WorldWideScience

Sample records for genes encoding 16s

  1. Isolation of endophytic bacteria from arboreal species of the Amazon and identification by sequencing of the 16S rRNA encoding gene

    Directory of Open Access Journals (Sweden)

    Mariza M. Coêlho

    2011-01-01

    Full Text Available Endophytic bacteria from three arboreal species native to the Amazon (Carapa guianenses, Ceiba pentandra, and Swietenia macrophylla, were isolated and identified, through partial sequencing of the 16S rRNA encoding gene. From these, 16 isolates were obtained, although, when compared to sequences deposited in GenBank, only seven had produced identifiable fragments. Bacillus, Pantoea and two non-culturable samples were identified. Results obtained through sequence analysis revealed low genetic diversity across the isolates, even when analyzing different species and plant structures. This is the first report concerning the isolation and identification of endophytic bacteria in these plant species.

  2. Genotypic Characterization of Bradyrhizobium Strains Nodulating Endemic Woody Legumes of the Canary Islands by PCR-Restriction Fragment Length Polymorphism Analysis of Genes Encoding 16S rRNA (16S rDNA) and 16S-23S rDNA Intergenic Spacers, Repetitive Extragenic Palindromic PCR Genomic Fingerprinting, and Partial 16S rDNA Sequencing

    Science.gov (United States)

    Vinuesa, Pablo; Rademaker, Jan L. W.; de Bruijn, Frans J.; Werner, Dietrich

    1998-01-01

    We present a phylogenetic analysis of nine strains of symbiotic nitrogen-fixing bacteria isolated from nodules of tagasaste (Chamaecytisus proliferus) and other endemic woody legumes of the Canary Islands, Spain. These and several reference strains were characterized genotypically at different levels of taxonomic resolution by computer-assisted analysis of 16S ribosomal DNA (rDNA) PCR-restriction fragment length polymorphisms (PCR-RFLPs), 16S-23S rDNA intergenic spacer (IGS) RFLPs, and repetitive extragenic palindromic PCR (rep-PCR) genomic fingerprints with BOX, ERIC, and REP primers. Cluster analysis of 16S rDNA restriction patterns with four tetrameric endonucleases grouped the Canarian isolates with the two reference strains, Bradyrhizobium japonicum USDA 110spc4 and Bradyrhizobium sp. strain (Centrosema) CIAT 3101, resolving three genotypes within these bradyrhizobia. In the analysis of IGS RFLPs with three enzymes, six groups were found, whereas rep-PCR fingerprinting revealed an even greater genotypic diversity, with only two of the Canarian strains having similar fingerprints. Furthermore, we show that IGS RFLPs and even very dissimilar rep-PCR fingerprints can be clustered into phylogenetically sound groupings by combining them with 16S rDNA RFLPs in computer-assisted cluster analysis of electrophoretic patterns. The DNA sequence analysis of a highly variable 264-bp segment of the 16S rRNA genes of these strains was found to be consistent with the fingerprint-based classification. Three different DNA sequences were obtained, one of which was not previously described, and all belonged to the B. japonicum/Rhodopseudomonas rDNA cluster. Nodulation assays revealed that none of the Canarian isolates nodulated Glycine max or Leucaena leucocephala, but all nodulated Acacia pendula, C. proliferus, Macroptilium atropurpureum, and Vigna unguiculata. PMID:9603820

  3. High throughput 16S rRNA gene amplicon sequencing

    DEFF Research Database (Denmark)

    Nierychlo, Marta; Larsen, Poul; Jørgensen, Mads Koustrup

    S rRNA gene amplicon sequencing has been developed over the past few years and is now ready to use for more comprehensive studies related to plant operation and optimization thanks to short analysis time, low cost, high throughput, and high taxonomic resolution. In this study we show how 16S r......RNA gene amplicon sequencing can be used to reveal factors of importance for the operation of full-scale nutrient removal plants related to settling problems and floc properties. Using optimized DNA extraction protocols, indexed primers and our in-house Illumina platform, we prepared multiple samples...... be correlated to the presence of the species that are regarded as “strong” and “weak” floc formers. In conclusion, 16S rRNA gene amplicon sequencing provides a high throughput approach for a rapid and cheap community profiling of activated sludge that in combination with multivariate statistics can be used...

  4. The distribution, diversity, and importance of 16S rRNA gene introns in the order Thermoproteales.

    Science.gov (United States)

    Jay, Zackary J; Inskeep, William P

    2015-07-09

    Intron sequences are common in 16S rRNA genes of specific thermophilic lineages of Archaea, specifically the Thermoproteales (phylum Crenarchaeota). Environmental sequencing (16S rRNA gene and metagenome) from geothermal habitats in Yellowstone National Park (YNP) has expanded the available datasets for investigating 16S rRNA gene introns. The objectives of this study were to characterize and curate archaeal 16S rRNA gene introns from high-temperature habitats, evaluate the conservation and distribution of archaeal 16S rRNA introns in geothermal systems, and determine which "universal" archaeal 16S rRNA gene primers are impacted by the presence of intron sequences. Several new introns were identified and their insertion loci were constrained to thirteen locations across the 16S rRNA gene. Many of these introns encode homing endonucleases, although some introns were short or partial sequences. Pyrobaculum, Thermoproteus, and Caldivirga 16S rRNA genes contained the most abundant and diverse intron sequences. Phylogenetic analysis of introns revealed that sequences within the same locus are distributed biogeographically. The most diverse set of introns were observed in a high-temperature, circumneutral (pH 6) sulfur sediment environment, which also contained the greatest diversity of different Thermoproteales phylotypes. The widespread presence of introns in the Thermoproteales indicates a high probability of misalignments using different "universal" 16S rRNA primers employed in environmental microbial community analysis.

  5. Phylogenetic Analysis of Pasteuria penetrans by 16S rRNA Gene Cloning and Sequencing.

    Science.gov (United States)

    Anderson, J M; Preston, J F; Dickson, D W; Hewlett, T E; Williams, N H; Maruniak, J E

    1999-09-01

    Pasteuria penetrans is an endospore-forming bacterial parasite of Meloidogyne spp. This organism is among the most promising agents for the biological control of root-knot nematodes. In order to establish the phylogenetic position of this species relative to other endospore-forming bacteria, the 16S ribosomal genes from two isolates of P. penetrans, P-20, which preferentially infects M. arenaria race 1, and P-100, which preferentially infects M. incognita and M. javanica, were PCR-amplified from a purified endospore extraction. Universal primers for the 16S rRNA gene were used to amplify DNA which was cloned, and a nucleotide sequence was obtained for 92% of the gene (1,390 base pairs) encoding the 16S rDNA from each isolate. Comparison of both isolates showed identical sequences that were compared to 16S rDNA sequences of 30 other endospore-forming bacteria obtained from GenBank. Parsimony analyses indicated that P. penetrans is a species within a clade that includes Alicyclobacillus acidocaldarius, A. cycloheptanicus, Sulfobacillus sp., Bacillus tusciae, B. schlegelii, and P. ramosa. Its closest neighbor is P. ramosa, a parasite of Daphnia spp. (water fleas). This study provided a genomic basis for the relationship of species assigned to the genus Pasteuria, and for comparison of species that are parasites of different phytopathogenic nematodes.

  6. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Science.gov (United States)

    Olson, Nathan D.; Lund, Steven P.; Zook, Justin M.; Rojas-Cornejo, Fabiola; Beck, Brian; Foy, Carole; Huggett, Jim; Whale, Alexandra S.; Sui, Zhiwei; Baoutina, Anna; Dobeson, Michael; Partis, Lina; Morrow, Jayne B.

    2015-01-01

    This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA) sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1) identity of biologically conserved position, (2) ratio of 16S rRNA gene copies featuring identified variants, and (3) the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies. PMID:27077030

  7. International interlaboratory study comparing single organism 16S rRNA gene sequencing data: Beyond consensus sequence comparisons

    Directory of Open Access Journals (Sweden)

    Nathan D. Olson

    2015-03-01

    Full Text Available This study presents the results from an interlaboratory sequencing study for which we developed a novel high-resolution method for comparing data from different sequencing platforms for a multi-copy, paralogous gene. The combination of PCR amplification and 16S ribosomal RNA gene (16S rRNA sequencing has revolutionized bacteriology by enabling rapid identification, frequently without the need for culture. To assess variability between laboratories in sequencing 16S rRNA, six laboratories sequenced the gene encoding the 16S rRNA from Escherichia coli O157:H7 strain EDL933 and Listeria monocytogenes serovar 4b strain NCTC11994. Participants performed sequencing methods and protocols available in their laboratories: Sanger sequencing, Roche 454 pyrosequencing®, or Ion Torrent PGM®. The sequencing data were evaluated on three levels: (1 identity of biologically conserved position, (2 ratio of 16S rRNA gene copies featuring identified variants, and (3 the collection of variant combinations in a set of 16S rRNA gene copies. The same set of biologically conserved positions was identified for each sequencing method. Analytical methods using Bayesian and maximum likelihood statistics were developed to estimate variant copy ratios, which describe the ratio of nucleotides at each identified biologically variable position, as well as the likely set of variant combinations present in 16S rRNA gene copies. Our results indicate that estimated variant copy ratios at biologically variable positions were only reproducible for high throughput sequencing methods. Furthermore, the likely variant combination set was only reproducible with increased sequencing depth and longer read lengths. We also demonstrate novel methods for evaluating variable positions when comparing multi-copy gene sequence data from multiple laboratories generated using multiple sequencing technologies.

  8. Prevalence of 16S rRNA methylase genes among b-lactamase ...

    African Journals Online (AJOL)

    2014-07-07

    Jul 7, 2014 ... School of Life Sciences, Pondicherry University, Pondicherry, India ... Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and .... Isolates positive for bla or 16S rRNA methylase genes.

  9. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria.

    Science.gov (United States)

    Sagova-Mareckova, Marketa; Ulanova, Dana; Sanderova, Petra; Omelka, Marek; Kamenik, Zdenek; Olsovska, Jana; Kopecky, Jan

    2015-04-01

    Distribution and evolutionary history of resistance genes in environmental actinobacteria provide information on intensity of antibiosis and evolution of specific secondary metabolic pathways at a given site. To this day, actinobacteria producing biologically active compounds were isolated mostly from soil but only a limited range of soil environments were commonly sampled. Consequently, soil remains an unexplored environment in search for novel producers and related evolutionary questions. Ninety actinobacteria strains isolated at contrasting soil sites were characterized phylogenetically by 16S rRNA gene, for presence of erm and ABC transporter resistance genes and antibiotic production. An analogous analysis was performed in silico with 246 and 31 strains from Integrated Microbial Genomes (JGI_IMG) database selected by the presence of ABC transporter genes and erm genes, respectively. In the isolates, distances of erm gene sequences were significantly correlated to phylogenetic distances based on 16S rRNA genes, while ABC transporter gene distances were not. The phylogenetic distance of isolates was significantly correlated to soil pH and organic matter content of isolation sites. In the analysis of JGI_IMG datasets the correlation between phylogeny of resistance genes and the strain phylogeny based on 16S rRNA genes or five housekeeping genes was observed for both the erm genes and ABC transporter genes in both actinobacteria and streptomycetes. However, in the analysis of sequences from genomes where both resistance genes occurred together the correlation was observed for both ABC transporter and erm genes in actinobacteria but in streptomycetes only in the erm gene. The type of erm resistance gene sequences was influenced by linkage to 16S rRNA gene sequences and site characteristics. The phylogeny of ABC transporter gene was correlated to 16S rRNA genes mainly above the genus level. The results support the concept of new specific secondary metabolite

  10. Phylogenetic relatedness determined between antibiotic resistance and 16S rRNA genes in actinobacteria

    Czech Academy of Sciences Publication Activity Database

    Ságová-Marečková, M.; Ulanová, Dana; Šanderová, P.; Omelka, M.; Kameník, Zdeněk; Olšovská, J.; Kopecký, J.

    2015-01-01

    Roč. 15, APR 2015 (2015) ISSN 1471-2180 Institutional support: RVO:61388971 Keywords : Actinobacteria * 16S rRNA diversity * Resistance genes Subject RIV: EH - Ecology, Behaviour Impact factor: 2.581, year: 2015

  11. Identification of pathogenic Nocardia species by reverse line blot hybridization targeting the 16S rRNA and 16S-23S rRNA gene spacer regions.

    Science.gov (United States)

    Xiao, Meng; Kong, Fanrong; Sorrell, Tania C; Cao, Yongyan; Lee, Ok Cha; Liu, Ying; Sintchenko, Vitali; Chen, Sharon C A

    2010-02-01

    Although 16S rRNA gene sequence analysis is employed most often for the definitive identification of Nocardia species, alternate molecular methods and polymorphisms in other gene targets have also enabled species determinations. We evaluated a combined Nocardia PCR-based reverse line blot (RLB) hybridization assay based on 16S and 16S-23S rRNA gene spacer region polymorphisms to identify 12 American Type Culture Collection and 123 clinical Nocardia isolates representing 14 species; results were compared with results from 16S rRNA gene sequencing. Thirteen 16S rRNA gene-based (two group-specific and 11 species-specific) and five 16S-23S spacer-targeted (two taxon-specific and three species-specific) probes were utilized. 16S rRNA gene-based probes correctly identified 124 of 135 isolates (sensitivity, 92%) but were unable to identify Nocardia paucivorans strains (n = 10 strains) and a Nocardia asteroides isolate with a novel 16S rRNA gene sequence. Nocardia farcinica and Nocardia cyriacigeorgica strains were identified by the sequential use of an N. farcinica-"negative" probe and a combined N. farcinica/N. cyriacigeorgica probe. The assay specificity was high (99%) except for weak cross-reactivity between the Nocardia brasiliensis probe with the Nocardia thailandica DNA product; however, cross-hybridization with closely related nontarget species may occur. The incorporation of 16S-23S rRNA gene spacer-based probes enabled the identification of all N. paucivorans strains. The overall sensitivity using both probe sets was >99%. Both N. farcinica-specific 16S-23S rRNA gene spacer-directed probes were required to identify all N. farcinica stains by using this probe set. The study demonstrates the utility of a combined PCR/RLB assay for the identification of clinically relevant Nocardia species and its potential for studying subtypes of N. farcinica. Where species assignment is ambiguous or not possible, 16S rRNA gene sequencing is recommended.

  12. Prevalence of 16S rRNA methylase genes among β-lactamase ...

    African Journals Online (AJOL)

    Background: Co production of 16S rRNA methylases gene and β-Lactamase gene among Enterobacteriaceae isolates conferring resistance to both therapeutic options has serious implications for clinicians worldwide. Methods: To study co existence of 16S rRNA methylases (armA, rmtA, rmtB, rmtC, rmtD, and npmA) and ...

  13. Comparative performance of the 16S rRNA gene in DNA barcoding of amphibians

    Directory of Open Access Journals (Sweden)

    Chiari Ylenia

    2005-03-01

    Full Text Available Abstract Background Identifying species of organisms by short sequences of DNA has been in the center of ongoing discussions under the terms DNA barcoding or DNA taxonomy. A C-terminal fragment of the mitochondrial gene for cytochrome oxidase subunit I (COI has been proposed as universal marker for this purpose among animals. Results Herein we present experimental evidence that the mitochondrial 16S rRNA gene fulfills the requirements for a universal DNA barcoding marker in amphibians. In terms of universality of priming sites and identification of major vertebrate clades the studied 16S fragment is superior to COI. Amplification success was 100% for 16S in a subset of fresh and well-preserved samples of Madagascan frogs, while various combination of COI primers had lower success rates.COI priming sites showed high variability among amphibians both at the level of groups and closely related species, whereas 16S priming sites were highly conserved among vertebrates. Interspecific pairwise 16S divergences in a test group of Madagascan frogs were at a level suitable for assignment of larval stages to species (1–17%, with low degrees of pairwise haplotype divergence within populations (0–1%. Conclusion We strongly advocate the use of 16S rRNA as standard DNA barcoding marker for vertebrates to complement COI, especially if samples a priori could belong to various phylogenetically distant taxa and false negatives would constitute a major problem.

  14. Comparison of two approaches for the classification of 16S rRNA gene sequences.

    Science.gov (United States)

    Chatellier, Sonia; Mugnier, Nathalie; Allard, Françoise; Bonnaud, Bertrand; Collin, Valérie; van Belkum, Alex; Veyrieras, Jean-Baptiste; Emler, Stefan

    2014-10-01

    The use of 16S rRNA gene sequences for microbial identification in clinical microbiology is accepted widely, and requires databases and algorithms. We compared a new research database containing curated 16S rRNA gene sequences in combination with the lca (lowest common ancestor) algorithm (RDB-LCA) to a commercially available 16S rDNA Centroid approach. We used 1025 bacterial isolates characterized by biochemistry, matrix-assisted laser desorption/ionization time-of-flight MS and 16S rDNA sequencing. Nearly 80 % of isolates were identified unambiguously at the species level by both classification platforms used. The remaining isolates were mostly identified correctly at the genus level due to the limited resolution of 16S rDNA sequencing. Discrepancies between both 16S rDNA platforms were due to differences in database content and the algorithm used, and could amount to up to 10.5 %. Up to 1.4 % of the analyses were found to be inconclusive. It is important to realize that despite the overall good performance of the pipelines for analysis, some inconclusive results remain that require additional in-depth analysis performed using supplementary methods. © 2014 The Authors.

  15. Mitochondrial 16S ribosomal RNA gene for forensic identification of crocodile species.

    Science.gov (United States)

    Naga Jogayya, K; Meganathan, P R; Dubey, Bhawna; Haque, I

    2013-05-01

    All crocodilians are under various threats due to over exploitation and these species have been listed in Appendix I or II of CITES. Lack of molecular techniques for the forensic identification of confiscated samples makes it difficult to enforce the law. Therefore, we herein present a molecular method developed on the basis on 16S rRNA gene of mitochondrial DNA for identification of crocodile species. We have developed a set of 16S rRNA primers for PCR based identification of crocodilian species. These novel primers amplify partial 16S rRNA sequences of six crocodile species which can be later combined to obtain a larger region (1290 bp) of 16S rRNA gene. This 16S rRNA gene could be used as an effective tool for forensic authentication of crocodiles. The described primers hold great promise in forensic identification of crocodile species, which can aid in the effective enforcement of law and conservation of these species. Copyright © 2012 Elsevier Ltd and Faculty of Forensic and Legal Medicine. All rights reserved.

  16. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification

    NARCIS (Netherlands)

    Ziesemer, K.A.; Mann, A.E.; Sankaranarayanan, K.; Schroeder, H.; Ozga, A.T.; Brandt, B.W.; Zaura, E.; Waters-Rist, A.; Hoogland, M.; Salazar-García, D.C.; Aldenderfer, M.; Speller, C.; Hendy, J.; Weston, D.A.; MacDonald, S.J.; Thomas, G.H.; Collins, M.J.; Lewis, C.M.; Hofman, C.; Warinner, C.

    2015-01-01

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this

  17. 16S rRNA gene sequence and phylogenetic tree of lactobacillus ...

    African Journals Online (AJOL)

    ... processed by denaturing gradient gel electrophoresis (DGGE). Phylogenetic tree was constructed with the sequences of the V2-V3 region of 16S rRNA gene. Results show two distinct divisions among the Lactobacillus species. The study presents a new understanding of the nature of the Lactobacillus vaginal microbiota ...

  18. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    OpenAIRE

    B Dhawan; S Sebastian; R Malhotra; A Kapil; D Gautam

    2016-01-01

    We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  19. Prosthetic joint infection due to Lysobacter thermophilus diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    B Dhawan

    2016-01-01

    Full Text Available We report the first case of prosthetic joint infection caused by Lysobacter thermophilus which was identified by 16S rRNA gene sequencing. Removal of prosthesis followed by antibiotic treatment resulted in good clinical outcome. This case illustrates the use of molecular diagnostics to detect uncommon organisms in suspected prosthetic infections.

  20. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  1. Detection and characterization of Pasteuria 16S rRNA gene sequences from nematodes and soils.

    Science.gov (United States)

    Duan, Y P; Castro, H F; Hewlett, T E; White, J H; Ogram, A V

    2003-01-01

    Various bacterial species in the genus Pasteuria have great potential as biocontrol agents against plant-parasitic nematodes, although study of this important genus is hampered by the current inability to cultivate Pasteuria species outside their host. To aid in the study of this genus, an extensive 16S rRNA gene sequence phylogeny was constructed and this information was used to develop cultivation-independent methods for detection of Pasteuria in soils and nematodes. Thirty new clones of Pasteuria 16S rRNA genes were obtained directly from nematodes and soil samples. These were sequenced and used to construct an extensive phylogeny of this genus. These sequences were divided into two deeply branching clades within the low-G + C, Gram-positive division; some sequences appear to represent novel species within the genus Pasteuria. In addition, a surprising degree of 16S rRNA gene sequence diversity was observed within what had previously been designated a single strain of Pasteuria penetrans (P-20). PCR primers specific to Pasteuria 16S rRNA for detection of Pasteuria in soils were also designed and evaluated. Detection limits for soil DNA were 100-10,000 Pasteuria endospores (g soil)(-1).

  2. Characterization of hydrocortisone bioconversion and 16S RNA gene in Synechococcus nidulans cultures.

    Science.gov (United States)

    Rasoul-Amini, S; Ghasemi, Y; Morowvat, M H; Ghoshoon, M B; Raee, M J; Mosavi-Azam, S B; Montazeri-Najafabady, N; Nouri, F; Parvizi, R; Negintaji, N; Khoubani, S

    2010-01-01

    A unicellular cyanobacterium, Synechococcus nidulans (Pringsheim) Komárek, was isolated from paddy-fields and applied in the biotransformation experiment of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The obtained products were chromatographically purified followed by their characterization using spectroscopic methods. 11beta,17beta-dihydroxyandrost-4-en-3-one (2), 11beta-hydroxyandrost-4-en-3,17-dione (3), and androst-4-ene-3,17-dione (4) were the main bioproducts in the hydrocortisone bioconversion. The observed bioreaction characteristics were the side chain degradation of the substrate to prepare compounds (2) and (3) following the 11beta-dehydroxylation for accumulation of the compound (4). Time course study showed the accumulation of the product (2) from the second day of the fermentation and compounds (3) and (4) from the third day. All the metabolites reached their maximum concentration in seven days. Cyanobacterial 16S rRNA gene was also amplified by PCR. Sequences were amplified using the universal prokaryotic primers which amplify a approximately 400-bp region of the 16S rRNA gene. PCR products were sequenced to confirm their authenticity as 16S rRNA gene of cyanobacteria. The result of PCR blasted with other sequenced cyanobacteria in NCBI showed 99% identity to the 16S small subunit rRNA of seven Synechococcus species.

  3. The Human Microbiome and Understanding the 16S rRNA Gene in Translational Nursing Science.

    Science.gov (United States)

    Ames, Nancy J; Ranucci, Alexandra; Moriyama, Brad; Wallen, Gwenyth R

    As more is understood regarding the human microbiome, it is increasingly important for nurse scientists and healthcare practitioners to analyze these microbial communities and their role in health and disease. 16S rRNA sequencing is a key methodology in identifying these bacterial populations that has recently transitioned from use primarily in research to having increased utility in clinical settings. The objectives of this review are to (a) describe 16S rRNA sequencing and its role in answering research questions important to nursing science; (b) provide an overview of the oral, lung, and gut microbiomes and relevant research; and (c) identify future implications for microbiome research and 16S sequencing in translational nursing science. Sequencing using the 16S rRNA gene has revolutionized research and allowed scientists to easily and reliably characterize complex bacterial communities. This type of research has recently entered the clinical setting, one of the best examples involving the use of 16S sequencing to identify resistant pathogens, thereby improving the accuracy of bacterial identification in infection control. Clinical microbiota research and related requisite methods are of particular relevance to nurse scientists-individuals uniquely positioned to utilize these techniques in future studies in clinical settings.

  4. Analysis of bacterial genetic diversity in biofloc by using ARDRA 16S-rRNA gene

    Directory of Open Access Journals (Sweden)

    , Widanarni

    2015-05-01

    Full Text Available ABSTRACT This study aimed to analyze the genetic diversity of bacteria associated in bioflocs using 16S-rRNA polymerase chain reaction (PCR with ARDRA technique. A total of 38 dominant bacterial isolates was obtained from bioflocs samples and of these isolates, 16S-rRNA gene was then isolated and amplified using PCR. The 16S-rRNA gene of the isolates was then cut using HaeIII (5’-GG↓CC and HhaI (5’-GCG↓C restriction enzymes resulting an ARDRA pattern which was further used as the binary data for the construction of phylogenetics tree that was used to estimate the group of bacteria. The result with HaeIII cut restriction enzyme from biofloc-associated bacteria gave 11 ARDRA patterns, while with the restriction enzyme HhaI gave eight ARDRA patterns. Phylogenetics of bacterial populations from biofloc-based cultivation system water consisted of at least 13 different bacterial species. Result of sequencing from two gene sample 16S-rRNA were identified as Microbacterium foliorumand and Pseudomonas putida. Keywords: bacterial diversity, ARDRA, biofloc, phylogeny  ABSTRAK Penelitian ini bertujuan untuk menganalisis keragaman genetika bakteri bioflok menggunakan metode polymerase chain reaction (PCR 16S-rRNA dengan teknik ARDRA. Sebanyak 38 isolat bakteri dominan yang diperoleh diamplifikasi gen 16S-rRNAnya dengan PCR, kemudian dipotong dengan enzim restriksi HaeIII (5’-GG↓CC dan HhaI (5’-GCG↓C. Pola ARDRA ini dijadikan data biner sebagai input untuk konstruksi pohon filogenetika yang dapat digunakan untuk memerkirakan jenis bakteri yang ada. Gen 16S-rRNA hasil PCR setelah dipotong dengan enzim restriksi HaeIII didapatkan 11 pola ARDRA, sedangkan dengan enzim restriksi HhaI menghasilkan delapan pola ARDRA. Berdasarkan pohon filogenetika, diketahui populasi bakteri pada air sistem budidaya bioflok sedikitnya terdiri atas 13 jenis bakteri. Berdasarkan sekuensing dari dua sampel gen 16S-rRNA teridentifikasi jenis bakteri Microbacterium

  5. A renaissance for the pioneering 16S rRNA gene

    Energy Technology Data Exchange (ETDEWEB)

    Tringe, Susannah; Hugenholtz, Philip

    2008-09-07

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the last quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  6. A renaissance for the pioneering 16S rRNA gene.

    Science.gov (United States)

    Tringe, Susannah G; Hugenholtz, Philip

    2008-10-01

    Culture-independent molecular surveys using the 16S rRNA gene have become a mainstay for characterizing microbial community structure over the past quarter century. More recently this approach has been overshadowed by metagenomics, which provides a global overview of a community's functional potential rather than just an inventory of its inhabitants. However, the pioneering 16S rRNA gene is making a comeback in its own right thanks to a number of methodological advancements including higher resolution (more sequences), analysis of multiple related samples (e.g. spatial and temporal series) and improved metadata, and use of metadata. The standard conclusion that microbial ecosystems are remarkably complex and diverse is now being replaced by detailed insights into microbial ecology and evolution based only on this one historically important marker gene.

  7. Diversity of 16S rRNA and dioxygenase genes detected in coal-tar-contaminated site undergoing active bioremediation

    Energy Technology Data Exchange (ETDEWEB)

    Kumar, M; Khanna, S [NIIT Univ, Neemrana (India). Dept. of Biotechnology & Bioinformation

    2010-04-15

    In order to develop effective bioremediation strategies for polyaromatic hydrocarbons (PAHs) degradation, the composition and metabolic potential of microbial communities need to be better understood, especially in highly PAH contaminated sites in which little information on the cultivation-independent communities is available. Coal-tar-contaminated soil was collected, which consisted of 122-122.5 mg g{sup -1} total extractable PAH compounds. Biodegradation studies with this soil indicated the presence of microbial community that is capable of degrading the model PAH compounds viz naphthalene, phenanthrene and pyrene at 50 ppm each. PCR clone libraries were established from the DNA of the coal-tar-contaminated soil, targeting the 16S rRNA to characterize (I) the microbial communities, (ii) partial gene fragment encoding the Rieske iron sulfur center {alpha}-subunit) common to all PAH dioxygenase enzymes and (iii) {beta}-subunit of dioxygenase. Phylotypes related to Proteobacteria ({Alpha}-, {Epsilon}- and Gammaproteobacteria), Acidobacteria, Actinobacteria, Firmicutes, Gemmatimonadetes and Deinococci were detected in 16S rRNA derived clone libraries. Many of the gene fragment sequences of alpha-subunit and beta-subunit of dioxygenase obtained from the respective clone libraries fell into clades that are distinct from the reference dioxygenase gene sequences. Presence of consensus sequence of the Rieske type (2Fe2S) cluster binding site suggested that these gene fragments encode for {alpha}-subunit of dioxygenase gene. Sequencing of the cloned libraries representing {alpha}-subunit gene fragments (Rf1) and beta-subunit of dioxygenase showed the presence of hitherto unidentified dioxygenase in coal-tar-contaminated soil.

  8. Greengenes: Chimera-checked 16S rRNA gene database and workbenchcompatible in ARB

    Energy Technology Data Exchange (ETDEWEB)

    DeSantis, T.Z.; Hugenholtz, P.; Larsen, N.; Rojas, M.; Brodie,E.L; Keller, K.; Huber, T.; Dalevi, D.; Hu, P.; Andersen, G.L.

    2006-02-01

    A 16S rRNA gene database (http://greengenes.lbl.gov) addresses limitations of public repositories by providing chimera-screening, standard alignments and taxonomic classification using multiple published taxonomies. It was revealed that incongruent taxonomic nomenclature exists among curators even at the phylum-level. Putative chimeras were identified in 3% of environmental sequences and 0.2% of records derived from isolates. Environmental sequences were classified into 100 phylum-level lineages within the Archaea and Bacteria.

  9. Intrinsic challenges in ancient microbiome reconstruction using 16S rRNA gene amplification.

    Science.gov (United States)

    Ziesemer, Kirsten A; Mann, Allison E; Sankaranarayanan, Krithivasan; Schroeder, Hannes; Ozga, Andrew T; Brandt, Bernd W; Zaura, Egija; Waters-Rist, Andrea; Hoogland, Menno; Salazar-García, Domingo C; Aldenderfer, Mark; Speller, Camilla; Hendy, Jessica; Weston, Darlene A; MacDonald, Sandy J; Thomas, Gavin H; Collins, Matthew J; Lewis, Cecil M; Hofman, Corinne; Warinner, Christina

    2015-11-13

    To date, characterization of ancient oral (dental calculus) and gut (coprolite) microbiota has been primarily accomplished through a metataxonomic approach involving targeted amplification of one or more variable regions in the 16S rRNA gene. Specifically, the V3 region (E. coli 341-534) of this gene has been suggested as an excellent candidate for ancient DNA amplification and microbial community reconstruction. However, in practice this metataxonomic approach often produces highly skewed taxonomic frequency data. In this study, we use non-targeted (shotgun metagenomics) sequencing methods to better understand skewed microbial profiles observed in four ancient dental calculus specimens previously analyzed by amplicon sequencing. Through comparisons of microbial taxonomic counts from paired amplicon (V3 U341F/534R) and shotgun sequencing datasets, we demonstrate that extensive length polymorphisms in the V3 region are a consistent and major cause of differential amplification leading to taxonomic bias in ancient microbiome reconstructions based on amplicon sequencing. We conclude that systematic amplification bias confounds attempts to accurately reconstruct microbiome taxonomic profiles from 16S rRNA V3 amplicon data generated using universal primers. Because in silico analysis indicates that alternative 16S rRNA hypervariable regions will present similar challenges, we advocate for the use of a shotgun metagenomics approach in ancient microbiome reconstructions.

  10. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  11. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons.

    Science.gov (United States)

    Lagkouvardos, Ilias; Fischer, Sandra; Kumar, Neeraj; Clavel, Thomas

    2017-01-01

    The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs) tables, including normalization steps, alpha - and beta -diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

  12. Rhea: a transparent and modular R pipeline for microbial profiling based on 16S rRNA gene amplicons

    Directory of Open Access Journals (Sweden)

    Ilias Lagkouvardos

    2017-01-01

    Full Text Available The importance of 16S rRNA gene amplicon profiles for understanding the influence of microbes in a variety of environments coupled with the steep reduction in sequencing costs led to a surge of microbial sequencing projects. The expanding crowd of scientists and clinicians wanting to make use of sequencing datasets can choose among a range of multipurpose software platforms, the use of which can be intimidating for non-expert users. Among available pipeline options for high-throughput 16S rRNA gene analysis, the R programming language and software environment for statistical computing stands out for its power and increased flexibility, and the possibility to adhere to most recent best practices and to adjust to individual project needs. Here we present the Rhea pipeline, a set of R scripts that encode a series of well-documented choices for the downstream analysis of Operational Taxonomic Units (OTUs tables, including normalization steps, alpha- and beta-diversity analysis, taxonomic composition, statistical comparisons, and calculation of correlations. Rhea is primarily a straightforward starting point for beginners, but can also be a framework for advanced users who can modify and expand the tool. As the community standards evolve, Rhea will adapt to always represent the current state-of-the-art in microbial profiles analysis in the clear and comprehensive way allowed by the R language. Rhea scripts and documentation are freely available at https://lagkouvardos.github.io/Rhea.

  13. Globicatella sanguinis bacteraemia identified by partial 16S rRNA gene sequencing

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Balslew, Ulla; Christensen, Jens Jørgen

    2007-01-01

    Globicatella sanguinis is a gram-positive coccus, resembling non-haemolytic streptococci. The organism has been isolated infrequently from normally sterile sites of humans. Three isolates obtained by blood culture could not be identified by Rapid 32 ID Strep, but partial sequencing of the 16S r......RNA gene revealed the identity of the isolated bacteria, and supplementary biochemical tests confirmed the species identification. The cases histories illustrate the dilemma of finding relevant, newly recognized, opportunistic pathogens and the identification achievement (s) that can be obtained by using...

  14. Phylogenetic inference of Coxiella burnetii by 16S rRNA gene sequencing.

    Directory of Open Access Journals (Sweden)

    Heather P McLaughlin

    Full Text Available Coxiella burnetii is a human pathogen that causes the serious zoonotic disease Q fever. It is ubiquitous in the environment and due to its wide host range, long-range dispersal potential and classification as a bioterrorism agent, this microorganism is considered an HHS Select Agent. In the event of an outbreak or intentional release, laboratory strain typing methods can contribute to epidemiological investigations, law enforcement investigation and the public health response by providing critical information about the relatedness between C. burnetii isolates collected from different sources. Laboratory cultivation of C. burnetii is both time-consuming and challenging. Availability of strain collections is often limited and while several strain typing methods have been described over the years, a true gold-standard method is still elusive. Building upon epidemiological knowledge from limited, historical strain collections and typing data is essential to more accurately infer C. burnetii phylogeny. Harmonization of auspicious high-resolution laboratory typing techniques is critical to support epidemiological and law enforcement investigation. The single nucleotide polymorphism (SNP -based genotyping approach offers simplicity, rapidity and robustness. Herein, we demonstrate SNPs identified within 16S rRNA gene sequences can differentiate C. burnetii strains. Using this method, 55 isolates were assigned to six groups based on six polymorphisms. These 16S rRNA SNP-based genotyping results were largely congruent with those obtained by analyzing restriction-endonuclease (RE-digested DNA separated by SDS-PAGE and by the high-resolution approach based on SNPs within multispacer sequence typing (MST loci. The SNPs identified within the 16S rRNA gene can be used as targets for the development of additional SNP-based genotyping assays for C. burnetii.

  15. Identification of active methanotrophs in a landfill cover soil through detection of expression of 16S rRNA and functional genes.

    Science.gov (United States)

    Chen, Yin; Dumont, Marc G; Cébron, Aurélie; Murrell, J Colin

    2007-11-01

    Active methanotrophs in a landfill soil were revealed by detecting the 16S rRNA of methanotrophs and the mRNA transcripts of key genes involved in methane oxidation. New 16S rRNA primers targeting type I and type II methanotrophs were designed and optimized for analysis by denaturing gradient gel electrophoresis. Direct extraction of RNA from soil enabled the analysis of the expression of the functional genes: mmoX, pmoA and mxaF, which encode subunits of soluble methane monooxygenase, particulate methane monooxygenase and methanol dehydrogenase respectively. The 16S rRNA polymerase chain reaction (PCR) primers for type I methanotrophs detected Methylomonas, Methylosarcina and Methylobacter sequences from both soil DNA and cDNA which was generated from RNA extracted directly from the landfill cover soil. The 16S rRNA primers for type II methanotrophs detected primarily Methylocella and some Methylocystis 16S rRNA genes. Phylogenetic analysis of mRNA recovered from the soil indicated that Methylobacter, Methylosarcina, Methylomonas, Methylocystis and Methylocella were actively expressing genes involved in methane and methanol oxidation. Transcripts of pmoA but not mmoX were readily detected by reverse transcription polymerase chain reaction (RT-PCR), indicating that particulate methane monooxygenase may be largely responsible for methane oxidation in situ.

  16. Partial Sequencing of 16S rRNA Gene of Selected Staphylococcus aureus Isolates and its Antibiotic Resistance

    Directory of Open Access Journals (Sweden)

    Harsi Dewantari Kusumaningrum

    2016-08-01

    Full Text Available The choice of primer used in 16S rRNA sequencing for identification of Staphylococcus species found in food is important. This study aimed to characterize Staphylococcus aureus isolates by partial sequencing based on 16S rRNA gene employing primers 16sF, 63F or 1387R. The isolates were isolated from milk, egg dishes and chicken dishes and selected based on the presence of sea gene that responsible for formation of enterotoxin-A. Antibiotic susceptibility of the isolates towards six antibiotics was also tested. The use of 16sF resulted generally in higher identity percentage and query coverage compared to the sequencing by 63F or 1387R. BLAST results of all isolates, sequenced by 16sF, showed 99% homology to complete genome of four S. aureus strains, with different characteristics on enterotoxin production and antibiotic resistance. Considering that all isolates were carrying sea gene, indicated by the occurence of 120 bp amplicon after PCR amplification using primer SEA1/SEA2,  the isolates were most in agreeing to S. aureus subsp. aureus ST288. This study indicated that 4 out of 8 selected isolates were resistant towards streptomycin. The 16S rRNA gene sequencing using 16sF is useful for identification of S. aureus. However, additional analysis such as PCR employing specific gene target, should give a valuable supplementary information, when specific characteristic is expected.

  17. Comparison of 16S ribosomal RNA gene sequence analysis and conventional culture in the environmental survey of a hospital

    OpenAIRE

    Manaka, Akihiro; Tokue, Yutaka; Murakami, Masami

    2017-01-01

    Background Nosocomial infection is one of the most common complications within health care facilities. Certain studies have reported outbreaks resulting from contaminated hospital environments. Although the identification of bacteria in the environment can readily be achieved using culturing methods, these methods detect live bacteria. Sequencing of the 16S ribosomal RNA (16S rRNA) gene is recognized to be effective for bacterial identification. In this study, we surveyed wards where drug-res...

  18. Identification by 16S rRNA Gene Sequencing of Lactobacillus salivarius Bacteremic Cholecystitis

    Science.gov (United States)

    Woo, Patrick C. Y.; Fung, Ami M. Y.; Lau, Susanna K. P.; Yuen, Kwok-Yung

    2002-01-01

    An anaerobic, nonsporulating, gram-positive bacterium was isolated from blood and bile pus cultures of a 70-year-old man with bacteremic acute cholecystitis. The API 20A system showed that it was 70% Actinomyces naeslundii and 30% Bifidobacterium species, whereas the Vitek ANI system and the ATB ID32A Expression system showed that it was “unidentified.” The 16S rRNA gene of the strain was amplified and sequenced. There were 3 base differences between the nucleotide sequence of the isolate and that of Lactobacillus salivarius subsp. salivarius or L. salivarius subsp. salicinius, indicating that the isolate was a strain of L. salivarius. The patient responded to cholecystectomy and a 2-week course of antibiotic treatment. Identification of the organism in the present study was important because the duration of antibiotic therapy would have been entirely different depending on the organism. If the bacterium had been identified as Actinomyces, penicillin for 6 months would have been the regimen of choice. However, it was Lactobacillus, and a 2-week course of antibiotic was sufficient. PMID:11773128

  19. Prokaryotic community profiling of local algae wastewaters using advanced 16S rRNA gene sequencing.

    Science.gov (United States)

    Limayem, Alya; Micciche, Andrew; Nayak, Bina; Mohapatra, Shyam

    2018-01-01

    Algae biomass-fed wastewaters are a promising source of lipid and bioenergy manufacture, revealing substantial end-product investment returns. However, wastewaters would contain lytic pathogens carrying drug resistance detrimental to algae yield and environmental safety. This study was conducted to simultaneously decipher through high-throughput advanced Illumina 16S ribosomal RNA (rRNA) gene sequencing, the cultivable and uncultivable bacterial community profile found in a single sample that was directly recovered from the local wastewater systems. Samples were collected from two previously documented sources including anaerobically digested (AD) municipal wastewater and swine wastewater with algae namely Chlorella spp. in addition to control samples, swine wastewater, and municipal wastewater without algae. Results indicated the presence of a significant level of Bacteria in all samples with an average of approximately 95.49% followed by Archaea 2.34%, in local wastewaters designed for algae cultivation. Taxonomic genus identification indicated the presence of Calothrix, Pseudomonas, and Clostridium as the most prevalent strains in both local municipal and swine wastewater samples containing algae with an average of 17.37, 12.19, and 7.84%, respectively. Interestingly, swine wastewater without algae displayed the lowest level of Pseudomonas strains algae indicates potential coexistence between these strains and algae microenvironment, suggesting further investigations. This finding was particularly relevant for the earlier documented adverse effects of some nosocomial Pseudomonas strains on algae growth and their multidrug resistance potential, requiring the development of targeted bioremediation with regard to the beneficial flora.

  20. Phylogenetic Relationship of Phosphate Solubilizing Bacteria according to 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mohammad Bagher Javadi Nobandegani

    2015-01-01

    Full Text Available Phosphate solubilizing bacteria (PSB can convert insoluble form of phosphorous to an available form. Applications of PSB as inoculants increase the phosphorus uptake by plant in the field. In this study, isolation and precise identification of PSB were carried out in Malaysian (Serdang oil palm field (University Putra Malaysia. Identification and phylogenetic analysis of 8 better isolates were carried out by 16S rRNA gene sequencing in which as a result five isolates belong to the Beta subdivision of Proteobacteria, one isolate was related to the Gama subdivision of Proteobacteria, and two isolates were related to the Firmicutes. Bacterial isolates of 6upmr, 2upmr, 19upmnr, 10upmr, and 24upmr were identified as Alcaligenes faecalis. Also, bacterial isolates of 20upmnr and 17upmnr were identified as Bacillus cereus and Vagococcus carniphilus, respectively, and bacterial isolates of 31upmr were identified as Serratia plymuthica. Molecular identification and characterization of oil palm strains as the specific phosphate solubilizer can reduce the time and cost of producing effective inoculate (biofertilizer in an oil palm field.

  1. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong; Qian, Pei-Yuan

    2009-01-01

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions

  2. Intra-Genomic Heterogeneity in 16S rRNA Genes in Strictly Anaerobic Clinical Isolates from Periodontal Abscesses.

    Science.gov (United States)

    Chen, Jiazhen; Miao, Xinyu; Xu, Meng; He, Junlin; Xie, Yi; Wu, Xingwen; Chen, Gang; Yu, Liying; Zhang, Wenhong

    2015-01-01

    Members of the genera Prevotella, Veillonella and Fusobacterium are the predominant culturable obligate anaerobic bacteria isolated from periodontal abscesses. When determining the cumulative number of clinical anaerobic isolates from periodontal abscesses, ambiguous or overlapping signals were frequently encountered in 16S rRNA gene sequencing chromatograms, resulting in ambiguous identifications. With the exception of the genus Veillonella, the high intra-chromosomal heterogeneity of rrs genes has not been reported. The 16S rRNA genes of 138 clinical, strictly anaerobic isolates and one reference strain were directly sequenced, and the chromatograms were carefully examined. Gene cloning was performed for 22 typical isolates with doublet sequencing signals for the 16S rRNA genes, and four copies of the rrs-ITS genes of 9 Prevotella intermedia isolates were separately amplified by PCR, sequenced and compared. Five conserved housekeeping genes, hsp60, recA, dnaJ, gyrB1 and rpoB from 89 clinical isolates of Prevotella were also amplified by PCR and sequenced for identification and phylogenetic analysis along with 18 Prevotella reference strains. Heterogeneity of 16S rRNA genes was apparent in clinical, strictly anaerobic oral bacteria, particularly in the genera Prevotella and Veillonella. One hundred out of 138 anaerobic strains (72%) had intragenomic nucleotide polymorphisms (SNPs) in multiple locations, and 13 strains (9.4%) had intragenomic insertions or deletions in the 16S rRNA gene. In the genera Prevotella and Veillonella, 75% (67/89) and 100% (19/19) of the strains had SNPs in the 16S rRNA gene, respectively. Gene cloning and separate amplifications of four copies of the rrs-ITS genes confirmed that 2 to 4 heterogeneous 16S rRNA copies existed. Sequence alignment of five housekeeping genes revealed that intra-species nucleotide similarities were very high in the genera Prevotella, ranging from 94.3-100%. However, the inter-species similarities were

  3. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...

  4. Microbial community in persistent apical periodontitis: a 16S rRNA gene clone library analysis.

    Science.gov (United States)

    Zakaria, M N; Takeshita, T; Shibata, Y; Maeda, H; Wada, N; Akamine, A; Yamashita, Y

    2015-08-01

    To characterize the microbial composition of persistent periapical lesions of root filled teeth using a molecular genetics approach. Apical lesion samples were collected from 12 patients (23-80 years old) who visited the Kyushu University Hospital for apicectomy with persistent periapical lesions associated with root filled teeth. DNA was directly extracted from each sample and the microbial composition was comprehensively analysed using clone library analysis of the 16S rRNA gene. Enterococcus faecalis, Candida albicans and specific fimA genotypes of Porphyromonas gingivalis were confirmed using polymerase chain reaction (PCR) analysis with specific primers. Bacteria were detected in all samples, and the dominant findings were P. gingivalis (19.9%), Fusobacterium nucleatum (11.2%) and Propionibacterium acnes (9%). Bacterial diversity was greater in symptomatic lesions than in asymptomatic ones. In addition, the following bacteria or bacterial combinations were characteristic to symptomatic lesions: Prevotella spp., Treponema spp., Peptostreptococcaceae sp. HOT-113, Olsenella uli, Slackia exigua, Selemonas infelix, P. gingivalis with type IV fimA, and a combination of P. gingivalis, F. nucleatum, and Peptostreptococcaceae sp. HOT-113 and predominance of Streptococcus spp. On the other hand, neither Enterococcus faecalis nor C. albicans were detected in any of the samples. Whilst a diverse bacterial species were observed in the persistent apical lesions, some characteristic patterns of bacterial community were found in the symptomatic lesions. The diverse variation of community indicates that bacterial combinations as a community may cause persistent inflammation in periapical tissues rather than specific bacterial species. © 2014 International Endodontic Journal. Published by John Wiley & Sons Ltd.

  5. Polybacterial community analysis in human conjunctiva through 16S rRNA gene libraries.

    Science.gov (United States)

    Deepthi, KrishnanNair Geetha; Jayasudha, Rajagopalaboopathi; Girish, Rameshan Nair; Manikandan, Palanisamy; Ram, Rammohan; Narendran, Venkatapathy; Prabagaran, Solai Ramatchandirane

    2018-05-14

    The conjunctival sac of healthy human harbours a variety of microorganisms. When the eye is compromised, an occasional inadvertent spread happens to the adjacent tissue, resulting in bacterial ocular infections. Microbiological investigation of the conjunctival swab is one of the broadly used modality to study the aetiological agent of conjunctiva. However, most of the time such methods yield unsatisfactory results. Hence, the present study intends to identify the bacterial community in human conjunctiva of pre-operative subjects through 16S rRNA gene libraries. Out of 45 samples collected from preoperative patients undergoing cataract surgery, 36 libraries were constructed with bacterial nested-PCR-positive samples. The representative clones with unique restriction pattern were generated through Amplified Ribosomal DNA Restriction Analysis (ARDRA) which were sequenced for phylogenetic affiliation. A total of 211 representative clones were obtained which were distributed in phyla Actinobacteria, Firmicutes, α-Proteobacteria, β-Proteobacteria, γ-Proteobacteria, Bacteroidetes, and Deinococcus-Thermus. Findings revealed the presence of polybacterial community, especially in some cases even though no bacterium or a single bacterium alone was identified through cultivable method. Remarkably, we identified 17 species which have never been reported in any ocular infections. The sequencing data reported 6 unidentified bacteria suggesting the possibility of novel organisms in the sample. Since, polybacterial community has been identified consisting of both gram positive and gram negative bacteria, a broad spectrum antibiotic therapy is advisable to the patients who are undergoing cataract surgery. Consolidated effort would significantly improve a clear understanding of the nature of microbial community in the human conjunctiva which will promote administration of appropriate antibiotic regimen and also help in the development of oligonucleotide probes to screen the

  6. Extensive 16S rRNA gene sequence diversity in Campylobacter hyointestinalis strains: taxonomic and applied implications

    DEFF Research Database (Denmark)

    Harrington, C.S.; On, Stephen L.W.

    1999-01-01

    Phylogenetic relationships of Campylobacter hyointestinalis subspecies were examined by means of 16S rRNA gene sequencing. Sequence similarities among C. hyointestinalis subsp. lawsonii strains exceeded 99.0 %, but values among C. hyointestinalis subsp. hyointestinalis strains ranged from 96...... of the genus Campylobacter, emphasizing the need for multiple strain analysis when using 16S rRNA gene sequence comparisons for taxonomic investigations........4 to 100 %. Sequence similarites between strains representing the two different subspecies ranged from 95.7 to 99.0 %. An intervening sequence was identified in certain of the C. hyointestinalis subsp. lawsonii strains. C. hyointestinalis strains occupied two distinct branches in a phylogenetic analysis...

  7. Variable Copy Number, Intra-Genomic Heterogeneities and Lateral Transfers of the 16S rRNA Gene in Pseudomonas

    Science.gov (United States)

    Bodilis, Josselin; Nsigue-Meilo, Sandrine; Besaury, Ludovic; Quillet, Laurent

    2012-01-01

    Even though the 16S rRNA gene is the most commonly used taxonomic marker in microbial ecology, its poor resolution is still not fully understood at the intra-genus level. In this work, the number of rRNA gene operons, intra-genomic heterogeneities and lateral transfers were investigated at a fine-scale resolution, throughout the Pseudomonas genus. In addition to nineteen sequenced Pseudomonas strains, we determined the 16S rRNA copy number in four other Pseudomonas strains by Southern hybridization and Pulsed-Field Gel Electrophoresis, and studied the intra-genomic heterogeneities by Denaturing Gradient Gel Electrophoresis and sequencing. Although the variable copy number (from four to seven) seems to be correlated with the evolutionary distance, some close strains in the P. fluorescens lineage showed a different number of 16S rRNA genes, whereas all the strains in the P. aeruginosa lineage displayed the same number of genes (four copies). Further study of the intra-genomic heterogeneities revealed that most of the Pseudomonas strains (15 out of 19 strains) had at least two different 16S rRNA alleles. A great difference (5 or 19 nucleotides, essentially grouped near the V1 hypervariable region) was observed only in two sequenced strains. In one of our strains studied (MFY30 strain), we found a difference of 12 nucleotides (grouped in the V3 hypervariable region) between copies of the 16S rRNA gene. Finally, occurrence of partial lateral transfers of the 16S rRNA gene was further investigated in 1803 full-length sequences of Pseudomonas available in the databases. Remarkably, we found that the two most variable regions (the V1 and V3 hypervariable regions) had probably been laterally transferred from another evolutionary distant Pseudomonas strain for at least 48.3 and 41.6% of the 16S rRNA sequences, respectively. In conclusion, we strongly recommend removing these regions of the 16S rRNA gene during the intra-genus diversity studies. PMID:22545126

  8. Defining reference sequences for Nocardia species by similarity and clustering analyses of 16S rRNA gene sequence data.

    Directory of Open Access Journals (Sweden)

    Manal Helal

    Full Text Available BACKGROUND: The intra- and inter-species genetic diversity of bacteria and the absence of 'reference', or the most representative, sequences of individual species present a significant challenge for sequence-based identification. The aims of this study were to determine the utility, and compare the performance of several clustering and classification algorithms to identify the species of 364 sequences of 16S rRNA gene with a defined species in GenBank, and 110 sequences of 16S rRNA gene with no defined species, all within the genus Nocardia. METHODS: A total of 364 16S rRNA gene sequences of Nocardia species were studied. In addition, 110 16S rRNA gene sequences assigned only to the Nocardia genus level at the time of submission to GenBank were used for machine learning classification experiments. Different clustering algorithms were compared with a novel algorithm or the linear mapping (LM of the distance matrix. Principal Components Analysis was used for the dimensionality reduction and visualization. RESULTS: The LM algorithm achieved the highest performance and classified the set of 364 16S rRNA sequences into 80 clusters, the majority of which (83.52% corresponded with the original species. The most representative 16S rRNA sequences for individual Nocardia species have been identified as 'centroids' in respective clusters from which the distances to all other sequences were minimized; 110 16S rRNA gene sequences with identifications recorded only at the genus level were classified using machine learning methods. Simple kNN machine learning demonstrated the highest performance and classified Nocardia species sequences with an accuracy of 92.7% and a mean frequency of 0.578. CONCLUSION: The identification of centroids of 16S rRNA gene sequence clusters using novel distance matrix clustering enables the identification of the most representative sequences for each individual species of Nocardia and allows the quantitation of inter- and intra

  9. Comparative analysis of vaginal microbiota sampling using 16S rRNA gene analysis.

    Science.gov (United States)

    Virtanen, Seppo; Kalliala, Ilkka; Nieminen, Pekka; Salonen, Anne

    2017-01-01

    Molecular methods such as next-generation sequencing are actively being employed to characterize the vaginal microbiota in health and disease. Previous studies have focused on characterizing the biological variation in the microbiota, and less is known about how factors related to sampling contribute to the results. Our aim was to investigate the impact of a sampling device and anatomical sampling site on the quantitative and qualitative outcomes relevant for vaginal microbiota research. We sampled 10 Finnish women representing diverse clinical characteristics with flocked swabs, the Evalyn® self-sampling device, sterile plastic spatulas and a cervical brush that were used to collect samples from fornix, vaginal wall and cervix. Samples were compared on DNA and protein yield, bacterial load, and microbiota diversity and species composition based on Illumina MiSeq sequencing of the 16S rRNA gene. We quantified the relative contributions of sampling variables versus intrinsic variables in the overall microbiota variation, and evaluated the microbiota profiles using several commonly employed metrics such as alpha and beta diversity as well as abundance of major bacterial genera and species. The total DNA yield was strongly dependent on the sampling device and to a lesser extent on the anatomical site of sampling. The sampling strategy did not affect the protein yield or the bacterial load. All tested sampling methods produced highly comparable microbiota profiles based on MiSeq sequencing. The sampling method explained only 2% (p-value = 0.89) of the overall microbiota variation, markedly surpassed by intrinsic factors such as clinical status (microscopy for bacterial vaginosis 53%, p = 0.0001), bleeding (19%, p = 0.0001), and the variation between subjects (11%, p-value 0.0001). The results indicate that different sampling strategies yield comparable vaginal microbiota composition and diversity. Hence, past and future vaginal microbiota studies employing different

  10. Campylobacter jejuni, an uncommon cause of splenic abscess diagnosed by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Piseth Seng

    2014-12-01

    Full Text Available Splenic abscess is a rare disease that primarily occurs in patients with splenic trauma, endocarditis, sickle cell anemia, or other diseases that compromise the immune system. This report describes a culture-negative splenic abscess in an immunocompetent patient caused by Campylobacter jejuni, as determined by 16S rRNA gene sequencing.

  11. Phylogenetic analysis of Thai oyster (Ostreidae) based on partial sequences of the mitochondrial 16S rDNA gene

    DEFF Research Database (Denmark)

    Bussarawit, Somchai; Gravlund, Peter; Glenner, Henrik

    2006-01-01

    Ten oyster species of the family Ostreidae (Subfamilies Crassostreinae and Lophinae) from Thailand were studied using morphological data and mitochondrial 16S rDNA gene sequences. Additional sequence data from five specimens of Ostreidae and one specimen of Tridacna gigas were downloaded from Gen...

  12. Direct 16S rRNA gene sequencing of polymicrobial culture-negative samples with analysis of mixed chromatograms

    DEFF Research Database (Denmark)

    Hartmeyer, Gitte N; Justesen, Ulrik S

    2010-01-01

    Two cases involving polymicrobial culture-negative samples were investigated by 16S rRNA gene sequencing, with analysis of mixed chromatograms. Fusobacterium necrophorum, Prevotella intermedia and Streptococcus constellatus were identified from pleural fluid in a patient with Lemierre's syndrome...

  13. 16S rRNA gene sequencing in routine identification of anaerobic bacteria isolated from blood cultures

    DEFF Research Database (Denmark)

    Justesen, Ulrik Stenz; Skov, Marianne Nielsine; Knudsen, Elisa

    2010-01-01

    A comparison between conventional identification and 16S rRNA gene sequencing of anaerobic bacteria isolated from blood cultures in a routine setting was performed (n = 127). With sequencing, 89% were identified to the species level, versus 52% with conventional identification. The times...

  14. Comparison of gull-specific assays targeting 16S rRNA gene of Catellicoccus marimammalium and Streptococcus spp.

    Science.gov (United States)

    Gulls have been implicated as a source of fecal contamination in inland and coastal waters. Only one gull-specific assay is currently available (i.e., gull2 qPCR assay). This assay is based on the 16S rRNA gene of Catellicocclls marimammalium and has showed a high level of host-s...

  15. Exploring internal features of 16S rRNA gene for identification of clinically relevant species of the genus Streptococcus

    Science.gov (United States)

    2011-01-01

    Background Streptococcus is an economically important genus as a number of species belonging to this genus are human and animal pathogens. The genus has been divided into different groups based on 16S rRNA gene sequence similarity. The variability observed among the members of these groups is low and it is difficult to distinguish them. The present study was taken up to explore 16S rRNA gene sequence to develop methods that can be used for preliminary identification and can supplement the existing methods for identification of clinically-relevant isolates of the genus Streptococcus. Methods 16S rRNA gene sequences belonging to the isolates of S. dysgalactiae, S. equi, S. pyogenes, S. agalactiae, S. bovis, S. gallolyticus, S. mutans, S. sobrinus, S. mitis, S. pneumoniae, S. thermophilus and S. anginosus were analyzed with the purpose to define genetic variability within each species to generate a phylogenetic framework, to identify species-specific signatures and in-silico restriction enzyme analysis. Results The framework based analysis was used to segregate Streptococcus spp. previously identified upto genus level. This segregation was validated using species-specific signatures and in-silico restriction enzyme analysis. 43 uncharacterized Streptococcus spp. could be identified using this approach. Conclusions The markers generated exploring 16S rRNA gene sequences provided useful tool that can be further used for identification of different species of the genus Streptococcus. PMID:21702978

  16. Plastid 16S rRNA gene diversity among eukaryotic picophytoplankton sorted by flow cytometry from the South Pacific Ocean.

    Directory of Open Access Journals (Sweden)

    Xiao Li Shi

    Full Text Available The genetic diversity of photosynthetic picoeukaryotes was investigated in the South East Pacific Ocean. Genetic libraries of the plastid 16S rRNA gene were constructed on picoeukaryote populations sorted by flow cytometry, using two different primer sets, OXY107F/OXY1313R commonly used to amplify oxygenic organisms, and PLA491F/OXY1313R, biased towards plastids of marine algae. Surprisingly, the two sets revealed quite different photosynthetic picoeukaryote diversity patterns, which were moreover different from what we previously reported using the 18S rRNA nuclear gene as a marker. The first 16S primer set revealed many sequences related to Pelagophyceae and Dictyochophyceae, the second 16S primer set was heavily biased toward Prymnesiophyceae, while 18S sequences were dominated by Prasinophyceae, Chrysophyceae and Haptophyta. Primer mismatches with major algal lineages is probably one reason behind this discrepancy. However, other reasons, such as DNA accessibility or gene copy numbers, may be also critical. Based on plastid 16S rRNA gene sequences, the structure of photosynthetic picoeukaryotes varied along the BIOSOPE transect vertically and horizontally. In oligotrophic regions, Pelagophyceae, Chrysophyceae, and Prymnesiophyceae dominated. Pelagophyceae were prevalent at the DCM depth and Chrysophyceae at the surface. In mesotrophic regions Pelagophyceae were still important but Chlorophyta contribution increased. Phylogenetic analysis revealed a new clade of Prasinophyceae (clade 16S-IX, which seems to be restricted to hyper-oligotrophic stations. Our data suggest that a single gene marker, even as widely used as 18S rRNA, provides a biased view of eukaryotic communities and that the use of several markers is necessary to obtain a complete image.

  17. 16S rRNA gene sequencing as a tool to study microbial populations in foods and process environments

    DEFF Research Database (Denmark)

    Buschhardt, Tasja; Hansen, Tina Beck; Bahl, Martin Iain

    2015-01-01

    communities in meat and the meat process environment with special focus on the Enterobacteriaceae family as a subpopulation comprising enteropathogens including Salmonella. Samples were analyzed by a nested PCR approach combined with MiSeq® Illumina®16S DNA sequencing and standardized culture methods as cross...... reference. Results: Taxonomic assignments and abundances of sequences in the total community and in the Enterobacteriaceae subpopulation were affected by the 16S rRNA gene variable region, DNA extraction methods, and polymerases chosen. However, community compositions were very reproducible when the same...

  18. Characterization of Acinetobacter baumannii clinical isolates carrying bla(OXA-23) carbapenemase and 16S rRNA methylase armA genes in Yemen.

    Science.gov (United States)

    Bakour, Sofiane; Alsharapy, Samer Ahmed; Touati, Abdelaziz; Rolain, Jean-Marc

    2014-12-01

    The aim of this study was to investigate the molecular support of resistance to carbapenems, aminoglycosides, and fluoroquinolones in Acinetobacter baumannii clinical isolates collected from Yemen hospital. Three A. baumannii were isolated in February 2013 from three patients hospitalized at Al-Thawra University Hospital in Sana'a, Yemen. Antibiotic susceptibility testing was performed using the disk diffusion and E-test methods. Carbapenemase production was carried out by the modified Hodge test (MHT) and imipenem-ethylenediaminetetraacetic acid (EDTA) methods. Carbapenem, aminoglycoside, and fluoroquinolone resistance determinants were studied by polymerase chain reaction and sequencing. The epidemiological relatedness of the three strains was studied using multilocus sequence typing (MLST). The isolates were resistant to almost all antibiotics tested with very high imipenem, amikacin, and ciprofloxacin minimum inhibitory concentrations (>32, >256, and >32 mg/L, respectively). The microbiological tests showed that the three A. baumannii were MHT positive, besides, the activity of β-lactamases was not inhibited by EDTA. All the three isolates contained the naturally occurring bla(OXA-51)-like gene and the bla(OXA-23)-like carbapenemase-encoding gene. The 16S rRNA methylase armA gene was detected in the three isolates. In addition, screening for genes encoding the aminoglycoside-modifying enzymes (AMEs) demonstrated that one isolate contained the acetyltransferase gene aac(6')-Ib. Fluoroquinolone resistance was associated with a single mutation Ser83Leu in the quinolone resistance determining region of the gyrA gene in all isolates. The MLST showed that the sequence type (ST) obtained corresponds to ST2 for the three strains. Here we report the first identification of multidrug-resistant A. baumannii isolates harboring the bla(OXA-23)-like gene, AMEs [aac(6')-Ib], and the 16S rRNA methylase (armA) in the Yemen hospital.

  19. Flow Cytometry-Assisted Cloning of Specific Sequence Motifs from Complex 16S rRNA Gene Libraries

    DEFF Research Database (Denmark)

    Nielsen, Jeppe Lund; Schramm, Andreas; Bernhard, Anne E.

    2004-01-01

    for Systems Biology,3 Seattle, Washington, and Department of Ecological Microbiology, University of Bayreuth, Bayreuth, Germany2 A flow cytometry method was developed for rapid screening and recovery of cloned DNA containing common sequence motifs. This approach, termed fluorescence-activated cell sorting......  FLOW CYTOMETRY-ASSISTED CLONING OF SPECIFIC SEQUENCE MOTIFS FROM COMPLEX 16S RRNA GENE LIBRARIES Jeppe L. Nielsen,1 Andreas Schramm,1,2 Anne E. Bernhard,1 Gerrit J. van den Engh,3 and David A. Stahl1* Department of Civil and Environmental Engineering, University of Washington,1 and Institute......-assisted cloning, was used to recover sequences affiliated with a unique lineage within the Bacteroidetes not abundant in a clone library of environmental 16S rRNA genes.  ...

  20. Dominant obligate anaerobes revealed in lower respiratory tract infection in horses by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kinoshita, Yuta; Niwa, Hidekazu; Katayama, Yoshinari; Hariu, Kazuhisa

    2014-04-01

    Obligate anaerobes are important etiological agents in pneumonia or pleuropneumonia in horses, because they are isolated more commonly from ill horses that have died or been euthanized than from those that survive. We performed bacterial identification and antimicrobial susceptibility testing for obligate anaerobes to establish effective antimicrobial therapy. We used 16S rRNA gene sequencing to identify 58 obligate anaerobes and compared the results with those from a phenotypic identification kit. The identification results of 16S rRNA gene sequencing were more reliable than those of the commercial kit. We concluded that genera Bacteroides and Prevotella-especially B. fragilis and P. heparinolytica-are dominant anaerobes in lower respiratory tract infection in horses; these organisms were susceptible to metronidazole, imipenem and clindamycin.

  1. A comprehensive evaluation of the sl1p pipeline for 16S rRNA gene sequencing analysis.

    Science.gov (United States)

    Whelan, Fiona J; Surette, Michael G

    2017-08-14

    Advances in next-generation sequencing technologies have allowed for detailed, molecular-based studies of microbial communities such as the human gut, soil, and ocean waters. Sequencing of the 16S rRNA gene, specific to prokaryotes, using universal PCR primers has become a common approach to studying the composition of these microbiota. However, the bioinformatic processing of the resulting millions of DNA sequences can be challenging, and a standardized protocol would aid in reproducible analyses. The short-read library 16S rRNA gene sequencing pipeline (sl1p, pronounced "slip") was designed with the purpose of mitigating this lack of reproducibility by combining pre-existing tools into a computational pipeline. This pipeline automates the processing of raw 16S rRNA gene sequencing data to create human-readable tables, graphs, and figures to make the collected data more readily accessible. Data generated from mock communities were compared using eight OTU clustering algorithms, two taxon assignment approaches, and three 16S rRNA gene reference databases. While all of these algorithms and options are available to sl1p users, through testing with human-associated mock communities, AbundantOTU+, the RDP Classifier, and the Greengenes 2011 reference database were chosen as sl1p's defaults based on their ability to best represent the known input communities. sl1p promotes reproducible research by providing a comprehensive log file, and reduces the computational knowledge needed by the user to process next-generation sequencing data. sl1p is freely available at https://bitbucket.org/fwhelan/sl1p .

  2. Assessing hog lagoon waste contamination in the Cape Fear Watershed using Bacteroidetes 16S rRNA gene pyrosequencing.

    Science.gov (United States)

    Arfken, Ann M; Song, Bongkeun; Mallin, Michael A

    2015-09-01

    Hog lagoons can be major sources of waste and nutrient contamination to watersheds adjacent to pig farms. Fecal source tracking methods targeting Bacteroidetes 16S rRNA genes in pig fecal matter may underestimate or fail to detect hog lagoon contamination in riverine environments. In order to detect hog lagoon wastewater contamination in the Cape Fear Watershed, where a large number of hog farms are present, we conducted pyrosequencing analyses of Bacteroidetes 16S rRNA genes in hog lagoon waste and identified new hog lagoon-specific marker sequences. Additional pyrosequencing analyses of Bacteroidetes 16S rRNA genes were conducted with surface water samples collected at 4 sites during 5 months in the Cape Fear Watershed. Using an operational taxonomic unit (OTU) identity cutoff value of 97 %, these newly identified hog lagoon markers were found in 3 of the river samples, while only 1 sample contained the pig fecal marker. In the sample containing the pig fecal marker, there was a relatively high percentage (14.1 %) of the hog lagoon markers and a low pig fecal marker relative abundance of 0.4 % in the Bacteroidetes 16S rRNA gene sequences. This suggests that hog lagoon contamination must be somewhat significant in order for pig fecal markers to be detected, and low levels of hog lagoon contamination cannot be detected targeting only pig-specific fecal markers. Thus, new hog lagoon markers have a better detection capacity for lagoon waste contamination, and in conjunction with a pig fecal marker, provide a more comprehensive and accurate detection of hog lagoon waste contamination in susceptible watersheds.

  3. 16S rRNA gene-based phylogenetic microarray for simultaneous identification of members of the genus Burkholderia.

    Science.gov (United States)

    Schönmann, Susan; Loy, Alexander; Wimmersberger, Céline; Sobek, Jens; Aquino, Catharine; Vandamme, Peter; Frey, Beat; Rehrauer, Hubert; Eberl, Leo

    2009-04-01

    For cultivation-independent and highly parallel analysis of members of the genus Burkholderia, an oligonucleotide microarray (phylochip) consisting of 131 hierarchically nested 16S rRNA gene-targeted oligonucleotide probes was developed. A novel primer pair was designed for selective amplification of a 1.3 kb 16S rRNA gene fragment of Burkholderia species prior to microarray analysis. The diagnostic performance of the microarray for identification and differentiation of Burkholderia species was tested with 44 reference strains of the genera Burkholderia, Pandoraea, Ralstonia and Limnobacter. Hybridization patterns based on presence/absence of probe signals were interpreted semi-automatically using the novel likelihood-based strategy of the web-tool Phylo- Detect. Eighty-eight per cent of the reference strains were correctly identified at the species level. The evaluated microarray was applied to investigate shifts in the Burkholderia community structure in acidic forest soil upon addition of cadmium, a condition that selected for Burkholderia species. The microarray results were in agreement with those obtained from phylogenetic analysis of Burkholderia 16S rRNA gene sequences recovered from the same cadmiumcontaminated soil, demonstrating the value of the Burkholderia phylochip for determinative and environmental studies.

  4. Phylogenetic analysis of Fusobacterium prausnitzii based upon the 16S rRNA gene sequence and PCR confirmation.

    Science.gov (United States)

    Wang, R F; Cao, W W; Cerniglia, C E

    1996-01-01

    In order to develop a PCR method to detect Fusobacterium prausnitzii in human feces and to clarify the phylogenetic position of this species, its 16S rRNA gene sequence was determined. The sequence described in this paper is different from the 16S rRNA gene sequence is specific for F. prausnitzii, and the results of this assay confirmed that F. prausnitzii is the most common species in human feces. However, a PCR assay based on the original GenBank sequence was negative when it was performed with two strains of F. prausnitzii obtained from the American Type Culture Collection. A phylogenetic tree based on the new 16S rRNA gene sequence was constructed. On this tree F. prausnitzii was not a member of the Fusobacterium group but was closer to some Eubacterium spp. and located between Clostridium "clusters III and IV" (M.D. Collins, P.A. Lawson, A. Willems, J.J. Cordoba, J. Fernandez-Garayzabal, P. Garcia, J. Cai, H. Hippe, and J.A.E. Farrow, Int. J. Syst. Bacteriol. 44:812-826, 1994).

  5. Conservative fragments in bacterial 16S rRNA genes and primer design for 16S ribosomal DNA amplicons in metagenomic studies

    KAUST Repository

    Wang, Yong

    2009-10-09

    Bacterial 16S ribosomal DNA (rDNA) amplicons have been widely used in the classification of uncultured bacteria inhabiting environmental niches. Primers targeting conservative regions of the rDNAs are used to generate amplicons of variant regions that are informative in taxonomic assignment. One problem is that the percentage coverage and application scope of the primers used in previous studies are largely unknown. In this study, conservative fragments of available rDNA sequences were first mined and then used to search for candidate primers within the fragments by measuring the coverage rate defined as the percentage of bacterial sequences containing the target. Thirty predicted primers with a high coverage rate (>90%) were identified, which were basically located in the same conservative regions as known primers in previous reports, whereas 30% of the known primers were associated with a coverage rate of <90%. The application scope of the primers was also examined by calculating the percentages of failed detections in bacterial phyla. Primers A519-539, E969- 983, E1063-1081, U515 and E517, are highly recommended because of their high coverage in almost all phyla. As expected, the three predominant phyla, Firmicutes, Gemmatimonadetes and Proteobacteria, are best covered by the predicted primers. The primers recommended in this report shall facilitate a comprehensive and reliable survey of bacterial diversity in metagenomic studies. © 2009 Wang, Qian.

  6. DNA sequencing reveals limited heterogeneity in the 16S rRNA gene from the rrnB operon among five Mycoplasma hominis isolates

    DEFF Research Database (Denmark)

    Mygind, T; Birkelund, Svend; Christiansen, Gunna

    1998-01-01

    To investigate the intraspecies heterogeneity within the 16S rRNA gene of Mycoplasma hominis, five isolates with diverse antigenic profiles, variable/identical P120 hypervariable domains, and different 16S rRNA gene RFLP patterns were analysed. The 16S rRNA gene from the rrnB operon was amplified...... by PCR and the PCR products were sequenced. Three isolates had identical 16S rRNA sequences and two isolates had sequences that differed from the others by only one nucleotide....

  7. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    KAUST Repository

    Ngugi, David; Stingl, Ulrich

    2012-01-01

    that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While

  8. Changes in the Composition of Drinking Water Bacterial Clone Libraries Introduced by Using Two Different 16S rRNA Gene PCR Primers

    Science.gov (United States)

    Sequence analysis of 16S rRNA gene clone libraries is a popular tool used to describe the composition of natural microbial communities. Commonly, clone libraries are developed by direct cloning of 16S rRNA gene PCR products. Different primers are often employed in the initial amp...

  9. Sequencing of 16S rRNA gene for id ntification of Sta h lococcus ...

    African Journals Online (AJOL)

    Asdmin

    2014-01-15

    Jan 15, 2014 ... as the type strains of a species of genus Trichoderma based on phylogenetic tree analysis together with the 18S rRNA gene sequence search in Ribosomal Database Project, small subunit rRNA and large subunit rRNA databases. The sequence was deposited in GenBank with the accession numbers.

  10. The Comparison of Biochemical and Sequencing 16S rDNA Gene Methods to Identify Nontuberculous Mycobacteria

    Directory of Open Access Journals (Sweden)

    Shafipour1, M.

    2014-11-01

    Full Text Available The identification of Mycobacteria in the species level has great medical importance. Biochemical tests are laborious and time-consuming, so new techniques could be used to identify the species. This research aimed to the comparison of biochemical and sequencing 16S rDNA gene methods to identify nontuberculous Mycobacteria in patients suspected to tuberculosis in Golestan province which is the most prevalent region of tuberculosis in Iran. Among 3336 patients suspected to tuberculosis referred to hospitals and health care centres in Golestan province during 2010-2011, 319 (9.56% culture positive cases were collected. Identification of species by using biochemical tests was done. On the samples recognized as nontuberculous Mycobacteria, after DNA extraction by boiling, 16S rDNA PCR was done and their sequencing were identified by NCBI BLAST. Of the 319 positive samples in Golestan Province, 300 cases were M.tuberculosis and 19 cases (5.01% were identified as nontuberculous Mycobacteria by biochemical tests. 15 out of 19 nontuberculous Mycobacteria were identified by PCR and sequencing method as similar by biochemical methods (similarity rate: 78.9%. But after PCR, 1 case known as M.simiae by biochemical test was identified as M. lentiflavum and 3 other cases were identified as Nocardia. Biochemical methods corresponded to the 16S rDNA PCR and sequencing in 78.9% of cases. However, in identification of M. lentiflavum and Nocaria sp. the molecular method is better than biochemical methods.

  11. Using DGGE and 16S rRNA gene sequence analysis to evaluate changes in oral bacterial composition.

    Science.gov (United States)

    Chen, Zhou; Trivedi, Harsh M; Chhun, Nok; Barnes, Virginia M; Saxena, Deepak; Xu, Tao; Li, Yihong

    2011-01-01

    To investigate whether a standard dental prophylaxis followed by tooth brushing with an antibacterial dentifrice will affect the oral bacterial community, as determined by denaturing gradient gel electrophoresis (DGGE) combined with 16S rRNA gene sequence analysis. Twenty-four healthy adults were instructed to brush their teeth using commercial dentifrice for 1 week during a washout period. An initial set of pooled supragingival plaque samples was collected from each participant at baseline (0 h) before prophylaxis treatment. The subjects were given a clinical examination and dental prophylaxis and asked to brush for 1 min with a dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride (Colgate Total). On the following day, a second set of pooled supragingival plaque samples (24 h) was collected. Total bacterial genomic DNA was isolated from the samples. Differences in the microbial composition before and after the prophylactic procedure and tooth brushing were assessed by comparing the DGGE profiles and 16S rRNA gene segments sequence analysis. Two distinct clusters of DGGE profiles were found, suggesting that a shift in the microbial composition had occurred 24 h after the prophylaxis and brushing. A detailed sequencing analysis of 16S rRNA gene segments further identified 6 phyla and 29 genera, including known and unknown bacterial species. Importantly, an increase in bacterial diversity was observed after 24 h, including members of the Streptococcaceae family, Prevotella, Corynebacterium, TM7 and other commensal bacteria. The results suggest that the use of a standard prophylaxis followed by the use of the dentifrice containing 0.3% triclosan, 2.0% PVM/MA copolymer and 0.243% sodium fluoride may promote a healthier composition within the oral bacterial community.

  12. Lyme disease caused by Borrelia burgdorferi with two homeologous 16S rRNA genes: a case report

    Directory of Open Access Journals (Sweden)

    Lee SH

    2016-04-01

    Full Text Available Sin Hang Lee,1,21Pathology Department, Milford Hospital, Milford, CT, USA; 2Milford Molecular Diagnostics, Milford, CT, USA Abstract: Lyme disease (LD, the most common tick-borne disease in North America, is believed to be caused exclusively by Borrelia burgdorferi sensu stricto and is usually diagnosed by clinical evaluation and serologic assays. As reported previously in a peer-reviewed article, a 13-year-old boy living in the Northeast of the USA was initially diagnosed with LD based on evaluation of his clinical presentations and on serologic test results. The patient was treated with a course of oral doxycycline for 28 days, and the symptoms resolved. A year later, the boy developed a series of unusual symptoms and did not attend school for 1 year. A LD specialist reviewed the case and found the serologic test band patterns nondiagnostic of LD. The boy was admitted to a psychiatric hospital. After discharge from the psychiatric hospital, a polymerase chain reaction test performed in a winter month when the boy was 16 years old showed a low density of B. burgdorferi sensu lato in the blood of the patient, confirmed by partial 16S rRNA (ribosomal RNA gene sequencing. Subsequent DNA sequencing analysis presented in this report demonstrated that the spirochete isolate was a novel strain of B. burgdorferi with two homeologous 16S rRNA genes, which has never been reported in the world literature. This case report shows that direct DNA sequencing is a valuable tool for reliable molecular diagnosis of Lyme and related borrelioses, as well as for studies of the diversity of the causative agents of LD because LD patients infected by a rare or novel borrelial variant may produce an antibody pattern that can be different from the pattern characteristic of an infection caused by a typical B. burgdorferi sensu stricto strain. Keywords: Lyme disease, Borrelia burgdorferi, homeologous 16S rRNA genes, DNA sequencing

  13. 16S rRNA gene metabarcoding and TEM reveals different ecological strategies within the genus Neogloboquadrina (planktonic foraminifer.

    Directory of Open Access Journals (Sweden)

    Clare Bird

    Full Text Available Uncovering the complexities of trophic and metabolic interactions among microorganisms is essential for the understanding of marine biogeochemical cycling and modelling climate-driven ecosystem shifts. High-throughput DNA sequencing methods provide valuable tools for examining these complex interactions, although this remains challenging, as many microorganisms are difficult to isolate, identify and culture. We use two species of planktonic foraminifera from the climatically susceptible, palaeoceanographically important genus Neogloboquadrina, as ideal test microorganisms for the application of 16S rRNA gene metabarcoding. Neogloboquadrina dutertrei and Neogloboquadrina incompta were collected from the California Current and subjected to either 16S rRNA gene metabarcoding, fluorescence microscopy, or transmission electron microscopy (TEM to investigate their species-specific trophic interactions and potential symbiotic associations. 53-99% of 16S rRNA gene sequences recovered from two specimens of N. dutertrei were assigned to a single operational taxonomic unit (OTU from a chloroplast of the phylum Stramenopile. TEM observations confirmed the presence of numerous intact coccoid algae within the host cell, consistent with algal symbionts. Based on sequence data and observed ultrastructure, we taxonomically assign the putative algal symbionts to Pelagophyceae and not Chrysophyceae, as previously reported in this species. In addition, our data shows that N. dutertrei feeds on protists within particulate organic matter (POM, but not on bacteria as a major food source. In total contrast, of OTUs recovered from three N. incompta specimens, 83-95% were assigned to bacterial classes Alteromonadales and Vibrionales of the order Gammaproteobacteria. TEM demonstrates that these bacteria are a food source, not putative symbionts. Contrary to the current view that non-spinose foraminifera are predominantly herbivorous, neither N. dutertrei nor N. incompta

  14. Microbial Dark Matter: Unusual intervening sequences in 16S rRNA genes of candidate phyla from the deep subsurface

    Energy Technology Data Exchange (ETDEWEB)

    Jarett, Jessica; Stepanauskas, Ramunas; Kieft, Thomas; Onstott, Tullis; Woyke, Tanja

    2014-03-17

    The Microbial Dark Matter project has sequenced genomes from over 200 single cells from candidate phyla, greatly expanding our knowledge of the ecology, inferred metabolism, and evolution of these widely distributed, yet poorly understood lineages. The second phase of this project aims to sequence an additional 800 single cells from known as well as potentially novel candidate phyla derived from a variety of environments. In order to identify whole genome amplified single cells, screening based on phylogenetic placement of 16S rRNA gene sequences is being conducted. Briefly, derived 16S rRNA gene sequences are aligned to a custom version of the Greengenes reference database and added to a reference tree in ARB using parsimony. In multiple samples from deep subsurface habitats but not from other habitats, a large number of sequences proved difficult to align and therefore to place in the tree. Based on comparisons to reference sequences and structural alignments using SSU-ALIGN, many of these ?difficult? sequences appear to originate from candidate phyla, and contain intervening sequences (IVSs) within the 16S rRNA genes. These IVSs are short (39 - 79 nt) and do not appear to be self-splicing or to contain open reading frames. IVSs were found in the loop regions of stem-loop structures in several different taxonomic groups. Phylogenetic placement of sequences is strongly affected by IVSs; two out of three groups investigated were classified as different phyla after their removal. Based on data from samples screened in this project, IVSs appear to be more common in microbes occurring in deep subsurface habitats, although the reasons for this remain elusive.

  15. Hot topic: 16S rRNA gene sequencing reveals the microbiome of the virgin and pregnant bovine uterus.

    Science.gov (United States)

    Moore, S G; Ericsson, A C; Poock, S E; Melendez, P; Lucy, M C

    2017-06-01

    We tested the hypothesis that the uterus of virgin heifers and pregnant cows possessed a resident microbiome by 16S rRNA gene sequencing of the virgin and pregnant bovine uterus. The endometrium of 10 virgin heifers in estrus and the amniotic fluid, placentome, intercotyledonary placenta, cervical lumen, and external cervix surface (control) of 5 pregnant cows were sampled using aseptic techniques. The DNA was extracted, the V4 hypervariable region of the 16S rRNA gene was amplified, and amplicons were sequenced using Illumina MiSeq technology (Illumina Inc., San Diego, CA). Operational taxonomic units (OTU) were generated from the sequences using Qiime v1.8 software, and taxonomy was assigned using the Greengenes database. The effect of tissue on the microbial composition within the pregnant uterus was tested using univariate (mixed model) and multivariate (permutational multivariate ANOVA) procedures. Amplicons of 16S rRNA gene were generated in all samples, supporting the contention that the uterus of virgin heifers and pregnant cows contained a microbiome. On average, 53, 199, 380, 382, 525, and 13,589 reads annotated as 16, 35, 43, 63, 48, and 176 OTU in the placentome, virgin endometrium, amniotic fluid, cervical lumen, intercotyledonary placenta, and external surface of the cervix, respectively, were generated. The 3 most abundant phyla in the uterus of the virgin heifers and pregnant cows were Firmicutes, Bacteroidetes, and Proteobacteria, and they accounted for approximately 40, 35, and 10% of the sequences, respectively. Phyla abundance was similar between the tissues of the pregnant uterus. Principal component analysis, one-way PERMANOVA analysis of the Bray-Curtis similarity index, and mixed model analysis of the Shannon diversity index and Chao1 index demonstrated that the microbiome of the control tissue (external surface of the cervix) was significantly different from that of the amniotic fluid, intercotyledonary placenta, and placentome tissues

  16. Microbial community structure of Arctic multiyear sea ice and surface seawater by 454 sequencing of the 16S RNA gene

    DEFF Research Database (Denmark)

    Bowman, Jeff S.; Rasmussen, Simon; Blom, Nikolaj

    2011-01-01

    community in MYI at two sites near the geographic North Pole using parallel tag sequencing of the 16S rRNA gene. Although the composition of the MYI microbial community has been characterized by previous studies, microbial community structure has not been. Although richness was lower in MYI than....... In addition, several low-abundance clades not previously reported in sea ice were present, including the phylum TM7 and the classes Spartobacteria and Opitutae. Members of Coraliomargarita, a recently described genus of the class Opitutae, were present in sufficient numbers to suggest niche occupation within...

  17. 16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease.

    Science.gov (United States)

    Suchodolski, Jan S; Dowd, Scot E; Wilke, Vicky; Steiner, Jörg M; Jergens, Albert E

    2012-01-01

    Canine idiopathic inflammatory bowel disease (IBD) is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6) and dogs with moderate IBD (n = 7) or severe IBD (n = 7) as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, pmicrobial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.

  18. Genetic variability of Echinococcus granulosus based on the mitochondrial 16S ribosomal RNA gene.

    Science.gov (United States)

    Wang, Ning; Wang, Jiahai; Hu, Dandan; Zhong, Xiuqin; Jiang, Zhongrong; Yang, Aiguo; Deng, Shijin; Guo, Li; Tsering, Dawa; Wang, Shuxian; Gu, Xiaobin; Peng, Xuerong; Yang, Guangyou

    2015-06-01

    Echinococcus granulosus is the etiological agent of cystic echinococcosis, a major zoonotic disease of both humans and animals. In this study, we assessed genetic variability and genetic structure of E. granulosus in the Tibet plateau, using the complete mitochondrial 16 S ribosomal RNA gene for the first time. We collected and sequenced 62 isolates of E. granulosus from 3 populations in the Tibet plateau. A BLAST analysis indicated that 61 isolates belonged to E. granulosus sensu stricto (genotypes G1-G3), while one isolate belonged to E. canadensis (genotype G6). We detected 16 haplotypes with a haplotype network revealing a star-like expansion, with the most common haplotype occupying the center of the network. Haplotype diversity and nucleotide diversity were low, while negative values were observed for Tajima's D and Fu's Fs. AMOVA results and Fst values revealed that the three geographic populations were not genetically differentiated. Our results suggest that a population bottleneck or population expansion has occurred in the past, and that this explains the low genetic variability of E. granulosus in the Tibet Plateau.

  19. Simultaneous pyrosequencing of the 16S rRNA, IncP-1 trfA, and merA genes

    DEFF Research Database (Denmark)

    Holmsgaard, Peter Nikolai; Sørensen, Søren Johannes; Hansen, Lars H.

    2013-01-01

    The use of amplicon pyrosequencing makes it possible to produce thousands of sequences of the same gene at relatively low costs. Here we show that it is possible to simultaneously sequence the 16S rRNA gene, IncP-1 trfA gene and mercury reductase gene (merA) as a way for screening the diversity...

  20. 16S rRNA gene pyrosequencing reveals bacterial dysbiosis in the duodenum of dogs with idiopathic inflammatory bowel disease.

    Directory of Open Access Journals (Sweden)

    Jan S Suchodolski

    Full Text Available BACKGROUND: Canine idiopathic inflammatory bowel disease (IBD is believed to be caused by a complex interaction of genetic, immunologic, and microbial factors. While mucosa-associated bacteria have been implicated in the pathogenesis of canine IBD, detailed studies investigating the enteric microbiota using deep sequencing techniques are lacking. The objective of this study was to evaluate mucosa-adherent microbiota in the duodenum of dogs with spontaneous idiopathic IBD using 16 S rRNA gene pyrosequencing. METHODOLOGY/PRINCIPAL FINDINGS: Biopsy samples of small intestinal mucosa were collected endoscopically from healthy dogs (n = 6 and dogs with moderate IBD (n = 7 or severe IBD (n = 7 as assessed by a clinical disease activity index. Total RNA was extracted from biopsy specimens and 454-pyrosequencing of the 16 S rRNA gene was performed on aliquots of cDNA from each dog. Intestinal inflammation was associated with significant differences in the composition of the intestinal microbiota when compared to healthy dogs. PCoA plots based on the unweighted UniFrac distance metric indicated clustering of samples between healthy dogs and dogs with IBD (ANOSIM, p<0.001. Proportions of Fusobacteria (p = 0.010, Bacteroidaceae (p = 0.015, Prevotellaceae (p = 0.022, and Clostridiales (p = 0.019 were significantly more abundant in healthy dogs. In contrast, specific bacterial genera within Proteobacteria, including Diaphorobacter (p = 0.044 and Acinetobacter (p = 0.040, were either more abundant or more frequently identified in IBD dogs. CONCLUSIONS/SIGNIFICANCE: In conclusion, dogs with spontaneous IBD exhibit alterations in microbial groups, which bear resemblance to dysbiosis reported in humans with chronic intestinal inflammation. These bacterial groups may serve as useful targets for monitoring intestinal inflammation.

  1. Analysis of microbiota associated with peri-implantitis using 16S rRNA gene clone library

    Directory of Open Access Journals (Sweden)

    Tatsuro Koyanagi

    2010-05-01

    Full Text Available Background: Peri-implantitis (PI is an inflammatory disease which leads to the destruction of soft and hard tissues around osseointegrated implants. The subgingival microbiota appears to be responsible for peri-implant lesions and although the complexity of the microbiota has been reported in PI, the microbiota responsible for PI has not been identified. Objective: The purpose of this study was to identify the microbiota in subjects who have PI, clinically healthy implants, and periodontitis-affected teeth using 16S rRNA gene clone library analysis to clarify the microbial differences. Design: Three subjects participated in this study. The conditions around the teeth and implants were evaluated based on clinical and radiographic examinations and diseased implants, clinically healthy implants, and periodontally diseased teeth were selected. Subgingival plaque samples were taken from the deepest pockets using sterile paper points. Prevalence and identity of bacteria was analyzed using a 16S rRNA gene clone library technique. Results: A total of 112 different species were identified from 335 clones sequenced. Among the 112 species, 51 (46% were uncultivated phylotypes, of which 22 were novel phylotypes. The numbers of bacterial species identified at the sites of PI, periodontitis, and periodontally healthy implants were 77, 57, and 12, respectively. Microbiota in PI mainly included Gram-negative species and the composition was more diverse when compared to that of the healthy implant and periodontitis. The phyla Chloroflexi, Tenericutes, and Synergistetes were only detected at PI sites, as were Parvimonas micra, Peptostreptococcus stomatis, Pseudoramibacter alactolyticus, and Solobacterium moorei. Low levels of periodontopathic bacteria, such as Porphyromonas gingivalis and Aggregatibacter actinomycetemcomitans, were seen in peri-implant lesions. Conclusions: The biofilm in PI showed a more complex microbiota when compared to periodontitis and

  2. Detection of Microbial 16S rRNA Gene in the Blood of Patients With Parkinson’s Disease

    Directory of Open Access Journals (Sweden)

    Yiwei Qian

    2018-05-01

    Full Text Available Emerging evidence suggests that the microbiota present in feces plays a role in Parkinson’s disease (PD. However, the alterations of the microbiome in the blood of PD patients remain unknown. To test this hypothesis, we conducted this case-control study to explore the microbiota compositions in the blood of Chinese PD patients. Microbiota communities in the blood of 45 patients and their healthy spouses were investigated using high-throughput Illumina HiSeq sequencing targeting the V3-V4 region of 16S ribosomal RNA (rRNA gene. The relationships between the microbiota in the blood and PD clinical characteristics were analyzed. No difference was detected in the structure and richness between PD patients and healthy controls. The following genera were enriched in the blood of PD patients: Isoptericola, Cloacibacterium, Enhydrobacter and Microbacterium; whereas genus Limnobacter was enriched in the healthy controls after adjusting for age, gender, body mass index (BMI and constipation. Additionally, the findings regarding these genera were validated in another independent group of 58 PD patients and 57 healthy controls using real-time PCR targeting genus-specific 16S rRNA genes. Furthermore, not only the genera Cloacibacterium and Isoptericola (which were identified as enriched in PD patients but also the genera Paludibacter and Saccharofermentans were positively associated with disease duration. Some specific genera in the blood were related to mood disorders. We believe this is the first report to provide direct evidence to support the hypothesis that the identified microbiota in the blood are associated with PD. Additionally, some microbiota in the blood are closely associated with the clinical characteristics of PD. Elucidating these differences in blood microbiomes will provide a foundation to improve our understanding of the role of microbiota in the pathogenesis of PD.

  3. 16S partial gene mitochondrial DNA and internal transcribed spacers ribosomal DNA as differential markers of Trichuris discolor populations.

    Science.gov (United States)

    Callejón, R; Halajian, A; de Rojas, M; Marrugal, A; Guevara, D; Cutillas, C

    2012-05-25

    Comparative morphological, biometrical and molecular studies of Trichuris discolor isolated from Bos taurus from Spain and Iran was carried out. Furthermore, Trichuris ovis isolated from B. taurus and Capra hircus from Spain has been, molecularly, analyzed. Morphological studies revealed clear differences between T. ovis and T. discolor isolated from B. taurus but differences were not observed between populations of T. discolor isolated from different geographical regions. Nevertheless, the molecular studies based on the amplification and sequencing of the internal transcribed spacers 1 and 2 ribosomal DNA and 16S partial gene mitochondrial DNA showed clear differences between both populations of T. discolor from Spain and Iran suggesting two cryptic species. Phylogenetic studies corroborated these data. Thus, phylogenetic trees based on ITS1, ITS2 and 16S partial gene sequences showed that individuals of T. discolor from B. taurus from Iran clustered together and separated, with high bootstrap values, of T. discolor isolated from B. taurus from Spain, while populations of T. ovis from B. taurus and C. hircus from Spain clustered together but separated with high bootstrap values of both populations of T. discolor. Furthermore, a comparative phylogenetic study has been carried out with the ITS1and ITS2 sequences of Trichuris species from different hosts. Three clades were observed: the first clustered all the species of Trichuris parasitizing herbivores (T. discolor, T. ovis, Trichuris leporis and Trichuris skrjabini), the second clustered all the species of Trichuris parasitizing omnivores (Trichuris trichiura and Trichuris suis) and finally, the third clustered species of Trichuris parasitizing carnivores (Trichuris muris, Trichuris arvicolae and Trichuris vulpis). Copyright © 2011 Elsevier B.V. All rights reserved.

  4. Nested PCR Biases in Interpreting Microbial Community Structure in 16S rRNA Gene Sequence Datasets.

    Science.gov (United States)

    Yu, Guoqin; Fadrosh, Doug; Goedert, James J; Ravel, Jacques; Goldstein, Alisa M

    2015-01-01

    Sequencing of the PCR-amplified 16S rRNA gene has become a common approach to microbial community investigations in the fields of human health and environmental sciences. This approach, however, is difficult when the amount of DNA is too low to be amplified by standard PCR. Nested PCR can be employed as it can amplify samples with DNA concentration several-fold lower than standard PCR. However, potential biases with nested PCRs that could affect measurement of community structure have received little attention. In this study, we used 17 DNAs extracted from vaginal swabs and 12 DNAs extracted from stool samples to study the influence of nested PCR amplification of the 16S rRNA gene on the estimation of microbial community structure using Illumina MiSeq sequencing. Nested and standard PCR methods were compared on alpha- and beta-diversity metrics and relative abundances of bacterial genera. The effects of number of cycles in the first round of PCR (10 vs. 20) and microbial diversity (relatively low in vagina vs. high in stool) were also investigated. Vaginal swab samples showed no significant difference in alpha diversity or community structure between nested PCR and standard PCR (one round of 40 cycles). Stool samples showed significant differences in alpha diversity (except Shannon's index) and relative abundance of 13 genera between nested PCR with 20 cycles in the first round and standard PCR (Pnested PCR with 10 cycles in the first round and standard PCR. Operational taxonomic units (OTUs) that had low relative abundance (sum of relative abundance 27% of total OTUs in stool). Nested PCR introduced bias in estimated diversity and community structure. The bias was more significant for communities with relatively higher diversity and when more cycles were applied in the first round of PCR. We conclude that nested PCR could be used when standard PCR does not work. However, rare taxa detected by nested PCR should be validated by other technologies.

  5. Detection of a Mixed Infection in a Culture-Negative Brain Abscess by Broad-Spectrum Bacterial 16S rRNA Gene PCR ▿ †

    Science.gov (United States)

    Keller, Peter M.; Rampini, Silvana K.; Bloemberg, Guido V.

    2010-01-01

    We describe the identification of two bacterial pathogens from a culture-negative brain abscess by the use of broad-spectrum 16S rRNA gene PCR. Simultaneous detection of Fusobacterium nucleatum and Porphyromonas endodontalis was possible due to a 24-bp length difference of their partially amplified 16S rRNA genes, which allowed separation by high-resolution polyacrylamide gel electrophoresis. PMID:20392909

  6. Diagnóstico de Mycoplasma genitalium por amplificación de los genes MgPa y ARN ribosomal 16S Diagnosis of Mycoplasma genitalium by MgPa and rRNA 16S gene amplification

    Directory of Open Access Journals (Sweden)

    Carmen Fernández-Molina

    2008-10-01

    Full Text Available OBJETIVO: El microorganismo Mycoplasma genitalium se ha relacionado con la uretritis no gonocócica (UNG. La técnica de PCR se ha convertido en el principal método de detección de este patógeno. En consecuencia, debe aplicarse un método de diagnóstico mediante la amplificación de fragmentos de ADN por la técnica PCR. MATERIAL Y MÉTODOS: Se seleccionaron los cebadores MGF-MGR y MgPaF-MgPaR, complementarios de los genes de ARNr 16S y MgPa de M. genitalium, respectivamente. Se efectuaron ensayos de especificidad y sensibilidad y se estudiaron muestras clínicas. RESULTADOS: La PCR con cada grupo de cebadores utilizado fue específica sólo para M. genitalium y la sensibilidad fue mayor con el grupo de cebadores MGF-MGR. En el estudio de 34 muestras clínicas, 18.5% fue positivo a M. genitalium y se encontró un mayor número de muestras positivas al utilizar los cebadores MgPaF-MgPaR. CONCLUSIONES: Debe aplicarse en la práctica clínica el diagnóstico de M. genitalium mediante la amplificación del ADN por PCR en los pacientes con UNG.OBJECTIVE: Mycoplasma genitalium has been associated with nongonococcal urethritis (NGU. Diagnosis by PCR has become the primary detection method for this organism. Thus, diagnosis by DNA amplification using the PCR technique should be utilized. MATERIAL AND METHODS: GMF/GMR and MgpF/MgpR primer pairs, complementary to the M. genitalium 16S rRNA and MgPa genes, respectively, were selected. Specificity and sensibility assays were conducted and clinical samples were studied. RESULTS: The PCR with each primer pair was specific only for M. genitalium, and the sensibility was higher with the GMF/GMR primers. In the study of 34 clinical samples, 18,5% were positive for M. genitalium, with more positive samples when the MgpF/MgpR primers were used. CONCLUSIONS: DNA amplification by PCR should be applied in clinical practice to the diagnosis of M. genitalium in patients with NGU should using.

  7. Bacillus caldolyticus prs gene encoding phosphoribosyldiphosphate synthase

    DEFF Research Database (Denmark)

    Krath, Britta N.; Hove-Jensen, Bjarne

    1996-01-01

    The prs gene, encoding phosphoribosyl-diphosphate (PRPP) synthase, as well as the flanking DNA sequences were cloned and sequenced from the Gram-positive thermophile, Bacillus caldolyticus. Comparison with the homologous sequences from the mesophile, Bacillus subtilis, revealed a gene (gca......D) encoding N-acetylglucosamine-l-phosphate uridyltransferase upstream of prs, and a gene homologous to ctc downstream of prs. cDNA synthesis with a B. caldolyticus gcaD-prs-ctc-specified mRNA as template, followed by amplification utilising the polymerase chain reaction indicated that the three genes are co......-transcribed. Comparison of amino acid sequences revealed a high similarity among PRPP synthases across a wide phylogenetic range. An E. coli strain harbouring the B. caldolyticus prs gene in a multicopy plasmid produced PRPP synthase activity 33-fold over the activity of a haploid B. caldolyticus strain. B. caldolyticus...

  8. Recognition of Potentially Novel Human Disease-Associated Pathogens by Implementation of Systematic 16S rRNA Gene Sequencing in the Diagnostic Laboratory▿ †

    Science.gov (United States)

    Keller, Peter M.; Rampini, Silvana K.; Büchler, Andrea C.; Eich, Gerhard; Wanner, Roger M.; Speck, Roberto F.; Böttger, Erik C.; Bloemberg, Guido V.

    2010-01-01

    Clinical isolates that are difficult to identify by conventional means form a valuable source of novel human pathogens. We report on a 5-year study based on systematic 16S rRNA gene sequence analysis. We found 60 previously unknown 16S rRNA sequences corresponding to potentially novel bacterial taxa. For 30 of 60 isolates, clinical relevance was evaluated; 18 of the 30 isolates analyzed were considered to be associated with human disease. PMID:20631113

  9. High prevalence of plasmid-mediated 16S rRNA methylase gene rmtB among Escherichia coli clinical isolates from a Chinese teaching hospital

    Directory of Open Access Journals (Sweden)

    Zhang Xue-qing

    2010-06-01

    Full Text Available Abstract Background Recently, production of 16S rRNA methylases by Gram-negative bacilli has emerged as a novel mechanism for high-level resistance to aminoglycosides by these organisms in a variety of geographic locations. Therefore, the spread of high-level aminoglycoside resistance determinants has become a great concern. Methods Between January 2006 and July 2008, 680 distinct Escherichia coli clinical isolates were collected from a teaching hospital in Wenzhou, China. PCR and DNA sequencing were used to identify 16S rRNA methylase and extended-spectrum β-lactamase (ESBL genes, including armA and rmtB, and in situ hybridization was performed to determine the location of 16S rRNA methylase genes. Conjugation experiments were subsequently performed to determine whether aminoglycoside resistance was transferable from the E. coli isolates via 16S rRNA methylase-bearing plasmids. Homology of the isolates harboring 16S rRNA methylase genes was determined using pulse-field gel electrophoresis (PFGE. Results Among the 680 E. coli isolates, 357 (52.5%, 346 (50.9% and 44 (6.5% isolates were resistant to gentamicin, tobramycin and amikacin, respectively. Thirty-seven of 44 amikacin-resistant isolates harbored 16S rRNA methylase genes, with 36 of 37 harboring the rmtB gene and only one harboring armA. The positive rates of 16S rRNA methylase genes among all isolates and amikacin-resistant isolates were 5.4% (37/680 and 84.1% (37/44, respectively. Thirty-one isolates harboring 16S rRNA methylase genes also produced ESBLs. In addition, high-level aminoglycoside resistance could be transferred by conjugation from four rmtB-positive donors. The plasmids of incompatibility groups IncF, IncK and IncN were detected in 34, 3 and 3 isolates, respectively. Upstream regions of the armA gene contained ISCR1 and tnpU, the latter a putative transposase gene,. Another putative transposase gene, tnpD, was located within a region downstream of armA. Moreover, a

  10. Bacterial community variations in an alfalfa-rice rotation system revealed by 16S rRNA gene 454-pyrosequencing.

    Science.gov (United States)

    Lopes, Ana R; Manaia, Célia M; Nunes, Olga C

    2014-03-01

    Crop rotation is a practice harmonized with the sustainable rice production. Nevertheless, the implications of this empirical practice are not well characterized, mainly in relation to the bacterial community composition and structure. In this study, the bacterial communities of two adjacent paddy fields in the 3rd and 4th year of the crop rotation cycle and of a nonseeded subplot were characterized before rice seeding and after harvesting, using 454-pyrosequencing of the 16S rRNA gene. Although the phyla Acidobacteria, Proteobacteria, Chloroflexi, Actinobacteria and Bacteroidetes predominated in all the samples, there were variations in relative abundance of these groups. Samples from the 3rd and 4th years of the crop rotation differed on the higher abundance of groups of presumable aerobic bacteria and of presumable anaerobic and acidobacterial groups, respectively. Members of the phylum Nitrospira were more abundant after rice harvest than in the previously sampled period. Rice cropping was positively correlated with the abundance of members of the orders Acidobacteriales and 'Solibacterales' and negatively with lineages such as Chloroflexi 'Ellin6529'. Studies like this contribute to understand variations occurring in the microbial communities in soils under sustainable rice production, based on real-world data. © 2013 Federation of European Microbiological Societies. Published by John Wiley & Sons Ltd. All rights reserved.

  11. Improved group-specific primers based on the full SILVA 16S rRNA gene reference database.

    Science.gov (United States)

    Pfeiffer, Stefan; Pastar, Milica; Mitter, Birgit; Lippert, Kathrin; Hackl, Evelyn; Lojan, Paul; Oswald, Andreas; Sessitsch, Angela

    2014-08-01

    Quantitative PCR (qPCR) and community fingerprinting methods, such as the Terminal Restriction Fragment Length Polymorphism (T-RFLP) analysis,are well-suited techniques for the examination of microbial community structures. The use of phylum and class-specific primers can provide enhanced sensitivity and phylogenetic resolution as compared with domain-specific primers. To date, several phylum- and class-specific primers targeting the 16S ribosomal RNA gene have been published. However, many of these primers exhibit low discriminatory power against non-target bacteria in PCR. In this study, we evaluated the precision of certain published primers in silico and via specific PCR. We designed new qPCR and T-RFLP primer pairs (for the classes Alphaproteobacteria and Betaproteobacteria, and the phyla Bacteroidetes, Firmicutes and Actinobacteria) by combining the sequence information from a public dataset (SILVA SSU Ref 102 NR) with manual primer design. We evaluated the primer pairs via PCR using isolates of the above-mentioned groups and via screening of clone libraries from environmental soil samples and human faecal samples. As observed through theoretical and practical evaluation, the primers developed in this study showed a higher level of precision than previously published primers, thus allowing a deeper insight into microbial community dynamics.

  12. Characterization of the Fecal Microbial Communities of Duroc Pigs Using 16S rRNA Gene Pyrosequencing

    Directory of Open Access Journals (Sweden)

    Edward Alain B. Pajarillo

    2015-04-01

    Full Text Available This study characterized the fecal bacterial community structure and inter-individual variation in 30-week-old Duroc pigs, which are known for their excellent meat quality. Pyrosequencing of the V1–V3 hypervariable regions of the 16S rRNA genes generated 108,254 valid reads and 508 operational taxonomic units at a 95% identity cut-off (genus level. Bacterial diversity and species richness as measured by the Shannon diversity index were significantly greater than those reported previously using denaturation gradient gel electrophoresis; thus, this study provides substantial information related to both known bacteria and the untapped portion of unclassified bacteria in the population. The bacterial composition of Duroc pig fecal samples was investigated at the phylum, class, family, and genus levels. Firmicutes and Bacteroidetes predominated at the phylum level, while Clostridia and Bacteroidia were most abundant at the class level. This study also detected prominent inter-individual variation starting at the family level. Among the core microbiome, which was observed at the genus level, Prevotella was consistently dominant, as well as a bacterial phylotype related to Oscillibacter valericigenes, a valerate producer. This study found high bacterial diversity and compositional variation among individuals of the same breed line, as well as high abundance of unclassified bacterial phylotypes that may have important functions in the growth performance of Duroc pigs.

  13. Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

    Science.gov (United States)

    Zhu, Daochen; Tanabe, Shoko-Hosoi; Yang, Chong; Zhang, Weimin; Sun, Jianzhong

    2013-01-01

    Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample) at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

  14. Bacterial community composition in the gut content of Lampetra japonica revealed by 16S rRNA gene pyrosequencing.

    Science.gov (United States)

    Zuo, Yu; Xie, Wenfang; Pang, Yue; Li, Tiesong; Li, Qingwei; Li, Yingying

    2017-01-01

    The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.

  15. Bacterial community composition in the gut content of Lampetra japonica revealed by 16S rRNA gene pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Yu Zuo

    Full Text Available The composition of the bacterial communities in the hindgut contents of Lampetrs japonica was surveyed by Illumina MiSeq of the 16S rRNA gene. An average of 32385 optimized reads was obtained from three samples. The rarefaction curve based on the operational taxonomic units tended to approach the asymptote. The rank abundance curve representing the species richness and evenness was calculated. The composition of microbe in six classification levels was also analyzed. Top 20 members in genera level were displayed as the classification tree. The abundance of microorganisms in different individuals was displayed as the pie charts at the branch nodes in the classification tree. The differences of top 50 genera in abundance between individuals of lamprey are displayed as a heatmap. The pairwise comparison of bacterial taxa abundance revealed that there are no significant differences of gut microbiota between three individuals of lamprey at a given rarefied depth. Also, the gut microbiota derived from L. japonica displays little similarity with other aquatic organism of Vertebrata after UPGMA analysis. The metabolic function of the bacterial communities was predicted through KEGG analysis. This study represents the first analysis of the bacterial community composition in the gut content of L. japonica. The investigation of the gut microbiota associated with L. japonica will broaden our understanding of this unique organism.

  16. Bacterial community composition of South China Sea sediments through pyrosequencing-based analysis of 16S rRNA genes.

    Directory of Open Access Journals (Sweden)

    Daochen Zhu

    Full Text Available BACKGROUND: Subseafloor sediments accumulate large amounts of organic and inorganic materials that contain a highly diverse microbial ecosystem. The aim of this study was to survey the bacterial community of subseafloor sediments from the South China Sea. METHODOLOGY/PRINCIPAL FINDINGS: Pyrosequencing of over 265,000 amplicons of the V3 hypervariable region of the 16S ribosomal RNA gene was performed on 16 sediment samples collected from multiple locations in the northern region of the South China Sea from depths ranging from 35 to 4000 m. A total of 9,726 operational taxonomic units (OTUs; between 695 and 2819 unique OTUs per sample at 97% sequence similarity level were generated. In total, 40 bacterial phyla including 22 formally described phyla and 18 candidate phyla, with Proteobacteria, Firmicutes, Planctomycetes, Actinobacteria and Chloroflexi being most diverse, were identified. The most abundant phylotype, accounting for 42.6% of all sequences, belonged to Gammaproteobacteria, which possessed absolute predominance in the samples analyzed. Among the 18 candidate phyla, 12 were found for the first time in the South China Sea. CONCLUSIONS: This study provided a novel insight into the composition of bacterial communities of the South China Sea subseafloor. Furthermore, abundances and community similarity analysis showed that the compositions of the bacterial communities are very similar at phylum level at different depths from 35-4000 m.

  17. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes

    Directory of Open Access Journals (Sweden)

    Mu Peng

    2015-09-01

    Full Text Available Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  18. Bacterial Community Diversity of Oil-Contaminated Soils Assessed by High Throughput Sequencing of 16S rRNA Genes.

    Science.gov (United States)

    Peng, Mu; Zi, Xiaoxue; Wang, Qiuyu

    2015-09-24

    Soil bacteria play a major role in ecological and biodegradable function processes in oil-contaminated soils. Here, we assessed the bacterial diversity and changes therein in oil-contaminated soils exposed to different periods of oil pollution using 454 pyrosequencing of 16S rRNA genes. No less than 24,953 valid reads and 6246 operational taxonomic units (OTUs) were obtained from all five studied samples. OTU richness was relatively higher in contaminated soils than clean samples. Acidobacteria, Actinobacteria, Bacteroidetes, Chloroflexi, Planctomycetes and Proteobacteria were the dominant phyla among all the soil samples. The heatmap plot depicted the relative percentage of each bacterial family within each sample and clustered five samples into two groups. For the samples, bacteria in the soils varied at different periods of oil exposure. The oil pollution exerted strong selective pressure to propagate many potentially petroleum degrading bacteria. Redundancy analysis (RDA) indicated that organic matter was the highest determinant factor for explaining the variations in community compositions. This suggests that compared to clean soils, oil-polluted soils support more diverse bacterial communities and soil bacterial community shifts were mainly controlled by organic matter and exposure time. These results provide some useful information for bioremediation of petroleum contaminated soil in the future.

  19. 16S rRNA gene-based detection of tetrachloroethene-dechlorinating Desulfuromonas and Dehalococcoides species

    Energy Technology Data Exchange (ETDEWEB)

    Loeffler, F.E.; Sun, Q.; Li, J.; Tiedje, J.M.

    2000-03-01

    Members of the genera Desulfuromonas and Dehalococcoides reductively dechlorinate tetrachloroethene (PCE) and trichloroethene. Two primer pairs specific to hypervariable regions of the 16S rRNA genes of the Dehalococcoides group (comprising Dehalococcoides ethenogenes and Dehalococcoides sp. strain FL2) and the acetate-oxidizing, PCE-dechlorinating Desulfuromonas group (comprising Desulfuromonas sp. strain BB1 and Desulfuromonas chloroethenica) were designed. The detection threshold of a nested PCR approach using universal bacterial primers followed by a second PCR with the Desulfuromonas dechlorinator-targeted primer pair was 1 x 10{sup 3} BB1 cells added per gram (wet weight) of sandy aquifer material. Total community DNA isolated from sediments of three Michigan rivers and six different chloroethene-contaminated aquifer samples was used as template in nested PCR. All river sediment samples yielded positive signals with the BB1- and the Dehalococcoides-targeted primers. One chloroethene-contaminated aquifer tested positive with the Dehalococcoides-targeted primers, and another contaminated aquifer tested positive with the Desulfuromonas dechlorinator-targeted primer pair. Restriction fragment analysis of the amplicons could discriminate strain BB1 from other known Desulfuromonas species. Microcosm studies confirmed the presence of PCE-dechlorinating, acetate-oxidizing Desulfuromonas and hydrogenotrophic Dehalococcoides species in samples yielding positive PCR signals with the specific primers.

  20. Bacteriophage-encoded shiga toxin gene in atypical bacterial host

    Directory of Open Access Journals (Sweden)

    Casas Veronica

    2011-07-01

    Full Text Available Abstract Background Contamination from fecal bacteria in recreational waters is a major health concern since bacteria capable of causing human disease can be found in animal feces. The Dog Beach area of Ocean Beach in San Diego, California is a beach prone to closures due to high levels of fecal indicator bacteria (FIB. A potential source of these FIB could be the canine feces left behind by owners who do not clean up after their pets. We tested this hypothesis by screening the DNA isolated from canine feces for the bacteriophage-encoded stx gene normally found in the virulent strains of the fecal bacterium Escherichia coli. Results Twenty canine fecal samples were collected, processed for total and bacterial fraction DNA, and screened by PCR for the stx gene. The stx gene was detected in the total and bacterial fraction DNA of one fecal sample. Bacterial isolates were then cultivated from the stx-positive fecal sample. Eighty nine of these canine fecal bacterial isolates were screened by PCR for the stx gene. The stx gene was detected in five of these isolates. Sequencing and phylogenetic analyses of 16S rRNA gene PCR products from the canine fecal bacterial isolates indicated that they were Enterococcus and not E. coli. Conclusions The bacteriophage-encoded stx gene was found in multiple species of bacteria cultivated from canine fecal samples gathered at the shoreline of the Dog Beach area of Ocean Beach in San Diego, California. The canine fecal bacteria carrying the stx gene were not the typical E. coli host and were instead identified through phylogenetic analyses as Enterococcus. This suggests a large degree of horizontal gene transfer of exotoxin genes in recreational waters.

  1. Pyrosequencing 16S rRNA genes of bacteria associated with wild tiger mosquito Aedes albopictus: a pilot study

    Directory of Open Access Journals (Sweden)

    Guillaume eMinard

    2014-05-01

    Full Text Available The Asian tiger mosquito Aedes (Stegomya albopictus is an invasive species that has spread across the world in the last two decades, showing a great capacity to adapt to contrasting climates and environments. While demonstrated in many insects, the contribution of bacterial symbionts in Aedes ecology is a challenging aspect that needs to be investigated however. Some bacterial species have already been identified in Ae. albopictus using classical methods, but a more accurate survey of mosquito-associated bacterial diversity is needed to decipher the potential biological functions of bacterial symbionts in mediating or constraining insect adaptation. We surveyed the bacteria associated with field populations of Ae. albopictus from Madagascar by pyrosequencing 16S rRNA gene amplicons. Different aspects of amplicon preparation and sequencing depth were tested to optimise the breadth of bacterial diversity identified. The results revealed that all mosquitoes collected from different sites have a bacterial microbiota dominated by a single taxon, Wolbachia pipientis, which accounted for about 99% of all 98,520 sequences obtained. Ae. albopictus is known to harbour two Wolbachia strains, wAlbA and wAlbB, and quantitative PCR was used to estimate the relative densities, i.e. the bacteria-to-host gene ratios, of the strains in individual mosquitoes. Relative densities were between 6.25 × 100.01 and 5.47 × 100.1 for wAlbA and between 2.03 × 100.1 and 1.4 × 101 for wAlbB. Apart from Wolbachia, a total of 32 bacterial taxa were identified at the genus level using the different in method variations. Diversity index values were low and probably underestimated the true diversity due to the high abundance of Wolbachia sequences vastly outnumbering sequences from other taxa. Further studies should implement alternative strategies to specifically discard from analysis any sequences from Wolbachia, the dominant endosymbiotic bacterium in Ae. albopictus from

  2. Retrieval of a million high-quality, full-length microbial 16S and 18S rRNA gene sequences without primer bias

    DEFF Research Database (Denmark)

    Karst, Søren Michael; Dueholm, Morten Simonsen; McIlroy, Simon Jon

    2018-01-01

    Small subunit ribosomal RNA (SSU rRNA) genes, 16S in bacteria and 18S in eukaryotes, have been the standard phylogenetic markers used to characterize microbial diversity and evolution for decades. However, the reference databases of full-length SSU rRNA gene sequences are skewed to well-studied e...

  3. Combining flow cytometry and 16S rRNA gene pyrosequencing: A promising approach for drinking water monitoring and characterization

    KAUST Repository

    Prest, Emmanuelle I E C

    2014-10-01

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5min intervals for 1h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345±15×103 to 425±35×103cellsmL-1) and in the percentage of intact bacterial cells (from 39±3.5% to 53±4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. © 2014 Elsevier Ltd.

  4. Combining flow cytometry and 16S rRNA gene pyrosequencing: a promising approach for drinking water monitoring and characterization.

    Science.gov (United States)

    Prest, E I; El-Chakhtoura, J; Hammes, F; Saikaly, P E; van Loosdrecht, M C M; Vrouwenvelder, J S

    2014-10-15

    The combination of flow cytometry (FCM) and 16S rRNA gene pyrosequencing data was investigated for the purpose of monitoring and characterizing microbial changes in drinking water distribution systems. High frequency sampling (5 min intervals for 1 h) was performed at the outlet of a treatment plant and at one location in the full-scale distribution network. In total, 52 bulk water samples were analysed with FCM, pyrosequencing and conventional methods (adenosine-triphosphate, ATP; heterotrophic plate count, HPC). FCM and pyrosequencing results individually showed that changes in the microbial community occurred in the water distribution system, which was not detected with conventional monitoring. FCM data showed an increase in the total bacterial cell concentrations (from 345 ± 15 × 10(3) to 425 ± 35 × 10(3) cells mL(-1)) and in the percentage of intact bacterial cells (from 39 ± 3.5% to 53 ± 4.4%) during water distribution. This shift was also observed in the FCM fluorescence fingerprints, which are characteristic of each water sample. A similar shift was detected in the microbial community composition as characterized with pyrosequencing, showing that FCM and genetic fingerprints are congruent. FCM and pyrosequencing data were subsequently combined for the calculation of cell concentration changes for each bacterial phylum. The results revealed an increase in cell concentrations of specific bacterial phyla (e.g., Proteobacteria), along with a decrease in other phyla (e.g., Actinobacteria), which could not be concluded from the two methods individually. The combination of FCM and pyrosequencing methods is a promising approach for future drinking water quality monitoring and for advanced studies on drinking water distribution pipeline ecology. Copyright © 2014 Elsevier Ltd. All rights reserved.

  5. 16S rRNA gene sequencing reveals effects of photoperiod on cecal microbiota of broiler roosters

    Directory of Open Access Journals (Sweden)

    Jun Wang

    2018-02-01

    Full Text Available Photoperiod is an important factor in stimulating broiler performance in commercial poultry practice. However, the mechanism by which photoperiod affects the performance of broiler chickens has not been adequately explored. The current study evaluated the effects of three different photoperiod regimes (short day (LD = 8 h light, control (CTR = 12.5 h light, and long day (SD = 16 h light on the cecal microbiota of broiler roosters by sequencing bacterial 16S rRNA genes. At the phylum level, the dominant bacteria were Firmicutes (CTR: 68%, SD: 69%, LD: 67% and Bacteroidetes (CTR: 25%, SD: 26%, and LD: 28%. There was a greater abundance of Proteobacteria (p < 0.01 and Cyanobacteria (p < 0.05 in chickens in the LD group than in those in the CTR group. A significantly greater abundance of Actinobacteria was observed in CTR chickens than in SD and LD chickens (p < 0.01. The abundance of Deferribacteres was significantly higher in LD chickens than in SD chickens (p < 0.01. Fusobacteria and Proteobacteria were more abundant in SD chickens than in CTR and LD chickens. The predicted functional properties indicate that cellular processes may be influenced by photoperiod. Conversely, carbohydrate metabolism was enhanced in CTR chickens as compared to that in SD and LD chickens. The current results indicate that different photoperiod regimes may influence the abundance of specific bacterial populations and then contribute to differences in the functional properties of gut microbiota of broiler roosters.

  6. Combined Analyses of the ITS Loci and the Corresponding 16S rRNA Genes Reveal High Micro- and Macrodiversity of SAR11 Populations in the Red Sea

    Science.gov (United States)

    Ngugi, David Kamanda; Stingl, Ulrich

    2012-01-01

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24°C throughout the year, and a remarkable uniform temperature (∼22°C) and salinity (∼41 psu) from the mixed layer (∼200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea’s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium. PMID:23185592

  7. Combined analyses of the ITS loci and the corresponding 16S rRNA genes reveal high micro- and macrodiversity of SAR11 populations in the Red Sea.

    KAUST Repository

    Ngugi, David

    2012-11-20

    Bacteria belonging to the SAR11 clade are among the most abundant prokaryotes in the pelagic zone of the ocean. 16S rRNA gene-based analyses indicate that they constitute up to 60% of the bacterioplankton community in the surface waters of the Red Sea. This extremely oligotrophic water body is further characterized by an epipelagic zone, which has a temperature above 24 °C throughout the year, and a remarkable uniform temperature (~22 °C) and salinity (~41 psu) from the mixed layer (~200 m) to the bottom at over 2000 m depth. Despite these conditions that set it apart from other marine environments, the microbiology of this ecosystem is still vastly understudied. Prompted by the limited phylogenetic resolution of the 16S rRNA gene, we extended our previous study by sequencing the internal transcribed spacer (ITS) region of SAR11 in different depths of the Red Sea\\'s water column together with the respective 16S fragment. The overall diversity captured by the ITS loci was ten times higher than that of the corresponding 16S rRNA genes. Moreover, species estimates based on the ITS showed a highly diverse population of SAR11 in the mixed layer that became diminished in deep isothermal waters, which was in contrast to results of the related 16S rRNA genes. While the 16S rRNA gene-based sequences clustered into three phylogenetic subgroups, the related ITS fragments fell into several phylotypes that showed clear depth-dependent shifts in relative abundances. Blast-based analyses not only documented the observed vertical partitioning and universal co-occurrence of specific phylotypes in five other distinct oceanic provinces, but also highlighted the influence of ecosystem-specific traits (e.g., temperature, nutrient availability, and concentration of dissolved oxygen) on the population dynamics of this ubiquitous marine bacterium.

  8. Identification of Bacillus Probiotics Isolated from Soil Rhizosphere Using 16S rRNA, recA, rpoB Gene Sequencing and RAPD-PCR.

    Science.gov (United States)

    Mohkam, Milad; Nezafat, Navid; Berenjian, Aydin; Mobasher, Mohammad Ali; Ghasemi, Younes

    2016-03-01

    Some Bacillus species, especially Bacillus subtilis and Bacillus pumilus groups, have highly similar 16S rRNA gene sequences, which are hard to identify based on 16S rDNA sequence analysis. To conquer this drawback, rpoB, recA sequence analysis along with randomly amplified polymorphic (RAPD) fingerprinting was examined as an alternative method for differentiating Bacillus species. The 16S rRNA, rpoB and recA genes were amplified via a polymerase chain reaction using their specific primers. The resulted PCR amplicons were sequenced, and phylogenetic analysis was employed by MEGA 6 software. Identification based on 16S rRNA gene sequencing was underpinned by rpoB and recA gene sequencing as well as RAPD-PCR technique. Subsequently, concatenation and phylogenetic analysis showed that extent of diversity and similarity were better obtained by rpoB and recA primers, which are also reinforced by RAPD-PCR methods. However, in one case, these approaches failed to identify one isolate, which in combination with the phenotypical method offsets this issue. Overall, RAPD fingerprinting, rpoB and recA along with concatenated genes sequence analysis discriminated closely related Bacillus species, which highlights the significance of the multigenic method in more precisely distinguishing Bacillus strains. This research emphasizes the benefit of RAPD fingerprinting, rpoB and recA sequence analysis superior to 16S rRNA gene sequence analysis for suitable and effective identification of Bacillus species as recommended for probiotic products.

  9. Changes in the diversity of pig ileal lactobacilli around weaning determined by means of 16S rRNA gene amplification and denaturing gradient gel electrophoresis

    NARCIS (Netherlands)

    Janzcyk, P.; Pieper, R.; Smidt, H.; Souffrant, W.B.

    2007-01-01

    Our study aimed to provide a comprehensive characterization of changes in porcine intestinal Lactobacillus populations around the time of weaning based on 16S rRNA gene amplification and denaturing gradient gel electrophoresis (DGGE). DNA was extracted from the ileal contents of piglets at weaning

  10. [Archaeal diversity in permafrost deposits of Bunger Hills Oasis and King George Island (Antarctica) according to the 16S rRNA gene sequencing].

    Science.gov (United States)

    Karaevskaia, E S; Demchenko, L S; Demidov, N É; Rivkina, E M; Bulat, S A; Gilichinskiĭ, D A

    2014-01-01

    Archaeal communities of permafrost deposits of King George Island and Bunger Hills Oasis (Antarctica) differing in the content of biogenic methane were analyzed using clone libraries of two 16S rRNA gene regions. Phylotypes belonging to methanogenic archaea were identified in all horizons.

  11. Large-scale benchmarking reveals false discoveries and count transformation sensitivity in 16S rRNA gene amplicon data analysis methods used in microbiome studies

    DEFF Research Database (Denmark)

    Thorsen, Jonathan; Brejnrod, Asker Daniel; Mortensen, Martin Steen

    2016-01-01

    BACKGROUND: There is an immense scientific interest in the human microbiome and its effects on human physiology, health, and disease. A common approach for examining bacterial communities is high-throughput sequencing of 16S rRNA gene hypervariable regions, aggregating sequence-similar amplicons...

  12. True microbiota involved in chronic lung infection of cystic fibrosis patients found by culturing and 16S rRNA gene analysis

    DEFF Research Database (Denmark)

    Rudkjøbing, Vibeke Børsholt; Thomsen, Trine R; Alhede, Morten

    2011-01-01

    Patients suffering from cystic fibrosis (CF) develop chronic lung infection. In this study, we investigated the microorganisms present in transplanted CF lungs (n = 5) by standard culturing and 16S rRNA gene analysis. A correspondence between culturing and the molecular methods was observed. In c...

  13. Characterization of microbial communities found in the human vagina by analysis of terminal restriction fragment length polymorphisms of 16S rRNA genes

    NARCIS (Netherlands)

    Coolen, MJL; Post, E; Davis, CC; Forney, LJ

    2005-01-01

    To define and monitor the structure of microbial communities found in the human vagina, a cultivation-independent approach based on analyses of terminal restriction fragment length polymorphisms (T-RFLP) of 16S rRNA genes was developed and validated. Sixteen bacterial strains commonly found in the

  14. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development

    Science.gov (United States)

    The bacterial composition of chlorinated drinking water was analyzed using 16S rRNA gene clone libraries derived from DNA extracts of 12 samples and compared to clone libraries previously generated using RNA extracts from the same samples. Phylogenetic analysis of 761 DNA-based ...

  15. 16S rRNA Gene Sequence Analysis of Drinking Water Using RNA and DNA Extracts as Targets for Clone Library Development - Poster

    Science.gov (United States)

    We examined the bacterial composition of chlorinated drinking water using 16S rRNA gene clone libraries derived from RNA and DNA extracted from twelve water samples collected in three different months (June, August, and September of 2007). Phylogenetic analysis of 1234 and 1117 ...

  16. Comparison of Gull Feces-specific Assays Targeting the 16S rRNA Gene of Catellicoccus Marimammalium and Streptococcus spp.

    Science.gov (United States)

    Two novel gull-specific qPCR assays were developed using 16S rRNA gene sequences from gull fecal clone libraries: a SYBR-green-based assay targeting Streptococcus spp. (i.e., gull3) and a TaqMan qPCR assay targeting Catellicoccus marimammalium (i.e., gull4). The main objectives ...

  17. Rapid diagnosis of virulent Pasteurella multocida isolated from farm animals with clinical manifestation of pneumonia respiratory infection using 16S rDNA and KMT1 gene

    Directory of Open Access Journals (Sweden)

    Gamal Mohamedin Hassan

    2016-01-01

    Full Text Available Objective: To characterize intra-isolates variation between clinical isolates of Pasteurella multocida (P. multocida isolated from sheep, cattle and buffalo at molecular level to check the distribution of pneumonia and hemorrhagic septicemia in some regions of Fayoum, Egypt. Methods: These isolates were obtained from various locations in the Fayoum Governorate, Egypt and they were identified by amplifying 16S rDNA and KMT1 genes using their DNA as a template in PCR reaction. Results: The results demonstrated that the five selective isolates of P. multocida had similar size of PCR products that generated one band of 16S rDNA having 1 471 bp and KMT1 gene having 460 bp. The phylogenetic tree and similarity of the five selective isolates of P. multocida which were collected from GenBank database were calculated and analyzed for the nucleotide sequence of 16S rDNA and KMT1 genes. The sequencing result of 16S rRNA gene product (1 471 bp for the five selective isolates of P. multocida showed that the isolates of sheep (FUP2 shared 94.08%, 88.10% homology with the buffalo isolate (FUP8 and cattle isolate (FUP9 respectively, whereas, the buffalo isolate (FUP5 shared 98.18% and 94.40% homology with the cattle isolates (FUP12 and FUP9. Conclusions: The results indicated the relationships of P. multocida isolated from buffalo and cattle rather than the close relationships between P. multocida isolated from cattle and sheep. Diagnosis of P. multocida by 16S rDNA and KMT1 gene sequences was important to determine the antigen that is responsible for protective cover within the same group of animals and to help for the production of new vaccines for the control of microbial infection for domestic animals.

  18. Polynucleotide probes that target a hypervariable region of 16S rRNA genes to identify bacterial isolates corresponding to bands of community fingerprints.

    Science.gov (United States)

    Heuer, H; Hartung, K; Wieland, G; Kramer, I; Smalla, K

    1999-03-01

    Temperature gradient gel electrophoresis (TGGE) is well suited for fingerprinting bacterial communities by separating PCR-amplified fragments of 16S rRNA genes (16S ribosomal DNA [rDNA]). A strategy was developed and was generally applicable for linking 16S rDNA from community fingerprints to pure culture isolates from the same habitat. For this, digoxigenin-labeled polynucleotide probes were generated by PCR, using bands excised from TGGE community fingerprints as a template, and applied in hybridizations with dot blotted 16S rDNA amplified from bacterial isolates. Within 16S rDNA, the hypervariable V6 region, corresponding to positions 984 to 1047 (Escherichia coli 16S rDNA sequence), which is a subset of the region used for TGGE (positions 968 to 1401), best met the criteria of high phylogenetic variability, required for sufficient probe specificity, and closely flanking conserved priming sites for amplification. Removal of flanking conserved bases was necessary to enable the differentiation of closely related species. This was achieved by 5' exonuclease digestion, terminated by phosphorothioate bonds which were synthesized into the primers. The remaining complementary strand was removed by single-strand-specific digestion. Standard hybridization with truncated probes allowed differentiation of bacteria which differed by only two bases within the probe target site and 1.2% within the complete 16S rDNA. However, a truncated probe, derived from an excised TGGE band of a rhizosphere community, hybridized with three phylogenetically related isolates with identical V6 sequences. Only one of the isolates comigrated with the excised band in TGGE, which was shown to be due to identical sequences, demonstrating the utility of a combined TGGE and V6 probe approach.

  19. Community analysis of chronic wound bacteria using 16S rRNA gene-based pyrosequencing: impact of diabetes and antibiotics on chronic wound microbiota.

    Directory of Open Access Journals (Sweden)

    Lance B Price

    Full Text Available BACKGROUND: Bacterial colonization is hypothesized to play a pathogenic role in the non-healing state of chronic wounds. We characterized wound bacteria from a cohort of chronic wound patients using a 16S rRNA gene-based pyrosequencing approach and assessed the impact of diabetes and antibiotics on chronic wound microbiota. METHODOLOGY/PRINCIPAL FINDINGS: We prospectively enrolled 24 patients at a referral wound center in Baltimore, MD; sampled patients' wounds by curette; cultured samples under aerobic and anaerobic conditions; and pyrosequenced the 16S rRNA V3 hypervariable region. The 16S rRNA gene-based analyses revealed an average of 10 different bacterial families in wounds--approximately 4 times more than estimated by culture-based analyses. Fastidious anaerobic bacteria belonging to the Clostridiales family XI were among the most prevalent bacteria identified exclusively by 16S rRNA gene-based analyses. Community-scale analyses showed that wound microbiota from antibiotic treated patients were significantly different from untreated patients (p = 0.007 and were characterized by increased Pseudomonadaceae abundance. These analyses also revealed that antibiotic use was associated with decreased Streptococcaceae among diabetics and that Streptococcaceae was more abundant among diabetics as compared to non-diabetics. CONCLUSIONS/SIGNIFICANCE: The 16S rRNA gene-based analyses revealed complex bacterial communities including anaerobic bacteria that may play causative roles in the non-healing state of some chronic wounds. Our data suggest that antimicrobial therapy alters community structure--reducing some bacteria while selecting for others.

  20. Quantification of 16S gene and its relation with the CO2 emission and soil properties in areas under management of sugarcane (Saccharum spp.)

    Science.gov (United States)

    Moitinho, Mara Regina; da Silva Bicalho, Elton; De Bortoli Teixeira, Daniel; La Scala, Newton, Jr.

    2015-04-01

    A diversity of microorganisms has an essential role in the recycling of soil chemical elements, controlling, for example, the dynamics of carbon de)ion and stabilization, and consequently the patterns of soil CO2 emission. In this sense, the objectives of this study were: (i) to estimate and compare the genetic diversity of microorganisms in soils under different sugarcane (Saccharum spp.) managements using molecular techniques based on metagenomic studies, and (ii) investigate the relationship of soil CO2 emission (FCO2) with microbiological results and soil chemical and physical properties in the evaluated managements. This study was conducted in agricultural areas located in southern Brazil, in which the following sugarcane managements were used: green and burned residues management, a sugarcane area under reform, and a native forest (used as a reference of the original soil condition). FCO2, soil temperature, and soil moisture were measured over 10 days, and at the end of the measurements soil samples were taken in order to determine the physical and chemical soil properties. The determination of the diversity of soil microorganisms was carried out by means of molecular techniques based on 16S rRNA gene sequencing. The highest mean value for FCO2 (3.25 μmol m-2s-1) was observed in the sugarcane area under reform, and the lowest values (1.85 and 1.27 μmol m-2s-1) were observed respectively in the green residue management and native forest areas. This same pattern was also observed when the 16S gene was quantified. In this case, the largest number of copies of this gene was found in the sugarcane area under reform (4.3x1010 copies of 16S rRNA gene per gram of dry soil), and its smallest number of copies was found in the green residues management area (1.7x1010 copies of 16S rRNA gene per gram of dry soil). The largest number of copies of the 16S gene associated to the highest values of FCO2, both observed in the sugarcane area under reform, could be related to

  1. Genomic GC-content affects the accuracy of 16S rRNA gene sequencing bsed microbial profiling due to PCR bias

    DEFF Research Database (Denmark)

    Laursen, Martin F.; Dalgaard, Marlene Danner; Bahl, Martin Iain

    2017-01-01

    Profiling of microbial community composition is frequently performed by partial 16S rRNA gene sequencing on benchtop platforms following PCR amplification of specific hypervariable regions within this gene. Accuracy and reproducibility of this strategy are two key parameters to consider, which may...... be influenced during all processes from sample collection and storage, through DNA extraction and PCR based library preparation to the final sequencing. In order to evaluate both the reproducibility and accuracy of 16S rRNA gene based microbial profiling using the Ion Torrent PGM platform, we prepared libraries...... be explained partly by premature read truncation, but to larger degree their genomic GC-content, which correlated negatively with the observed relative abundances, suggesting a PCR bias against GC-rich species during library preparation. Increasing the initial denaturation time during the PCR amplification...

  2. Phylogenetic study of Geitlerinema and Microcystis (Cyanobacteria) using PC-IGS and 16S-23S ITS as markers: investigation of horizontal gene transfer.

    Science.gov (United States)

    Piccin-Santos, Viviane; Brandão, Marcelo Mendes; Bittencourt-Oliveira, Maria Do Carmo

    2014-08-01

    Selection of genes that have not been horizontally transferred for prokaryote phylogenetic inferences is regarded as a challenging task. The markers internal transcribed spacer of ribosomal genes (16S-23S ITS) and phycocyanin intergenic spacer (PC-IGS), based on the operons of ribosomal and phycocyanin genes respectively, are among the most used markers in cyanobacteria. The region of the ribosomal genes has been considered stable, whereas the phycocyanin operon may have undergone horizontal transfer. To investigate the occurrence of horizontal transfer of PC-IGS, phylogenetic trees of Geitlerinema and Microcystis strains were generated using PC-IGS and 16S-23S ITS and compared. Phylogenetic trees based on the two markers were mostly congruent for Geitlerinema and Microcystis, indicating a common evolutionary history among ribosomal and phycocyanin genes with no evidence for horizontal transfer of PC-IGS. Thus, PC-IGS is a suitable marker, along with 16S-23S ITS for phylogenetic studies of cyanobacteria. © 2014 Phycological Society of America.

  3. Bacterial Diversity Studies Using the 16S rRNA Gene Provide a Powerful Research-Based Curriculum for Molecular Biology Laboratory

    Directory of Open Access Journals (Sweden)

    Bryan E. Dutton

    2002-12-01

    Full Text Available We have developed a ten-week curriculum for molecular biology that uses 16S ribosomal RNA genes to characterize and compare novel bacteria from hot spring communities in Yellowstone National Park. The 16S rRNA approach bypasses selective culture-based methods. Our molecular biology course offered the opportunity for students to learn broadly applicable methods while contributing to a long-term research project. Specifically, students isolated and characterized clones that contained novel 16S rRNA inserts using restriction enzyme, DNA sequencing, and computer-based phylogenetic methods. In both classes, students retrieved novel bacterial 16S rRNA genes, several of which were most similar to Green Nonsulfur bacterial isolates. During class, we evaluated student performance and mastery of skills and concepts using quizzes, formal lab notebooks, and a broad project assignment. For this report, we also assessed student performance alongside data quality and discussed the significance, our goal being to improve both research and teaching methods.

  4. Diversity of Protease-Producing Bacillus spp. From Fresh Indonesian Tempeh Based on 16S rRNA Gene Sequence

    Directory of Open Access Journals (Sweden)

    Tati Barus

    2017-01-01

    Full Text Available Tempeh is a type of traditional fermented food in Indonesia. The fermentation can be performed by Rhizopus microsporus as a main microorganism. However, Bacillus spp. is found in abundance in tempeh production. Nevertheless, information regarding the diversity of Bacillus spp. in tempeh production has not been reported yet. Therefore, the aim of this investigation was to study the genetic diversity of Bacillus spp. in tempeh production based on the 16S ribosomal RNA sequence. In this study, about 22 of 24 fresh tempeh from Jakarta, Bogor, and Tangerang were used. A total of 52 protease-producing Bacillus spp. isolates were obtained. Based on 16S ribosomal RNA results, all 52 isolates were identified to be similar to B. pumilus, B. subtilis, B. megaterium, B. licheniformis, B. cereus, B. thuringiensis, B. amyloliquefaciens, Brevibacillus brevis, and Bacillus sp. All the identified isolates were divided into two large clusters: 1 a cluster of B. cereus, B. thuringiensis, Bacillus sp., and B. brevis and 2 a cluster of B. pumilus, B. subtilis, B. megaterium, B. licheniformis, and B. amyloliquefaciens. Information about the Bacillus spp. role in determining the quality of tempeh has not been reported and this is a preliminary study of Bacillus spp. from tempeh.

  5. Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination

    DEFF Research Database (Denmark)

    Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M

    2010-01-01

    Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16......S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing......-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains...

  6. [Characterizing Beijing's Airborne Bacterial Communities in PM2.5 and PM1 Samples During Haze Pollution Episodes Using 16S rRNA Gene Analysis Method].

    Science.gov (United States)

    Wang, Bu-ying; Lang, Ji-dong; Zhang, Li-na; Fang, Jian-huo; Cao, Chen; Hao, Ji-ming; Zhu, Ting; Tian, Geng; Jiang, Jing-kun

    2015-08-01

    During 8th-14th Jan., 2013, severe particulate matter (PM) pollution episodes happened in Beijing. These air pollution events lead to high risks for public health. In addition to various PM chemical compositions, biological components in the air may also impose threaten. Little is known about airborne microbial community in such severe air pollution conditions. PM2.5 and PM10 samples were collected during that 7-day pollution period. The 16S rRNA gene V3 amplification and the MiSeq sequencing were performed for analyzing these samples. It is found that there is no significant difference at phylum level for PM2.5 bacterial communities during that 7-day pollution period both at phylum and at genus level. At genus level, Arthrobacter and Frankia are the major airborne microbes presented in Beijing winter.samples. At genus level, there are 39 common genera (combined by first 50 genera bacterial of the two analysis) between the 16S rRNA gene analysis and those are found by Metagenomic analysis on the same PM samples. Frankia and Paracoccus are relatively more abundant in 16S rRNA gene data, while Kocuria and Geodermatophilus are relatively more abundant in Meta-data. PM10 bacterial communities are similar to those of PM2.5 with some noticeable differences, i.e., at phylum level, more Firmicutes and less Actinobacteria present in PM10 samples than in PM2.5 samples, while at genus level, more Clostridium presents in PM10 samples. The findings in Beijing were compared with three 16S rRNA gene studies in other countries. Although the sampling locations and times are different from each other, compositions of bacterial community are similar for those sampled at the ground atmosphere. Airborne microbial communities near the ground surface are different from those sampled in the upper troposphere.

  7. Comparison of traditional phenotypic identification methods with partial 5' 16S rRNA gene sequencing for species-level identification of nonfermenting Gram-negative bacilli.

    Science.gov (United States)

    Cloud, Joann L; Harmsen, Dag; Iwen, Peter C; Dunn, James J; Hall, Gerri; Lasala, Paul Rocco; Hoggan, Karen; Wilson, Deborah; Woods, Gail L; Mellmann, Alexander

    2010-04-01

    Correct identification of nonfermenting Gram-negative bacilli (NFB) is crucial for patient management. We compared phenotypic identifications of 96 clinical NFB isolates with identifications obtained by 5' 16S rRNA gene sequencing. Sequencing identified 88 isolates (91.7%) with >99% similarity to a sequence from the assigned species; 61.5% of sequencing results were concordant with phenotypic results, indicating the usability of sequencing to identify NFB.

  8. Abundance and activity of 16S rRNA, amoA and nifH bacterial genes during assisted phytostabilization of mine tailings

    OpenAIRE

    Nelson, Karis N.; Neilson, Julia W.; Root, Robert A.; Chorover, Jon; Maier, Raina M.

    2015-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nif...

  9. 16S Ribosomal Ribonucleic Acid Gene Polymerase Chain Reaction in the Diagnosis of Bloodstream Infections: A Systematic Review and Meta-Analysis.

    Science.gov (United States)

    Su, Guoming; Fu, Zhuqing; Hu, Liren; Wang, Yueying; Zhao, Zuguo; Yang, Weiqing

    2015-01-01

    We aim to evaluate the accuracy of the 16S ribosomal ribonucleic acid (rRNA) gene polymerase chain reaction (PCR) test in the diagnosis of bloodstream infections through a systematic review and meta-analysis. A computerized literature search was conducted to identify studies that assessed the diagnostic value of 16S rRNA gene PCR test for bloodstream infections. Study quality was assessed using the revised Quality Assessment of Diagnostic Accuracy Studies (QUADAS-2) tool. We calculated the sensitivity, specificity, positive likelihood ratio (PLR), negative likelihood ratio (NLR), diagnostic odds ratio (DOR) and their 95% confidence intervals (95% CI) for each study. Summary receiver operating characteristic (SROC) curve was used to summarize overall test performance. Statistical analysis was performed in Meta-DiSc 1.4 and Stata/SE 12.0 software. Twenty-eight studies were included in our meta-analysis. Using random-effect model analysis, the pooled sensitivity, specificity, PLR, NLR, and DOR were 0.87 (95% CI, 0.85-0.89), 0.94 (95% CI, 0.93-0.95), 12.65 (95% CI, 8.04-19.90), 0.14 (95% CI, 0.08-0.24), and 116.76 (95% CI, 52.02-262.05), respectively. The SROC curve indicated that the area under the curve (AUC) was 0.9690 and the maximum joint sensitivity and specificity (Q*) was 0.9183. In addition, heterogeneity was statistically significant but was not caused by the threshold effect. Existing data suggest that 16S rRNA gene PCR test is a practical tool for the rapid screening of sepsis. Further prospective studies are needed to assess the diagnostic value of PCR amplification and DNA microarray hybridization of 16S rRNA gene in the future.

  10. Rapid identification of Campylobacter, Arcobacter, and Helicobacter isolates by PCR-restriction fragment length polymorphism analysis of the 16S rRNA gene.

    Science.gov (United States)

    Marshall, S M; Melito, P L; Woodward, D L; Johnson, W M; Rodgers, F G; Mulvey, M R

    1999-12-01

    A rapid two-step identification scheme based on PCR-restriction fragment length polymorphism (PCR-RFLP) analysis of the 16S rRNA gene was developed in order to differentiate isolates belonging to the Campylobacter, Arcobacter, and Helicobacter genera. For 158 isolates (26 reference cultures and 132 clinical isolates), specific RFLP patterns were obtained and species were successfully identified by this assay.

  11. High-Resolution Melting Curve Analysis of the 16S Ribosomal Gene to Detect and Identify Pathogenic and Saprophytic Leptospira Species in Colombian Isolates.

    Science.gov (United States)

    Peláez Sánchez, Ronald G; Quintero, Juan Álvaro López; Pereira, Martha María; Agudelo-Flórez, Piedad

    2017-05-01

    AbstractIt is important to identify the circulating Leptospira agent to enhance the performance of serodiagnostic tests by incorporating specific antigens of native species, develop vaccines that take into account the species/serovars circulating in different regions, and optimize prevention and control strategies. The objectives of this study were to develop a polymerase chain reaction (PCR)-high-resolution melting (HRM) assay for differentiating between species of the genus Leptospira and to verify its usefulness in identifying unknown samples to species level. A set of primers from the initial region of the 16S ribosomal gene was designed to detect and differentiate the 22 species of Leptospira . Eleven reference strains were used as controls to establish the reference species and differential melting curves. Twenty-five Colombian Leptospira isolates were studied to evaluate the usefulness of the PCR-HRM assay in identifying unknown samples to species level. This identification was confirmed by sequencing and phylogenetic analysis of the 16S ribosomal gene. Eleven Leptospira species were successfully identified, except for Leptospira meyeri / Leptospira yanagawae because the sequences were 100% identical. The 25 isolates from humans, animals, and environmental water sources were identified as Leptospira santarosai (twelve), Leptospira interrogans (nine), and L. meyeri / L. yanagawae (four). The species verification was 100% concordant between PCR-HRM and phylogenetic analysis of the 16S ribosomal gene. The PCR-HRM assay designed in this study is a useful tool for identifying Leptospira species from isolates.

  12. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis.

    Science.gov (United States)

    Sönksen, Ute Wolff; Christensen, Jens Jørgen; Nielsen, Lisbeth; Hesselbjerg, Annemarie; Hansen, Dennis Schrøder; Bruun, Brita

    2010-12-31

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial 16S rRNA gene sequence analysis results: For 76 strains phenotypic and sequencing identifications were identical, for 23 strains the sequencing identifications were either probable or possible, and for one strain only the genus was confirmed. Thus, the Vitek 2 NH system identifies most of the commonly occurring species included in the database. Some strains of rarely occurring species and strains of non-database species closely related to database species cause problems. Partial 16S rRNA gene sequence analysis performs well, but does not always suffice, additional phenotypical characterization being useful for final identification.

  13. Metagenomic of Actinomycetes Based on 16S rRNA and nifH Genes in Soil and Roots of Four Indonesian Rice Cultivars Using PCR-DGGE

    Directory of Open Access Journals (Sweden)

    Mahyarudin

    2015-07-01

    Full Text Available The research was conducted to study the metagenomic of actinomycetes based on 16S ribosomal RNA (rRNA and bacterial nifH genes in soil and roots of four rice cultivars. The denaturing gradient gel electrophoresis profile based on 16S rRNA gene showed that the diversity of actinomycetes in roots was higher than soil samples. The profile also showed that the diversity of actinomycetes was similar in four varieties of rice plant and three types of agroecosystem. The profile was partially sequenced and compared to GenBank database indicating their identity with closely related microbes. The blast results showed that 17 bands were closely related ranging from 93% to 100% of maximum identity with five genera of actinomycetes, which is Geodermatophilus, Actinokineospora, Actinoplanes, Streptomyces and Kocuria. Our study found that Streptomyces species in soil and roots of rice plants were more varied than other genera, with a dominance of Streptomyces alboniger and Streptomyces acidiscabies in almost all the samples. Bacterial community analyses based on nifH gene denaturing gradient gel electrophoresis showed that diversity of bacteria in soils which have nifH gene was higher than that in rice plant roots. The profile also showed that the diversity of those bacteria was similar in four varieties of rice plant and three types of agroecosystem. Five bands were closely related with nifH gene from uncultured bacterium clone J50, uncultured bacterium clone clod-38, and uncultured bacterium clone BG2.37 with maximum identity 99%, 98%, and 92%, respectively. The diversity analysis based on 16S rRNA gene differed from nifH gene and may not correlate with each other. The findings indicated the diversity of actinomycetes and several bacterial genomes analyzed here have an ability to fix nitrogen in soil and roots of rice plant.

  14. Rapid Sanger sequencing of the 16S rRNA gene for identification of some common pathogens.

    Directory of Open Access Journals (Sweden)

    Linxiang Chen

    Full Text Available Conventional Sanger sequencing remains time-consuming and laborious. In this study, we developed a rapid improved sequencing protocol of 16S rRNA for pathogens identification by using a new combination of SYBR Green I real-time PCR and Sanger sequencing with FTA® cards. To compare the sequencing quality of this method with conventional Sanger sequencing, 12 strains, including three kinds of strains (1 reference strain and 3 clinical strains, which were previously identified by biochemical tests, which have 4 Pseudomonas aeruginosa, 4 Staphyloccocus aureus and 4 Escherichia coli, were targeted. Additionally, to validate the sequencing results and bacteria identification, expanded specimens with 90 clinical strains, also comprised of the three kinds of strains which included 30 samples respectively, were performed as just described. The results showed that although statistical differences (P<0.05 were found in sequencing quality between the two methods, their identification results were all correct and consistent. The workload, the time consumption and the cost per batch were respectively light versus heavy, 8 h versus 11 h and $420 versus $400. In the 90 clinical strains, all of the Pseudomonas aeruginosa and Staphyloccocus aureus strains were correctly identified, but only 26.7% of the Escherichia coli strains were recognized as Escherichia coli, while 33.3% as Shigella sonnei and 40% as Shigella dysenteriae. The protocol described here is a rapid, reliable, stable and convenient method for 16S rRNA sequencing, and can be used for Pseudomonas aeruginosa and Staphyloccocus aureus identification, yet it is not completely suitable for discriminating Escherichia coli and Shigella strains.

  15. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Mannalamkunnath Alikunhi, Nabeel; Batang, Zenon B.; AlJahdali, Haitham A.; Aziz, Mohammed A.M.; Al-Suwailem, Abdulaziz M.

    2016-01-01

    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  16. Culture-dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Nabeel M. Alikunhi

    2017-09-01

    Full Text Available Fish contamination has been extensively investigated along the Saudi coasts, but studies pertaining to bacterial pathogens are scarce. We conducted qualitative assessment and molecular identification of culture-dependent bacteria in 13 fish species from three coastal sites and a local fish market in Jeddah, Saudi Arabia. Bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac, Eosin Methylene Blue (EMB and Thiosulfate Citrate Bile Salts (TCBS culture media. Bacterial counts significantly differed between species, sources and feeding habits of examined fishes. Mugil cephalus exhibited higher counts on TCBS (all body parts, Mac (gills, muscle and gut and EMB (gills and muscle. Fishes from Area I had higher bacterial loads, coinciding with those in seawater and sediment from the same site, indicating direct association between habitat conditions and the levels of bacterial contamination. By feeding habit, detritivorous fish harbored higher counts than herbivorous and carnivorous species. Bacterial counts of skin were higher in fish from market than field sites, and positively correlated with other body parts indicating the relation of surface bacterial load on the overall quality of fish. Rahnella aquatilis (Enterobacteriaceae and Photobacterium damselae (Vibrionaceae were among the dominant species from fish muscle based on 16S rRNA sequencing. These species are known human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens, e.g. Hafnia sp. (Enterobacteriaceae and Pseudomonas stutzeri (Pseudomonadaceae also occurred in fish muscle. The inclusion of bacterial contamination in future monitoring efforts is thus crucial.

  17. Culture dependent bacteria in commercial fishes: Qualitative assessment and molecular identification using 16S rRNA gene sequencing

    KAUST Repository

    Alikunhi, Nabeel M.

    2016-05-27

    Fish contaminations have been extensively investigated in Saudi coasts, but studies pertaining to bacterial pathogens are meager. We conducted qualitative assessment and molecular identification of culture dependent bacteria in 13 fish species collected from three fishing sites and a local fish market in Jeddah, Saudi Arabia. The bacterial counts of gills, skin, gut and muscle were examined on agar plates of Macconkey’s (Mac), Eosin methylene blue (EMB) and Thiosulfate Citrate Bile Salts (TCBS) culture media. Bacterial counts exhibited interspecific, locational and behavioral differences. Mugil cephalus exhibited higher counts on TCBS (all body-parts), Mac (gills, muscle and gut) and EMB (gills and muscle). Samples of Area I were with higher counts, concurrent to seawater and sediment samples, revealing the influence of residing environment on fish contamination. Among feeding habits, detritivorous fish harbored higher bacterial counts, while carnivorous group accounted for lesser counts. Counts were higher in skin of fish obtained from market compared to field samples, revealing market as a major source of contamination. Bacterial counts of skin were positively correlated with other body-parts indicating influence of surface bacterial biota in overall quality of fish. Hence, hygienic practices and proper storage facilities in the Jeddah fish market is recommended to prevent adverse effect of food-borne illness in consumers. Rahnella aquatilis (Enterobacteriaceae) and Photobacterium damselae (Vibrionaceae) were among the dominant species identified from fish muscle samples using Sanger sequencing of 16S rRNA. This bacterial species are established human pathogens capable of causing foodborne illness with severe antibiotic resistance. Opportunistic pathogens such as Hafnia sp. (Enterobacteriaceae) and Pseudomonas stutzeri (Pseudomonadaceae) were also identified from fish muscle. These findings indicate bacterial contamination risk in commonly consumed fish of

  18. Simultaneous DNA-RNA Extraction from Coastal Sediments and Quantification of 16S rRNA Genes and Transcripts by Real-time PCR.

    Science.gov (United States)

    Tatti, Enrico; McKew, Boyd A; Whitby, Corrine; Smith, Cindy J

    2016-06-11

    Real Time Polymerase Chain Reaction also known as quantitative PCR (q-PCR) is a widely used tool in microbial ecology to quantify gene abundances of taxonomic and functional groups in environmental samples. Used in combination with a reverse transcriptase reaction (RT-q-PCR), it can also be employed to quantify gene transcripts. q-PCR makes use of highly sensitive fluorescent detection chemistries that allow quantification of PCR amplicons during the exponential phase of the reaction. Therefore, the biases associated with 'end-point' PCR detected in the plateau phase of the PCR reaction are avoided. A protocol to quantify bacterial 16S rRNA genes and transcripts from coastal sediments via real-time PCR is provided. First, a method for the co-extraction of DNA and RNA from coastal sediments, including the additional steps required for the preparation of DNA-free RNA, is outlined. Second, a step-by-step guide for the quantification of 16S rRNA genes and transcripts from the extracted nucleic acids via q-PCR and RT-q-PCR is outlined. This includes details for the construction of DNA and RNA standard curves. Key considerations for the use of RT-q-PCR assays in microbial ecology are included.

  19. Prevalence of 16S rRNA Methylase Gene rmtB Among Escherichia coli Isolated from Bovine Mastitis in Ningxia, China.

    Science.gov (United States)

    Yu, Ting; He, Tao; Yao, Hong; Zhang, Jin-Bao; Li, Xiao-Na; Zhang, Rong-Ming; Wang, Gui-Qin

    2015-09-01

    The aim of this study is to understand the prevalence and molecular characterization of 16S rRNA methylase gene, rmtB, among Escherichia coli strains isolated from bovine mastitis in China. A total of 245 E. coli isolates were collected from bovine mastitis in China between 2013 and 2014 and were screened for 16S rRNA methylase genes (armA, rmtA, rmtB, rmtC, rmtD, rmtE, and npmA) by polymerase chain reaction. About 5.3% (13/245) of the isolates carried the rmtB gene; the isolates were highly resistant to amikacin. Thirteen rmtB-positive strains were analyzed for the presence of extended-spectrum β-lactamase genes (bla(TEM), bla(CTX-M), bla(OXA), and bla(SHV)). All the isolates harbored both bla(TEM-1) and bla(CTX-M-15) genes and two of the isolates were also positive for bla(OXA-1). Pulsed-field gel electrophoresis (PFGE) analysis indicated that the nine rmtB-positive strains belonging to ST10 from one farm showed the similar PFGE pattern, indicating a clonal expansion in this farm. S1-PFGE and Southern blotting showed that 12 isolates harbored the rmtB gene in plasmids of two different sizes (≈45 kb [n=10] and ≈48 kb [n=2]), while only 1 strain harbored the rmtB gene in the chromosome. These plasmids were transferable by conjugation studies, and two isolates from two respective farms carried the same size of plasmid, suggesting that the horizontal transmission of plasmids also contributed to the spread of rmtB gene. This is the first report of prevalence of the 16S rRNA methylase gene rmtB among E. coli isolated from bovine mastitis in China, and rmtB-carrying E. coli may pose a threat to the treatment of bovine mastitis.

  20. High-throughput sequencing of 16S rRNA gene amplicons: effects of extraction procedure, primer length and annealing temperature.

    Science.gov (United States)

    Sergeant, Martin J; Constantinidou, Chrystala; Cogan, Tristan; Penn, Charles W; Pallen, Mark J

    2012-01-01

    The analysis of 16S-rDNA sequences to assess the bacterial community composition of a sample is a widely used technique that has increased with the advent of high throughput sequencing. Although considerable effort has been devoted to identifying the most informative region of the 16S gene and the optimal informatics procedures to process the data, little attention has been paid to the PCR step, in particular annealing temperature and primer length. To address this, amplicons derived from 16S-rDNA were generated from chicken caecal content DNA using different annealing temperatures, primers and different DNA extraction procedures. The amplicons were pyrosequenced to determine the optimal protocols for capture of maximum bacterial diversity from a chicken caecal sample. Even at very low annealing temperatures there was little effect on the community structure, although the abundance of some OTUs such as Bifidobacterium increased. Using shorter primers did not reveal any novel OTUs but did change the community profile obtained. Mechanical disruption of the sample by bead beating had a significant effect on the results obtained, as did repeated freezing and thawing. In conclusion, existing primers and standard annealing temperatures captured as much diversity as lower annealing temperatures and shorter primers.

  1. Cutaneous manifestations of Nocardia brasiliensis infection in Taiwan during 2002-2012-clinical studies and molecular typing of pathogen by gyrB and 16S gene sequencing.

    Science.gov (United States)

    Chen, Kuo-Wei; Lu, Chun-Wei; Huang, Ting-Chi; Lu, Chin-Fang; Liau, Yea-Ling; Lin, Jeng-Fong; Li, Shu-Ying

    2013-09-01

    To observe the clinicopathologic and resistance profiles of the Nocardia brasiliensis causing cutaneous nocardiosis in Taiwan, 12 N. brasiliensis isolates were prospectively collected from patients with cutaneous nocardiosis in a hospital during 2002-2012. Clinicopathologic data were obtained, and isolates were identified by biochemical methods and 16S rRNA sequencing. Susceptibilities to 14 antimicrobial compounds were tested. Isolates were further genotyped by sequencing of 16S rRNA, secA1, hsp65, and gyrB genes. The nodulopustular pyoderma associated with sporotrichoid spreading was the most common skin presentations caused by N. brasiliensis. All of the isolates were susceptible to amikacin, gentamicin, tobramycin, piperacillin/tazobactam, and trimethoprim/sulfamethoxazole and resistant to kanamycin, erythromycin, and oxacillin, while susceptibilities to imipenem, vancomycin, penicillin-G, tetracycline, clindamycin, and ciprofloxacin varied among the 12 isolates. GyrB genotyping delineated the 12 isolates into 2 major groups, which was coincident with different single nucleotide substitutions at position 160 (G versus T) of 16S rRNA, different levels of imipenem minimum inhibition concentration (4-32 versus 0.25-0.75 mg/L), and prevalence of lymphadenitis (66.7 versus 16.7%). We have noted that tiny pustular lesions can be the first sign of cutaneous nocardiosis, which we believe has not been previously emphasized. No resistance to trimethoprim and sulfamethoxazole was found; therefore, sulphonamide drugs remain effective for treatment of cutaneous nocardiosis in Taiwan. Copyright © 2013 Elsevier Inc. All rights reserved.

  2. Effect of phenylurea herbicides on soil microbial communities estimated by analysis of 16S rRNA gene fingerprints and community-level physiological profiles.

    Science.gov (United States)

    el Fantroussi, S; Verschuere, L; Verstraete, W; Top, E M

    1999-03-01

    The effect of three phenyl urea herbicides (diuron, linuron, and chlorotoluron) on soil microbial communities was studied by using soil samples with a 10-year history of treatment. Denaturing gradient gel electrophoresis (DGGE) was used for the analysis of 16S rRNA genes (16S rDNA). The degree of similarity between the 16S rDNA profiles of the communities was quantified by numerically analysing the DGGE band patterns. Similarity dendrograms showed that the microbial community structures of the herbicide-treated and nontreated soils were significantly different. Moreover, the bacterial diversity seemed to decrease in soils treated with urea herbicides, and sequence determination of several DGGE fragments showed that the most affected species in the soils treated with diuron and linuron belonged to an uncultivated bacterial group. As well as the 16S rDNA fingerprints, the substrate utilization patterns of the microbial communities were compared. Principal-component analysis performed on BIOLOG data showed that the functional abilities of the soil microbial communities were altered by the application of the herbicides. In addition, enrichment cultures of the different soils in medium with the urea herbicides as the sole carbon and nitrogen source showed that there was no difference between treated and nontreated soil in the rate of transformation of diuron and chlorotoluron but that there was a strong difference in the case of linuron. In the enrichment cultures with linuron-treated soil, linuron disappeared completely after 1 week whereas no significant transformation was observed in cultures inoculated with nontreated soil even after 4 weeks. In conclusion, this study showed that both the structure and metabolic potential of soil microbial communities were clearly affected by a long-term application of urea herbicides.

  3. Biphasic Study to Characterize Agricultural Biogas Plants by High-Throughput 16S rRNA Gene Amplicon Sequencing and Microscopic Analysis.

    Science.gov (United States)

    Maus, Irena; Kim, Yong Sung; Wibberg, Daniel; Stolze, Yvonne; Off, Sandra; Antonczyk, Sebastian; Pühler, Alfred; Scherer, Paul; Schlüter, Andreas

    2017-02-28

    Process surveillance within agricultural biogas plants (BGPs) was concurrently studied by high-throughput 16S rRNA gene amplicon sequencing and an optimized quantitative microscopic fingerprinting (QMF) technique. In contrast to 16S rRNA gene amplicons, digitalized microscopy is a rapid and cost-effective method that facilitates enumeration and morphological differentiation of the most significant groups of methanogens regarding their shape and characteristic autofluorescent factor 420. Moreover, the fluorescence signal mirrors cell vitality. In this study, four different BGPs were investigated. The results indicated stable process performance in the mesophilic BGPs and in the thermophilic reactor. Bacterial subcommunity characterization revealed significant differences between the four BGPs. Most remarkably, the genera Defluviitoga and Halocella dominated the thermophilic bacterial subcommunity, whereas members of another taxon, Syntrophaceticus , were found to be abundant in the mesophilic BGP. The domain Archaea was dominated by the genus Methanoculleus in all four BGPs, followed by Methanosaeta in BGP1 and BGP3. In contrast, Methanothermobacter members were highly abundant in the thermophilic BGP4. Furthermore, a high consistency between the sequencing approach and the QMF method was shown, especially for the thermophilic BGP. The differences elucidated that using this biphasic approach for mesophilic BGPs provided novel insights regarding disaggregated single cells of Methanosarcina and Methanosaeta species. Both dominated the archaeal subcommunity and replaced coccoid Methanoculleus members belonging to the same group of Methanomicrobiales that have been frequently observed in similar BGPs. This work demonstrates that combining QMF and 16S rRNA gene amplicon sequencing is a complementary strategy to describe archaeal community structures within biogas processes.

  4. The genetic diversity of genus Bacillus and the related genera revealed by 16S rRNA gene sequences and ardra analyses isolated from geothermal regions of turkey

    Directory of Open Access Journals (Sweden)

    Arzu Coleri Cihan

    2012-03-01

    Full Text Available Previously isolated 115 endospore-forming bacilli were basically grouped according to their temperature requirements for growth: the thermophiles (74%, the facultative thermophiles (14% and the mesophiles (12%. These isolates were taken into 16S rRNA gene sequence analyses, and they were clustered among the 7 genera: Anoxybacillus, Aeribacillus, Bacillus, Brevibacillus, Geobacillus, Paenibacillus, and Thermoactinomycetes. Of these bacilli, only the thirty two isolates belonging to genera Bacillus (16, Brevibacillus (13, Paenibacillus (1 and Thermoactinomycetes (2 were selected and presented in this paper. The comparative sequence analyses revealed that the similarity values were ranged as 91.4-100 %, 91.8- 99.2 %, 92.6- 99.8 % and 90.7 - 99.8 % between the isolates and the related type strains from these four genera, respectively. Twenty nine of them were found to be related with the validly published type strains. The most abundant species was B. thermoruber with 9 isolates followed by B. pumilus (6, B. lichenformis (3, B. subtilis (3, B. agri (3, B. smithii (2, T. vulgaris (2 and finally P. barengoltzii (1. In addition, isolates of A391a, B51a and D295 were proposed as novel species as their 16S rRNA gene sequences displayed similarities ≤ 97% to their closely related type strains. The AluI-, HaeIII- and TaqI-ARDRA results were in congruence with the 16S rRNA gene sequence analyses. The ARDRA results allowed us to differentiate these isolates, and their discriminative restriction fragments were able to be determined. Some of their phenotypic characters and their amylase, chitinase and protease production were also studied and biotechnologically valuable enzyme producing isolates were introduced in order to use in further studies.

  5. Polyphasic characterization of Dolichospermum spp. and Sphaerospermopsis spp. (Nostocales, cyanobacteria): morphology, 16S rRNA gene sequences and fatty acid and secondary metabolite profiles

    Czech Academy of Sciences Publication Activity Database

    Zapomělová, Eliška; Hrouzek, Pavel; Řezanka, Tomáš; Jezberová, Jitka; Řeháková, Klára; Hisem, D.; Komárková, Jaroslava

    2011-01-01

    Roč. 47, č. 5 (2011), s. 1152-1163 ISSN 0022-3646 R&D Projects: GA AV ČR(CZ) KJB600960703; GA ČR(CZ) GAP504/10/1501; GA ČR(CZ) GA206/09/0309 Institutional research plan: CEZ:AV0Z60170517; CEZ:AV0Z50200510; CEZ:AV0Z60050516 Keywords : taxonomy * cyanobacteria * Anabaena * Dolichospermum * Sphaerospermopsis * phylogeny * 16S rRNA gene * fatty acids * secondary metabolites Subject RIV: EE - Microbiology, Virology Impact factor: 2.071, year: 2011

  6. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...

  7. Genetic classification and distinguishing of Staphylococcus species based on different partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf gene sequences.

    Science.gov (United States)

    Ghebremedhin, B; Layer, F; König, W; König, B

    2008-03-01

    The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (approximately 931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (approximately 97%), rpoB (approximately 86%), hsp60 (approximately 82%), and sodA (approximately 78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification.

  8. Genetic Classification and Distinguishing of Staphylococcus Species Based on Different Partial gap, 16S rRNA, hsp60, rpoB, sodA, and tuf Gene Sequences▿

    Science.gov (United States)

    Ghebremedhin, B.; Layer, F.; König, W.; König, B.

    2008-01-01

    The analysis of 16S rRNA gene sequences has been the technique generally used to study the evolution and taxonomy of staphylococci. However, the results of this method do not correspond to the results of polyphasic taxonomy, and the related species cannot always be distinguished from each other. Thus, new phylogenetic markers for Staphylococcus spp. are needed. We partially sequenced the gap gene (∼931 bp), which encodes the glyceraldehyde-3-phosphate dehydrogenase, for 27 Staphylococcus species. The partial sequences had 24.3 to 96% interspecies homology and were useful in the identification of staphylococcal species (F. Layer, B. Ghebremedhin, W. König, and B. König, J. Microbiol. Methods 70:542-549, 2007). The DNA sequence similarities of the partial staphylococcal gap sequences were found to be lower than those of 16S rRNA (∼97%), rpoB (∼86%), hsp60 (∼82%), and sodA (∼78%). Phylogenetically derived trees revealed four statistically supported groups: S. hyicus/S. intermedius, S. sciuri, S. haemolyticus/S. simulans, and S. aureus/epidermidis. The branching of S. auricularis, S. cohnii subsp. cohnii, and the heterogeneous S. saprophyticus group, comprising S. saprophyticus subsp. saprophyticus and S. equorum subsp. equorum, was not reliable. Thus, the phylogenetic analysis based on the gap gene sequences revealed similarities between the dendrograms based on other gene sequences (e.g., the S. hyicus/S. intermedius and S. sciuri groups) as well as differences, e.g., the grouping of S. arlettae and S. kloosii in the gap-based tree. From our results, we propose the partial sequencing of the gap gene as an alternative molecular tool for the taxonomical analysis of Staphylococcus species and for decreasing the possibility of misidentification. PMID:18174295

  9. [Identification of new conserved and variable regions in the 16S rRNA gene of acetic acid bacteria and acetobacteraceae family].

    Science.gov (United States)

    Chakravorty, S; Sarkar, S; Gachhui, R

    2015-01-01

    The Acetobacteraceae family of the class Alpha Proteobacteria is comprised of high sugar and acid tolerant bacteria. The Acetic Acid Bacteria are the economically most significant group of this family because of its association with food products like vinegar, wine etc. Acetobacteraceae are often hard to culture in laboratory conditions and they also maintain very low abundances in their natural habitats. Thus identification of the organisms in such environments is greatly dependent on modern tools of molecular biology which require a thorough knowledge of specific conserved gene sequences that may act as primers and or probes. Moreover unconserved domains in genes also become markers for differentiating closely related genera. In bacteria, the 16S rRNA gene is an ideal candidate for such conserved and variable domains. In order to study the conserved and variable domains of the 16S rRNA gene of Acetic Acid Bacteria and the Acetobacteraceae family, sequences from publicly available databases were aligned and compared. Near complete sequences of the gene were also obtained from Kombucha tea biofilm, a known Acetobacteraceae family habitat, in order to corroborate the domains obtained from the alignment studies. The study indicated that the degree of conservation in the gene is significantly higher among the Acetic Acid Bacteria than the whole Acetobacteraceae family. Moreover it was also observed that the previously described hypervariable regions V1, V3, V5, V6 and V7 were more or less conserved in the family and the spans of the variable regions are quite distinct as well.

  10. Bacteriemia fulminante asociada a Capnocytophaga sputigena en un paciente con linfoma no Hodgkin tipo T: Diagnóstico por secuenciación genética del ARNr 16S Fatal bacteremia related to Capnocytophaga sputigena in a hematological patient with type T non- Hodgkin lymphoma: Diagnosis by 16S rRNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Tomás García Lozano

    2012-09-01

    Full Text Available Describimos un caso de bacteriemia fulminante asociada a Capnocytophaga sputigena en un paciente hematológico. El aislamiento fue identificado mediante la secuenciación genética de la subunidad 16S del ARNr.We described a case of fatal bacteremia related to Capnocytophaga sputigena in a hematological patient. The strain was identified by 16S rRNA gene sequencing.

  11. Two Genes Encoding Uracil Phosphoribosyltransferase Are Present in Bacillus subtilis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Glaser, Philippe; Andersen, Paal S.

    1995-01-01

    Uracil phosphoribosyltransferase (UPRTase) catalyzes the key reaction in the salvage of uracil in many microorganisms. Surprisingly, two genes encoding UPRTase activity were cloned from Bacillus subtilis by complementation of an Escherichia coli mutant. The genes were sequenced, and the putative...

  12. The phylogenetic position of Lygodactylus angularis and the utility of using the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

    Directory of Open Access Journals (Sweden)

    Riccardo Castiglia

    2011-06-01

    Full Text Available The African genus Lygodactylus Gray, is composed of roughly 60 species of diurnal geckos that inhabit tropical and temperate Africa, Madagascar, and South America. In this study, we assessed the phylogenetic position of L. angularis, for which molecular data were so far lacking, by means of sequence analysis of the mitochondrial 16S rDNA gene. We also compared intraspecific vs. interspecific genetic divergences using an extended data set (34 species, 153 sequences, to determine whether a fragment of this gene can be useful for species identification and to reveal the possible existence of new cryptic species in the genus. The analysis placed L. angularis in a monophyletic group together with members of “fischeri” and “picturatus” groups. Nevertheless, the independence of the “angularis” lineage is supported by the high genetic divergence. Comparison of intraspecific vs. interspecific genetic distances highlights that, assuming an equal molecular rate of evolution among the studied species for the used gene, the threshold value useful for recognising a candidate new species can be tentatively placed at 7%. We identified four species that showed an intraspecific divergence higher than, or close to, the 7% threshold: L. capensis (8.7%, L. gutturalis (9.3%, L. madagascariensis (6.5% and L. picturatus (8.1%. Moreover, two species, L. mombasicus and L. verticillatus, are paraphyletic in terms of gene genealogy. Thus, the study shows that a short fragment of the 16S rDNA gene can be an informative tool for species-level taxonomy in the genus Lygodactylus.

  13. Population Abundance of Potentially Pathogenic Organisms in Intestinal Microbiome of Jungle Crow (Corvus macrorhynchos Shown with 16S rRNA Gene-Based Microbial Community Analysis

    Directory of Open Access Journals (Sweden)

    Isamu Maeda

    2013-01-01

    Full Text Available Jungle Crows (Corvus macrorhynchos prefer human habitats because of their versatility in feeding accompanied with human food consumption. Therefore, it is important from a public health viewpoint to characterize their intestinal microbiota. However, no studies have been involved in molecular characterization of the microbiota based on huge and reliable number of data acquisition. In this study, 16S rRNA gene-based microbial community analysis coupled with the next-generation DNA sequencing techniques was applied to the taxonomic classification of intestinal microbiome for three jungle crows. Clustering of the reads into 130 operational taxonomic units showed that at least 70% of analyzed sequences for each crow were highly homologous to Eimeria sp., which belongs to the protozoan phylum Apicomplexa. The microbiotas of three crows also contained potentially pathogenic bacteria with significant percentages, such as the genera Campylobacter and Brachyspira. Thus, the profiling of a large number of 16S rRNA gene sequences in crow intestinal microbiomes revealed the high-frequency existence or vestige of potentially pathogenic microorganisms.

  14. Bacterial community structure in High-Arctic snow and freshwater as revealed by pyrosequencing of 16S rRNA genes and cultivation

    Directory of Open Access Journals (Sweden)

    Annette K. Møller

    2013-04-01

    Full Text Available The bacterial community structures in High-Arctic snow over sea ice and an ice-covered freshwater lake were examined by pyrosequencing of 16S rRNA genes and 16S rRNA gene sequencing of cultivated isolates. Both the pyrosequence and cultivation data indicated that the phylogenetic composition of the microbial assemblages was different within the snow layers and between snow and freshwater. The highest diversity was seen in snow. In the middle and top snow layers, Proteobacteria, Bacteroidetes and Cyanobacteria dominated, although Actinobacteria and Firmicutes were relatively abundant also. High numbers of chloroplasts were also observed. In the deepest snow layer, large percentages of Firmicutes and Fusobacteria were seen. In freshwater, Bacteroidetes, Actinobacteria and Verrucomicrobia were the most abundant phyla while relatively few Proteobacteria and Cyanobacteria were present. Possibly, light intensity controlled the distribution of the Cyanobacteria and algae in the snow while carbon and nitrogen fixed by these autotrophs in turn fed the heterotrophic bacteria. In the lake, a probable lower light input relative to snow resulted in low numbers of Cyanobacteria and chloroplasts and, hence, limited input of organic carbon and nitrogen to the heterotrophic bacteria. Thus, differences in the physicochemical conditions may play an important role in the processes leading to distinctive bacterial community structures in High-Arctic snow and freshwater.

  15. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant. PMID:22481887

  16. Analysis of 16S rRNA and mxaF genes reveling insights into Methylobacterium niche-specific plant association

    Directory of Open Access Journals (Sweden)

    Manuella Nóbrega Dourado

    2012-01-01

    Full Text Available The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  17. Analysis of 16S rRNA and mxaF genes revealing insights into Methylobacterium niche-specific plant association.

    Science.gov (United States)

    Dourado, Manuella Nóbrega; Andreote, Fernando Dini; Dini-Andreote, Francisco; Conti, Raphael; Araújo, Janete Magali; Araújo, Welington Luiz

    2012-01-01

    The genus Methylobacterium comprises pink-pigmented facultative methylotrophic (PPFM) bacteria, known to be an important plant-associated bacterial group. Species of this group, described as plant-nodulating, have the dual capacity of producing cytokinin and enzymes, such as pectinase and cellulase, involved in systemic resistance induction and nitrogen fixation under specific plant environmental conditions. The aim hereby was to evaluate the phylogenetic distribution of Methylobacterium spp. isolates from different host plants. Thus, a comparative analysis between sequences from structural (16S rRNA) and functional mxaF (which codifies for a subunit of the enzyme methanol dehydrogenase) ubiquitous genes, was undertaken. Notably, some Methylobacterium spp. isolates are generalists through colonizing more than one host plant, whereas others are exclusively found in certain specific plant-species. Congruency between phylogeny and specific host inhabitance was higher in the mxaF gene than in the 16S rRNA, a possible indication of function-based selection in this niche. Therefore, in a first stage, plant colonization by Methylobacterium spp. could represent generalist behavior, possibly related to microbial competition and adaptation to a plant environment. Otherwise, niche-specific colonization is apparently impelled by the host plant.

  18. Low Maternal Microbiota Sharing across Gut, Breast Milk and Vagina, as Revealed by 16S rRNA Gene and Reduced Metagenomic Sequencing

    Directory of Open Access Journals (Sweden)

    Ekaterina Avershina

    2018-05-01

    Full Text Available The maternal microbiota plays an important role in infant gut colonization. In this work we have investigated which bacterial species are shared across the breast milk, vaginal and stool microbiotas of 109 women shortly before and after giving birth using 16S rRNA gene sequencing and a novel reduced metagenomic sequencing (RMS approach in a subgroup of 16 women. All the species predicted by the 16S rRNA gene sequencing were also detected by RMS analysis and there was good correspondence between their relative abundances estimated by both approaches. Both approaches also demonstrate a low level of maternal microbiota sharing across the population and RMS analysis identified only two species common to most women and in all sample types (Bifidobacterium longum and Enterococcus faecalis. Breast milk was the only sample type that had significantly higher intra- than inter- individual similarity towards both vaginal and stool samples. We also searched our RMS dataset against an in silico generated reference database derived from bacterial isolates in the Human Microbiome Project. The use of this reference-based search enabled further separation of Bifidobacterium longum into Bifidobacterium longum ssp. longum and Bifidobacterium longum ssp. infantis. We also detected the Lactobacillus rhamnosus GG strain, which was used as a probiotic supplement by some women, demonstrating the potential of RMS approach for deeper taxonomic delineation and estimation.

  19. Identification of sulfur-cycle prokaryotes in a low-sulfate lake (Lake Pavin) using aprA and 16S rRNA gene markers.

    Science.gov (United States)

    Biderre-Petit, Corinne; Boucher, Delphine; Kuever, Jan; Alberic, Patrick; Jézéquel, Didier; Chebance, Brigitte; Borrel, Guillaume; Fonty, Gérard; Peyret, Pierre

    2011-02-01

    Geochemical researches at Lake Pavin, a low-sulfate-containing freshwater lake, suggest that the dominant biogeochemical processes are iron and sulfate reduction, and methanogenesis. Although the sulfur cycle is one of the main active element cycles in this lake, little is known about the sulfate-reducer and sulfur-oxidizing bacteria. The aim of this study was to assess the vertical distribution of these microbes and their diversities and to test the hypothesis suggesting that only few SRP populations are involved in dissimilatory sulfate reduction and that Epsilonproteobacteria are the likely key players in the oxidative phase of sulfur cycle by using a PCR aprA gene-based approach in comparison with a 16S rRNA gene-based analysis. The results support this hypothesis. Finally, this preliminary work points strongly the likelihood of novel metabolic processes upon the availability of sulfate and other electron acceptors.

  20. PCR-SSCP of the 16S rRNA gene, a simple methodology for species identification of fish eggs and larvae

    Directory of Open Access Journals (Sweden)

    Eva Garcia-Vazquez

    2006-10-01

    Full Text Available Patterns of the 16S rRNA gene obtained in 8 and 12% acrylamide gels by the SSCP (Single Strand Conformation Polymorphism method were different for various marine fish species (Macrorhamphosus scolopax, Scomber scombrus, Lepidorhombus boscii, L. whiffiagonis, Trachurus trachurus, T. mediterraneus, Molva molva, Merluccius merluccius. SSCP patterns of this gene were employed to successfully identify formaldehyde-fixed eggs of different species (Merluccius merluccius, Scomber scombrus, Macrorhamphosus scolopax and L. whiffiagonis in plankton samples. The advantages of SSCPs in comparison with current genetic methods of egg identification are based on their technical simplicity and low price. The application of the PCR-SSCP methodology is proposed for routine genetic analyses in plankton surveys.

  1. Extreme expansion of NBS-encoding genes in Rosaceae.

    Science.gov (United States)

    Jia, YanXiao; Yuan, Yang; Zhang, Yanchun; Yang, Sihai; Zhang, Xiaohui

    2015-05-03

    Nucleotide binding site leucine-rich repeats (NBS-LRR) genes encode a large class of disease resistance (R) proteins in plants. Extensive studies have been carried out to identify and investigate NBS-encoding gene families in many important plant species. However, no comprehensive research into NBS-encoding genes in the Rosaceae has been performed. In this study, five whole-genome sequenced Rosaceae species, including apple, pear, peach, mei, and strawberry, were analyzed to investigate the evolutionary pattern of NBS-encoding genes and to compare them to those of three Cucurbitaceae species, cucumber, melon, and watermelon. Considerable differences in the copy number of NBS-encoding genes were observed between Cucurbitaceae and Rosaceae species. In Rosaceae species, a large number and a high proportion of NBS-encoding genes were observed in peach (437, 1.52%), mei (475, 1.51%), strawberry (346, 1.05%) and pear (617, 1.44%), and apple contained a whopping 1303 (2.05%) NBS-encoding genes, which might be the highest number of R-genes in all of these reported diploid plant. However, no more than 100 NBS-encoding genes were identified in Cucurbitaceae. Many more species-specific gene families were classified and detected with the signature of positive selection in Rosaceae species, especially in the apple genome. Taken together, our findings indicate that NBS-encoding genes in Rosaceae, especially in apple, have undergone extreme expansion and rapid adaptive evolution. Useful information was provided for further research on the evolutionary mode of disease resistance genes in Rosaceae crops.

  2. PhytoREF: a reference database of the plastidial 16S rRNA gene of photosynthetic eukaryotes with curated taxonomy.

    Science.gov (United States)

    Decelle, Johan; Romac, Sarah; Stern, Rowena F; Bendif, El Mahdi; Zingone, Adriana; Audic, Stéphane; Guiry, Michael D; Guillou, Laure; Tessier, Désiré; Le Gall, Florence; Gourvil, Priscillia; Dos Santos, Adriana L; Probert, Ian; Vaulot, Daniel; de Vargas, Colomban; Christen, Richard

    2015-11-01

    Photosynthetic eukaryotes have a critical role as the main producers in most ecosystems of the biosphere. The ongoing environmental metabarcoding revolution opens the perspective for holistic ecosystems biological studies of these organisms, in particular the unicellular microalgae that often lack distinctive morphological characters and have complex life cycles. To interpret environmental sequences, metabarcoding necessarily relies on taxonomically curated databases containing reference sequences of the targeted gene (or barcode) from identified organisms. To date, no such reference framework exists for photosynthetic eukaryotes. In this study, we built the PhytoREF database that contains 6490 plastidial 16S rDNA reference sequences that originate from a large diversity of eukaryotes representing all known major photosynthetic lineages. We compiled 3333 amplicon sequences available from public databases and 879 sequences extracted from plastidial genomes, and generated 411 novel sequences from cultured marine microalgal strains belonging to different eukaryotic lineages. A total of 1867 environmental Sanger 16S rDNA sequences were also included in the database. Stringent quality filtering and a phylogeny-based taxonomic classification were applied for each 16S rDNA sequence. The database mainly focuses on marine microalgae, but sequences from land plants (representing half of the PhytoREF sequences) and freshwater taxa were also included to broaden the applicability of PhytoREF to different aquatic and terrestrial habitats. PhytoREF, accessible via a web interface (http://phytoref.fr), is a new resource in molecular ecology to foster the discovery, assessment and monitoring of the diversity of photosynthetic eukaryotes using high-throughput sequencing. © 2015 John Wiley & Sons Ltd.

  3. Discriminating activated sludge flocs from biofilm microbial communities in a novel pilot-scale reciprocation MBR using high-throughput 16S rRNA gene sequencing.

    Science.gov (United States)

    De Sotto, Ryan; Ho, Jaeho; Lee, Woonyoung; Bae, Sungwoo

    2018-03-29

    Membrane bioreactors (MBRs) are a well-established filtration technology that has become a popular solution for treating wastewater. One of the drawbacks of MBRs, however, is the formation of biofilm on the surface of membrane modules. The occurrence of biofilms leads to biofouling, which eventually compromises water quality and damages the membranes. To prevent this, it is vital to understand the mechanism of biofilm formation on membrane surfaces. In this pilot-scale study, a novel reciprocation membrane bioreactor was operated for a period of 8 months and fed with domestic wastewater from an aerobic tank of a local WWTP. Water quality parameters were monitored and the microbial composition of the attached biofilm and suspended aggregates was evaluated in this reciprocating MBR configuration. The abundance of nitrifiers and composition of microbial communities from biofilm and suspended solids samples were investigated using qPCR and high throughput 16S amplicon sequencing. Removal efficiencies of 29%, 16%, and 15% of chemical oxygen demand, total phosphorus and total nitrogen from the influent were observed after the MBR process with average effluent concentrations of 16 mg/L, 4.6 mg/L, and 5.8 mg/L respectively. This suggests that the energy-efficient MBR, apart from reducing the total energy consumption, was able to maintain effluent concentrations that are within regulatory standards for discharge. Molecular analysis showed the presence of amoA Bacteria and 16S Nitrospira genes with the occurrence of nitrification. Candidatus Accumulibacter, a genus with organisms that can accumulate phosphorus, was found to be present in both groups which explains why phosphorus removal was observed in the system. High-throughput 16S rRNA amplicon sequencing revealed the genus Saprospira to be the most abundant species from the total OTUs of both the membrane tank and biofilm samples. Copyright © 2018 Elsevier Ltd. All rights reserved.

  4. Amplification and sequence analysis of partial bacterial 16S ribosomal RNA gene in gallbladder bile from patients with primary biliary cirrhosis.

    Science.gov (United States)

    Hiramatsu, K; Harada, K; Tsuneyama, K; Sasaki, M; Fujita, S; Hashimoto, T; Kaneko, S; Kobayashi, K; Nakanuma, Y

    2000-07-01

    The etiopathogenesis of bile duct lesion in primary biliary cirrhosis is unknown, though the participation of bacteria and/or their components and products is suspected. In this study, we tried to detect and identify bacteria in the bile of patients with primary biliary cirrhosis by polymerase chain reaction using universal bacterial primers of the 16S ribosomal RNA gene. Gallbladder bile samples from 15 patients with primary biliary cirrhosis, 5 with primary sclerosing cholangitis, 5 with hepatitis C virus-related liver cirrhosis, 11 with cholecystolithiasis, and from 12 normal adult gallbladders were used. In addition to the culture study, partial bacterial 16S ribosomal RNA gene was amplified by polymerase chain reaction (PCR) taking advantage of universal primers that can amplify the gene of almost all bacterial species, and the amplicons were cloned and sequenced. Sequence homology with specific bacterial species was analyzed by database research. Bacterial contamination at every step of the bile sampling, DNA extraction and PCR study was avoided. Furthermore, to confirm whether bacterial DNA is detectable in liver explants, the same analysis was performed using 10 liver explants of patients with primary biliary cirrhosis. In primary biliary cirrhosis, 75% (p<0.0001) of 100 clones were identified as so-called gram-positive cocci while these cocci were positive in only 5% in cholecystolithiasis (p<0.0001). In cholecystolithiasis gram-negative rods were predominant instead. One bacterial species detected in a normal adult was not related to those detected in primary biliary cirrhosis and cholecystolithiasis patients. No bacterial DNA was detected by PCR amplification in 10 liver explants of patients with primary biliary cirrhosis. The present results raise several possible roles of gram-positive bacteria in bile in the etiopathogenesis of primary biliary cirrhosis. However, these results could also reflect an epiphenomenon due to decreased bile flow in the

  5. Molecular Characterization of the 16S rRNA Gene of Phytoplasmas Detected in Two Leafhopper Species Associated with Alfalfa Plants Infected with Witches' Broom in Oman

    Directory of Open Access Journals (Sweden)

    A.J. Khan

    2003-12-01

    Full Text Available Two leafhopper species, Austroagallia avicula and Empoasca sp., were consistently found in alfalfa fields infected with witches’ broom phytoplasma (OmanAlfWB in the Al-Batinah, Dakhliya, North and South Sharqiya, Muscat, and Al-Bureimi regions of the Sultanate of Oman. Phytoplasmas from both leafhoppers were detected by specific polymerase chain reaction (PCR amplification of the 16S rRNA gene and the spacer region in direct PCR using P1/P7 primer pairs. Comparative RFLP profiles of the amplified rRNA gene and the spacer region from leafhopper phytoplasmas and from 20 phytoplasma controls yielded patterns referable to phytoplasmas belonging to the peanut witches’ broom group (16SrII group. In particular, extensive RFLP analyses with the endonucleases HpaII, Tru9I, Tsp509I, and RsaI indicated that the phytoplasmas in A. avicula and Empoasca sp. were identical but showed some differences from OmanAlfWB; however, RFLP patterns obtained with TaqI showed the OmanAlfWB and the phytoplasmas from the two leafhoppers to be identical. Direct PCR products amplified from phytoplasma leafhopper DNA using the P1/P7 primer pair were cloned and sequenced yielding 1758 bp and 1755 bp products from A. avicula and Empoasca sp. respectively; the homology of these sequences with OmanAlfWB and papaya yellow crinkle phytoplasmas was more than 98%. A phylogenetic tree based on the 16S rRNA gene and spacer region sequences from 44 phytoplasmas revealed that the phytoplasmas from the leafhoppers clustered with OmanAlfWB, papaya yellow crinkle, and gerbera phyllody phytoplasmas, all belonging to 16SrII group, but were distinct from lime witches’ broom phytoplasma, the most commonly found phytoplasma in the Sultanate of Oman.

  6. Influence of heavy metals on rhizosphere microbial communities of Siam weed (Chromolaena odorata (L. using a 16S rRNA gene amplicon sequencing approach

    Directory of Open Access Journals (Sweden)

    Thanyaporn Ruangdech

    2017-06-01

    Full Text Available A 16S rRNA amplicon sequencing approach was used to assess the impacts of cadmium (Cd and zinc (Zn contamination on populations of rhizobacteria on Siam weed (Chromolaena odorata (L.. Bacterial communities were characterized using the Illumina MiSeq platform and the V6 hypervariable region of the 16S rRNA gene. Among the 54,026 unique operational taxonomic units (OTUs identified, 99.7% were classified as bacteria and the rest were classified as archaea. Several dominant bacterial phyla were observed in all samples—Proteobacteria, Actinobacteria, Acidobacteria, Firmicutes and Bacteroidetes. These five phyla accounted for 89.2% of all OTUs identified among all sites, and only two OTUs could not be classified to a phylum. Comparison among samples containing low and high levels of Cd contamination using nonparametric Shannon and Shannon diversity indices showed that soils with low levels of diversity had a higher level of Cd (p < 0.05. These results indicated that levels of Cd may significantly alter bacterial species selection. The Cd- and Zn-resistant bacteria from each sample were subjected to heavy-metal minimum inhibitory concentration (MIC analyses. The MIC values obtained from 1152 isolates were used to individually analyze the pattern of gene function using the BioNumerics software. The results of this analysis showed that 26.7% of the bacteria were resistant to Cd concentrations up to 320 mg/L and only 2.3% of bacteria were resistant to Zn at concentrations up to 3200 mg/L. The MIC analyses indicated that the number of resistant bacteria decreased with increasing metal concentrations and those bacteria resistant to Cd and Zn may contain more than one group of metal-resistance genes.

  7. The effects of alignment quality, distance calculation method, sequence filtering, and region on the analysis of 16S rRNA gene-based studies.

    Directory of Open Access Journals (Sweden)

    Patrick D Schloss

    Full Text Available Pyrosequencing of PCR-amplified fragments that target variable regions within the 16S rRNA gene has quickly become a powerful method for analyzing the membership and structure of microbial communities. This approach has revealed and introduced questions that were not fully appreciated by those carrying out traditional Sanger sequencing-based methods. These include the effects of alignment quality, the best method of calculating pairwise genetic distances for 16S rRNA genes, whether it is appropriate to filter variable regions, and how the choice of variable region relates to the genetic diversity observed in full-length sequences. I used a diverse collection of 13,501 high-quality full-length sequences to assess each of these questions. First, alignment quality had a significant impact on distance values and downstream analyses. Specifically, the greengenes alignment, which does a poor job of aligning variable regions, predicted higher genetic diversity, richness, and phylogenetic diversity than the SILVA and RDP-based alignments. Second, the effect of different gap treatments in determining pairwise genetic distances was strongly affected by the variation in sequence length for a region; however, the effect of different calculation methods was subtle when determining the sample's richness or phylogenetic diversity for a region. Third, applying a sequence mask to remove variable positions had a profound impact on genetic distances by muting the observed richness and phylogenetic diversity. Finally, the genetic distances calculated for each of the variable regions did a poor job of correlating with the full-length gene. Thus, while it is tempting to apply traditional cutoff levels derived for full-length sequences to these shorter sequences, it is not advisable. Analysis of beta-diversity metrics showed that each of these factors can have a significant impact on the comparison of community membership and structure. Taken together, these results

  8. Increased Pathogen Identification in Vascular Graft Infections by the Combined Use of Tissue Cultures and 16S rRNA Gene Polymerase Chain Reaction

    Directory of Open Access Journals (Sweden)

    Evelyne Ajdler-Schaeffler

    2018-06-01

    Full Text Available Background: Vascular graft infections (VGI are difficult to diagnose and treat, and despite redo surgery combined with antimicrobial treatment, outcomes are often poor. VGI diagnosis is based on a combination of clinical, radiological, laboratory and microbiological criteria. However, as many of the VGI patients are already under antimicrobial treatment at the time of redo surgery, microbiological identification is often difficult and bacterial cultures often remain negative rendering targeted treatment impossible. We aimed to assess the benefit of 16S rRNA gene polymerase chain reaction (broad-range PCR for better microbiological identification in patients with VGI.Methods: We prospectively analyzed the clinical, microbiological, and treatment data of patients enrolled in the observational Vascular Graft Cohort Study (VASGRA, University Hospital Zurich, Switzerland. The routine diagnostic work-up involved microbiological cultures of minced tissue samples, and the use of molecular techniques in parallel. Patient-related and microbiological data were assessed in descriptive analyses, and we calculated sensitivity, specificity, negative and positive predictive value for broad-range 16S rRNA gene PCR versus culture (considered as gold standard.Results: We investigated 60 patients (median age 66 years (Interquartile range [IQR] 59–75 with confirmed VGI between May 2013 and July 2017. The prevalence of antimicrobial pretreatment at the time of sampling was high [91%; median days of antibiotics 7 days (IQR 1–18]. We investigated 226 microbiological specimens. Thereof, 176 (78% were culture-negative and 50 (22% were culture-positive. There was a concordance of 70% (158/226 between conventional culture and broad-range PCR (sensitivity 58% (95% CI 43–72; specificity 74% (67–80%. Among the group of 176 culture-negative specimens, 46 specimens were broad-range PCR-positive resulting in identification of overall 69 species. Among the culture and

  9. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Directory of Open Access Journals (Sweden)

    Dawyndt Peter

    2010-01-01

    Full Text Available Abstract Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the

  10. From learning taxonomies to phylogenetic learning: integration of 16S rRNA gene data into FAME-based bacterial classification.

    Science.gov (United States)

    Slabbinck, Bram; Waegeman, Willem; Dawyndt, Peter; De Vos, Paul; De Baets, Bernard

    2010-01-30

    Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for the discrimination of bacterial

  11. From learning taxonomies to phylogenetic learning: Integration of 16S rRNA gene data into FAME-based bacterial classification

    Science.gov (United States)

    2010-01-01

    Background Machine learning techniques have shown to improve bacterial species classification based on fatty acid methyl ester (FAME) data. Nonetheless, FAME analysis has a limited resolution for discrimination of bacteria at the species level. In this paper, we approach the species classification problem from a taxonomic point of view. Such a taxonomy or tree is typically obtained by applying clustering algorithms on FAME data or on 16S rRNA gene data. The knowledge gained from the tree can then be used to evaluate FAME-based classifiers, resulting in a novel framework for bacterial species classification. Results In view of learning in a taxonomic framework, we consider two types of trees. First, a FAME tree is constructed with a supervised divisive clustering algorithm. Subsequently, based on 16S rRNA gene sequence analysis, phylogenetic trees are inferred by the NJ and UPGMA methods. In this second approach, the species classification problem is based on the combination of two different types of data. Herein, 16S rRNA gene sequence data is used for phylogenetic tree inference and the corresponding binary tree splits are learned based on FAME data. We call this learning approach 'phylogenetic learning'. Supervised Random Forest models are developed to train the classification tasks in a stratified cross-validation setting. In this way, better classification results are obtained for species that are typically hard to distinguish by a single or flat multi-class classification model. Conclusions FAME-based bacterial species classification is successfully evaluated in a taxonomic framework. Although the proposed approach does not improve the overall accuracy compared to flat multi-class classification, it has some distinct advantages. First, it has better capabilities for distinguishing species on which flat multi-class classification fails. Secondly, the hierarchical classification structure allows to easily evaluate and visualize the resolution of FAME data for

  12. Whole-Cell MALDI-TOF MS Versus 16S rRNA Gene Analysis for Identification and Dereplication of Recurrent Bacterial Isolates

    Directory of Open Access Journals (Sweden)

    Michal Strejcek

    2018-06-01

    Full Text Available Many ecological experiments are based on the extraction and downstream analyses of microorganisms from different environmental samples. Due to its high throughput, cost-effectiveness and rapid performance, Matrix Assisted Laser Desorption/Ionization Mass Spectrometry with Time-of-Flight detector (MALDI-TOF MS, which has been proposed as a promising tool for bacterial identification and classification, could be advantageously used for dereplication of recurrent bacterial isolates. In this study, we compared whole-cell MALDI-TOF MS-based analyses of 49 bacterial cultures to two well-established bacterial identification and classification methods based on nearly complete 16S rRNA gene sequence analyses: a phylotype-based approach, using a closest type strain assignment, and a sequence similarity-based approach involving a 98.65% sequence similarity threshold, which has been found to best delineate bacterial species. Culture classification using reference-based MALDI-TOF MS was comparable to that yielded by phylotype assignment up to the genus level. At the species level, agreement between 16S rRNA gene analysis and MALDI-TOF MS was found to be limited, potentially indicating that spectral reference databases need to be improved. We also evaluated the mass spectral similarity technique for species-level delineation which can be used independently of reference databases. We established optimal mass spectral similarity thresholds which group MALDI-TOF mass spectra of common environmental isolates analogically to phylotype- and sequence similarity-based approaches. When using a mass spectrum similarity approach, we recommend a mass range of 4–10 kDa for analysis, which is populated with stable mass signals and contains the majority of phylotype-determining peaks. We show that a cosine similarity (CS threshold of 0.79 differentiate mass spectra analogously to 98.65% species-level delineation sequence similarity threshold, with corresponding precision

  13. Fastidious Gram-Negatives: Identification by the Vitek 2 Neisseria-Haemophilus Card and by Partial 16S rRNA Gene Sequencing Analysis

    DEFF Research Database (Denmark)

    Wolff Sönksen, Ute; Christensen, Jens Jørgen; Nielsen, Lisbeth

    2010-01-01

    Taxonomy and identification of fastidious Gram negatives are evolving and challenging. We compared identifications achieved with the Vitek 2 Neisseria-Haemophilus (NH) card and partial 16S rRNA gene sequence (526 bp stretch) analysis with identifications obtained with extensive phenotypic...... characterization using 100 fastidious Gram negative bacteria. Seventy-five strains represented 21 of the 26 taxa included in the Vitek 2 NH database and 25 strains represented related species not included in the database. Of the 100 strains, 31 were the type strains of the species. Vitek 2 NH identification...... results: 48 of 75 database strains were correctly identified, 11 strains gave `low discrimination´, seven strains were unidentified, and nine strains were misidentified. Identification of 25 non-database strains resulted in 14 strains incorrectly identified as belonging to species in the database. Partial...

  14. 16S rRNA gene-based association study identified microbial taxa associated with pork intramuscular fat content in feces and cecum lumen.

    Science.gov (United States)

    Fang, Shaoming; Xiong, Xingwei; Su, Ying; Huang, Lusheng; Chen, Congying

    2017-07-19

    Intramuscular fat (IMF) that deposits among muscle fibers or within muscle cells is an important meat quality trait in pigs. Previous studies observed the effects of dietary nutrients and additives on improving the pork IMF. Gut microbiome plays an important role in host metabolism and energy harvest. Whether gut microbiota exerts effect on IMF remains unknown. In this study, we investigated the microbial community structure of 500 samples from porcine cecum and feces using high-throughput 16S rRNA gene sequencing. We found that phylogenetic composition and potential function capacity of microbiome varied between two types of samples. Bacteria wide association study identified 119 OTUs significantly associated with IMF in the two types of samples (FDR microbiome associated with IMF might be caused by the IMF-associated microbial taxa. This study firstly evaluated the contribution of gut microbiome to porcine IMF content. The results presented a potential capacity for improving IMF through modulating gut microbiota.

  15. Identification of Raoultella terrigena as a Rare Causative Agent of Subungual Abscess Based on 16S rRNA and Housekeeping Gene Sequencing

    Directory of Open Access Journals (Sweden)

    Yu Wang

    2016-01-01

    Full Text Available A 63-year-old-man was admitted to our hospital with severe subungual abscess. Bacteria were isolated from pus samples, and an inconsistent identification was shown by VITEK 2 system and MALDI-TOF mass spectrometry as Raoultella planticola and Raoultella terrigena, respectively. Molecular identification by 16S rRNA sequencing suggested that the isolate is R. terrigena, and this was further demonstrated by sequencing three housekeeping genes (rpoB, gyrA, and parC with phylogenetic analysis. To our knowledge, this is the first report of subungual abscess caused by R. terrigena, a rare case of human infection due to soil bacterium. Our study highlights the technique importance on this pathogen identification.

  16. Endophytic bacterial diversity in grapevine (Vitis vinifera L.) leaves described by 16S rRNA gene sequence analysis and length heterogeneity-PCR.

    Science.gov (United States)

    Bulgari, Daniela; Casati, Paola; Brusetti, Lorenzo; Quaglino, Fabio; Brasca, Milena; Daffonchio, Daniele; Bianco, Piero Attilio

    2009-08-01

    Diversity of bacterial endophytes associated with grapevine leaf tissues was analyzed by cultivation and cultivation-independent methods. In order to identify bacterial endophytes directly from metagenome, a protocol for bacteria enrichment and DNA extraction was optimized. Sequence analysis of 16S rRNA gene libraries underscored five diverse Operational Taxonomic Units (OTUs), showing best sequence matches with gamma-Proteobacteria, family Enterobacteriaceae, with a dominance of the genus Pantoea. Bacteria isolation through cultivation revealed the presence of six OTUs, showing best sequence matches with Actinobacteria, genus Curtobacterium, and with Firmicutes genera Bacillus and Enterococcus. Length Heterogeneity-PCR (LH-PCR) electrophoretic peaks from single bacterial clones were used to setup a database representing the bacterial endophytes identified in association with grapevine tissues. Analysis of healthy and phytoplasma-infected grapevine plants showed that LH-PCR could be a useful complementary tool for examining the diversity of bacterial endophytes especially for diversity survey on a large number of samples.

  17. Infective Endocarditis: Identification of Catalase-Negative, Gram-Positive Cocci from Blood Cultures by Partial 16S rRNA Gene Analysis and by Vitek 2 Examination.

    Science.gov (United States)

    Abdul-Redha, Rawaa Jalil; Kemp, Michael; Bangsborg, Jette M; Arpi, Magnus; Christensen, Jens Jørgen

    2010-01-01

    Streptococci, enterococci and Streptococcus-like bacteria are frequent etiologic agents of infective endocarditis and correct species identification can be a laboratory challenge. Viridans streptococci (VS) not seldomly cause contamination of blood cultures. Vitek 2 and partial sequencing of the 16S rRNA gene were applied in order to compare the results of both methods. STRAINS ORIGINATED FROM TWO GROUPS OF PATIENTS: 149 strains from patients with infective endocarditis and 181 strains assessed as blood culture contaminants. Of the 330 strains, based on partial 16S rRNA gene sequencing results, 251 (76%) were VS strains, 10 (3%) were pyogenic streptococcal strains, 54 (16%) were E. faecalis strains and 15 (5%) strains belonged to a group of miscellaneous catalase-negative, Gram-positive cocci. Among VS strains, respectively, 220 (87,6%) and 31 (12,3%) obtained agreeing and non-agreeing identifications with the two methods with respect to allocation to the same VS group. Non-agreeing species identification mostly occurred among strains in the contaminant group, while for endocarditis strains notably fewer disagreeing results were observed.Only 67 of 150 strains in the mitis group strains obtained identical species identifications by the two methods. Most VS strains belonging to the groups of salivarius, anginosus, and mutans obtained agreeing species identifications with the two methods, while this only was the case for 13 of the 21 bovis strains. Pyogenic strains (n=10), Enterococcus faecalis strains (n=54) and a miscellaneous group of catalase-negative, Gram-positive cocci (n=15) seemed well identified by both methods, except that disagreements in identifications in the miscellaneous group of strains occurred for 6 of 15 strains.

  18. Toolbox Approaches Using Molecular Markers and 16S rRNA Gene Amplicon Data Sets for Identification of Fecal Pollution in Surface Water.

    Science.gov (United States)

    Ahmed, W; Staley, C; Sadowsky, M J; Gyawali, P; Sidhu, J P S; Palmer, A; Beale, D J; Toze, S

    2015-10-01

    In this study, host-associated molecular markers and bacterial 16S rRNA gene community analysis using high-throughput sequencing were used to identify the sources of fecal pollution in environmental waters in Brisbane, Australia. A total of 92 fecal and composite wastewater samples were collected from different host groups (cat, cattle, dog, horse, human, and kangaroo), and 18 water samples were collected from six sites (BR1 to BR6) along the Brisbane River in Queensland, Australia. Bacterial communities in the fecal, wastewater, and river water samples were sequenced. Water samples were also tested for the presence of bird-associated (GFD), cattle-associated (CowM3), horse-associated, and human-associated (HF183) molecular markers, to provide multiple lines of evidence regarding the possible presence of fecal pollution associated with specific hosts. Among the 18 water samples tested, 83%, 33%, 17%, and 17% were real-time PCR positive for the GFD, HF183, CowM3, and horse markers, respectively. Among the potential sources of fecal pollution in water samples from the river, DNA sequencing tended to show relatively small contributions from wastewater treatment plants (up to 13% of sequence reads). Contributions from other animal sources were rarely detected and were very small (molecular markers showed variable agreement. A lack of relationships among fecal indicator bacteria, host-associated molecular markers, and 16S rRNA gene community analysis data was also observed. Nonetheless, we show that bacterial community and host-associated molecular marker analyses can be combined to identify potential sources of fecal pollution in an urban river. This study is a proof of concept, and based on the results, we recommend using bacterial community analysis (where possible) along with PCR detection or quantification of host-associated molecular markers to provide information on the sources of fecal pollution in waterways. Copyright © 2015, American Society for Microbiology

  19. Segal’s Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project

    Directory of Open Access Journals (Sweden)

    James B. Pettengill

    2017-06-01

    Full Text Available Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella, we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria, respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb. These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species, but it was surprising how often methods differ in classifying reads—even at higher taxonomic ranks (e.g., family. This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal’s Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype.

  20. Segal's Law, 16S rRNA gene sequencing, and the perils of foodborne pathogen detection within the American Gut Project.

    Science.gov (United States)

    Pettengill, James B; Rand, Hugh

    2017-01-01

    Obtaining human population level estimates of the prevalence of foodborne pathogens is critical for understanding outbreaks and ameliorating such threats to public health. Estimates are difficult to obtain due to logistic and financial constraints, but citizen science initiatives like that of the American Gut Project (AGP) represent a potential source of information concerning enteric pathogens. With an emphasis on genera Listeria and Salmonella , we sought to document the prevalence of those two taxa within the AGP samples. The results provided by AGP suggest a surprising 14% and 2% of samples contained Salmonella and Listeria , respectively. However, a reanalysis of those AGP sequences described here indicated that results depend greatly on the algorithm for assigning taxonomy and differences persisted across both a range of parameter settings and different reference databases (i.e., Greengenes and HITdb). These results are perhaps to be expected given that AGP sequenced the V4 region of 16S rRNA gene, which may not provide good resolution at the lower taxonomic levels (e.g., species), but it was surprising how often methods differ in classifying reads-even at higher taxonomic ranks (e.g., family). This highlights the misleading conclusions that can be reached when relying on a single method that is not a gold standard; this is the essence of Segal's Law: an individual with one watch knows what time it is but an individual with two is never sure. Our results point to the need for an appropriate molecular marker for the taxonomic resolution of interest, and calls for the development of more conservative classification methods that are fit for purpose. Thus, with 16S rRNA gene datasets, one must be cautious regarding the detection of taxonomic groups of public health interest (e.g., culture independent identification of foodborne pathogens or taxa associated with a given phenotype).

  1. Analysis of bacterial flora associated with peri-implantitis using obligate anaerobic culture technique and 16S rDNA gene sequence.

    Science.gov (United States)

    Tamura, Naoki; Ochi, Morio; Miyakawa, Hiroshi; Nakazawa, Futoshi

    2013-01-01

    To analyze and characterize the predominant bacterial flora associated with peri-implantitis by using culture techniques under obligate anaerobic conditions and 16S rDNA gene sequences. Subgingival bacterial specimens were taken from 30 patients: control (n = 15), consisting of patients with only healthy implants; and test (n = 15), consisting of patients with peri-implantitis. In both groups, subgingival bacterial specimens were taken from the deepest sites. An anaerobic glove box system was used to cultivate bacterial strains. The bacterial strains were identified by 16S rDNA genebased polymerase chain reaction and comparison of the gene sequences. Peri-implantitis sites had approximately 10-fold higher mean colony forming units (per milliliter) than healthy implant sites. A total of 69 different bacterial species were identified in the peri-implantitis sites and 53 in the healthy implant sites. The predominant bacterial species in the peri-implantitis sites were Eubacterium nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, Parascardovia denticolens, Prevotella intermedia, Fusobacterium nucleatum, Porphyromonas gingivalis, Centipeda periodontii, and Parvimonas micra. The predominant bacteria in healthy implant sites apart from Streptococcus were Pseudoramibacter alactolyticus, Veillonella species, Actinomyces israelii, Actinomyces species, Propionibacterium acnes, and Parvimonas micra. These results suggest that the environment in the depths of the sulcus showing peri-implantitis is well suited for growth of obligate anaerobic bacteria. The present study demonstrated that the sulcus around oral implants with peri-implantitis harbors high levels of asaccharolytic anaerobic gram-positive rods (AAGPRs) such as E. nodatum, E. brachy, E. saphenum, Filifactor alocis, Slackia exigua, and gram-negative anaerobic rods, suggesting that conventional periodontopathic bacteria are not the only periodontal pathogens active in peri-implantitis, and that AAGPRs

  2. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  3. Cloning, expression and characterisation of a novel gene encoding ...

    African Journals Online (AJOL)

    微软用户

    2012-01-12

    Jan 12, 2012 ... ... characterisation of a novel gene encoding a chemosensory protein from Bemisia ... The genomic DNA sequence comparisons revealed a 1490 bp intron ... have several conserved sequence motifs, including the. N-terminal ...

  4. Abundance and activity of 16S rRNA, amoA and nifH bacterial genes during assisted phytostabilization of mine tailings

    Science.gov (United States)

    Nelson, Karis N.; Neilson, Julia W.; Root, Robert A.; Chorover, Jon; Maier, Raina M.

    2014-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings. PMID:25495940

  5. Abundance and Activity of 16S rRNA, AmoA and NifH Bacterial Genes During Assisted Phytostabilization of Mine Tailings.

    Science.gov (United States)

    Nelson, Karis N; Neilson, Julia W; Root, Robert A; Chorover, Jon; Maier, Raina M

    2015-01-01

    Mine tailings in semiarid regions are highly susceptible to erosion and are sources of dust pollution and potential avenues of human exposure to toxic metals. One constraint to revegetation of tailings by phytostabilization is the absence of microbial communities critical for biogeochemical cycling of plant nutrients. The objective of this study was to evaluate specific genes as in situ indicators of biological soil response during phytoremediation. The abundance and activity of 16S rRNA, nifH, and amoA were monitored during a nine month phytostabilization study using buffalo grass and quailbush grown in compost-amended, metalliferous tailings. The compost amendment provided a greater than 5-log increase in bacterial abundance, and survival of this compost-inoculum was more stable in planted treatments. Despite increased abundance, the activity of the introduced community was low, and significant increases were not detected until six and nine months in quailbush, and unplanted compost and buffalo grass treatments, respectively. In addition, increased abundances of nitrogen-fixation (nifH) and ammonia-oxidizing (amoA) genes were observed in rhizospheres of buffalo grass and quailbush, respectively. Thus, plant establishment facilitated the short term stabilization of introduced bacterial biomass and supported the growth of two key nitrogen-cycling populations in compost-amended tailings.

  6. 16S rRNA and Omp31 Gene Based Molecular Characterization of Field Strains of B. melitensis from Aborted Foetus of Goats in India

    Science.gov (United States)

    Singh, Ajay; Gupta, Vivek Kumar; Kumar, Amit; Singh, Vikas Kumar; Nayakwadi, Shivasharanappa

    2013-01-01

    Brucellosis is a reemerging infectious zoonotic disease of worldwide importance. In human, it is mainly caused by Brucella melitensis, a natural pathogen for goats. In India, a large number of goats are reared in semi-intensive to intensive system within the close vicinity of human being. At present, there is no vaccination and control strategy for caprine brucellosis in the country. Thus, to formulate an effective control strategy, the status of etiological agent is essential. To cope up with these, the present study was conducted to isolate and identify the prevalent Brucella species in caprine brucellosis in India. The 30 samples (fetal membrane, fetal stomach content and vaginal swabs) collected throughout India from the aborted fetus of goats revealed the isolation of 05 isolates all belonging to Brucella melitensis biovars 3. All the isolates produced amplification products of 1412 and 720 bp in polymerase chain reaction with genus and species specific 16S rRNA and omp31 gene based primers, respectively. Moreover, the amplification of omp31 gene in all the isolates confirmed the presence of immuno dominant outer membrane protein (31 kDa omp) in all the field isolates of B. melitensis in aborted foetus of goats in India. These findings can support the development of omp31 based specific serodiagnostic test as well as vaccine for the control of caprine brucellosis in India. PMID:24453799

  7. Bacterial diversity analysis of Huanglongbing pathogen-infected citrus, using PhyloChip and 16S rRNA gene clone library sequencing

    Energy Technology Data Exchange (ETDEWEB)

    Shankar Sagaram, U.; DeAngelis, K.M.; Trivedi, P.; Andersen, G.L.; Lu, S.-E.; Wang, N.

    2009-03-01

    between the relative abundance, species richness and phylogenetic diversity of the microbial communities associated with the leaf midribs of HLB symptomatic and asymptomatic citrus trees were investigated using high-density 16S rDNA microarray PhyloChip and 16S rRNA gene clone library methods.

  8. Evaluation of the use of amplified 16S rRNA gene-restriction fragment length polymorphism analysis to detect enterobacter cloacae and bacillus licheniformis for microbial enhanced oil recovery field pilot

    Energy Technology Data Exchange (ETDEWEB)

    Fujiwara, Kazuhiro; Tanaka, Shinji; Otsuka, Makiko; Ichimura, Naoya [Lansai Research Institute, Kyoto (Japan); Yonebayashi, Hideharu [Japan National Oil Corp., Chiba (Japan); Hong, Chengxie; Enomoto, Heiji [Tohoku University, Miyagi (Japan)

    1999-09-01

    Evaluation of effectiveness of restriction fragment length polymorphism (RFLP) analysis of the 16S rRNA gene of microorganisms injected into an oil reservoir, for monitoring their levels over time, was conducted. Two microorganisms, enterobacter cloacae TRC-322 and Bacillus licheniformis TRC-18-2-a, were focused in this paper among the microorganisms selected for injection, and gene fragments of the 16S rRNA gene of these microorganisms were amplified by polymerase chain reaction (PCP), using one set of universal primers. Samples of the reservoir brine and reservoir rock were obtained; the microorganisms inhabiting in the reservoir were isolated from these samples, and the 16S rRNA gene of these microorganisms was amplified, condition remaining the same. RFLP analysis was performed on the 16S rRNA gene of each of these microorganisms, using restriction endonucleases HhaI, MspI, AluI and TaqI as necessary. Comparison of the resultant rRNA gene fragments, demonstrated that closely-related species displaying RFLP profile similar to that of E. cloacae TRC-322 or B. licheniformis TRC-18-2-a were not among the microorganisms isolated from the reservoir. PCR-RFLP analysis of the 16S rRNA gene, using the protocol; presented in this paper, is effective to detect the presence appropriate injecting microorganisms. This method was also effective for studying microorganisms isolated from the reservoir, which have the ability to grow on a molasses. (author)

  9. De novo clustering methods outperform reference-based methods for assigning 16S rRNA gene sequences to operational taxonomic units

    Directory of Open Access Journals (Sweden)

    Sarah L. Westcott

    2015-12-01

    Full Text Available Background. 16S rRNA gene sequences are routinely assigned to operational taxonomic units (OTUs that are then used to analyze complex microbial communities. A number of methods have been employed to carry out the assignment of 16S rRNA gene sequences to OTUs leading to confusion over which method is optimal. A recent study suggested that a clustering method should be selected based on its ability to generate stable OTU assignments that do not change as additional sequences are added to the dataset. In contrast, we contend that the quality of the OTU assignments, the ability of the method to properly represent the distances between the sequences, is more important.Methods. Our analysis implemented six de novo clustering algorithms including the single linkage, complete linkage, average linkage, abundance-based greedy clustering, distance-based greedy clustering, and Swarm and the open and closed-reference methods. Using two previously published datasets we used the Matthew’s Correlation Coefficient (MCC to assess the stability and quality of OTU assignments.Results. The stability of OTU assignments did not reflect the quality of the assignments. Depending on the dataset being analyzed, the average linkage and the distance and abundance-based greedy clustering methods generated OTUs that were more likely to represent the actual distances between sequences than the open and closed-reference methods. We also demonstrated that for the greedy algorithms VSEARCH produced assignments that were comparable to those produced by USEARCH making VSEARCH a viable free and open source alternative to USEARCH. Further interrogation of the reference-based methods indicated that when USEARCH or VSEARCH were used to identify the closest reference, the OTU assignments were sensitive to the order of the reference sequences because the reference sequences can be identical over the region being considered. More troubling was the observation that while both USEARCH and

  10. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    RNAi-based silencing of genes encoding the vacuolar- ATPase subunits a and c in pink bollworm (Pectinophora gossypiella). Ahmed M. A. Mohammed. Abstract. RNA interference is a post- transcriptional gene regulation mechanism that is predominantly found in eukaryotic organisms. RNAi demonstrated a successful ...

  11. An assessment of the hypervariable domains of the 16S rRNA genes for their value in determining microbial community diversity: the paradox of traditional ecological indices.

    Science.gov (United States)

    Mills, DeEtta K; Entry, James A; Voss, Joshua D; Gillevet, Patrick M; Mathee, Kalai

    2006-09-01

    Amplicon length heterogeneity PCR (LH-PCR) was investigated for its ability to distinguish between microbial community patterns from the same soil type under different land management practices. Natural sagebrush and irrigated mouldboard-ploughed soils from Idaho were queried as to which hypervariable domains, or combinations of 16S rRNA gene domains, were the best molecular markers. Using standard ecological indices to measure richness, diversity and evenness, the combination of three domains, V1, V3 and V1+V2, or the combined V1 and V3 domains were the markers that could best distinguish the undisturbed natural sagebrush communities from the mouldboard-ploughed microbial communities. Bray-Curtis similarity and multidimensional scaling were found to be better metrics to ordinate and cluster the LH-PCR community profiling data. The use/misuse of traditional ecological indices such as diversity and evenness to study microbial community profiles will remain a major point to consider when performing metagenomic studies.

  12. Bacterial community composition in the gut content and ambient sediment of sea cucumber Apostichopus japonicus revealed by 16S rRNA gene pyrosequencing.

    Directory of Open Access Journals (Sweden)

    Fei Gao

    Full Text Available The composition of the bacterial communities in the contents of the foregut and hindgut of the sea cucumber Apostichopus japonicus and in the ambient surface sediment was surveyed by 16S rRNA gene 454-pyrosequencing. A total of 188,623 optimized reads and 15,527 operational taxonomic units (OTUs were obtained from the ten gut contents samples and four surface sediment samples. The sequences in the sediments, foregut contents, and hindgut contents were assigned to 38.0±4.7, 31.2±6.2 and 27.8±6.5 phyla, respectively. The bacterial richness and Shannon diversity index were both higher in the ambient sediments than in the gut contents. Proteobacteria was the predominant phylum in both the gut contents and sediment samples. The predominant classes in the foregut, hindgut, and ambient sediment were Holophagae and Gammaproteobacteria, Deltaproteobacteria and Gammaproteobacteria, and Gammaproteobacteria and Deltaproteobacteria, respectively. The potential probiotics, including sequences related to Bacillus, lactic acid bacteria (Lactobacillus, Lactococcus, and Streptococcus and Pseudomonas were detected in the gut of A. japonicus. Principle component analysis and heatmap figure showed that the foregut, hindgut, and ambient sediment respectively harbored different characteristic bacterial communities. Selective feeding of A. japonicus may be the primary source of the different bacterial communities between the foregut contents and ambient sediments.

  13. Influence of menstruation on the microbiota of healthy women's labia minora as analyzed using a 16S rRNA gene-based clone library method.

    Science.gov (United States)

    Shiraishi, Tsukasa; Fukuda, Kazumasa; Morotomi, Nobuo; Imamura, Yuri; Mishima, Junko; Imai, Shigeo; Miyazawa, Kiyoshi; Taniguchi, Hatsumi

    2011-01-01

    The aim of this study was to determine the influence of menstruation on the bacterial population of healthy Japanese women's vulvas, especially the labia minora. Labia minora swabs were obtained from 10 premenopausal, nonpregnant Japanese women at premenstruation and on day 2 of menstruation. Vaginal swabs were also obtained from 3 out of the 10 women. No significant difference was found in the average bacterial cell count between the menstruation and premenstruation samples. Molecular analysis using a 16S rRNA gene-based clone library method detected 22 genera from the labia minora swabs (total 20), with the genus Lactobacillus being predominant at both premenstruation and during menstruation in 7 out of the 10 women. Of the other 3 women, 2 showed various kinds of bacterial species, including oral and fecal bacteria, with Atopobium vaginae and Gardnerella vaginalis predominating in the remaining woman's vulva in both conditions. In total, 6 out of 10 cases (60%) showed significantly different microbiota of the labia minora between the two conditions. These results imply that menstruation may promote a distortion of the bacterial flora around the vulva, although it causes no significant increase of the bacterial count.

  14. Exploiting 16S rRNA gene for the detection and quantification of fish as a potential allergenic food: A comparison of two real-time PCR approaches.

    Science.gov (United States)

    Fernandes, Telmo J R; Costa, Joana; Oliveira, M Beatriz P P; Mafra, Isabel

    2018-04-15

    Fish is one of the most common allergenic foods that should be accurately labelled to protect the health of allergic consumers. In this work, two real-time PCR systems based on the EvaGreen dye and a TaqMan probe are proposed and compared. New primers were designed to target the 16S rRNA gene, as a universal maker for fish detection, with fully demonstrated specificity for a wide range of fish species. Both systems showed similar absolute sensitivities, down to 0.01 pg of fish DNA, and adequate real-time PCR performance parameters. The probe system showed higher relative sensitivity and dynamic range (0.0001-50%) than the EvaGreen (0.05-50%). They were both precise, but trueness was compromised at the highest tested level with the EvaGreen assay. Therefore, both systems were successful, although the probe one exhibited the best performance. Its application to verify labelling compliance of foodstuffs suggested a high level of mislabelling and/or fraudulent practices. Copyright © 2017 Elsevier Ltd. All rights reserved.

  15. IDENTIFICATION OF A LOCAL PROBIOTIC BACTERIUM USING 16S rRNA GENE SEQUENCE THAT WAS USED FOR FIELD TRIAL TO ENHANCED WHITELEG SHRIMP (Litopenaeus vannamei SURVIVAL

    Directory of Open Access Journals (Sweden)

    Tb. Haeru Rahayu

    2015-12-01

    Full Text Available The use of local probiotics in the culture of aquatic organisms is increasing with the demand for more environmental-friendly aquaculture practices. The local bacterium isolate considered as a probiotic was added into the water of whiteleg shrimp (Litopenaeus vannamei culture in a field trial. Four rectangular plastic ponds (ca. 20 m x 30 m per pond were used for 100 days experimentation for six consecutive crops in two years experiment. Survival, harvest size, feed conversion ratio (FCR and Vibrio bacterial count was compared with those of shrimp receiving and none of local isolate. Identification based on 16S rRNA gene sequence shown those isolate was Bacillus pumilus strain DURCK14 with 99% homology. Water shrimp pond added a local isolate had significantly higher survival at about 10.0% to 11.7% than shrimp without added the isolate (p<0.05, and better FCR, but no significant different in shrimp harvest size. Vibrio bacterial was undetected by total plate count. Moreover, it shown better projected yields on an annual basis (three crops per year.

  16. Anterior foregut microbiota of the glassy-winged sharpshooter explored using deep 16S rRNA gene sequencing from individual insects.

    Directory of Open Access Journals (Sweden)

    Elizabeth E Rogers

    Full Text Available The glassy-winged sharpshooter (GWSS is an invasive insect species that transmits Xylella fastidiosa, the bacterium causing Pierce's disease of grapevine and other leaf scorch diseases. X. fastidiosa has been shown to colonize the anterior foregut (cibarium and precibarium of sharpshooters, where it may interact with other naturally-occurring bacterial species. To evaluate such interactions, a comprehensive list of bacterial species associated with the sharpshooter cibarium and precibarium is needed. Here, a survey of microbiota associated with the GWSS anterior foregut was conducted. Ninety-six individual GWSS, 24 from each of 4 locations (Bakersfield, CA; Ojai, CA; Quincy, FL; and a laboratory colony, were characterized for bacteria in dissected sharpshooter cibaria and precibaria by amplification and sequencing of a portion of the 16S rRNA gene using Illumina MiSeq technology. An average of approximately 150,000 sequence reads were obtained per insect. The most common genus detected was Wolbachia; sequencing of the Wolbachia ftsZ gene placed this strain in supergroup B, one of two Wolbachia supergroups most commonly associated with arthropods. X. fastidiosa was detected in all 96 individuals examined. By multilocus sequence typing, both X. fastidiosa subspecies fastidiosa and subspecies sandyi were present in GWSS from California and the colony; only subspecies fastidiosa was detected in GWSS from Florida. In addition to Wolbachia and X. fastidiosa, 23 other bacterial genera were detected at or above an average incidence of 0.1%; these included plant-associated microbes (Methylobacterium, Sphingomonas, Agrobacterium, and Ralstonia and soil- or water-associated microbes (Anoxybacillus, Novosphingobium, Caulobacter, and Luteimonas. Sequences belonging to species of the family Enterobacteriaceae also were detected but it was not possible to assign these to individual genera. Many of these species likely interact with X. fastidiosa in the

  17. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    OpenAIRE

    Har, Jia Y.; Helbig, Tim; Lim, Ju H.; Fernando, Samodha C.; Reitzel, Adam M.; Penn, Kevin; Thompson, Janelle R.

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacter...

  18. Bioinformatics analysis and detection of gelatinase encoded gene in Lysinibacillussphaericus

    Science.gov (United States)

    Repin, Rul Aisyah Mat; Mutalib, Sahilah Abdul; Shahimi, Safiyyah; Khalid, Rozida Mohd.; Ayob, Mohd. Khan; Bakar, Mohd. Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, we performed bioinformatics analysis toward genome sequence of Lysinibacillussphaericus (L. sphaericus) to determine gene encoded for gelatinase. L. sphaericus was isolated from soil and gelatinase species-specific bacterium to porcine and bovine gelatin. This bacterium offers the possibility of enzymes production which is specific to both species of meat, respectively. The main focus of this research is to identify the gelatinase encoded gene within the bacteria of L. Sphaericus using bioinformatics analysis of partially sequence genome. From the research study, three candidate gene were identified which was, gelatinase candidate gene 1 (P1), NODE_71_length_93919_cov_158.931839_21 which containing 1563 base pair (bp) in size with 520 amino acids sequence; Secondly, gelatinase candidate gene 2 (P2), NODE_23_length_52851_cov_190.061386_17 which containing 1776 bp in size with 591 amino acids sequence; and Thirdly, gelatinase candidate gene 3 (P3), NODE_106_length_32943_cov_169.147919_8 containing 1701 bp in size with 566 amino acids sequence. Three pairs of oligonucleotide primers were designed and namely as, F1, R1, F2, R2, F3 and R3 were targeted short sequences of cDNA by PCR. The amplicons were reliably results in 1563 bp in size for candidate gene P1 and 1701 bp in size for candidate gene P3. Therefore, the results of bioinformatics analysis of L. Sphaericus resulting in gene encoded gelatinase were identified.

  19. Profiling the Succession of Bacterial Communities throughout the Life Stages of a Higher Termite Nasutitermes arborum (Termitidae, Nasutitermitinae) Using 16S rRNA Gene Pyrosequencing

    Science.gov (United States)

    Diouf, Michel; Roy, Virginie; Mora, Philippe; Frechault, Sophie; Lefebvre, Thomas; Hervé, Vincent; Rouland-Lefèvre, Corinne; Miambi, Edouard

    2015-01-01

    Previous surveys of the gut microbiota of termites have been limited to the worker caste. Termite gut microbiota has been well documented over the last decades and consists mainly of lineages specific to the gut microbiome which are maintained across generations. Despite this intimate relationship, little is known of how symbionts are transmitted to each generation of the host, especially in higher termites where proctodeal feeding has never been reported. The bacterial succession across life stages of the wood-feeding higher termite Nasutitermes arborum was characterized by 16S rRNA gene deep sequencing. The microbial community in the eggs, mainly affiliated to Proteobacteria and Actinobacteria, was markedly different from the communities in the following developmental stages. In the first instar and last instar larvae and worker caste termites, Proteobacteria and Actinobacteria were less abundant than Firmicutes, Bacteroidetes, Spirochaetes, Fibrobacteres and the candidate phylum TG3 from the last instar larvae. Most of the representatives of these phyla (except Firmicutes) were identified as termite-gut specific lineages, although their relative abundances differed. The most salient difference between last instar larvae and worker caste termites was the very high proportion of Spirochaetes, most of which were affiliated to the Treponema Ic, Ia and If subclusters, in workers. The results suggest that termite symbionts are not transmitted from mother to offspring but become established by a gradual process allowing the offspring to have access to the bulk of the microbiota prior to the emergence of workers, and, therefore, presumably through social exchanges with nursing workers. PMID:26444989

  20. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid.

    Science.gov (United States)

    Naito, Keisuke; Yamasaki, Kei; Yatera, Kazuhiro; Akata, Kentaro; Noguchi, Shingo; Kawanami, Toshinori; Fukuda, Kazumasa; Kido, Takashi; Ishimoto, Hiroshi; Mukae, Hiroshi

    2017-01-01

    Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF) of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83) and healthcare-associated pneumonia (94) between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT) images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177), mild in 36.2% (64/177), moderate in 10.2% (18/177), and severe in 6.2% (11/177). Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The detection rates of Haemophilus influenzae and Pseudomonas aeruginosa were unrelated to the severity of pulmonary emphysematous changes, and Streptococcus species - except for the S. anginosus group and S. pneumoniae - were detected more frequently using the molecular method we used for the BALF of patients with pneumonia than using culture methods. Our findings suggest that M. catarrhalis is more frequently detected in pneumonia patients with moderate or

  1. Sponge-associated actinobacterial diversity: validation of the methods of actinobacterial DNA extraction and optimization of 16S rRNA gene amplification.

    Science.gov (United States)

    Yang, Qi; Franco, Christopher M M; Zhang, Wei

    2015-10-01

    Experiments were designed to validate the two common DNA extraction protocols (CTAB-based method and DNeasy Blood & Tissue Kit) used to effectively recover actinobacterial DNA from sponge samples in order to study the sponge-associated actinobacterial diversity. This was done by artificially spiking sponge samples with actinobacteria (spores, mycelia and a combination of the two). Our results demonstrated that both DNA extraction methods were effective in obtaining DNA from the sponge samples as well as the sponge samples spiked with different amounts of actinobacteria. However, it was noted that in the presence of the sponge, the bacterial 16S rRNA gene could not be amplified unless the combined DNA template was diluted. To test the hypothesis that the extracted sponge DNA contained inhibitors, dilutions of the DNA extracts were tested for six sponge species representing five orders. The results suggested that the inhibitors were co-extracted with the sponge DNA, and a high dilution of this DNA was required for the successful PCR amplification for most of the samples. The optimized PCR conditions, including primer selection, PCR reaction system and program optimization, further improved the PCR performance. However, no single PCR condition was found to be suitable for the diverse sponge samples using various primer sets. These results highlight for the first time that the DNA extraction methods used are effective in obtaining actinobacterial DNA and that the presence of inhibitors in the sponge DNA requires high dilution coupled with fine tuning of the PCR conditions to achieve success in the study of sponge-associated actinobacterial diversity.

  2. Carbon transformations in deep granitic groundwater by attached bacterial populations characterized with 16S-rRNA gene sequencing technique and scanning electron microscopy

    International Nuclear Information System (INIS)

    Ekendahl, S.; Arlinger, J.; Staahl, F.; Pedersen, K.

    1993-10-01

    This report presents molecular characterization of attached bacterial populations growing in slowly flowing (1-3 mm s -1 ) artesian groundwater from deep crystalline bed-rock of the Stripa research mine, south central Sweden. The assimilation rate of CO 2 and lactate, and the lactate respiration rates were also determined. The bacteria studied grew in anoxic, high pH, 9-10, and low redox artesian groundwater flowing up through tubings from two levels of a borehole designated V2, 812-820 m and 970-1240 m below ground. The major groups of bacteria were found. Signature bases placed them in the appropriate systematic groups. All belonged to the Proteobacterial groups beta and gamma. One group was found only at the 812-820 m level, where it constituted 63% of the sequenced clones, whereas the second group existed almost exclusively and constituted 85% of the sequenced clones at the 970-1240 m level. The third group was equally distributed between the levels. A few other bacteria were also found. None of the 16S-rRNA genes from the dominating bacteria resembled any of the other by more than 90% similarity, and none of them resembled anything in the database by more than 96%. Temperature did not seem to have any effect on species composition at the deeper level. SEM images showed rods appearing in microcolonies. The difference in population diversity between the two levels studied presumably reflect the different environments. The earlier proposed presence of sulphate reducing bacteria could no be confirmed

  3. Microbiological changes, shelf life and identification of initial and spoilage microbiota of sea bream fillets stored under various conditions using 16S rRNA gene analysis.

    Science.gov (United States)

    Parlapani, Foteini F; Kormas, Konstantinos Ar; Boziaris, Ioannis S

    2015-09-01

    Sea bream fillets are one of the most important value-added products of the seafood market. Fresh seafood spoils mainly owing to bacterial action. In this study an exploration of initial and spoilage microbiota of sea bream fillets stored under air and commercial modified atmosphere packaging (MAP) at 0 and 5 °C was conducted by 16S rRNA gene sequence analysis of isolates grown on plates. Sensory evaluation and enumeration of total viable counts and spoilage microorganisms were also conducted to determine shelf life and bacterial growth respectively. Different temperatures and atmospheres affected growth and synthesis of spoilage microbiota as well as shelf life. Shelf life under air at 0 and 5 °C was 14 and 5 days respectively, while under MAP it was 20 and 8 days respectively. Initial microbiota were dominated by Pseudomonas fluorescens, Psychrobacter and Macrococcus caseolyticus. Different temperatures and atmospheres affected the synthesis of spoilage microbiota. At the end of shelf life, different phylotypes of Pseudomonas closely related to Pseudomonas fragi were found to dominate in most cases, while Pseudomonas veronii dominated in fillets under MAP at 0 °C. Furthermore, in fillets under MAP at 5 °C, new dominant species such as Carnobacterium maltaromaticum, Carnobacterium divergens and Vagococcus fluvialis were revealed. Different temperature and atmospheric conditions affected bacterial growth, shelf life and the synthesis of spoilage microbiota. Molecular identification revealed species and strains of microorganisms that have not been reported before for sea bream fillets stored under various conditions, thus providing valuable information regarding microbiological spoilage. © 2014 Society of Chemical Industry.

  4. The impact of different DNA extraction kits and laboratories upon the assessment of human gut microbiota composition by 16S rRNA gene sequencing.

    Science.gov (United States)

    Kennedy, Nicholas A; Walker, Alan W; Berry, Susan H; Duncan, Sylvia H; Farquarson, Freda M; Louis, Petra; Thomson, John M; Satsangi, Jack; Flint, Harry J; Parkhill, Julian; Lees, Charlie W; Hold, Georgina L

    2014-01-01

    Determining bacterial community structure in fecal samples through DNA sequencing is an important facet of intestinal health research. The impact of different commercially available DNA extraction kits upon bacterial community structures has received relatively little attention. The aim of this study was to analyze bacterial communities in volunteer and inflammatory bowel disease (IBD) patient fecal samples extracted using widely used DNA extraction kits in established gastrointestinal research laboratories. Fecal samples from two healthy volunteers (H3 and H4) and two relapsing IBD patients (I1 and I2) were investigated. DNA extraction was undertaken using MoBio Powersoil and MP Biomedicals FastDNA SPIN Kit for Soil DNA extraction kits. PCR amplification for pyrosequencing of bacterial 16S rRNA genes was performed in both laboratories on all samples. Hierarchical clustering of sequencing data was done using the Yue and Clayton similarity coefficient. DNA extracted using the FastDNA kit and the MoBio kit gave median DNA concentrations of 475 (interquartile range 228-561) and 22 (IQR 9-36) ng/µL respectively (p<0.0001). Hierarchical clustering of sequence data by Yue and Clayton coefficient revealed four clusters. Samples from individuals H3 and I2 clustered by patient; however, samples from patient I1 extracted with the MoBio kit clustered with samples from patient H4 rather than the other I1 samples. Linear modelling on relative abundance of common bacterial families revealed significant differences between kits; samples extracted with MoBio Powersoil showed significantly increased Bacteroidaceae, Ruminococcaceae and Porphyromonadaceae, and lower Enterobacteriaceae, Lachnospiraceae, Clostridiaceae, and Erysipelotrichaceae (p<0.05). This study demonstrates significant differences in DNA yield and bacterial DNA composition when comparing DNA extracted from the same fecal sample with different extraction kits. This highlights the importance of ensuring that samples

  5. Molecular analysis of 16S rRNA genes identifies potentially periodontal pathogenic bacteria and archaea in the plaque of partially erupted third molars.

    Science.gov (United States)

    Mansfield, J M; Campbell, J H; Bhandari, A R; Jesionowski, A M; Vickerman, M M

    2012-07-01

    Small subunit rRNA sequencing and phylogenetic analysis were used to identify cultivable and uncultivable microorganisms present in the dental plaque of symptomatic and asymptomatic partially erupted third molars to determine the prevalence of putative periodontal pathogens in pericoronal sites. Template DNA prepared from subgingival plaque collected from partially erupted symptomatic and asymptomatic mandibular third molars and healthy incisors was used in polymerase chain reaction with broad-range oligonucleotide primers to amplify 16S rRNA bacterial and archaeal genes. Amplicons were cloned, sequenced, and compared with known nucleotide sequences in online databases to identify the microorganisms present. Two thousand three hundred two clones from the plaque of 12 patients carried bacterial sequences from 63 genera belonging to 11 phyla, including members of the uncultivable TM7, SR1, and Chloroflexi, and difficult-to-cultivate Synergistetes and Spirochaetes. Dialister invisus, Filifactor alocis, Fusobacterium nucleatum, Porphyromonas endodontalis, Prevotella denticola, Tannerella forsythia, and Treponema denticola, which have been associated with periodontal disease, were found in significantly greater abundance in pericoronal compared with incisor sites. Dialister invisus and F nucleatum were found in greater abundance in sites exhibiting clinical symptoms. The archaeal species, Methanobrevibacter oralis, which has been associated with severe periodontitis, was found in 3 symptomatic patients. These findings have provided new insights into the complex microbiota of pericoronitis. Several bacterial and archaeal species implicated in periodontal disease were recovered in greater incidence and abundance from the plaque of partially erupted third molars compared with incisors, supporting the hypothesis that the pericoronal region may provide a favored niche for periodontal pathogens in otherwise healthy mouths. Copyright © 2012 American Association of Oral and

  6. Relationships between 16S-23S rRNA gene internal transcribed spacer DNA and genomic DNA similarities in the taxonomy of phototrophic bacteria

    International Nuclear Information System (INIS)

    Okamura, K; Hisada, T; Takata, K; Hiraishi, A

    2013-01-01

    Rapid and accurate identification of microbial species is essential task in microbiology and biotechnology. In prokaryotic systematics, genomic DNA-DNA hybridization is the ultimate tool to determine genetic relationships among bacterial strains at the species level. However, a practical problem in this assay is that the experimental procedure is laborious and time-consuming. In recent years, information on the 16S-23S rRNA gene internal transcribed spacer (ITS) region has been used to classify bacterial strains at the species and intraspecies levels. It is unclear how much information on the ITS region can reflect the genome that contain it. In this study, therefore, we evaluate the quantitative relationship between ITS DNA and entire genomic DNA similarities. For this, we determined ITS sequences of several species of anoxygenic phototrophic bacteria belonging to the order Rhizobiales, and compared with DNA-DNA relatedness among these species. There was a high correlation between the two genetic markers. Based on the regression analysis of this relationship, 70% DNA-DNA relatedness corresponded to 92% ITS sequence similarity. This suggests the usefulness of the ITS sequence similarity as a criterion for determining the genospecies of the phototrophic bacteria. To avoid the effects of polymorphism bias of ITS on similarities, PCR products from all loci of ITS were used directly as genetic probes for comparison. The results of ITS DNA-DNA hybridization coincided well with those of genomic DNA-DNA relatedness. These collective data indicate that the whole ITS DNA-DNA similarity can be used as an alternative to genomic DNA-DNA similarity.

  7. Comparison of Fecal Microbiota of Mongolian and Thoroughbred Horses by High-throughput Sequencing of the V4 Region of the 16S rRNA Gene.

    Science.gov (United States)

    Zhao, Yiping; Li, Bei; Bai, Dongyi; Huang, Jinlong; Shiraigo, Wunierfu; Yang, Lihua; Zhao, Qinan; Ren, Xiujuan; Wu, Jing; Bao, Wuyundalai; Dugarjaviin, Manglai

    2016-09-01

    The hindgut of horses is an anaerobic fermentative chamber for a complex and dynamic microbial population, which plays a critical role in health and energy requirements. Research on the gut microbiota of Mongolian horses has not been reported until now as far as we know. Mongolian horse is a major local breed in China. We performed high-throughput sequencing of the 16S rRNA genes V4 hypervariable regions from gut fecal material to characterize the gut microbiota of Mongolian horses and compare them to the microbiota in Thoroughbred horses. Fourteen Mongolian and 19 Thoroughbred horses were used in the study. A total of 593,678 sequence reads were obtained from 33 samples analyzed, which were found to belong to 16 phyla and 75 genera. The bacterial community compositions were similar for the two breeds. Firmicutes (56% in Mongolian horses and 53% in Thoroughbred horses) and Bacteroidetes (33% and 32% respectively) were the most abundant and predominant phyla followed by Spirochaete, Verrucomicrobia, Proteobacteria, and Fibrobacteres. Of these 16 phyla, five (Synergistetes, Planctomycetes, Proteobacteria, TM7, and Chloroflexi) were significantly different (phorses vs 29% in Thoroughbred horses), followed by Ruminococcus, Roseburia, Pseudobutyrivibrio, and Anaeroplasma, which were detected in higher distribution proportion in Mongolian horses than in Thoroughbred horses. In contrast, Oscillibacter, Fibrobacter, Methanocorpusculum, and Succinivibrio levels were lower in Mongolian horses. Among 75 genera, 30 genera were significantly different (phorse gut microbiota. These findings provide novel information about the gut microbiota of Mongolian horses and a foundation for future investigations of gut bacterial factors that may influence the development and progression of gastrointestinal disease in horses.

  8. 16S rRNA gene-based molecular analysis of mat-forming and accompanying bacteria covering organically-enriched marine sediments underlying a salmon farm in Southern Chile (Calbuco Island)

    OpenAIRE

    Aranda, Carlos; Paredes, Javier; Valenzuela, Cristian; Lam, Phyllis; Guillou, Laure

    2010-01-01

    The mat forming bacteria covering organic matter-enriched and anoxic marine sediments underlying a salmon farm in Southern Chile, were examined using 16S rRNA gene phylogenies. This mat was absent in the sea bed outside the direct influence of the farm (360 m outside fish cages). Based on nearly complete 16S rRNA gene sequences (-1500 bp), mat-forming filamentous cells were settled as the sulphur-oxidizing and putatively dissimilative nitrate-reducing Beggiatoa spp., being closely related (up...

  9. A deep auto-encoder model for gene expression prediction.

    Science.gov (United States)

    Xie, Rui; Wen, Jia; Quitadamo, Andrew; Cheng, Jianlin; Shi, Xinghua

    2017-11-17

    Gene expression is a key intermediate level that genotypes lead to a particular trait. Gene expression is affected by various factors including genotypes of genetic variants. With an aim of delineating the genetic impact on gene expression, we build a deep auto-encoder model to assess how good genetic variants will contribute to gene expression changes. This new deep learning model is a regression-based predictive model based on the MultiLayer Perceptron and Stacked Denoising Auto-encoder (MLP-SAE). The model is trained using a stacked denoising auto-encoder for feature selection and a multilayer perceptron framework for backpropagation. We further improve the model by introducing dropout to prevent overfitting and improve performance. To demonstrate the usage of this model, we apply MLP-SAE to a real genomic datasets with genotypes and gene expression profiles measured in yeast. Our results show that the MLP-SAE model with dropout outperforms other models including Lasso, Random Forests and the MLP-SAE model without dropout. Using the MLP-SAE model with dropout, we show that gene expression quantifications predicted by the model solely based on genotypes, align well with true gene expression patterns. We provide a deep auto-encoder model for predicting gene expression from SNP genotypes. This study demonstrates that deep learning is appropriate for tackling another genomic problem, i.e., building predictive models to understand genotypes' contribution to gene expression. With the emerging availability of richer genomic data, we anticipate that deep learning models play a bigger role in modeling and interpreting genomics.

  10. Bacterial 16S rRNA gene analysis revealed that bacteria related to Arcobacter spp. constitute an abundant and common component of the oyster microbiota (Tiostrea chilensis).

    Science.gov (United States)

    Romero, J; García-Varela, M; Laclette, J P; Espejo, R T

    2002-11-01

    To explore the bacterial microbiota in Chilean oyster (Tiostrea chilensis), a molecular approach that permits detection of different bacteria, independently of their capacity to grow in culture media, was used. Bacterial diversity was assessed by analysis of both the 16S rDNA and the 16S-23S intergenic region, obtained by PCR amplifications of DNA extracted from depurated oysters. RFLP of the PCR amplified 16S rDNA showed a prevailing pattern in most of the individuals analyzed, indicating that a few bacterial species were relatively abundant and common in oysters. Cloning and sequencing of the 16S rDNA with the prevailing RFLP pattern indicated that this rRNA was most closely related to Arcobacter spp. However, analysis by the size of the amplified 16S-23S rRNA intergenic regions revealed not Arcobacter spp. but Staphylococcus spp. related bacteria as a major and common component in oyster. These different results may be caused by the absence of target for one of the primers employed for amplification of the intergenic region. Neither of the two bacteria species found in large abundance was recovered after culturing under aerobic, anaerobic, or microaerophilic conditions. This result, however, is expected because the number of bacteria recovered after cultivation was less than 0.01% of the total. All together, these observations suggest that Arcobacter-related strains are probably abundant and common in the Chilean oyster bacterial microbiota.

  11. Transcriptional modulation of genes encoding nitrate reductase in ...

    African Journals Online (AJOL)

    The free aluminum (Al) content in soil can reach levels that are toxic to plants, and this has frequently limited increased productivity of cultures. Four genes encoding nitrate reductase (NR) were identified, named ZmNR1–4. With the aim of evaluating NR activity and the transcriptional modulation of the ZmNR1, ZmNR2, ...

  12. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  13. RNAi-based silencing of genes encoding the vacuolar- ATPase ...

    African Journals Online (AJOL)

    2016-11-09

    Nov 9, 2016 ... Spodoptera exigua larval development by silencing chitin synthase gene with RNA interference. Bull. Entomol. Res. 98:613-619. Dow JAT (1999). The Multifunctional Drosophila melanogaster V-. ATPase is encoded by a multigene family. J. Bioenerg. Biomembr. 31:75-83. Fire A, Xu SQ, Montgomery MK, ...

  14. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial

    Directory of Open Access Journals (Sweden)

    Shumeng Kou

    2018-03-01

    Full Text Available Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya, Desmonostoc muscorum, and Microcoleus steenstrupii. The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ; the most (relative abundant being uncharacterized species within the genera Methylobacillus, Solirubrobacter, and Ohtaekwangia. Three metal treatment alone resulted in identification of 22 OTUs (genera or species which were not detected in control soil, notably including Yonghaparkia alkaliphila, Pedobacter steynii, Pseudolabrys taiwanensis

  15. Bacteriological incidence in pneumonia patients with pulmonary emphysema: a bacterial floral analysis using the 16S ribosomal RNA gene in bronchoalveolar lavage fluid

    Directory of Open Access Journals (Sweden)

    Naito K

    2017-07-01

    Full Text Available Keisuke Naito,1 Kei Yamasaki,1 Kazuhiro Yatera,1 Kentaro Akata,1 Shingo Noguchi,1 Toshinori Kawanami,1 Kazumasa Fukuda,2 Takashi Kido,1 Hiroshi Ishimoto,3 Hiroshi Mukae3 1Department of Respiratory Medicine, 2Department of Microbiology, University of Occupational and Environmental Health, Japan, Kitakyushu City, Fukuoka, 3Second Department of Internal Medicine, Nagasaki University School of Medicine, Nagasaki City, Nagasaki, Japan Abstract: Pulmonary emphysema is an important radiological finding in chronic obstructive pulmonary disease patients, but bacteriological differences in pneumonia patients according to the severity of emphysematous changes have not been reported. Therefore, we evaluated the bacteriological incidence in the bronchoalveolar lavage fluid (BALF of pneumonia patients using cultivation and a culture-independent molecular method. Japanese patients with community-acquired pneumonia (83 and healthcare-associated pneumonia (94 between April 2010 and February 2014 were evaluated. The BALF obtained from pneumonia lesions was evaluated by both cultivation and a molecular method. In the molecular method, ~600 base pairs of bacterial 16S ribosomal RNA genes in the BALF were amplified by polymerase chain reaction, and clone libraries were constructed. The nucleotide sequences of 96 randomly selected colonies were determined, and a homology search was performed to identify the bacterial species. A qualitative radiological evaluation of pulmonary emphysema based on chest computed tomography (CT images was performed using the Goddard classification. The severity of pulmonary emphysema based on the Goddard classification was none in 47.4% (84/177, mild in 36.2% (64/177, moderate in 10.2% (18/177, and severe in 6.2% (11/177. Using the culture-independent molecular method, Moraxella catarrhalis was significantly more frequently detected in moderate or severe emphysema patients than in patients with no or mild emphysematous changes. The

  16. The Response of a 16S Ribosomal RNA Gene Fragment Amplified Community to Lead, Zinc, and Copper Pollution in a Shanghai Field Trial.

    Science.gov (United States)

    Kou, Shumeng; Vincent, Gilles; Gonzalez, Emmanuel; Pitre, Frederic E; Labrecque, Michel; Brereton, Nicholas J B

    2018-01-01

    Industrial and agricultural activities have caused extensive metal contamination of land throughout China and across the globe. The pervasive nature of metal pollution can be harmful to human health and can potentially cause substantial negative impact to the biosphere. To investigate the impact of anthropogenic metal pollution found in high concentrations in industrial, agricultural, and urban environments, 16S ribosomal RNA gene amplicon sequencing was used to track change in the amplified microbial community after metal contamination in a large-scale field experiment in Shanghai. A total of 1,566 operational taxonomic units (OTUs) identified from 448,108 sequences gathered from 20 plots treated as controls or with lead, zinc, copper, or all three metals. Constrained Analysis of Principal Coordinates ordination did not separate control and lead treatment but could separate control/lead, zinc, copper, and three metal treatment. DESeq2 was applied to identify 93 significantly differentially abundant OTUs varying in 211 pairwise instances between the treatments. Differentially abundant OTUs representing genera or species belonging to the phyla Chloroflexi, Cyanobacteria, Firmicutes, Latescibacteria, and Planctomycetes were almost universally reduced in abundance due to zinc, copper, or three metal treatment; with three metal treatment abolishing the detection of some OTUs, such as Leptolyngbya , Desmonostoc muscorum , and Microcoleus steenstrupii . The greatest increases due to metal treatment were observed in Bacteroidetes, Actinobacteria, Chlamydiae, Nitrospirae, and Proteobacteria (α, β, δ, and γ); the most (relative) abundant being uncharacterized species within the genera Methylobacillus , Solirubrobacter , and Ohtaekwangia . Three metal treatment alone resulted in identification of 22 OTUs (genera or species) which were not detected in control soil, notably including Yonghaparkia alkaliphila , Pedobacter steynii , Pseudolabrys taiwanensis , Methylophilus

  17. A novel ultra high-throughput 16S rRNA gene amplicon sequencing library preparation method for the Illumina HiSeq platform.

    Science.gov (United States)

    de Muinck, Eric J; Trosvik, Pål; Gilfillan, Gregor D; Hov, Johannes R; Sundaram, Arvind Y M

    2017-07-06

    Advances in sequencing technologies and bioinformatics have made the analysis of microbial communities almost routine. Nonetheless, the need remains to improve on the techniques used for gathering such data, including increasing throughput while lowering cost and benchmarking the techniques so that potential sources of bias can be better characterized. We present a triple-index amplicon sequencing strategy to sequence large numbers of samples at significantly lower c ost and in a shorter timeframe compared to existing methods. The design employs a two-stage PCR protocol, incorpo rating three barcodes to each sample, with the possibility to add a fourth-index. It also includes heterogeneity spacers to overcome low complexity issues faced when sequencing amplicons on Illumina platforms. The library preparation method was extensively benchmarked through analysis of a mock community in order to assess biases introduced by sample indexing, number of PCR cycles, and template concentration. We further evaluated the method through re-sequencing of a standardized environmental sample. Finally, we evaluated our protocol on a set of fecal samples from a small cohort of healthy adults, demonstrating good performance in a realistic experimental setting. Between-sample variation was mainly related to batch effects, such as DNA extraction, while sample indexing was also a significant source of bias. PCR cycle number strongly influenced chimera formation and affected relative abundance estimates of species with high GC content. Libraries were sequenced using the Illumina HiSeq and MiSeq platforms to demonstrate that this protocol is highly scalable to sequence thousands of samples at a very low cost. Here, we provide the most comprehensive study of performance and bias inherent to a 16S rRNA gene amplicon sequencing method to date. Triple-indexing greatly reduces the number of long custom DNA oligos required for library preparation, while the inclusion of variable length

  18. Long PCR-RFLP of 16S-ITS-23S rRNA genes: a high-resolution molecular tool for bacterial genotyping

    Czech Academy of Sciences Publication Activity Database

    Zeng, Yonghui; Koblížek, Michal; Li, Y. X.; Liu, Y. P.; Feng, F. Y.; Ji, J. D.; Jian, J. C.; Wu, Z. H.

    2013-01-01

    Roč. 114, č. 2 (2013), s. 433-447 ISSN 1364-5072 R&D Projects: GA MŠk(CZ) ED2.1.00/03.0110 Institutional support: RVO:61388971 Keywords : 16S-ITS-23S * bacterial genome * computer simulation Subject RIV: EE - Microbiology, Virology Impact factor: 2.386, year: 2013

  19. Proposals for revival of Streptomyces setonii and reclassification of S. fimicarius as a later synonym of S. setonii and S. albovinaceus as a later synonym of S. globisporus based on combined 16S rRNA-gyrB gene analysis

    Science.gov (United States)

    The 16S rRNA and gyrB genes of 22 Streptomyces species belonging to the Streptomyces griseus cluster were sequenced, and their taxonomic positions were re-evaluated. For correct analysis, all of the publicly available sequences of the species were collected and compared with those obtained in this s...

  20. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression

    Directory of Open Access Journals (Sweden)

    Jia Yi Har

    2015-09-01

    Full Text Available We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing 99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e. Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P, polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins. We hypothesize that such activities may mediate acclimation and persistence of bacteria in N. vectensis.

  1. Microbial diversity and activity in the Nematostella vectensis holobiont: insights from 16S rRNA gene sequencing, isolate genomes, and a pilot-scale survey of gene expression.

    Science.gov (United States)

    Har, Jia Y; Helbig, Tim; Lim, Ju H; Fernando, Samodha C; Reitzel, Adam M; Penn, Kevin; Thompson, Janelle R

    2015-01-01

    We have characterized the molecular and genomic diversity of the microbiota of the starlet sea anemone Nematostella vectensis, a cnidarian model for comparative developmental and functional biology and a year-round inhabitant of temperate salt marshes. Molecular phylogenetic analysis of 16S rRNA gene clone libraries revealed four ribotypes associated with N. vectensis at multiple locations and times. These associates include two novel ribotypes within the ε-Proteobacterial order Campylobacterales and the Spirochetes, respectively, each sharing 99% 16S rRNA identity with Endozoicomonas elysicola and Pseudomonas oleovorans, respectively. Species-specific PCR revealed that these populations persisted in N. vectensis asexually propagated under laboratory conditions. cDNA indicated expression of the Campylobacterales and Endozoicomonas 16S rRNA in anemones from Sippewissett Marsh, MA. A collection of bacteria from laboratory raised N. vectensis was dominated by isolates from P. oleovorans and Rhizobium radiobacter. Isolates from field-collected anemones revealed an association with Limnobacter and Stappia isolates. Genomic DNA sequencing was carried out on 10 cultured bacterial isolates representing field- and laboratory-associates, i.e., Limnobacter spp., Stappia spp., P. oleovorans and R. radiobacter. Genomes contained multiple genes identified as virulence (host-association) factors while S. stellulata and L. thiooxidans genomes revealed pathways for mixotrophic sulfur oxidation. A pilot metatranscriptome of laboratory-raised N. vectensis was compared to the isolate genomes and indicated expression of ORFs from L. thiooxidans with predicted functions of motility, nutrient scavenging (Fe and P), polyhydroxyalkanoate synthesis for carbon storage, and selective permeability (porins). We hypothesize that such activities may mediate acclimation and persistence of bacteria in a N. vectensis holobiont defined by both internal and external gradients of chemicals and

  2. Environmental cycle of antibiotic resistance encoded genes: A systematic review

    Directory of Open Access Journals (Sweden)

    R. ghanbari

    2017-12-01

    Full Text Available Antibiotic-resistant bacteria and genes enter the environment in different ways. The release of these factors into the environment has increased concerns related to public health. The aim of the study was to evaluate the antibiotic resistance genes (ARGs in the environmental resources. In this systematic review, the data were extracted from valid sources of information including ScienceDirect, PubMed, Google Scholar and SID. Evaluation and selection of articles were conducted on the basis of the PRISMA checklist. A total of 39 articles were included in the study, which were chosen from a total of 1249 papers. The inclusion criterion was the identification of genes encoding antibiotic resistance against the eight important groups of antibiotics determined by using the PCR technique in the environmental sources including municipal and hospital wastewater treatment plants, animal and agricultural wastes, effluents from treatment plants, natural waters, sediments, and drinking waters. In this study, 113 genes encoding antibiotic resistance to eight groups of antibiotics (beta-lactams, aminoglycosides, tetracyclines, macrolides, sulfonamides, chloramphenicol, glycopeptides and quinolones were identified in various environments. Antibiotic resistance genes were found in all the investigated environments. The investigation of microorganisms carrying these genes shows that most of the bacteria especially gram-negative bacteria are effective in the acquisition and the dissemination of these pollutants in the environment. Discharging the raw wastewaters and effluents from wastewater treatments acts as major routes in the dissemination of ARGs into environment sources and can pose hazards to public health.

  3. Fungicidal activity of peptides encoded by immunoglobulin genes

    OpenAIRE

    Polonelli, Luciano; Ciociola, Tecla; Sperind?, Martina; Giovati, Laura; D?Adda, Tiziana; Galati, Serena; Travassos, Luiz R.; Magliani, Walter; Conti, Stefania

    2017-01-01

    Evidence from previous works disclosed the antimicrobial, antiviral, anti-tumour and/or immunomodulatory activity exerted, through different mechanisms of action, by peptides expressed in the complementarity-determining regions or even in the constant region of antibodies, independently from their specificity and isotype. Presently, we report the selection, from available databases, of peptide sequences encoded by immunoglobulin genes for the evaluation of their potential biological activitie...

  4. [High gene conversion frequency between genes encoding 2-deoxyglucose-6-phosphate phosphatase in 3 Saccharomyces species].

    Science.gov (United States)

    Piscopo, Sara-Pier; Drouin, Guy

    2014-05-01

    Gene conversions are nonreciprocal sequence exchanges between genes. They are relatively common in Saccharomyces cerevisiae, but few studies have investigated the evolutionary fate of gene conversions or their functional impacts. Here, we analyze the evolution and impact of gene conversions between the two genes encoding 2-deoxyglucose-6-phosphate phosphatase in S. cerevisiae, Saccharomyces paradoxus and Saccharomyces mikatae. Our results demonstrate that the last half of these genes are subject to gene conversions among these three species. The greater similarity and the greater percentage of GC nucleotides in the converted regions, as well as the absence of long regions of adjacent common converted sites, suggest that these gene conversions are frequent and occur independently in all three species. The high frequency of these conversions probably result from the fact that they have little impact on the protein sequences encoded by these genes.

  5. Phylogeny of Indonesian Nostoc (Cyanobac teria Isolated from Paddy Fields as Inferred from Partial Se quence of 16S rRNA Gene

    Directory of Open Access Journals (Sweden)

    Dian Hendrayanti

    2012-12-01

    Full Text Available In order to collect Indonesian Nostoc, isolation of soil microflora from several paddy fields in West Java, Bali, andSouth Celebes was carried out. Fast-growing isolates of Nostoc were selected to describe and perform molecular identification using partial sequences of 16S rRNA. The results showed that partial sequences of 16S rRNA could not resolve the phylogeny of the isolates. However, it supported the morphological studies that recognize isolates as different species of Nostoc. Potential use of Nostoc as a nitrogen source for paddy growth was carried out using six strains as single inoculums. A total biomass of 2 g (fresh weight for each strain was inoculated, respectively, into the pot planted with three paddy plants. This experiment was conducted in the green house for 115 days. Statistical analyses (ANOVA; α = 0.05 showed that of six strains tested in this study, only strain GIA13a had influence on the augmentation of root length and the total number of filled grains.

  6. Molecular phylogeny of the neritidae (Gastropoda: Neritimorpha) based on the mitochondrial genes cytochrome oxidase I (COI) and 16S rRNA

    International Nuclear Information System (INIS)

    Quintero Galvis, Julian Fernando; Castro, Lyda Raquel

    2013-01-01

    The family Neritidae has representatives in tropical and subtropical regions that occur in a variety of environments, and its known fossil record dates back to the late Cretaceous. However there have been few studies of molecular phylogeny in this family. We performed a phylogenetic reconstruction of the family Neritidae using the COI (722 bp) and the 16S rRNA (559 bp) regions of the mitochondrial genome. Neighbor-joining, maximum parsimony and Bayesian inference were performed. The best phylogenetic reconstruction was obtained using the COI region, and we consider it an appropriate marker for phylogenetic studies within the group. Consensus analysis (COI +16S rRNA) generally obtained the same tree topologies and confirmed that the genus Nerita is monophyletic. The consensus analysis using parsimony recovered a monophyletic group consisting of the genera Neritina, Septaria, Theodoxus, Puperita, and Clithon, while in the Bayesian analyses Theodoxus is separated from the other genera. The phylogenetic status of the species from the genus Nerita from the Colombian Caribbean generated in this study was consistent with that reported for the genus in previous studies. In the resulting consensus tree obtained using maximum parsimony, we included information on habitat type for each species, to map the evolution by habitat. Species of the family Neritidae possibly have their origin in marine environments, which is consistent with conclusions from previous reports based on anatomical studies.

  7. Highly divergent 16S rRNA sequences in ribosomal operons of Scytonema hyalinum (Cyanobacteria.

    Directory of Open Access Journals (Sweden)

    Jeffrey R Johansen

    Full Text Available A highly divergent 16S rRNA gene was found in one of the five ribosomal operons present in a species complex currently circumscribed as Scytonema hyalinum (Nostocales, Cyanobacteria using clone libraries. If 16S rRNA sequence macroheterogeneity among ribosomal operons due to insertions, deletions or truncation is excluded, the sequence heterogeneity observed in S. hyalinum was the highest observed in any prokaryotic species thus far (7.3-9.0%. The secondary structure of the 16S rRNA molecules encoded by the two divergent operons was nearly identical, indicating possible functionality. The 23S rRNA gene was examined for a few strains in this complex, and it was also found to be highly divergent from the gene in Type 2 operons (8.7%, and likewise had nearly identical secondary structure between the Type 1 and Type 2 operons. Furthermore, the 16S-23S ITS showed marked differences consistent between operons among numerous strains. Both operons have promoter sequences that satisfy consensus requirements for functional prokaryotic transcription initiation. Horizontal gene transfer from another unknown heterocytous cyanobacterium is considered the most likely explanation for the origin of this molecule, but does not explain the ultimate origin of this sequence, which is very divergent from all 16S rRNA sequences found thus far in cyanobacteria. The divergent sequence is highly conserved among numerous strains of S. hyalinum, suggesting adaptive advantage and selective constraint of the divergent sequence.

  8. Multiple genes encode the major surface glycoprotein of Pneumocystis carinii

    DEFF Research Database (Denmark)

    Kovacs, J A; Powell, F; Edman, J C

    1993-01-01

    hydrophobic region at the carboxyl terminus. The presence of multiple related msg genes encoding the major surface glycoprotein of P. carinii suggests that antigenic variation is a possible mechanism for evading host defenses. Further characterization of this family of genes should allow the development......The major surface antigen of Pneumocystis carinii, a life-threatening opportunistic pathogen in human immunodeficiency virus-infected patients, is an abundant glycoprotein that functions in host-organism interactions. A monoclonal antibody to this antigen is protective in animals, and thus...... blot studies using chromosomal or restricted DNA, the major surface glycoproteins are the products of a multicopy family of genes. The predicted protein has an M(r) of approximately 123,000, is relatively rich in cysteine residues (5.5%) that are very strongly conserved, and contains a well conserved...

  9. Recombinant vectors construction for cellobiohydrolase encoding gene constitutive expression

    Directory of Open Access Journals (Sweden)

    Leontina GURGU

    2012-12-01

    Full Text Available Cellobiohydrolases (EC 3.2.1.91 are important exo enzymes involved in cellulose hydrolysis alongside endoglucanases (EC 3.2.1.4 and β-glucosidases (EC 3.2.1.21. Heterologous cellobiohydrolase gene expression under constitutive promoter control using Saccharomyces cerevisiae as host system is of great importance for a successful SSF process. From this point of view, the main objective of the work was to use Yeplac181 expression vector as a recipient for cellobiohdrolase - cbhB encoding gene expression under the control of the actin promoter, in Saccharomyces cerevisiae. Two hybridvectors, YEplac-Actp and YEplac-Actp-CbhB, were generated usingEscherichia coli XLI Blue for the cloning experiments. Constitutive cbhB gene expression was checked by proteine gel electrophoresis (SDS-PAGE after insertion of these constructs into Saccharomyces cerevisiae.

  10. Characterization of 16S rRNA genes from oil field microbial communities indicates the presence of a variety of sulfate-reducing, fermentative, and sulfide-oxidizing bacteria.

    OpenAIRE

    Voordouw, G; Armstrong, S M; Reimer, M F; Fouts, B; Telang, A J; Shen, Y; Gevertz, D

    1996-01-01

    Oil field bacteria were characterized by cloning and sequencing of PCR-amplified 16S rRNA genes. A variety of gram-negative, sulfate-reducing bacteria was detected (16 members of the family Desulfovibrionaceae and 8 members of the family Desulfobacteriaceae). In contrast, a much more limited number of anaerobic, fermentative, or acetogenic bacteria was found (one Clostridium sp., one Eubacterium sp., and one Synergistes sp.). Potential sulfide oxidizers and/or microaerophiles (Thiomicrospira,...

  11. Temporal dynamics of fibrolytic and methanogenic rumen microorganisms during in situ incubation of switchgrass determined by 16S rRNA gene profiling.

    Science.gov (United States)

    Piao, Hailan; Lachman, Medora; Malfatti, Stephanie; Sczyrba, Alexander; Knierim, Bernhard; Auer, Manfred; Tringe, Susannah G; Mackie, Roderick I; Yeoman, Carl J; Hess, Matthias

    2014-01-01

    The rumen microbial ecosystem is known for its biomass-degrading and methane-producing phenotype. Fermentation of recalcitrant plant material, comprised of a multitude of interwoven fibers, necessitates the synergistic activity of diverse microbial taxonomic groups that inhabit the anaerobic rumen ecosystem. Although interspecies hydrogen (H2) transfer, a process during which bacterially generated H2 is transferred to methanogenic Archaea, has obtained significant attention over the last decades, the temporal variation of the different taxa involved in in situ biomass-degradation, H2 transfer and the methanogenesis process remains to be established. Here we investigated the temporal succession of microbial taxa and its effect on fiber composition during rumen incubation using 16S rRNA amplicon sequencing. Switchgrass filled nylon bags were placed in the rumen of a cannulated cow and collected at nine time points for DNA extraction and 16S pyrotag profiling. The microbial community colonizing the air-dried and non-incubated (0 h) switchgrass was dominated by members of the Bacilli (recruiting 63% of the pyrotag reads). During in situ incubation of the switchgrass, two major shifts in the community composition were observed: Bacilli were replaced within 30 min by members belonging to the Bacteroidia and Clostridia, which recruited 34 and 25% of the 16S rRNA reads generated, respectively. A second significant shift was observed after 16 h of rumen incubation, when members of the Spirochaetes and Fibrobacteria classes became more abundant in the fiber-adherent community. During the first 30 min of rumen incubation ~13% of the switchgrass dry matter was degraded, whereas little biomass degradation appeared to have occurred between 30 min and 4 h after the switchgrass was placed in the rumen. Interestingly, methanogenic members of the Euryarchaeota (i.e., Methanobacteria) increased up to 3-fold during this period of reduced biomass-degradation, with peak abundance just

  12. MOLECULAR PHYLOGENY OF THE NERITIDAE (GASTROPODA: NERITIMORPHA BASED ON THE MITOCHONDRIAL GENES CYTOCHROME OXIDASE I (COI AND 16S rRNA

    Directory of Open Access Journals (Sweden)

    Julián Fernando Quintero Galvis

    2013-05-01

    La familia Neritidae cuenta con representantes en regiones tropicales y subtropicales adaptadas a diferentes ambientes, con un registro fósil que data para finales del Cretáceo. Sin embargo no se han realizado estudios de filogenia molecular en la familia. En este estudio se realizó una reconstrucción filogenética de la familia Neritidae utilizando las regiones COI (722 pb y 16S rRNA (559 pb del genoma mitocondrial. Se realizaron análisis de distancias de Neighbor-Joining, Máxima Parsimonia e Inferencia Bayesiana. La mejor reconstrucción filogenética fue mediante la región COI, considerándola un marcador apropiado para realizar estudios filogenéticos dentro del grupo. El consenso de las relaciones filogenéticas (COI+16S rRNA permitió confirmar que el género Nerita es monofilético. El consenso del análisis de parsimonia reveló un grupo monofilético formado por los géneros Neritina, Septaria, Theodoxus, Puperita y Clithon, mientras que en el análisis bayesiano Theodoxus se encuentra separado de los otros géneros. El resultado en las especies del género Nerita del Caribe colombiano fue consistente con lo reportado para el género en estudios previos. En el árbol resultante del análisis de parsimonia se sobrepuso la

  13. Impact of Fishmeal Replacement in Diets for Gilthead Sea Bream (Sparus aurata on the Gastrointestinal Microbiota Determined by Pyrosequencing the 16S rRNA Gene.

    Directory of Open Access Journals (Sweden)

    G Estruch

    Full Text Available Recent studies have demonstrated the impact of diet on microbiota composition, but the essential need for the optimization of production rates and costs forces farms and aquaculture production to carry out continuous dietary tests. In order to understand the effect of total fishmeal replacement by vegetable-based feed in the sea bream (Sparus aurata, the microbial composition of the stomach, foregut, midgut and hindgut was analysed using high-throughput 16S rDNA sequencing, also considering parameters of growth, survival and nutrient utilisation indices.A total of 91,539 16S rRNA filtered-sequences were analysed, with an average number of 3661.56 taxonomically assigned, high-quality sequences per sample. The dominant phyla throughout the whole gastrointestinal tract were Actinobacteria, Protebacteria and Firmicutes. A lower diversity in the stomach in comparison to the other intestinal sections was observed. The microbial composition of the Recirculating Aquaculture System was totally different to that of the sea bream gastrointestinal tract. Total fishmeal replacement had an important impact on microbial profiles but not on diversity. Streptococcus (p-value: 0.043 and Photobacterium (p-value: 0.025 were highly represented in fish fed with fishmeal and vegetable-meal diets, respectively. In the stomach samples with the vegetable diet, reads of chloroplasts and mitochondria from vegetable dietary ingredients were rather abundant. Principal Coordinate Analysis showed a clear differentiation between diets in the microbiota present in the gut, supporting the presence of specific bacterial consortia associated with the diet.Although differences in growth and nutritive parameters were not observed, a negative effect of the vegetable diet on the survival rate was determined. Further studies are required to shed more light on the relationship between the immune system and sea bream gastrointestinal tract microbiota and should consider the modulation of

  14. Temporal dynamics of fibrolytic and methanogenic rumen microorganisms during in situ incubation of switchgrass determined by 16S rRNA gene profiling

    Directory of Open Access Journals (Sweden)

    Hailan ePiao

    2014-07-01

    Full Text Available The rumen is known for its biomass-degrading and methane-producing phenotype. Fermentation of recalcitrant plant material necessitates the synergistic activity of diverse microbial taxonomic groups that inhabit this anaerobic environment. Although interspecies hydrogen (H2 transfer, a process during which bacterially generated H2 is transferred to methanogenic Archaea, has obtained significant attention over the last decades, the temporal variation of the different taxa involved in in situ biomass-degradation, H2 transfer and methanogenesis process remains to be established. We investigated the temporal succession of microbial taxa and its effect on fiber composition during rumen incubation using 16S rRNA amplicon sequencing. Switchgrass filled nylon bags were placed in the rumen of a cannulated cow and collected at nine time points for DNA extraction and 16S pyrotag profiling. The microbial community colonizing the air-dried and non-incubated switchgrass was dominated by members of the Bacilli. During in situ incubation of the switchgrass, two major shifts in the community composition were observed: Bacilli were replaced within 30 min by members belonging to the Bacteroidia and Clostridia. A second significant shift was observed after 16 h of rumen incubation, when members of the Spirochaetes and Fibrobacteria classes became more abundant in the fiber-adherent community. During the first 30 min of rumen incubation ~13% of the switchgrass dry matter was degraded, whereas little biomass degradation appeared to have occurred between 30 min and 4 h after the switchgrass was placed in the rumen. Interestingly, methanogenic members of the Euryarchaeota increased up to 3-fold during this period of reduced biomass-degradation, with peak abundance just before rates of dry matter degradation increased again. We hypothesize that during this period microbial-mediated fibrolysis was temporarily inhibited until H2 was metabolized into CH4 by methanogens.

  15. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples.

    Science.gov (United States)

    Turankar, Ravindra P; Pandey, Shradha; Lavania, Mallika; Singh, Itu; Nigam, Astha; Darlong, Joydeepa; Darlong, Fam; Sengupta, Utpal

    2015-03-01

    PCR assay is a highly sensitive, specific and reliable diagnostic tool for the identification of pathogens in many infectious diseases. Genome sequencing Mycobacterium leprae revealed several gene targets that could be used for the detection of DNA from clinical and environmental samples. The PCR sensitivity of particular gene targets for specific clinical and environmental isolates has not yet been established. The present study was conducted to compare the sensitivity of RLEP, rpoT, Sod A and 16S rRNA gene targets in the detection of M. leprae in slit skin smear (SSS), blood, soil samples of leprosy patients and their surroundings. Leprosy patients were classified into Paucibacillary (PB) and Multibacillary (MB) types. Ziehl-Neelsen (ZN) staining method for all the SSS samples and Bacteriological Index (BI) was calculated for all patients. Standard laboratory protocol was used for DNA extraction from SSS, blood and soil samples. PCR technique was performed for the detection of M. leprae DNA from all the above-mentioned samples. RLEP gene target was able to detect the presence of M. leprae in 83% of SSS, 100% of blood samples and in 36% of soil samples and was noted to be the best out of all other gene targets (rpoT, Sod A and 16S rRNA). It was noted that the RLEP gene target was able to detect the highest number (53%) of BI-negative leprosy patients amongst all the gene targets used in this study. Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes. Copyright © 2015 Asian African Society for Mycobacteriology. Published by Elsevier Ltd. All rights reserved.

  16. New recombinant bacterium comprises a heterologous gene encoding glycerol dehydrogenase and/or an up-regulated native gene encoding glycerol dehydrogenase, useful for producing ethanol

    DEFF Research Database (Denmark)

    2010-01-01

    dehydrogenase encoding region of the bacterium, or is inserted into a phosphotransacetylase encoding region of the bacterium, or is inserted into an acetate kinase encoding region of the bacterium. It is operably linked to an inducible, a regulated or a constitutive promoter. The up-regulated glycerol......TECHNOLOGY FOCUS - BIOTECHNOLOGY - Preparation (claimed): Producing recombinant bacterium having enhanced ethanol production characteristics when cultivated in growth medium comprising glycerol comprises: (a) transforming a parental bacterium by (i) the insertion of a heterologous gene encoding...... glycerol dehydrogenase; and/or (ii) up-regulating a native gene encoding glycerol dehydrogenase; and (b) obtaining the recombinant bacterium. Preferred Bacterium: In the recombinant bacterium above, the inserted heterologous gene and/or the up-regulated native gene is encoding a glycerol dehydrogenase...

  17. Complex community of nitrite-dependent anaerobic methane oxidation bacteria in coastal sediments of the Mai Po wetland by PCR amplification of both 16S rRNA and pmoA genes.

    Science.gov (United States)

    Chen, Jing; Zhou, Zhichao; Gu, Ji-Dong

    2015-02-01

    In the present work, both 16S rRNA and pmoA gene-based PCR primers were employed successfully to study the diversity and distribution of n-damo bacteria in the surface and lower layer sediments at the coastal Mai Po wetland. The occurrence of n-damo bacteria in both the surface and subsurface sediments with high diversity was confirmed in this study. Unlike the two other known n-damo communities from coastal areas, the pmoA gene-amplified sequences in the present work clustered not only with some freshwater subclusters but also within three newly erected marine subclusters mostly, indicating the unique niche specificity of n-damo bacteria in this wetland. Results suggested vegetation affected the distribution and community structures of n-damo bacteria in the sediments and n-damo could coexist with sulfate-reducing methanotrophs in the coastal ecosystem. Community structures of the Mai Po n-damo bacteria based on 16S rRNA gene were different from those of either the freshwater or the marine. In contrast, structures of the Mai Po n-damo communities based on pmoA gene grouped with the marine ones and were clearly distinguished from the freshwater ones. The abundance of n-damo bacteria at this wetland was quantified using 16S rRNA gene PCR primers to be 2.65-6.71 × 10(5) copies/g dry sediment. Ammonium and nitrite strongly affected the community structures and distribution of n-damo bacteria in the coastal Mai Po wetland sediments.

  18. The phylogenetic position of Lygodactylus angularis and the utility of the 16S rDNA gene for delimiting species in Lygodactylus (Squamata, Gekkonidae

    Directory of Open Access Journals (Sweden)

    Riccardo Castiglia

    2011-06-01

    Hidden="false" UnhideWhenUsed="false" QFormat="true" Name="Subtle Emphasis" />

    The African genus Lygodactylus Gray, is composed of about 60 species of diurnal geckos inhabiting tropical and temperate Africa, Madagascar and South America. In this paper we analysed, by means of the mitochondrial 16S rDNA gene

  19. Identification of clinically relevant nonhemolytic Streptococci on the basis of sequence analysis of 16S-23S intergenic spacer region and partial gdh gene

    DEFF Research Database (Denmark)

    Nielsen, Xiaohui Chen; Justesen, Ulrik Stenz; Dargis, Rimtas

    2009-01-01

    Nonhemolytic streptococci (NHS) cause serious infections, such as endocarditis and septicemia. Many conventional phenotypic methods are insufficient for the identification of bacteria in this group to the species level. Genetic analysis has revealed that single-gene analysis is insufficient...

  20. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  1. Using Matrix-Assisted Laser Desorption Ionization-Time of Flight (MALDI-TOF) Complemented with Selected 16S rRNA and gyrB Genes Sequencing to Practically Identify Clinical Important Viridans Group Streptococci (VGS).

    Science.gov (United States)

    Zhou, Menglan; Yang, Qiwen; Kudinha, Timothy; Zhang, Li; Xiao, Meng; Kong, Fanrong; Zhao, Yupei; Xu, Ying-Chun

    2016-01-01

    There are challenges in viridans group streptococci (VGS) identification especially for the mitis group. Few studies have investigated the performance of MALDI-TOF MS system in VGS identification. Using 16S rRNA gene and gyrB gene sequencing as a gold standard, the performance of two MALDI-TOF MS instruments in the identification of 181 VGS clinical isolates was studied. The Bruker Biotyper and Vitek MS IVD systems correctly identified 88.4% and 98.9% of the 181 isolates, respectively. The Vitek MS RUO system was the least reliable, only correctly identifying 38.7% of the isolates to species level with several misidentifications and invalid results. The Bruker Biotyper system was very unreliable in the identification of species within the mitis group. Among 22 non-pneumococci isolates (S. mitis/S. oralis/S. pseudopneumoniae), Biotyper misidentified 21 of them as S. pneumoniae leading to a low sensitivity and low positive predictive value in these species. In contrast, the Vitek MS IVD demonstrated a better resolution for pneumococci and non-pneumococci despite the inability to distinguish between S. mitis/S. oralis. For more accurate species-level identification, further improvements in the VGS spectra databases are needed. Based on MALDI-TOF analysis and selected 16S rRNA gene plus gyrB genes sequencing, we designed a practical VGS identification algorithm.

  2. Composition and Metabolic Activities of the Bacterial Community in Shrimp Sauce at the Flavor-Forming Stage of Fermentation As Revealed by Metatranscriptome and 16S rRNA Gene Sequencings.

    Science.gov (United States)

    Duan, Shan; Hu, Xiaoxi; Li, Mengru; Miao, Jianyin; Du, Jinghe; Wu, Rongli

    2016-03-30

    The bacterial community and the metabolic activities involved at the flavor-forming stage during the fermentation of shrimp sauce were investigated using metatranscriptome and 16S rRNA gene sequencings. Results showed that the abundance of Tetragenococcus was 95.1%. Tetragenococcus halophilus was identified in 520 of 588 transcripts annotated in the Nr database. Activation of the citrate cycle and oxidative phosphorylation, along with the absence of lactate dehydrogenase gene expression, in T. halophilus suggests that T. halophilus probably underwent aerobic metabolism during shrimp sauce fermentation. The metabolism of amino acids, production of peptidase, and degradation of limonene and pinene were very active in T. halophilus. Carnobacterium, Pseudomonas, Escherichia, Staphylococcus, Bacillus, and Clostridium were also metabolically active, although present in very small populations. Enterococcus, Abiotrophia, Streptococcus, and Lactobacillus were detected in metatranscriptome sequencing, but not in 16S rRNA gene sequencing. Many minor taxa showed no gene expression, suggesting that they were in dormant status.

  3. Rhizobia with 16S rRNA and nifH similar to Mesorhizobium huakuii but Novel recA, glnII, nodA and nodC genes are symbionts of New Zealand Carmichaelinae.

    Directory of Open Access Journals (Sweden)

    Heng Wee Tan

    Full Text Available New Zealand became geographically isolated about 80 million years ago and this separation gave rise to a unique native flora including four genera of legume, Carmichaelia, Clianthus and Montigena in the Carmichaelinae clade, tribe Galegeae, and Sophora, tribe Sophoreae, sub-family Papilionoideae. Ten bacterial strains isolated from NZ Carmichaelinae growing in natural ecosystems grouped close to the Mesorhizobium huakuii type strain in relation to their 16S rRNA and nifH gene sequences. However, the ten strains separated into four groups on the basis of their recA and glnII sequences: all groups were clearly distinct from all Mesorhizobium type strains. The ten strains separated into two groups on the basis of their nodA sequences but grouped closely together in relation to nodC sequences; all nodA and nodC sequences were novel. Seven strains selected and the M. huakuii type strain (isolated from Astragalus sinicus produced functional nodules on Carmichaelia spp., Clianthus puniceus and A. sinicus but did not nodulate two Sophora species. We conclude that rhizobia closely related to M. huakuii on the basis of 16S rRNA and nifH gene sequences, but with variable recA and glnII genes and novel nodA and nodC genes, are common symbionts of NZ Carmichaelinae.

  4. Comparison of growth on mannitol salt agar, matrix-assisted laser desorption/ionization time-of-flight mass spectrometry, VITEK® 2 with partial sequencing of 16S rRNA gene for identification of coagulase-negative staphylococci.

    Science.gov (United States)

    Ayeni, Funmilola A; Andersen, Camilla; Nørskov-Lauritsen, Niels

    2017-04-01

    Mannitol salt agar (MSA) is often used in resources' limited laboratories for identification of S. aureus however, coagulase-negative staphylococci (CoNS) grows and ferments mannitol on MSA. 171 strains of CoNS which have been previously misidentified as S. aureus due to growth on MSA were collected from different locations in Nigeria and two methods for identification of CoNS were compared i.e. ViTEK 2 and MALDI-TOF MS with partial 16S rRNA gene sequencing as gold standard. Partial tuf gene sequencing was used for contradicting identification. All 171 strains (13 species) grew on MSA and ferments mannitol. All tested strains of S. epidermidis, S. haemolyticus, S. nepalensis, S. pasteuri, S. sciuri,, S. warneri, S. xylosus, S. capitis were correctly identified by MALDI-TOF while variable identification were observed in S. saprophyticus and S. cohnii (90%, 81%). There was low identification of S. arlettae (14%) while all strains of S. kloosii and S. gallinarum were misidentified. There is absence of S. gallinarum in the MALDI-TOF database at the period of this study. All tested strains of S. epidermidis, S. gallinarum, S. haemolyticus, S. sciuri,, S. warneri, S. xylosus and S. capitis were correctly identified by ViTEK while variable identification were observed in S. saprophyticus, S. arlettae, S. cohnii, S. kloosii, (84%, 86%, 75%, 60%) and misidentification of S. nepalensis, S. pasteuri. Partial sequencing of 16S rRNA gene was used as gold standard for most strains except S. capitis and S. xylosus where the two species were misidentified by partial sequencing of 16S rRNA contrary to MALDI-TOF and ViTEK identification. Tuf gene sequencing was used for correct identification. Characteristic growth on MSA for CoNS is also identical to S. aureus growth on the media and therefore, MSA could not differentiate between S. aureus and CoNS. The percentage accuracy of ViTEK was better than MALDI-TOF in identification of CoNS. Although partial sequencing of

  5. Identificarion of contaminant bacteria in cachaça yeast by 16s rDNA gene sequencing Identificação de bactérias contaminantes de fermento de cachaça por seqüenciamento do gene 16s rDNA

    Directory of Open Access Journals (Sweden)

    Osmar Vaz de Carvalho-Netto

    2008-01-01

    Full Text Available Cachaça is a typical Brazilian liquor produced from the distillation of fermented sugarcane juice mainly by Saccharomyces cerevisiae. Most of the domestic production is artisanal, and producers usually are not concerned regarding microbiological control of the fermentation. This study aimed to characterize the contaminant bacterial community of the yeast used in the production of cachaça in an artisanal still. Four samples were collected, of which one (NA was used for comparison purposes and was collected one year earlier. The remaining samples were collected at three different periods: at the end of the first day of fermentation (NP, after fifteen days (NS, and thirty days after the same yeast was used (NT. Five hundred and eighty-seven sequences were analyzed from the partial sequencing of the 16S rDNA gene. Sequence analyses revealed the presence of 170 operational taxonomic units (OTUs. Of these, only one was shared among three samples and seventeen were shared between two samples. The remaining 152 OTUs were identified only once in distinct samples indicating that the contaminant bacterial population is highly dynamic along the fermentation process. Statistical analyses revealed differences in bacterial composition among samples. Undescribed species in the literature on yeasts of cachaça were found, such as Weissella cibaria, Leuconostoc citreum, and some species of Lactobacillus, in addition to some unknown bacteria. The community of bacteria in the fermentation process is much more complex than it was previously considered. No previous report is known regarding the use of this technique to determine bacterial contaminants in yeast for the production of cachaça.A cachaça é uma bebida típica brasileira produzida a partir da destilação do caldo de cana-de-açúcar fermentado principalmente por Saccharomyces cerevisiae. Grande parte da produção nacional é artesanal, e não há uma preocupação por parte dos produtores quanto ao

  6. Phylogenetic relationships of Chilean leptodactylids: a molecular approach based on mitochondrial genes 12S and 16S Relaciones filogenéticas de los leptodactílidos chilenos: una aproximación molecular basada en los genes mitocondriales 12S y 16S

    Directory of Open Access Journals (Sweden)

    CLAUDIO CORREA

    2006-12-01

    Full Text Available Most Chilean amphibians belong to the subfamily Telmatobiinae (Anura, Leptodactylidae. Several phylogenetic studies of Leptodactylidae and Telmatobiinae, based principally on morphological characters, have implicitly suggested closer relationships of some species of the Telmatobiinae with members of other subfamilies of leptodactylids, including the leptodactyline genus Pleurodema which is present in Chile. Furthermore, a growing number of molecular studies suggest a non monophyletic status for Telmatobiinae, although none of these studies have investigated the phylogenetic relationships of this subfamily. We compared partial sequences of the ribosomal mitochondrial genes 12S and 16S to determine the phylogenetic relationships of Chilean leptodactylids and its position within the modern anurans (Neobatrachia. We included 22 species from nine of the 10 genera of telmatobiines present in Chile (Alsodes, Atelognathus, Batrachyla, Caudiverbera, Eupsophus, Hylorina, Insuetophrynus, Telmatobufo and Telmatobius, two species of the genus Pleurodema, and one species of Rhinodermatidae, which is considered a leptodactylid derivative family by some authors. We also included 51 species representing most of the families that compose Neobatrachia. Phylogenetic reconstructions were performed using the methods of maximum parsimony, maximum likelihood and Bayesian inference. The topologies obtained in all the analyses indicate that Telmatobiinae is a polyphyletic assemblage, composed by species belonging to Hyloidea (most of the genera and species more related to Australasian taxa (the clade Caudiverbera + Telmatobufo, defined as the tribe Calyptocephalellini. These molecular data support groups based on other kinds of evidence (Caudiverbera + Telmatobufo, Alsodes + Eupsophus and Batrachyla + Hylorina and raise new phylogenetic hypotheses for several genera of telmatobiines (Atelognathus with Batrachyla and Hylorina, Insuetophrynus + Rhinoderma. The phylogenetic

  7. Analysis of dissimilatory sulfite reductase and 16S rRNA gene fragments from deep-sea hydrothermal sites of the Suiyo Seamount, Izu-Bonin Arc, Western Pacific.

    Science.gov (United States)

    Nakagawa, Tatsunori; Ishibashi, Jun-Ichiro; Maruyama, Akihiko; Yamanaka, Toshiro; Morimoto, Yusuke; Kimura, Hiroyuki; Urabe, Tetsuro; Fukui, Manabu

    2004-01-01

    This study describes the occurrence of unique dissimilatory sulfite reductase (DSR) genes at a depth of 1,380 m from the deep-sea hydrothermal vent field at the Suiyo Seamount, Izu-Bonin Arc, Western Pacific, Japan. The DSR genes were obtained from microbes that grew in a catheter-type in situ growth chamber deployed for 3 days on a vent and from the effluent water of drilled holes at 5 degrees C and natural vent fluids at 7 degrees C. DSR clones SUIYOdsr-A and SUIYOdsr-B were not closely related to cultivated species or environmental clones. Moreover, samples of microbial communities were examined by PCR-denaturing gradient gel electrophoresis (DGGE) analysis of the 16S rRNA gene. The sequence analysis of 16S rRNA gene fragments obtained from the vent catheter after a 3-day incubation revealed the occurrence of bacterial DGGE bands affiliated with the Aquificae and gamma- and epsilon-Proteobacteria as well as the occurrence of archaeal phylotypes affiliated with the Thermococcales and of a unique archaeon sequence that clustered with "Nanoarchaeota." The DGGE bands obtained from drilled holes and natural vent fluids from 7 to 300 degrees C were affiliated with the delta-Proteobacteria, genus Thiomicrospira, and Pelodictyon. The dominant DGGE bands retrieved from the effluent water of casing pipes at 3 and 4 degrees C were closely related to phylotypes obtained from the Arctic Ocean. Our results suggest the presence of microorganisms corresponding to a unique DSR lineage not detected previously from other geothermal environments.

  8. Temporal dynamics of in-situ fiber-adherent bacterial community under ruminal acidotic conditions determined by 16S rRNA gene profiling.

    Directory of Open Access Journals (Sweden)

    Renee M Petri

    -adherent rumen microbial population and their predicted functional genes occur in both the short (48 h and long term (4 wk under both continuous and interrupted SARA challenge models.

  9. Identidade molecular dos fitoplasmas associados aos enfezamentos do tomateiro e da berinjela com base na análise do gene 16S rDNA Molecular identity of the phytoplasma associated to stunting of tomato and eggplant on the basis of analyses of the 16S rDNA

    Directory of Open Access Journals (Sweden)

    Ana Paula de Oliveira Amaral Mello

    2007-09-01

    Full Text Available Doenças de hortaliças de ocorrência no território brasileiro e em outras áreas do mundo têm sido associadas a diversos fitoplasmas. Na região de Piracicaba-SP e Bragança Paulista-SP, em plantas de tomate e berinjela foram observados sintomas típicos de enfezamento caracterizados por porte reduzido, clorose foliar, superbrotamento de ramos, desenvolvimento anormal do cálice, encurtamento de entre-nós, redução no tamanho de folhas, flores e frutos. Através de duplo PCR, utilizando os iniciadores R16 mF1/mR2 e R16 F2n/R2, fragmentos de DNA de 1,2 kb foram amplificados de amostras sintomáticas, demonstrando a presença de fitoplasma nos tecidos das plantas. O uso de iniciadores específicos demonstrou que estes fitoplasmas eram afiliados ao grupo 16SrIII. Análises de RFLP, usando as enzimas de restrição AluI, HpaII, KpnI, MboI, MseI e RsaI confirmaram que os fitoplasmas detectados eram representantes do grupo 16SrIII. Os fragmentos de DNA amplificados foram clonados em Escherichia coli, sequenciados e comparados, por homologia de seqüência, entre si e com outros fitoplasmas do grupo 16SrIII. Um índice de similaridade de seqüência acima de 95% foi encontrado quando seqüências dos fitoplasmas detectados em tomate e berinjela foram comparadas com aquelas de outros representantes do grupo 16SrIII. Um índice de 98-99% foi obtido quando seqüências dos fitoplasmas encontrados em tomate e berinjela foram comparadas entre si. Estes resultados evidenciaram que o enfezamento do tomateiro e da berinjela podem estar associados a um mesmo fitoplasma, com base na análise de seqüências do gene do 16S rDNA.Vegetable diseases occurring in the Brazilian territory and around the world have been associated with various phytoplasmas. In the region of Piracicaba-SP and Bragança-SP, in eggplant and tomato plants typical symptoms of stunting characterized by reduced canopy, leaf yellowing, proliferation of shoots, calix malformation

  10. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  11. Characterisation of the human uterine microbiome in non-pregnant women through deep sequencing of the V1-2 region of the 16S rRNA gene

    Directory of Open Access Journals (Sweden)

    Hans Verstraelen

    2016-01-01

    Full Text Available Background. It is widely assumed that the uterine cavity in non-pregnant women is physiologically sterile, also as a premise to the long-held view that human infants develop in a sterile uterine environment, though likely reflecting under-appraisal of the extent of the human bacterial metacommunity. In an exploratory study, we aimed to investigate the putative presence of a uterine microbiome in a selected series of non-pregnant women through deep sequencing of the V1-2 hypervariable region of the 16S ribosomal RNA (rRNA gene.Methods. Nineteen women with various reproductive conditions, including subfertility, scheduled for hysteroscopy and not showing uterine anomalies were recruited. Subjects were highly diverse with regard to demographic and medical history and included nulliparous and parous women. Endometrial tissue and mucus harvesting was performed by use of a transcervical device designed to obtain endometrial biopsy, while avoiding cervicovaginal contamination. Bacteria were targeted by use of a barcoded Illumina MiSeq paired-end sequencing method targeting the 16S rRNA gene V1-2 region, yielding an average of 41,194 reads per sample after quality filtering. Taxonomic annotation was pursued by comparison with sequences available through the Ribosomal Database Project and the NCBI database.Results. Out of 183 unique 16S rRNA gene amplicon sequences, 15 phylotypes were present in all samples. In some 90% of the women included, community architecture was fairly similar inasmuch B. xylanisolvens, B. thetaiotaomicron, B. fragilis and an undetermined Pelomonas taxon constituted over one third of the endometrial bacterial community. On the singular phylotype level, six women showed predominance of L. crispatus or L. iners in the presence of the Bacteroides core. Two endometrial communities were highly dissimilar, largely lacking the Bacteroides core, one dominated by L. crispatus and another consisting of a highly diverse community, including

  12. Cloning of an epoxide hydrolase encoding gene from Rhodotorula mucilaginosa and functional expresion in Yarrowia lipolytica

    CSIR Research Space (South Africa)

    Labuschagne, M

    2007-01-01

    Full Text Available , were used to amplify the genomic EH-encoding gene from Rhodotorula mucilaginosa. The 2347 bp genomic sequence revealed a 1979 bp ORF containing nine introns. The cDNA sequence revealed an 1185 bp EH-encoding gene that translates into a 394 amino acid...

  13. Genome-wide identification of structural variants in genes encoding drug targets

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Dahmcke, Christina Mackeprang

    2012-01-01

    The objective of the present study was to identify structural variants of drug target-encoding genes on a genome-wide scale. We also aimed at identifying drugs that are potentially amenable for individualization of treatments based on knowledge about structural variation in the genes encoding...

  14. Genome-wide comparative analysis of NBS-encoding genes between Brassica species and Arabidopsis thaliana.

    Science.gov (United States)

    Yu, Jingyin; Tehrim, Sadia; Zhang, Fengqi; Tong, Chaobo; Huang, Junyan; Cheng, Xiaohui; Dong, Caihua; Zhou, Yanqiu; Qin, Rui; Hua, Wei; Liu, Shengyi

    2014-01-03

    Plant disease resistance (R) genes with the nucleotide binding site (NBS) play an important role in offering resistance to pathogens. The availability of complete genome sequences of Brassica oleracea and Brassica rapa provides an important opportunity for researchers to identify and characterize NBS-encoding R genes in Brassica species and to compare with analogues in Arabidopsis thaliana based on a comparative genomics approach. However, little is known about the evolutionary fate of NBS-encoding genes in the Brassica lineage after split from A. thaliana. Here we present genome-wide analysis of NBS-encoding genes in B. oleracea, B. rapa and A. thaliana. Through the employment of HMM search and manual curation, we identified 157, 206 and 167 NBS-encoding genes in B. oleracea, B. rapa and A. thaliana genomes, respectively. Phylogenetic analysis among 3 species classified NBS-encoding genes into 6 subgroups. Tandem duplication and whole genome triplication (WGT) analyses revealed that after WGT of the Brassica ancestor, NBS-encoding homologous gene pairs on triplicated regions in Brassica ancestor were deleted or lost quickly, but NBS-encoding genes in Brassica species experienced species-specific gene amplification by tandem duplication after divergence of B. rapa and B. oleracea. Expression profiling of NBS-encoding orthologous gene pairs indicated the differential expression pattern of retained orthologous gene copies in B. oleracea and B. rapa. Furthermore, evolutionary analysis of CNL type NBS-encoding orthologous gene pairs among 3 species suggested that orthologous genes in B. rapa species have undergone stronger negative selection than those in B .oleracea species. But for TNL type, there are no significant differences in the orthologous gene pairs between the two species. This study is first identification and characterization of NBS-encoding genes in B. rapa and B. oleracea based on whole genome sequences. Through tandem duplication and whole genome

  15. Broilers fed dietary vitamins harbor higher diversity of cecal bacteria and higher ratio of Clostridium, Faecalibacterium, and Lactobacillus than broilers with no dietary vitamins revealed by 16S rRNA gene clone libraries.

    Science.gov (United States)

    Luo, Yu-heng; Peng, Huan-wei; Wright, André-Denis G; Bai, Shi-ping; Ding, Xue-mei; Zeng, Qiu-feng; Li, Hua; Zheng, Ping; Su, Zhuo-wei; Cui, Ren-yong; Zhang, Ke-ying

    2013-09-01

    Research on the interaction between dietary vitamins and intestinal bacteria is poorly understood. To investigate the effect of dietary vitamins on the cecal bacterial communities, 2 bacterial 16S rRNA gene clone libraries were constructed from pooled PCR products obtained from the cecal digesta of 28-d broilers fed diets with vitamins (V) at the NRC level or with no vitamins (NV). The results showed that BW gain and average feed intake of V broilers was significantly higher (P vitamins can increase the ratio of facultative pathogenic bacteria and decrease the diversity of bacteria in the cecum of broilers. Our results provide new leads for further investigations on the interaction between dietary vitamin additives and the gut health of broilers.

  16. Rapid PCR using nested primers of the 16S rRNA and the hippuricase (hipO) genes to detect Campylobacter jejuni and Campylobacter coli in environmental samples

    DEFF Research Database (Denmark)

    Bang, Dang Duong; Wedderkopp, A.; Pedersen, Karl

    2002-01-01

    sensitivity due to the use of selective media, the low number of bacteria in the samples and possibly also due to the presence of non-culturable or sub-lethally injured stages of the bacteria. The present paper describes a rapid PCR assay using nested primers of the 16S rRNA or the hippuricase (hipO) genes...... to detect Campylobacter jejuni and Campylobacter coli in environmental samples. The sensitivity of the nested PCR was determined to be 0.01 pg/PCR, corresponding to 2-3 colony forming units (cfu) per ml. The nested PCR assays were applied to detect C. jejuni and C. coli in 269 environmental samples...... collected from ten broiler farms. The sensitivity, specificity and the usefulness of the PCR assay for detection of C. jejuni and C coli in environmental samples are presented and discussed....

  17. Phylogenetic diversity and spatial distribution of the microbial community associated with the Caribbean deep-water sponge Polymastia cf. corticata by 16S rRNA, aprA, and amoA gene analysis.

    Science.gov (United States)

    Meyer, Birte; Kuever, Jan

    2008-08-01

    Denaturing gradient gel electrophoresis (DGGE)-based analyses of 16S rRNA, aprA, and amoA genes demonstrated that a phylogenetically diverse and complex microbial community was associated with the Caribbean deep-water sponge Polymastia cf. corticata Ridley and Dendy, 1887. From the 38 archaeal and bacterial 16S rRNA phylotypes identified, 53% branched into the sponge-specific, monophyletic sequence clusters determined by previous studies (considering predominantly shallow-water sponge species), whereas 26% appeared to be P. cf. corticata specifically associated microorganisms ("specialists"); 21% of the phylotypes were confirmed to represent seawater- and sediment-derived proteobacterial species ("contaminants") acquired by filtration processes from the host environment. Consistently, the aprA and amoA gene-based analyses indicated the presence of environmentally derived sulfur- and ammonia-oxidizers besides putative sponge-specific sulfur-oxidizing Gammaproteobacteria and Alphaproteobacteria and a sulfate-reducing archaeon. A sponge-specific, endosymbiotic sulfur cycle as described for marine oligochaetes is proposed to be also present in P. cf. corticata. Overall, the results of this work support the recent studies that demonstrated the sponge species specificity of the associated microbial community while the biogeography of the host collection site has only a minor influence on the composition. In P. cf. corticata, the specificity of the sponge-microbe associations is even extended to the spatial distribution of the microorganisms within the sponge body; distinct bacterial populations were associated with the different tissue sections, papillae, outer and inner cortex, and choanosome. The local distribution of a phylotype within P. cf. corticata correlated with its (1) phylogenetic affiliation, (2) classification as sponge-specific or nonspecifically associated microorganism, and (3) potential ecological role in the host sponge.

  18. Different bacterial communities in heat and gamma irradiation treated replant disease soils revealed by 16S rRNA gene analysis – contribution to improved aboveground apple plant growth?

    Directory of Open Access Journals (Sweden)

    Bunlong eYim

    2015-11-01

    Full Text Available Replant disease (RD severely affects apple production in propagation tree nurseries and in fruit orchards worldwide. This study aimed to investigate the effects of soil disinfection treatments on plant growth and health in a biotest in two different RD soil types under greenhouse conditions and to link the plant growth status with the bacterial community composition at the time of plant sampling. In the biotest performed we observed that the aboveground growth of apple rootstock M26 plants after eight weeks was improved in the two RD soils either treated at 50 °C or with gamma irradiation compared to the untreated RD soils. Total community DNA was extracted from soil loosely adhering to the roots and quantitative real-time PCR revealed no pronounced differences in 16S rRNA gene copy numbers. 16S rRNA gene-based bacterial community analysis by denaturing gradient gel electrophoresis (DGGE and 454-pyrosequencing revealed significant differences in the bacterial community composition even after eight weeks of plant growth. In both soils, the treatments affected different phyla but only the relative abundance of Acidobacteria was reduced by both treatments. The genera Streptomyces, Bacillus, Paenibacillus and Sphingomonas had a higher relative abundance in both heat treated soils, whereas the relative abundance of Mucilaginibacter, Devosia and Rhodanobacter was increased in the gamma-irradiated soils and only the genus Phenylobacterium was increased in both treatments. The increased abundance of genera with potentially beneficial bacteria, i.e. potential degraders of phenolic compounds might have contributed to the improved plant growth in both treatments.

  19. Glycosulfatase-Encoding Gene Cluster in Bifidobacterium breve UCC2003.

    Science.gov (United States)

    Egan, Muireann; Jiang, Hao; O'Connell Motherway, Mary; Oscarson, Stefan; van Sinderen, Douwe

    2016-11-15

    Bifidobacteria constitute a specific group of commensal bacteria typically found in the gastrointestinal tract (GIT) of humans and other mammals. Bifidobacterium breve strains are numerically prevalent among the gut microbiota of many healthy breastfed infants. In the present study, we investigated glycosulfatase activity in a bacterial isolate from a nursling stool sample, B. breve UCC2003. Two putative sulfatases were identified on the genome of B. breve UCC2003. The sulfated monosaccharide N-acetylglucosamine-6-sulfate (GlcNAc-6-S) was shown to support the growth of B. breve UCC2003, while N-acetylglucosamine-3-sulfate, N-acetylgalactosamine-3-sulfate, and N-acetylgalactosamine-6-sulfate did not support appreciable growth. By using a combination of transcriptomic and functional genomic approaches, a gene cluster designated ats2 was shown to be specifically required for GlcNAc-6-S metabolism. Transcription of the ats2 cluster is regulated by a repressor open reading frame kinase (ROK) family transcriptional repressor. This study represents the first description of glycosulfatase activity within the Bifidobacterium genus. Bifidobacteria are saccharolytic organisms naturally found in the digestive tract of mammals and insects. Bifidobacterium breve strains utilize a variety of plant- and host-derived carbohydrates that allow them to be present as prominent members of the infant gut microbiota as well as being present in the gastrointestinal tract of adults. In this study, we introduce a previously unexplored area of carbohydrate metabolism in bifidobacteria, namely, the metabolism of sulfated carbohydrates. B. breve UCC2003 was shown to metabolize N-acetylglucosamine-6-sulfate (GlcNAc-6-S) through one of two sulfatase-encoding gene clusters identified on its genome. GlcNAc-6-S can be found in terminal or branched positions of mucin oligosaccharides, the glycoprotein component of the mucous layer that covers the digestive tract. The results of this study provide

  20. Molecular cloning and functional analysis of the gene encoding ...

    African Journals Online (AJOL)

    Here we report for the first time the cloning of a full-length cDNA encoding GGPPS (Jc-GGPPS) from Jatropha curcas L. The full-length cDNA was 1414 base pair (bp), with an 1110-bp open reading frame (ORF) encoding a 370- amino-acids polypeptide. Bioinformatic analysis revealed that Jc-GGPPS is a member of the ...

  1. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  2. Identification of Genes Encoding the Folate- and Thiamine-Binding Membrane Proteins in Firmicutes

    NARCIS (Netherlands)

    Eudes, Aymerick; Erkens, Guus B.; Slotboom, Dirk J.; Rodionov, Dmitry A.; Naponelli, Valeria; Hanson, Andrew D.

    Genes encoding high-affinity folate- and thiamine-binding proteins (FolT, ThiT) were identified in the Lactobacillus casei genome, expressed in Lactococcus lactis, and functionally characterized. Similar genes occur in many Firmicutes, sometimes next to folate or thiamine salvage genes. Most thiT

  3. Effects of deoxycycline induced lentivirus encoding FasL gene on ...

    African Journals Online (AJOL)

    Abstract. Fas/Fas ligand (FasL)-mediated apoptosis plays a critical role in deletion of activated T cells. This study aimed to construct the lentivirus encoding FasL gene induced by deoxycycline and evaluate its effects on apoptosis of Th1 cells. A plasmid expression system encoding FasL was constructed through utilizing the ...

  4. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.

    2015-01-01

    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  5. Identification of bacteria on the surface of clinically infected and non-infected prosthetic hip joints removed during revision arthroplasties by 16S rRNA gene sequencing and by microbiological culture

    Science.gov (United States)

    Dempsey, Kate E; Riggio, Marcello P; Lennon, Alan; Hannah, Victoria E; Ramage, Gordon; Allan, David; Bagg, Jeremy

    2007-01-01

    It has been postulated that bacteria attached to the surface of prosthetic hip joints can cause localised inflammation, resulting in failure of the replacement joint. However, diagnosis of infection is difficult with traditional microbiological culture methods, and evidence exists that highly fastidious or non-cultivable organisms have a role in implant infections. The purpose of this study was to use culture and culture-independent methods to detect the bacteria present on the surface of prosthetic hip joints removed during revision arthroplasties. Ten consecutive revisions were performed by two surgeons, which were all clinically and radiologically loose. Five of the hip replacement revision surgeries were performed because of clinical infections and five because of aseptic loosening. Preoperative and perioperative specimens were obtained from each patient and subjected to routine microbiological culture. The prostheses removed from each patient were subjected to mild ultrasonication to dislodge adherent bacteria, followed by aerobic and anaerobic microbiological culture. Bacterial DNA was extracted from each sonicate and the 16S rRNA gene was amplified with the universal primer pair 27f/1387r. All 10 specimens were positive for the presence of bacteria by both culture and PCR. PCR products were then cloned, organised into groups by RFLP analysis and one clone from each group was sequenced. Bacteria were identified by comparison of the 16S rRNA gene sequences obtained with those deposited in public access sequence databases. A total of 512 clones were analysed by RFLP analysis, of which 118 were sequenced. Culture methods identified species from the genera Leifsonia (54.3%), Staphylococcus (21.7%), Proteus (8.7%), Brevundimonas (6.5%), Salibacillus (4.3%), Methylobacterium (2.2%) and Zimmermannella (2.2%). Molecular detection methods identified a more diverse microflora. The predominant genus detected was Lysobacter, representing 312 (60.9%) of 512 clones

  6. The presence of two S-layer-protein-encoding genes is conserved among species related to Lactobacillus acidophilus

    NARCIS (Netherlands)

    Boot, H.J.; Kolen, C.P.A.M.; Pot, B.; Kersters, K.; Pouwels, P.H.

    1996-01-01

    Previously we have shown that the type strain of Lactobacillus acidophilus possesses two S-protein-encoding genes, one of which is silent, on a chromosomal segment of 6 kb. The S-protein-encoding gene in the expression site can be exchanged for the silent S-protein-encoding gene by inversion of this

  7. 'Candidatus mycoplasma haemodidelphidis' sp. nov., 'Candidatus mycoplasma haemolamae' sp. nov. and Mycoplasma haemocanis comb. nov., haemotrophic parasites from a naturally infected opossum (Didelphis virginiana), alpaca (Lama pacos) and dog (Canis familiaris): phylogenetic and secondary structural relatedness of their 16S rRNA genes to other mycoplasmas.

    Science.gov (United States)

    Messick, Joanne B; Walker, Pamela G; Raphael, William; Berent, Linda; Shi, Xun

    2002-05-01

    The 16S rRNA sequence of newly characterized haemotrophic bacteria in an opossum (Didelphis virginiana) and alpaca (Lama pacos) was determined. In addition, the 16S rRNA sequence of a haemotrophic parasite in the dog (Canis familiaris) was determined. Sequence alignment and evolutionary analysis as well as secondary structural similarity and signature nucleotide sequence motifs of their 16S rRNA genes, positioned these organisms in the genus Mycoplasma. The highest scoring sequence similarities were 16S rRNA genes from haemotrophic mycoplasma species (Haemobartonella and Eperythrozoon spp.). However, the lack of several higher-order structural idiosyncrasies used to define the pneumoniae group, suggests that these organisms and related haemotrophic mycoplasmas represent a new group of mycoplasmas. It is recommended that the organisms be named 'Candidatus Mycoplasma haemodidelphidis', 'Candidatus Mycoplasma haemolamae' and Mycoplasma haemocanis comb. nov., to provide some indication of the target cell and host species of these parasites, and to reflect their phylogenetic affiliation.

  8. The first report: An analysis of bacterial flora of the first voided urine specimens of patients with male urethritis using the 16S ribosomal RNA gene-based clone library method.

    Science.gov (United States)

    You, Chunlin; Hamasuna, Ryoichi; Ogawa, Midori; Fukuda, Kazumasa; Hachisuga, Toru; Matsumoto, Tetsuro; Taniguchi, Hatsumi

    2016-06-01

    To analyse the bacterial flora of urine from patients with male urethritis using the clone library method. Urine specimens from patients with urethritis were used. The bacterial flora was analysed according to the 16S ribosomal RNA gene-based clone library method. In addition, Neisseria gonorrhoeae, Chlamydia trachomatis, Mycoplasma genitalium, Mycoplasma hominis, Ureaplasma urealyticum or Ureaplasma parvum were detected by the conventional PCR methods (TMA or real-time PCR) and data from the clone library and conventional PCR methods were compared. Among 58 urine specimens, 38 were successfully analysed using the clone library method. From the specimens, 2427 clones were evaluated and 95 bacterial phylotypes were detected. N. gonorrhoeae was detected from 6 specimens and as the predominant bacterial species in 5 specimens. M. genitalium was detected from 5 specimens and as the predominant bacterial species in 3 specimens. C. trachomatis was detected from 15 specimens using the TMA method, but was detected from only 1 specimen using the clone library method. U. parvum was detected from only 2 specimens using the clone library method. In addition, Haemophilus influenzae and Neisseria meningitidis were also detected in 8 and 1 specimens, respectively. Gardnerella vaginalis, which is a potential pathogen for bacterial vaginitis in women, was detected in 10 specimens. The clone library method can detect the occupancy rate of each bacteria species among the bacterial flora and may be a new method for bacterial analyses in male urethritis. Copyright © 2016 Elsevier Ltd. All rights reserved.

  9. Bacterial diversity of the Colombian fermented milk "Suero Costeño" assessed by culturing and high-throughput sequencing and DGGE analysis of 16S rRNA gene amplicons.

    Science.gov (United States)

    Motato, Karina Edith; Milani, Christian; Ventura, Marco; Valencia, Francia Elena; Ruas-Madiedo, Patricia; Delgado, Susana

    2017-12-01

    "Suero Costeño" (SC) is a traditional soured cream elaborated from raw milk in the Northern-Caribbean coast of Colombia. The natural microbiota that characterizes this popular Colombian fermented milk is unknown, although several culturing studies have previously been attempted. In this work, the microbiota associated with SC from three manufacturers in two regions, "Planeta Rica" (Córdoba) and "Caucasia" (Antioquia), was analysed by means of culturing methods in combination with high-throughput sequencing and DGGE analysis of 16S rRNA gene amplicons. The bacterial ecosystem of SC samples was revealed to be composed of lactic acid bacteria belonging to the Streptococcaceae and Lactobacillaceae families; the proportions and genera varying among manufacturers and region of elaboration. Members of the Lactobacillus acidophilus group, Lactocococcus lactis, Streptococcus infantarius and Streptococcus salivarius characterized this artisanal product. In comparison with culturing, the use of molecular in deep culture-independent techniques provides a more realistic picture of the overall bacterial communities residing in SC. Besides the descriptive purpose, these approaches will facilitate a rational strategy to follow (culture media and growing conditions) for the isolation of indigenous strains that allow standardization in the manufacture of SC. Copyright © 2017 Elsevier Ltd. All rights reserved.

  10. Bacteriological Analysis, Antimicrobial Susceptibility and Detection of 16S rRNA gene of Helicobacter pylori by PCR in Drinking Water Samples of Earthquake Affected Areas and Other Parts of Pakistan

    Directory of Open Access Journals (Sweden)

    Rasheed, F.

    2009-01-01

    Full Text Available In Pakistan, clean drinking water is not available to most of the population. Main source of drinking water in Hazara, Azad Jammu and Kashmir-Pakistan is underground and spring water, due to earthquake water reservoirs in these areas were immensely contaminated. Moreover, drinking water treatment and proper sanitary facilities were also lacking. This study was conducted to analyze the quality of drinking water available in most of the cities of Pakistan including earthquake hit areas. For this purpose, 112 water samples were collected and analyzed by membrane filtration method. Microbial isolates were identified using QTS-10 and biochemical tests. Almost all samples were found to be contaminated but in earthquake affected areas quality of drinking water was substandard than other areas of Pakistan. Results revealed the detection of following bacterial pathogens among the water samples: Enterobacter sp., Klebsiellasp., Stenotrophomonas sp., Salmonella sp., Proteus sp., Edwardsiella tarda, Pseudomonas aeruginosa, Vibrio parahaemolyticus, Vibrio cholerae, Escherichia coli, Acinetobacter baumanii, Aeromonas hydrophila, Citrobacter freundii, Shigella dysenteriae, Staphylococcus aureus, Staphylococcus sp. and Streptococcus sp. Furthermore, these bacterial isolates were found to be resistant to ampicillin (32.1%, amoxicillin (30.4%, sulphometoxazole (20.5% and cefaclor (31.3%. All drinking water samples were analyzed for 16S rRNA gene of Helicobacter pylori by using PCR, however no positive result was found in these samples. Based on our results it is suggested that authorities should pay attention to supply safe water and proper sanitary facilities to avoid epidemics of infectious diseases in future.

  11. Characterization of 16S rRNA genes from oil field microbial communities indicates the presence of a variety of sulfate-reducing, fermentative, and sulfide-oxidizing bacteria.

    Science.gov (United States)

    Voordouw, G; Armstrong, S M; Reimer, M F; Fouts, B; Telang, A J; Shen, Y; Gevertz, D

    1996-05-01

    Oil field bacteria were characterized by cloning and sequencing of PCR-amplified 16S rRNA genes. A variety of gram-negative, sulfate-reducing bacteria was detected (16 members of the family Desulfovibrionaceae and 8 members of the family Desulfobacteriaceae). In contrast, a much more limited number of anaerobic, fermentative, or acetogenic bacteria was found (one Clostridium sp., one Eubacterium sp., and one Synergistes sp.). Potential sulfide oxidizers and/or microaerophiles (Thiomicrospira, Arcobacter, Campylobacter, and Oceanospirillum spp.) were also detected. The first two were prominently amplified from uncultured production water DNA and represented 28 and 47% of all clones, respectively. Growth on media containing sulfide as the electron donor and nitrate as the electron acceptor and designed for the isolation of Thiomicrospira spp. gave only significant enrichment of the Campylobacter sp., which was shown to be present in different western Canadian oil fields. This newly discovered sulfide oxidizer may provide a vital link in the oil field sulfur cycle by reoxidizing sulfide formed by microbial sulfate or sulfur reduction.

  12. Escherichia coli rpiA gene encoding ribose phosphate isomerase A

    DEFF Research Database (Denmark)

    Hove-Jensen, Bjarne; Maigaard, Marianne

    1993-01-01

    The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment was seque......The rpiA gene encoding ribose phosphate isomerase A was cloned from phage 1A2(471) of the Kohara gene library. Subcloning, restriction, and complementation analyses revealed an 1,800-bp SspI-generated DNA fragment that contained the entire control and coding sequences. This DNA fragment...

  13. Methyltransferase That Modifies Guanine 966 of the 16 S rRNA: FUNCTIONAL IDENTIFICATION AND TERTIARY STRUCTURE*

    Science.gov (United States)

    Lesnyak, Dmitry V.; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V.; Bogdanov, Alexey A.; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A.

    2010-01-01

    N2-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m2G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m2G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m2G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05 Å. The structure closely resembles RsmC rRNA methyltransferase, specific for m2G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m2G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed. PMID:17189261

  14. Methyltransferase that modifies guanine 966 of the 16 S rRNA: functional identification and tertiary structure.

    Science.gov (United States)

    Lesnyak, Dmitry V; Osipiuk, Jerzy; Skarina, Tatiana; Sergiev, Petr V; Bogdanov, Alexey A; Edwards, Aled; Savchenko, Alexei; Joachimiak, Andrzej; Dontsova, Olga A

    2007-02-23

    N(2)-Methylguanine 966 is located in the loop of Escherichia coli 16 S rRNA helix 31, forming a part of the P-site tRNA-binding pocket. We found yhhF to be a gene encoding for m(2)G966 specific 16 S rRNA methyltransferase. Disruption of the yhhF gene by kanamycin resistance marker leads to a loss of modification at G966. The modification could be rescued by expression of recombinant protein from the plasmid carrying the yhhF gene. Moreover, purified m(2)G966 methyltransferase, in the presence of S-adenosylomethionine (AdoMet), is able to methylate 30 S ribosomal subunits that were purified from yhhF knock-out strain in vitro. The methylation is specific for G966 base of the 16 S rRNA. The m(2)G966 methyltransferase was crystallized, and its structure has been determined and refined to 2.05A(.) The structure closely resembles RsmC rRNA methyltransferase, specific for m(2)G1207 of the 16 S rRNA. Structural comparisons and analysis of the enzyme active site suggest modes for binding AdoMet and rRNA to m(2)G966 methyltransferase. Based on the experimental data and current nomenclature the protein expressed from the yhhF gene was renamed to RsmD. A model for interaction of RsmD with ribosome has been proposed.

  15. Community Structure of Denitrifiers, Bacteria, and Archaea along Redox Gradients in Pacific Northwest Marine Sediments by Terminal Restriction Fragment Length Polymorphism Analysis of Amplified Nitrite Reductase (nirS) and 16S rRNA Genes

    Science.gov (United States)

    Braker, Gesche; Ayala-del-Río, Héctor L.; Devol, Allan H.; Fesefeldt, Andreas; Tiedje, James M.

    2001-01-01

    Steep vertical gradients of oxidants (O2 and NO3−) in Puget Sound and Washington continental margin sediments indicate that aerobic respiration and denitrification occur within the top few millimeters to centimeters. To systematically explore the underlying communities of denitrifiers, Bacteria, and Archaea along redox gradients at distant geographic locations, nitrite reductase (nirS) genes and bacterial and archaeal 16S rRNA genes (rDNAs) were PCR amplified and analyzed by terminal restriction fragment length polymorphism (T-RFLP) analysis. The suitablility of T-RFLP analysis for investigating communities of nirS-containing denitrifiers was established by the correspondence of dominant terminal restriction fragments (T-RFs) of nirS to computer-simulated T-RFs of nirS clones. These clones belonged to clusters II, III, and IV from the same cores and were analyzed in a previous study (G. Braker, J. Zhou, L. Wu, A. H. Devol, and J. M. Tiedje, Appl. Environ. Microbiol. 66:2096–2104, 2000). T-RFLP analysis of nirS and bacterial rDNA revealed a high level of functional and phylogenetic diversity, whereas the level of diversity of Archaea was lower. A comparison of T-RFLPs based on the presence or absence of T-RFs and correspondence analysis based on the frequencies and heights of T-RFs allowed us to group sediment samples according to the sampling location and thus clearly distinguish Puget Sound and the Washington margin populations. However, changes in community structure within sediment core sections during the transition from aerobic to anaerobic conditions were minor. Thus, within the top layers of marine sediments, redox gradients seem to result from the differential metabolic activities of populations of similar communities, probably through mixing by marine invertebrates rather than from the development of distinct communities. PMID:11282647

  16. Molecular quantification of genes encoding for green-fluorescent proteins

    DEFF Research Database (Denmark)

    Felske, A; Vandieken, V; Pauling, B V

    2003-01-01

    A quantitative PCR approach is presented to analyze the amount of recombinant green fluorescent protein (gfp) genes in environmental DNA samples. The quantification assay is a combination of specific PCR amplification and temperature gradient gel electrophoresis (TGGE). Gene quantification...... PCR strategy is a highly specific and sensitive way to monitor recombinant DNA in environments like the efflux of a biotechnological plant....

  17. Genes encoding enzymes of the lignin biosynthesis pathway in Eucalyptus

    Directory of Open Access Journals (Sweden)

    Ricardo Harakava

    2005-01-01

    Full Text Available Eucalyptus ESTs libraries were screened for genes involved in lignin biosynthesis. This search was performed under the perspective of recent revisions on the monolignols biosynthetic pathway. Eucalyptus orthologues of all genes of the phenylpropanoid pathway leading to lignin biosynthesis reported in other plant species were identified. A library made with mRNAs extracted from wood was enriched for genes involved in lignin biosynthesis and allowed to infer the isoforms of each gene family that play a major role in wood lignin formation. Analysis of the wood library suggests that, besides the enzymes of the phenylpropanoids pathway, chitinases, laccases, and dirigent proteins are also important for lignification. Colocalization of several enzymes on the endoplasmic reticulum membrane, as predicted by amino acid sequence analysis, supports the existence of metabolic channeling in the phenylpropanoid pathway. This study establishes a framework for future investigations on gene expression level, protein expression and enzymatic assays, sequence polymorphisms, and genetic engineering.

  18. A highly divergent gene cluster in honey bees encodes a novel silk family.

    Science.gov (United States)

    Sutherland, Tara D; Campbell, Peter M; Weisman, Sarah; Trueman, Holly E; Sriskantha, Alagacone; Wanjura, Wolfgang J; Haritos, Victoria S

    2006-11-01

    The pupal cocoon of the domesticated silk moth Bombyx mori is the best known and most extensively studied insect silk. It is not widely known that Apis mellifera larvae also produce silk. We have used a combination of genomic and proteomic techniques to identify four honey bee fiber genes (AmelFibroin1-4) and two silk-associated genes (AmelSA1 and 2). The four fiber genes are small, comprise a single exon each, and are clustered on a short genomic region where the open reading frames are GC-rich amid low GC intergenic regions. The genes encode similar proteins that are highly helical and predicted to form unusually tight coiled coils. Despite the similarity in size, structure, and composition of the encoded proteins, the genes have low primary sequence identity. We propose that the four fiber genes have arisen from gene duplication events but have subsequently diverged significantly. The silk-associated genes encode proteins likely to act as a glue (AmelSA1) and involved in silk processing (AmelSA2). Although the silks of honey bees and silkmoths both originate in larval labial glands, the silk proteins are completely different in their primary, secondary, and tertiary structures as well as the genomic arrangement of the genes encoding them. This implies independent evolutionary origins for these functionally related proteins.

  19. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  20. Nucleotide sequence of the Agrobacterium tumefaciens octopine Ti plasmid-encoded tmr gene

    NARCIS (Netherlands)

    Heidekamp, F.; Dirkse, W.G.; Hille, J.; Ormondt, H. van

    1983-01-01

    The nucleotide sequence of the tmr gene, encoded by the octopine Ti plasmid from Agrobacterium tumefaciens (pTiAch5), was determined. The T-DNA, which encompasses this gene, is involved in tumor formation and maintenance, and probably mediates the cytokinin-independent growth of transformed plant

  1. The Schizosaccharomyces pombe mam1 gene encodes an ABC transporter mediating secretion of M-factor

    DEFF Research Database (Denmark)

    Christensen, P U; Davey, William John; Nielsen, O

    1997-01-01

    In the fission yeast Schizosaccharomyces pombe, cells of opposite mating type communicate via diffusible peptide pheromones prior to mating. We have cloned the S. pombe mam1 gene, which encodes a 1336-amino acid protein belonging to the ATP-binding cassette (ABC) superfamily. The mam1 gene is onl...

  2. The mitochondrial gene encoding ribosomal protein S12 has been translocated to the nuclear genome in Oenothera.

    Science.gov (United States)

    Grohmann, L; Brennicke, A; Schuster, W

    1992-01-01

    The Oenothera mitochondrial genome contains only a gene fragment for ribosomal protein S12 (rps12), while other plants encode a functional gene in the mitochondrion. The complete Oenothera rps12 gene is located in the nucleus. The transit sequence necessary to target this protein to the mitochondrion is encoded by a 5'-extension of the open reading frame. Comparison of the amino acid sequence encoded by the nuclear gene with the polypeptides encoded by edited mitochondrial cDNA and genomic sequences of other plants suggests that gene transfer between mitochondrion and nucleus started from edited mitochondrial RNA molecules. Mechanisms and requirements of gene transfer and activation are discussed. Images PMID:1454526

  3. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  4. Escherichia coli yjjPB genes encode a succinate transporter important for succinate production.

    Science.gov (United States)

    Fukui, Keita; Nanatani, Kei; Hara, Yoshihiko; Yamakami, Suguru; Yahagi, Daiki; Chinen, Akito; Tokura, Mitsunori; Abe, Keietsu

    2017-09-01

    Under anaerobic conditions, Escherichia coli produces succinate from glucose via the reductive tricarboxylic acid cycle. To date, however, no genes encoding succinate exporters have been established in E. coli. Therefore, we attempted to identify genes encoding succinate exporters by screening an E. coli MG1655 genome library. We identified the yjjPB genes as candidates encoding a succinate transporter, which enhanced succinate production in Pantoea ananatis under aerobic conditions. A complementation assay conducted in Corynebacterium glutamicum strain AJ110655ΔsucE1 demonstrated that both YjjP and YjjB are required for the restoration of succinate production. Furthermore, deletion of yjjPB decreased succinate production in E. coli by 70% under anaerobic conditions. Taken together, these results suggest that YjjPB constitutes a succinate transporter in E. coli and that the products of both genes are required for succinate export.

  5. Molecular comparison of the structural proteins encoding gene clusters of two related Lactobacillus delbrueckii bacteriophages.

    Science.gov (United States)

    Vasala, A; Dupont, L; Baumann, M; Ritzenthaler, P; Alatossava, T

    1993-01-01

    Virulent phage LL-H and temperate phage mv4 are two related bacteriophages of Lactobacillus delbrueckii. The gene clusters encoding structural proteins of these two phages have been sequenced and further analyzed. Six open reading frames (ORF-1 to ORF-6) were detected. Protein sequencing and Western immunoblotting experiments confirmed that ORF-3 (g34) encoded the main capsid protein Gp34. The presence of a putative late promoter in front of the phage LL-H g34 gene was suggested by primer extension experiments. Comparative sequence analysis between phage LL-H and phage mv4 revealed striking similarities in the structure and organization of this gene cluster, suggesting that the genes encoding phage structural proteins belong to a highly conservative module. Images PMID:8497043

  6. Motif analysis unveils the possible co-regulation of chloroplast genes and nuclear genes encoding chloroplast proteins.

    Science.gov (United States)

    Wang, Ying; Ding, Jun; Daniell, Henry; Hu, Haiyan; Li, Xiaoman

    2012-09-01

    Chloroplasts play critical roles in land plant cells. Despite their importance and the availability of at least 200 sequenced chloroplast genomes, the number of known DNA regulatory sequences in chloroplast genomes are limited. In this paper, we designed computational methods to systematically study putative DNA regulatory sequences in intergenic regions near chloroplast genes in seven plant species and in promoter sequences of nuclear genes in Arabidopsis and rice. We found that -35/-10 elements alone cannot explain the transcriptional regulation of chloroplast genes. We also concluded that there are unlikely motifs shared by intergenic sequences of most of chloroplast genes, indicating that these genes are regulated differently. Finally and surprisingly, we found five conserved motifs, each of which occurs in no more than six chloroplast intergenic sequences, are significantly shared by promoters of nuclear-genes encoding chloroplast proteins. By integrating information from gene function annotation, protein subcellular localization analyses, protein-protein interaction data, and gene expression data, we further showed support of the functionality of these conserved motifs. Our study implies the existence of unknown nuclear-encoded transcription factors that regulate both chloroplast genes and nuclear genes encoding chloroplast protein, which sheds light on the understanding of the transcriptional regulation of chloroplast genes.

  7. Variations in gut microbiota and fecal metabolic phenotype associated with Fenbendazole and Ivermectin Tablets by 16S rRNA gene sequencing and LC/MS-based metabolomics in Amur tiger.

    Science.gov (United States)

    He, Fengping; Zhai, Jiancheng; Zhang, Le; Liu, Dan; Ma, Yue; Rong, Ke; Xu, Yanchun; Ma, Jianzhang

    2018-05-15

    The Amur tiger is one of the most endangered species in the world, and the healthy population of captive Amur tigers assists the recovery of the wild population. Gut microbes have been shown to be important for human disease and health, but little research exists regarding the microbiome of Amur tigers in captivity. In this study, we used an integrated approach of 16S rRNA gene sequencing combined with ultra-high-performance liquid chromatography-mass spectrometry (UHPLC-MS)-based metabolomics to analyze the effects of Fenbendazole and Ivermectin Tablets on the gut microbiota and fecal metabolic phenotype of the Amur tiger. The relative abundances of the bacterial genera Collinsella, Clostridium XI and Megamonas were decreased, whereas those of Escherichia and Clostridium sensu stricto were increased in experimental Amur tigers compared with those in normal controls. Meanwhile, distinct changes in the fecal metabolic phenotype of the experimental Amur tigers were also found, including lower levels of acrylic acid, acetoacetate and catechol and higher amounts of 5,6-dihydrouracil, adenine hydrochloride hydrate and galactitol. Moreover, the differentially abundant gut microbes were substantially associated with the altered fecal metabolites, especially the bacteria in the Firmicutes and Actinomycetes, which were involved in the metabolism of 5,6-dihydrouracil, 6-phospho-d-gluconate and 1-methylnicotinamide. Our results indicate for the first time that Fenbendazole and Ivermectin Tablets not only disturb the gut microbiota at the abundance level but also alter the metabolic homeostasis of the Amur tiger. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  9. Gene encoding virulence markers among Escherichia coli isolates ...

    African Journals Online (AJOL)

    River water sources and diarrhoeic stools of residents in the Venda Region, Limpopo Province of South Africa were analysed for the prevalence of Escherichia coli (E. coli) and the presence of virulence genes among the isolates. A control group of 100 nondiarrhoeic stool samples was included. Escherichia coli was ...

  10. Cloning and heterologous expression of a gene encoding lycopene ...

    African Journals Online (AJOL)

    This report describes the cloning and expression of a gene lycopene epsilon cyclase, (LCYE) from Camellia sinensis var assamica which is a precursor of the carotenoid lutein in tea. The 1982 bp cDNA sequence with 1599 bp open reading frame of LCYE was identified from an SSH library constructed for quality trait in tea.

  11. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  12. Comparative differential gene expression analysis of nucleus-encoded proteins for Rafflesia cantleyi against Arabidopsis thaliana

    Science.gov (United States)

    Ng, Siuk-Mun; Lee, Xin-Wei; Wan, Kiew-Lian; Firdaus-Raih, Mohd

    2015-09-01

    Regulation of functional nucleus-encoded proteins targeting the plastidial functions was comparatively studied for a plant parasite, Rafflesia cantleyi versus a photosynthetic plant, Arabidopsis thaliana. This study involved two species of different feeding modes and different developmental stages. A total of 30 nucleus-encoded proteins were found to be differentially-regulated during two stages in the parasite; whereas 17 nucleus-encoded proteins were differentially-expressed during two developmental stages in Arabidopsis thaliana. One notable finding observed for the two plants was the identification of genes involved in the regulation of photosynthesis-related processes where these processes, as expected, seem to be present only in the autotroph.

  13. Smoking, genes encoding dopamine pathway and risk for Parkinson's disease.

    Science.gov (United States)

    Gu, Zhuqin; Feng, Xiuli; Dong, Xiumin; Chan, Piu

    2010-09-20

    Smoking has been reported to be inversely associated with Parkinson's disease (PD) in many studies, but a recent study in China found that smoking increased the risk of PD. Variants in genes associated with dopamine metabolism found to increase the risk for PD have also been associated with smoking behavior. To investigate the association between smoking and PD in a Chinese population and determine whether the genetic variants of genes involved in dopamine metabolism influence the relationship between smoking and risk for PD. Chinese PD patients were recruited from Xuanwu Hospital. Controls were sampled from community. Detailed information on life-long smoking behavior was collected by face-to-face interview. Genotypes were determined for SLC6A3 VNTR, COMT Val108/158Met and MAO-B intron13 A/G polymorphisms by PCR-RFLP, DHPLC and sequencing. Chi-square and logistic regression model were used in the analysis. 176 PD cases and 354 controls were enrolled in this study. 23.9% cases are smokers, compared to 48.0% in controls. Ever smoking is inversely associated with PD (odds ratio=0.14, 95% CI 0.08-0.26, adjusted for age and gender). None of the above-mentioned genetic polymorphisms was associated with PD risk or smoking. When each variant was included in the logistic regression model, the inverse association between smoking and PD remained the same, and the interactions between smoking and variants were not significant in the model. Our data support a reduction of PD risk associated with smoking in a Chinese population. These variants of genes associated with DA uptake and metabolism do not affect the inverse association between smoking and PD. Copyright 2010 Elsevier Ireland Ltd. All rights reserved.

  14. Staphylococcus aureus nasal carriage in Ukraine: antibacterial resistance and virulence factor encoding genes.

    Science.gov (United States)

    Netsvyetayeva, Irina; Fraczek, Mariusz; Piskorska, Katarzyna; Golas, Marlena; Sikora, Magdalena; Mlynarczyk, Andrzej; Swoboda-Kopec, Ewa; Marusza, Wojciech; Palmieri, Beniamino; Iannitti, Tommaso

    2014-03-05

    The number of studies regarding the incidence of multidrug resistant strains and distribution of genes encoding virulence factors, which have colonized the post-Soviet states, is considerably limited. The aim of the study was (1) to assess the Staphylococcus (S.) aureus nasal carriage rate, including Methicillin Resistant S. aureus (MRSA) strains in adult Ukrainian population, (2) to determine antibiotic resistant pattern and (3) the occurrence of Panton Valentine Leukocidine (PVL)-, Fibronectin-Binding Protein A (FnBPA)- and Exfoliative Toxin (ET)-encoding genes. Nasal samples for S. aureus culture were obtained from 245 adults. The susceptibility pattern for several classes of antibiotics was determined by disk diffusion method according to the European Committee on Antimicrobial Susceptibility Testing (EUCAST) guidelines. The virulence factor encoding genes, mecA, lukS-lukF, eta, etb, etd, fnbA, were detected by Polymerase Chain Reaction (PCR). The S. aureus nasal carriage rate was 40%. The prevalence of nasal MRSA carriage in adults was 3.7%. LukS-lukF genes were detected in over 58% of the strains. ET-encoding genes were detected in over 39% of the strains and the most prevalent was etd. The fnbA gene was detected in over 59% of the strains. All MRSA isolates tested were positive for the mecA gene. LukS-lukF genes and the etd gene were commonly co-present in MRSA, while lukS-lukF genes and the fnbA gene were commonly co-present in Methicillin Sensitive S. aureus (MSSA) isolates. No significant difference was detected between the occurrence of lukS-lukF genes (P > 0.05) and the etd gene (P > 0.05) when comparing MRSA and MSSA. The occurrence of the fnbA gene was significantly more frequent in MSSA strains (P aureus is a common cause of infection. The prevalence of S. aureus nasal carriage in our cohort of patients from Ukraine was 40.4%. We found that 9.1% of the strains were classified as MRSA and all MRSA isolates tested positive for the mecA gene

  15. A neurotransmitter transporter encoded by the Drosophila inebriated gene

    Science.gov (United States)

    Soehnge, Holly; Huang, Xi; Becker, Marie; Whitley, Penn; Conover, Diana; Stern, Michael

    1996-01-01

    Behavioral and electrophysiological studies on mutants defective in the Drosophila inebriated (ine) gene demonstrated increased excitability of the motor neuron. In this paper, we describe the cloning and sequence analysis of ine. Mutations in ine were localized on cloned DNA by restriction mapping and restriction fragment length polymorphism (RFLP) mapping of ine mutants. DNA from the ine region was then used to isolate an ine cDNA. In situ hybridization of ine transcripts to developing embryos revealed expression of this gene in several cell types, including the posterior hindgut, Malpighian tubules, anal plate, garland cells, and a subset of cells in the central nervous system. The ine cDNA contains an open reading frame of 658 amino acids with a high degree of sequence similarity to members of the Na+/Cl−-dependent neurotransmitter transporter family. Members of this family catalyze the rapid reuptake of neurotransmitters released into the synapse and thereby play key roles in controlling neuronal function. We conclude that ine mutations cause increased excitability of the Drosophila motor neuron by causing the defective reuptake of the substrate neurotransmitter of the ine transporter and thus overstimulation of the motor neuron by this neurotransmitter. From this observation comes a unique opportunity to perform a genetic dissection of the regulation of excitability of the Drosophila motor neuron. PMID:8917579

  16. Co-expression of an Erwinia chrysanthemi pectate lyase-encoding gene (pelE) and an E. carotovora polygalacturonase-encoding gene (peh1) in Saccharomyces cerevisiae.

    Science.gov (United States)

    Laing, E; Pretorius, I S

    1993-05-01

    A pectate lyase (PL)-encoding gene (pelE) from Erwinia chrysanthemi and a polygalacturonase (PG)-encoding gene (peh1) from E. carotovora were each inserted between a novel yeast expression-secretion cassette and a yeast gene terminator, and cloned separately into a yeast-centromeric shuttle vector (YCp50), generating recombinant plasmids pAMS12 and pAMS13. Transcription initiation signals present in the expression-secretion cassette were derived from the yeast alcohol dehydrogenase gene promoter (ADC1P), whereas the transcription termination signals were derived from the yeast tryptophan synthase gene terminator (TRP5T). Secretion of PL and PG was directed by the signal sequence of the yeast mating pheromone alpha-factor (MF alpha 1s). A pectinase cassette comprising ADC1P-MF alpha 1s-pelE-TRP5T and ADC1P-MF alpha 1s-peh1-TRP5T was subcloned into YCp50, generating plasmid pAMS14. Subsequently, the dominant selectable Geneticin G418-resistance (GtR) marker, APH1, inserted between the yeast uridine diphosphoglucose 4-epimerase gene promoter (GAL10P) and yeast orotidine-5'-phosphate carboxylase gene terminator (URA3T), was cloned into pAMS14, resulting in plasmid pAMS15. Plasmids pAMS12, pAMS13 and pAMS14 were transformed into a laboratory strain of Saccharomyces cerevisiae, whereas pAMS15 was stably introduced into two commercial wine yeast strains. DNA-DNA and DNA-RNA hybridization analyses revealed the presence of these plasmids, and the pelE and peh1 transcripts in the yeast transformants, respectively. A polypectate agarose assay indicated the extracellular production of biologically active PL and PG by the S. cerevisiae transformants and confirmed that co-expression of the pelE and peh1 genes synergistically enhanced pectate degradation.

  17. Molecular evolution of the Paramyxoviridae and Rhabdoviridae multiple-protein-encoding P gene.

    Science.gov (United States)

    Jordan, I K; Sutter, B A; McClure, M A

    2000-01-01

    Presented here is an analysis of the molecular evolutionary dynamics of the P gene among 76 representative sequences of the Paramyxoviridae and Rhabdoviridae RNA virus families. In a number of Paramyxoviridae taxa, as well as in vesicular stomatitis viruses of the Rhabdoviridae, the P gene encodes multiple proteins from a single genomic RNA sequence. These products include the phosphoprotein (P), as well as the C and V proteins. The complexity of the P gene makes it an intriguing locus to study from an evolutionary perspective. Amino acid sequence alignments of the proteins encoded at the P and N loci were used in independent phylogenetic reconstructions of the Paramyxoviridae and Rhabdoviridae families. P-gene-coding capacities were mapped onto the Paramyxoviridae phylogeny, and the most parsimonious path of multiple-coding-capacity evolution was determined. Levels of amino acid variation for Paramyxoviridae and Rhabdoviridae P-gene-encoded products were also analyzed. Proteins encoded in overlapping reading frames from the same nucleotides have different levels of amino acid variation. The nucleotide architecture that underlies the amino acid variation was determined in order to evaluate the role of selection in the evolution of the P gene overlapping reading frames. In every case, the evolution of one of the proteins encoded in the overlapping reading frames has been constrained by negative selection while the other has evolved more rapidly. The integrity of the overlapping reading frame that represents a derived state is generally maintained at the expense of the ancestral reading frame encoded by the same nucleotides. The evolution of such multicoding sequences is likely a response by RNA viruses to selective pressure to maximize genomic information content while maintaining small genome size. The ability to evolve such a complex genomic strategy is intimately related to the dynamics of the viral quasispecies, which allow enhanced exploration of the adaptive

  18. Cellulolytic (cel) genes of Clostridium thermocellum F7 and the proteins encoded by them

    International Nuclear Information System (INIS)

    Piruzyan, E.S.; Mogutov, M.A.; Velikodvorskaya, G.A.; Pushkarskaya, T.A.

    1988-01-01

    This study is concerned with genes cell, ce12, and ce13 encoding the endoglucanase of the cellulolytic complex of the anaerobic thermophilic Clostridium thermocellum F7 bacteria, these genes having been closed by us earlier. The authors present the characteristics of proteins synthesized by the cel genes in the minicell system of the strain Escherichia coli K-12 X925. The molecular weights of the proteins encoded by genes cell, ce12, and ce13 are 30,000, 45,000, and 50,000 dalton, respectively. The study of the homology of the cloned section of the C. thermocellum DNA containing the endoglucanase genes, using Southern's blot-hybridization method, did not reveal their physical linkage in the genome. The authors detected a plasmid with a size of about 30 kb in the cells of the C. thermocellum F7 strain investigated

  19. The euryhaline yeast Debaryomyces hansenii has two catalase genes encoding enzymes with differential activity profile.

    Science.gov (United States)

    Segal-Kischinevzky, Claudia; Rodarte-Murguía, Beatriz; Valdés-López, Victor; Mendoza-Hernández, Guillermo; González, Alicia; Alba-Lois, Luisa

    2011-03-01

    Debaryomyces hansenii is a spoilage yeast able to grow in a variety of ecological niches, from seawater to dairy products. Results presented in this article show that (i) D. hansenii has an inherent resistance to H2O2 which could be attributed to the fact that this yeast has a basal catalase activity which is several-fold higher than that observed in Saccharomyces cerevisiae under the same culture conditions, (ii) D. hansenii has two genes (DhCTA1 and DhCTT1) encoding two catalase isozymes with a differential enzymatic activity profile which is not strictly correlated with a differential expression profile of the encoding genes.

  20. Genes encoding calmodulin-binding proteins in the Arabidopsis genome

    Science.gov (United States)

    Reddy, Vaka S.; Ali, Gul S.; Reddy, Anireddy S N.

    2002-01-01

    Analysis of the recently completed Arabidopsis genome sequence indicates that approximately 31% of the predicted genes could not be assigned to functional categories, as they do not show any sequence similarity with proteins of known function from other organisms. Calmodulin (CaM), a ubiquitous and multifunctional Ca(2+) sensor, interacts with a wide variety of cellular proteins and modulates their activity/function in regulating diverse cellular processes. However, the primary amino acid sequence of the CaM-binding domain in different CaM-binding proteins (CBPs) is not conserved. One way to identify most of the CBPs in the Arabidopsis genome is by protein-protein interaction-based screening of expression libraries with CaM. Here, using a mixture of radiolabeled CaM isoforms from Arabidopsis, we screened several expression libraries prepared from flower meristem, seedlings, or tissues treated with hormones, an elicitor, or a pathogen. Sequence analysis of 77 positive clones that interact with CaM in a Ca(2+)-dependent manner revealed 20 CBPs, including 14 previously unknown CBPs. In addition, by searching the Arabidopsis genome sequence with the newly identified and known plant or animal CBPs, we identified a total of 27 CBPs. Among these, 16 CBPs are represented by families with 2-20 members in each family. Gene expression analysis revealed that CBPs and CBP paralogs are expressed differentially. Our data suggest that Arabidopsis has a large number of CBPs including several plant-specific ones. Although CaM is highly conserved between plants and animals, only a few CBPs are common to both plants and animals. Analysis of Arabidopsis CBPs revealed the presence of a variety of interesting domains. Our analyses identified several hypothetical proteins in the Arabidopsis genome as CaM targets, suggesting their involvement in Ca(2+)-mediated signaling networks.

  1. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  2. Genetic variants in nuclear-encoded mitochondrial genes influence AIDS progression.

    Directory of Open Access Journals (Sweden)

    Sher L Hendrickson

    2010-09-01

    Full Text Available The human mitochondrial genome includes only 13 coding genes while nuclear-encoded genes account for 99% of proteins responsible for mitochondrial morphology, redox regulation, and energetics. Mitochondrial pathogenesis occurs in HIV patients and genetically, mitochondrial DNA haplogroups with presumed functional differences have been associated with differential AIDS progression.Here we explore whether single nucleotide polymorphisms (SNPs within 904 of the estimated 1,500 genes that specify nuclear-encoded mitochondrial proteins (NEMPs influence AIDS progression among HIV-1 infected patients. We examined NEMPs for association with the rate of AIDS progression using genotypes generated by an Affymetrix 6.0 genotyping array of 1,455 European American patients from five US AIDS cohorts. Successfully genotyped SNPs gave 50% or better haplotype coverage for 679 of known NEMP genes. With a Bonferroni adjustment for the number of genes and tests examined, multiple SNPs within two NEMP genes showed significant association with AIDS progression: acyl-CoA synthetase medium-chain family member 4 (ACSM4 on chromosome 12 and peroxisomal D3,D2-enoyl-CoA isomerase (PECI on chromosome 6.Our previous studies on mitochondrial DNA showed that European haplogroups with presumed functional differences were associated with AIDS progression and HAART mediated adverse events. The modest influences of nuclear-encoded mitochondrial genes found in the current study add support to the idea that mitochondrial function plays a role in AIDS pathogenesis.

  3. The Expression of Genes Encoding Secreted Proteins in Medicago truncatula A17 Inoculated Roots

    Directory of Open Access Journals (Sweden)

    LUCIA KUSUMAWATI

    2013-09-01

    Full Text Available Subtilisin-like serine protease (MtSBT, serine carboxypeptidase (MtSCP, MtN5, non-specific lipid transfer protein (MtnsLTP, early nodulin2-like protein (MtENOD2-like, FAD-binding domain containing protein (MtFAD-BP1, and rhicadhesin receptor protein (MtRHRE1 were among 34 proteins found in the supernatant of M. truncatula 2HA and sickle cell suspension cultures. This study investigated the expression of genes encoding those proteins in roots and developing nodules. Two methods were used: quantitative real time RT-PCR and gene expression analysis (with promoter:GUS fusion in roots. Those proteins are predicted as secreted proteins which is indirectly supported by the findings that promoter:GUS fusions of six of the seven genes encoding secreted proteins were strongly expressed in the vascular bundle of transgenic hairy roots. All six genes have expressed in 14-day old nodule. The expression levels of the selected seven genes were quantified in Sinorhizobium-inoculated and control plants using quantitative real time RT-PCR. In conclusion, among seven genes encoding secreted proteins analyzed, the expression level of only one gene, MtN5, was up-regulated significantly in inoculated root segments compared to controls. The expression of MtSBT1, MtSCP1, MtnsLTP, MtFAD-BP1, MtRHRE1 and MtN5 were higher in root tip than in other tissues examined.

  4. Nucleotide sequences of the genes encoding fructosebisphosphatase and phosphoribulokinase from Xanthobacter flavus H4-14

    NARCIS (Netherlands)

    Meijer, Wilhelmus; Enequist, H.G.; Terpstra, Peter; Dijkhuizen, L.

    The genes encoding fructosebisphosphatase and phosphoribulokinase present on a 2.5 kb SalI fragment from Xanthobacter flavus H4-14 were sequenced. Two large open reading frames (ORFs) were identified, preceded by plausible ribosome-binding sites. The ORFs were transcribed in the same direction and

  5. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  6. Cloning and expression of clt genes encoding milk-clotting proteases from Myxococcus xanthus 422.

    Science.gov (United States)

    Poza, M; Prieto-Alcedo, M; Sieiro, C; Villa, T G

    2004-10-01

    The screening of a gene library of the milk-clotting strain Myxococcus xanthus 422 constructed in Escherichia coli allowed the description of eight positive clones containing 26 open reading frames. Only three of them (cltA, cltB, and cltC) encoded proteins that exhibited intracellular milk-clotting ability in E. coli, Saccharomyces cerevisiae, and Pichia pastoris expression systems.

  7. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  8. Cloning of human genes encoding novel G protein-coupled receptors

    Energy Technology Data Exchange (ETDEWEB)

    Marchese, A.; Docherty, J.M.; Heiber, M. [Univ. of Toronto, (Canada)] [and others

    1994-10-01

    We report the isolation and characterization of several novel human genes encoding G protein-coupled receptors. Each of the receptors contained the familiar seven transmembrane topography and most closely resembled peptide binding receptors. Gene GPR1 encoded a receptor protein that is intronless in the coding region and that shared identity (43% in the transmembrane regions) with the opioid receptors. Northern blot analysis revealed that GPR1 transcripts were expressed in the human hippocampus, and the gene was localized to chromosome 15q21.6. Gene GPR2 encoded a protein that most closely resembled an interleukin-8 receptor (51% in the transmembrane regions), and this gene, not expressed in the six brain regions examined, was localized to chromosome 17q2.1-q21.3. A third gene, GPR3, showed identity (56% in the transmembrane regions) with a previously characterized cDNA clone from rat and was localized to chromosome 1p35-p36.1. 31 refs., 5 figs., 1 tab.

  9. Gene set of nuclear-encoded mitochondrial regulators is enriched for common inherited variation in obesity.

    Directory of Open Access Journals (Sweden)

    Nadja Knoll

    Full Text Available There are hints of an altered mitochondrial function in obesity. Nuclear-encoded genes are relevant for mitochondrial function (3 gene sets of known relevant pathways: (1 16 nuclear regulators of mitochondrial genes, (2 91 genes for oxidative phosphorylation and (3 966 nuclear-encoded mitochondrial genes. Gene set enrichment analysis (GSEA showed no association with type 2 diabetes mellitus in these gene sets. Here we performed a GSEA for the same gene sets for obesity. Genome wide association study (GWAS data from a case-control approach on 453 extremely obese children and adolescents and 435 lean adult controls were used for GSEA. For independent confirmation, we analyzed 705 obesity GWAS trios (extremely obese child and both biological parents and a population-based GWAS sample (KORA F4, n = 1,743. A meta-analysis was performed on all three samples. In each sample, the distribution of significance levels between the respective gene set and those of all genes was compared using the leading-edge-fraction-comparison test (cut-offs between the 50(th and 95(th percentile of the set of all gene-wise corrected p-values as implemented in the MAGENTA software. In the case-control sample, significant enrichment of associations with obesity was observed above the 50(th percentile for the set of the 16 nuclear regulators of mitochondrial genes (p(GSEA,50 = 0.0103. This finding was not confirmed in the trios (p(GSEA,50 = 0.5991, but in KORA (p(GSEA,50 = 0.0398. The meta-analysis again indicated a trend for enrichment (p(MAGENTA,50 = 0.1052, p(MAGENTA,75 = 0.0251. The GSEA revealed that weak association signals for obesity might be enriched in the gene set of 16 nuclear regulators of mitochondrial genes.

  10. Screening of the Enterocin-Encoding Genes and Antimicrobial Activity in Enterococcus Species.

    Science.gov (United States)

    Ogaki, Mayara Baptistucci; Rocha, Katia Real; Terra, MÁrcia Regina; Furlaneto, MÁrcia Cristina; Maia, Luciana Furlaneto

    2016-06-28

    In the current study, a total of 135 enterococci strains from different sources were screened for the presence of the enterocin-encoding genes entA, entP, entB, entL50A, and entL50B. The enterocin genes were present at different frequencies, with entA occurring the most frequently, followed by entP and entB; entL50A and L50B were not detected. The occurrence of single enterocin genes was higher than the occurrence of multiple enterocin gene combinations. The 80 isolates that harbor at least one enterocin-encoding gene (denoted "Gene(+) strains") were screened for antimicrobial activity. A total of 82.5% of the Gene(+) strains inhibited at least one of the indicator strains, and the isolates harboring multiple enterocin-encoding genes inhibited a larger number of indicator strains than isolates harboring a single gene. The indicator strains that exhibited growth inhibition included Listeria innocua strain CLIP 12612 (ATCC BAA-680), Listeria monocytogenes strain CDC 4555, Enterococcus faecalis ATCC 29212, Staphylococcus aureus ATCC 25923, S. aureus ATCC 29213, S. aureus ATCC 6538, Salmonella enteritidis ATCC 13076, Salmonella typhimurium strain UK-1 (ATCC 68169), and Escherichia coli BAC 49LT ETEC. Inhibition due to either bacteriophage lysis or cytolysin activity was excluded. The growth inhibition of antilisterial Gene+ strains was further tested under different culture conditions. Among the culture media formulations, the MRS agar medium supplemented with 2% (w/v) yeast extract was the best solidified medium for enterocin production. Our findings extend the current knowledge of enterocin-producing enterococci, which may have potential applications as biopreservatives in the food industry due to their capability of controlling food spoilage pathogens.

  11. [Divergence of paralogous growth-hormone-encoding genes and their promoters in Salmonidae].

    Science.gov (United States)

    Kamenskaya, D N; Pankova, M V; Atopkin, D M; Brykov, V A

    2017-01-01

    In many fish species, including salmonids, the growth-hormone is encoded by two duplicated paralogous genes, gh1 and gh2. Both genes were already in place at the time of divergence of species in this group. A comparison of the entire sequence of these genes of salmonids has shown that their conserved regions are associated with exons, while their most variable regions correspond to introns. Introns C and D include putative regulatory elements (sites Pit-1, CRE, and ERE), that are also conserved. In chars, the degree of polymorphism of gh2 gene is 2-3 times as large as that in gh1 gene. However, a comparison across all Salmonidae species would not extent this observation to other species. In both these chars' genes, the promoters are conserved mainly because they correspond to putative regulatory sequences (TATA box, binding sites for the pituitary transcription factor Pit-1 (F1-F4), CRE, GRE and RAR/RXR elements). The promoter of gh2 gene has a greater degree of polymorphism compared with gh1 gene promoter in all investigated species of salmonids. The observed differences in the rates of accumulation of changes in growth hormone encoding paralogs could be explained by differences in the intensity of selection.

  12. Genes Encoding Aluminum-Activated Malate Transporter II and their Association with Fruit Acidity in Apple

    Directory of Open Access Journals (Sweden)

    Baiquan Ma

    2015-11-01

    Full Text Available A gene encoding aluminum-activated malate transporter (ALMT was previously reported as a candidate for the locus controlling acidity in apple ( × Borkh.. In this study, we found that apple genes can be divided into three families and the gene belongs to the family. Duplication of genes in apple is related to the polyploid origin of the apple genome. Divergence in expression has occurred between the gene and its homologs in the family and only the gene is significantly associated with malic acid content. The locus consists of two alleles, and . resides in the tonoplast and its ectopic expression in yeast was found to increase the influx of malic acid into yeast cells significantly, suggesting it may function as a vacuolar malate channel. In contrast, encodes a truncated protein because of a single nucleotide substitution of G with A in the last exon. As this truncated protein resides within the cell membrane, it is deemed to be nonfunctional as a vacuolar malate channel. The frequency of the genotype is very low in apple cultivars but is high in wild relatives, which suggests that apple domestication may be accompanied by selection for the gene. In addition, variations in the malic acid content of mature fruits were also observed between accessions with the same genotype in the locus. This suggests that the gene is not the only genetic determinant of fruit acidity in apple.

  13. Phylogenetic characterization of a biogas plant microbial community integrating clone library 16S-rDNA sequences and metagenome sequence data obtained by 454-pyrosequencing.

    Science.gov (United States)

    Kröber, Magdalena; Bekel, Thomas; Diaz, Naryttza N; Goesmann, Alexander; Jaenicke, Sebastian; Krause, Lutz; Miller, Dimitri; Runte, Kai J; Viehöver, Prisca; Pühler, Alfred; Schlüter, Andreas

    2009-06-01

    The phylogenetic structure of the microbial community residing in a fermentation sample from a production-scale biogas plant fed with maize silage, green rye and liquid manure was analysed by an integrated approach using clone library sequences and metagenome sequence data obtained by 454-pyrosequencing. Sequencing of 109 clones from a bacterial and an archaeal 16S-rDNA amplicon library revealed that the obtained nucleotide sequences are similar but not identical to 16S-rDNA database sequences derived from different anaerobic environments including digestors and bioreactors. Most of the bacterial 16S-rDNA sequences could be assigned to the phylum Firmicutes with the most abundant class Clostridia and to the class Bacteroidetes, whereas most archaeal 16S-rDNA sequences cluster close to the methanogen Methanoculleus bourgensis. Further sequences of the archaeal library most probably represent so far non-characterised species within the genus Methanoculleus. A similar result derived from phylogenetic analysis of mcrA clone sequences. The mcrA gene product encodes the alpha-subunit of methyl-coenzyme-M reductase involved in the final step of methanogenesis. BLASTn analysis applying stringent settings resulted in assignment of 16S-rDNA metagenome sequence reads to 62 16S-rDNA amplicon sequences thus enabling frequency of abundance estimations for 16S-rDNA clone library sequences. Ribosomal Database Project (RDP) Classifier processing of metagenome 16S-rDNA reads revealed abundance of the phyla Firmicutes, Bacteroidetes and Euryarchaeota and the orders Clostridiales, Bacteroidales and Methanomicrobiales. Moreover, a large fraction of 16S-rDNA metagenome reads could not be assigned to lower taxonomic ranks, demonstrating that numerous microorganisms in the analysed fermentation sample of the biogas plant are still unclassified or unknown.

  14. Molecular cloning and chromosome mapping of the human gene encoding protein phosphotyrosyl phosphatase 1B

    International Nuclear Information System (INIS)

    Brown-Shimer, S.; Johnson, K.A.; Bruskin, A.; Green, N.R.; Hill, D.E.; Lawrence, J.B.; Johnson, C.

    1990-01-01

    The inactivation of growth suppressor genes appears to play a major role in the malignant process. To assess whether protein phosphotyrosyl phosphatases function as growth suppressors, the authors have isolated a cDNA clone encoding human protein phosphotyrosyl phosphatase 1B for structural and functional characterization. The translation product deduced from the 1,305-nucleotide open reading frame predicts a protein containing 435 amino acids and having a molecular mass of 49,966 Da. The amino-terminal 321 amino acids deduced from the cDNA sequence are identical to the empirically determined sequence of protein phosphotyrosyl phosphatase 1B. A genomic clone has been isolated and used in an in situ hybridization to banded metaphase chromosomes to determine that the gene encoding protein phosphotyrosyl phosphatase 1B maps as a single-copy gene to the long arm of chromosome 20 in the region q13.1-q13.2

  15. Identification and Characterization of an Autolysin-Encoding Gene of Streptococcus mutans

    OpenAIRE

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-01-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved β-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysi...

  16. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  17. Horse cDNA clones encoding two MHC class I genes

    Energy Technology Data Exchange (ETDEWEB)

    Barbis, D.P.; Maher, J.K.; Stanek, J.; Klaunberg, B.A.; Antczak, D.F.

    1994-12-31

    Two full-length clones encoding MHC class I genes were isolated by screening a horse cDNA library, using a probe encoding in human HLA-A2.2Y allele. The library was made in the pcDNA1 vector (Invitrogen, San Diego, CA), using mRNA from peripheral blood lymphocytes obtained from a Thoroughbred stallion (No. 0834) homozygous for a common horse MHC haplotype (ELA-A2, -B2, -D2; Antczak et al. 1984; Donaldson et al. 1988). The clones were sequenced, using SP6 and T7 universal primers and horse-specific oligonucleotides designed to extend previously determined sequences.

  18. The carB gene encoding the large subunit of carbamoylphosphate synthetase from Lactococcus lactis is transcribed monocistronically

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1998-01-01

    The biosynthesis of carbamoylphosphate is catalysed by the heterodimeric enzyme carbamoylphosphate synthetase (CPSase). The genes encoding the two subunits in procaryotes are normally transcribed as an operon, whereas in Lactococcus lactis, the gene encoding the large subunit (carB) is shown...

  19. Prevalence of enterotoxin-encoding genes and antimicrobial resistance in coagulase-negative and coagulase-positive Staphylococcus isolates from black pudding

    Directory of Open Access Journals (Sweden)

    Tiane Martin de Moura

    2012-10-01

    Full Text Available INTRODUCTION: Staphylococcal species are pathogens that are responsible for outbreaks of foodborne diseases. The aim of this study was to investigate the prevalence of enterotoxin-genes and the antimicrobial resistance profile in staphylococcus coagulase-negative (CoNS and coagulasepositive (CoPS isolates from black pudding in southern Brazil. METHODS: Two hundred typical and atypical colonies from Baird-Parker agar were inoculated on mannitol salt agar. Eighty-two mannitol-positive staphylococci were submitted to conventional biochemical tests and antimicrobial susceptibility profiling. The presence of coagulase (coa and enterotoxin (se genes was investigated by polymerase chain reaction. RESULTS: The isolates were divided into 2 groups: 75.6% (62/82 were CoNS and 24.4% (20/82 were CoPS. The biochemical tests identified 9 species, of which Staphylococcus saprophyticus (37.8% and Staphylococcus carnosus (15.9% were the most prevalent. Antimicrobial susceptibility tests showed resistance phenotypes to antibiotics widely administered in humans, such as gentamicin, tetracycline, chloramphenicol, and erythromycin. The coa gene was detected in 19.5% (16/82 of the strains and 4 polymorphic DNA fragments were observed. Five CoNS isolates carrying the coa gene were submitted for 16S rRNA sequencing and 3 showed similarity with CoNS. Forty strains were positive for at least 1 enterotoxin-encoding gene, the genes most frequently detected were sea (28.6% and seb (27.5%. CONCLUSIONS: The presence of antimicrobial resistant and enterotoxin-encoding genes in staphylococci isolates from black pudding indicated that this fermented food may represent a potential health risk, since staphylococci present in food could cause foodborne diseases or be a possible route for the transfer of antimicrobial resistance to humans.

  20. Bioinformatics Analysis of NBS-LRR Encoding Resistance Genes in Setaria italica.

    Science.gov (United States)

    Zhao, Yan; Weng, Qiaoyun; Song, Jinhui; Ma, Hailian; Yuan, Jincheng; Dong, Zhiping; Liu, Yinghui

    2016-06-01

    In plants, resistance (R) genes are involved in pathogen recognition and subsequent activation of innate immune responses. The nucleotide-binding site-leucine-rich repeat (NBS-LRR) genes family forms the largest R-gene family among plant genomes and play an important role in plant disease resistance. In this paper, comprehensive analysis of NBS-encoding genes is performed in the whole Setaria italica genome. A total of 96 NBS-LRR genes are identified, and comprehensive overview of the NBS-LRR genes is undertaken, including phylogenetic analysis, chromosome locations, conserved motifs of proteins, and gene expression. Based on the domain, these genes are divided into two groups and distributed in all Setaria italica chromosomes. Most NBS-LRR genes are located at the distal tip of the long arms of the chromosomes. Setaria italica NBS-LRR proteins share at least one nucleotide-biding domain and one leucine-rich repeat domain. Our results also show the duplication of NBS-LRR genes in Setaria italica is related to their gene structure.

  1. Comparación y utilidad de las regiones mitocondriales de los genes 16S y COX1 para los análisis genéticos en garrapatas (Acari: Ixodidae

    Directory of Open Access Journals (Sweden)

    Luis Enrique Paternina

    2016-06-01

    Conclusión. Los resultados indicaron que el gen 16S parece tener mejores características para los análisis filogenéticos interespecíficos dada su alta divergencia genética y baja saturación de transiciones, mientras que el gen COX1 parece ser más útil para estudios de variabilidad genética intraespecífica. Sin embargo, dado que el estudio se hizo a escala local, se requieren más investigaciones en diferentes escalas biogeográficas para establecer su utilidad en circunstancias más amplias y complejas.

  2. Characterization of Urtica dioica agglutinin isolectins and the encoding gene family.

    Science.gov (United States)

    Does, M P; Ng, D K; Dekker, H L; Peumans, W J; Houterman, P M; Van Damme, E J; Cornelissen, B J

    1999-01-01

    Urtica dioica agglutinin (UDA) has previously been found in roots and rhizomes of stinging nettles as a mixture of UDA-isolectins. Protein and cDNA sequencing have shown that mature UDA is composed of two hevein domains and is processed from a precursor protein. The precursor contains a signal peptide, two in-tandem hevein domains, a hinge region and a carboxyl-terminal chitinase domain. Genomic fragments encoding precursors for UDA-isolectins have been amplified by five independent polymerase chain reactions on genomic DNA from stinging nettle ecotype Weerselo. One amplified gene was completely sequenced. As compared to the published cDNA sequence, the genomic sequence contains, besides two basepair substitutions, two introns located at the same positions as in other plant chitinases. By partial sequence analysis of 40 amplified genes, 16 different genes were identified which encode seven putative UDA-isolectins. The deduced amino acid sequences share 78.9-98.9% identity. In extracts of roots and rhizomes of stinging nettle ecotype Weerselo six out of these seven isolectins were detected by mass spectrometry. One of them is an acidic form, which has not been identified before. Our results demonstrate that UDA is encoded by a large gene family.

  3. Cloning and characterization of largemouth bass ( Micropterus salmoides) myostatin encoding gene and its promoter

    Science.gov (United States)

    Li, Shengjie; Bai, Junjie; Wang, Lin

    2008-08-01

    Myostatin or GDF-8, a member of the transforming growth factor-β (TGF-β) superfamily, has been demonstrated to be a negative regulator of skeletal muscle mass in mammals. In the present study, we obtained a 5.64 kb sequence of myostatin encoding gene and its promoter from largemouth bass ( Micropterus salmoides). The myostatin encoding gene consisted of three exons (488 bp, 371 bp and 1779 bp, respectively) and two introns (390 bp and 855 bp, respectively). The intron-exon boundaries were conservative in comparison with those of mammalian myostatin encoding genes, whereas the size of introns was smaller than that of mammals. Sequence analysis of 1.569 kb of the largemouth bass myostatin gene promoter region revealed that it contained two TATA boxes, one CAAT box and nine putative E-boxes. Putative muscle growth response elements for myocyte enhancer factor 2 (MEF2), serum response factor (SRF), activator protein 1 (AP1), etc., and muscle-specific Mt binding site (MTBF) were also detected. Some of the transcription factor binding sites were conserved among five teleost species. This information will be useful for studying the transcriptional regulation of myostatin in fish.

  4. Genome-Wide Identification and Analysis of Genes Encoding PHD-Finger Protein in Tomato

    International Nuclear Information System (INIS)

    Hayat, S.; Cheng, Z.; Chen, X.

    2016-01-01

    The PHD-finger proteins are conserved in eukaryotic organisms and are involved in a variety of important functions in different biological processes in plants. However, the function of PHD fingers are poorly known in tomato (Solanum lycopersicum L.). In current study, we identified 45 putative genes coding Phd finger protein in tomato distributed on 11 chromosomes except for chromosome 8. Some of the genes encode other conserved key domains besides Phd-finger. Phylogenetic analysis of these 45 proteins resulted in seven clusters. Most Phd finger proteins were predicted to PML body location. These PHD-finger genes displayed differential expression either in various organs, at different development stages and under stresses in tomato. Our study provides the first systematic analysis of PHD-finger genes and proteins in tomato. This preliminary study provides a very useful reference information for Phd-finger proteins in tomato. They will be helpful for cloning and functional study of tomato PHD-finger genes. (author)

  5. Chicken genome analysis reveals novel genes encoding biotin-binding proteins related to avidin family

    Directory of Open Access Journals (Sweden)

    Nordlund Henri R

    2005-03-01

    Full Text Available Abstract Background A chicken egg contains several biotin-binding proteins (BBPs, whose complete DNA and amino acid sequences are not known. In order to identify and characterise these genes and proteins we studied chicken cDNAs and genes available in the NCBI database and chicken genome database using the reported N-terminal amino acid sequences of chicken egg-yolk BBPs as search strings. Results Two separate hits showing significant homology for these N-terminal sequences were discovered. For one of these hits, the chromosomal location in the immediate proximity of the avidin gene family was found. Both of these hits encode proteins having high sequence similarity with avidin suggesting that chicken BBPs are paralogous to avidin family. In particular, almost all residues corresponding to biotin binding in avidin are conserved in these putative BBP proteins. One of the found DNA sequences, however, seems to encode a carboxy-terminal extension not present in avidin. Conclusion We describe here the predicted properties of the putative BBP genes and proteins. Our present observations link BBP genes together with avidin gene family and shed more light on the genetic arrangement and variability of this family. In addition, comparative modelling revealed the potential structural elements important for the functional and structural properties of the putative BBP proteins.

  6. The evolutionary fate of the genes encoding the purine catabolic enzymes in hominoids, birds, and reptiles.

    Science.gov (United States)

    Keebaugh, Alaine C; Thomas, James W

    2010-06-01

    Gene loss has been proposed to play a major role in adaptive evolution, and recent studies are beginning to reveal its importance in human evolution. However, the potential consequence of a single gene-loss event upon the fates of functionally interrelated genes is poorly understood. Here, we use the purine metabolic pathway as a model system in which to explore this important question. The loss of urate oxidase (UOX) activity, a necessary step in this pathway, has occurred independently in the hominoid and bird/reptile lineages. Because the loss of UOX would have removed the functional constraint upon downstream genes in this pathway, these downstream genes are generally assumed to have subsequently deteriorated. In this study, we used a comparative genomics approach to empirically determine the fate of UOX itself and the downstream genes in five hominoids, two birds, and a reptile. Although we found that the loss of UOX likely triggered the genetic deterioration of the immediate downstream genes in the hominoids, surprisingly in the birds and reptiles, the UOX locus itself and some of the downstream genes were present in the genome and predicted to encode proteins. To account for the variable pattern of gene retention and loss after the inactivation of UOX, we hypothesize that although gene loss is a common fate for genes that have been rendered obsolete due to the upstream loss of an enzyme a metabolic pathway, it is also possible that same lack of constraint will foster the evolution of new functions or allow the optimization of preexisting alternative functions in the downstream genes, thereby resulting in gene retention. Thus, adaptive single-gene losses have the potential to influence the long-term evolutionary fate of functionally interrelated genes.

  7. Haloalkane-utilizing Rhodococcus strains isolated from geographically distinct locations possess a highly conserved gene cluster encoding haloalkane catabolism

    NARCIS (Netherlands)

    Poelarends, GJ; Bosma, T; Kulakov, LA; Larkin, MJ; Marchesi, [No Value; Weightman, AJ; Janssen, DB; Kulakov, Leonid A.; Larkin, Michael J.; Marchesi, Julian R.; Weightman, Andrew J.

    The sequences of the 16S rRNA and haloalkane dehalogenase (dhaA) genes of five gram-positive haloalkane-utilizing bacteria isolated from contaminated sites in Europe, Japan, and the United States and of the archetypal haloalkane-degrading bacterium Rhodococcus sp. strain NCIMB13064 were compared.

  8. The promoter of the glucoamylase-encoding gene of Aspergillus niger functions in Ustilago maydis

    Energy Technology Data Exchange (ETDEWEB)

    Smith, T.L. (Dept. of Agriculture, Madison, WI (United States) Univ. of Wisconsin, Madison (United States)); Gaskell, J.; Cullen, D. (Dept. of Agriculture, Madison, WI (United States)); Berka, R.M.; Yang, M.; Henner, D.J. (Genentech Inc., San Francisco, CA (United States))

    1990-01-01

    Promoter sequences from the Aspergillus niger glucoamylase-encoding gene (glaA) were linked to the bacterial hygromycin (Hy) phosphotransferase-encoding gene (hph) and this chimeric marker was used to select Hy-resistant (Hy[sup R]) Ustilago maydis transformants. This is an example of an Ascomycete promoter functioning in a Basidiomycete. Hy[sup R] transformants varied with respect to copy number of integrated vector, mitotic stability, and tolerance to Hy. Only 216 bp of glaA promoter sequence is required for expression in U. maydis but this promoter is not induced by starch as it is in Aspergillus spp. The transcription start points are the same in U. maydis and A. niger.

  9. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  10. Cloning and Sequence Analysis of Vibrio halioticoli Genes Encoding Three Types of Polyguluronate Lyase.

    Science.gov (United States)

    Sugimura; Sawabe; Ezura

    2000-01-01

    The alginate lyase-coding genes of Vibrio halioticoli IAM 14596(T), which was isolated from the gut of the abalone Haliotis discus hannai, were cloned using plasmid vector pUC 18, and expressed in Escherichia coli. Three alginate lyase-positive clones, pVHB, pVHC, and pVHE, were obtained, and all clones expressed the enzyme activity specific for polyguluronate. Three genes, alyVG1, alyVG2, and alyVG3, encoding polyguluronate lyase were sequenced: alyVG1 from pVHB was composed of a 1056-bp open reading frame (ORF) encoding 352 amino acid residues; alyVG2 gene from pVHC was composed of a 993-bp ORF encoding 331 amino acid residues; and alyVG3 gene from pVHE was composed of a 705-bp ORF encoding 235 amino acid residues. Comparison of nucleotide and deduced amino acid sequences among AlyVG1, AlyVG2, and AlyVG3 revealed low homologies. The identity value between AlyVG1 and AlyVG2 was 18.7%, and that between AlyVG2 and AlyVG3 was 17.0%. A higher identity value (26.0%) was observed between AlyVG1 and AlyVG3. Sequence comparison among known polyguluronate lyases including AlyVG1, AlyVG2, and AlyVG3 also did not reveal an identical region in these sequences. However, AlyVG1 showed the highest identity value (36.2%) and the highest similarity (73.3%) to AlyA from Klebsiella pneumoniae. A consensus region comprising nine amino acid (YFKAGXYXQ) in the carboxy-terminal region previously reported by Mallisard and colleagues was observed only in AlyVG1 and AlyVG2.

  11. Sieve element occlusion (SEO) genes encode structural phloem proteins involved in wound sealing of the phloem.

    Science.gov (United States)

    Ernst, Antonia M; Jekat, Stephan B; Zielonka, Sascia; Müller, Boje; Neumann, Ulla; Rüping, Boris; Twyman, Richard M; Krzyzanek, Vladislav; Prüfer, Dirk; Noll, Gundula A

    2012-07-10

    The sieve element occlusion (SEO) gene family originally was delimited to genes encoding structural components of forisomes, which are specialized crystalloid phloem proteins found solely in the Fabaceae. More recently, SEO genes discovered in various non-Fabaceae plants were proposed to encode the common phloem proteins (P-proteins) that plug sieve plates after wounding. We carried out a comprehensive characterization of two tobacco (Nicotiana tabacum) SEO genes (NtSEO). Reporter genes controlled by the NtSEO promoters were expressed specifically in immature sieve elements, and GFP-SEO fusion proteins formed parietal agglomerates in intact sieve elements as well as sieve plate plugs after wounding. NtSEO proteins with and without fluorescent protein tags formed agglomerates similar in structure to native P-protein bodies when transiently coexpressed in Nicotiana benthamiana, and the analysis of these protein complexes by electron microscopy revealed ultrastructural features resembling those of native P-proteins. NtSEO-RNA interference lines were essentially devoid of P-protein structures and lost photoassimilates more rapidly after injury than control plants, thus confirming the role of P-proteins in sieve tube sealing. We therefore provide direct evidence that SEO genes in tobacco encode P-protein subunits that affect translocation. We also found that peptides recently identified in fascicular phloem P-protein plugs from squash (Cucurbita maxima) represent cucurbit members of the SEO family. Our results therefore suggest a common evolutionary origin for P-proteins found in the sieve elements of all dicotyledonous plants and demonstrate the exceptional status of extrafascicular P-proteins in cucurbits.

  12. Isolation of Clostridium difficile and Detection of A and B Toxins Encoding Genes

    Directory of Open Access Journals (Sweden)

    Abbas Ali Imani Fooladi

    2014-02-01

    Full Text Available Background: Clostridium difficile is the most important anaerobic, gram positive, spore forming bacillus which is known as a prevalent factor leading to antibiotic associated diarrheas and is the causative agent of pseudomembrane colitis. The role of this bacterium along with the over use of antibiotics have been proved to result in colitis. The major virulence factors of these bacteria are the A and B toxins. Objectives: The purpose of this study was to isolate C. difficile from stool samples and detect A and B toxins encoding genes, in order toserve as a routine method for clinical diagnosis. Materials and Methods: Recognition of A and B toxins encoding genes by uniplex and multiplex PCR using two pairs of primers from 136 accumulated stool samples. Results: Results of the present study showed that out of 136 stool samples, three C. difficile were isolated and these strains contained A and B toxins encoding genes. Conclusions: It was concluded that although detection of C. difficile from stool samples based on PCR (polymerase chain reaction is expensive, yet this method is more sensitive and less time-consuming than culture methods and can be used as a clinical laboratory test.

  13. Expression-based clustering of CAZyme-encoding genes of Aspergillus niger.

    Science.gov (United States)

    Gruben, Birgit S; Mäkelä, Miia R; Kowalczyk, Joanna E; Zhou, Miaomiao; Benoit-Gelber, Isabelle; De Vries, Ronald P

    2017-11-23

    The Aspergillus niger genome contains a large repertoire of genes encoding carbohydrate active enzymes (CAZymes) that are targeted to plant polysaccharide degradation enabling A. niger to grow on a wide range of plant biomass substrates. Which genes need to be activated in certain environmental conditions depends on the composition of the available substrate. Previous studies have demonstrated the involvement of a number of transcriptional regulators in plant biomass degradation and have identified sets of target genes for each regulator. In this study, a broad transcriptional analysis was performed of the A. niger genes encoding (putative) plant polysaccharide degrading enzymes. Microarray data focusing on the initial response of A. niger to the presence of plant biomass related carbon sources were analyzed of a wild-type strain N402 that was grown on a large range of carbon sources and of the regulatory mutant strains ΔxlnR, ΔaraR, ΔamyR, ΔrhaR and ΔgalX that were grown on their specific inducing compounds. The cluster analysis of the expression data revealed several groups of co-regulated genes, which goes beyond the traditionally described co-regulated gene sets. Additional putative target genes of the selected regulators were identified, based on their expression profile. Notably, in several cases the expression profile puts questions on the function assignment of uncharacterized genes that was based on homology searches, highlighting the need for more extensive biochemical studies into the substrate specificity of enzymes encoded by these non-characterized genes. The data also revealed sets of genes that were upregulated in the regulatory mutants, suggesting interaction between the regulatory systems and a therefore even more complex overall regulatory network than has been reported so far. Expression profiling on a large number of substrates provides better insight in the complex regulatory systems that drive the conversion of plant biomass by fungi. In

  14. Open reading frame 176 in the photosynthesis gene cluster of Rhodobacter capsulatus encodes idi, a gene for isopentenyl diphosphate isomerase.

    OpenAIRE

    Hahn, F M; Baker, J A; Poulter, C D

    1996-01-01

    Isopentenyl diphosphate (IPP) isomerase catalyzes an essential activation step in the isoprenoid biosynthetic pathway. A database search based on probes from the highly conserved regions in three eukaryotic IPP isomerases revealed substantial similarity with ORF176 in the photosynthesis gene cluster in Rhodobacter capsulatus. The open reading frame was cloned into an Escherichia coli expression vector. The encoded 20-kDa protein, which was purified in two steps by ion exchange and hydrophobic...

  15. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  16. Comparative evaluation of PCR amplification of RLEP, 16S rRNA, rpoT and Sod A gene targets for detection of M. leprae DNA from clinical and environmental samples

    Directory of Open Access Journals (Sweden)

    Ravindra P Turankar

    2015-01-01

    Conclusion: Amongst all the gene targets used in this study, PCR positivity using RLEP gene target was the highest in all the clinical and environmental samples. Further, the RLEP gene target was able to detect 53% of blood samples as positive in BI-negative leprosy cases indicating its future standardization and use for diagnostic purposes.

  17. Genome analysis and identification of gelatinase encoded gene in Enterobacter aerogenes

    Science.gov (United States)

    Shahimi, Safiyyah; Mutalib, Sahilah Abdul; Khalid, Rozida Abdul; Repin, Rul Aisyah Mat; Lamri, Mohd Fadly; Bakar, Mohd Faizal Abu; Isa, Mohd Noor Mat

    2016-11-01

    In this study, bioinformatic analysis towards genome sequence of E. aerogenes was done to determine gene encoded for gelatinase. Enterobacter aerogenes was isolated from hot spring water and gelatinase species-specific bacterium to porcine and fish gelatin. This bacterium offers the possibility of enzymes production which is specific to both species gelatine, respectively. Enterobacter aerogenes was partially genome sequenced resulting in 5.0 mega basepair (Mbp) total size of sequence. From pre-process pipeline, 87.6 Mbp of total reads, 68.8 Mbp of total high quality reads and 78.58 percent of high quality percentage was determined. Genome assembly produced 120 contigs with 67.5% of contigs over 1 kilo base pair (kbp), 124856 bp of N50 contig length and 55.17 % of GC base content percentage. About 4705 protein gene was identified from protein prediction analysis. Two candidate genes selected have highest similarity identity percentage against gelatinase enzyme available in Swiss-Prot and NCBI online database. They were NODE_9_length_26866_cov_148.013245_12 containing 1029 base pair (bp) sequence with 342 amino acid sequence and NODE_24_length_155103_cov_177.082458_62 which containing 717 bp sequence with 238 amino acid sequence, respectively. Thus, two paired of primers (forward and reverse) were designed, based on the open reading frame (ORF) of selected genes. Genome analysis of E. aerogenes resulting genes encoded gelatinase were identified.

  18. A single Danio rerio hars gene encodes both cytoplasmic and mitochondrial histidyl-tRNA synthetases.

    Directory of Open Access Journals (Sweden)

    Ashley L Waldron

    Full Text Available Histidyl tRNA Synthetase (HARS is a member of the aminoacyl tRNA synthetase (ARS family of enzymes. This family of 20 enzymes is responsible for attaching specific amino acids to their cognate tRNA molecules, a critical step in protein synthesis. However, recent work highlighting a growing number of associations between ARS genes and diverse human diseases raises the possibility of new and unexpected functions in this ancient enzyme family. For example, mutations in HARS have been linked to two different neurological disorders, Usher Syndrome Type IIIB and Charcot Marie Tooth peripheral neuropathy. These connections raise the possibility of previously undiscovered roles for HARS in metazoan development, with alterations in these functions leading to complex diseases. In an attempt to establish Danio rerio as a model for studying HARS functions in human disease, we characterized the Danio rerio hars gene and compared it to that of human HARS. Using a combination of bioinformatics, molecular biology, and cellular approaches, we found that while the human genome encodes separate genes for cytoplasmic and mitochondrial HARS protein, the Danio rerio genome encodes a single hars gene which undergoes alternative splicing to produce the respective cytoplasmic and mitochondrial versions of Hars. Nevertheless, while the HARS genes of humans and Danio differ significantly at the genomic level, we found that they are still highly conserved at the amino acid level, underscoring the potential utility of Danio rerio as a model organism for investigating HARS function and its link to human diseases in vivo.

  19. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions

    DEFF Research Database (Denmark)

    Luo, Yonglun; Friis, Jenny Blechingberg; Fernandes, Ana Miguel

    2015-01-01

    at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. Conclusions The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes...... involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.......Background FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins...

  20. Transcription Factors Encoded on Core and Accessory Chromosomes of Fusarium oxysporum Induce Expression of Effector Genes

    Science.gov (United States)

    van der Does, H. Charlotte; Schmidt, Sarah M.; Langereis, Léon; Hughes, Timothy R.

    2016-01-01

    Proteins secreted by pathogens during host colonization largely determine the outcome of pathogen-host interactions and are commonly called ‘effectors’. In fungal plant pathogens, coordinated transcriptional up-regulation of effector genes is a key feature of pathogenesis and effectors are often encoded in genomic regions with distinct repeat content, histone code and rate of evolution. In the tomato pathogen Fusarium oxysporum f. sp. lycopersici (Fol), effector genes reside on one of four accessory chromosomes, known as the ‘pathogenicity’ chromosome, which can be exchanged between strains through horizontal transfer. The three other accessory chromosomes in the Fol reference strain may also be important for virulence towards tomato. Expression of effector genes in Fol is highly up-regulated upon infection and requires Sge1, a transcription factor encoded on the core genome. Interestingly, the pathogenicity chromosome itself contains 13 predicted transcription factor genes and for all except one, there is a homolog on the core genome. We determined DNA binding specificity for nine transcription factors using oligonucleotide arrays. The binding sites for homologous transcription factors were highly similar, suggesting that extensive neofunctionalization of DNA binding specificity has not occurred. Several DNA binding sites are enriched on accessory chromosomes, and expression of FTF1, its core homolog FTF2 and SGE1 from a constitutive promoter can induce expression of effector genes. The DNA binding sites of only these three transcription factors are enriched among genes up-regulated during infection. We further show that Ftf1, Ftf2 and Sge1 can activate transcription from their binding sites in yeast. RNAseq analysis revealed that in strains with constitutive expression of FTF1, FTF2 or SGE1, expression of a similar set of plant-responsive genes on the pathogenicity chromosome is induced, including most effector genes. We conclude that the Fol

  1. A Novel Complementation Assay for Quick and Specific Screen of Genes Encoding Glycerol-3-Phosphate Acyltransferases

    Directory of Open Access Journals (Sweden)

    Jie Lei

    2018-03-01

    Full Text Available The initial step in glycerolipid biosynthesis, especially in diverse allopolyploid crop species, is poorly understood, mainly due to the lack of an effective and convenient method for functional characterization of genes encoding glycerol-3-phosphate acyltransferases (GPATs catalyzing this reaction. Here we present a novel complementation assay for quick and specific characterization of GPAT-encoding genes. Its key design involves rational construction of yeast conditional lethal gat1Δgat2Δ double mutant bearing the heterologous Arabidopsis AtGPAT1 gene whose leaky expression under repressed conditions does not support any non-specific growth, thereby circumventing the false positive problem encountered with the system based on the gat1Δgat2Δ mutant harboring the native episomal GAT1 gene whose leaky expression appears to be sufficient for generating enough GPAT activities for the non-specific restoration of the mutant growth. A complementation assay developed based on this novel mutant enables quick phenotypic screen of GPAT sequences. A high degree of specificity of our assay was exemplified by its ability to differentiate effectively GPAT-encoding genes from those of other fatty acyltransferases and lipid-related sequences. Using this assay, we show that Arabidopsis AtGPAT1, AtGPAT5, and AtGPAT7 can complement the phosphatidate biosynthetic defect in the double mutants. Collectively, our assay provides a powerful tool for rapid screening, validation and optimization of GPAT sequences, aiding future engineering of the initial step of the triacylglycerol biosynthesis in oilseeds.

  2. Genes regulation encoding ADP/ATP carrier in yeasts Saccharomyces cerevisiae and Candida parapsilosis

    International Nuclear Information System (INIS)

    Nebohacova, M.

    2000-01-01

    Genes encoding a mitochondrial ADP/ATP carrier (AAC) in yeast Saccharomyces cerevisiae and Candida parapsilosis were investigated. AAC2 is coding for the major AAC isoform in S. cerevisiae. We suggest that AAC2 is a member of a syn-expression group of genes encoding oxidative phosphorylation proteins. Within our previous studies on the regulation of the AAC2 transcription an UAS (-393/-268) was identified that is essential for the expression of this gene. Two functional regulatory cis-elements are located within this UAS -binding sites for an ABFl factor and for HAP2/3/4/5 heteromeric complex. We examined relative contributions and mutual interactions of the ABFl and HAP2/3/4/5 factors in the activation of transcription from the UAS of the AAC2 gene. The whole UAS was dissected into smaller sub-fragments and tested for (i) the ability to form DNA-protein complexes with cellular proteins in vitro, (ii) the ability to confer heterologous expression using AAC3 gene lacking its own promoter, and (iii) the expression of AAC3-lacZ fusion instead of intact AAC3 gene. The obtained results demonstrated that: a) The whole UAS as well as sub-fragment containing only ABF1-binding site are able to form DNA-protein complexes with cellular proteins in oxygen- and heme- dependent manner. The experiments with antibody against the ABF1 showed that the ABF1 factor is one of the proteins binding to AAC2 promoter. We have been unsuccessful to prove the binding of cellular proteins to the HAP2/3/4/5-binding site. However, the presence of HAP2/3/4/5-binding site is necessary to drive a binding of cellular proteins to the ABF1-binding site in carbon source-dependent manner. b) The presence of both ABF1- and HAP2/3/4/5-binding sites and original spacing between them is necessary to confer the growth of Aaac2 mutant strain on non- fermentable carbon source when put in front of AAC3 gene introduced on centromeric vector to Aaac2 mutant strain. c) For the activation of AAC3-lacZ expression on

  3. Mutagenesis in sequence encoding of human factor VII for gene therapy of hemophilia

    Directory of Open Access Journals (Sweden)

    B Kazemi

    2009-12-01

    Full Text Available "nBackground: Current treatment of hemophilia which is one of the most common bleeding disorders, involves replacement therapy using concentrates of FVIII and FIX .However, these concentrates have been associated with viral infections and thromboembolic complications and development of antibodies. "nThe use of recombinant human factor VII (rhFVII is effective  for the treatment of patients with  hemophilia A or B, who develop antibodies ( referred as inhibitors against  replacement therapy , because it induces coagulation independent of FVIII and FIX. However, its short half-life and high cost have limited its use. One potential solution to this problem may be the use of FVIIa gene transfer, which would attain continuing therapeutic levels of expression from a single injection. The aim of this study was to engineer a novel hFVII (human FVII gene containing a cleavage site for the intracellular protease and furin, by PCR mutagenesis "nMethods: The sequence encoding light and heavy chains of hFVII, were amplified by using hFVII/pTZ57R and specific primers, separately. The PCR products were cloned in pTZ57R vector. "nResults and discussion: Cloning was confirmed by restriction analysis or PCR amplification using specific primers and plasmid universal primers. Mutagenesis of sequence encoding light and heavy chain was confirmed by restriction enzyme. "nConclusion: In the present study, it was provided recombinant plasmids based on mutant form of DNA encoding light and heavy chains.  Joining mutant form of DNA encoding light chain with mutant heavy chain led to a new variant of hFVII. This variant can be activated by furin and an increase in the proportion of activated form of FVII. This mutant form of hFVII may be used for gene therapy of hemophilia.

  4. Heterogenic expression of genes encoding secreted proteins at the periphery of Aspergillus niger colonies.

    Science.gov (United States)

    Vinck, Arman; de Bekker, Charissa; Ossin, Adam; Ohm, Robin A; de Vries, Ronald P; Wösten, Han A B

    2011-01-01

    Colonization of a substrate by fungi starts with the invasion of exploring hyphae. These hyphae secrete enzymes that degrade the organic material into small molecules that can be taken up by the fungus to serve as nutrients. We previously showed that only part of the exploring hyphae of Aspergillus niger highly express the glucoamylase gene glaA. This was an unexpected finding since all exploring hyphae are exposed to the same environmental conditions. Using GFP as a reporter, we here demonstrate that the acid amylase gene aamA, the α-glucuronidase gene aguA, and the feruloyl esterase gene faeA of A. niger are also subject to heterogenic expression within the exploring mycelium. Coexpression studies using GFP and dTomato as reporters showed that hyphae that highly express one of these genes also highly express the other genes encoding secreted proteins. Moreover, these hyphae also highly express the amylolytic regulatory gene amyR, and the glyceraldehyde-3-phosphate dehydrogenase gene gpdA. In situ hybridization demonstrated that the high expressers are characterized by a high 18S rRNA content. Taken together, it is concluded that two subpopulations of hyphae can be distinguished within the exploring mycelium of A. niger. The experimental data indicate that these subpopulations differ in their transcriptional and translational activity. © 2010 Society for Applied Microbiology and Blackwell Publishing Ltd.

  5. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed.

    Science.gov (United States)

    Tornow, J; Santangelo, G M

    1994-06-01

    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  6. Virulence properties of methicillin-susceptible Staphylococcus aureus food isolates encoding Panton-Valentine Leukocidin gene.

    Science.gov (United States)

    Sudagidan, Mert; Aydin, Ali

    2010-04-15

    In this study, three Panton-Valentine Leukocidin gene carrying methicillin-susceptible Staphylococcus aureus (MSSA) strains (M1-AAG42B, PY30C-b and YF1B-b) were isolated from different food samples in Kesan-Edirne, Turkey. These strains were characterized on the basis of MLST type, spa type, virulence factor gene contents, antibiotic susceptibilities against 21 antibiotics and biofilm formation. The genetic relatedness of the strains was determined by PFGE. In addition, the complete gene sequences of lukS-PV and lukF-PV were also investigated. All strains were found to be susceptible to tested antibiotics and they were mecA negative. Three strains showed the same PFGE band pattern, ST152 clonal type and t355 spa type. In the detection of virulence factor genes, sea, seb, sec, sed, see, seg, seh, sei, sej, sek, sel, sem, sen, seo, sep, seq, seu, eta, etb, set1, geh and tst genes were not detected. All strains showed the positive results for alpha- and beta-haemolysin genes (hla and hlb), protease encoding genes (sspA, sspB and aur), lukE and lukD leukocidin genes (lukED). The strains were found to be non-biofilm formers. By this study, the virulence properties of the strains were described and this is one of the first reports regarding PVL-positive MSSA strains from food. (c) 2010 Elsevier B.V. All rights reserved.

  7. EWS and FUS bind a subset of transcribed genes encoding proteins enriched in RNA regulatory functions.

    Science.gov (United States)

    Luo, Yonglun; Blechingberg, Jenny; Fernandes, Ana Miguel; Li, Shengting; Fryland, Tue; Børglum, Anders D; Bolund, Lars; Nielsen, Anders Lade

    2015-11-14

    FUS (TLS) and EWS (EWSR1) belong to the FET-protein family of RNA and DNA binding proteins. FUS and EWS are structurally and functionally related and participate in transcriptional regulation and RNA processing. FUS and EWS are identified in translocation generated cancer fusion proteins and involved in the human neurological diseases amyotrophic lateral sclerosis and fronto-temporal lobar degeneration. To determine the gene regulatory functions of FUS and EWS at the level of chromatin, we have performed chromatin immunoprecipitation followed by next generation sequencing (ChIP-seq). Our results show that FUS and EWS bind to a subset of actively transcribed genes, that binding often is downstream the poly(A)-signal, and that binding overlaps with RNA polymerase II. Functional examinations of selected target genes identified that FUS and EWS can regulate gene expression at different levels. Gene Ontology analyses showed that FUS and EWS target genes preferentially encode proteins involved in regulatory processes at the RNA level. The presented results yield new insights into gene interactions of EWS and FUS and have identified a set of FUS and EWS target genes involved in pathways at the RNA regulatory level with potential to mediate normal and disease-associated functions of the FUS and EWS proteins.

  8. Isolation of the opdE gene that encodes for a new hydrolase of Enterobacter sp. capable of degrading organophosphorus pesticides.

    Science.gov (United States)

    Chino-Flores, Concepción; Dantán-González, Edgar; Vázquez-Ramos, Alejandra; Tinoco-Valencia, Raunel; Díaz-Méndez, Rafael; Sánchez-Salinas, Enrique; Castrejón-Godínez, Maria Luisa; Ramos-Quintana, Fernando; Ortiz-Hernández, Maria Laura

    2012-06-01

    Microbial enzymes that can hydrolyze organophosphorus compounds have been isolated, identified and characterized from different microbial species in order to use them in biodegradation of organophosphorus compounds. We isolated a bacterial strain Cons002 from an agricultural soil bacterial consortium, which can hydrolyze methyl-parathion (MP) and other organophosphate pesticides. HPLC analysis showed that strain Cons002 is capable of degrading pesticides MP, parathion and phorate. Pulsed-field gel electrophoresis and 16S rRNA amplification were performed for strain characterization and identification, respectively, showing that the strain Cons002 is related to the genus Enterobacter sp. which has a single chromosome of 4.6 Mb and has no plasmids. Genomic library was constructed from DNA of Enterobacter sp. Cons002. A gene called opdE (Organophosphate Degradation from Enterobacter) consists of 753 bp and encodes a protein of 25 kDa, which was isolated using activity methods. This gene opdE had no similarity to any genes reported to degrade organophosphates. When kanamycin-resistance cassette was placed in the gene opdE, hydrolase activity was suppressed and Enterobacter sp. Cons002 had no growth with MP as a nutrients source.

  9. Coevolution between Nuclear-Encoded DNA Replication, Recombination, and Repair Genes and Plastid Genome Complexity.

    Science.gov (United States)

    Zhang, Jin; Ruhlman, Tracey A; Sabir, Jamal S M; Blazier, John Chris; Weng, Mao-Lun; Park, Seongjun; Jansen, Robert K

    2016-02-17

    Disruption of DNA replication, recombination, and repair (DNA-RRR) systems has been hypothesized to cause highly elevated nucleotide substitution rates and genome rearrangements in the plastids of angiosperms, but this theory remains untested. To investigate nuclear-plastid genome (plastome) coevolution in Geraniaceae, four different measures of plastome complexity (rearrangements, repeats, nucleotide insertions/deletions, and substitution rates) were evaluated along with substitution rates of 12 nuclear-encoded, plastid-targeted DNA-RRR genes from 27 Geraniales species. Significant correlations were detected for nonsynonymous (dN) but not synonymous (dS) substitution rates for three DNA-RRR genes (uvrB/C, why1, and gyrA) supporting a role for these genes in accelerated plastid genome evolution in Geraniaceae. Furthermore, correlation between dN of uvrB/C and plastome complexity suggests the presence of nucleotide excision repair system in plastids. Significant correlations were also detected between plastome complexity and 13 of the 90 nuclear-encoded organelle-targeted genes investigated. Comparisons revealed significant acceleration of dN in plastid-targeted genes of Geraniales relative to Brassicales suggesting this correlation may be an artifact of elevated rates in this gene set in Geraniaceae. Correlation between dN of plastid-targeted DNA-RRR genes and plastome complexity supports the hypothesis that the aberrant patterns in angiosperm plastome evolution could be caused by dysfunction in DNA-RRR systems. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  10. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  11. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  12. Isolation and characterization of the gene encoding the starch debranching enzyme limit dextrinase from germinating barley

    DEFF Research Database (Denmark)

    Kristensen, Michael; Lok, Finn; Planchot, Véronique

    1999-01-01

    with a value of 105 kDa estimated by SDS;;PAGE, The coding sequence is interrupted by 26 introns varying in length from 93 bp to 825 bp. The 27 exons vary in length from 53 bp to 197 bp. Southern blot analysis shows that the limit dextrinase gene is present as a single copy in the barley genome. Gene......The gene encoding the starch debranching enzyme limit dextrinase, LD, from barley (Hordeum vulgare), was isolated from a genomic phage library using a barley cDNA clone as probe. The gene encodes a protein of 904 amino acid residues with a calculated molecular mass of 98.6 kDa. This is in agreement...... expression is high during germination and the steady state transcription level reaches a maximum at day 5 of germination. The deduced amino acid sequence corresponds to the protein sequence of limit dextrinase purified from germinating malt, as determined by automated N-terminal sequencing of tryptic...

  13. YebU is a m5C methyltransferase specific for 16 S rRNA nucleotide 1407

    DEFF Research Database (Denmark)

    Andersen, Niels Møller; Douthwaite, Stephen

    2006-01-01

    generally require specific enzymes, and only one m5C rRNA methyltransferase, RsmB (formerly Fmu) that methylates nucleotide C967, has previously been identified. BLAST searches of the E.coli genome revealed a single gene, yebU, with sufficient similarity to rsmB to encode a putative m5C RNA...... methyltransferase. This suggested that the yebU gene product modifies C1407 and/or C1962. Here, we analysed the E.coli rRNAs by matrix assisted laser desorption/ionization mass spectrometry and show that inactivation of the yebU gene leads to loss of methylation at C1407 in 16 S rRNA, but does not interfere...

  14. A plasmid-encoded UmuD homologue regulates expression of Pseudomonas aeruginosa SOS genes.

    Science.gov (United States)

    Díaz-Magaña, Amada; Alva-Murillo, Nayeli; Chávez-Moctezuma, Martha P; López-Meza, Joel E; Ramírez-Díaz, Martha I; Cervantes, Carlos

    2015-07-01

    The Pseudomonas aeruginosa plasmid pUM505 contains the umuDC operon that encodes proteins similar to error-prone repair DNA polymerase V. The umuC gene appears to be truncated and its product is probably not functional. The umuD gene, renamed umuDpR, possesses an SOS box overlapped with a Sigma factor 70 type promoter; accordingly, transcriptional fusions revealed that the umuDpR gene promoter is activated by mitomycin C. The predicted sequence of the UmuDpR protein displays 23 % identity with the Ps. aeruginosa SOS-response LexA repressor. The umuDpR gene caused increased MMC sensitivity when transferred to the Ps. aeruginosa PAO1 strain. As expected, PAO1-derived knockout lexA-  mutant PW6037 showed resistance to MMC; however, when the umuDpR gene was transferred to PW6037, MMC resistance level was reduced. These data suggested that UmuDpR represses the expression of SOS genes, as LexA does. To test whether UmuDpR exerts regulatory functions, expression of PAO1 SOS genes was evaluated by reverse transcription quantitative PCR assays in the lexA-  mutant with or without the pUC_umuD recombinant plasmid. Expression of lexA, imuA and recA genes increased 3.4-5.3 times in the lexA-  mutant, relative to transcription of the corresponding genes in the lexA+ strain, but decreased significantly in the lexA- /umuDpR transformant. These results confirmed that the UmuDpR protein is a repressor of Ps. aeruginosa SOS genes controlled by LexA. Electrophoretic mobility shift assays, however, did not show binding of UmuDpR to 5' regions of SOS genes, suggesting an indirect mechanism of regulation.

  15. Detailed analysis of putative genes encoding small proteins in legume genomes

    Directory of Open Access Journals (Sweden)

    Gabriel eGuillén

    2013-06-01

    Full Text Available Diverse plant genome sequencing projects coupled with powerful bioinformatics tools have facilitated massive data analysis to construct specialized databases classified according to cellular function. However, there are still a considerable number of genes encoding proteins whose function has not yet been characterized. Included in this category are small proteins (SPs, 30-150 amino acids encoded by short open reading frames (sORFs. SPs play important roles in plant physiology, growth, and development. Unfortunately, protocols focused on the genome-wide identification and characterization of sORFs are scarce or remain poorly implemented. As a result, these genes are underrepresented in many genome annotations. In this work, we exploited publicly available genome sequences of Phaseolus vulgaris, Medicago truncatula, Glycine max and Lotus japonicus to analyze the abundance of annotated SPs in plant legumes. Our strategy to uncover bona fide sORFs at the genome level was centered in bioinformatics analysis of characteristics such as evidence of expression (transcription, presence of known protein regions or domains, and identification of orthologous genes in the genomes explored. We collected 6170, 10461, 30521, and 23599 putative sORFs from P. vulgaris, G. max, M. truncatula, and L. japonicus genomes, respectively. Expressed sequence tags (ESTs available in the DFCI Gene Index database provided evidence that ~one-third of the predicted legume sORFs are expressed. Most potential SPs have a counterpart in a different plant species and counterpart regions or domains in larger proteins. Potential functional sORFs were also classified according to a reduced set of GO categories, and the expression of 13 of them during P. vulgaris nodule ontogeny was confirmed by qPCR. This analysis provides a collection of sORFs that potentially encode for meaningful SPs, and offers the possibility of their further functional evaluation.

  16. Atypical DNA methylation of genes encoding cysteine-rich peptides in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    You Wanhui

    2012-04-01

    Full Text Available Abstract Background In plants, transposons and non-protein-coding repeats are epigenetically silenced by CG and non-CG methylation. This pattern of methylation is mediated in part by small RNAs and two specialized RNA polymerases, termed Pol IV and Pol V, in a process called RNA-directed DNA methylation. By contrast, many protein-coding genes transcribed by Pol II contain in their gene bodies exclusively CG methylation that is independent of small RNAs and Pol IV/Pol V activities. It is unclear how the different methylation machineries distinguish between transposons and genes. Here we report on a group of atypical genes that display in their coding region a transposon-like methylation pattern, which is associated with gene silencing in sporophytic tissues. Results We performed a methylation-sensitive amplification polymorphism analysis to search for targets of RNA-directed DNA methylation in Arabidopsis thaliana and identified several members of a gene family encoding cysteine-rich peptides (CRPs. In leaves, the CRP genes are silent and their coding regions contain dense, transposon-like methylation in CG, CHG and CHH contexts, which depends partly on the Pol IV/Pol V pathway and small RNAs. Methylation in the coding region is reduced, however, in the synergid cells of the female gametophyte, where the CRP genes are specifically expressed. Further demonstrating that expressed CRP genes lack gene body methylation, a CRP4-GFP fusion gene under the control of the constitutive 35 S promoter remains unmethylated in leaves and is transcribed to produce a translatable mRNA. By contrast, a CRP4-GFP fusion gene under the control of a CRP4 promoter fragment acquires CG and non-CG methylation in the CRP coding region in leaves similar to the silent endogenous CRP4 gene. Conclusions Unlike CG methylation in gene bodies, which does not dramatically affect Pol II transcription, combined CG and non-CG methylation in CRP coding regions is likely to

  17. Relationships between protein-encoding gene abundance and corresponding process are commonly assumed yet rarely observed

    Science.gov (United States)

    Rocca, Jennifer D.; Hall, Edward K.; Lennon, Jay T.; Evans, Sarah E.; Waldrop, Mark P.; Cotner, James B.; Nemergut, Diana R.; Graham, Emily B.; Wallenstein, Matthew D.

    2015-01-01

    For any enzyme-catalyzed reaction to occur, the corresponding protein-encoding genes and transcripts are necessary prerequisites. Thus, a positive relationship between the abundance of gene or transcripts and corresponding process rates is often assumed. To test this assumption, we conducted a meta-analysis of the relationships between gene and/or transcript abundances and corresponding process rates. We identified 415 studies that quantified the abundance of genes or transcripts for enzymes involved in carbon or nitrogen cycling. However, in only 59 of these manuscripts did the authors report both gene or transcript abundance and rates of the appropriate process. We found that within studies there was a significant but weak positive relationship between gene abundance and the corresponding process. Correlations were not strengthened by accounting for habitat type, differences among genes or reaction products versus reactants, suggesting that other ecological and methodological factors may affect the strength of this relationship. Our findings highlight the need for fundamental research on the factors that control transcription, translation and enzyme function in natural systems to better link genomic and transcriptomic data to ecosystem processes.

  18. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  19. Cloning an artificial gene encoding angiostatic anginex: From designed peptide to functional recombinant protein

    International Nuclear Information System (INIS)

    Brandwijk, Ricardo J.M.G.E.; Nesmelova, Irina; Dings, Ruud P.M.; Mayo, Kevin H.; Thijssen, Victor L.J.L.; Griffioen, Arjan W.

    2005-01-01

    Anginex, a designed peptide 33-mer, is a potent angiogenesis inhibitor and anti-tumor agent in vivo. Anginex functions by inhibiting endothelial cell (EC) proliferation and migration leading to detachment and apoptosis of activated EC's. To better understand tumor endothelium targeting properties of anginex and enable its use in gene therapy, we constructed an artificial gene encoding the biologically exogenous peptide and produced the protein recombinantly in Pichia pastoris. Mass spectrometry shows recombinant anginex to be a dimer and circular dichroism shows the recombinant protein folds with β-strand structure like the synthetic peptide. Moreover, like parent anginex, the recombinant protein is active at inhibiting EC growth and migration, as well as inhibiting angiogenesis in vivo in the chorioallantoic membrane of the chick embryo. This study demonstrated that it is possible to produce a functionally active protein version of a rationally designed peptide, using an artificial gene and the recombinant protein approach

  20. Surfactant Protein-D-Encoding Gene Variant Polymorphisms Are Linked to Respiratory Outcome in Premature Infants

    DEFF Research Database (Denmark)

    Sorensen, Grith Lykke; Dahl, Marianne; Tan, Qihua

    2014-01-01

    OBJECTIVE: Associations between the genetic variation within or downstream of the surfactant protein-D-encoding gene (SFTPD), which encodes the collectin surfactant protein-D (SP-D) and may lead to respiratory distress syndrome or bronchopulmonary dysplasia, recently were reported. Our aim...... were used to associate genetic variation to SP-D, respiratory distress (RD), oxygen requirement, and respiratory support. RESULTS: The 5'-upstream SFTPD SNP rs1923534 and the 3 structural SNPs rs721917, rs2243639, and rs3088308 were associated with the SP-D level. The same SNPs were associated with RD......, a requirement for supplemental oxygen, and a requirement for respiratory support. Haplotype analyses identified 3 haplotypes that included the minor alleles of rs1923534, rs721917, and rs3088308 that exhibited highly significant associations with decreased SP-D levels and decreased ORs for RD, oxygen...

  1. Genes encoding novel lipid transporters and their use to increase oil production in vegetative tissues of plants

    Science.gov (United States)

    Xu, Changcheng; Fan, Jilian; Yan, Chengshi; Shanklin, John

    2017-12-26

    The present invention discloses a novel gene encoding a transporter protein trigalactosyldiacylglycerol-5 (TGD5), mutations thereof and their use to enhance TAG production and retention in plant vegetative tissue.

  2. The porcine lymphotropic herpesvirus 1 encodes functional regulators of gene expression

    International Nuclear Information System (INIS)

    Lindner, I.; Ehlers, B.; Noack, S.; Dural, G.; Yasmum, N.; Bauer, C.; Goltz, M.

    2007-01-01

    The porcine lymphotropic herpesviruses (PLHV) are discussed as possible risk factors in xenotransplantation because of the high prevalence of PLHV-1, PLHV-2 and PLHV-3 in pig populations world-wide and the fact that PLHV-1 has been found to be associated with porcine post-transplant lymphoproliferative disease. To provide structural and functional knowledge on the PLHV immediate-early (IE) transactivator genes, the central regions of the PLHV genomes were characterized by genome walking, sequence and splicing analysis. Three spliced genes were identified (ORF50, ORFA6/BZLF1 h , ORF57) encoding putative IE transactivators, homologous to (i) ORF50 and BRLF1/Rta (ii) K8/K-bZIP and BZLF1/Zta and (iii) ORF57 and BMLF1 of HHV-8 and EBV, respectively. Expressed as myc-tag or HA-tag fusion proteins, they were located to the cellular nucleus. In reporter gene assays, several PLHV-promoters were mainly activated by PLHV-1 ORF50, to a lower level by PLHV-1 ORFA6/BZLF1 h and not by PLHV-1 ORF57. However, the ORF57-encoded protein acted synergistically on ORF50-mediated activation

  3. RAD6 gene of Saccharomyces cerevisiae encodes a protein containing a tract of 13 consecutive aspartates

    International Nuclear Information System (INIS)

    Reynolds, P.; Weber, S.; Prakash, L.

    1985-01-01

    The RAD6 gene of Saccharomyces cerevisiae is required for postreplication repair of UV-damaged DNA, for induced mutagenesis, and for sporulation. The authors have mapped the transcripts and determined the nucleotide sequence of the cloned RAD6 gene. The RAD6 gene encodes two transcripts of 0.98 and 0.86 kilobases which differ only in their 3' termini. The transcribed region contains an open reading frame of 516 nucleotides. The rad6-1 and rad6-3 mutant alleles, which the authors have cloned and sequenced, introduce amber and ochre nonsense mutations, respectively into the open reading frame, proving that it encodes the RAD6 protein. The RAD6 protein predicted by the nucleotide sequence is 172 amino acids long, has a molecular weight of 19,704, and contains 23.3% acidic and 11.6% basic residues. Its most striking feature is the highly acidic carboxyl terminus: 20 of the 23 terminal amino acids are acidic, including 13 consecutive aspartates. RAD6 protein thus resembles high mobility group proteins HMG-1 and HMG-2, which each contain a carboxyl-proximal tract of acidic amino acids. 48 references, 6 figures

  4. Identification of the Gene Encoding Isoprimeverose-producing Oligoxyloglucan Hydrolase in Aspergillus oryzae*

    Science.gov (United States)

    Matsuzawa, Tomohiko; Mitsuishi, Yasushi; Kameyama, Akihiko

    2016-01-01

    Aspergillus oryzae produces a unique β-glucosidase, isoprimeverose-producing oligoxyloglucan hydrolase (IPase), that recognizes and releases isoprimeverose (α-d-xylopyranose-(1→6)-d-glucopyranose) units from the non-reducing ends of oligoxyloglucans. A gene encoding A. oryzae IPase, termed ipeA, was identified and expressed in Pichia pastoris. With the exception of cellobiose, IpeA hydrolyzes a variety of oligoxyloglucans and is a member of the glycoside hydrolase family 3. Xylopyranosyl branching at the non-reducing ends was vital for IPase activity, and galactosylation at a α-1,6-linked xylopyranosyl side chain completely abolished IpeA activity. Hepta-oligoxyloglucan saccharide (Xyl3Glc4) substrate was preferred over tri- (Xyl1Glc2) and tetra- (Xyl2Glc2) oligoxyloglucan saccharides substrates. IpeA transferred isoprimeverose units to other saccharides, indicating transglycosylation activity. The ipeA gene was expressed in xylose and xyloglucan media and was strongly induced in the presence of xyloglucan endo-xyloglucanase-hydrolyzed products. This is the first study to report the identification of a gene encoding IPase in eukaryotes. PMID:26755723

  5. Multiple ace genes encoding acetylcholinesterases of Caenorhabditis elegans have distinct tissue expression.

    Science.gov (United States)

    Combes, Didier; Fedon, Yann; Toutant, Jean-Pierre; Arpagaus, Martine

    2003-08-01

    ace-1 and ace-2 genes encoding acetylcholinesterase in the nematode Caenorhabditis elegans present 35% identity in coding sequences but no homology in noncoding regions (introns, 5'- and 3'-untranslated regions). A 5'-region of ace-2 was defined by rescue of ace-1;ace-2 mutants. When green fluorescent protein (GFP) expression was driven by this regulatory region, the resulting pattern was distinct from that of ace-1. This latter gene is expressed in all body-wall and vulval muscle cells (Culetto et al., 1999), whereas ace-2 is expressed almost exclusively in neurons. ace-3 and ace-4 genes are located in close proximity on chromosome II (Combes et al., 2000). These two genes were first transcribed in vivo as a bicistronic messenger and thus constitute an ace-3;ace-4 operon. However, there was a very low level of monocistronic mRNA of ace-4 (the upstream gene) in vivo, and no ACE-4 enzymatic activity was ever detected. GFP expression driven by a 5' upstream region of the ace-3;ace-4 operon was detected in several muscle cells of the pharynx (pm3, pm4, pm5 and pm7) and in the two canal associated neurons (CAN cells). A dorsal row of body-wall muscle cells was intensively labelled in larval stages but no longer detected in adults. The distinct tissue-specific expression of ace-1, ace-2 and ace-3 (coexpressed only in pm5 cells) indicates that ace genes are not redundant.

  6. Regulation of dsr genes encoding proteins responsible for the oxidation of stored sulfur in Allochromatium vinosum.

    Science.gov (United States)

    Grimm, Frauke; Dobler, Nadine; Dahl, Christiane

    2010-03-01

    Sulfur globules are formed as obligatory intermediates during the oxidation of reduced sulfur compounds in many environmentally important photo- and chemolithoautotrophic bacteria. It is well established that the so-called Dsr proteins are essential for the oxidation of zero-valent sulfur accumulated in the globules; however, hardly anything is known about the regulation of dsr gene expression. Here, we present a closer look at the regulation of the dsr genes in the phototrophic sulfur bacterium Allochromatium vinosum. The dsr genes are expressed in a reduced sulfur compound-dependent manner and neither sulfite, the product of the reverse-acting dissimilatory sulfite reductase DsrAB, nor the alternative electron donor malate inhibit the gene expression. Moreover, we show the oxidation of sulfur to sulfite to be the rate-limiting step in the oxidation of sulfur to sulfate as sulfate production starts concomitantly with the upregulation of the expression of the dsr genes. Real-time RT-PCR experiments suggest that the genes dsrC and dsrS are additionally expressed from secondary internal promoters, pointing to a special function of the encoded proteins. Earlier structural analyses indicated the presence of a helix-turn-helix (HTH)-like motif in DsrC. We therefore assessed the DNA-binding capability of the protein and provide evidence for a possible regulatory function of DsrC.

  7. Diversity of beetle genes encoding novel plant cell wall degrading enzymes.

    Directory of Open Access Journals (Sweden)

    Yannick Pauchet

    Full Text Available Plant cell walls are a heterogeneous mixture of polysaccharides and proteins that require a range of different enzymes to degrade them. Plant cell walls are also the primary source of cellulose, the most abundant and useful biopolymer on the planet. Plant cell wall degrading enzymes (PCWDEs are therefore important in a wide range of biotechnological processes from the production of biofuels and food to waste processing. However, despite the fact that the last common ancestor of all deuterostomes was inferred to be able to digest, or even synthesize, cellulose using endogenous genes, all model insects whose complete genomes have been sequenced lack genes encoding such enzymes. To establish if the apparent "disappearance" of PCWDEs from insects is simply a sampling problem, we used 454 mediated pyrosequencing to scan the gut transcriptomes of beetles that feed on a variety of plant derived diets. By sequencing the transcriptome of five beetles, and surveying publicly available ESTs, we describe 167 new beetle PCWDEs belonging to eight different enzyme families. This survey proves that these enzymes are not only present in non-model insects but that the multigene families that encode them are apparently undergoing complex birth-death dynamics. This reinforces the observation that insects themselves, and not just their microbial symbionts, are a rich source of PCWDEs. Further it emphasises that the apparent absence of genes encoding PCWDEs from model organisms is indeed simply a sampling artefact. Given the huge diversity of beetles alive today, and the diversity of their lifestyles and diets, we predict that beetle guts will emerge as an important new source of enzymes for use in biotechnology.

  8. The Novel Gene CRNDE Encodes a Nuclear Peptide (CRNDEP Which Is Overexpressed in Highly Proliferating Tissues.

    Directory of Open Access Journals (Sweden)

    Lukasz Michal Szafron

    Full Text Available CRNDE, recently described as the lncRNA-coding gene, is overexpressed at RNA level in human malignancies. Its role in gametogenesis, cellular differentiation and pluripotency has been suggested as well. Herein, we aimed to verify our hypothesis that the CRNDE gene may encode a protein product, CRNDEP. By using bioinformatics methods, we identified the 84-amino acid ORF encoded by one of two CRNDE transcripts, previously described by our research team. This ORF was cloned into two expression vectors, subsequently utilized in localization studies in HeLa cells. We also developed a polyclonal antibody against CRNDEP. Its specificity was confirmed in immunohistochemical, cellular localization, Western blot and immunoprecipitation experiments, as well as by showing a statistically significant decrease of endogenous CRNDEP expression in the cells with transient shRNA-mediated knockdown of CRNDE. Endogenous CRNDEP localizes predominantly to the nucleus and its expression seems to be elevated in highly proliferating tissues, like the parabasal layer of the squamous epithelium, intestinal crypts or spermatocytes. After its artificial overexpression in HeLa cells, in a fusion with either the EGFP or DsRed Monomer fluorescent tag, CRNDEP seems to stimulate the formation of stress granules and localize to them. Although the exact role of CRNDEP is unknown, our preliminary results suggest that it may be involved in the regulation of the cell proliferation. Possibly, CRNDEP also participates in oxygen metabolism, considering our in silico results, and the correlation between its enforced overexpression and the formation of stress granules. This is the first report showing the existence of a peptide encoded by the CRNDE gene.

  9. Identification and characterization of an oleate hydratase-encoding gene from Bifidobacterium breve.

    Science.gov (United States)

    O'Connell, Kerry Joan; Motherway, Mary O'Connell; Hennessey, Alan A; Brodhun, Florian; Ross, R Paul; Feussner, Ivo; Stanton, Catherine; Fitzgerald, Gerald F; van Sinderen, Douwe

    2013-01-01

    Bifidobacteria are common commensals of the mammalian gastrointestinal tract. Previous studies have suggested that a bifidobacterial myosin cross reactive antigen (MCRA) protein plays a role in bacterial stress tolerance, while this protein has also been linked to the biosynthesis of conjugated linoleic acid (CLA) in bifidobacteria. In order to increase our understanding on the role of MCRA in bifidobacteria we created and analyzed an insertion mutant of the MCRA-encoding gene of B. breve NCFB 2258. Our results demonstrate that the MCRA protein of B. breve NCFB 2258 does not appear to play a role in CLA production, yet is an oleate hydratase, which contributes to bifidobacterial solvent stress protection.

  10. Expression analysis of the Theileria parva subtelomere-encoded variable secreted protein gene family.

    Directory of Open Access Journals (Sweden)

    Jacqueline Schmuckli-Maurer

    Full Text Available The intracellular protozoan parasite Theileria parva transforms bovine lymphocytes inducing uncontrolled proliferation. Proteins released from the parasite are assumed to contribute to phenotypic changes of the host cell and parasite persistence. With 85 members, genes encoding subtelomeric variable secreted proteins (SVSPs form the largest gene family in T. parva. The majority of SVSPs contain predicted signal peptides, suggesting secretion into the host cell cytoplasm.We analysed SVSP expression in T. parva-transformed cell lines established in vitro by infection of T or B lymphocytes with cloned T. parva parasites. Microarray and quantitative real-time PCR analysis revealed mRNA expression for a wide range of SVSP genes. The pattern of mRNA expression was largely defined by the parasite genotype and not by host background or cell type, and found to be relatively stable in vitro over a period of two months. Interestingly, immunofluorescence analysis carried out on cell lines established from a cloned parasite showed that expression of a single SVSP encoded by TP03_0882 is limited to only a small percentage of parasites. Epitope-tagged TP03_0882 expressed in mammalian cells was found to translocate into the nucleus, a process that could be attributed to two different nuclear localisation signals.Our analysis reveals a complex pattern of Theileria SVSP mRNA expression, which depends on the parasite genotype. Whereas in cell lines established from a cloned parasite transcripts can be found corresponding to a wide range of SVSP genes, only a minority of parasites appear to express a particular SVSP protein. The fact that a number of SVSPs contain functional nuclear localisation signals suggests that proteins released from the parasite could contribute to phenotypic changes of the host cell. This initial characterisation will facilitate future studies on the regulation of SVSP gene expression and the potential biological role of these enigmatic

  11. Effects of TCDD on the expression of nuclear encoded mitochondrial genes

    International Nuclear Information System (INIS)

    Forgacs, Agnes L.; Burgoon, Lyle D.; Lynn, Scott G.; LaPres, John J.; Zacharewski, Timothy

    2010-01-01

    Generation of mitochondrial reactive oxygen species (ROS) can be perturbed following exposure to environmental chemicals such as 2,3,7,8-tetrachlorodibenzo-p-dioxin (TCDD). Reports indicate that the aryl hydrocarbon receptor (AhR) mediates TCDD-induced sustained hepatic oxidative stress by decreasing hepatic ATP levels and through hyperpolarization of the inner mitochondrial membrane. To further elucidate the effects of TCDD on the mitochondria, high-throughput quantitative real-time PCR (HTP-QRTPCR) was used to evaluate the expression of 90 nuclear genes encoding mitochondrial proteins involved in electron transport, oxidative phosphorylation, uncoupling, and associated chaperones. HTP-QRTPCR analysis of time course (30 μg/kg TCDD at 2, 4, 8, 12, 18, 24, 72, and 168 h) liver samples obtained from orally gavaged immature, ovariectomized C57BL/6 mice identified 54 differentially expressed genes (|fold change| > 1.5 and P-value < 0.1). Of these, 8 exhibited a sigmoidal or exponential dose-response profile (0.03 to 300 μg/kg TCDD) at 4, 24 or 72 h. Dose-responsive genes encoded proteins associated with electron transport chain (ETC) complexes I (NADH dehydrogenase), III (cytochrome c reductase), IV (cytochrome c oxidase), and V (ATP synthase) and could be generally categorized as having proton gradient, ATP synthesis, and chaperone activities. In contrast, transcript levels of ETC complex II, succinate dehydrogenase, remained unchanged. Putative dioxin response elements were computationally found in the promoter regions of all 8 dose-responsive genes. This high-throughput approach suggests that TCDD alters the expression of genes associated with mitochondrial function which may contribute to TCDD-elicited mitochondrial toxicity.

  12. Expression of genes encoding multi-transmembrane proteins in specific primate taste cell populations.

    Directory of Open Access Journals (Sweden)

    Bryan D Moyer

    Full Text Available BACKGROUND: Using fungiform (FG and circumvallate (CV taste buds isolated by laser capture microdissection and analyzed using gene arrays, we previously constructed a comprehensive database of gene expression in primates, which revealed over 2,300 taste bud-associated genes. Bioinformatics analyses identified hundreds of genes predicted to encode multi-transmembrane domain proteins with no previous association with taste function. A first step in elucidating the roles these gene products play in gustation is to identify the specific taste cell types in which they are expressed. METHODOLOGY/PRINCIPAL FINDINGS: Using double label in situ hybridization analyses, we identified seven new genes expressed in specific taste cell types, including sweet, bitter, and umami cells (TRPM5-positive, sour cells (PKD2L1-positive, as well as other taste cell populations. Transmembrane protein 44 (TMEM44, a protein with seven predicted transmembrane domains with no homology to GPCRs, is expressed in a TRPM5-negative and PKD2L1-negative population that is enriched in the bottom portion of taste buds and may represent developmentally immature taste cells. Calcium homeostasis modulator 1 (CALHM1, a component of a novel calcium channel, along with family members CALHM2 and CALHM3; multiple C2 domains; transmembrane 1 (MCTP1, a calcium-binding transmembrane protein; and anoctamin 7 (ANO7, a member of the recently identified calcium-gated chloride channel family, are all expressed in TRPM5 cells. These proteins may modulate and effect calcium signalling stemming from sweet, bitter, and umami receptor activation. Synaptic vesicle glycoprotein 2B (SV2B, a regulator of synaptic vesicle exocytosis, is expressed in PKD2L1 cells, suggesting that this taste cell population transmits tastant information to gustatory afferent nerve fibers via exocytic neurotransmitter release. CONCLUSIONS/SIGNIFICANCE: Identification of genes encoding multi-transmembrane domain proteins

  13. GRN2SBML: automated encoding and annotation of inferred gene regulatory networks complying with SBML.

    Science.gov (United States)

    Vlaic, Sebastian; Hoffmann, Bianca; Kupfer, Peter; Weber, Michael; Dräger, Andreas

    2013-09-01

    GRN2SBML automatically encodes gene regulatory networks derived from several inference tools in systems biology markup language. Providing a graphical user interface, the networks can be annotated via the simple object access protocol (SOAP)-based application programming interface of BioMart Central Portal and minimum information required in the annotation of models registry. Additionally, we provide an R-package, which processes the output of supported inference algorithms and automatically passes all required parameters to GRN2SBML. Therefore, GRN2SBML closes a gap in the processing pipeline between the inference of gene regulatory networks and their subsequent analysis, visualization and storage. GRN2SBML is freely available under the GNU Public License version 3 and can be downloaded from http://www.hki-jena.de/index.php/0/2/490. General information on GRN2SBML, examples and tutorials are available at the tool's web page.

  14. Nuclear scaffold attachment sites within ENCODE regions associate with actively transcribed genes.

    Directory of Open Access Journals (Sweden)

    Mignon A Keaton

    2011-03-01

    Full Text Available The human genome must be packaged and organized in a functional manner for the regulation of DNA replication and transcription. The nuclear scaffold/matrix, consisting of structural and functional nuclear proteins, remains after extraction of nuclei and anchors loops of DNA. In the search for cis-elements functioning as chromatin domain boundaries, we identified 453 nuclear scaffold attachment sites purified by lithium-3,5-iodosalicylate extraction of HeLa nuclei across 30 Mb of the human genome studied by the ENCODE pilot project. The scaffold attachment sites mapped predominately near expressed genes and localized near transcription start sites and the ends of genes but not to boundary elements. In addition, these regions were enriched for RNA polymerase II and transcription factor binding sites and were located in early replicating regions of the genome. We believe these sites correspond to genome-interactions mediated by transcription factors and transcriptional machinery immobilized on a nuclear substructure.

  15. Relating genes to function: identifying enriched transcription factors using the ENCODE ChIP-Seq significance tool.

    Science.gov (United States)

    Auerbach, Raymond K; Chen, Bin; Butte, Atul J

    2013-08-01

    Biological analysis has shifted from identifying genes and transcripts to mapping these genes and transcripts to biological functions. The ENCODE Project has generated hundreds of ChIP-Seq experiments spanning multiple transcription factors and cell lines for public use, but tools for a biomedical scientist to analyze these data are either non-existent or tailored to narrow biological questions. We present the ENCODE ChIP-Seq Significance Tool, a flexible web application leveraging public ENCODE data to identify enriched transcription factors in a gene or transcript list for comparative analyses. The ENCODE ChIP-Seq Significance Tool is written in JavaScript on the client side and has been tested on Google Chrome, Apple Safari and Mozilla Firefox browsers. Server-side scripts are written in PHP and leverage R and a MySQL database. The tool is available at http://encodeqt.stanford.edu. abutte@stanford.edu Supplementary material is available at Bioinformatics online.

  16. Three synonymous genes encode calmodulin in a reptile, the Japanese tortoise, Clemmys japonica

    Directory of Open Access Journals (Sweden)

    Kouji Shimoda

    2002-01-01

    Full Text Available Three distinct calmodulin (CaM-encoding cDNAs were isolated from a reptile, the Japanese tortoise (Clemmys japonica, based on degenerative primer PCR. Because of synonymous codon usages, the deduced amino acid (aa sequences were exactly the same in all three genes and identical to the aa sequence of vertebrate CaM. The three cDNAs, referred to as CaM-A, -B, and -C, seemed to belong to the same type as CaMI, CaMII, and CaMIII, respectively, based on their sequence identity with those of the mammalian cDNAs and the glutamate codon biases. Northern blot analysis detected CaM-A and -B as bands corresponding to 1.8 kb, with the most abundant levels in the brain and testis, while CaM-C was detected most abundantly in the brain as bands of 1.4 and 2.0 kb. Our results indicate that, in the tortoise, CaM protein is encoded by at least three non-allelic genes, and that the ‘multigene-one protein' principle of CaM synthesis is applicable to all classes of vertebrates, from fishes to mammals.

  17. Gene encoding a deubiquitinating enzyme is mutated in artesunate- and chloroquine-resistant rodent malaria parasites.

    Science.gov (United States)

    Hunt, Paul; Afonso, Ana; Creasey, Alison; Culleton, Richard; Sidhu, Amar Bir Singh; Logan, John; Valderramos, Stephanie G; McNae, Iain; Cheesman, Sandra; do Rosario, Virgilio; Carter, Richard; Fidock, David A; Cravo, Pedro

    2007-07-01

    Artemisinin- and artesunate-resistant Plasmodium chabaudi mutants, AS-ART and AS-ATN, were previously selected from chloroquine-resistant clones AS-30CQ and AS-15CQ respectively. Now, a genetic cross between AS-ART and the artemisinin-sensitive clone AJ has been analysed by Linkage Group Selection. A genetic linkage group on chromosome 2 was selected under artemisinin treatment. Within this locus, we identified two different mutations in a gene encoding a deubiquitinating enzyme. A distinct mutation occurred in each of the clones AS-30CQ and AS-ATN, relative to their respective progenitors in the AS lineage. The mutations occurred independently in different clones under drug selection with chloroquine (high concentration) or artesunate. Each mutation maps to a critical residue in a homologous human deubiquitinating protein structure. Although one mutation could theoretically account for the resistance of AS-ATN to artemisinin derivates, the other cannot account solely for the resistance of AS-ART, relative to the responses of its sensitive progenitor AS-30CQ. Two lines of Plasmodium falciparum with decreased susceptibility to artemisinin were also selected. Their drug-response phenotype was not genetically stable. No mutations in the UBP-1 gene encoding the P. falciparum orthologue of the deubiquitinating enzyme were observed. The possible significance of these mutations in parasite responses to chloroquine or artemisinin is discussed.

  18. Protocols for 16S rDNA Array Analyses of Microbial Communities by Sequence-Specific Labeling of DNA Probes

    Directory of Open Access Journals (Sweden)

    Knut Rudi

    2003-01-01

    Full Text Available Analyses of complex microbial communities are becoming increasingly important. Bottlenecks in these analyses, however, are the tools to actually describe the biodiversity. Novel protocols for DNA array-based analyses of microbial communities are presented. In these protocols, the specificity obtained by sequence-specific labeling of DNA probes is combined with the possibility of detecting several different probes simultaneously by DNA array hybridization. The gene encoding 16S ribosomal RNA was chosen as the target in these analyses. This gene contains both universally conserved regions and regions with relatively high variability. The universally conserved regions are used for PCR amplification primers, while the variable regions are used for the specific probes. Protocols are presented for DNA purification, probe construction, probe labeling, and DNA array hybridizations.

  19. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Science.gov (United States)

    Savage, Linda J; Imre, Kathleen M; Hall, David A; Last, Robert L

    2013-01-01

    The Chloroplast 2010 Project (http://www.plastid.msu.edu/) identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/). Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles were identified.

  20. Analysis of essential Arabidopsis nuclear genes encoding plastid-targeted proteins.

    Directory of Open Access Journals (Sweden)

    Linda J Savage

    Full Text Available The Chloroplast 2010 Project (http://www.plastid.msu.edu/ identified and phenotypically characterized homozygous mutants in over three thousand genes, the majority of which encode plastid-targeted proteins. Despite extensive screening by the community, no homozygous mutant alleles were available for several hundred genes, suggesting that these might be enriched for genes of essential function. Attempts were made to generate homozygotes in ~1200 of these lines and 521 of the homozygous viable lines obtained were deposited in the Arabidopsis Biological Resource Center (http://abrc.osu.edu/. Lines that did not yield a homozygote in soil were tested as potentially homozygous lethal due to defects either in seed or seedling development. Mutants were characterized at four stages of development: developing seed, mature seed, at germination, and developing seedlings. To distinguish seed development or seed pigment-defective mutants from seedling development mutants, development of seeds was assayed in siliques from heterozygous plants. Segregating seeds from heterozygous parents were sown on supplemented media in an attempt to rescue homozygous seedlings that could not germinate or survive in soil. Growth of segregating seeds in air and air enriched to 0.3% carbon dioxide was compared to discover mutants potentially impaired in photorespiration or otherwise responsive to CO2 supplementation. Chlorophyll fluorescence measurements identified CO2-responsive mutants with altered photosynthetic parameters. Examples of genes with a viable mutant allele and one or more putative homozygous-lethal alleles were documented. RT-PCR of homozygotes for potentially weak alleles revealed that essential genes may remain undiscovered because of the lack of a true null mutant allele. This work revealed 33 genes with two or more lethal alleles and 73 genes whose essentiality was not confirmed with an independent lethal mutation, although in some cases second leaky alleles

  1. The Relationship Between Transcript Expression Levels of Nuclear Encoded (TFAM, NRF1 and Mitochondrial Encoded (MT-CO1 Genes in Single Human Oocytes During Oocyte Maturation

    Directory of Open Access Journals (Sweden)

    Ghaffari Novin M.

    2015-06-01

    Full Text Available In some cases of infertility in women, human oocytes fail to mature when they reach the metaphase II (MII stage. Mitochondria plays an important role in oocyte maturation. A large number of mitochondrial DNA (mtDNA, copied in oocytes, is essential for providing adenosine triphosphate (ATP during oocyte maturation. The purpose of this study was to identify the relationship between transcript expression levels of the mitochondrial encoded gene (MT-CO1 and two nuclear encoded genes, nuclear respiratory factor 1 (NRF1 and mitochondrial transcription factor A (TFAM in various stages of human oocyte maturation. Nine consenting patients, age 21-35 years old, with male factors were selected for ovarian stimulation and intracytoplasmic sperm injection (ICSI procedures. mRNA levels of mitochondrial- related genes were performed by singlecell TaqMan® quantitative real-time polymerase chain reaction (qRT-PCR. There was no significant relationship between the relative expression levels in germinal vesicle (GV stage oocytes (p = 0.62. On the contrary, a significant relationship was seen between the relative expression levels of TFAM and NRF1 and the MT-CO1 genes at the stages of metaphase I (MI and MII (p = 0.03 and p = 0.002. A relationship exists between the transcript expression levels of TFAM and NRF1, and MT-CO1 genes in various stages of human oocyte maturation.

  2. [Cloning, prokaryotic expression and antibacterial assay of Tenecin gene encoding an antibacterial peptide from Tenebrio molitor].

    Science.gov (United States)

    Liu, Ying; Jiang, Yu-xin; Li, Chao-pin

    2011-12-01

    To clone tenecin gene, an antibacterial peptide gene, from Tenebrio molitor for its prokaryotic expression and explore the molecular mechanism for regulating the expression of antibacterial peptide in Tenebrio molitor larvae. The antibacterial peptide was induced from the larvae of Tenebrio molitor by intraperitoneal injection of Escherichia coli DH-5α (1×10(8)/ml). RT-PCR was performed 72 h after the injection to clone Tenecin gene followed by sequencing and bioinformatic analysis. The recombinant expression vector pET-28a(+)-Tenecin was constructed and transformed into E. coli BL21(DE3) cells and the expression of tenecin protein was observed after IPTG induction. Tenecin expression was detected in transformed E.coli using SDS-PAGE after 1 mmol/L IPTG induction. Tenecin gene, which was about 255 bp in length, encoded Tenecin protein with a relative molecular mass of 9 kD. Incubation of E.coli with 80, 60, 40, and 20 µg/ml tenecin for 18 h resulted in a diameter of the inhibition zone of 25.1∓0.03, 20.7∓0.06, 17.2∓0.11 and 9.3∓0.04 mm, respectively. Tenecin protein possesses strong antibacterial activity against E. coli DH-5α, which warrants further study of this protein for its potential as an antibacterial agent in clinical application.

  3. Polymorphisms in genes encoding leptin, ghrelin and their receptors in German multiple sclerosis patients.

    Science.gov (United States)

    Rey, Linda K; Wieczorek, Stefan; Akkad, Denis A; Linker, Ralf A; Chan, Andrew; Hoffjan, Sabine

    2011-01-01

    Multiple sclerosis (MS) is a neuro-inflammatory, autoimmune disease influenced by environmental and polygenic components. There is growing evidence that the peptide hormone leptin, known to regulate energy homeostasis, as well as its antagonist ghrelin play an important role in inflammatory processes in autoimmune diseases, including MS. Recently, single nucleotide polymorphisms (SNPs) in the genes encoding leptin, ghrelin and their receptors were evaluated, amongst others, in Wegener's granulomatosis and Churg-Strauss syndrome. The Lys656Asn SNP in the LEPR gene showed a significant but contrasting association with these vasculitides. We therefore aimed at investigating these polymorphisms in a German MS case-control cohort. Twelve SNPs in the LEP, LEPR, GHRL and GHSR genes were genotyped in 776 MS patients and 878 control subjects. We found an association of a haplotype in the GHSR gene with MS that could not be replicated in a second cohort. Otherwise, no significant differences in allele or genotype frequencies were observed between patients and controls in this particular cohort. Thus, the present results do not support the hypothesis that genetic variation in the leptin/ghrelin system contributes substantially to the pathogenesis of MS. However, a modest effect of GHSR variation cannot be ruled out and needs to be further evaluated in future studies. Copyright © 2011 Elsevier Ltd. All rights reserved.

  4. Regulation of the ald Gene Encoding Alanine Dehydrogenase by AldR in Mycobacterium smegmatis

    Science.gov (United States)

    Jeong, Ji-A; Baek, Eun-Young; Kim, Si Wouk; Choi, Jong-Soon

    2013-01-01

    The regulatory gene aldR was identified 95 bp upstream of the ald gene encoding l-alanine dehydrogenase in Mycobacterium smegmatis. The AldR protein shows sequence similarity to the regulatory proteins of the Lrp/AsnC family. Using an aldR deletion mutant, we demonstrated that AldR serves as both activator and repressor for the regulation of ald gene expression, depending on the presence or absence of l-alanine. The purified AldR protein exists as a homodimer in the absence of l-alanine, while it adopts the quaternary structure of a homohexamer in the presence of l-alanine. The binding affinity of AldR for the ald control region was shown to be increased significantly by l-alanine. Two AldR binding sites (O1 and O2) with the consensus sequence GA-N2-ATC-N2-TC and one putative AldR binding site with the sequence GA-N2-GTT-N2-TC were identified upstream of the ald gene. Alanine and cysteine were demonstrated to be the effector molecules directly involved in the induction of ald expression. The cellular level of l-alanine was shown to be increased in M. smegmatis cells grown under hypoxic conditions, and the hypoxic induction of ald expression appears to be mediated by AldR, which senses the intracellular level of alanine. PMID:23749971

  5. Carboxylesterase 1A2 encoding gene with increased transcription and potential rapid drug metabolism in Asian populations

    DEFF Research Database (Denmark)

    Rasmussen, Henrik Berg; Madsen, Majbritt Busk; Lyauk, Yassine Kamal

    2017-01-01

    The carboxylesterase 1 gene (CES1) encodes a hydrolase implicated in the metabolism of commonly used drugs. CES1A2, a hybrid of CES1 and a CES1-like pseudogene, has a promoter that is weak in most individuals. However, some individuals harbor a promoter haplotype of this gene with two overlapping...

  6. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  7. Medicago truncatula contains a second gene encoding a plastid located glutamine synthetase exclusively expressed in developing seeds

    Directory of Open Access Journals (Sweden)

    Seabra Ana R

    2010-08-01

    Full Text Available Abstract Background Nitrogen is a crucial nutrient that is both essential and rate limiting for plant growth and seed production. Glutamine synthetase (GS, occupies a central position in nitrogen assimilation and recycling, justifying the extensive number of studies that have been dedicated to this enzyme from several plant sources. All plants species studied to date have been reported as containing a single, nuclear gene encoding a plastid located GS isoenzyme per haploid genome. This study reports the existence of a second nuclear gene encoding a plastid located GS in Medicago truncatula. Results This study characterizes a new, second gene encoding a plastid located glutamine synthetase (GS2 in M. truncatula. The gene encodes a functional GS isoenzyme with unique kinetic properties, which is exclusively expressed in developing seeds. Based on molecular data and the assumption of a molecular clock, it is estimated that the gene arose from a duplication event that occurred about 10 My ago, after legume speciation and that duplicated sequences are also present in closely related species of the Vicioide subclade. Expression analysis by RT-PCR and western blot indicate that the gene is exclusively expressed in developing seeds and its expression is related to seed filling, suggesting a specific function of the enzyme associated to legume seed metabolism. Interestingly, the gene was found to be subjected to alternative splicing over the first intron, leading to the formation of two transcripts with similar open reading frames but varying 5' UTR lengths, due to retention of the first intron. To our knowledge, this is the first report of alternative splicing on a plant GS gene. Conclusions This study shows that Medicago truncatula contains an additional GS gene encoding a plastid located isoenzyme, which is functional and exclusively expressed during seed development. Legumes produce protein-rich seeds requiring high amounts of nitrogen, we postulate

  8. Diagnostic Utility of Broad Range Bacterial 16S rRNA Gene PCR with Degradation of Human and Free Bacterial DNA in Bloodstream Infection Is More Sensitive Than an In-House Developed PCR without Degradation of Human and Free Bacterial DNA

    Directory of Open Access Journals (Sweden)

    Petra Rogina

    2014-01-01

    Full Text Available We compared a commercial broad range 16S rRNA gene PCR assay (SepsiTest to an in-house developed assay (IHP. We assessed whether CD64 index, a biomarker of bacterial infection, can be used to exclude patients with a low probability of systemic bacterial infection. From January to March 2010, 23 patients with suspected sepsis were enrolled. CD64 index, procalcitonin, and C-reactive protein were measured on admission. Broad range 16S rRNA gene PCR was performed from whole blood (SepsiTest or blood plasma (IHP and compared to blood culture results. Blood samples spiked with Staphylococcus aureus were used to assess sensitivity of the molecular assays in vitro. CD64 index was lower in patients where possible sepsis was excluded than in patients with microbiologically confirmed sepsis (P=0.004. SepsiTest identified more relevant pathogens than blood cultures (P=0.008; in three patients (13% results from blood culture and SepsiTest were congruent, whereas in four cases (17.4% relevant pathogens were detected by SepsiTest only. In vitro spiking experiments suggested equal sensitivity of SepsiTest and IHP. A diagnostic algorithm using CD64 index as a decision maker to perform SepsiTest shows improved detection of pathogens in patients with suspected blood stream infection and may enable earlier targeted antibiotic therapy.

  9. Overproduction of lactimidomycin by cross-overexpression of genes encoding Streptomyces antibiotic regulatory proteins.

    Science.gov (United States)

    Zhang, Bo; Yang, Dong; Yan, Yijun; Pan, Guohui; Xiang, Wensheng; Shen, Ben

    2016-03-01

    The glutarimide-containing polyketides represent a fascinating class of natural products that exhibit a multitude of biological activities. We have recently cloned and sequenced the biosynthetic gene clusters for three members of the glutarimide-containing polyketides-iso-migrastatin (iso-MGS) from Streptomyces platensis NRRL 18993, lactimidomycin (LTM) from Streptomyces amphibiosporus ATCC 53964, and cycloheximide (CHX) from Streptomyces sp. YIM56141. Comparative analysis of the three clusters identified mgsA and chxA, from the mgs and chx gene clusters, respectively, that were predicted to encode the PimR-like Streptomyces antibiotic regulatory proteins (SARPs) but failed to reveal any regulatory gene from the ltm gene cluster. Overexpression of mgsA or chxA in S. platensis NRRL 18993, Streptomyces sp. YIM56141 or SB11024, and a recombinant strain of Streptomyces coelicolor M145 carrying the intact mgs gene cluster has no significant effect on iso-MGS or CHX production, suggesting that MgsA or ChxA regulation may not be rate-limiting for iso-MGS and CHX production in these producers. In contrast, overexpression of mgsA or chxA in S. amphibiosporus ATCC 53964 resulted in a significant increase in LTM production, with LTM titer reaching 106 mg/L, which is five-fold higher than that of the wild-type strain. These results support MgsA and ChxA as members of the SARP family of positive regulators for the iso-MGS and CHX biosynthetic machinery and demonstrate the feasibility to improve glutarimide-containing polyketide production in Streptomyces strains by exploiting common regulators.

  10. Diversity and impact of rare variants in genes encoding the platelet G protein-coupled receptors.

    Science.gov (United States)

    Jones, Matthew L; Norman, Jane E; Morgan, Neil V; Mundell, Stuart J; Lordkipanidzé, Marie; Lowe, Gillian C; Daly, Martina E; Simpson, Michael A; Drake, Sian; Watson, Steve P; Mumford, Andrew D

    2015-04-01

    Platelet responses to activating agonists are influenced by common population variants within or near G protein-coupled receptor (GPCR) genes that affect receptor activity. However, the impact of rare GPCR gene variants is unknown. We describe the rare single nucleotide variants (SNVs) in the coding and splice regions of 18 GPCR genes in 7,595 exomes from the 1,000-genomes and Exome Sequencing Project databases and in 31 cases with inherited platelet function disorders (IPFDs). In the population databases, the GPCR gene target regions contained 740 SNVs (318 synonymous, 410 missense, 7 stop gain and 6 splice region) of which 70 % had global minor allele frequency (MAF) < 0.05 %. Functional annotation using six computational algorithms, experimental evidence and structural data identified 156/740 (21 %) SNVs as potentially damaging to GPCR function, most commonly in regions encoding the transmembrane and C-terminal intracellular receptor domains. In 31 index cases with IPFDs (Gi-pathway defect n=15; secretion defect n=11; thromboxane pathway defect n=3 and complex defect n=2) there were 256 SNVs in the target regions of 15 stimulatory platelet GPCRs (34 unique; 12 with MAF< 1 % and 22 with MAF≥ 1 %). These included rare variants predicting R122H, P258T and V207A substitutions in the P2Y12 receptor that were annotated as potentially damaging, but only partially explained the platelet function defects in each case. Our data highlight that potentially damaging variants in platelet GPCR genes have low individual frequencies, but are collectively abundant in the population. Potentially damaging variants are also present in pedigrees with IPFDs and may contribute to complex laboratory phenotypes.

  11. Two Paralogous Genes Encoding Auxin Efflux Carrier Differentially Expressed in Bitter Gourd (Momordica charantia

    Directory of Open Access Journals (Sweden)

    Yi-Li Li

    2017-11-01

    Full Text Available The phytohormone auxin regulates various developmental programs in plants, including cell growth, cell division and cell differentiation. The auxin efflux carriers are essential for the auxin transport. To show an involvement of auxin transporters in the coordination of fruit development in bitter gourd, a juicy fruit, we isolated novel cDNAs (referred as McPIN encoding putative auxin efflux carriers, including McPIN1, McPIN2 (allele of McPIN1 and McPIN3, from developing fruits of bitter gourd. Both McPIN1 and McPIN3 genes possess six exons and five introns. Hydropathy analysis revealed that both polypeptides have two hydrophobic regions with five transmembrane segments and a predominantly hydrophilic core. Phylogenetic analyses revealed that McPIN1 shared the highest homology to the group of Arabidopsis, cucumber and tomato PIN1, while McPIN3 belonged to another group, including Arabidopsis and tomato PIN3 as well as PIN4. This suggests different roles for McPIN1 and McPIN3 in auxin transport involved in the fruit development of bitter gourd. Maximum mRNA levels for both genes were detected in staminate and pistillate flowers. McPIN1 is expressed in a particular period of early fruit development but McPIN3 continues to be expressed until the last stage of fruit ripening. Moreover, these two genes are auxin-inducible and qualified as early auxin-response genes. Their expression patterns suggest that these two auxin transporter genes play a pivotal role in fruit setting and development.

  12. The Candida albicans-specific gene EED1 encodes a key regulator of hyphal extension.

    LENUS (Irish Health Repository)

    Martin, Ronny

    2011-04-01

    The extension of germ tubes into elongated hyphae by Candida albicans is essential for damage of host cells. The C. albicans-specific gene EED1 plays a crucial role in this extension and maintenance of filamentous growth. eed1Δ cells failed to extend germ tubes into long filaments and switched back to yeast growth after 3 h of incubation during growth on plastic surfaces. Expression of EED1 is regulated by the transcription factor Efg1 and ectopic overexpression of EED1 restored filamentation in efg1Δ. Transcriptional profiling of eed1Δ during infection of oral tissue revealed down-regulation of hyphal associated genes including UME6, encoding another key transcriptional factor. Ectopic overexpression of EED1 or UME6 rescued filamentation and damage potential in eed1Δ. Transcriptional profiling during overexpression of UME6 identified subsets of genes regulated by Eed1 or Ume6. These data suggest that Eed1 and Ume6 act in a pathway regulating maintenance of hyphal growth thereby repressing hyphal-to-yeast transition and permitting dissemination of C. albicans within epithelial tissues.

  13. Identification of genes encoding granule-bound starch synthase involved in amylose metabolism in banana fruit.

    Directory of Open Access Journals (Sweden)

    Hongxia Miao

    Full Text Available Granule-bound starch synthase (GBSS is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage.

  14. Identification of Genes Encoding Granule-Bound Starch Synthase Involved in Amylose Metabolism in Banana Fruit

    Science.gov (United States)

    Liu, Weixin; Xu, Biyu; Jin, Zhiqiang

    2014-01-01

    Granule-bound starch synthase (GBSS) is responsible for amylose synthesis, but the role of GBSS genes and their encoded proteins remains poorly understood in banana. In this study, amylose content and GBSS activity gradually increased during development of the banana fruit, and decreased during storage of the mature fruit. GBSS protein in banana starch granules was approximately 55.0 kDa. The protein was up-regulated expression during development while it was down-regulated expression during storage. Six genes, designated as MaGBSSI-1, MaGBSSI-2, MaGBSSI-3, MaGBSSI-4, MaGBSSII-1, and MaGBSSII-2, were cloned and characterized from banana fruit. Among the six genes, the expression pattern of MaGBSSI-3 was the most consistent with the changes in amylose content, GBSS enzyme activity, GBSS protein levels, and the quantity or size of starch granules in banana fruit. These results suggest that MaGBSSI-3 might regulate amylose metabolism by affecting the variation of GBSS levels and the quantity or size of starch granules in banana fruit during development or storage. PMID:24505384

  15. The abp gene in Geobacillus stearothermophilus T-6 encodes a GH27 β-L-arabinopyranosidase.

    Science.gov (United States)

    Salama, Rachel; Alalouf, Onit; Tabachnikov, Orly; Zolotnitsky, Gennady; Shoham, Gil; Shoham, Yuval

    2012-07-30

    In this study we demonstrate that the abp gene in Geobacillus stearothermophilus T-6 encodes a family 27 glycoside hydrolase β-L-arabinopyranosidase. The catalytic constants towards the chromogenic substrate pNP-β-L-arabinopyranoside were 0.8±0.1 mM, 6.6±0.3 s(-1), and 8.2±0.3 s(-1) mM(-1) for K(m), k(cat) and k(cat)/K(m), respectively. (13)C NMR spectroscopy unequivocally showed that Abp is capable of removing β-L-arabinopyranose residues from the natural arabino-polysaccharide, larch arabinogalactan. Most family 27 enzymes are active on galactose and contain a conserved Asp residue, whereas in Abp this residue is Ile67, which shifts the specificity of the enzyme towards arabinopyranoside. Copyright © 2012 Federation of European Biochemical Societies. Published by Elsevier B.V. All rights reserved.

  16. Reduction of antinutritional glucosinolates in Brassica oilseeds by mutation of genes encoding transporters

    DEFF Research Database (Denmark)

    Nour-Eldin, Hussam Hassan; Madsen, Svend Roesen; Engelen, Steven

    2017-01-01

    The nutritional value of Brassica seed meals is reduced by the presence of glucosinolates, which are toxic compounds involved in plant defense. Mutation of the genes encoding two glucosinolate transporters (GTRs) eliminated glucosinolates from Arabidopsis thaliana seeds, but translation of loss......-of-function phenotypes into Brassica crops is challenging because Brassica is polyploid. We mutated one of seven and four of 12 GTR orthologs and reduced glucosinolate levels in seeds by 60-70% in two different Brassica species (Brassica rapa and Brassica juncea). Reduction in seed glucosinolates was stably inherited...... over multiple generations and maintained in field trials of two mutant populations at three locations. Successful translation of the gtr loss-of-function phenotype from model plant to two Brassica crops suggests that our transport engineering approach could be broadly applied to reduce seed...

  17. OVER-EXPRESSION OF GENE ENCODING FATTY ACID METABOLIC ENZYMES IN FISH

    Directory of Open Access Journals (Sweden)

    Alimuddin Alimuddin

    2008-12-01

    Full Text Available Eicosapentaenoic acid (EPA, 20:5n-3 and docosahexaenoic acid (DHA, 22:6n-3 have important nutritional benefits in humans. EPA and DHA are mainly derived from fish, but the decline in the stocks of major marine capture fishes could result in these fatty acids being consumed less. Farmed fish could serve as promising sources of EPA and DHA, but they need these fatty acids in their diets. Generation of fish strains that are capable of synthesizing enough amounts of EPA/DHA from the conversion of α-linolenic acid (LNA, 18:3n-3 rich oils can supply a new EPA/DHA source. This may be achieved by over-expression of genes encoding enzymes involved in HUFA biosynthesis. In aquaculture, the successful of this technique would open the possibility to reduce the enrichment of live food with fish oils for marine fish larvae, and to completely substitute fish oils with plant oils without reducing the quality of flesh in terms of EPA and DHA contents. Here, three genes, i.e. Δ6-desaturase-like (OmΔ6FAD, Δ5-desaturase-like (OmΔ5FAD and elongase-like (MELO encoding EPA/DHA metabolic enzymes derived from masu salmon (Oncorhynchus masou were individually transferred into zebrafish (Danio rerio as a model to increase its ability for synthesizing EPA and DHA. Fatty acid analysis showed that EPA content in whole body of the second transgenic fish generation over-expressing OmΔ6FAD gene was 1.4 fold and that of DHA was 2.1 fold higher (P<0.05 than those in non-transgenic fish. The EPA content in whole body of transgenic fish over-expressing OmΔ5FAD gene was 1.21-fold, and that of DHA was 1.24-fold higher (P<0.05 than those in nontransgenic fish. The same patterns were obtained in transgenic fish over-expressing MELO gene. EPA content was increased by 1.30-fold and DHA content by 1.33-fold higher (P<0.05 than those in non-transgenic fish. The results of studies demonstrated that fatty acid content of fish can be enhanced by over

  18. Evolutionary genomics of plant genes encoding N-terminal-TM-C2 domain proteins and the similar FAM62 genes and synaptotagmin genes of metazoans

    Directory of Open Access Journals (Sweden)

    Craxton Molly

    2007-07-01

    Full Text Available Abstract Background Synaptotagmin genes are found in animal genomes and are known to function in the nervous system. Genes with a similar domain architecture as well as sequence similarity to synaptotagmin C2 domains have also been found in plant genomes. The plant genes share an additional region of sequence similarity with a group of animal genes named FAM62. FAM62 genes also have a similar domain architecture. Little is known about the functions of the plant genes and animal FAM62 genes. Indeed, many members of the large and diverse Syt gene family await functional characterization. Understanding the evolutionary relationships among these genes will help to realize the full implications of functional studies and lead to improved genome annotation. Results I collected and compared plant Syt-like sequences from the primary nucleotide sequence databases at NCBI. The collection comprises six groups of plant genes conserved in embryophytes: NTMC2Type1 to NTMC2Type6. I collected and compared metazoan FAM62 sequences and identified some similar sequences from other eukaryotic lineages. I found evidence of RNA editing and alternative splicing. I compared the intron patterns of Syt genes. I also compared Rabphilin and Doc2 genes. Conclusion Genes encoding proteins with N-terminal-transmembrane-C2 domain architectures resembling synaptotagmins, are widespread in eukaryotes. A collection of these genes is presented here. The collection provides a resource for studies of intron evolution. I have classified the collection into homologous gene families according to distinctive patterns of sequence conservation and intron position. The evolutionary histories of these gene families are traceable through the appearance of family members in different eukaryotic lineages. Assuming an intron-rich eukaryotic ancestor, the conserved intron patterns distinctive of individual gene families, indicate independent origins of Syt, FAM62 and NTMC2 genes. Resemblances

  19. Analysis of the structural genes encoding M-factor in the fission yeast Schizosaccharomyces pombe: identification of a third gene, mfm3

    DEFF Research Database (Denmark)

    Kjaerulff, S; Davey, William John; Nielsen, O

    1994-01-01

    We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M-factor. ......We previously identified two genes, mfm1 and mfm2, with the potential to encode the M-factor mating pheromone of the fission yeast Schizosaccharomyces pombe (J. Davey, EMBO J. 11:951-960, 1992), but further analysis revealed that a mutant strain lacking both genes still produced active M...... that is not rescued by addition of exogenous M-factor. A mutational analysis reveals that all three mfm genes contribute to the production of M-factor. Their transcription is limited to M cells and requires the mat1-Mc and ste11 gene products. Each gene is induced when the cells are starved of nitrogen and further...

  20. MitoRes: a resource of nuclear-encoded mitochondrial genes and their products in Metazoa.

    Science.gov (United States)

    Catalano, Domenico; Licciulli, Flavio; Turi, Antonio; Grillo, Giorgio; Saccone, Cecilia; D'Elia, Domenica

    2006-01-24

    Mitochondria are sub-cellular organelles that have a central role in energy production and in other metabolic pathways of all eukaryotic respiring cells. In the last few years, with more and more genomes being sequenced, a huge amount of data has been generated providing an unprecedented opportunity to use the comparative analysis approach in studies of evolution and functional genomics with the aim of shedding light on molecular mechanisms regulating mitochondrial biogenesis and metabolism. In this context, the problem of the optimal extraction of representative datasets of genomic and proteomic data assumes a crucial importance. Specialised resources for nuclear-encoded mitochondria-related proteins already exist; however, no mitochondrial database is currently available with the same features of MitoRes, which is an update of the MitoNuc database extensively modified in its structure, data sources and graphical interface. It contains data on nuclear-encoded mitochondria-related products for any metazoan species for which this type of data is available and also provides comprehensive sequence datasets (gene, transcript and protein) as well as useful tools for their extraction and export. MitoRes http://www2.ba.itb.cnr.it/MitoRes/ consolidates information from publicly external sources and automatically annotates them into a relational database. Additionally, it also clusters proteins on the basis of their sequence similarity and interconnects them with genomic data. The search engine and sequence management tools allow the query/retrieval of the database content and the extraction and export of sequences (gene, transcript, protein) and related sub-sequences (intron, exon, UTR, CDS, signal peptide and gene flanking regions) ready to be used for in silico analysis. The tool we describe here has been developed to support lab scientists and bioinformaticians alike in the characterization of molecular features and evolution of mitochondrial targeting sequences. The

  1. Genetic and functional analysis of the gene encoding GAP-43 in schizophrenia.

    Science.gov (United States)

    Shen, Yu-Chih; Tsai, Ho-Min; Cheng, Min-Chih; Hsu, Shih-Hsin; Chen, Shih-Fen; Chen, Chia-Hsiang

    2012-02-01

    In earlier reports, growth-associated protein 43 (GAP-43) has been shown to be critical for initial establishment or reorganization of synaptic connections, a process thought to be disrupted in schizophrenia. Additionally, abnormal GAP-43 expression in different brain regions has been linked to this disorder in postmortem brain studies. In this study, we investigated the involvement of the gene encoding GAP-43 in the susceptibility to schizophrenia. We searched for genetic variants in the promoter region and 3 exons (including both UTR ends) of the GAP-43 gene using direct sequencing in a sample of patients with schizophrenia (n=586) and non-psychotic controls (n=576), both being Han Chinese from Taiwan, and conducted an association and functional study. We identified 11 common polymorphisms in the GAP-43 gene. SNP and haplotype-based analyses displayed no associations with schizophrenia. Additionally, we identified 4 rare variants in 5 out of 586 patients, including 1 variant located at the promoter region (c.-258-4722G>T) and 1 synonymous (V110V) and 2 missense (G150R and P188L) variants located at exon 2. No rare variants were found in the control subjects. The results of the reporter gene assay demonstrated that the regulatory activity of construct containing c.-258-4722T was significantly lower as compared to the wild type construct (c.-258-4722G; panalysis also demonstrated the functional relevance of other rare variants. Our study lends support to the hypothesis of multiple rare mutations in schizophrenia, and it provides genetic clues that indicate the involvement of GAP-43 in this disorder. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Sequence variation in the alpha-toxin encoding plc gene of Clostridium perfringens strains isolated from diseased and healthy chickens

    DEFF Research Database (Denmark)

    Abildgaard, L; Engberg, RM; Pedersen, Karl

    2009-01-01

    The aim of the present study was to analyse the genetic diversity of the alpha-toxin encoding plc gene and the variation in a-toxin production of Clostridium perfringens type A strains isolated from presumably healthy chickens and chickens suffering from either necrotic enteritis (NE) or cholangio......-hepatitis. The a-toxin encoding plc genes from 60 different pulsed-field gel electrophoresis (PFGE) types (strains) of C perfringens were sequenced and translated in silico to amino acid sequences and the a-toxin production was investigated in batch cultures of 45 of the strains using an enzyme...

  3. Genes involved in meso-diaminopimelate synthesis in Bacillus subtilis: identification of the gene encoding aspartokinase I.

    Science.gov (United States)

    Roten, C A; Brandt, C; Karamata, D

    1991-04-01

    Thermosensitive mutants of Bacillus subtilis deficient in peptidoglycan synthesis were screened for mutations in the meso-diaminopimelate (LD-A2pm) metabolic pathway. Mutations in two out of five relevant linkage groups, lssB and lssD, were shown to induce, at the restrictive temperature, a deficiency in LD-A2pm synthesis and accumulation of UDP-MurNAc-dipeptide. Group lssB is heterogeneous; it encompasses mutations that confer deficiency in the deacylation of N-acetyl-LL-A2pm and accumulation of this precursor. Accordingly, these mutations are assigned to the previously identified locus dapE. Mutations in linkage group lssD entail a thermosensitive aspartokinase 1. Therefore, they are most likely to affect the structural gene of this enzyme, which we propose to designate dapG. Mutation pyc-1476, previously reported to affect the pyruvate carboxylase, was shown to confer a deficiency in aspartokinase 1, not in the carboxylase, and to belong to the dapG locus, dapG is closely linked to spoVF, the putative gene of dipicolinate synthase. In conclusion, mutations affecting only two out of eight steps known to be involved in LD-A2pm synthesis were uncovered in a large collection of thermosensitive mutants obtained by indirect selection. We propose that this surprisingly restricted distribution of the thermosensitive dap mutations isolated so far is due to the existence, in each step of the pathway, of isoenzymes encoded by separate genes. The biological role of different aspartokinases was investigated with mutants deficient in dapE and dapG genes. Growth characteristics of these mutants in the presence of various combinations of aspartate family amino acids allow a reassessment of a metabolic channel hypothesis, i.e. the proposed existence of multienzyme complexes, each specific for a given end product.

  4. The you gene encodes an EGF-CUB protein essential for Hedgehog signaling in zebrafish.

    Directory of Open Access Journals (Sweden)

    Ian G Woods

    2005-03-01

    Full Text Available Hedgehog signaling is required for many aspects of development in vertebrates and invertebrates. Misregulation of the Hedgehog pathway causes developmental abnormalities and has been implicated in certain types of cancer. Large-scale genetic screens in zebrafish have identified a group of mutations, termed you-class mutations, that share common defects in somite shape and in most cases disrupt Hedgehog signaling. These mutant embryos exhibit U-shaped somites characteristic of defects in slow muscle development. In addition, Hedgehog pathway mutations disrupt spinal cord patterning. We report the positional cloning of you, one of the original you-class mutations, and show that it is required for Hedgehog signaling in the development of slow muscle and in the specification of ventral fates in the spinal cord. The you gene encodes a novel protein with conserved EGF and CUB domains and a secretory pathway signal sequence. Epistasis experiments support an extracellular role for You upstream of the Hedgehog response mechanism. Analysis of chimeras indicates that you mutant cells can appropriately respond to Hedgehog signaling in a wild-type environment. Additional chimera analysis indicates that wild-type you gene function is not required in axial Hedgehog-producing cells, suggesting that You is essential for transport or stability of Hedgehog signals in the extracellular environment. Our positional cloning and functional studies demonstrate that You is a novel extracellular component of the Hedgehog pathway in vertebrates.

  5. An evolutionarily conserved gene family encodes proton-selective ion channels.

    Science.gov (United States)

    Tu, Yu-Hsiang; Cooper, Alexander J; Teng, Bochuan; Chang, Rui B; Artiga, Daniel J; Turner, Heather N; Mulhall, Eric M; Ye, Wenlei; Smith, Andrew D; Liman, Emily R

    2018-03-02

    Ion channels form the basis for cellular electrical signaling. Despite the scores of genetically identified ion channels selective for other monatomic ions, only one type of proton-selective ion channel has been found in eukaryotic cells. By comparative transcriptome analysis of mouse taste receptor cells, we identified Otopetrin1 (OTOP1), a protein required for development of gravity-sensing otoconia in the vestibular system, as forming a proton-selective ion channel. We found that murine OTOP1 is enriched in acid-detecting taste receptor cells and is required for their zinc-sensitive proton conductance. Two related murine genes, Otop2 and Otop3 , and a Drosophila ortholog also encode proton channels. Evolutionary conservation of the gene family and its widespread tissue distribution suggest a broad role for proton channels in physiology and pathophysiology. Copyright © 2018 The Authors, some rights reserved; exclusive licensee American Association for the Advancement of Science. No claim to original U.S. Government Works.

  6. A family of related proteins is encoded by the major Drosophila heat shock gene family

    International Nuclear Information System (INIS)

    Wadsworth, S.C.

    1982-01-01

    At least four proteins of 70,000 to 75,000 molecular weight (70-75K) were synthesized from mRNA which hybridized with a cloned heat shock gene previously shown to be localized to the 87A and 87C heat shock puff sites. These in vitro-synthesized proteins were indistinguishable from in vivo-synthesized heat shock-induced proteins when analyzed on sodium dodecyl sulfate-polyacrylamide gels. A comparison of the pattern of this group of proteins synthesized in vivo during a 5-min pulse or during continuous labeling indicates that the 72-75K proteins are probably not kinetic precursors to the major 70K heat shock protein. Partial digestion products generated with V8 protease indicated that the 70-75K heat shock proteins are closely related, but that there are clear differences between them. The partial digestion patterns obtained from heat shock proteins from the Kc cell line and from the Oregon R strain of Drosophila melanogaster are very similar. Genetic analysis of the patterns of 70-75K heat shock protein synthesis indicated that the genes encoding at least two of the three 72-75K heat shock proteins are located outside of the major 87A and 87C puff sites

  7. A single gene (Eu4) encodes the tissue-ubiquitous urease of soybean.

    Science.gov (United States)

    Torisky, R S; Griffin, J D; Yenofsky, R L; Polacco, J C

    1994-02-01

    We sought to determine the genetic basis of expression of the ubiquitous (metabolic) urease of soybean. This isozyme is termed the metabolic urease because its loss, in eu4/eu4 mutants, leads to accumulation of urea, whereas loss of the embryo-specific urease isozyme does not. The eu4 lesion eliminated the expression of the ubiquitous urease in vegetative and embryonic tissues. RFLP analysis placed urease clone LC4 near, or within, the Eu4 locus. Sequence comparison of urease proteins (ubiquitous and embryo-specific) and clones (LC4 and LS1) indicated that LC4 and LS1 encode ubiquitous and embryo-specific ureases, respectively. That LC4 is transcribed into poly(A)+ RNA in all tissues was indicated by the amplification of its transcript by an LC4-specific PCR primer. (The LS1-specific primer, on the other hand, amplified poly(A)+ RNA only from developing embryos expressing the embryo-specific urease.) These observations are consistent with Eu4 being the ubiquitous urease structural gene contained in the LC4 clone. In agreement with this notion, the mutant phenotype of eu4/eu4 callus was partially corrected by the LC4 urease gene introduced by particle bombardment.

  8. Cloning of gene-encoded stem bromelain on system coming from Pichia pastoris as therapeutic protein candidate

    Science.gov (United States)

    Yusuf, Y.; Hidayati, W.

    2018-01-01

    The process of identifying bacterial recombination using PCR, and restriction, and then sequencing process was done after identifying the bacteria. This research aimed to get a yeast cell of Pichia pastoris which has an encoder gene of stem bromelain enzyme. The production of recombinant stem bromelain enzymes using yeast cells of P. pastoris can produce pure bromelain rod enzymes and have the same conformation with the enzyme’s conformation in pineapple plants. This recombinant stem bromelain enzyme can be used as a therapeutic protein in inflammatory, cancer and degenerative diseases. This study was an early stage of a step series to obtain bromelain rod protein derived from pineapple made with genetic engineering techniques. This research was started by isolating the RNA of pineapple stem which was continued with constructing cDNA using reserve transcriptase-PCR technique (RT-PCR), doing the amplification of bromelain enzyme encoder gene with PCR technique using a specific premiere couple which was designed. The process was continued by cloning into bacterium cells of Escherichia coli. A vector which brought the encoder gene of stem bromelain enzyme was inserted into the yeast cell of P. pastoris and was continued by identifying the yeast cell of P. pastoris which brought the encoder gene of stem bromelain enzyme. The research has not found enzyme gene of stem bromelain in yeast cell of P. pastoris yet. The next step is repeating the process by buying new reagent; RNase inhibitor, and buying liquid nitrogen.

  9. Proanthocyanidin synthesis in Theobroma cacao: genes encoding anthocyanidin synthase, anthocyanidin reductase, and leucoanthocyanidin reductase.

    Science.gov (United States)

    Liu, Yi; Shi, Zi; Maximova, Siela; Payne, Mark J; Guiltinan, Mark J

    2013-12-05

    The proanthocyanidins (PAs), a subgroup of flavonoids, accumulate to levels of approximately 10% total dry weight of cacao seeds. PAs have been associated with human health benefits and also play important roles in pest and disease defense throughout the plant. To dissect the genetic basis of PA biosynthetic pathway in cacao (Theobroma cacao), we have isolated three genes encoding key PA synthesis enzymes, anthocyanidin synthase (ANS), anthocyanidin reductase (ANR) and leucoanthocyanidin reductase (LAR). We measured the expression levels of TcANR, TcANS and TcLAR and PA content in cacao leaves, flowers, pod exocarp and seeds. In all tissues examined, all three genes were abundantly expressed and well correlated with PA accumulation levels, suggesting their active roles in PA synthesis. Overexpression of TcANR in an Arabidopsis ban mutant complemented the PA deficient phenotype in seeds and resulted in reduced anthocyanidin levels in hypocotyls. Overexpression of TcANS in tobacco resulted in increased content of both anthocyanidins and PAs in flower petals. Overexpression of TcANS in an Arabidopsis ldox mutant complemented its PA deficient phenotype in seeds. Recombinant TcLAR protein converted leucoanthocyanidin to catechin in vitro. Transgenic tobacco overexpressing TcLAR had decreased amounts of anthocyanidins and increased PAs. Overexpressing TcLAR in Arabidopsis ldox mutant also resulted in elevated synthesis of not only catechin but also epicatechin. Our results confirm the in vivo function of cacao ANS and ANR predicted based on sequence homology to previously characterized enzymes from other species. In addition, our results provide a clear functional analysis of a LAR gene in vivo.

  10. Adenovirus-encoding virus-associated RNAs suppress HDGF gene expression to support efficient viral replication.

    Directory of Open Access Journals (Sweden)

    Saki Kondo

    Full Text Available Non-coding small RNAs are involved in many physiological responses including viral life cycles. Adenovirus-encoding small RNAs, known as virus-associated RNAs (VA RNAs, are transcribed throughout the replication process in the host cells, and their transcript levels depend on the copy numbers of the viral genome. Therefore, VA RNAs are abundant in infected cells after genome replication, i.e. during the late phase of viral infection. Their function during the late phase is the inhibition of interferon-inducible protein kinase R (PKR activity to prevent antiviral responses; recently, mivaRNAs, the microRNAs processed from VA RNAs, have been reported to inhibit cellular gene expression. Although VA RNA transcription starts during the early phase, little is known about its function. The reason may be because much smaller amount of VA RNAs are transcribed during the early phase than the late phase. In this study, we applied replication-deficient adenovirus vectors (AdVs and novel AdVs lacking VA RNA genes to analyze the expression changes in cellular genes mediated by VA RNAs using microarray analysis. AdVs are suitable to examine the function of VA RNAs during the early phase, since they constitutively express VA RNAs but do not replicate except in 293 cells. We found that the expression level of hepatoma-derived growth factor (HDGF significantly decreased in response to the VA RNAs under replication-deficient condition, and this suppression was also observed during the early phase under replication-competent conditions. The suppression was independent of mivaRNA-induced downregulation, suggesting that the function of VA RNAs during the early phase differs from that during the late phase. Notably, overexpression of HDGF inhibited AdV growth. This is the first report to show the function, in part, of VA RNAs during the early phase that may be contribute to efficient viral growth.

  11. Characterization of a Thioredoxin-1 Gene from Taenia solium and Its Encoding Product

    Science.gov (United States)

    Jiménez, Lucía; Rodríguez-Lima, Oscar; Ochoa-Sánchez, Alicia; Landa, Abraham

    2015-01-01

    Taenia solium thioredoxin-1 gene (TsTrx-1) has a length of 771 bp with three exons and two introns. The core promoter gene presents two putative stress transcription factor binding sites, one putative TATA box, and a transcription start site (TSS). TsTrx-1 mRNA is expressed higher in larvae than in adult. This gene encodes a protein of 107 amino acids that presents the Trx active site (CGPC), the classical secondary structure of the thioredoxin fold, and the highest degree of identity with the Echinococcus granulosus Trx. A recombinant TsTrx-1 (rTsTrx-1) was produced in Escherichia coli with redox activity. Optimal activity for rTsTrx-1 was at pH 6.5 in the range of 15 to 25°C. The enzyme conserved activity for 3 h and lost it in 24 h at 37°C. rTsTrx-1 lost 50% activity after 1 h and lost activity completely in 24 h at temperatures higher than 55°C. Best storage temperature for rTsTrx-1 was at −70°C. It was inhibited by high concentrations of H2O2 and methylglyoxal (MG), but it was inhibited neither by NaCl nor by anti-rTsTrx-1 rabbit antibodies that strongly recognized a ~12 kDa band in extracts from several parasites. These TsTrx-1 properties open the opportunity to study its role in relationship T. solium-hosts. PMID:26090410

  12. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  13. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  14. Bioinformatic analysis of the nucleotide binding site-encoding disease-resistance genes in foxtail millet (Setaria italica (L.) Beauv.).

    Science.gov (United States)

    Zhu, Y B; Xie, X Q; Li, Z Y; Bai, H; Dong, L; Dong, Z P; Dong, J G

    2014-08-28

    The nucleotide-binding site (NBS) disease-resistance genes are the largest category of plant disease-resistance gene analogs. The complete set of disease-resistant candidate genes, which encode the NBS sequence, was filtered in the genomes of two varieties of foxtail millet (Yugu1 and 'Zhang gu'). This study investigated a number of characteristics of the putative NBS genes, such as structural diversity and phylogenetic relationships. A total of 269 and 281 NBS-coding sequences were identified in Yugu1 and 'Zhang gu', respectively. When the two databases were compared, 72 genes were found to be identical and 164 genes showed more than 90% similarity. Physical positioning and gene family analysis of the NBS disease-resistance genes in the genome revealed that the number of genes on each chromosome was similar in both varieties. The eighth chromosome contained the largest number of genes and the ninth chromosome contained the lowest number of genes. Exactly 34 gene clusters containing the 161 genes were found in the Yugu1 genome, with each cluster containing 4.7 genes on average. In comparison, the 'Zhang gu' genome possessed 28 gene clusters, which had 151 genes, with an average of 5.4 genes in each cluster. The largest gene cluster, located on the eighth chromosome, contained 12 genes in the Yugu1 database, whereas it contained 16 genes in the 'Zhang gu' database. The classification results showed that the CC-NBS-LRR gene made up the largest part of each chromosome in the two databases. Two TIR-NBS genes were also found in the Yugu1 genome.

  15. Sequence analysis of mitochondrial 16S ribosomal RNA gene ...

    Indian Academy of Sciences (India)

    Unknown

    For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. ... been widely used for phylogenetic studies and sequence differences in ... In order to fill up the internal gap, a new set.

  16. Sequence analysis of mitochondrial 16S ribosomal RNA gene

    Indian Academy of Sciences (India)

    Mosquitoes are vectors for the transmission of many human pathogens that include viruses, nematodes and protozoa. For the understanding of their vectorial capacity, identification of disease carrying and refractory strains is essential. Recently, molecular taxonomic techniques have been utilized for this purpose. Sequence ...

  17. Identification of the gene encoding the 65-kilodalton DNA-binding protein of herpes simplex virus type 1

    International Nuclear Information System (INIS)

    Parris, D.S.; Cross, A.; Orr, A.; Frame, M.C.; Murphy, M.; McGeoch, D.J.; Marsden, H.S.; Haarr, L.

    1988-01-01

    Hybrid arrest of in vitro translation was used to localize the region of the herpes simplex virus type 1 genome encoding the 65-kilodalton DNA-binding protein (65K DBP ) to between genome coordinates 0.592 and 0.649. Knowledge of the DNA sequence of this region allowed us to identify three open reading frames as likely candidates for the gene encoding 65K DBP . Two independent approaches were used to determine which of these three open reading frames encoded the protein. For the first approach a monoclonal antibody, MAb 6898, which reacted specifically with 65K DBP , was isolated. This antibody was used, with the techniques of hybrid arrest of in vitro translation and in vitro translation of selected mRNA, to identify the gene encoding 65K DBP . The second approach involved preparation of antisera directed against oligopeptides corresponding to regions of the predicted amino acid sequence of this gene. These antisera reacted specifically with 65K DBP , thus confirming the gene assignment

  18. Regulation of transcription of cellulases- and hemicellulases-encoding genes in Aspergillus niger and Hypocrea jecorina (Trichoderma reesei)

    NARCIS (Netherlands)

    Stricker, A.R.; Mach, R.L.; Graaff, de L.H.

    2008-01-01

    The filamentous fungi Aspergillus niger and Hypocrea jecorina (Trichoderma reesei) have been the subject of many studies investigating the mechanism of transcriptional regulation of hemicellulase- and cellulase-encoding genes. The transcriptional regulator XlnR that was initially identified in A.

  19. [Cloning, mutagenesis and symbiotic phenotype of three lipid transfer protein encoding genes from Mesorhizobium huakuii 7653R].

    Science.gov (United States)

    Li, Yanan; Zeng, Xiaobo; Zhou, Xuejuan; Li, Youguo

    2016-12-04

    Lipid transfer protein superfamily is involved in lipid transport and metabolism. This study aimed to construct mutants of three lipid transfer protein encoding genes in Mesorhizobium huakuii 7653R, and to study the phenotypes and function of mutations during symbiosis with Astragalus sinicus. We used bioinformatics to predict structure characteristics and biological functions of lipid transfer proteins, and conducted semi-quantitative and fluorescent quantitative real-time PCR to analyze the expression levels of target genes in free-living and symbiotic conditions. Using pK19mob insertion mutagenesis to construct mutants, we carried out pot plant experiments to observe symbiotic phenotypes. MCHK-5577, MCHK-2172 and MCHK-2779 genes encoding proteins belonged to START/RHO alpha_C/PITP/Bet_v1/CoxG/CalC (SRPBCC) superfamily, involved in lipid transport or metabolism, and were identical to M. loti at 95% level. Gene relative transcription level of the three genes all increased compared to free-living condition. We obtained three mutants. Compared with wild-type 7653R, above-ground biomass of plants and nodulenitrogenase activity induced by the three mutants significantly decreased. Results indicated that lipid transfer protein encoding genes of Mesorhizobium huakuii 7653R may play important roles in symbiotic nitrogen fixation, and the mutations significantly affected the symbiotic phenotypes. The present work provided a basis to study further symbiotic function mechanism associated with lipid transfer proteins from rhizobia.

  20. The pyrH gene of Lactococcus lactis subsp. cremoris encoding UMP kinase is transcribed as part of an operon including the frr1 gene encoding ribosomal recycling factor

    DEFF Research Database (Denmark)

    Wadskov-Hansen, Steen Lüders; Martinussen, Jan; Hammer, Karin

    2000-01-01

    establishing the ability of the encoded protein to synthesize UDP. The pyrH gene in L. lactis is flanked downstream by frr1 encoding ribosomal recycling factor 1 and upstream by an open reading frame, orfA, of unknown function. The three genes were shown to constitute an operon transcribed in the direction orf......A-pyrH-frr1 from a promoter immediately in front of orfA. This operon belongs to an evolutionary highly conserved gene cluster, since the organization of pyrH on the chromosomal level in L. lactis shows a high resemblance to that found in Bacillus subtilis as well as in Escherichia coli and several other...

  1. StAR Enhances Transcription of Genes Encoding the Mitochondrial Proteases Involved in Its Own Degradation

    Science.gov (United States)

    Bahat, Assaf; Perlberg, Shira; Melamed-Book, Naomi; Lauria, Ines; Langer, Thomas

    2014-01-01

    Steroidogenic acute regulatory protein (StAR) is essential for steroid hormone synthesis in the adrenal cortex and the gonads. StAR activity facilitates the supply of cholesterol substrate into the inner mitochondrial membranes where conversion of the sterol to a steroid is catalyzed. Mitochondrial import terminates the cholesterol mobilization activity of StAR and leads to mounting accumulation of StAR in the mitochondrial matrix. Our studies suggest that to prevent mitochondrial impairment, StAR proteolysis is executed by at least 2 mitochondrial proteases, ie, the matrix LON protease and the inner membrane complexes of the metalloproteases AFG3L2 and AFG3L2:SPG7/paraplegin. Gonadotropin administration to prepubertal rats stimulated ovarian follicular development associated with increased expression of the mitochondrial protein quality control system. In addition, enrichment of LON and AFG3L2 is evident in StAR-expressing ovarian cells examined by confocal microscopy. Furthermore, reporter studies of the protease promoters examined in the heterologous cell model suggest that StAR expression stimulates up to a 3.5-fold increase in the protease gene transcription. Such effects are StAR-specific, are independent of StAR activity, and failed to occur upon expression of StAR mutants that do not enter the matrix. Taken together, the results of this study suggest the presence of a novel regulatory loop, whereby acute accumulation of an apparent nuisance protein in the matrix provokes a mitochondria to nucleus signaling that, in turn, activates selected transcription of genes encoding the enrichment of mitochondrial proteases relevant for enhanced clearance of StAR. PMID:24422629

  2. Molecular cloning and expression analysis of the gene encoding proline dehydrogenase from Jatropha curcas L.

    Science.gov (United States)

    Wang, Haibo; Ao, Pingxing; Yang, Shuanglong; Zou, Zhurong; Wang, Shasha; Gong, Ming

    2015-03-01

    Proline dehydrogenase (ProDH) (EC 1.5.99.8) is a key enzyme in the catabolism of proline. The enzyme JcProDH and its complementary DNA (cDNA) were isolated from Jatropha curcas L., an important woody oil plant used as a raw material for biodiesels. It has been classified as a member of the Pro_dh superfamily based on multiple sequence alignment, phylogenetic characterization, and its role in proline catabolism. Its cDNA is 1674 bp in length with a complete open reading frame of 1485 bp, which encodes a polypeptide chain of 494 amino acids with a predicted molecular mass of 54 kD and a pI of 8.27. Phylogenetic analysis indicated that JcProDH showed high similarity with ProDH from other plants. Reverse transcription PCR (RT-PCR) analysis revealed that JcProDH was especially abundant in the seeds and flowers but scarcely present in the stems, roots, and leaves. In addition, the expression of JcProDH increased in leaves experiencing environmental stress such as cold (5 °C), heat (42 °C), salt (300 mM), and drought (30 % PEG6000). The JcProDH protein was successfully expressed in the yeast strain INVSc1 and showed high enzyme activity in proline catabolism. This result confirmed that the JcProDH gene negatively participated in the stress response.

  3. Idiopathic neonatal necrotising fasciitis caused by community-acquired MSSA encoding Panton Valentine Leukocidin genes.

    LENUS (Irish Health Repository)

    Dunlop, Rebecca L E

    2012-02-01

    Neonatal necrotising fasciitis is very rare in comparison to the adult presentation of the disease and a Plastic Surgeon may only encounter one such case during his or her career. Often this is initially misdiagnosed and managed as simple cellulitis. It generally affects previously healthy babies, the site is often the lower back area and a history of minor skin trauma may be elicited. The causative organism is usually Streptococcus or polymicrobial, as is the case in the adult population. We present the case of a previously healthy 11-day-old infant with idiopathic, rapidly progressive necrotising fasciitis of the back, cause by Methicillin sensitive Staphylococcus aureus (MSSA) infection. The strain was isolated and found to encode the Panton-Valentine Leukocidin genes, which have been associated with particularly severe necrotising infections in other sites, with high mortality. These strains are the subject of specific treatment and eradication guidance in the UK but awareness of this and the importance of obtaining detailed culture typing is likely to be low amongst Plastic Surgeons.

  4. Genetic analysis of the VP2-encoding gene of canine parvovirus strains from Africa.

    Science.gov (United States)

    Dogonyaro, Banenat B; Bosman, Anna-Mari; Sibeko, Kgomotso P; Venter, Estelle H; van Vuuren, Moritz

    2013-08-30

    Since the emergence of canine parvovirus type-2 (CPV-2) in the early 1970s, it has been evolving into novel genetic and antigenic variants (CPV-2a, 2b and 2c) that are unevenly distributed throughout the world. Genetic characterization of CPV-2 has not been documented in Africa since 1998 apart from the study carried out in Tunisia 2009. A total of 139 field samples were collected from South Africa and Nigeria, detected using PCR and the full length VP2-encoding gene of 27 positive samples were sequenced and genetically analyzed. Nigerian samples (n=6), South Africa (n=19) and vaccine strains (n=2) were compared with existing sequences obtained from GenBank. The results showed the presence of both CPV-2a and 2b in South Africa and only CPV-2a in Nigeria. No CPV-2c strain was detected during this study. Phylogenetic analysis showed a clustering not strictly associated with the geographical origin of the analyzed strains, although most of the South African strains tended to cluster together and the viral strains analyzed in this study were not completely distinct from CPV-2 strains from other parts of the world. Amino acid analysis showed predicted amino acid changes. Copyright © 2013 Elsevier B.V. All rights reserved.

  5. Amtyr1: characterization of a gene from honeybee (Apis mellifera) brain encoding a functional tyramine receptor.

    Science.gov (United States)

    Blenau, W; Balfanz, S; Baumann, A

    2000-03-01

    Biogenic amine receptors are involved in the regulation and modulation of various physiological and behavioral processes in both vertebrates and invertebrates. We have cloned a member of this gene family from the CNS of the honeybee, Apis mellifera. The deduced amino acid sequence is homologous to tyramine receptors cloned from Locusta migratoria and Drosophila melanogaster as well as to an octopamine receptor cloned from Heliothis virescens. Functional properties of the honeybee receptor were studied in stably transfected human embryonic kidney 293 cells. Tyramine reduced forskolin-induced cyclic AMP production in a dose-dependent manner with an EC50 of approximately 130 nM. A similar effect of tyramine was observed in membrane homogenates of honeybee brains. Octopamine also reduced cyclic AMP production in the transfected cell line but was both less potent (EC50 of approximately 3 microM) and less efficacious than tyramine. Receptor-encoding mRNA has a wide-spread distribution in the brain and subesophageal ganglion of the honeybee, suggesting that this tyramine receptor is involved in sensory signal processing as well as in higher-order brain functions.

  6. Sharp switches between regular and swinger mitochondrial replication: 16S rDNA systematically exchanging nucleotides AT+CG in the mitogenome of Kamimuria wangi.

    Science.gov (United States)

    Seligmann, Hervé

    2016-07-01

    Swinger DNAs are sequences whose homology with known sequences is detected only by assuming systematic exchanges between nucleotides. Nine symmetric (XY, i.e. AC) and fourteen asymmetric (X->Y->Z, i.e. A->C->G) exchanges exist. All swinger DNA previously detected in GenBank follow the AT+CG exchange, while mitochondrial swinger RNAs distribute among different swinger types. Here different alignment criteria detect 87 additional swinger mitochondrial DNAs (86 from insects), including the first swinger gene embedded within a complete genome, corresponding to the mitochondrial 16S rDNA of the stonefly Kamimuria wangi. Other Kamimuria mt genome regions are "regular", stressing unanswered questions on (a) swinger polymerization regulation; (b) swinger 16S rDNA functions; and (c) specificity to rDNA, in particular 16S rDNA. Sharp switches between regular and swinger replication, together with previous observations on swinger transcription, suggest that swinger replication might be due to a switch in polymerization mode of regular polymerases and the possibility of swinger-encoded information, predicted in primordial genes such as rDNA.

  7. AIB1 gene amplification and the instability of polyQ encoding sequence in breast cancer cell lines

    Directory of Open Access Journals (Sweden)

    Clarke Robert

    2006-05-01

    Full Text Available Abstract Background The poly Q polymorphism in AIB1 (amplified in breast cancer gene is usually assessed by fragment length analysis which does not reveal the actual sequence variation. The purpose of this study is to investigate the sequence variation of poly Q encoding region in breast cancer cell lines at single molecule level, and to determine if the sequence variation is related to AIB1 gene amplification. Methods The polymorphic poly Q encoding region of AIB1 gene was investigated at the single molecule level by PCR cloning/sequencing. The amplification of AIB1 gene in various breast cancer cell lines were studied by real-time quantitative PCR. Results Significant amplifications (5–23 folds of AIB1 gene were found in 2 out of 9 (22% ER positive cell lines (in BT-474 and MCF-7 but not in BT-20, ZR-75-1, T47D, BT483, MDA-MB-361, MDA-MB-468 and MDA-MB-330. The AIB1 gene was not amplified in any of the ER negative cell lines. Different passages of MCF-7 cell lines and their derivatives maintained the feature of AIB1 amplification. When the cells were selected for hormone independence (LCC1 and resistance to 4-hydroxy tamoxifen (4-OH TAM (LCC2 and R27, ICI 182,780 (LCC9 or 4-OH TAM, KEO and LY 117018 (LY-2, AIB1 copy number decreased but still remained highly amplified. Sequencing analysis of poly Q encoding region of AIB1 gene did not reveal specific patterns that could be correlated with AIB1 gene amplification. However, about 72% of the breast cancer cell lines had at least one under represented (3CAA(CAG9(CAACAG3(CAACAGCAG2CAA of the original cell line, a number of altered poly Q encoding sequences were found in the derivatives of MCF-7 cell lines. Conclusion These data suggest that poly Q encoding region of AIB1 gene is somatic unstable in breast cancer cell lines. The instability and the sequence characteristics, however, do not appear to be associated with the level of the gene amplification.

  8. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  9. Detection of β-lactamase encoding genes in feces, soil and water from a Brazilian pig farm.

    Science.gov (United States)

    Furlan, João Pedro Rueda; Stehling, Eliana Guedes

    2018-01-10

    β-lactam antibiotics are widely used for the treatment of different types of infections worldwide and the resistance to these antibiotics has grown sharply, which is of great concern. Resistance to β-lactams in gram-negative bacteria is mainly due to the production of β-lactamases, which are classified according to their functional activities. The aim of this study was to verify the presence of β-lactamases encoding genes in feces, soil, and water from a Brazilian pig farm. Different β-lactamases encoding genes were found, including bla CTX-M-Gp1 , bla CTX-M-Gp9 , bla SHV , bla OXA-1-like , bla GES , and bla VEB . The bla SHV and bla CTX-M-Gp1 genes have been detected in all types of samples, indicating the spread of β-lactam resistant bacteria among farm pigs and the environment around them. These results indicate that β-lactamase encoding genes belonging to the cloxacillinase, ESBL, and carbapenemase and they have high potential to spread in different sources, due to the fact that genes are closely related to mobile genetic elements, especially plasmids.

  10. Molecular cloning and expression of the gene encoding the kinetoplast-associated type II DNA topoisomerase of Crithidia fasciculata.

    Science.gov (United States)

    Pasion, S G; Hines, J C; Aebersold, R; Ray, D S

    1992-01-01

    A type II DNA topoisomerase, topoIImt, was shown previously to be associated with the kinetoplast DNA of the trypanosomatid Crithidia fasciculata. The gene encoding this kinetoplast-associated topoisomerase has been cloned by immunological screening of a Crithidia genomic expression library with monoclonal antibodies raised against the purified enzyme. The gene CfaTOP2 is a single copy gene and is expressed as a 4.8-kb polyadenylated transcript. The nucleotide sequence of CfaTOP2 has been determined and encodes a predicted polypeptide of 1239 amino acids with a molecular mass of 138,445. The identification of the cloned gene is supported by immunoblot analysis of the beta-galactosidase-CfaTOP2 fusion protein expressed in Escherichia coli and by analysis of tryptic peptide sequences derived from purified topoIImt. CfaTOP2 shares significant homology with nuclear type II DNA topoisomerases of other eukaryotes suggesting that in Crithidia both nuclear and mitochondrial forms of topoisomerase II are encoded by the same gene.

  11. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation.

    Science.gov (United States)

    Henry, Romain; Bruneau, Emmanuelle; Gardan, Rozenn; Bertin, Stéphane; Fleuchot, Betty; Decaris, Bernard; Leblond-Bourget, Nathalie

    2011-10-07

    Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  12. The rgg0182 gene encodes a transcriptional regulator required for the full Streptococcus thermophilus LMG18311 thermal adaptation

    Directory of Open Access Journals (Sweden)

    Bertin Stéphane

    2011-10-01

    Full Text Available Abstract Background Streptococcus thermophilus is an important starter strain for the production of yogurt and cheeses. The analysis of sequenced genomes of four strains of S. thermophilus indicates that they contain several genes of the rgg familly potentially encoding transcriptional regulators. Some of the Rgg proteins are known to be involved in bacterial stress adaptation. Results In this study, we demonstrated that Streptococcus thermophilus thermal stress adaptation required the rgg0182 gene which transcription depends on the culture medium and the growth temperature. This gene encoded a protein showing similarity with members of the Rgg family transcriptional regulator. Our data confirmed that Rgg0182 is a transcriptional regulator controlling the expression of its neighboring genes as well as chaperones and proteases encoding genes. Therefore, analysis of a Δrgg0182 mutant revealed that this protein played a role in the heat shock adaptation of Streptococcus thermophilus LMG18311. Conclusions These data showed the importance of the Rgg0182 transcriptional regulator on the survival of S. thermophilus during dairy processes and more specifically during changes in temperature.

  13. Chromosome locations of genes encoding human signal transduction adapter proteins, Nck (NCK), Shc (SHC1), and Grb2 (GRB2)

    DEFF Research Database (Denmark)

    Huebner, K; Kastury, K; Druck, T

    1994-01-01

    "adapter" proteins, which are involved in transducing signals from receptor tyrosine kinases to downstream signal recipients such as ras, because adaptor protein genes could also, logically, serve as targets of mutation, rearrangement, or other aberration in disease. Therefore, DNAs from panels of rodent-human......Abnormalities due to chromosomal aberration or point mutation in gene products of growth factor receptors or in ras gene products, which lie on the same signaling pathway, can cause disease in animals and humans. Thus, it can be important to determine chromosomal map positions of genes encoding...... hybrids carrying defined complements of human chromosomes were assayed for the presence of the cognate genes for NCK, SHC, and GRB2, three SH2 or SH2/SH3 (Src homology 2 and 3) domain-containing adapter proteins. Additionally, NCK and SHC genes were more narrowly localized by chromosomal in situ...

  14. Translational Control of Host Gene Expression by a Cys-Motif Protein Encoded in a Bracovirus.

    Directory of Open Access Journals (Sweden)

    Eunseong Kim

    Full Text Available Translational control is a strategy that various viruses use to manipulate their hosts to suppress acute antiviral response. Polydnaviruses, a group of insect double-stranded DNA viruses symbiotic to some endoparasitoid wasps, are divided into two genera: ichnovirus (IV and bracovirus (BV. In IV, some Cys-motif genes are known as host translation-inhibitory factors (HTIF. The genome of endoparasitoid wasp Cotesia plutellae contains a Cys-motif gene (Cp-TSP13 homologous to an HTIF known as teratocyte-secretory protein 14 (TSP14 of Microplitis croceipes. Cp-TSP13 consists of 129 amino acid residues with a predicted molecular weight of 13.987 kDa and pI value of 7.928. Genomic DNA region encoding its open reading frame has three introns. Cp-TSP13 possesses six conserved cysteine residues as other Cys-motif genes functioning as HTIF. Cp-TSP13 was expressed in Plutella xylostella larvae parasitized by C. plutellae. C. plutellae bracovirus (CpBV was purified and injected into non-parasitized P. xylostella that expressed Cp-TSP13. Cp-TSP13 was cloned into a eukaryotic expression vector and used to infect Sf9 cells to transiently express Cp-TSP13. The synthesized Cp-TSP13 protein was detected in culture broth. An overlaying experiment showed that the purified Cp-TSP13 entered hemocytes. It was localized in the cytosol. Recombinant Cp-TSP13 significantly inhibited protein synthesis of secretory proteins when it was added to in vitro cultured fat body. In addition, the recombinant Cp-TSP13 directly inhibited the translation of fat body mRNAs in in vitro translation assay using rabbit reticulocyte lysate. Moreover, the recombinant Cp-TSP13 significantly suppressed cellular immune responses by inhibiting hemocyte-spreading behavior. It also exhibited significant insecticidal activities by both injection and feeding routes. These results indicate that Cp-TSP13 is a viral HTIF.

  15. The A581G Mutation in the Gene Encoding Plasmodium falciparum Dihydropteroate Synthetase Reduces the Effectiveness of Sulfadoxine-Pyrimethamine Preventive Therapy in Malawian Pregnant Women

    NARCIS (Netherlands)

    Gutman, Julie; Kalilani, Linda; Taylor, Steve; Zhou, Zhiyong; Wiegand, Ryan E.; Thwai, Kyaw L.; Mwandama, Dyson; Khairallah, Carole; Madanitsa, Mwayi; Chaluluka, Ebbie; Dzinjalamala, Fraction; Ali, Doreen; Mathanga, Don P.; Skarbinski, Jacek; Shi, Ya Ping; Meshnick, Steve; ter Kuile, Feiko O.

    2015-01-01

    Background. The A581G mutation in the gene encoding Plasmodium falciparum dihydropteroate synthase (dhps), in combination with the quintuple mutant involving mutations in both dhps and the gene encoding dihydrofolate reductase (dhfr), the so-called sextuple mutant, has been associated with increased

  16. Cloning and characterization of the gsk gene encoding guanosine kinase of Escherichia coli

    DEFF Research Database (Denmark)

    Harlow, Kenneth W.; Nygaard, Per; Hove-Jensen, Bjarne

    1995-01-01

    The Escherichia coli gsk gene encoding guanosine kinase was cloned from the Kohara gene library by complementation of the E. coli gsk-1 mutant allele. The cloned DNA fragment was sequenced and shown to encode a putative polypeptide of 433 amino acids with a molecular mass of 48,113 Da. Minicell...

  17. Chronic granulomatous disease caused by mutations other than the common GT deletion in NCF1, the gene encoding the p47phox component of the phagocyte NADPH oxidase

    NARCIS (Netherlands)

    Roos, Dirk; de Boer, Martin; Köker, M. Yavuz; Dekker, Jan; Singh-Gupta, Vinita; Ahlin, Anders; Palmblad, Jan; Sanal, Ozden; Kurenko-Deptuch, Magdalena; Jolles, Stephen; Wolach, Baruch

    2006-01-01

    Chronic granulomatous disease (CGD) is an inherited immunodeficiency caused by defects in any of four genes encoding components of the leukocyte nicotinamide dinucleotide phosphate, reduced (NADPH) oxidase. One of these is the autosomal neutrophil cytosolic factor 1 (NCF1) gene encoding the p47phox

  18. Cloning, characterization, expression analysis and inhibition studies of a novel gene encoding Bowman-Birk type protease inhibitor from rice bean

    Science.gov (United States)

    This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...

  19. The Aspergillus niger faeB gene encodes a second feruloyl esterase involved in pectin and xylan degradation and is specifically induced in the presence of aromatic compounds

    NARCIS (Netherlands)

    Vries, de R.P.; vanKuyk, P.A.; Kester, H.C.M.; Visser, J.

    2002-01-01

    The faeB gene encoding a second feruloyl esterase from Aspergillus niger has been cloned and characterized. It consists of an open reading frame of 1644 bp containing one intron. The gene encodes a protein of 521 amino acids that has sequence similarity to that of an Aspergillus oryzae tannase.

  20. Analysis of 16S libraries of mouse gastrointestinal microflora reveals a large new group of mouse intestinal bacteria

    NARCIS (Netherlands)

    Salzman, NH; de Jong, H; Paterson, Y; Harmsen, HJM; Welling, GW; Bos, NA

    2002-01-01

    Total genomic DNA from samples of intact mouse small intestine, large intestine, caecum and faeces was used as template for PCR amplification of 16S rRNA gene sequences with conserved bacterial primers. Phylogenetic analysis of the amplification products revealed 40 unique 16S rDNA sequences. Of

  1. Genomic polymorphism, recombination, and linkage disequilibrium in human major histocompatibility complex-encoded antigen-processing genes.

    Science.gov (United States)

    van Endert, P M; Lopez, M T; Patel, S D; Monaco, J J; McDevitt, H O

    1992-01-01

    Recently, two subunits of a large cytosolic protease and two putative peptide transporter proteins were found to be encoded by genes within the class II region of the major histocompatibility complex (MHC). These genes have been suggested to be involved in the processing of antigenic proteins for presentation by MHC class I molecules. Because of the high degree of polymorphism in MHC genes, and previous evidence for both functional and polypeptide sequence polymorphism in the proteins encoded by the antigen-processing genes, we tested DNA from 27 consanguineous human cell lines for genomic polymorphism by restriction fragment length polymorphism (RFLP) analysis. These studies demonstrate a strong linkage disequilibrium between TAP1 and LMP2 RFLPs. Moreover, RFLPs, as well as a polymorphic stop codon in the telomeric TAP2 gene, appear to be in linkage disequilibrium with HLA-DR alleles and RFLPs in the HLA-DO gene. A high rate of recombination, however, seems to occur in the center of the complex, between the TAP1 and TAP2 genes. Images PMID:1360671

  2. Evidence for the bacterial origin of genes encoding fermentation enzymes of the amitochondriate protozoan parasite Entamoeba histolytica.

    Science.gov (United States)

    Rosenthal, B; Mai, Z; Caplivski, D; Ghosh, S; de la Vega, H; Graf, T; Samuelson, J

    1997-06-01

    Entamoeba histolytica is an amitochondriate protozoan parasite with numerous bacterium-like fermentation enzymes including the pyruvate:ferredoxin oxidoreductase (POR), ferredoxin (FD), and alcohol dehydrogenase E (ADHE). The goal of this study was to determine whether the genes encoding these cytosolic E. histolytica fermentation enzymes might derive from a bacterium by horizontal transfer, as has previously been suggested for E. histolytica genes encoding heat shock protein 60, nicotinamide nucleotide transhydrogenase, and superoxide dismutase. In this study, the E. histolytica por gene and the adhE gene of a second amitochondriate protozoan parasite, Giardia lamblia, were sequenced, and their phylogenetic positions were estimated in relation to POR, ADHE, and FD cloned from eukaryotic and eubacterial organisms. The E. histolytica por gene encodes a 1,620-amino-acid peptide that contained conserved iron-sulfur- and thiamine pyrophosphate-binding sites. The predicted E. histolytica POR showed fewer positional identities to the POR of G. lamblia (34%) than to the POR of the enterobacterium Klebsiella pneumoniae (49%), the cyanobacterium Anabaena sp. (44%), and the protozoan Trichomonas vaginalis (46%), which targets its POR to anaerobic organelles called hydrogenosomes. Maximum-likelihood, neighbor-joining, and parsimony analyses also suggested as less likely E. histolytica POR sharing more recent common ancestry with G. lamblia POR than with POR of bacteria and the T. vaginalis hydrogenosome. The G. lamblia adhE encodes an 888-amino-acid fusion peptide with an aldehyde dehydrogenase at its amino half and an iron-dependent (class 3) ADH at its carboxy half. The predicted G. lamblia ADHE showed extensive positional identities to ADHE of Escherichia coli (49%), Clostridium acetobutylicum (44%), and E. histolytica (43%) and lesser identities to the class 3 ADH of eubacteria and yeast (19 to 36%). Phylogenetic analyses inferred a closer relationship of the E

  3. A study of Staphylococcus aureusnasal carriage, antibacterial resistance and virulence factor encoding genes in a tertiary care hospital, Kayseri, Turkey.

    Science.gov (United States)

    Oguzkaya-Artan, M; Artan, C; Baykan, Z; Sakalar, C; Turan, A; Aksu, H

    2015-01-01

    This study was to determine the virulence encoding genes, and the antibiotic resistance patterns of the Staphylococcus aureus isolates, which were isolated from the nasal samples of chest clinic patients. The nasal samples of the in-patients (431) and out-patients (1857) in Kayseri Training and Research Hospital's Chest Clinic, Kayseri, Turkey, were cultured on CHROMagar (Biolife, Italiana) S. aureus, and subcultured on sheep blood agar for the isolation of S. aureus. Disc diffusion method was used for antimicrobial susceptibility testing. The occurrence of the staphylococcal virulence encoding genes (enterotoksins [sea, seb, sec, see, seg, seh, sei, sej], fibronectin-binding proteins A, B [fnbA, fnbB], toxic shock syndrome toxin-1 [tst]) were detected by polymerase chain reaction. Forty-five of the 55 (81.8%) S. aureus isolates from inpatients, and 319 (90.6%) isolates from tested 352 out-patient's isolates were suspected to all the antibiotics tested. methicillin-resistant S. aureus (MRSA) was detected in 1.2% of S. aureus isolates. Rifampin, trimethoprim-sulfamethoxazole, clindamycin, erythromycin, gentamicin resistance rates were 1.2%, 1.7%, 2.0%, 8.8%, and 1.2%, respectively. The isolates were susceptible to teicoplanin and vancomycin. The genes most frequently found were tst (92.7%), seg (85.8%), sea (83.6%), fnbA (70.9%). There was no statistical significance detected between MRSA and mecA-negative S. aureus isolates in encoding genes distribution (P > 0.05). Our results show that virulence factor encoding genes were prevalent in patients with S. aureus carriage, whereas antibiotic resistance was low. These virulence determinants may increase the risk for subsequent invasive infections in carriers.

  4. The Down regulated in Adenoma (dra) gene encodes an intestine-specific membrane sulfate transport protein.

    Science.gov (United States)

    Silberg, D G; Wang, W; Moseley, R H; Traber, P G

    1995-05-19

    A gene has been described, Down Regulated in Adenoma (dra), which is expressed in normal colon but is absent in the majority of colon adenomas and adenocarcinomas. However, the function of this protein is unknown. Because of sequence similarity to a recently cloned membrane sulfate transporter in rat liver, the transport function of Dra was examined. We established that dra encodes for a Na(+)-independent transporter for both sulfate and oxalate using microinjected Xenopus oocytes as an assay system. Sulfate transport was sensitive to the anion exchange inhibitor DIDS (4,4'-diisothiocyano-2,2' disulfonic acid stilbene). Using an RNase protection assay, we found that dra mRNA expression is limited to the small intestine and colon in mouse, therefore identifying Dra as an intestine-specific sulfate transporter. dra also had a unique pattern of expression during intestinal development. Northern blot analysis revealed a low level of expression in colon at birth with a marked increase in the first 2 postnatal weeks. In contrast, there was a lower, constant level of expression in small intestine in the postnatal period. Caco-2 cells, a colon carcinoma cell line that differentiates over time in culture, demonstrated a marked induction of dra mRNA as cells progressed from the preconfluent (undifferentiated) to the postconfluent (differentiated) state. These results show that Dra is an intestine-specific Na(+)-independent sulfate transporter that has differential expression during colonic development. This functional characterization provides the foundation for investigation of the role of Dra in intestinal sulfate transport and in the malignant phenotype.

  5. Characterization of mouse UDP-glucose pyrophosphatase, a Nudix hydrolase encoded by the Nudt14 gene

    Energy Technology Data Exchange (ETDEWEB)

    Heyen, Candy A.; Tagliabracci, Vincent S.; Zhai, Lanmin [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States); Roach, Peter J., E-mail: proach@iupui.edu [Department of Biochemistry and Molecular Biology, Indiana University School of Medicine, Indianapolis, IN 46202 (United States)

    2009-12-25

    Recombinant mouse UDP-glucose pyrophosphatase (UGPPase), encoded by the Nudt14 gene, was produced in Escherichia coli and purified close to homogeneity. The enzyme catalyzed the conversion of [{beta}-{sup 32}P]UDP-glucose to [{sup 32}P]glucose-1-P and UMP, confirming that it hydrolyzed the pyrophosphate of the nucleoside diphosphate sugar to generate glucose-1-P and UMP. The enzyme was also active toward ADP-ribose. Activity is dependent on the presence of Mg{sup 2+} and was greatest at alkaline pH above 8. Kinetic analysis indicated a K{sub m} of {approx}4 mM for UDP-glucose and {approx}0.3 mM for ADP-ribose. Based on V{sub max}/K{sub m} values, the enzyme was {approx}20-fold more active toward ADP-ribose. UGPPase behaves as a dimer in solution and can be cross-linked to generate a species of M{sub r} 54,000 from a monomer of 30,000 as judged by SDS-PAGE. The dimerization was not affected by the presence of glucose-1-P or UDP-glucose. Using antibodies raised against the recombinant protein, Western analysis indicated that UGPPase was widely expressed in mouse tissues, including skeletal muscle, liver, kidney, heart, lung, fat, heart and pancreas with a lower level in brain. It was generally present as a doublet when analyzed by SDS-PAGE, suggesting the occurrence of some form of post-translational modification. Efforts to interconvert the species by adding or inhibiting phosphatase activity were unsuccessful, leaving the nature of the modification unknown. Sequence alignments and database searches revealed related proteins in species as distant as Drosophila melanogaster and Caenorhabditis elegans.

  6. Determination of ploidy level and isolation of genes encoding acetyl-CoA carboxylase in Japanese Foxtail (Alopecurus japonicus.

    Directory of Open Access Journals (Sweden)

    Hongle Xu

    Full Text Available Ploidy level is important in biodiversity studies and in developing strategies for isolating important plant genes. Many herbicide-resistant weed species are polyploids, but our understanding of these polyploid weeds is limited. Japanese foxtail, a noxious agricultural grass weed, has evolved herbicide resistance. However, most studies on this weed have ignored the fact that there are multiple copies of target genes. This may complicate the study of resistance mechanisms. Japanese foxtail was found to be a tetraploid by flow cytometer and chromosome counting, two commonly used methods in the determination of ploidy levels. We found that there are two copies of the gene encoding plastidic acetyl-CoA carboxylase (ACCase in Japanese foxtail and all the homologous genes are expressed. Additionally, no difference in ploidy levels or ACCase gene copy numbers was observed between an ACCase-inhibiting herbicide-resistant and a herbicide-sensitive population in this study.

  7. Regulation of the pT181 encoded tetracycline resistance gene in Straphylococcus aureus

    International Nuclear Information System (INIS)

    Mojumdar, M.

    1986-01-01

    pT181 is a naturally-occurring 4437 basepair (bp) plasmid isolated from Staphylococcus aureus which encodes inducible resistance to tetracycline (Tc). The DNA sequence data has identified three open reading frames (ORFs). The largest ORF B, has been found to be responsible for the Tc resistance phenotype of pT181. Since most Tc resistance systems appear to be regulated by an effector protein and a repressor protein, several Bal 31 deletion mutants of pT181 were constructed and analyzed in an effort to identify the elements involved in Tc resistance. Two transcomplementing groups of mutants were identified within the tet gene. The mechanism of Tc resistance was studied by assaying the accumulation of [7- 3 H] Tc by Tc sensitive cells, and uninduced and induced pT181-containing cells. A sharp decrease in accumulation of the drug after an initial increase was observed in Tc induced pT181-containing cells. In vivo labeling of Bacillus subtilis minicells containing pT181 was performed with 35 S-methionine to identify the polypeptide product of the tet gene. A Tc-inducible protein having a molecular weight of approximately 50,000 daltons was detected only in B. subtilis minicells carrying pT181. Cell fractionation studies of S. aureus cells with and without pT181 showed that an approximately 28,000 daltons Tc-inducible protein was present in membranes of pT181 containing cells. The amount of TET protein in Tc induced minicells was about fifteen-fold higher than that in uninduced minicells. RNA prepared from stationary phase cells analyzed by Northern blot hybridization showed that the steady-state level of the tet mRNA in induced pT181-containing cells was bout four-fold higher than that in uninduced pT181-containing cells. When RNA synthesis was blocked with rifampicin, tet mRAN was found to be much more stable in Tc induced cells as compared to that in uninduced cells over a 30 min period

  8. Overexpression of Genes Encoding Glycolytic Enzymes in Corynebacterium glutamicum Enhances Glucose Metabolism and Alanine Production under Oxygen Deprivation Conditions

    Science.gov (United States)

    Yamamoto, Shogo; Gunji, Wataru; Suzuki, Hiroaki; Toda, Hiroshi; Suda, Masako; Jojima, Toru; Inui, Masayuki

    2012-01-01

    We previously reported that Corynebacterium glutamicum strain ΔldhAΔppc+alaD+gapA, overexpressing glyceraldehyde-3-phosphate dehydrogenase-encoding gapA, shows significantly improved glucose consumption and alanine formation under oxygen deprivation conditions (T. Jojima, M. Fujii, E. Mori, M. Inui, and H. Yukawa, Appl. Microbiol. Biotechnol. 87:159–165, 2010). In this study, we employ stepwise overexpression and chromosomal integration of a total of four genes encoding glycolytic enzymes (herein referred to as glycolytic genes) to demonstrate further successive improvements in C. glutamicum glucose metabolism under oxygen deprivation. In addition to gapA, overexpressing pyruvate kinase-encoding pyk and phosphofructokinase-encoding pfk enabled strain GLY2/pCRD500 to realize respective 13% and 20% improved rates of glucose consumption and alanine formation compared to GLY1/pCRD500. Subsequent overexpression of glucose-6-phosphate isomerase-encoding gpi in strain GLY3/pCRD500 further improved its glucose metabolism. Notably, both alanine productivity and yield increased after each overexpression step. After 48 h of incubation, GLY3/pCRD500 produced 2,430 mM alanine at a yield of 91.8%. This was 6.4-fold higher productivity than that of the wild-type strain. Intracellular metabolite analysis showed that gapA overexpression led to a decreased concentration of metabolites upstream of glyceraldehyde-3-phosphate dehydrogenase, suggesting that the overexpression resolved a bottleneck in glycolysis. Changing ratios of the extracellular metabolites by overexpression of glycolytic genes resulted in reduction of the intracellular NADH/NAD+ ratio, which also plays an important role on the improvement of glucose consumption. Enhanced alanine dehydrogenase activity using a high-copy-number plasmid further accelerated the overall alanine productivity. Increase in glycolytic enzyme activities is a promising approach to make drastic progress in growth-arrested bioprocesses. PMID

  9. Composition and expression of genes encoding carbohydrate-active enzymes in the straw-degrading mushroom Volvariella volvacea.

    Directory of Open Access Journals (Sweden)

    Bingzhi Chen

    Full Text Available Volvariella volvacea is one of a few commercial cultivated mushrooms mainly using straw as carbon source. In this study, the genome of V. volcacea was sequenced and assembled. A total of 285 genes encoding carbohydrate-active enzymes (CAZymes in V. volvacea were identified and annotated. Among 15 fungi with sequenced genomes, V. volvacea ranks seventh in the number of genes encoding CAZymes. In addition, the composition of glycoside hydrolases in V. volcacea is dramatically different from other basidiomycetes: it is particularly rich in members of the glycoside hydrolase families GH10 (hemicellulose degradation and GH43 (hemicellulose and pectin degradation, and the lyase families PL1, PL3 and PL4 (pectin degradation but lacks families GH5b, GH11, GH26, GH62, GH93, GH115, GH105, GH9, GH53, GH32, GH74 and CE12. Analysis of genome-wide gene expression profiles of 3 strains using 3'-tag digital gene expression (DGE reveals that 239 CAZyme genes were expressed even in potato destrose broth medium. Our data also showed that the formation of a heterokaryotic strain could dramatically increase the expression of a number of genes which were poorly expressed in its parental homokaryotic strains.

  10. Mitochondrial and cytoplasmic isoleucyl-, glutamyl- and arginyl-tRNA synthetases of yeast are encoded by separate genes.

    Science.gov (United States)

    Tzagoloff, A; Shtanko, A

    1995-06-01

    Three complementation groups of a pet mutant collection have been found to be composed of respiratory-deficient deficient mutants with lesions in mitochondrial protein synthesis. Recombinant plasmids capable of restoring respiration were cloned by transformation of representatives of each complementation group with a yeast genomic library. The plasmids were used to characterize the complementing genes and to institute disruption of the chromosomal copies of each gene in respiratory-proficient yeast. The sequences of the cloned genes indicate that they code for isoleucyl-, arginyl- and glutamyl-tRNA synthetases. The properties of the mutants used to obtain the genes and of strains with the disrupted genes indicate that all three aminoacyl-tRNA synthetases function exclusively in mitochondrial proteins synthesis. The ISM1 gene for mitochondrial isoleucyl-tRNA synthetase has been localized to chromosome XVI next to UME5. The MSR1 gene for the arginyl-tRNA synthetase was previously located on yeast chromosome VIII. The third gene MSE1 for the mitochondrial glutamyl-tRNA synthetase has not been localized. The identification of three new genes coding for mitochondrial-specific aminoacyl-tRNA synthetases indicates that in Saccharomyces cerevisiae at least 11 members of this protein family are encoded by genes distinct from those coding for the homologous cytoplasmic enzymes.

  11. Mitochondrially-Encoded Adenosine Triphosphate Synthase 6 Gene Haplotype Variation among World Population during 2003-2013

    OpenAIRE

    Steven Steven; Yoni F Syukriani; Julius B Dewanto

    2016-01-01

    Background: Adaptation and natural selection serve as an important part of evolution. Adaptation in molecular level can lead to genetic drift which causes mutation of genetic material; one of which is polymorphism of mitochondrial DNA (mtDNA). The aim of this study is to verify the polymorphism of mitochondrially-encoded Adenosine Triphosphate synthase6gene (MT-ATP6) as one of mtDNA building blocks among tropic, sub-tropic, and polar areas. Methods: This descriptive quantitative research used...

  12. Human coronavirus 229E encodes a single ORF4 protein between the spike and the envelope genes

    Directory of Open Access Journals (Sweden)

    Berkhout Ben

    2006-12-01

    Full Text Available Abstract Background The genome of coronaviruses contains structural and non-structural genes, including several so-called accessory genes. All group 1b coronaviruses encode a single accessory protein between the spike and envelope genes, except for human coronavirus (HCoV 229E. The prototype virus has a split gene, encoding the putative ORF4a and ORF4b proteins. To determine whether primary HCoV-229E isolates exhibit this unusual genome organization, we analyzed the ORF4a/b region of five current clinical isolates from The Netherlands and three early isolates collected at the Common Cold Unit (CCU in Salisbury, UK. Results All Dutch isolates were identical in the ORF4a/b region at amino acid level. All CCU isolates are only 98% identical to the Dutch isolates at the nucleotide level, but more closely related to the prototype HCoV-229E (>98%. Remarkably, our analyses revealed that the laboratory adapted, prototype HCoV-229E has a 2-nucleotide deletion in the ORF4a/b region, whereas all clinical isolates carry a single ORF, 660 nt in size, encoding a single protein of 219 amino acids, which is a homologue of the ORF3 proteins encoded by HCoV-NL63 and PEDV. Conclusion Thus, the genome organization of the group 1b coronaviruses HCoV-NL63, PEDV and HCoV-229E is identical. It is possible that extensive culturing of the HCoV-229E laboratory strain resulted in truncation of ORF4. This may indicate that the protein is not essential in cell culture, but the highly conserved amino acid sequence of the ORF4 protein among clinical isolates suggests that the protein plays an important role in vivo.

  13. Identification of genes expressed in cultures of E. coli lysogens carrying the Shiga toxin-encoding prophage Φ24B

    Directory of Open Access Journals (Sweden)

    Riley Laura M

    2012-03-01

    Full Text Available Abstract Background Shigatoxigenic E. coli are a global and emerging health concern. Shiga toxin, Stx, is encoded on the genome of temperate, lambdoid Stx phages. Genes essential for phage maintenance and replication are encoded on approximately 50% of the genome, while most of the remaining genes are of unknown function nor is it known if these annotated hypothetical genes are even expressed. It is hypothesized that many of the latter have been maintained due to positive selection pressure, and that some, expressed in the lysogen host, have a role in pathogenicity. This study used Change Mediated Antigen Technology (CMAT™ and 2D-PAGE, in combination with RT-qPCR, to identify Stx phage genes that are expressed in E. coli during the lysogenic cycle. Results Lysogen cultures propagated for 5-6 hours produced a high cell density with a low proportion of spontaneous prophage induction events. The expression of 26 phage genes was detected in these cultures by differential 2D-PAGE of expressed proteins and CMAT. Detailed analyses of 10 of these genes revealed that three were unequivocally expressed in the lysogen, two expressed from a known lysogenic cycle promoter and one uncoupled from the phage regulatory network. Conclusion Propagation of a lysogen culture in which no cells at all are undergoing spontaneous lysis is impossible. To overcome this, RT-qPCR was used to determine gene expression profiles associated with the growth phase of lysogens. This enabled the definitive identification of three lambdoid Stx phage genes that are expressed in the lysogen and seven that are expressed during lysis. Conservation of these genes in this phage genome, and other Stx phages where they have been identified as present, indicates their importance in the phage/lysogen life cycle, with possible implications for the biology and pathogenicity of the bacterial host.

  14. The pkI gene encoding pyruvate kinase I links to the luxZ gene which enhances bioluminescence of the lux operon from Photobacterium leiognathi.

    Science.gov (United States)

    Lin, J W; Lu, H C; Chen, H Y; Weng, S F

    1997-10-09

    Partial 3'-end nucleotide sequence of the pkI gene (GenBank accession No. AF019143) from Photobacterium leiognathi ATCC 25521 has been determined, and the encoded pyruvate kinase I is deduced. Pyruvate kinase I is the key enzyme of glycolysis, which converts phosphoenol pyruvate to pyruvate. Alignment and comparison of pyruvate kinase Is from P. leiognathi, E. coli and Salmonella typhimurium show that they are homologous. Nucleotide sequence reveals that the pkI gene is linked to the luxZ gene that enhances bioluminescence of the lux operon from P. leiognathi. The gene order of the pkI and luxZ genes is-pk1-ter-->-R&R"-luxZ-ter"-->, whereas ter is transcriptional terminator for the pkI and related genes, and R&R" is the regulatory region and ter" is transcriptional terminator for the luxZ gene. It clearly elicits that the pkI gene and luxZ gene are divided to two operons. Functional analysis confirms that the potential hairpin loop omega T is the transcriptional terminator for the pkI and related genes. It infers that the pkI and related genes are simply linked to the luxZ gene in P. leiognathi genome.

  15. The frequency of genes encoding three putative group B streptococcal virulence factors among invasive and colonizing isolates

    Directory of Open Access Journals (Sweden)

    Borchardt Stephanie M

    2006-07-01

    Full Text Available Abstract Background Group B Streptococcus (GBS causes severe infections in very young infants and invasive disease in pregnant women and adults with underlying medical conditions. GBS pathogenicity varies between and within serotypes, with considerable variation in genetic content between strains. Three proteins, Rib encoded by rib, and alpha and beta C proteins encoded by bca and bac, respectively, have been suggested as potential vaccine candidates for GBS. It is not known, however, whether these genes occur more frequently in invasive versus colonizing GBS strains. Methods We screened 162 invasive and 338 colonizing GBS strains from different collections using dot blot hybridization to assess the frequency of bca, bac and rib. All strains were defined by serotyping for capsular type, and frequency differences were tested using the Chi square test. Results Genes encoding the beta C protein (bac and Rib (rib occurred at similar frequencies among invasive and colonizing isolates, bac (20% vs. 23%, and rib (28% vs. 20%, while the alpha (bca C protein was more frequently found in colonizing strains (46% vs, invasive (29%. Invasive strains were associated with specific serotype/gene combinations. Conclusion Novel virulence factors must be identified to better understand GBS disease.

  16. Several genes encoding enzymes with the same activity are necessary for aerobic fungal degradation of cellulose in nature

    DEFF Research Database (Denmark)

    Busk, Peter Kamp; Lange, Mette; Pilgaard, Bo

    2014-01-01

    The cellulose-degrading fungal enzymes are glycoside hydrolases of the GH families and lytic polysaccharide monooxygenases. The entanglement of glycoside hydrolase families and functions makes it difficult to predict the enzymatic activity of glycoside hydrolases based on their sequence....... In the present study we further developed the method Peptide Pattern Recognition to an automatic approach not only to find all genes encoding glycoside hydrolases and lytic polysaccharide monooxygenases in fungal genomes but also to predict the function of the genes. The functional annotation is an important...

  17. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  18. A novel human gene encoding a G-protein-coupled receptor (GPR15) is located on chromosome 3

    Energy Technology Data Exchange (ETDEWEB)

    Heiber, M.; Marchese, A.; O`Dowd, B.F. [Univ. of Toronto, Ontario (Canada)] [and others

    1996-03-05

    We used sequence similarities among G-protein-coupled receptor genes to discover a novel receptor gene. Using primers based on conserved regions of the opioid-related receptors, we isolated a PCR product that was used to locate the full-length coding region of a novel human receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor gene, which we have named GPR15. A comparison of the amino acid sequence of the receptor encoded by GPR15 with other receptors revealed that it shared sequence identity with the angiotensin II AT1 and AT2 receptors, the interleukin 8b receptor, and the orphan receptors GPR1 and AGTL1. GPR15 was mapped to human chromosome 3q11.2-q13.1. 12 refs., 2 figs.

  19. A lepidopteran-specific gene family encoding valine-rich midgut proteins.

    Directory of Open Access Journals (Sweden)

    Jothini Odman-Naresh

    Full Text Available Many lepidopteran larvae are serious agricultural pests due to their feeding ac