(2) accumulation is dependent on calcium release and Krebs cycle activity. In addition, pyruvate dehydrogenase, 2-oxoxglutarate dehydrogenase, and isocitrate dehydrogenase activities of the Krebs cycle increased at 2, 3, 12, and/or 14 h, and these increases were inhibited in vitro by EGTA, a calcium chelating agent. Calcium release at 2, 3, and 12 h was inhibited by 2-(4-carboxyphenyl)-4,4,5,5-tetramethylimidazoline-1-oxyl-3-oxide and ascorbate, indicating activation by NO and H(2)O(2). In addition, the level of antioxidant protein gene transcripts decreased with N-(6-aminohexyl)-5-chloro-1-naphtalene sulfonamide and staurosporine. Thus, there is a copper-induced cross talk among calcium, H(2)O(2), and NO and a calcium-dependent activation of gene expression involving calmodulins and calcium-dependent protein

  10. Genome-wide identification and comparative analysis of squamosa-promoter binding proteins (sbp) transcription factor family in gossypium raimondii and arabidopsis thaliana

    International Nuclear Information System (INIS)

    Ali, M.A.; Alia, K.B.; Atif, R.M.; Rasulj, I.; Nadeem, H.U.; Shahid, A.; Azeem, F

    2017-01-01

    SQUAMOSA-Promoter Binding Proteins (SBP) are class of transcription factors that play vital role in regulation of plant tissue growth and development. The genes encoding these proteins have not yet been identified in diploid cotton. Thus here, a comprehensive genome wide analysis of SBP genes/proteins was carried out to identify the genes encoding SBP proteins in Gossypium raimondii and Arabidopsis thaliana. We identified 17 SBP genes from Arabidopsis thaliana genome and 30 SBP genes from Gossypium raimondii. Chromosome localization studies revealed the uneven distribution of SBP encoding genes both in the genomes of A. thaliana and G. raimondii. In cotton, five SBP genes were located on chromosome no. 2, while no gene was found on chromosome 9. In A. thaliana, maximum seven SBP genes were identified on chromosome 9, while chromosome 4 did not have any SBP gene. Thus, the SBP gene family might have expanded as a result of segmental as well as tandem duplications in these species. The comparative phylogenetic analysis of Arabidopsis and cotton SBPs revealed the presence of eight groups. The gene structure analysis of SBP encoding genes revealed the presence of one to eleven inrons in both Arabidopsis and G. raimondii. The proteins sharing the same phyletic group mostly demonstrated the similar intron-exon occurrence pattern; and share the common conserved domains. The SBP DNA-binding domain shared 24 absolutely conserved residues in Arabidopsis. The present study can serve as a base for the functional characterization of SBP gene family in Gossypium raimondii. (author)

  11. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  12. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  13. Caveolin versus calmodulin. Counterbalancing allosteric modulators of endothelial nitric oxide synthase.

    Science.gov (United States)

    Michel, J B; Feron, O; Sase, K; Prabhakar, P; Michel, T

    1997-10-10

    Nitric oxide is synthesized in diverse mammalian tissues by a family of calmodulin-dependent nitric oxide synthases. The endothelial isoform of nitric oxide synthase (eNOS) is targeted to the specialized signal-transducing membrane domains termed plasmalemmal caveolae. Caveolin, the principal structural protein in caveolae, interacts with eNOS and leads to enzyme inhibition in a reversible process modulated by Ca2+-calmodulin (Michel, J. B., Feron, O., Sacks, D., and Michel, T. (1997) J. Biol. Chem. 272, 15583-15586). Caveolin also interacts with other structurally distinct signaling proteins via a specific region identified within the caveolin sequence (amino acids 82-101) that appears to subserve the role of a "scaffolding domain." We now report that the co-immunoprecipitation of eNOS with caveolin is completely and specifically blocked by an oligopeptide corresponding to the caveolin scaffolding domain. Peptides corresponding to this domain markedly inhibit nitric oxide synthase activity in endothelial membranes and interact directly with the enzyme to inhibit activity of purified recombinant eNOS expressed in Escherichia coli. The inhibition of purified eNOS by the caveolin scaffolding domain peptide is competitive and completely reversed by Ca2+-calmodulin. These studies establish that caveolin, via its scaffolding domain, directly forms an inhibitory complex with eNOS and suggest that caveolin inhibits eNOS by abrogating the enzyme's activation by calmodulin.

  14. Isolation and Abiotic Stress Resistance Analyses of a Catalase Gene from Ipomoea batatas (L.) Lam.

    Science.gov (United States)

    Yong, Bin; Wang, Xiaoyan; Xu, Pan; Zheng, Haiyan; Fei, Xueting; Hong, Zixi; Ma, Qinqin; Miao, Yuzhi; Yuan, Xianghua; Jiang, Yusong; Shao, Huanhuan

    2017-01-01

    As an indicator of the antioxidant capability of plants, catalase can detoxify reactive oxygen species (ROS) generated by environmental stresses. Sweet potato is one of the top six most important crops in the world. However, its catalases remain largely unknown. In this study, a catalase encoding gene, IbCAT2 (accession number: KY615708), was identified and cloned from sweet potato cv. Xushu 18. It contained a 1479 nucleotides' open reading frame (ORF). S-R-L, Q-K-L, and a putative calmodulin binding domain were located at the C-terminus of IbCAT2, which suggests that IbCAT2 could be a peroxisomal catalase. Next-generation sequencing (NGS) based quantitative analyses showed that IbCAT2 was mainly expressed in young leaves and expanding tuberous roots under normal conditions. When exposed to 10% PEG6000 or 200 mmol/L NaCl solutions, IbCAT2 was upregulated rapidly in the first 11 days and then downregulated, although different tissues showed different degree of change. Overexpression of IbCAT2 conferred salt and drought tolerance in Escherichia coli and Saccharomyces cerevisiae . The positive response of IbCAT2 to abiotic stresses suggested that IbCAT2 might play an important role in stress responses.

  15. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  16. Regulation of the alpha-glucuronidase-encoding gene ( aguA) from Aspergillus niger.

    Science.gov (United States)

    de Vries, R P; van de Vondervoort, P J I; Hendriks, L; van de Belt, M; Visser, J

    2002-09-01

    The alpha-glucuronidase gene aguA from Aspergillus niger was cloned and characterised. Analysis of the promoter region of aguA revealed the presence of four putative binding sites for the major carbon catabolite repressor protein CREA and one putative binding site for the transcriptional activator XLNR. In addition, a sequence motif was detected which differed only in the last nucleotide from the XLNR consensus site. A construct in which part of the aguA coding region was deleted still resulted in production of a stable mRNA upon transformation of A. niger. The putative XLNR binding sites and two of the putative CREA binding sites were mutated individually in this construct and the effects on expression were examined in A. niger transformants. Northern analysis of the transformants revealed that the consensus XLNR site is not actually functional in the aguA promoter, whereas the sequence that diverges from the consensus at a single position is functional. This indicates that XLNR is also able to bind to the sequence GGCTAG, and the XLNR binding site consensus should therefore be changed to GGCTAR. Both CREA sites are functional, indicating that CREA has a strong influence on aguA expression. A detailed expression analysis of aguA in four genetic backgrounds revealed a second regulatory system involved in activation of aguA gene expression. This system responds to the presence of glucuronic and galacturonic acids, and is not dependent on XLNR.

  17. Human sex hormone-binding globulin gene expression- multiple promoters and complex alternative splicing

    Directory of Open Access Journals (Sweden)

    Rosner William

    2009-05-01

    Full Text Available Abstract Background Human sex hormone-binding globulin (SHBG regulates free sex steroid concentrations in plasma and modulates rapid, membrane based steroid signaling. SHBG is encoded by an eight exon-long transcript whose expression is regulated by a downstream promoter (PL. The SHBG gene was previously shown to express a second major transcript of unknown function, derived from an upstream promoter (PT, and two minor transcripts. Results We report that transcriptional expression of the human SHBG gene is far more complex than previously described. PL and PT direct the expression of at least six independent transcripts each, resulting from alternative splicing of exons 4, 5, 6, and/or 7. We mapped two transcriptional start sites downstream of PL and PT, and present evidence for a third SHBG gene promoter (PN within the neighboring FXR2 gene; PN regulates the expression of at least seven independent SHBG gene transcripts, each possessing a novel, 164-nt first exon (1N. Transcriptional expression patterns were generated for human prostate, breast, testis, liver, and brain, and the LNCaP, MCF-7, and HepG2 cell lines. Each expresses the SHBG transcript, albeit in varying abundance. Alternative splicing was more pronounced in the cancer cell lines. PL- PT- and PN-derived transcripts were most abundant in liver, testis, and prostate, respectively. Initial findings reveal the existence of a smaller immunoreactive SHBG species in LNCaP, MCF-7, and HepG2 cells. Conclusion These results extend our understanding of human SHBG gene transcription, and raise new and important questions regarding the role of novel alternatively spliced transcripts, their function in hormonally responsive tissues including the breast and prostate, and the role that aberrant SHBG gene expression may play in cancer.

  18. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  19. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  20. Identification of light-harvesting chlorophyll a/b-binding protein genes of Zostera marina L. and their expression under different environmental conditions

    Science.gov (United States)

    Kong, Fanna; Zhou, Yang; Sun, Peipei; Cao, Min; Li, Hong; Mao, Yunxiang

    2016-02-01

    Photosynthesis includes the collection of light and the transfer of solar energy using light-harvesting chlorophyll a/b-binding (LHC) proteins. In high plants, the LHC gene family includes LHCA and LHCB sub-families, which encode proteins constituting the light-harvesting complex of photosystems I and II. Zostera marina L. is a monocotyledonous angiosperm and inhabits submerged marine environments rather than land environments. We characterized the Lhca and Lhcb gene families of Z. marina from the expressed sequence tags (EST) database. In total, 13 unigenes were annotated as ZmLhc, 6 in Lhca family and 7 in ZmLhcb family. ZmLHCA and ZmLHCB contained the conservative LHC motifs and amino acid residues binding chlorophyll. The average similarity among mature ZmLHCA and ZmLHCB was 48.91% and 48.66%, respectively, which indicated a high degree of divergence within ZmLHChc gene family. The reconstructed phylogenetic tree showed that the tree topology and phylogenetic relationship were similar to those reported in other high plants, suggesting that the Lhc genes were highly conservative and the classification of ZmLhc genes was consistent with the evolutionary position of Z. marina. Real-time reverse transcription (RT) PCR analysis showed that different members of ZmLhca and ZmLhcb responded to a stress in different expression patterns. Salinity, temperature, light intensity and light quality may affect the expression of most ZmLhca and ZmLhcb genes. Inorganic carbon concentration and acidity had no obvious effect on ZmLhca and ZmLhcb gene expression, except for ZmLhca6.

  1. Adeno-associated virus (AAV-mediated suppression of Ca2+/calmodulin kinase IV activity in the nucleus accumbens modulates emotional behaviour in mice

    Directory of Open Access Journals (Sweden)

    Bading Hilmar

    2007-12-01

    Full Text Available Abstract Background Calcium/calmodulin-dependent protein kinase IV (CaMKIV controls activity-dependent gene transcription by regulating the activity of the cyclic AMP response element binding protein (CREB. This signaling pathway is involved in gating emotional responses in the CNS but previous studies did not address the potential roles of CaMKIV in discrete brain regions. In the present study, we aimed at specifically dissecting the role of CaMKIV in the nucleus accumbens of adult mice. Results We used recombinant adeno-associated virus (rAAV-mediated gene transfer of a dominant-negative CaMKIV variant (rAAV-dnCaMKIV to inhibit endogenous CaMKIV in the nucleus accumbens. rAAV-dnCaMKIV treated animals were subjected to a battery of tests including, prepulse inhibition of the acoustic startle response, open field, social interaction and anxiety-related behaviour. We found that basal locomotor activity in the open field, and prepulse inhibition or startle performance were unaltered in mice infected with rAAV-dnCaMKIV in the nucleus accumbens. However, anxiogenic effects were revealed in social interaction testing and the light/dark emergence test. Conclusion Our findings suggest a modulatory role of CaMKIV in the nucleus accumbens in anxiety-like behaviour but not sensorimotor gating.

  2. Modulation of DNA binding by gene-specific transcription factors.

    Science.gov (United States)

    Schleif, Robert F

    2013-10-01

    The transcription of many genes, particularly in prokaryotes, is controlled by transcription factors whose activity can be modulated by controlling their DNA binding affinity. Understanding the molecular mechanisms by which DNA binding affinity is regulated is important, but because forming definitive conclusions usually requires detailed structural information in combination with data from extensive biophysical, biochemical, and sometimes genetic experiments, little is truly understood about this topic. This review describes the biological requirements placed upon DNA binding transcription factors and their consequent properties, particularly the ways that DNA binding affinity can be modulated and methods for its study. What is known and not known about the mechanisms modulating the DNA binding affinity of a number of prokaryotic transcription factors, including CAP and lac repressor, is provided.

  3. An Unusual Phage Repressor Encoded by Mycobacteriophage BPs.

    Directory of Open Access Journals (Sweden)

    Valerie M Villanueva

    Full Text Available Temperate bacteriophages express transcription repressors that maintain lysogeny by down-regulating lytic promoters and confer superinfection immunity. Repressor regulation is critical to the outcome of infection-lysogenic or lytic growth-as well as prophage induction into lytic replication. Mycobacteriophage BPs and its relatives use an unusual integration-dependent immunity system in which the phage attachment site (attP is located within the repressor gene (33 such that site-specific integration leads to synthesis of a prophage-encoded product (gp33103 that is 33 residues shorter at its C-terminus than the virally-encoded protein (gp33136. However, the shorter form of the repressor (gp33103 is stable and active in repression of the early lytic promoter PR, whereas the longer virally-encoded form (gp33136 is inactive due to targeted degradation via a C-terminal ssrA-like tag. We show here that both forms of the repressor bind similarly to the 33-34 intergenic regulatory region, and that BPs gp33103 is a tetramer in solution. The BPs gp33103 repressor binds to five regulatory regions spanning the BPs genome, and regulates four promoters including the early lytic promoter, PR. BPs gp33103 has a complex pattern of DNA recognition in which a full operator binding site contains two half sites separated by a variable spacer, and BPs gp33103 induces a DNA bend at the full operator site but not a half site. The operator site structure is unusual in that one half site corresponds to a 12 bp palindrome identified previously, but the other half site is a highly variable variant of the palindrome.

  4. Comparative analysis and molecular characterization of a gene BANF1 encoded a DNA-binding protein during mitosis from the Giant Panda and Black Bear.

    Science.gov (United States)

    Zeng, Yichun; Hou, Yi-Ling; Ding, Xiang; Hou, Wan-Ru; Li, Jian

    2014-01-01

    Barrier to autointegration factor 1 (BANF1) is a DNA-binding protein found in the nucleus and cytoplasm of eukaryotic cells that functions to establish nuclear architecture during mitosis. The cDNA and the genomic sequence of BANF1 were cloned from the Giant Panda (Ailuropoda melanoleuca) and Black Bear (Ursus thibetanus mupinensis) using RT-PCR technology and Touchdown-PCR, respectively. The cDNA of the BANF1 cloned from Giant Panda and Black Bear is 297 bp in size, containing an open reading frame of 270 bp encoding 89 amino acids. The length of the genomic sequence from Giant Panda is 521 bp, from Black Bear is 536 bp, which were found both to possess 2 exons. Alignment analysis indicated that the nucleotide sequence and the deduced amino acid sequence are highly conserved to some mammalian species studied. Topology prediction showed there is one Protein kinase C phosphorylation site, one Casein kinase II phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Giant Panda, and there is one Protein kinase C phosphorylation site, one Tyrosine kinase phosphorylation site, one N-myristoylation site, and one Amidation site in the BANF1 protein of the Black Bear. The BANF1 gene can be readily expressed in E. coli. Results showed that the protein BANF1 fusion with the N-terminally His-tagged form gave rise to the accumulation of an expected 14 kD polypeptide that formed inclusion bodies. The expression products obtained could be used to purify the proteins and study their function further.

  5. Identification of a single‐copy gene encoding a Type I chlorophyll a/b‐binding polypeptide of photosystem I in Arabidopsis thaliana

    DEFF Research Database (Denmark)

    Jensen, Poul E; Kristensen, Michael; Hoff, Tine

    1992-01-01

    We have isolated and sequenced cDNA and genomic clones from Arabidopsis thaliana which specify a 241 residue protein with 84% sequence identity to a photosystem I Type I chlorophyll a/b-binding (CAB) protein from tomato. The open reading frame is interrupted by three introns which are found...... at equivalent positions as the corresponding introns in the tomato gene. Comparison to the amino acid sequence of other CAB proteins confirms that all CAB proteins share two regions of very high similarity. However, near the N-terminus and between the conserved regions this light-harvesting complex I (LHCI...

  6. MicroRNA-target binding structures mimic microRNA duplex structures in humans.

    Directory of Open Access Journals (Sweden)

    Xi Chen

    Full Text Available Traditionally, researchers match a microRNA guide strand to mRNA sequences using sequence comparisons to predict its potential target genes. However, many of the predictions can be false positives due to limitations in sequence comparison alone. In this work, we consider the association of two related RNA structures that share a common guide strand: the microRNA duplex and the microRNA-target binding structure. We have analyzed thousands of such structure pairs and found many of them share high structural similarity. Therefore, we conclude that when predicting microRNA target genes, considering just the microRNA guide strand matches to gene sequences may not be sufficient--the microRNA duplex structure formed by the guide strand and its companion passenger strand must also be considered. We have developed software to translate RNA binding structure into encoded representations, and we have also created novel automatic comparison methods utilizing such encoded representations to determine RNA structure similarity. Our software and methods can be utilized in the other RNA secondary structure comparisons as well.

  7. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  8. Analysis of functional importance of binding sites in the Drosophila gap gene network model.

    Science.gov (United States)

    Kozlov, Konstantin; Gursky, Vitaly V; Kulakovskiy, Ivan V; Dymova, Arina; Samsonova, Maria

    2015-01-01

    The statistical thermodynamics based approach provides a promising framework for construction of the genotype-phenotype map in many biological systems. Among important aspects of a good model connecting the DNA sequence information with that of a molecular phenotype (gene expression) is the selection of regulatory interactions and relevant transcription factor bindings sites. As the model may predict different levels of the functional importance of specific binding sites in different genomic and regulatory contexts, it is essential to formulate and study such models under different modeling assumptions. We elaborate a two-layer model for the Drosophila gap gene network and include in the model a combined set of transcription factor binding sites and concentration dependent regulatory interaction between gap genes hunchback and Kruppel. We show that the new variants of the model are more consistent in terms of gene expression predictions for various genetic constructs in comparison to previous work. We quantify the functional importance of binding sites by calculating their impact on gene expression in the model and calculate how these impacts correlate across all sites under different modeling assumptions. The assumption about the dual interaction between hb and Kr leads to the most consistent modeling results, but, on the other hand, may obscure existence of indirect interactions between binding sites in regulatory regions of distinct genes. The analysis confirms the previously formulated regulation concept of many weak binding sites working in concert. The model predicts a more or less uniform distribution of functionally important binding sites over the sets of experimentally characterized regulatory modules and other open chromatin domains.

  9. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Molecular characterization of the Jatropha curcas JcR1MYB1 gene encoding a putative R1-MYB transcription factor

    Directory of Open Access Journals (Sweden)

    Hui-Liang Li

    2014-09-01

    Full Text Available The cDNA encoding the R1-MYB transcription factor, designated as JcR1MYB1, was isolated from Jatropha curcas using rapid amplification of cDNA ends. JcR1MYB1 contains a 951 bp open reading frame that encodes 316 amino acids. The deduced JcR1MYB1 protein was predicted to possess the conserved, 56-amino acid-long DNA-binding domain, which consists of a single helix-turn-helix module and usually occurs in R1-MYBs. JcR1MYB1 is a member of the R1-MYB transcription factor subfamily. A subcellular localization study confirmed the nuclear localization of JcR1MYB1. Expression analysis showed that JcR1MYB1 transcripts accumulated in various examined tissues, with high expression levels in the root and low levels in the stem. JcR1MYB1 transcription was up-regulated by polyethylene glycol, NaCl, and cold treatments, as well as by abscisic acid, jasmonic acid, and ethylene treatment. Analysis of transgenic tobacco plants over-expressing JcR1MYB1 indicates an inportant function for this gene in salt stress.

  11. Arabidopsis calmodulin-like protein CML36 is a calcium (Ca2+) sensor that interacts with the plasma membrane Ca2+-ATPase isoform ACA8 and stimulates its activity.

    Science.gov (United States)

    Astegno, Alessandra; Bonza, Maria Cristina; Vallone, Rosario; La Verde, Valentina; D'Onofrio, Mariapina; Luoni, Laura; Molesini, Barbara; Dominici, Paola

    2017-09-08

    Calmodulin-like (CML) proteins are major EF-hand-containing, calcium (Ca 2+ )-binding proteins with crucial roles in plant development and in coordinating plant stress tolerance. Given their abundance in plants, the properties of Ca 2+ sensors and identification of novel target proteins of CMLs deserve special attention. To this end, we recombinantly produced and biochemically characterized CML36 from Arabidopsis thaliana We analyzed Ca 2+ and Mg 2+ binding to the individual EF-hands, observed metal-induced conformational changes, and identified a physiologically relevant target. CML36 possesses two high-affinity Ca 2+ /Mg 2+ mixed binding sites and two low-affinity Ca 2+ -specific sites. Binding of Ca 2+ induced an increase in the α-helical content and a conformational change that lead to the exposure of hydrophobic regions responsible for target protein recognition. Cation binding, either Ca 2+ or Mg 2+ , stabilized the secondary and tertiary structures of CML36, guiding a large structural transition from a molten globule apo-state to a compact holoconformation. Importantly, through in vitro binding and activity assays, we showed that CML36 interacts directly with the regulative N terminus of the Arabidopsis plasma membrane Ca 2+ -ATPase isoform 8 (ACA8) and that this interaction stimulates ACA8 activity. Gene expression analysis revealed that CML36 and ACA8 are co-expressed mainly in inflorescences. Collectively, our results support a role for CML36 as a Ca 2+ sensor that binds to and modulates ACA8, uncovering a possible involvement of the CML protein family in the modulation of plant-autoinhibited Ca 2+ pumps. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  12. Identification of the functional binding pocket for compounds targeting small-conductance Ca²⁺-activated potassium channels.

    Science.gov (United States)

    Zhang, Miao; Pascal, John M; Schumann, Marcel; Armen, Roger S; Zhang, Ji-Fang

    2012-01-01

    Small- and intermediate-conductance Ca(2+)-activated potassium channels, activated by Ca(2+)-bound calmodulin, have an important role in regulating membrane excitability. These channels are also linked to clinical abnormalities. A tremendous amount of effort has been devoted to developing small molecule compounds targeting these channels. However, these compounds often suffer from low potency and lack of selectivity, hindering their potential for clinical use. A key contributing factor is the lack of knowledge of the binding site(s) for these compounds. Here we demonstrate by X-ray crystallography that the binding pocket for the compounds of the 1-ethyl-2-benzimidazolinone (1-EBIO) class is located at the calmodulin-channel interface. We show that, based on structure data and molecular docking, mutations of the channel can effectively change the potency of these compounds. Our results provide insight into the molecular nature of the binding pocket and its contribution to the potency and selectivity of the compounds of the 1-EBIO class.

  13. Identification of human microRNA-like sequences embedded within the protein-encoding genes of the human immunodeficiency virus.

    Directory of Open Access Journals (Sweden)

    Bryan Holland

    Full Text Available BACKGROUND: MicroRNAs (miRNAs are highly conserved, short (18-22 nts, non-coding RNA molecules that regulate gene expression by binding to the 3' untranslated regions (3'UTRs of mRNAs. While numerous cellular microRNAs have been associated with the progression of various diseases including cancer, miRNAs associated with retroviruses have not been well characterized. Herein we report identification of microRNA-like sequences in coding regions of several HIV-1 genomes. RESULTS: Based on our earlier proteomics and bioinformatics studies, we have identified 8 cellular miRNAs that are predicted to bind to the mRNAs of multiple proteins that are dysregulated during HIV-infection of CD4+ T-cells in vitro. In silico analysis of the full length and mature sequences of these 8 miRNAs and comparisons with all the genomic and subgenomic sequences of HIV-1 strains in global databases revealed that the first 18/18 sequences of the mature hsa-miR-195 sequence (including the short seed sequence, matched perfectly (100%, or with one nucleotide mismatch, within the envelope (env genes of five HIV-1 genomes from Africa. In addition, we have identified 4 other miRNA-like sequences (hsa-miR-30d, hsa-miR-30e, hsa-miR-374a and hsa-miR-424 within the env and the gag-pol encoding regions of several HIV-1 strains, albeit with reduced homology. Mapping of the miRNA-homologues of env within HIV-1 genomes localized these sequence to the functionally significant variable regions of the env glycoprotein gp120 designated V1, V2, V4 and V5. CONCLUSIONS: We conclude that microRNA-like sequences are embedded within the protein-encoding regions of several HIV-1 genomes. Given that the V1 to V5 regions of HIV-1 envelopes contain specific, well-characterized domains that are critical for immune responses, virus neutralization and disease progression, we propose that the newly discovered miRNA-like sequences within the HIV-1 genomes may have evolved to self-regulate survival of the

  14. Specific DNA binding of a potential transcriptional regulator, inosine 5'-monophosphate dehydrogenase-related protein VII, to the promoter region of a methyl coenzyme m reductase I-encoding operon retrieved from Methanothermobacter thermautotrophicus strain DeltaH.

    Science.gov (United States)

    Shinzato, Naoya; Enoki, Miho; Sato, Hiroaki; Nakamura, Kohei; Matsui, Toru; Kamagata, Yoichi

    2008-10-01

    Two methyl coenzyme M reductases (MCRs) encoded by the mcr and mrt operons of the hydrogenotrophic methanogen Methanothermobacter thermautotrophicus DeltaH are expressed in response to H(2) availability. In the present study, cis elements and trans-acting factors responsible for the gene expression of MCRs were investigated by using electrophoretic mobility shift assay (EMSA) and affinity particle purification. A survey of their operator regions by EMSA with protein extracts from mrt-expressing cultures restricted them to 46- and 41-bp-long mcr and mrt upstream regions, respectively. Affinity particle purification of DNA-binding proteins conjugated with putative operator regions resulted in the retrieval of a protein attributed to IMP dehydrogenase-related protein VII (IMPDH VII). IMPDH VII is predicted to have a winged helix-turn-helix DNA-binding motif and two cystathionine beta-synthase domains, and it has been suspected to be an energy-sensing module. EMSA with oligonucleotide probes with unusual sequences showed that the binding site of IMPDH VII mostly overlaps the factor B-responsible element-TATA box of the mcr operon. The results presented here suggest that IMPDH VII encoded by MTH126 is a plausible candidate for the transcriptional regulator of the mcr operon in this methanogen.

  15. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  16. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  17. Different patterns of gene expression in rice varieties undergoing a ...

    African Journals Online (AJOL)

    Some genes specifically up-regulated in infected 9804-Rxo1 were defenserelated, including the genes encoding pathogenesis-related protein, terpene synthase family, transcription factors (TFs) AP2 domain containing protein, myb-like deoxyribonucleic acid (DNA)- binding domain containing protein, and C2H2-type ...

  18. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  19. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  20. Identification and Phylogenetic Analysis of a CC-NBS-LRR Encoding Gene Assigned on Chromosome 7B of Wheat

    Directory of Open Access Journals (Sweden)

    Xiangqi Zhang

    2013-07-01

    Full Text Available Hexaploid wheat displays limited genetic variation. As a direct A and B genome donor of hexaploid wheat, tetraploid wheat represents an important gene pool for cultivated bread wheat. Many disease resistant genes express conserved domains of the nucleotide-binding site and leucine-rich repeats (NBS-LRR. In this study, we isolated a CC-NBS-LRR gene locating on chromosome 7B from durum wheat variety Italy 363, and designated it TdRGA-7Ba. Its open reading frame was 4014 bp, encoding a 1337 amino acid protein with a complete NBS domain and 18 LRR repeats, sharing 44.7% identity with the PM3B protein. TdRGA-7Ba expression was continuously seen at low levels and was highest in leaves. TdRGA-7Ba has another allele TdRGA-7Bb with a 4 bp deletion at position +1892 in other cultivars of tetraploid wheat. In Ae. speltoides, as a B genome progenitor, both TdRGA-7Ba and TdRGA-7Bb were detected. In all six species of hexaploid wheats (AABBDD, only TdRGA-7Bb existed. Phylogenic analysis showed that all TdRGA-7Bb type genes were grouped in one sub-branch. We speculate that TdRGA-7Bb was derived from a TdRGA-7Ba mutation, and it happened in Ae. speltoides. Both types of TdRGA-7B participated in tetraploid wheat formation. However, only the TdRGA-7Bb was retained in hexaploid wheat.

  1. Facilitation of plateau potentials in turtle motoneurones by a pathway dependent on calcium and calmodulin

    DEFF Research Database (Denmark)

    Perrier, J F; Mejia-Gervacio, S; Hounsgaard, J

    2000-01-01

    1. The involvement of intracellular calcium and calmodulin in the modulation of plateau potentials in motoneurones was investigated using intracellular recordings from a spinal cord slice preparation. 2. Chelation of intracellular calcium with BAPTA-AM or inactivation of calmodulin with W-7 or tr...

  2. Transcriptional activation of the mouse obese (ob) gene by CCAAT/enhancer binding protein alpha

    DEFF Research Database (Denmark)

    Hwang, C S; Mandrup, S; MacDougald, O A

    1996-01-01

    Like other adipocyte genes that are transcriptionally activated by CCAAT/enhancer binding protein alpha (C/EBP alpha) during preadipocyte differentiation, expression of the mouse obese (ob) gene is immediately preceded by the expression of C/EBP alpha. While the 5' flanking region of the mouse ob...... gene contains several consensus C/EBP binding sites, only one of these sites appears to be functional. DNase I cleavage inhibition patterns (footprinting) of the ob gene promoter revealed that recombinant C/EBP alpha, as well as a nuclear factor present in fully differentiated 3T3-L1 adipocytes...... to a consensus C/EBP binding site at nucleotides -55 to -47 generated a specific protein-oligonucleotide complex that was supershifted by antibody against C/EBP alpha. Probes corresponding to two upstream consensus C/EBP binding sites failed to generate protein-oligonucleotide complexes. Cotransfection of a C...

  3. Molecular cloning and tissue expression of the fatty acid-binding protein (Es-FABP gene in female Chinese mitten crab (Eriocheir sinensis

    Directory of Open Access Journals (Sweden)

    He Lin

    2010-09-01

    Full Text Available Abstract Background Fatty acid-binding proteins (FABPs, small cytosolic proteins that function in the uptake and utilization of fatty acids, have been extensively studied in higher vertebrates while invertebrates have received little attention despite similar nutritional requirements during periods of reproductive activity. Results Therefore, a cDNA encoding Eriocheir sinensis FABP (Es-FABP was cloned based upon EST analysis of a hepatopancreas cDNA library. The full length cDNA was 750 bp and encoded a 131 aa polypeptide that was highly homologous to related genes reported in shrimp. The 9108 bp Es-FABP gene contained four exons that were interrupted by three introns, a genomic organization common among FABP multigene family members in vertebrates. Gene expression analysis, as determined by RT-PCR, revealed the presence of Es-FABP transcripts in hepatopancreas, hemocytes, ovary, gills, muscle, thoracic ganglia, heart, and intestine, but not stomach or eyestalk. Real-time quantitative RT-PCR analysis revealed that Es-FABP expression in ovary, hemocytes, and hepatopancreas was dependent on the status of ovarian development, with peak expression observed in January. Conclusions Evidence provided in the present report supports a role of Es-FABP in lipid transport during the period of rapid ovarian growth in E. sinensis, and indirectly confirms the participation of the hepatopancreas, ovary, and hemocytes in lipid nutrient absorption and utilization processes.

  4. H-2RIIBP, a member of the nuclear hormone receptor superfamily that binds to both the regulatory element of major histocompatibility class I genes and the estrogen response element.

    Science.gov (United States)

    Hamada, K; Gleason, S L; Levi, B Z; Hirschfeld, S; Appella, E; Ozato, K

    1989-11-01

    Transcription of major histocompatibility complex (MHC) class I genes is regulated by the conserved MHC class I regulatory element (CRE). The CRE has two factor-binding sites, region I and region II, both of which elicit enhancer function. By screening a mouse lambda gt 11 library with the CRE as a probe, we isolated a cDNA clone that encodes a protein capable of binding to region II of the CRE. This protein, H-2RIIBP (H-2 region II binding protein), bound to the native region II sequence, but not to other MHC cis-acting sequences or to mutant region II sequences, similar to the naturally occurring region II factor in mouse cells. The deduced amino acid sequence of H-2RIIBP revealed two putative zinc fingers homologous to the DNA-binding domain of steroid/thyroid hormone receptors. Although sequence similarity in other regions was minimal, H-2RIIBP has apparent modular domains characteristic of the nuclear hormone receptors. Further analyses showed that both H-2RIIBP and the natural region II factor bind to the estrogen response element (ERE) of the vitellogenin A2 gene. The ERE is composed of a palindrome, and half of this palindrome resembles the region II binding site of the MHC CRE. These results indicate that H-2RIIBP (i) is a member of the superfamily of nuclear hormone receptors and (ii) may regulate not only MHC class I genes but also genes containing the ERE and related sequences. Sequences homologous to the H-2RIIBP gene are widely conserved in the animal kingdom. H-2RIIBP mRNA is expressed in many mouse tissues, in agreement with the distribution of the natural region II factor.

  5. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  6. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  7. Typing of Panton-Valentine Leukocidin-Encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China.

    Science.gov (United States)

    Zhao, Huanqiang; Hu, Fupin; Jin, Shu; Xu, Xiaogang; Zou, Yuhan; Ding, Baixing; He, Chunyan; Gong, Fang; Liu, Qingzhong

    2016-01-01

    Panton-Valentine leukocidin (PVL, encoded by lukSF-PV genes), a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus has been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec) typing, staphylococcal protein A (spa) gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE) typing, accessory gene regulator (agr) locus typing and multilocus sequence typing (MLST). Seventy eight (78/1175, 6.6%) isolates possessed the lukSF-PV genes and 59.0% (46/78) of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n = 13) and ΦPVL (n = 12) were the most prevalent among them. While 25 (25/78, 32.1%) isolates, belonging to ST30, and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs) were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages, and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  8. Typing of Panton-Valentine Leukocidin-encoding Phages and lukSF-PV Gene Sequence Variation in Staphylococcus aureus from China

    Directory of Open Access Journals (Sweden)

    Huanqiang Zhao

    2016-08-01

    Full Text Available Panton-Valentine leucocidin (PVL, encoded by lukSF-PV genes, a bi-component and pore-forming toxin, is carried by different staphylococcal bacteriophages. The prevalence of PVL in Staphylococcus aureus (S. aureus have been reported around the globe. However, the data on PVL-encoding phage types, lukSF-PV gene variation and chromosomal phage insertion sites for PVL-positive S. aureus are limited, especially in China. In order to obtain a more complete understanding of the molecular epidemiology of PVL-positive S. aureus, an integrated and modified PCR-based scheme was applied to detect the PVL-encoding phage types. Phage insertion locus and the lukSF-PV variant were determined by PCR and sequencing. Meanwhile, the genetic background was characterized by staphylococcal cassette chromosome mec (SCCmec typing, staphylococcal protein A (spa gene polymorphisms typing, pulsed-field gel electrophoresis (PFGE typing, accessory gene regulator (agr locus typing and multilocus sequence typing (MLST. Seventy eight (78/1175, 6.6% isolates possessed the lukSF-PV genes and 59.0% (46/78 of PVL-positive strains belonged to CC59 lineage. Eight known different PVL-encoding phage types were detected, and Φ7247PVL/ΦST5967PVL (n=13 and ΦPVL (n=12 were the most prevalent among them. While 25 (25/78, 32.1% isolates, belonging to ST30 and ST59 clones, were unable to be typed by the modified PCR-based scheme. Single nucleotide polymorphisms (SNPs were identified at five locations in the lukSF-PV genes, two of which were non-synonymous. Maximum-likelihood tree analysis of attachment sites sequences detected six SNP profiles for attR and eight for attL, respectively. In conclusion, the PVL-positive S. aureus mainly harbored Φ7247PVL/ΦST5967PVL and ΦPVL in the regions studied. lukSF-PV gene sequences, PVL-encoding phages and phage insertion locus generally varied with lineages. Moreover, PVL-positive clones that have emerged worldwide likely carry distinct phages.

  9. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  10. Inhibition of calmodulin - regulated calcium pump activity in rat brain by toxaphene

    International Nuclear Information System (INIS)

    Trottman, C.H.; Moorthy, K.S.

    1986-01-01

    In vivo effects of toxaphene on calcium pump activity in rat brain synaptosomes was studied. Male Sprague-Dawley rats were dosed with toxaphene at 0,25,50, and 100 mg/kg/day for 3 days and sacrificed 24 h after last dose. Ca 2+ -ATPase activity and 45 Ca uptake were determined in brain P 2 fraction. Toxaphene inhibited both Ca 2+ -ATPase activity and 45 Ca 2+ uptake and the inhibition was dose dependent. Both substrate and Ca 2+ activation kinetics of Ca 2+ -ATPase indicated non-competitive type of inhibition as evidenced by decreased catalytic velocity but not enzyme-substrate affinity. The inhibited Ca 2+ -ATPase activity and Ca 2+ uptake were restored to normal level by exogenously added calmodulin which increased both velocity and affinity. The inhibition of Ca 2+ -ATPase activity and Ca 2+ uptake and restoration by calmodulin suggests that toxaphene may impair active calcium transport mechanisms by decreasing regulator protein calmodulin levels

  11. Genomic sequence and organization of two members of a human lectin gene family

    International Nuclear Information System (INIS)

    Gitt, M.A.; Barondes, S.H.

    1991-01-01

    The authors have isolated and sequenced the genomic DNA encoding a human dimeric soluble lactose-binding lectin. The gene has four exons, and its upstream region contains sequences that suggest control by glucocorticoids, heat (environmental) shock, metals, and other factors. They have also isolated and sequenced three exons of the gene encoding another human putative lectin, the existence of which was first indicated by isolation of its cDNA. Comparisons suggest a general pattern of genomic organization of members of this lectin gene family

  12. The pectin lyase-encoding gene (pnl) family from Glomerella cingulata: characterization of pnlA and its expression in yeast.

    Science.gov (United States)

    Templeton, M D; Sharrock, K R; Bowen, J K; Crowhurst, R N; Rikkerink, E H

    1994-05-03

    Oligodeoxyribonucleotide primers were designed from conserved amino acid (aa) sequences between pectin lyase D (PNLD) from Aspergillus niger and pectate lyases A and E (PELA/E) from Erwinia chrysanthemi. The polymerase chain reaction (PCR) was used with these primers to amplify genomic DNA from the plant pathogenic fungus Glomerella cingulata. Three different 220-bp fragments with homology to PNL-encoding genes from A. niger, and a 320-bp fragment with homology to PEL-encoding genes from Nicotiana tabacum and E. carotovora were cloned. One of the 220-bp PCR products (designated pnlA) was used as a probe to isolate a PNL-encoding gene from a lambda genomic DNA library prepared from G. cingulata. Nucleotide (nt) sequence data revealed that this gene has seven exons and codes for a putative 380-aa protein. The nt sequence of a cDNA clone, prepared using PCR, confirmed the presence of the six introns. The positions of the introns were different from the sites of the five introns present in the three PNL-encoding genes previously sequenced from A. niger. PNLA was synthesised in yeast by cloning the cDNA into the expression vector, pEMBLYex-4, and enzymatically active protein was secreted into the culture medium. Significantly higher expression was achieved when the context of the start codon, CACCATG, was mutated to CAAAATG, a consensus sequence commonly found in highly expressed yeast genes. The produced protein had an isoelectric point (pI) of 9.4, the same as that for the G. cingulata pnlA product.(ABSTRACT TRUNCATED AT 250 WORDS)

  13. Gene expression analysis of FABP4 in gastric cancer

    Directory of Open Access Journals (Sweden)

    Abdulkarim Yasin Karim

    2016-06-01

    Full Text Available Purpose: Gastric cancer has high incidence and mortality rate in several countries and is still one of the most frequent and lethal disease. In this study, we aimed to determine diagnostic markers in gastric cancer by molecular techniques; include mRNA expression analysis of FABP4 gene. Fatty acid binding protein 4 (FABP4 gene encodes the fatty acid binding protein found in adipocytes. The protein encoded by FABP4 are a family of small, highly conserved, cytoplasmic proteins that bind long-chain fatty acids and other hydrophobic ligands. It is thought that FABPs roles include fatty acid uptake, transport, and metabolism. Material and Methods: Total RNA were extracted from paired tumor and normal tissues of 47 gastric cancer. The mRNA expression level of FABP4 was measured employing semi- quantitative reverse transcription- polymerase chain reaction (RT- PCR. Results: The mRNA expression level of FABP4 was significantly decreased (down- regulated. Conclusion: Down-regulation of FABP4 gene seems to occur at the initial steps of gastric cancer development. In order to confirm the relationship between the gastric tumor and FABP4 gene, further analysis like immunohistochemistry and epigenetc techniques are necessary. [Cukurova Med J 2016; 41(2.000: 248-252

  14. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  15. Identification and characterization of genes encoding polycyclic aromatic hydrocarbon dioxygenase and polycyclic aromatic hydrocarbon dihydrodiol dehydrogenase in Pseudomonas putida OUS82.

    OpenAIRE

    Takizawa, N; Kaida, N; Torigoe, S; Moritani, T; Sawada, T; Satoh, S; Kiyohara, H

    1994-01-01

    Naphthalene and phenanthrene are transformed by enzymes encoded by the pah gene cluster of Pseudomonas putida OUS82. The pahA and pahB genes, which encode the first and second enzymes, dioxygenase and cis-dihydrodiol dehydrogenase, respectively, were identified and sequenced. The DNA sequences showed that pahA and pahB were clustered and that pahA consisted of four cistrons, pahAa, pahAb, pahAc, and pahAd, which encode ferredoxin reductase, ferredoxin, and two subunits of the iron-sulfur prot...

  16. Exon organization of the mouse entactin gene corresponds to the structural domains of the polypeptide and has regional homology to the low-density lipoprotein receptor gene

    DEFF Research Database (Denmark)

    Durkin, M E; Wewer, U M; Chung, A E

    1995-01-01

    of the mouse entactin gene closely corresponds to the organization of the polypeptide into distinct structural and functional domains. The two amino-terminal globular domains are encoded by three exons each. Single exons encode the two protease-sensitive, O-glycosylated linking regions. The six EGF......Entactin is a widespread basement membrane protein of 150 kDa that binds to type IV collagen and laminin. The complete exon-intron structure of the mouse entactin gene has been determined from lambda genomic DNA clones. The gene spans at least 65 kb and contains 20 exons. The exon organization...

  17. Cloning and characterization of the ddc homolog encoding L-2,4-diaminobutyrate decarboxylase in Enterobacter aerogenes.

    Science.gov (United States)

    Yamamoto, S; Mutoh, N; Tsuzuki, D; Ikai, H; Nakao, H; Shinoda, S; Narimatsu, S; Miyoshi, S I

    2000-05-01

    L-2,4-diaminobutyrate decarboxylase (DABA DC) catalyzes the formation of 1,3-diaminopropane (DAP) from DABA. In the present study, the ddc gene encoding DABA DC from Enterobacter aerogenes ATCC 13048 was cloned and characterized. Determination of the nucleotide sequence revealed an open reading frame of 1470 bp encoding a 53659-Da protein of 490 amino acids, whose deduced NH2-terminal sequence was identical to that of purified DABA DC from E. aerogenes. The deduced amino acid sequence was highly similar to those of Acinetobacter baumannii and Haemophilus influenzae DABA DCs encoded by the ddc genes. The lysine-307 of the E. aerogenes DABA DC was identified as the pyridoxal 5'-phosphate binding residue by site-directed mutagenesis. Furthermore, PCR analysis revealed the distribution of E. aerogenes ddc homologs in some other species of Enterobacteriaceae. Such a relatively wide occurrence of the ddc homologs implies biological significance of DABA DC and its product DAP.

  18. The Riemerella anatipestifer AS87_01735 Gene Encodes Nicotinamidase PncA, an Important Virulence Factor.

    Science.gov (United States)

    Wang, Xiaolan; Liu, Beibei; Dou, Yafeng; Fan, Hongjie; Wang, Shaohui; Li, Tao; Ding, Chan; Yu, Shengqing

    2016-10-01

    Riemerella anatipestifer is a major bacterial pathogen that causes septicemic and exudative diseases in domestic ducks. In our previous study, we found that deletion of the AS87_01735 gene significantly decreased the bacterial virulence of R. anatipestifer strain Yb2 (mutant RA625). The AS87_01735 gene was predicted to encode a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, the AS87_01735 gene was expressed and identified as the PncA-encoding gene, using an enzymatic assay. Western blot analysis demonstrated that R. anatipestifer PncA was localized to the cytoplasm. The mutant strain RA625 (named Yb2ΔpncA in this study) showed a similar growth rate but decreased NAD(+) quantities in both the exponential and stationary phases in tryptic soy broth culture, compared with the wild-type strain Yb2. In addition, Yb2ΔpncA-infected ducks showed much lower bacterial loads in their blood, and no visible histological changes were observed in the heart, liver, and spleen. Furthermore, Yb2ΔpncA immunization of ducks conferred effective protection against challenge with the virulent wild-type strain Yb2. Our results suggest that the R. anatipestifer AS87_01735 gene encodes PncA, which is an important virulence factor, and that the Yb2ΔpncA mutant can be used as a novel live vaccine candidate. Riemerella anatipestifer is reported worldwide as a cause of septicemic and exudative diseases of domestic ducks. The pncA gene encodes a nicotinamidase (PncA), a key enzyme that catalyzes the conversion of nicotinamide to nicotinic acid, which is an important reaction in the NAD(+) salvage pathway. In this study, we identified and characterized the pncA-homologous gene AS87_01735 in R. anatipestifer strain Yb2. R. anatipestifer PncA is a cytoplasmic protein that possesses similar PncA activity, compared with other organisms. Generation of the pncA mutant Yb

  19. Did androgen-binding protein paralogs undergo neo- and/or Subfunctionalization as the Abp gene region expanded in the mouse genome?

    Science.gov (United States)

    Karn, Robert C; Chung, Amanda G; Laukaitis, Christina M

    2014-01-01

    The Androgen-binding protein (Abp) region of the mouse genome contains 30 Abpa genes encoding alpha subunits and 34 Abpbg genes encoding betagamma subunits, their products forming dimers composed of an alpha and a betagamma subunit. We endeavored to determine how many Abp genes are expressed as proteins in tears and saliva, and as transcripts in the exocrine glands producing them. Using standard PCR, we amplified Abp transcripts from cDNA libraries of C57BL/6 mice and found fifteen Abp gene transcripts in the lacrimal gland and five in the submandibular gland. Proteomic analyses identified proteins corresponding to eleven of the lacrimal gland transcripts, all of them different from the three salivary ABPs reported previously. Our qPCR results showed that five of the six transcripts that lacked corresponding proteins are expressed at very low levels compared to those transcripts with proteins. We found 1) no overlap in the repertoires of expressed Abp paralogs in lacrimal gland/tears and salivary glands/saliva; 2) substantial sex-limited expression of lacrimal gland/tear expressed-paralogs in males but no sex-limited expression in females; and 3) that the lacrimal gland/tear expressed-paralogs are found exclusively in ancestral clades 1, 2 and 3 of the five clades described previously while the salivary glands/saliva expressed-paralogs are found only in clade 5. The number of instances of extremely low levels of transcription without corresponding protein production in paralogs specific to tears and saliva suggested the role of subfunctionalization, a derived condition wherein genes that may have been expressed highly in both glands ancestrally were down-regulated subsequent to duplication. Thus, evidence for subfunctionalization can be seen in our data and we argue that the partitioning of paralog expression between lacrimal and salivary glands that we report here occurred as the result of adaptive evolution.

  20. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  1. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  2. Single Nucleotide Polymorphism in Gene Encoding Transcription Factor Prep1 Is Associated with HIV-1-Associated Dementia

    Science.gov (United States)

    van Manen, Daniëlle; Bunnik, Evelien M.; van Sighem, Ard I.; Sieberer, Margit; Boeser-Nunnink, Brigitte; de Wolf, Frank; Schuitemaker, Hanneke; Portegies, Peter; Kootstra, Neeltje A.; van 't Wout, Angélique B.

    2012-01-01

    Background Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD). While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. Methods We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs) affecting HIV-1 replication in macrophages in vitro were also tested. Results The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2×10−5). Prep1 has recently been identified as a transcription factor preferentially binding the −2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. Conclusion These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders. PMID:22347417

  3. Single nucleotide polymorphism in gene encoding transcription factor Prep1 is associated with HIV-1-associated dementia.

    Directory of Open Access Journals (Sweden)

    Sebastiaan M Bol

    Full Text Available BACKGROUND: Infection with HIV-1 may result in severe cognitive and motor impairment, referred to as HIV-1-associated dementia (HAD. While its prevalence has dropped significantly in the era of combination antiretroviral therapy, milder neurocognitive disorders persist with a high prevalence. To identify additional therapeutic targets for treating HIV-associated neurocognitive disorders, several candidate gene polymorphisms have been evaluated, but few have been replicated across multiple studies. METHODS: We here tested 7 candidate gene polymorphisms for association with HAD in a case-control study consisting of 86 HAD cases and 246 non-HAD AIDS patients as controls. Since infected monocytes and macrophages are thought to play an important role in the infection of the brain, 5 recently identified single nucleotide polymorphisms (SNPs affecting HIV-1 replication in macrophages in vitro were also tested. RESULTS: The CCR5 wt/Δ32 genotype was only associated with HAD in individuals who developed AIDS prior to 1991, in agreement with the observed fading effect of this genotype on viral load set point. A significant difference in genotype distribution among all cases and controls irrespective of year of AIDS diagnosis was found only for a SNP in candidate gene PREP1 (p = 1.2 × 10(-5. Prep1 has recently been identified as a transcription factor preferentially binding the -2,518 G allele in the promoter of the gene encoding MCP-1, a protein with a well established role in the etiology of HAD. CONCLUSION: These results support previous findings suggesting an important role for MCP-1 in the onset of HIV-1-associated neurocognitive disorders.

  4. CCAAT/enhancer-binding proteins regulate expression of the human steroidogenic acute regulatory protein (StAR) gene.

    Science.gov (United States)

    Christenson, L K; Johnson, P F; McAllister, J M; Strauss, J F

    1999-09-10

    Two putative CCAAT/enhancer-binding protein (C/EBP) response elements were identified in the proximal promoter of the human steroidogenic acute regulatory protein (StAR) gene, which encodes a key protein-regulating steroid hormone synthesis. Expression of C/EBPalpha and -beta increased StAR promoter activity in COS-1 and HepG2 cells. Cotransfection of C/EBPalpha or -beta and steroidogenic factor 1, a transcription factor required for cAMP regulation of StAR expression, into COS-1 augmented 8-bromoadenosine 3':5'-cyclic monophosphate (8-Br-cAMP)-stimulated promoter activity. When the putative C/EBP response elements were mutated, individually or together, a pronounced decline in basal StAR promoter activity in human granulosa-lutein cells resulted, but the fold stimulation of promoter activity by 8-Br-cAMP was unaffected. Recombinant C/EBPalpha and -beta bound to the two identified sequences but not the mutated elements. Human granulosa-lutein cell nuclear extracts also bound these elements but not the mutated sequences. An antibody to C/EBPbeta, but not C/EBPalpha, supershifted the nuclear protein complex associated with the more distal element. The complex formed by nuclear extracts with the proximal element was not supershifted by either antibody. Western blot analysis revealed the presence of C/EBPalpha and C/EBPbeta in human granulosa-lutein cell nuclear extracts. C/EBPbeta levels were up-regulated 3-fold by 8-Br-cAMP treatment. Our studies demonstrate a role for C/EBPbeta as well as yet to be identified proteins, which can bind to C/EBP response elements, in the regulation of StAR gene expression and suggest a mechanism by which C/EBPbeta participates in the cAMP regulation of StAR gene transcription.

  5. Screening a yeast promoter library leads to the isolation of the RP29/L32 and SNR17B/RPL37A divergent promoters and the discovery of a gene encoding ribosomal protein L37.

    Science.gov (United States)

    Santangelo, G M; Tornow, J; McLaughlin, C S; Moldave, K

    1991-08-30

    Two promoters (A7 and A23), isolated at random from the Saccharomyces cerevisiae genome by virtue of their capacity to activate transcription, are identical to known intergenic bidirectional promoters. Sequence analysis of the genomic DNA adjacent to the A7 promoter identified a split gene encoding ribosomal (r) protein L37, which is homologous to the tRNA-binding r-proteins, L35a (from human and rat) and L32 (from frogs).

  6. Drosophila TDP-43 RNA-Binding Protein Facilitates Association of Sister Chromatid Cohesion Proteins with Genes, Enhancers and Polycomb Response Elements.

    Directory of Open Access Journals (Sweden)

    Amanda Swain

    2016-09-01

    Full Text Available The cohesin protein complex mediates sister chromatid cohesion and participates in transcriptional control of genes that regulate growth and development. Substantial reduction of cohesin activity alters transcription of many genes without disrupting chromosome segregation. Drosophila Nipped-B protein loads cohesin onto chromosomes, and together Nipped-B and cohesin occupy essentially all active transcriptional enhancers and a large fraction of active genes. It is unknown why some active genes bind high levels of cohesin and some do not. Here we show that the TBPH and Lark RNA-binding proteins influence association of Nipped-B and cohesin with genes and gene regulatory sequences. In vitro, TBPH and Lark proteins specifically bind RNAs produced by genes occupied by Nipped-B and cohesin. By genomic chromatin immunoprecipitation these RNA-binding proteins also bind to chromosomes at cohesin-binding genes, enhancers, and Polycomb response elements (PREs. RNAi depletion reveals that TBPH facilitates association of Nipped-B and cohesin with genes and regulatory sequences. Lark reduces binding of Nipped-B and cohesin at many promoters and aids their association with several large enhancers. Conversely, Nipped-B facilitates TBPH and Lark association with genes and regulatory sequences, and interacts with TBPH and Lark in affinity chromatography and immunoprecipitation experiments. Blocking transcription does not ablate binding of Nipped-B and the RNA-binding proteins to chromosomes, indicating transcription is not required to maintain binding once established. These findings demonstrate that RNA-binding proteins help govern association of sister chromatid cohesion proteins with genes and enhancers.

  7. Fluorescence Spectra Studies on the Interaction between Lanthanides and Calmodulin

    Institute of Scientific and Technical Information of China (English)

    1999-01-01

    The conformation of Calmodulin(CaM) induced by lanthanides has been examined using fluorescence methods.With the addition of lanthanide (Ln3+), the intrinsic fluorescence intensity of CaM without calcium ions (Apo-CaM) first increases and then decreases.Ln3+ causes the decrease of intrinsic fluorescence intensity of calcium saturated CaM (Ca2+4-CaM) only at high concentrations.At low concentrations, Ln3+ results not only in the enhancement of fluorescence intensity of Apo-CaM, but also in a blue shift of the maximum emission wavelengh of dansyl labeled calmodulin(Apo-D-CaM).The molecular mechanism of the interaction between Ln3+ and CaM has been discussed in the light of the fluorescence spectra.

  8. [Molecular cloning and characterization of cDNA of the rpc10+ gene encoding the smallest subunit of nuclear RNA polymerases of Schizosaccharomyces pombe].

    Science.gov (United States)

    Shpakovskiĭ, G V; Lebedenko, E N

    1997-05-01

    The full-length cDNA of the rpc10+ gene encoding mini-subunit Rpc10, which is common for all three nuclear RNA polymerases of the fission yeast Schizosaccharomyces pombe, was cloned and sequenced. The Rpc10 subunit of Sz. pombe and its homologs from S. cerevisiae and H. sapiens are positively charged proteins with a highly conserved C-terminal region and an invariant zinc-binding domain (Zn-finger) of a typical amino acid composition: YxCx2Cx12RCx2CGxR. Functional tests of heterospecific complementation, using tetrad analysis or plasmid shuffling, showed that the Rpc10 subunit of Sz. pombe can successfully replace the homologous ABC10 alpha subunit in nuclear RNA polymerases I-III of S. cerevisiae.

  9. Disruption and analysis of the clpB, clpC, and clpE genes in Lactococcus lactis: ClpE, a new Clp family in gram-positive bacteria

    DEFF Research Database (Denmark)

    Ingmer, Hanne; Vogensen, Finn K.; Hammer, Karin

    1999-01-01

    In the genome of the gram-positive bacterium Lactococcus lactis MG1363, we have identified three genes (clpC, clpE, and clpB) which encode Clp proteins containing two conserved ATP binding domains. The proteins encoded by two of the genes belong to the previously described ClpB and ClpC families....... The clpE gene, however, encodes a member of a new Clp protein family that is characterized by a short N-terminal domain including a putative zinc binding domain (-CX2CX22CX2C-). Expression of the 83-kDa ClpE protein as well as of the two proteins encoded by clpB was strongly induced by heat shock and...... was shown to participate in the degradation of randomly folded proteins in L. lactis, could be necessary for degrading proteins generated by certain types of stress....

  10. Biomimetic conformation-specific assembly of proteins at artificial binding sites nano-patterned on silicon

    Science.gov (United States)

    de la Rica, Roberto; Matsui, Hiroshi

    2009-01-01

    Biomolecules such as enzymes and antibodies possess binding sites where the molecular architecture and the physicochemical properties are optimum for their interaction with a particular target, in some cases even differentiating between stereoisomers. Here, we mimic this exquisite specificity via the creation of a suitable chemical environment by fabricating artificial binding sites for the protein calmodulin (CaM). By downscaling well-known surface chemical modification methodologies to the nanometer scale via silicon nanopatterning, the Ca2+-CaM conformer was found to selectively bind the biomimetic binding sites. The methodology could be adapted to mimic other protein-receptor interactions for sensing and catalysis. PMID:19757782

  11. A burst of ABC genes in the genome of the polyphagous spider mite Tetranychus urticae

    NARCIS (Netherlands)

    Dermauw, W.; Osborne, E.J.; Clark, R.M.; Grbić, M.; Tirry, L.; Van Leeuwen, T.

    2013-01-01

    Background: The ABC (ATP-binding cassette) gene superfamily is widespread across all living species. The majority of ABC genes encode ABC transporters, which are membrane-spanning proteins capable of transferring substrates across biological membranes by hydrolyzing ATP. Although ABC transporters

  12. Engineered resistance and hypersusceptibility through functional metabolic studies of 100 genes in soybean to its major pathogen, the soybean cyst nematode.

    Science.gov (United States)

    Matthews, Benjamin F; Beard, Hunter; MacDonald, Margaret H; Kabir, Sara; Youssef, Reham M; Hosseini, Parsa; Brewer, Eric

    2013-05-01

    During pathogen attack, the host plant induces genes to ward off the pathogen while the pathogen often produces effector proteins to increase susceptibility of the host. Gene expression studies of syncytia formed in soybean root by soybean cyst nematode (Heterodera glycines) identified many genes altered in expression in resistant and susceptible roots. However, it is difficult to assess the role and impact of these genes on resistance using gene expression patterns alone. We selected 100 soybean genes from published microarray studies and individually overexpressed them in soybean roots to determine their impact on cyst nematode development. Nine genes reduced the number of mature females by more than 50 % when overexpressed, including genes encoding ascorbate peroxidase, β-1,4-endoglucanase, short chain dehydrogenase, lipase, DREPP membrane protein, calmodulin, and three proteins of unknown function. One gene encoding a serine hydroxymethyltransferase decreased the number of mature cyst nematode females by 45 % and is located at the Rhg4 locus. Four genes increased the number of mature cyst nematode females by more than 200 %, while thirteen others increased the number of mature cyst nematode females by more than 150 %. Our data support a role for auxin and ethylene in susceptibility of soybean to cyst nematodes. These studies highlight the contrasting gene sets induced by host and nematode during infection and provide new insights into the interactions between host and pathogen at the molecular level. Overexpression of some of these genes result in a greater decrease in the number of cysts formed than recognized soybean cyst nematode resistance loci.

  13. CDNA encoding a polypeptide including a hevein sequence

    Science.gov (United States)

    Raikhel, Natasha V.; Broekaert, Willem F.; Chua, Nam-Hai; Kush, Anil

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  14. Modulation of expression of genes encoding nuclear proteins following exposure to JANUS neutrons or γ-rays

    International Nuclear Information System (INIS)

    Woloschak, G.E.; Chang-Liu, Chin-Mei

    1994-01-01

    Previous work has shown that exposure of cells to ionizing radiations causes modulation of a variety of genes, including those encoding c-fos, interleukin-1, tumor necrosis factor, cytoskeletal elements, and many more. The experiments reported herein were designed to examine the effects of either JANUS neutron or γ-ray exposure on expression of genes encoding nucleus-associated proteins (H4-histone, c-jun, c-myc, Rb, and p53). Cycling Syrian hamster embryo cells were irradiated with varying doses and dose rates of either JANUS fission-spectrum neutrons or γ-rays; after incubation of the cell cultures for 1 h following radiation exposure, mRNA was harvested and analyzed by Northern blot. Results revealed induction of transcripts for c-jun, H4-histone, and Rb following γ-ray but not following neutron exposure. Interestingly, expression of c-myc was repressed following γ-ray but not following neutron exposure. Radiations at different doses and dose rates were compared for each of the genes studied

  15. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  16. Properties of the periplasmic ModA molybdate-binding protein of Escherichia coli.

    Science.gov (United States)

    Rech, S; Wolin, C; Gunsalus, R P

    1996-02-02

    The modABCD operon, located at 17 min on the Escherichia coli chromosome, encodes the protein components of a high affinity molybdate uptake system. Sequence analysis of the modA gene (GenBank L34009) predicts that it encodes a periplasmic binding protein based on the presence of a leader-like sequence at its N terminus. To examine the properties of the ModA protein, the modA structural gene was overexpressed, and its product was purified. The ModA protein was localized to the periplasmic space of the cell, and it was released following a gentle osmotic shock. The N-terminal sequence of ModA confirmed that a leader region of 24 amino acids was removed upon export from the cell. The apparent size of ModA is 31.6 kDa as determined by gel sieve chromatography, whereas it is 22.5 kDa when examined by SDS-polyacrylamide gel electrophoresis. A ligand-dependent protein mobility shift assay was devised using a native polyacrylamide gel electrophoresis protocol to examine binding of molybdate and other anions to the ModA periplasmic protein. Whereas molybdate and tungstate were bound with high affinity (approximately 5 microM), sulfate, chromate, selenate, phosphate, and chlorate did not bind even when tested at 2 mM. A UV spectral assay revealed apparent Kd values of binding for molybdate and tungstate of 3 and 7 microM, respectively. Strains defective in the modA gene were unable to transport molybdate unless high levels of the anion were supplied in the medium. Therefore the modA gene product is essential for high affinity molybdate uptake by the cell. Tungstate interference of molybdate acquisition by the cell is apparently due in part to the high affinity of the ModA protein for this anion.

  17. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  18. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  19. DNA-binding proteins regulating pIP501 transfer and replication

    Directory of Open Access Journals (Sweden)

    Elisabeth Grohmann

    2016-08-01

    Full Text Available pIP501 is a Gram-positive broad-host-range model plasmid intensively used for studying plasmid replication and conjugative transfer. It is a multiple antibiotic resistance plasmid frequently found in clinical Enterococcus faecalis and Enterococcus faecium isolates. Replication of pIP501 proceeds unidirectionally by a theta mechanism. The minimal replicon of pIP501 is composed of the repR gene encoding the essential rate-limiting replication initiator protein RepR and the origin of replication, oriR, located downstream of repR. RepR is similar to RepE of related streptococcal plasmid pAMβ1, which has been shown to possess RNase activity cleaving free RNA molecules in close proximity of the initiation site of DNA synthesis. Replication of pIP501 is controlled by the concerted action of a small protein, CopR, and an antisense RNA, RNAIII. CopR has a dual role: It acts as transcriptional repressor at the repR promoter and prevents convergent transcription of RNAIII and repR mRNA (RNAII, thereby indirectly increasing RNAIII synthesis. CopR binds asymmetrically as a dimer at two consecutive binding sites upstream of and overlapping with the repR promoter. RNAIII induces transcriptional attenuation within the leader region of the repR mRNA (RNAII. Deletion of either control component causes a 10- to 20-fold increase of plasmid copy number, while simultaneous deletions have no additional effect. Conjugative transfer of pIP501 depends on a type IV secretion system (T4SS encoded in a single operon. Its transfer host-range is considerably broad, as it has been transferred to virtually all Gram-positive bacteria including filamentous streptomycetes and even the Gram-negative Escherichia coli. Expression of the 15 genes encoding the T4SS is tightly controlled by binding of the relaxase TraA, the transfer initiator protein, to the operon promoter, which overlaps with the origin of transfer (oriT. The T4SS operon encodes the DNA-binding proteins TraJ (VirD4

  20. Nucleotide sequences of two genomic DNAs encoding peroxidase of Arabidopsis thaliana.

    Science.gov (United States)

    Intapruk, C; Higashimura, N; Yamamoto, K; Okada, N; Shinmyo, A; Takano, M

    1991-02-15

    The peroxidase (EC 1.11.1.7)-encoding gene of Arabidopsis thaliana was screened from a genomic library using a cDNA encoding a neutral isozyme of horseradish, Armoracia rusticana, peroxidase (HRP) as a probe, and two positive clones were isolated. From the comparison with the sequences of the HRP-encoding genes, we concluded that two clones contained peroxidase-encoding genes, and they were named prxCa and prxEa. Both genes consisted of four exons and three introns; the introns had consensus nucleotides, GT and AG, at the 5' and 3' ends, respectively. The lengths of each putative exon of the prxEa gene were the same as those of the HRP-basic-isozyme-encoding gene, prxC3, and coded for 349 amino acids (aa) with a sequence homology of 89% to that encoded by prxC3. The prxCa gene was very close to the HRP-neutral-isozyme-encoding gene, prxC1b, and coded for 354 aa with 91% homology to that encoded by prxC1b. The aa sequence homology was 64% between the two peroxidases encoded by prxCa and prxEa.

  1. Modulation of myometrium mitochondrial membrane potential by calmodulin antagonists

    Directory of Open Access Journals (Sweden)

    S. G. Shlykov

    2014-02-01

    Full Text Available Influence of calmodulin antagonists on mitochondrial membrane potential was investigated using­ a flow cytometry method, confocal microscopy and fluorescent potential-sensitive probes TMRM and MTG. Influence of different concentrations of calmodulin antagonists on mitochondrial membrane potential was studied using flow cytometry method and a fraction of myometrium mitochondria of unpregnant rats. It was shown that 1-10 µМ calmidazolium gradually reduced mitochondria membrane potential. At the same time 10-100 µМ trifluope­razine influenced as follows: 10 µМ – increased polarization, while 100 µМ – caused almost complete depolarization of mitochondrial membranes. In experiments which were conducted with the use of confocal microscopy method and myometrium cells it was shown, that MTG addition to the incubation medium­ led to the appearance of fluorescence signal in a green range. Addition of the second probe (ТМRM resulted in the appearance of fluorescent signal in a red range. Mitochondrial membrane depolarization by 1µМ СССР or 10 mМ NaN3 was accompanied by the decline of “red” fluo­rescence intensity, “green” fluorescence was kept. The 10-15 minute incubation of myometrium cells in the presen­ce 10 µМ calmidazolium or 100 µМ trifluoperazine was accompanied by almost complete decrease of the TMRM fluorescent signal. Thus, with the use of potential-sensitive fluorescent probes TMRM and MTG it was shown, that calmodulin antagonists modulate mitochondrial membrane potential of myometrium cells.

  2. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  3. Immunoglobulin superfamily members encoded by viruses and their multiple roles in immune evasion.

    Science.gov (United States)

    Farré, Domènec; Martínez-Vicente, Pablo; Engel, Pablo; Angulo, Ana

    2017-05-01

    Pathogens have developed a plethora of strategies to undermine host immune defenses in order to guarantee their survival. For large DNA viruses, these immune evasion mechanisms frequently rely on the expression of genes acquired from host genomes. Horizontally transferred genes include members of the immunoglobulin superfamily, whose products constitute the most diverse group of proteins of vertebrate genomes. Their promiscuous immunoglobulin domains, which comprise the building blocks of these molecules, are involved in a large variety of functions mediated by ligand-binding interactions. The flexible structural nature of the immunoglobulin domains makes them appealing targets for viral capture due to their capacity to generate high functional diversity. Here, we present an up-to-date review of immunoglobulin superfamily gene homologs encoded by herpesviruses, poxviruses, and adenoviruses, that include CD200, CD47, Fc receptors, interleukin-1 receptor 2, interleukin-18 binding protein, CD80, carcinoembryonic antigen-related cell adhesion molecules, and signaling lymphocyte activation molecules. We discuss their distinct structural attributes, binding properties, and functions, shaped by evolutionary pressures to disarm specific immune pathways. We include several novel genes identified from extensive genome database surveys. An understanding of the properties and modes of action of these viral proteins may guide the development of novel immune-modulatory therapeutic tools. © 2017 WILEY-VCH Verlag GmbH & Co. KGaA, Weinheim.

  4. Shared CaM- and S100A1-binding epitopes in the distal TRPM4 N terminus

    Czech Academy of Sciences Publication Activity Database

    Boušová, Kristýna; Heřman, P.; Večeř, J.; Bednárová, Lucie; Monincová, Lenka; Majer, Pavel; Vyklický, L.; Vondrášek, Jiří; Teisinger, J.

    2018-01-01

    Roč. 285, č. 3 (2018), s. 599-613 ISSN 1742-464X Institutional support: RVO:61388963 Keywords : calmodulin * fluorescence anisotropy * ligand-binding domains * S100A1 * TRPM4 channel Subject RIV: CE - Biochemistry OBOR OECD: Biochemistry and molecular biology Impact factor: 3.902, year: 2016

  5. Involvement of the VDE homing endonuclease and rapamycin in regulation of the Saccharomyces cerevisiae GSH11 gene encoding the high affinity glutathione transporter.

    Science.gov (United States)

    Miyake, Tsuyoshi; Hiraishi, Hiroyuki; Sammoto, Hiroyuki; Ono, Bun-Ichiro

    2003-10-10

    The Saccharomyces cerevisiae gene HGT1/GSH11 encodes the high affinity glutathione transporter and is repressed by cysteine added to the culture medium. It has been found previously that a 5'-upstream cis-element, CCGCCACAC, is responsible for regulating GSH11 expression and that several proteins bind to this element (Miyake, T., Kanayama, M., Sammoto, H., and Ono, B. (2002) Mol. Genet. Genomics 266, 1004-1011). In this report we present evidence that the most prominent of these proteins is VDE, known previously as the homing endonuclease encoded by VMA1. We show also that GSH11 is not expressed in a VDE-deleted strain and that inability to express the GSH11 of this strain is overcome by introduction of the coding region of VDE or the entire VMA1 gene. It is also found that VDE does not cut DNA in the vicinity of the GSH11 cis-element. Rapamycin, an inhibitor of the target of rapamycin (TOR) signal-transduction system, is found to enhance expression of GSH11 in a VDE-dependent manner under conditions of sulfur starvation. These results indicate that GSH11 is regulated by a system sensitive to sulfur starvation (presumably via cysteine depletion) and a more general system involving the nutritional starvation signal mediated by the TOR system. Both systems need to be operational (inhibition of TOR and sulfur starvation) for full expression of GSH11.

  6. Genetic variants alter T-bet binding and gene expression in mucosal inflammatory disease.

    Directory of Open Access Journals (Sweden)

    Katrina Soderquest

    2017-02-01

    Full Text Available The polarization of CD4+ T cells into distinct T helper cell lineages is essential for protective immunity against infection, but aberrant T cell polarization can cause autoimmunity. The transcription factor T-bet (TBX21 specifies the Th1 lineage and represses alternative T cell fates. Genome-wide association studies have identified single nucleotide polymorphisms (SNPs that may be causative for autoimmune diseases. The majority of these polymorphisms are located within non-coding distal regulatory elements. It is considered that these genetic variants contribute to disease by altering the binding of regulatory proteins and thus gene expression, but whether these variants alter the binding of lineage-specifying transcription factors has not been determined. Here, we show that SNPs associated with the mucosal inflammatory diseases Crohn's disease, ulcerative colitis (UC and celiac disease, but not rheumatoid arthritis or psoriasis, are enriched at T-bet binding sites. Furthermore, we identify disease-associated variants that alter T-bet binding in vitro and in vivo. ChIP-seq for T-bet in individuals heterozygous for the celiac disease-associated SNPs rs1465321 and rs2058622 and the IBD-associated SNPs rs1551398 and rs1551399, reveals decreased binding to the minor disease-associated alleles. Furthermore, we show that rs1465321 is an expression quantitative trait locus (eQTL for the neighboring gene IL18RAP, with decreased T-bet binding associated with decreased expression of this gene. These results suggest that genetic polymorphisms may predispose individuals to mucosal autoimmune disease through alterations in T-bet binding. Other disease-associated variants may similarly act by modulating the binding of lineage-specifying transcription factors in a tissue-selective and disease-specific manner.

  7. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  8. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  9. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  10. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes.

    Science.gov (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M

    2017-08-01

    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  11. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  12. The use of dansyl-calmodulin to study interactions with channels and other proteins.

    Science.gov (United States)

    Alaimo, Alessandro; Malo, Covadonga; Areso, Pilar; Aloria, Kerman; Millet, Oscar; Villarroel, Alvaro

    2013-01-01

    Steady-state fluorescence spectroscopy is a biophysical technique widely employed to characterize -interactions between proteins in vitro. Only a few proteins naturally fluoresce in cells, but by covalently attaching fluorophores virtually all proteins can be monitored. One of the first extrinsic fluorescent probes to be developed, and that is still in use, is dansyl chloride. We have used this method to monitor the interaction of a variety of proteins, including ion channels, with the Ca(2+)-dependent regulatory protein calmodulin. Here we describe the preparation and use of dansyl-calmodulin (D-CaM).

  13. Plant responses to environmental stress: regulation and functions of the Arabidopsis TCH genes

    Science.gov (United States)

    Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.; McIntire, L. V. (Principal Investigator)

    1997-01-01

    Expression of the Arabidopsis TCH genes is markedly upregulated in response to a variety of environmental stimuli including the seemingly innocuous stimulus of touch. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicates that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that at least a subset of the TCH proteins may collaborate in cell wall biogenesis.

  14. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  15. Rapid identification of emerging human-pathogenic Sporothrix species with rolling circle amplification

    Directory of Open Access Journals (Sweden)

    Anderson Messias Rodrigues

    2015-12-01

    Full Text Available Sporothrix infections are emerging as an important human and animal threat among otherwise healthy patients, especially in Brazil and China. Correct identification of sporotrichosis agents is beneficial for epidemiological surveillance, enabling implementation of adequate public-health policies and guiding antifungal therapy. In areas of limited resources where sporotrichosis is endemic, high-throughput detection methods that are specific and sensitive are preferred over phenotypic methods that usually result in misidentification of closely related Sporothrix species. We sought to establish rolling circle amplification (RCA as a low-cost screening tool for species-specific identification of human-pathogenic Sporothrix. We developed six species-specific padlock probes targeting polymorphisms in the gene encoding calmodulin. BLAST-searches revealed candidate probes that were conserved intraspecifically; no significant homology with sequences from humans, mice, plants or microorganisms outside members of Sporothrix were found. The accuracy of our RCA-based assay was demonstrated through the specificity of probe-template binding to 25 S. brasiliensis, 58 S. schenckii, 5 S. globosa, 1 S. luriei, 4 S. mexicana, and 3 S. pallida samples. No cross reactivity between closely related species was evident in vitro, and padlock probes yielded 100% specificity and sensitivity down to 3 x 10 6 copies of the target sequence. RCA-based speciation matched identifications via phylogenetic analysis of the gene encoding calmodulin and the rDNA operon (kappa 1.0; 95% confidence interval 1.0-1.0, supporting its use as a reliable alternative to DNA sequencing. This method is a powerful tool for rapid identification and specific detection of medically relevant Sporothrix, and due to its robustness has potential for ecological studies.

  16. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Directory of Open Access Journals (Sweden)

    Mi Zhao

    Full Text Available We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  17. A Homeodomain Transcription Factor Gene, PfMSX, Activates Expression of Pif Gene in the Pearl Oyster Pinctada fucata

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5′ flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster. PMID:25099698

  18. A homeodomain transcription factor gene, PfMSX, activates expression of Pif gene in the pearl oyster Pinctada fucata.

    Science.gov (United States)

    Zhao, Mi; He, Maoxian; Huang, Xiande; Wang, Qi

    2014-01-01

    We reported pearl oyster Pinctada fucata cDNA and genomic characterization of a new homeobox-containing protein, PfMSX. The PfMSX gene encodes a transcription factor that was localized to the nucleus. Analyses of PfMSX mRNA in tissues and developmental stages showed high expressions in mantle or D-shaped larvae. In electrophoretic mobility shift assays (EMSAs) PfMSX binded to MSX consensus binding sites in the 5' flanking region of the Pif promoter. In co-transfection experiment PfMSX transactivated reporter constructs containing Pif promoter sequences, and mutation of the MSX-binding sites attenuated transactivation. A knockdown experiment using PfMSX dsRNA showed decreased Pif mRNA and unregular crystallization of the nacreous layer using scanning electron microscopy. Our results suggested that PfMSX was a conserved homeodomain transcription factor gene, which can activate Pif gene expression through MSX binding site, and was then involved in the mineralization process in pearl oyster Pinctada fucata. Our data provided important clues about mechanisms regulating biomineralization in pearl oyster.

  19. Cloning and sequencing of a gene encoding a 21-kilodalton outer membrane protein from Bordetella avium and expression of the gene in Salmonella typhimurium.

    Science.gov (United States)

    Gentry-Weeks, C R; Hultsch, A L; Kelly, S M; Keith, J M; Curtiss, R

    1992-01-01

    Three gene libraries of Bordetella avium 197 DNA were prepared in Escherichia coli LE392 by using the cosmid vectors pCP13 and pYA2329, a derivative of pCP13 specifying spectinomycin resistance. The cosmid libraries were screened with convalescent-phase anti-B. avium turkey sera and polyclonal rabbit antisera against B. avium 197 outer membrane proteins. One E. coli recombinant clone produced a 56-kDa protein which reacted with convalescent-phase serum from a turkey infected with B. avium 197. In addition, five E. coli recombinant clones were identified which produced B. avium outer membrane proteins with molecular masses of 21, 38, 40, 43, and 48 kDa. At least one of these E. coli clones, which encoded the 21-kDa protein, reacted with both convalescent-phase turkey sera and antibody against B. avium 197 outer membrane proteins. The gene for the 21-kDa outer membrane protein was localized by Tn5seq1 mutagenesis, and the nucleotide sequence was determined by dideoxy sequencing. DNA sequence analysis of the 21-kDa protein revealed an open reading frame of 582 bases that resulted in a predicted protein of 194 amino acids. Comparison of the predicted amino acid sequence of the gene encoding the 21-kDa outer membrane protein with protein sequences in the National Biomedical Research Foundation protein sequence data base indicated significant homology to the OmpA proteins of Shigella dysenteriae, Enterobacter aerogenes, E. coli, and Salmonella typhimurium and to Neisseria gonorrhoeae outer membrane protein III, Haemophilus influenzae protein P6, and Pseudomonas aeruginosa porin protein F. The gene (ompA) encoding the B. avium 21-kDa protein hybridized with 4.1-kb DNA fragments from EcoRI-digested, chromosomal DNA of Bordetella pertussis and Bordetella bronchiseptica and with 6.0- and 3.2-kb DNA fragments from EcoRI-digested, chromosomal DNA of B. avium and B. avium-like DNA, respectively. A 6.75-kb DNA fragment encoding the B. avium 21-kDa protein was subcloned into the

  20. Impact of methionine oxidation on calmodulin structural dynamics

    Energy Technology Data Exchange (ETDEWEB)

    McCarthy, Megan R.; Thompson, Andrew R.; Nitu, Florentin [Biochemistry, Molecular Biology and Biophysics Department, University of Minnesota, Minneapolis, MN 55455 (United States); Moen, Rebecca J. [Chemistry and Geology Department, Minnesota State University, Mankato, MN 56001 (United States); Olenek, Michael J. [Biology Department, University of Wisconsin, La Crosse, WI 54601 (United States); Klein, Jennifer C., E-mail: jklein@uwlax.edu [Biology Department, University of Wisconsin, La Crosse, WI 54601 (United States); Thomas, David D., E-mail: ddt@umn.edu [Biochemistry, Molecular Biology and Biophysics Department, University of Minnesota, Minneapolis, MN 55455 (United States)

    2015-01-09

    Highlights: • We measured the distance distribution between two spin labels on calmodulin by DEER. • Two structural states, open and closed, were resolved at both low and high Ca. • Ca shifted the equilibrium toward the open state by a factor of 13. • Methionine oxidation, simulated by glutamine substitution, decreased the Ca effect. • These results have important implications for aging in muscle and other tissues. - Abstract: We have used electron paramagnetic resonance (EPR) to examine the structural impact of oxidizing specific methionine (M) side chains in calmodulin (CaM). It has been shown that oxidation of either M109 or M124 in CaM diminishes CaM regulation of the muscle calcium release channel, the ryanodine receptor (RyR), and that mutation of M to Q (glutamine) in either case produces functional effects identical to those of oxidation. Here we have used site-directed spin labeling and double electron–electron resonance (DEER), a pulsed EPR technique that measures distances between spin labels, to characterize the structural changes resulting from these mutations. Spin labels were attached to a pair of introduced cysteine residues, one in the C-lobe (T117C) and one in the N-lobe (T34C) of CaM, and DEER was used to determine the distribution of interspin distances. Ca binding induced a large increase in the mean distance, in concert with previous X-ray crystallography and NMR data, showing a closed structure in the absence of Ca and an open structure in the presence of Ca. DEER revealed additional information about CaM’s structural heterogeneity in solution: in both the presence and absence of Ca, CaM populates both structural states, one with probes separated by ∼4 nm (closed) and another at ∼6 nm (open). Ca shifts the structural equilibrium constant toward the open state by a factor of 13. DEER reveals the distribution of interprobe distances, showing that each of these states is itself partially disordered, with the width of each

  1. Investigation of the role of genes encoding zinc exporters zntA, zitB, and fieF during Salmonella typhimurium infection

    DEFF Research Database (Denmark)

    Huang, Kaisong; Wang, Dan; Frederiksen, Rikki F.

    2018-01-01

    The transition metal zinc is involved in crucial biological processes in all living organisms and is essential for survival of Salmonella in the host. However, little is known about the role of genes encoding zinc efflux transporters during Salmonella infection. In this study, we constructed...... deletion mutants for genes encoding zinc exporters (zntA, zitB, and fieF) in the wild-type (WT) strain Salmonella enterica serovar Typhimurium (S. Typhimurium) 4/74. The mutants 4/74ΔzntA and 4/74ΔzntA/zitB exhibited a dramatic growth delay and abrogated growth ability, respectively, in Luria Bertani...... medium supplemented with 0.25 mM ZnCl2 or 1.5 mM CuSO4 compared to the WT strain. In order to investigate the role of genes encoding zinc exporters on survival of S. Typhimurium inside cells, amoeba and macrophage infection models were used. No significant differences in uptake or survival were detected...

  2. XTH31, Encoding an in Vitro XEH/XET-Active Enzyme, Regulates Aluminum Sensitivity by Modulating in Vivo XET Action, Cell Wall Xyloglucan Content, and Aluminum Binding Capacity in Arabidopsis[W

    Science.gov (United States)

    Zhu, Xiao Fang; Shi, Yuan Zhi; Lei, Gui Jie; Fry, Stephen C.; Zhang, Bao Cai; Zhou, Yi Hua; Braam, Janet; Jiang, Tao; Xu, Xiao Yan; Mao, Chuan Zao; Pan, Yuan Jiang; Yang, Jian Li; Wu, Ping; Zheng, Shao Jian

    2012-01-01

    Xyloglucan endohydrolase (XEH) and xyloglucan endotransglucosylase (XET) activities, encoded by xyloglucan endotransglucosylase-hydrolase (XTH) genes, are involved in cell wall extension by cutting or cutting and rejoining xyloglucan chains, respectively. However, the physiological significance of this biochemical activity remains incompletely understood. Here, we find that an XTH31 T-DNA insertion mutant, xth31, is more Al resistant than the wild type. XTH31 is bound to the plasma membrane and the encoding gene is expressed in the root elongation zone and in nascent leaves, suggesting a role in cell expansion. XTH31 transcript accumulation is strongly downregulated by Al treatment. XTH31 expression in yeast yields a protein with an in vitro XEH:XET activity ratio of >5000:1. xth31 accumulates significantly less Al in the root apex and cell wall, shows remarkably lower in vivo XET action and extractable XET activity, has a lower xyloglucan content, and exhibits slower elongation. An exogenous supply of xyloglucan significantly ameliorates Al toxicity by reducing Al accumulation in the roots, owing to the formation of an Al-xyloglucan complex in the medium, as verified by an obvious change in chemical shift of 27Al-NMR. Taken together, the data indicate that XTH31 affects Al sensitivity by modulating cell wall xyloglucan content and Al binding capacity. PMID:23204407

  3. Effect of long-term actual spaceflight on the expression of key genes encoding serotonin and dopamine system

    Science.gov (United States)

    Popova, Nina; Shenkman, Boris; Naumenko, Vladimir; Kulikov, Alexander; Kondaurova, Elena; Tsybko, Anton; Kulikova, Elisabeth; Krasnov, I. B.; Bazhenova, Ekaterina; Sinyakova, Nadezhda

    The effect of long-term spaceflight on the central nervous system represents important but yet undeveloped problem. The aim of our work was to study the effect of 30-days spaceflight of mice on Russian biosatellite BION-M1 on the expression in the brain regions of key genes of a) serotonin (5-HT) system (main enzymes in 5-HT metabolism - tryptophan hydroxylase-2 (TPH-2), monoamine oxydase A (MAO A), 5-HT1A, 5-HT2A and 5-HT3 receptors); b) pivotal enzymes in DA metabolism (tyrosine hydroxylase, COMT, MAO A, MAO B) and D1, D2 receptors. Decreased expression of genes encoding the 5-HT catabolism (MAO A) and 5-HT2A receptor in some brain regions was shown. There were no differences between “spaceflight” and control mice in the expression of TPH-2 and 5-HT1A, 5-HT3 receptor genes. Significant changes were found in genetic control of DA system. Long-term spaceflight decreased the expression of genes encoding the enzyme in DA synthesis (tyrosine hydroxylase in s.nigra), DA metabolism (MAO B in the midbrain and COMT in the striatum), and D1 receptor in hypothalamus. These data suggested that 1) microgravity affected genetic control of 5-HT and especially the nigrostriatal DA system implicated in the central regulation of muscular tonus and movement, 2) the decrease in the expression of genes encoding key enzyme in DA synthesis, DA degradation and D1 receptor contributes to the movement impairment and dyskinesia produced by the spaceflight. The study was supported by Russian Foundation for Basic Research grant No. 14-04-00173.

  4. Proteins containing the UBA domain are able to bind to multi-ubiquitin chains

    DEFF Research Database (Denmark)

    Wilkinson, C R; Seeger, M; Hartmann-Petersen, R

    2001-01-01

    The UBA domain is a motif found in a variety of proteins, some of which are associated with the ubiquitin-proteasome system. We describe the isolation of a fission-yeast gene, mud1+, which encodes a UBA domain containing protein that is able to bind multi-ubiquitin chains. We show that the UBA do...

  5. A CHROMATIN MODIFYING ENZYME, SDG8, IS REQUIRED FOR MORPHOLOGICAL, GENE EXPRESSION, AND EPIGENETIC RESPONSES TO MECHANICAL STIMULATION

    Directory of Open Access Journals (Sweden)

    Christopher Ian Cazzonelli

    2014-10-01

    Full Text Available Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3, which encodes a calmodulin-like protein (CML12. The gene neighbouring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.

  6. A chromatin modifying enzyme, SDG8, is involved in morphological, gene expression, and epigenetic responses to mechanical stimulation.

    Science.gov (United States)

    Cazzonelli, Christopher I; Nisar, Nazia; Roberts, Andrea C; Murray, Kevin D; Borevitz, Justin O; Pogson, Barry J

    2014-01-01

    Thigmomorphogenesis is viewed as being a response process of acclimation to short repetitive bursts of mechanical stimulation or touch. The underlying molecular mechanisms that coordinate changes in how touch signals lead to long-term morphological changes are enigmatic. Touch responsive gene expression is rapid and transient, and no transcription factor or DNA regulatory motif has been reported that could confer a genome wide mechanical stimulus. We report here on a chromatin modifying enzyme, SDG8/ASHH2, which can regulate the expression of many touch responsive genes identified in Arabidopsis. SDG8 is required for the permissive expression of touch induced genes; and the loss of function of sdg8 perturbs the maximum levels of induction on selected touch gene targets. SDG8 is required to maintain permissive H3K4 trimethylation marks surrounding the Arabidopsis touch-inducible gene TOUCH 3 (TCH3), which encodes a calmodulin-like protein (CML12). The gene neighboring was also slightly down regulated, revealing a new target for SDG8 mediated chromatin modification. Finally, sdg8 mutants show perturbed morphological response to wind-agitated mechanical stimuli, implicating an epigenetic memory-forming process in the acclimation response of thigmomorphogenesis.

  7. A phospho-sugar binding domain homologous to NagB enzymes regulates the activity of the central glycolytic genes repressor.

    Science.gov (United States)

    Doan, Thierry; Martin, Laetitia; Zorrilla, Silvia; Chaix, Denis; Aymerich, Stéphane; Labesse, Gilles; Declerck, Nathalie

    2008-06-01

    CggR belongs to the SorC family of bacterial transcriptional regulators which control the expression of genes and operons involved in carbohydrate catabolism. CggR was first identified in Bacillus subtilis where it represses the gapA operon encoding the five enzymes that catalyze the central part of glycolysis. Here we present a structure/function study demonstrating that the C-terminal region of CggR regulates the DNA binding activity of this repressor in response to binding of a phosphorylated sugar. Molecular modeling of CggR revealed a winged-helix DNA-binding motif followed by a C-terminal domain presenting weak but significant homology with glucosamine-6-phosphate deaminases from the NagB family. In silico ligand screening suggested that the CggR C-terminal domain would bind preferentially bi-phosphorylated compounds, in agreement with previous studies that proposed fructuose-1,6-biphosphate (FBP) as the inducer metabolite. In vitro, FBP was the only sugar compound capable of interfering with CggR cooperative binding to DNA. FBP was also found to protect CggR against trypsin degradation at two arginine residues predicted to reside in a mobile loop forming the active site lid of the NagB enzymes. Replacement of residues predicted to interact with FBP led to mutant CggR with altered repressor activity in vivo but retaining their structural integrity and DNA binding activity in vitro. Interestingly, some of the mutant repressors responded with different specificity towards mono- and di-phospho-fructosides. Based on these results, we propose that the activity of the CggR-like repressors is controlled by a phospho-sugar binding (PSB) domain presenting structural and functional homology with NagB enzymes. (c) 2008 Wiley-Liss, Inc.

  8. Replacement of the folC gene, encoding folylpolyglutamate synthetase-dihydrofolate synthetase in Escherichia coli, with genes mutagenized in vitro.

    Science.gov (United States)

    Pyne, C; Bognar, A L

    1992-03-01

    The folylpolyglutamate synthetase-dihydrofolate synthetase gene (folC) in Escherichia coli was deleted from the bacterial chromosome and replaced by a selectable Kmr marker. The deletion strain required a complementing gene expressing folylpolyglutamate synthetase encoded on a plasmid for viability, indicating that folC is an essential gene in E. coli. The complementing folC gene was cloned into the vector pPM103 (pSC101, temperature sensitive for replication), which segregated spontaneously at 42 degrees C in the absence of selection. This complementing plasmid was replaced in the folC deletion strain by compatible pUC plasmids containing folC genes with mutations generated in vitro, producing strains which express only mutant folylpolyglutamate synthetase. Mutant folC genes expressing insufficient enzyme activity could not complement the chromosomal deletion, resulting in retention of the pPM103 plasmid. Some mutant genes expressing low levels of enzyme activity replaced the complementing plasmid, but the strains produced were auxotrophic for products of folate-dependent pathways. The folylpolyglutamate synthetase gene from Lactobacillus casei, which may lack dihydrofolate synthetase activity, replaced the complementing plasmid, but the strain was auxotrophic for all folate end products.

  9. Isolation and characterization of major histocompatibility complex class IIB genes from the nurse shark.

    OpenAIRE

    Bartl, S; Weissman, I L

    1994-01-01

    The major histocompatibility complex (MHC) contains a set of linked genes which encode cell surface proteins involved in the binding of small peptide antigens for their subsequent recognition by T lymphocytes. MHC proteins share structural features and the presence and location of polymorphic residues which play a role in the binding of antigens. In order to compare the structure of these molecules and gain insights into their evolution, we have isolated two MHC class IIB genes from the nurse...

  10. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  11. Identification, expression profiling and fluorescence-based binding assays of a chemosensory protein gene from the Western flower thrips, Frankliniella occidentalis.

    Directory of Open Access Journals (Sweden)

    Zhi-Ke Zhang

    Full Text Available Using RT-PCR and RACE-PCR strategies, we cloned and identified a new chemosensory protein (FoccCSP from the Western flower thrips, Frankliniella occidentalis, a species for which no chemosensory protein (CSP has yet been identified. The FoccCSP gene contains a 387 bp open-reading frame encoding a putative protein of 128 amino acids with a molecular weight of 14.51 kDa and an isoelectric point of 5.41. The deduced amino acid sequence contains a putative signal peptide of 19 amino acid residues at the N-terminus, as well as the typical four-cysteine signature found in other insect CSPs. As FoccCSP is from a different order of insect than other known CSPs, the GenBank FoccCSP homolog showed only 31-50% sequence identity with them. A neighbor-joining tree was constructed and revealed that FoccCSP is in a group with CSPs from Homopteran insects (e.g., AgosCSP4, AgosCSP10, ApisCSP, and NlugCSP9, suggesting that these genes likely developed from a common ancestral gene. The FoccCSP gene expression profile of different tissues and development stages was measured by quantitative real-time PCR. The results of this analysis revealed this gene is predominantly expressed in the antennae and also highly expressed in the first instar nymph, suggesting a function for FoccCSP in olfactory reception and in particular life activities during the first instar nymph stage. We expressed recombinant FoccCSP protein in a prokaryotic expression system and purified FoccCSP protein by affinity chromatography using a Ni-NTA-Sepharose column. Using N-phenyl-1-naphthylamine (1-NPN as a fluorescent probe in fluorescence-based competitive binding assay, we determined the binding affinities of 19 volatile substances for FoccCSP protein. This analysis revealed that anisic aldehyde, geraniol and methyl salicylate have high binding affinities for FoccCSP, with KD values of 10.50, 15.35 and 35.24 μM, respectively. Thus, our study indicates that FoccCSP may play an important role in

  12. Transcription factor IID in the Archaea: sequences in the Thermococcus celer genome would encode a product closely related to the TATA-binding protein of eukaryotes

    Science.gov (United States)

    Marsh, T. L.; Reich, C. I.; Whitelock, R. B.; Olsen, G. J.; Woese, C. R. (Principal Investigator)

    1994-01-01

    The first step in transcription initiation in eukaryotes is mediated by the TATA-binding protein, a subunit of the transcription factor IID complex. We have cloned and sequenced the gene for a presumptive homolog of this eukaryotic protein from Thermococcus celer, a member of the Archaea (formerly archaebacteria). The protein encoded by the archaeal gene is a tandem repeat of a conserved domain, corresponding to the repeated domain in its eukaryotic counterparts. Molecular phylogenetic analyses of the two halves of the repeat are consistent with the duplication occurring before the divergence of the archael and eukaryotic domains. In conjunction with previous observations of similarity in RNA polymerase subunit composition and sequences and the finding of a transcription factor IIB-like sequence in Pyrococcus woesei (a relative of T. celer) it appears that major features of the eukaryotic transcription apparatus were well-established before the origin of eukaryotic cellular organization. The divergence between the two halves of the archael protein is less than that between the halves of the individual eukaryotic sequences, indicating that the average rate of sequence change in the archael protein has been less than in its eukaryotic counterparts. To the extent that this lower rate applies to the genome as a whole, a clearer picture of the early genes (and gene families) that gave rise to present-day genomes is more apt to emerge from the study of sequences from the Archaea than from the corresponding sequences from eukaryotes.

  13. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  14. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  15. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  16. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    2000-07-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  17. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 12 figs.

  18. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, Natasha V. (Okemos, MI); Broekaert, Willem F. (Dilbeek, BE); Chua, Nam-Hai (Scarsdale, NY); Kush, Anil (New York, NY)

    1999-05-04

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74-79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli.

  19. cDNA encoding a polypeptide including a hevein sequence

    Energy Technology Data Exchange (ETDEWEB)

    Raikhel, N.V.; Broekaert, W.F.; Chua, N.H.; Kush, A.

    1995-03-21

    A cDNA clone (HEV1) encoding hevein was isolated via polymerase chain reaction (PCR) using mixed oligonucleotides corresponding to two regions of hevein as primers and a Hevea brasiliensis latex cDNA library as a template. HEV1 is 1,018 nucleotides long and includes an open reading frame of 204 amino acids. The deduced amino acid sequence contains a putative signal sequence of 17 amino acid residues followed by a 187 amino acid polypeptide. The amino-terminal region (43 amino acids) is identical to hevein and shows homology to several chitin-binding proteins and to the amino-termini of wound-induced genes in potato and poplar. The carboxyl-terminal portion of the polypeptide (144 amino acids) is 74--79% homologous to the carboxyl-terminal region of wound-inducible genes of potato. Wounding, as well as application of the plant hormones abscisic acid and ethylene, resulted in accumulation of hevein transcripts in leaves, stems and latex, but not in roots, as shown by using the cDNA as a probe. A fusion protein was produced in E. coli from the protein of the present invention and maltose binding protein produced by the E. coli. 11 figures.

  20. Population genetics and comparative genetics of CLDN1, a gene involved in hepatitis C virus entry

    NARCIS (Netherlands)

    Bekker, Vincent; O'Brien, Thomas R.; Chanock, Stephen

    2009-01-01

    The claudin-1 gene (CLDN1) is a member of a family of genes that encodes proteins found in tight junctions and it has recently been implicated as one of several receptors for late stage binding of hepatitis C virus (HCV). Exploration of the population genetics of this gene could be informative,

  1. Isolation and expression of the genes coding for the membrane bound transglycosylase B (MltB and the transferrin binding protein B (TbpB of the salmon pathogen Piscirickettsia salmonis

    Directory of Open Access Journals (Sweden)

    VIVIAN WILHELM

    2004-01-01

    Full Text Available We have isolated and sequenced the genes encoding the membrane bound transglycosylase B (MltB and the transferring binding protein B (TbpB of the salmon pathogen Piscirickettsia salmonis. The results of the sequence revealed two open reading frames that encode proteins with calculated molecular weights of 38,830 and 85,140. The deduced aminoacid sequences of both proteins show a significant homology to the respective protein from phylogenetically related microorganisms. Partial sequences coding the amino and carboxyl regions of MltB and a sequence of 761 base pairs encoding the amino region of TbpB have been expressed in E. coli. The strong humoral response elicited by these proteins in mouse confirmed the immunogenic properties of the recombinant proteins. A similar response was elicited by both proteins when injected intraperitoneally in Atlantic salmon. The present data indicates that these proteins are good candidates to be used in formulations to study the protective immunity of salmon to infection by P. salmonis.

  2. Detection, Characterization, and In Vitro and In Vivo Expression of Genes Encoding S-Proteins in Lactobacillus gallinarum Strains Isolated from Chicken Crops

    Science.gov (United States)

    Hagen, Karen E.; Guan, Le Luo; Tannock, Gerald W.; Korver, Doug R.; Allison, Gwen E.

    2005-01-01

    Thirty-eight isolates of Lactobacillus gallinarum cultured from the crops of broiler chickens were screened for the presence of genes encoding S-layer proteins. All of the isolates had two S-protein genes, which were designated Lactobacillus gallinarum S-protein (lgs) genes. One gene in each isolate was either lgsA or lgsB. The Lactobacillus isolates were further characterized by pulsed-field gel electrophoresis of DNA digests, which grouped the isolates into 17 genotypes (strains). The second gene in each of eight representative strains was sequenced and shown to differ among strains (lgsC, lgsD, lgsE, lgsF, lgsG, lgsH, and lgsI). The genome of each strain thus encoded a common S-protein (encoded by either lgsA or lgsB) and a strain-specific S-protein. The extraction of cell surface proteins from cultures of the eight strains showed that each strain produced a single S-protein that was always encoded by the strain-specific lgs gene. Two of the strains were used to inoculate chickens maintained in a protected environment which were Lactobacillus-free prior to inoculation. DNAs and RNAs extracted from the digesta of the chickens were used for PCR and reverse transcription-PCR, respectively, to demonstrate the presence and transcription of lgs genes in vivo. In both cases, only the strain-specific gene was transcribed. Both of the strains adhered to the crop epithelium, consistent with published data predicting that S-proteins of lactobacilli are adhesins. The results of this study provide a basis for the investigation of gene duplication and sequence variation as mechanisms by which bacterial strains of the same species can share the same habitat. PMID:16269691

  3. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  4. Calcium/calmodulin kinase1 and its relation to thermotolerance and HSP90 in Sporothrix schenckii: an RNAi and yeast two-hybrid study

    Directory of Open Access Journals (Sweden)

    Gonzalez-Mendez Ricardo

    2011-07-01

    Full Text Available Abstract Background Sporothrix schenckii is a pathogenic dimorphic fungus of worldwide distribution. It grows in the saprophytic form with hyaline, regularly septated hyphae and pyriform conidia at 25°C and as the yeast or parasitic form at 35°C. Previously, we characterized a calcium/calmodulin kinase in this fungus. Inhibitors of this kinase were observed to inhibit the yeast cell cycle in S. schenckii. Results The presence of RNA interference (RNAi mechanism in this fungus was confirmed by the identification of a Dicer-1 homologue in S. schenckii DNA. RNAi technology was used to corroborate the role of calcium/calmodulin kinase I in S. schenckii dimorphism. Yeast cells were transformed with the pSilent-Dual2G (pSD2G plasmid w/wo inserts of the coding region of the calcium/calmodulin kinase I (sscmk1 gene. Transformants were selected at 35°C using resistance to geneticin. Following transfer to liquid medium at 35°C, RNAi transformants developed as abnormal mycelium clumps and not as yeast cells as would be expected. The level of sscmk1 gene expression in RNAi transformants at 35°C was less than that of cells transformed with the empty pSD2G at this same temperature. Yeast two-hybrid analysis of proteins that interact with SSCMK1 identified a homologue of heat shock protein 90 (HSP90 as interacting with this kinase. Growth of the fungus similar to that of the RNAi transformants was observed in medium with geldanamycin (GdA, 10 μM, an inhibitor of HSP90. Conclusions Using the RNAi technology we silenced the expression of sscmk1 gene in this fungus. RNAi transformants were unable to grow as yeast cells at 35°C showing decreased tolerance to this temperature. The interaction of SSCMK1 with HSP90, observed using the yeast two-hybrid assay suggests that this kinase is involved in thermotolerance through its interaction with HSP90. SSCMK1 interacted with the C terminal domain of HSP90 where effector proteins and co-chaperones interact. These

  5. A Gene Encoding a DUF247 Domain Protein Cosegregates with the S Self-Incompatibility Locus in Perennial Ryegrass

    DEFF Research Database (Denmark)

    Manzanares, Chloe; Barth, Susanne; Thorogood, Daniel

    2016-01-01

    genes cosegregating with the S-locus, a highly polymorphic gene encoding for a protein containing a DUF247 was fully predictive of known S-locus genotypes at the amino acid level in the seven mapping populations. Strikingly, this gene showed a frameshift mutation in self-compatible darnel (Lolium...

  6. Impact of a Central Scaffold on the Binding Affinity of Fragment Pairs Isolated from DNA-Encoded Self-Assembling Chemical Libraries.

    Science.gov (United States)

    Bigatti, Martina; Dal Corso, Alberto; Vanetti, Sara; Cazzamalli, Samuele; Rieder, Ulrike; Scheuermann, Jörg; Neri, Dario; Sladojevich, Filippo

    2017-11-08

    The screening of encoded self-assembling chemical libraries allows the identification of fragment pairs that bind to adjacent pockets on target proteins of interest. For practical applications, it is necessary to link these ligand pairs into discrete organic molecules, devoid of any nucleic acid component. Here we describe the discovery of a synergistic binding pair for acid alpha-1 glycoprotein and a chemical strategy for the identification of optimal linkers, connecting the two fragments. The procedure yielded a set of small organic ligands, the best of which exhibited a dissociation constant of 9.9 nm, as measured in solution by fluorescence polarization. © 2017 Wiley-VCH Verlag GmbH & Co. KGaA, Weinheim.

  7. Depletion of Acyl-Coenzyme A-Binding Protein Affects Sphingolipid Synthesis and Causes Vesicle Accumulation and Membrane Defects in Saccharomyces cerevisiae

    DEFF Research Database (Denmark)

    Gaigg, B; Neergaard, T B; Schneiter, R

    2001-01-01

    Deletion of the yeast gene ACB1 encoding Acb1p, the yeast homologue of the acyl-CoA-binding protein (ACBP), resulted in a slower growing phenotype that adapted into a faster growing phenotype with a frequency >1:10(5). A conditional knockout strain (Y700pGAL1-ACB1) with the ACB1 gene under contro...

  8. Every which way--nanos gene regulation in echinoderms.

    Science.gov (United States)

    Oulhen, Nathalie; Wessel, Gary M

    2014-03-01

    Nanos is an essential factor of germ line success in all animals tested. This gene encodes a Zn-finger RNA-binding protein that in complex with its partner pumilio binds to and changes the fate of several known transcripts. We summarize here the documented functions of Nanos in several key organisms, and then emphasize echinoderms as a working model for how nanos expression is regulated. Nanos presence outside of the target cells is often detrimental to the animal, and in sea urchins, nanos expression appears to be regulated at every step of transcription, and post-transcriptional activity, making this gene product exciting, every which way. Copyright © 2013 Wiley Periodicals, Inc.

  9. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  10. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  11. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  12. Novel Mutation in the ATP-Binding Cassette Transporter A3 (ABCA3) Encoding Gene Causes Respiratory Distress Syndrome in A Term Newborn in Southwest Iran

    Science.gov (United States)

    Rezaei, Farideh; Shafiei, Mohammad; Shariati, Gholamreza; Dehdashtian, Ali; Mohebbi, Maryam; Galehdari, Hamid

    2016-01-01

    Introduction ABCA3 glycoprotein belongs to the ATP-binding cassette (ABC) superfamily of transporters, which utilize the energy derived from hydrolysis of ATP for the translocation of a wide variety of substrates across the plasma membrane. Mutations in the ABCA3 gene are knowingly causative for fatal surfactant deficiency, particularly respiratory distress syndrome (RDS) in term babies. Case Presentation In this study, Sanger sequencing of the whole ABCA3 gene (NCBI NM_001089) was performed in a neonatal boy with severe RDS. A homozygous mutation has been identified in the patient. Parents were heterozygous for the same missense mutation GGA > AGA at position 202 in exon 6 of the ABCA3 gene (c.604G > A; p.G202R). Furthermore, 70 normal individuals have been analyzed for the mentioned change with negative results. Conclusions Regarding Human Genome Mutation Database (HGMD) and other literature recherche, the detected change is a novel mutation and has not been reported before. Bioinformatics mutation predicting tools prefer it as pathogenic. PMID:27437095

  13. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  14. Life in a changing world: TCH gene regulation of expression and responses to environmental signals

    Science.gov (United States)

    Braam, J.; Sistrunk, M. L.; Polisensky, D. H.; Xu, W.; Purugganan, M. M.; Antosiewicz, D. M.; Campbell, P.; Johnson, K. A.

    1996-01-01

    The Arabidopsis TCH genes were discovered as a consequence of their marked upregulation of expression in response to seemingly innocuous stimuli such as touch. Further analyses have indicated that these genes are upregulated by a variety of diverse stimuli. Understanding the mechanism(s) and factors that control TCH gene regulation will shed light on the signaling pathways that enable plants to respond to changing environmental conditions. The TCH proteins include calmodulin, calmodulin-related proteins and a xyloglucan endotransglycosylase. Expression analyses and localization of protein accumulation indicate that the potential sites of TCH protein function include expanding cells and tissues under mechanical strain. We hypothesize that the TCH proteins may collaborate in cell wall biogenesis.

  15. Multiple ETS family proteins regulate PF4 gene expression by binding to the same ETS binding site.

    Directory of Open Access Journals (Sweden)

    Yoshiaki Okada

    Full Text Available In previous studies on the mechanism underlying megakaryocyte-specific gene expression, several ETS motifs were found in each megakaryocyte-specific gene promoter. Although these studies suggested that several ETS family proteins regulate megakaryocyte-specific gene expression, only a few ETS family proteins have been identified. Platelet factor 4 (PF4 is a megakaryocyte-specific gene and its promoter includes multiple ETS motifs. We had previously shown that ETS-1 binds to an ETS motif in the PF4 promoter. However, the functions of the other ETS motifs are still unclear. The goal of this study was to investigate a novel functional ETS motif in the PF4 promoter and identify proteins binding to the motif. In electrophoretic mobility shift assays and a chromatin immunoprecipitation assay, FLI-1, ELF-1, and GABP bound to the -51 ETS site. Expression of FLI-1, ELF-1, and GABP activated the PF4 promoter in HepG2 cells. Mutation of a -51 ETS site attenuated FLI-1-, ELF-1-, and GABP-mediated transactivation of the promoter. siRNA analysis demonstrated that FLI-1, ELF-1, and GABP regulate PF4 gene expression in HEL cells. Among these three proteins, only FLI-1 synergistically activated the promoter with GATA-1. In addition, only FLI-1 expression was increased during megakaryocytic differentiation. Finally, the importance of the -51 ETS site for the activation of the PF4 promoter during physiological megakaryocytic differentiation was confirmed by a novel reporter gene assay using in vitro ES cell differentiation system. Together, these data suggest that FLI-1, ELF-1, and GABP regulate PF4 gene expression through the -51 ETS site in megakaryocytes and implicate the differentiation stage-specific regulation of PF4 gene expression by multiple ETS factors.

  16. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  17. Effect of praziquantel on the differential expression of mouse hepatic genes and parasite ATP binding cassette transporter gene family members during Schistosoma mansoni infection.

    Directory of Open Access Journals (Sweden)

    Melissa C Sanchez

    2017-06-01

    Full Text Available Schistosomiasis is a chronic parasitic disease caused by sexually dimorphic blood flukes of the genus Schistosoma. Praziquantel (PZQ is the only drug widely available to treat the disease but does not kill juvenile parasites. Here we report the use of next generation sequencing to study the transcriptional effect of PZQ on murine hepatic inflammatory, immune and fibrotic responses to Schistosoma mansoni worms and eggs. An initial T helper cell 1 (Th1 response is induced against schistosomes in mice treated with drug vehicle (Vh around the time egg laying begins, followed by a T helper cell 2 (Th2 response and the induction of genes whose action leads to granuloma formation and fibrosis. When PZQ is administered at this time, there is a significant reduction in egg burden yet the hepatic Th1, Th2 and fibrotic responses are still observed in the absence of granuloma formation suggesting some degree of gene regulation may be induced by antigens released from the dying adult worms. Quantitative real-time PCR was used to examine the relative expression of 16 juvenile and adult S. mansoni genes during infection and their response to Vh and PZQ treatment in vivo. While the response of stress genes in adult parasites suggests the worms were alive immediately following exposure to PZQ, they were unable to induce transcription of any of the 9 genes encoding ATP-binding cassette (ABC transporters tested. In contrast, juvenile schistosomes were able to significantly induce the activities of ABCB, C and G family members, underscoring the possibility that these efflux systems play a major role in drug resistance.

  18. TFII-I regulates target genes in the PI-3K and TGF-β signaling pathways through a novel DNA binding motif.

    Science.gov (United States)

    Segura-Puimedon, Maria; Borralleras, Cristina; Pérez-Jurado, Luis A; Campuzano, Victoria

    2013-09-25

    General transcription factor (TFII-I) is a multi-functional protein involved in the transcriptional regulation of critical developmental genes, encoded by the GTF2I gene located on chromosome 7q11.23. Haploinsufficiency at GTF2I has been shown to play a major role in the neurodevelopmental features of Williams-Beuren syndrome (WBS). Identification of genes regulated by TFII-I is thus critical to detect molecular determinants of WBS as well as to identify potential new targets for specific pharmacological interventions, which are currently absent. We performed a microarray screening for transcriptional targets of TFII-I in cortex and embryonic cells from Gtf2i mutant and wild-type mice. Candidate genes with altered expression were verified using real-time PCR. A novel motif shared by deregulated genes was found and chromatin immunoprecipitation assays in embryonic fibroblasts were used to document in vitro TFII-I binding to this motif in the promoter regions of deregulated genes. Interestingly, the PI3K and TGFβ signaling pathways were over-represented among TFII-I-modulated genes. In this study we have found a highly conserved DNA element, common to a set of genes regulated by TFII-I, and identified and validated novel in vivo neuronal targets of this protein affecting the PI3K and TGFβ signaling pathways. Overall, our data further contribute to unravel the complexity and variability of the different genetic programs orchestrated by TFII-I. © 2013 Elsevier B.V. All rights reserved.

  19. An erythrocyte-specific DNA-binding factor recognizes a regulatory sequence common to all chicken globin genes

    International Nuclear Information System (INIS)

    Evans, T.; Reitman, M.; Felsenfeld, G.

    1988-01-01

    The authors have identified a protein present only in erythroid cells that binds to two adjacent sites within an enhancer region of the chicken β-globin locus. Mutation of the sites, so that binding by the factor can no longer be detected in vitro, leads to a loss of enhancing ability, assayed by transient expression in primary erythrocytes. Binding sites for the erythroid-specific factor (Eryf1) are found within regulatory regions for all chicken globin genes. A strong Eryf1 binding site is also present within the enhancer of at least one human globin gene, and proteins from human erythroid cells (but not HeLa cells) bind to both the chicken and the human sites

  20. Complementation of the amylose-free starch mutant of potato (Solanum tuberosum.) by the gene encoding granule-bound starch synthase

    NARCIS (Netherlands)

    van der Leij, E.R.; Visser, R.G.E.; OOSTERHAVEN, K; VANDERKOP, DAM; Jacobsen, E.; Feenstra, W.

    1991-01-01

    Agrobacterium rhizogenes-mediated introduction of the wild-type allele of the gene encoding granule-bound starch synthase (GBSS) into the amylose-free starch mutant amf of potato leads to restoration of GBSS activity and amylose synthesis, which demonstrates that Amf is the structural gene for GBSS.