
Sample records for genes duplications phylogeny

  1. A salmonid EST genomic study: genes, duplications, phylogeny and microarrays

    Directory of Open Access Journals (Sweden)

    Brahmbhatt Sonal


    Full Text Available Abstract Background Salmonids are of interest because of their relatively recent genome duplication, and their extensive use in wild fisheries and aquaculture. A comprehensive gene list and a comparison of genes in some of the different species provide valuable genomic information for one of the most widely studied groups of fish. Results 298,304 expressed sequence tags (ESTs from Atlantic salmon (69% of the total, 11,664 chinook, 10,813 sockeye, 10,051 brook trout, 10,975 grayling, 8,630 lake whitefish, and 3,624 northern pike ESTs were obtained in this study and have been deposited into the public databases. Contigs were built and putative full-length Atlantic salmon clones have been identified. A database containing ESTs, assemblies, consensus sequences, open reading frames, gene predictions and putative annotation is available. The overall similarity between Atlantic salmon ESTs and those of rainbow trout, chinook, sockeye, brook trout, grayling, lake whitefish, northern pike and rainbow smelt is 93.4, 94.2, 94.6, 94.4, 92.5, 91.7, 89.6, and 86.2% respectively. An analysis of 78 transcript sets show Salmo as a sister group to Oncorhynchus and Salvelinus within Salmoninae, and Thymallinae as a sister group to Salmoninae and Coregoninae within Salmonidae. Extensive gene duplication is consistent with a genome duplication in the common ancestor of salmonids. Using all of the available EST data, a new expanded salmonid cDNA microarray of 32,000 features was created. Cross-species hybridizations to this cDNA microarray indicate that this resource will be useful for studies of all 68 salmonid species. Conclusion An extensive collection and analysis of salmonid RNA putative transcripts indicate that Pacific salmon, Atlantic salmon and charr are 94–96% similar while the more distant whitefish, grayling, pike and smelt are 93, 92, 89 and 86% similar to salmon. The salmonid transcriptome reveals a complex history of gene duplication that is

  2. Rooting phylogenies using gene duplications: an empirical example from the bees (Apoidea). (United States)

    Brady, Seán G; Litman, Jessica R; Danforth, Bryan N


    The placement of the root node in a phylogeny is fundamental to characterizing evolutionary relationships. The root node of bee phylogeny remains unclear despite considerable previous attention. In order to test alternative hypotheses for the location of the root node in bees, we used the F1 and F2 paralogs of elongation factor 1-alpha (EF-1α) to compare the tree topologies that result when using outgroup versus paralogous rooting. Fifty-two taxa representing each of the seven bee families were sequenced for both copies of EF-1α. Two datasets were analyzed. In the first (the "concatenated" dataset), the F1 and F2 copies for each species were concatenated and the tree was rooted using appropriate outgroups (sphecid and crabronid wasps). In the second dataset (the "duplicated" dataset), the F1 and F2 copies were aligned to each another and each copy for all taxa were treated as separate terminals. In this dataset, the root was placed between the F1 and F2 copies (e.g., paralog rooting). Bayesian analyses demonstrate that the outgroup rooting approach outperforms paralog rooting, recovering deeper clades and showing stronger support for groups well established by both morphological and other molecular data. Sequence characteristics of the two copies were compared at the amino acid level, but little evidence was found to suggest that one copy is more functionally conserved. Although neither approach yields an unambiguous root to the tree, both approaches strongly indicate that the root of bee phylogeny does not fall near Colletidae, as has been previously proposed. We discuss paralog rooting as a general strategy and why this approach performs relatively poorly with our particular dataset. Copyright © 2011 Elsevier Inc. All rights reserved.

  3. The roles of segmental and tandem gene duplication in the evolution of large gene families in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Baumgarten Andrew


    Full Text Available Abstract Background Most genes in Arabidopsis thaliana are members of gene families. How do the members of gene families arise, and how are gene family copy numbers maintained? Some gene families may evolve primarily through tandem duplication and high rates of birth and death in clusters, and others through infrequent polyploidy or large-scale segmental duplications and subsequent losses. Results Our approach to understanding the mechanisms of gene family evolution was to construct phylogenies for 50 large gene families in Arabidopsis thaliana, identify large internal segmental duplications in Arabidopsis, map gene duplications onto the segmental duplications, and use this information to identify which nodes in each phylogeny arose due to segmental or tandem duplication. Examples of six gene families exemplifying characteristic modes are described. Distributions of gene family sizes and patterns of duplication by genomic distance are also described in order to characterize patterns of local duplication and copy number for large gene families. Both gene family size and duplication by distance closely follow power-law distributions. Conclusions Combining information about genomic segmental duplications, gene family phylogenies, and gene positions provides a method to evaluate contributions of tandem duplication and segmental genome duplication in the generation and maintenance of gene families. These differences appear to correspond meaningfully to differences in functional roles of the members of the gene families.

  4. Duplicability of self-interacting human genes.

    LENUS (Irish Health Repository)

    Pérez-Bercoff, Asa


    BACKGROUND: There is increasing interest in the evolution of protein-protein interactions because this should ultimately be informative of the patterns of evolution of new protein functions within the cell. One model proposes that the evolution of new protein-protein interactions and protein complexes proceeds through the duplication of self-interacting genes. This model is supported by data from yeast. We examined the relationship between gene duplication and self-interaction in the human genome. RESULTS: We investigated the patterns of self-interaction and duplication among 34808 interactions encoded by 8881 human genes, and show that self-interacting proteins are encoded by genes with higher duplicability than genes whose proteins lack this type of interaction. We show that this result is robust against the system used to define duplicate genes. Finally we compared the presence of self-interactions amongst proteins whose genes have duplicated either through whole-genome duplication (WGD) or small-scale duplication (SSD), and show that the former tend to have more interactions in general. After controlling for age differences between the two sets of duplicates this result can be explained by the time since the gene duplication. CONCLUSIONS: Genes encoding self-interacting proteins tend to have higher duplicability than proteins lacking self-interactions. Moreover these duplicate genes have more often arisen through whole-genome rather than small-scale duplication. Finally, self-interacting WGD genes tend to have more interaction partners in general in the PIN, which can be explained by their overall greater age. This work adds to our growing knowledge of the importance of contextual factors in gene duplicability.

  5. The duplicated genes database: identification and functional annotation of co-localised duplicated genes across genomes.

    Directory of Open Access Journals (Sweden)

    Marion Ouedraogo

    Full Text Available BACKGROUND: There has been a surge in studies linking genome structure and gene expression, with special focus on duplicated genes. Although initially duplicated from the same sequence, duplicated genes can diverge strongly over evolution and take on different functions or regulated expression. However, information on the function and expression of duplicated genes remains sparse. Identifying groups of duplicated genes in different genomes and characterizing their expression and function would therefore be of great interest to the research community. The 'Duplicated Genes Database' (DGD was developed for this purpose. METHODOLOGY: Nine species were included in the DGD. For each species, BLAST analyses were conducted on peptide sequences corresponding to the genes mapped on a same chromosome. Groups of duplicated genes were defined based on these pairwise BLAST comparisons and the genomic location of the genes. For each group, Pearson correlations between gene expression data and semantic similarities between functional GO annotations were also computed when the relevant information was available. CONCLUSIONS: The Duplicated Gene Database provides a list of co-localised and duplicated genes for several species with the available gene co-expression level and semantic similarity value of functional annotation. Adding these data to the groups of duplicated genes provides biological information that can prove useful to gene expression analyses. The Duplicated Gene Database can be freely accessed through the DGD website at

  6. On the Complexity of Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees. (United States)

    Kordi, Misagh; Bansal, Mukul S


    Duplication-Transfer-Loss (DTL) reconciliation has emerged as a powerful technique for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation takes as input a gene family phylogeny and the corresponding species phylogeny, and reconciles the two by postulating speciation, gene duplication, horizontal gene transfer, and gene loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. However, gene trees are frequently non-binary. With such non-binary gene trees, the reconciliation problem seeks to find a binary resolution of the gene tree that minimizes the reconciliation cost. Given the prevalence of non-binary gene trees, many efficient algorithms have been developed for this problem in the context of the simpler Duplication-Loss (DL) reconciliation model. Yet, no efficient algorithms exist for DTL reconciliation with non-binary gene trees and the complexity of the problem remains unknown. In this work, we resolve this open question by showing that the problem is, in fact, NP-hard. Our reduction applies to both the dated and undated formulations of DTL reconciliation. By resolving this long-standing open problem, this work will spur the development of both exact and heuristic algorithms for this important problem.

  7. Comparative study of human mitochondrial proteome reveals extensive protein subcellular relocalization after gene duplications

    Directory of Open Access Journals (Sweden)

    Huang Yong


    Full Text Available Abstract Background Gene and genome duplication is the principle creative force in evolution. Recently, protein subcellular relocalization, or neolocalization was proposed as one of the mechanisms responsible for the retention of duplicated genes. This hypothesis received support from the analysis of yeast genomes, but has not been tested thoroughly on animal genomes. In order to evaluate the importance of subcellular relocalizations for retention of duplicated genes in animal genomes, we systematically analyzed nuclear encoded mitochondrial proteins in the human genome by reconstructing phylogenies of mitochondrial multigene families. Results The 456 human mitochondrial proteins selected for this study were clustered into 305 gene families including 92 multigene families. Among the multigene families, 59 (64% consisted of both mitochondrial and cytosolic (non-mitochondrial proteins (mt-cy families while the remaining 33 (36% were composed of mitochondrial proteins (mt-mt families. Phylogenetic analyses of mt-cy families revealed three different scenarios of their neolocalization following gene duplication: 1 relocalization from mitochondria to cytosol, 2 from cytosol to mitochondria and 3 multiple subcellular relocalizations. The neolocalizations were most commonly enabled by the gain or loss of N-terminal mitochondrial targeting signals. The majority of detected subcellular relocalization events occurred early in animal evolution, preceding the evolution of tetrapods. Mt-mt protein families showed a somewhat different pattern, where gene duplication occurred more evenly in time. However, for both types of protein families, most duplication events appear to roughly coincide with two rounds of genome duplications early in vertebrate evolution. Finally, we evaluated the effects of inaccurate and incomplete annotation of mitochondrial proteins and found that our conclusion of the importance of subcellular relocalization after gene duplication on

  8. The odds of duplicate gene persistence after polyploidization

    Directory of Open Access Journals (Sweden)

    Chain Frédéric JJ


    Full Text Available Abstract Background Gene duplication is an important biological phenomenon associated with genomic redundancy, degeneration, specialization, innovation, and speciation. After duplication, both copies continue functioning when natural selection favors duplicated protein function or expression, or when mutations make them functionally distinct before one copy is silenced. Results Here we quantify the degree to which genetic parameters related to gene expression, molecular evolution, and gene structure in a diploid frog - Silurana tropicalis - influence the odds of functional persistence of orthologous duplicate genes in a closely related tetraploid species - Xenopus laevis. Using public databases and 454 pyrosequencing, we obtained genetic and expression data from S. tropicalis orthologs of 3,387 X. laevis paralogs and 4,746 X. laevis singletons - the most comprehensive dataset for African clawed frogs yet analyzed. Using logistic regression, we demonstrate that the most important predictors of the odds of duplicate gene persistence in the tetraploid species are the total gene expression level and evenness of expression across tissues and development in the diploid species. Slow protein evolution and information density (fewer exons, shorter introns in the diploid are also positively correlated with duplicate gene persistence in the tetraploid. Conclusions Our findings suggest that a combination of factors contribute to duplicate gene persistence following whole genome duplication, but that the total expression level and evenness of expression across tissues and through development before duplication are most important. We speculate that these parameters are useful predictors of duplicate gene longevity after whole genome duplication in other taxa.

  9. Effect of Duplicate Genes on Mouse Genetic Robustness: An Update

    Directory of Open Access Journals (Sweden)

    Zhixi Su


    Full Text Available In contrast to S. cerevisiae and C. elegans, analyses based on the current knockout (KO mouse phenotypes led to the conclusion that duplicate genes had almost no role in mouse genetic robustness. It has been suggested that the bias of mouse KO database toward ancient duplicates may possibly cause this knockout duplicate puzzle, that is, a very similar proportion of essential genes (PE between duplicate genes and singletons. In this paper, we conducted an extensive and careful analysis for the mouse KO phenotype data and corroborated a strong effect of duplicate genes on mouse genetics robustness. Moreover, the effect of duplicate genes on mouse genetic robustness is duplication-age dependent, which holds after ruling out the potential confounding effect from coding-sequence conservation, protein-protein connectivity, functional bias, or the bias of duplicates generated by whole genome duplication (WGD. Our findings suggest that two factors, the sampling bias toward ancient duplicates and very ancient duplicates with a proportion of essential genes higher than that of singletons, have caused the mouse knockout duplicate puzzle; meanwhile, the effect of genetic buffering may be correlated with sequence conservation as well as protein-protein interactivity.

  10. Exon duplications in the ATP7A gene

    DEFF Research Database (Denmark)

    Mogensen, Mie; Skjørringe, Tina; Kodama, Hiroko


    the identified duplicated fragments originated from a single or from two different X-chromosomes, polymorphic markers located in the duplicated fragments were analyzed. RESULTS: Partial ATP7A gene duplication was identified in 20 unrelated patients including one patient with Occipital Horn Syndrome (OHS...

  11. Functional requirements driving the gene duplication in 12 Drosophila species. (United States)

    Zhong, Yan; Jia, Yanxiao; Gao, Yang; Tian, Dacheng; Yang, Sihai; Zhang, Xiaohui


    Gene duplication supplies the raw materials for novel gene functions and many gene families arisen from duplication experience adaptive evolution. Most studies of young duplicates have focused on mammals, especially humans, whereas reports describing their genome-wide evolutionary patterns across the closely related Drosophila species are rare. The sequenced 12 Drosophila genomes provide the opportunity to address this issue. In our study, 3,647 young duplicate gene families were identified across the 12 Drosophila species and three types of expansions, species-specific, lineage-specific and complex expansions, were detected in these gene families. Our data showed that the species-specific young duplicate genes predominated (86.6%) over the other two types. Interestingly, many independent species-specific expansions in the same gene family have been observed in many species, even including 11 or 12 Drosophila species. Our data also showed that the functional bias observed in these young duplicate genes was mainly related to responses to environmental stimuli and biotic stresses. This study reveals the evolutionary patterns of young duplicates across 12 Drosophila species on a genomic scale. Our results suggest that convergent evolution acts on young duplicate genes after the species differentiation and adaptive evolution may play an important role in duplicate genes for adaption to ecological factors and environmental changes in Drosophila.

  12. Gene structure, phylogeny and expression profile of the sucrose ...

    Indian Academy of Sciences (India)

    Gene structure, phylogeny and expression profile of the sucrose synthase gene family in .... 24, 701–713. Bate N. and Twell D. 1998 Functional architecture of a late pollen .... Manzara T. and Gruissem W. 1988 Organization and expression.

  13. Maintenance and Loss of Duplicated Genes by Dosage Subfunctionalization. (United States)

    Gout, Jean-Francois; Lynch, Michael


    Whole-genome duplications (WGDs) have contributed to gene-repertoire enrichment in many eukaryotic lineages. However, most duplicated genes are eventually lost and it is still unclear why some duplicated genes are evolutionary successful whereas others quickly turn to pseudogenes. Here, we show that dosage constraints are major factors opposing post-WGD gene loss in several Paramecium species that share a common ancestral WGD. We propose a model where a majority of WGD-derived duplicates preserve their ancestral function and are retained to produce enough of the proteins performing this same ancestral function. Under this model, the expression level of individual duplicated genes can evolve neutrally as long as they maintain a roughly constant summed expression, and this allows random genetic drift toward uneven contributions of the two copies to total expression. Our analysis suggests that once a high level of imbalance is reached, which can require substantial lengths of time, the copy with the lowest expression level contributes a small enough fraction of the total expression that selection no longer opposes its loss. Extension of our analysis to yeast species sharing a common ancestral WGD yields similar results, suggesting that duplicated-gene retention for dosage constraints followed by divergence in expression level and eventual deterministic gene loss might be a universal feature of post-WGD evolution. © The Author 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution. All rights reserved. For permissions, please e-mail:

  14. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms. (United States)

    Li, Zhen; Defoort, Jonas; Tasdighian, Setareh; Maere, Steven; Van de Peer, Yves; De Smet, Riet


    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of "gene duplicability" is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. © 2016 American Society of Plant Biologists. All rights reserved.

  15. Evolution of Rosaceae Fruit Types Based on Nuclear Phylogeny in the Context of Geological Times and Genome Duplication. (United States)

    Xiang, Yezi; Huang, Chien-Hsun; Hu, Yi; Wen, Jun; Li, Shisheng; Yi, Tingshuang; Chen, Hongyi; Xiang, Jun; Ma, Hong


    Fruits are the defining feature of angiosperms, likely have contributed to angiosperm successes by protecting and dispersing seeds, and provide foods to humans and other animals, with many morphological types and important ecological and agricultural implications. Rosaceae is a family with ∼3000 species and an extraordinary spectrum of distinct fruits, including fleshy peach, apple, and strawberry prized by their consumers, as well as dry achenetum and follicetum with features facilitating seed dispersal, excellent for studying fruit evolution. To address Rosaceae fruit evolution and other questions, we generated 125 new transcriptomic and genomic datasets and identified hundreds of nuclear genes to reconstruct a well-resolved Rosaceae phylogeny with highly supported monophyly of all subfamilies and tribes. Molecular clock analysis revealed an estimated age of ∼101.6 Ma for crown Rosaceae and divergence times of tribes and genera, providing a geological and climate context for fruit evolution. Phylogenomic analysis yielded strong evidence for numerous whole genome duplications (WGDs), supporting the hypothesis that the apple tribe had a WGD and revealing another one shared by fleshy fruit-bearing members of this tribe, with moderate support for WGDs in the peach tribe and other groups. Ancestral character reconstruction for fruit types supports independent origins of fleshy fruits from dry-fruit ancestors, including the evolution of drupes (e.g., peach) and pomes (e.g., apple) from follicetum, and drupetum (raspberry and blackberry) from achenetum. We propose that WGDs and environmental factors, including animals, contributed to the evolution of the many fruits in Rosaceae, which provide a foundation for understanding fruit evolution. © The Author 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  16. Gene Duplicability of Core Genes Is Highly Consistent across All Angiosperms[OPEN (United States)

    Li, Zhen; Van de Peer, Yves; De Smet, Riet


    Gene duplication is an important mechanism for adding to genomic novelty. Hence, which genes undergo duplication and are preserved following duplication is an important question. It has been observed that gene duplicability, or the ability of genes to be retained following duplication, is a nonrandom process, with certain genes being more amenable to survive duplication events than others. Primarily, gene essentiality and the type of duplication (small-scale versus large-scale) have been shown in different species to influence the (long-term) survival of novel genes. However, an overarching view of “gene duplicability” is lacking, mainly due to the fact that previous studies usually focused on individual species and did not account for the influence of genomic context and the time of duplication. Here, we present a large-scale study in which we investigated duplicate retention for 9178 gene families shared between 37 flowering plant species, referred to as angiosperm core gene families. For most gene families, we observe a strikingly consistent pattern of gene duplicability across species, with gene families being either primarily single-copy or multicopy in all species. An intermediate class contains gene families that are often retained in duplicate for periods extending to tens of millions of years after whole-genome duplication, but ultimately appear to be largely restored to singleton status, suggesting that these genes may be dosage balance sensitive. The distinction between single-copy and multicopy gene families is reflected in their functional annotation, with single-copy genes being mainly involved in the maintenance of genome stability and organelle function and multicopy genes in signaling, transport, and metabolism. The intermediate class was overrepresented in regulatory genes, further suggesting that these represent putative dosage-balance-sensitive genes. PMID:26744215

  17. Concomitant duplications of opioid peptide and receptor genes before the origin of jawed vertebrates.

    Directory of Open Access Journals (Sweden)

    Görel Sundström

    Full Text Available BACKGROUND: The opioid system is involved in reward and pain mechanisms and consists in mammals of four receptors and several peptides. The peptides are derived from four prepropeptide genes, PENK, PDYN, PNOC and POMC, encoding enkephalins, dynorphins, orphanin/nociceptin and beta-endorphin, respectively. Previously we have described how two rounds of genome doubling (2R before the origin of jawed vertebrates formed the receptor family. METHODOLOGY/PRINCIPAL FINDINGS: Opioid peptide gene family members were investigated using a combination of sequence-based phylogeny and chromosomal locations of the peptide genes in various vertebrates. Several adjacent gene families were investigated similarly. The results show that the ancestral peptide gene gave rise to two additional copies in the genome doublings. The fourth member was generated by a local gene duplication, as the genes encoding POMC and PNOC are located on the same chromosome in the chicken genome and all three teleost genomes that we have studied. A translocation has disrupted this synteny in mammals. The PDYN gene seems to have been lost in chicken, but not in zebra finch. Duplicates of some peptide genes have arisen in the teleost fishes. Within the prepropeptide precursors, peptides have been lost or gained in different lineages. CONCLUSIONS/SIGNIFICANCE: The ancestral peptide and receptor genes were located on the same chromosome and were thus duplicated concomitantly. However, subsequently genetic linkage has been lost. In conclusion, the system of opioid peptides and receptors was largely formed by the genome doublings that took place early in vertebrate evolution.


    Directory of Open Access Journals (Sweden)

    Khlestkina E.


    Full Text Available Gene duplication followed by subfunctionalization and neofunctionalization is of a great evolutionary importance. In plant genomes, duplicated genes may result from either polyploidization (homoeologous genes or segmental chromosome duplications (paralogous genes. In allohexaploid wheat Triticum aestivum L. (2n=6x=42, genome BBAADD, both homoeologous and paralogous copies were found for the regulatory gene Myc encoding MYC-like transcriptional factor in the biosynthesis of flavonoid pigments, anthocyanins, and for the structural gene F3h encoding one of the key enzymes of flavonoid biosynthesis, flavanone 3-hydroxylase. From the 5 copies (3 homoeologous and 2 paralogous of the Myc gene found in T. aestivum, only one plays a regulatory role in anthocyanin biosynthesis, interacting complementary with another transcriptional factor (MYB-like to confer purple pigmentation of grain pericarp in wheat. The role and functionality of the other 4 copies of the Myc gene remain unknown. From the 4 functional copies of the F3h gene in T. aestivum, three homoeologues have similar function. They are expressed in wheat organs colored with anthocyanins or in the endosperm, participating there in biosynthesis of uncolored flavonoid substances. The fourth copy (the B-genomic paralogue is transcribed neither in wheat organs colored with anthocyanins nor in seeds, however, it’s expression has been noticed in roots of aluminium-stressed plants, where the three homoeologous copies are not active. Functional diversification of the duplicated flavonoid biosynthesis genes in wheat may be a reason for maintenance of the duplicated copies and preventing them from pseudogenization.The study was supported by RFBR (11-04-92707. We also thank Ms. Galina Generalova for technical assistance.

  19. The IQD gene family in soybean: structure, phylogeny, evolution and expression.

    Directory of Open Access Journals (Sweden)

    Lin Feng

    Full Text Available Members of the plant-specific IQ67-domain (IQD protein family are involved in plant development and the basal defense response. Although systematic characterization of this family has been carried out in Arabidopsis, tomato (Solanum lycopersicum, Brachypodium distachyon and rice (Oryza sativa, systematic analysis and expression profiling of this gene family in soybean (Glycine max have not previously been reported. In this study, we identified and structurally characterized IQD genes in the soybean genome. A complete set of 67 soybean IQD genes (GmIQD1-67 was identified using Blast search tools, and the genes were clustered into four subfamilies (IQD I-IV based on phylogeny. These soybean IQD genes are distributed unevenly across all 20 chromosomes, with 30 segmental duplication events, suggesting that segmental duplication has played a major role in the expansion of the soybean IQD gene family. Analysis of the Ka/Ks ratios showed that the duplicated genes of the GmIQD family primarily underwent purifying selection. Microsynteny was detected in most pairs: genes in clade 1-3 might be present in genome regions that were inverted, expanded or contracted after the divergence; most gene pairs in clade 4 showed high conservation with little rearrangement among these gene-residing regions. Of the soybean IQD genes examined, six were most highly expressed in young leaves, six in flowers, one in roots and two in nodules. Our qRT-PCR analysis of 24 soybean IQD III genes confirmed that these genes are regulated by MeJA stress. Our findings present a comprehensive overview of the soybean IQD gene family and provide insights into the evolution of this family. In addition, this work lays a solid foundation for further experiments aimed at determining the biological functions of soybean IQD genes in growth and development.

  20. A role for gene duplication and natural variation of gene expression in the evolution of metabolism.

    Directory of Open Access Journals (Sweden)

    Daniel J Kliebenstein

    Full Text Available BACKGROUND: Most eukaryotic genomes have undergone whole genome duplications during their evolutionary history. Recent studies have shown that the function of these duplicated genes can diverge from the ancestral gene via neo- or sub-functionalization within single genotypes. An additional possibility is that gene duplicates may also undergo partitioning of function among different genotypes of a species leading to genetic differentiation. Finally, the ability of gene duplicates to diverge may be limited by their biological function. METHODOLOGY/PRINCIPAL FINDINGS: To test these hypotheses, I estimated the impact of gene duplication and metabolic function upon intraspecific gene expression variation of segmental and tandem duplicated genes within Arabidopsis thaliana. In all instances, the younger tandem duplicated genes showed higher intraspecific gene expression variation than the average Arabidopsis gene. Surprisingly, the older segmental duplicates also showed evidence of elevated intraspecific gene expression variation albeit typically lower than for the tandem duplicates. The specific biological function of the gene as defined by metabolic pathway also modulated the level of intraspecific gene expression variation. The major energy metabolism and biosynthetic pathways showed decreased variation, suggesting that they are constrained in their ability to accumulate gene expression variation. In contrast, a major herbivory defense pathway showed significantly elevated intraspecific variation suggesting that it may be under pressure to maintain and/or generate diversity in response to fluctuating insect herbivory pressures. CONCLUSION: These data show that intraspecific variation in gene expression is facilitated by an interaction of gene duplication and biological activity. Further, this plays a role in controlling diversity of plant metabolism.

  1. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    Based on whole-genome analysis of Arabidopsis thaliana, there is compelling evidence that angiosperms underwent two whole-genome duplication events early during their evolutionary history. Recent studies have shown that these events were crucial for creation of many important developmental and regulatory genes ...

  2. A fungal phylogeny based on 42 complete genomes derived from supertree and combined gene analysis

    Directory of Open Access Journals (Sweden)

    Stajich Jason E


    Full Text Available Abstract Background To date, most fungal phylogenies have been derived from single gene comparisons, or from concatenated alignments of a small number of genes. The increase in fungal genome sequencing presents an opportunity to reconstruct evolutionary events using entire genomes. As a tool for future comparative, phylogenomic and phylogenetic studies, we used both supertrees and concatenated alignments to infer relationships between 42 species of fungi for which complete genome sequences are available. Results A dataset of 345,829 genes was extracted from 42 publicly available fungal genomes. Supertree methods were employed to derive phylogenies from 4,805 single gene families. We found that the average consensus supertree method may suffer from long-branch attraction artifacts, while matrix representation with parsimony (MRP appears to be immune from these. A genome phylogeny was also reconstructed from a concatenated alignment of 153 universally distributed orthologs. Our MRP supertree and concatenated phylogeny are highly congruent. Within the Ascomycota, the sub-phyla Pezizomycotina and Saccharomycotina were resolved. Both phylogenies infer that the Leotiomycetes are the closest sister group to the Sordariomycetes. There is some ambiguity regarding the placement of Stagonospora nodurum, the sole member of the class Dothideomycetes present in the dataset. Within the Saccharomycotina, a monophyletic clade containing organisms that translate CTG as serine instead of leucine is evident. There is also strong support for two groups within the CTG clade, one containing the fully sexual species Candida lusitaniae, Candida guilliermondii and Debaryomyces hansenii, and the second group containing Candida albicans, Candida dubliniensis, Candida tropicalis, Candida parapsilosis and Lodderomyces elongisporus. The second major clade within the Saccharomycotina contains species whose genomes have undergone a whole genome duplication (WGD, and their close

  3. Gene duplication, silencing and expression alteration govern the molecular evolution of PRC2 genes in plants. (United States)

    Furihata, Hazuka Y; Suenaga, Kazuya; Kawanabe, Takahiro; Yoshida, Takanori; Kawabe, Akira


    PRC2 genes were analyzed for their number of gene duplications, d N /d S ratios and expression patterns among Brassicaceae and Gramineae species. Although both amino acid sequences and copy number of the PRC2 genes were generally well conserved in both Brassicaceae and Gramineae species, we observed that some rapidly evolving genes experienced duplications and expression pattern changes. After multiple duplication events, all but one or two of the duplicated copies tend to be silenced. Silenced copies were reactivated in the endosperm and showed ectopic expression in developing seeds. The results indicated that rapid evolution of some PRC2 genes is initially caused by a relaxation of selective constraint following the gene duplication events. Several loci could become maternally expressed imprinted genes and acquired functional roles in the endosperm.

  4. Recombination facilitates neofunctionalization of duplicate genes via originalization

    Directory of Open Access Journals (Sweden)

    Huang Ren


    Full Text Available Abstract Background Recently originalization was proposed to be an effective way of duplicate-gene preservation, in which recombination provokes the high frequency of original (or wild-type allele on both duplicated loci. Because the high frequency of wild-type allele might drive the arising and accumulating of advantageous mutation, it is hypothesized that recombination might enlarge the probability of neofunctionalization (Pneo of duplicate genes. In this article this hypothesis has been tested theoretically. Results Results show that through originalization recombination might not only shorten mean time to neofunctionalizaiton, but also enlarge Pneo. Conclusions Therefore, recombination might facilitate neofunctionalization via originalization. Several extensive applications of these results on genomic evolution have been discussed: 1. Time to nonfunctionalization can be much longer than a few million generations expected before; 2. Homogenization on duplicated loci results from not only gene conversion, but also originalization; 3. Although the rate of advantageous mutation is much small compared with that of degenerative mutation, Pneo cannot be expected to be small.

  5. Gene duplication, tissue-specific gene expression and sexual conflict in stalk-eyed flies (Diopsidae). (United States)

    Baker, Richard H; Narechania, Apurva; Johns, Philip M; Wilkinson, Gerald S


    Gene duplication provides an essential source of novel genetic material to facilitate rapid morphological evolution. Traits involved in reproduction and sexual dimorphism represent some of the fastest evolving traits in nature, and gene duplication is intricately involved in the origin and evolution of these traits. Here, we review genomic research on stalk-eyed flies (Diopsidae) that has been used to examine the extent of gene duplication and its role in the genetic architecture of sexual dimorphism. Stalk-eyed flies are remarkable because of the elongation of the head into long stalks, with the eyes and antenna laterally displaced at the ends of these stalks. Many species are strongly sexually dimorphic for eyespan, and these flies have become a model system for studying sexual selection. Using both expressed sequence tag and next-generation sequencing, we have established an extensive database of gene expression in the developing eye-antennal imaginal disc, the adult head and testes. Duplicated genes exhibit narrower expression patterns than non-duplicated genes, and the testes, in particular, provide an abundant source of gene duplication. Within somatic tissue, duplicated genes are more likely to be differentially expressed between the sexes, suggesting gene duplication may provide a mechanism for resolving sexual conflict.

  6. Gene duplication, loss and selection in the evolution of saxitoxin biosynthesis in alveolates. (United States)

    Murray, Shauna A; Diwan, Rutuja; Orr, Russell J S; Kohli, Gurjeet S; John, Uwe


    A group of marine dinoflagellates (Alveolata, Eukaryota), consisting of ∼10 species of the genus Alexandrium, Gymnodinium catenatum and Pyrodinium bahamense, produce the toxin saxitoxin and its analogues (STX), which can accumulate in shellfish, leading to ecosystem and human health impacts. The genes, sxt, putatively involved in STX biosynthesis, have recently been identified, however, the evolution of these genes within dinoflagellates is not clear. There are two reasons for this: uncertainty over the phylogeny of dinoflagellates; and that the sxt genes of many species of Alexandrium and other dinoflagellate genera are not known. Here, we determined the phylogeny of STX-producing and other dinoflagellates based on a concatenated eight-gene alignment. We determined the presence, diversity and phylogeny of sxtA, domains A1 and A4 and sxtG in 52 strains of Alexandrium, and a further 43 species of dinoflagellates and thirteen other alveolates. We confirmed the presence and high sequence conservation of sxtA, domain A4, in 40 strains (35 Alexandrium, 1 Pyrodinium, 4 Gymnodinium) of 8 species of STX-producing dinoflagellates, and absence from non-producing species. We found three paralogs of sxtA, domain A1, and a widespread distribution of sxtA1 in non-STX producing dinoflagellates, indicating duplication events in the evolution of this gene. One paralog, clade 2, of sxtA1 may be particularly related to STX biosynthesis. Similarly, sxtG appears to be generally restricted to STX-producing species, while three amidinotransferase gene paralogs were found in dinoflagellates. We investigated the role of positive (diversifying) selection following duplication in sxtA1 and sxtG, and found negative selection in clades of sxtG and sxtA1, clade 2, suggesting they were functionally constrained. Significant episodic diversifying selection was found in some strains in clade 3 of sxtA1, a clade that may not be involved in STX biosynthesis, indicating pressure for diversification

  7. Signals of historical interlocus gene conversion in human segmental duplications.

    Directory of Open Access Journals (Sweden)

    Beth L Dumont

    Full Text Available Standard methods of DNA sequence analysis assume that sequences evolve independently, yet this assumption may not be appropriate for segmental duplications that exchange variants via interlocus gene conversion (IGC. Here, we use high quality multiple sequence alignments from well-annotated segmental duplications to systematically identify IGC signals in the human reference genome. Our analysis combines two complementary methods: (i a paralog quartet method that uses DNA sequence simulations to identify a statistical excess of sites consistent with inter-paralog exchange, and (ii the alignment-based method implemented in the GENECONV program. One-quarter (25.4% of the paralog families in our analysis harbor clear IGC signals by the quartet approach. Using GENECONV, we identify 1477 gene conversion tracks that cumulatively span 1.54 Mb of the genome. Our analyses confirm the previously reported high rates of IGC in subtelomeric regions and Y-chromosome palindromes, and identify multiple novel IGC hotspots, including the pregnancy specific glycoproteins and the neuroblastoma breakpoint gene families. Although the duplication history of a paralog family is described by a single tree, we show that IGC has introduced incredible site-to-site variation in the evolutionary relationships among paralogs in the human genome. Our findings indicate that IGC has left significant footprints in patterns of sequence diversity across segmental duplications in the human genome, out-pacing the contributions of single base mutation by orders of magnitude. Collectively, the IGC signals we report comprise a catalog that will provide a critical reference for interpreting observed patterns of DNA sequence variation across duplicated genomic regions, including targets of recent adaptive evolution in humans.

  8. Evolution of stress-regulated gene expression in duplicate genes of Arabidopsis thaliana.

    Directory of Open Access Journals (Sweden)

    Cheng Zou


    Full Text Available Due to the selection pressure imposed by highly variable environmental conditions, stress sensing and regulatory response mechanisms in plants are expected to evolve rapidly. One potential source of innovation in plant stress response mechanisms is gene duplication. In this study, we examined the evolution of stress-regulated gene expression among duplicated genes in the model plant Arabidopsis thaliana. Key to this analysis was reconstructing the putative ancestral stress regulation pattern. By comparing the expression patterns of duplicated genes with the patterns of their ancestors, duplicated genes likely lost and gained stress responses at a rapid rate initially, but the rate is close to zero when the synonymous substitution rate (a proxy for time is > approximately 0.8. When considering duplicated gene pairs, we found that partitioning of putative ancestral stress responses occurred more frequently compared to cases of parallel retention and loss. Furthermore, the pattern of stress response partitioning was extremely asymmetric. An analysis of putative cis-acting DNA regulatory elements in the promoters of the duplicated stress-regulated genes indicated that the asymmetric partitioning of ancestral stress responses are likely due, at least in part, to differential loss of DNA regulatory elements; the duplicated genes losing most of their stress responses were those that had lost more of the putative cis-acting elements. Finally, duplicate genes that lost most or all of the ancestral responses are more likely to have gained responses to other stresses. Therefore, the retention of duplicates that inherit few or no functions seems to be coupled to neofunctionalization. Taken together, our findings provide new insight into the patterns of evolutionary changes in gene stress responses after duplication and lay the foundation for testing the adaptive significance of stress regulatory changes under highly variable biotic and abiotic environments.

  9. Evolution of the duplicated intracellular lipid-binding protein genes of teleost fishes. (United States)

    Venkatachalam, Ananda B; Parmar, Manoj B; Wright, Jonathan M


    Increasing organismal complexity during the evolution of life has been attributed to the duplication of genes and entire genomes. More recently, theoretical models have been proposed that postulate the fate of duplicated genes, among them the duplication-degeneration-complementation (DDC) model. In the DDC model, the common fate of a duplicated gene is lost from the genome owing to nonfunctionalization. Duplicated genes are retained in the genome either by subfunctionalization, where the functions of the ancestral gene are sub-divided between the sister duplicate genes, or by neofunctionalization, where one of the duplicate genes acquires a new function. Both processes occur either by loss or gain of regulatory elements in the promoters of duplicated genes. Here, we review the genomic organization, evolution, and transcriptional regulation of the multigene family of intracellular lipid-binding protein (iLBP) genes from teleost fishes. Teleost fishes possess many copies of iLBP genes owing to a whole genome duplication (WGD) early in the teleost fish radiation. Moreover, the retention of duplicated iLBP genes is substantially higher than the retention of all other genes duplicated in the teleost genome. The fatty acid-binding protein genes, a subfamily of the iLBP multigene family in zebrafish, are differentially regulated by peroxisome proliferator-activated receptor (PPAR) isoforms, which may account for the retention of iLBP genes in the zebrafish genome by the process of subfunctionalization of cis-acting regulatory elements in iLBP gene promoters.

  10. Differential retention of metabolic genes following whole-genome duplication. (United States)

    Gout, Jean-François; Duret, Laurent; Kahn, Daniel


    Classical studies in Metabolic Control Theory have shown that metabolic fluxes usually exhibit little sensitivity to changes in individual enzyme activity, yet remain sensitive to global changes of all enzymes in a pathway. Therefore, little selective pressure is expected on the dosage or expression of individual metabolic genes, yet entire pathways should still be constrained. However, a direct estimate of this selective pressure had not been evaluated. Whole-genome duplications (WGDs) offer a good opportunity to address this question by analyzing the fates of metabolic genes during the massive gene losses that follow. Here, we take advantage of the successive rounds of WGD that occurred in the Paramecium lineage. We show that metabolic genes exhibit different gene retention patterns than nonmetabolic genes. Contrary to what was expected for individual genes, metabolic genes appeared more retained than other genes after the recent WGD, which was best explained by selection for gene expression operating on entire pathways. Metabolic genes also tend to be less retained when present at high copy number before WGD, contrary to other genes that show a positive correlation between gene retention and preduplication copy number. This is rationalized on the basis of the classical concave relationship relating metabolic fluxes with enzyme expression.

  11. Gene Conversion in Angiosperm Genomes with an Emphasis on Genes Duplicated by Polyploidization

    Directory of Open Access Journals (Sweden)

    Xi-Yin Wang


    Full Text Available Angiosperm genomes differ from those of mammals by extensive and recursive polyploidizations. The resulting gene duplication provides opportunities both for genetic innovation, and for concerted evolution. Though most genes may escape conversion by their homologs, concerted evolution of duplicated genes can last for millions of years or longer after their origin. Indeed, paralogous genes on two rice chromosomes duplicated an estimated 60–70 million years ago have experienced gene conversion in the past 400,000 years. Gene conversion preserves similarity of paralogous genes, but appears to accelerate their divergence from orthologous genes in other species. The mutagenic nature of recombination coupled with the buffering effect provided by gene redundancy, may facilitate the evolution of novel alleles that confer functional innovations while insulating biological fitness of affected plants. A mixed evolutionary model, characterized by a primary birth-and-death process and occasional homoeologous recombination and gene conversion, may best explain the evolution of multigene families.

  12. Genome Mutational and Transcriptional Hotspots Are Traps for Duplicated Genes and Sources of Adaptations. (United States)

    Fares, Mario A; Sabater-Muñoz, Beatriz; Toft, Christina


    Gene duplication generates new genetic material, which has been shown to lead to major innovations in unicellular and multicellular organisms. A whole-genome duplication occurred in the ancestor of Saccharomyces yeast species but 92% of duplicates returned to single-copy genes shortly after duplication. The persisting duplicated genes in Saccharomyces led to the origin of major metabolic innovations, which have been the source of the unique biotechnological capabilities in the Baker's yeast Saccharomyces cerevisiae. What factors have determined the fate of duplicated genes remains unknown. Here, we report the first demonstration that the local genome mutation and transcription rates determine the fate of duplicates. We show, for the first time, a preferential location of duplicated genes in the mutational and transcriptional hotspots of S. cerevisiae genome. The mechanism of duplication matters, with whole-genome duplicates exhibiting different preservation trends compared to small-scale duplicates. Genome mutational and transcriptional hotspots are rich in duplicates with large repetitive promoter elements. Saccharomyces cerevisiae shows more tolerance to deleterious mutations in duplicates with repetitive promoter elements, which in turn exhibit higher transcriptional plasticity against environmental perturbations. Our data demonstrate that the genome traps duplicates through the accelerated regulatory and functional divergence of their gene copies providing a source of novel adaptations in yeast. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  13. Profiling of gene duplication patterns of sequenced teleost genomes: evidence for rapid lineage-specific genome expansion mediated by recent tandem duplications. (United States)

    Lu, Jianguo; Peatman, Eric; Tang, Haibao; Lewis, Joshua; Liu, Zhanjiang


    Gene duplication has had a major impact on genome evolution. Localized (or tandem) duplication resulting from unequal crossing over and whole genome duplication are believed to be the two dominant mechanisms contributing to vertebrate genome evolution. While much scrutiny has been directed toward discerning patterns indicative of whole-genome duplication events in teleost species, less attention has been paid to the continuous nature of gene duplications and their impact on the size, gene content, functional diversity, and overall architecture of teleost genomes. Here, using a Markov clustering algorithm directed approach we catalogue and analyze patterns of gene duplication in the four model teleost species with chromosomal coordinates: zebrafish, medaka, stickleback, and Tetraodon. Our analyses based on set size, duplication type, synonymous substitution rate (Ks), and gene ontology emphasize shared and lineage-specific patterns of genome evolution via gene duplication. Most strikingly, our analyses highlight the extraordinary duplication and retention rate of recent duplicates in zebrafish and their likely role in the structural and functional expansion of the zebrafish genome. We find that the zebrafish genome is remarkable in its large number of duplicated genes, small duplicate set size, biased Ks distribution toward minimal mutational divergence, and proportion of tandem and intra-chromosomal duplicates when compared with the other teleost model genomes. The observed gene duplication patterns have played significant roles in shaping the architecture of teleost genomes and appear to have contributed to the recent functional diversification and divergence of important physiological processes in zebrafish. We have analyzed gene duplication patterns and duplication types among the available teleost genomes and found that a large number of genes were tandemly and intrachromosomally duplicated, suggesting their origin of independent and continuous duplication

  14. Gene duplications in prokaryotes can be associated with environmental adaptation. (United States)

    Bratlie, Marit S; Johansen, Jostein; Sherman, Brad T; Huang, Da Wei; Lempicki, Richard A; Drabløs, Finn


    Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive advantage to the organism. Paralogs and singletons dominate

  15. Gene duplications in prokaryotes can be associated with environmental adaptation

    Directory of Open Access Journals (Sweden)

    Lempicki Richard A


    Full Text Available Abstract Background Gene duplication is a normal evolutionary process. If there is no selective advantage in keeping the duplicated gene, it is usually reduced to a pseudogene and disappears from the genome. However, some paralogs are retained. These gene products are likely to be beneficial to the organism, e.g. in adaptation to new environmental conditions. The aim of our analysis is to investigate the properties of paralog-forming genes in prokaryotes, and to analyse the role of these retained paralogs by relating gene properties to life style of the corresponding prokaryotes. Results Paralogs were identified in a number of prokaryotes, and these paralogs were compared to singletons of persistent orthologs based on functional classification. This showed that the paralogs were associated with for example energy production, cell motility, ion transport, and defence mechanisms. A statistical overrepresentation analysis of gene and protein annotations was based on paralogs of the 200 prokaryotes with the highest fraction of paralog-forming genes. Biclustering of overrepresented gene ontology terms versus species was used to identify clusters of properties associated with clusters of species. The clusters were classified using similarity scores on properties and species to identify interesting clusters, and a subset of clusters were analysed by comparison to literature data. This analysis showed that paralogs often are associated with properties that are important for survival and proliferation of the specific organisms. This includes processes like ion transport, locomotion, chemotaxis and photosynthesis. However, the analysis also showed that the gene ontology terms sometimes were too general, imprecise or even misleading for automatic analysis. Conclusions Properties described by gene ontology terms identified in the overrepresentation analysis are often consistent with individual prokaryote lifestyles and are likely to give a competitive

  16. On Computing Breakpoint Distances for Genomes with Duplicate Genes. (United States)

    Shao, Mingfu; Moret, Bernard M E


    A fundamental problem in comparative genomics is to compute the distance between two genomes in terms of its higher level organization (given by genes or syntenic blocks). For two genomes without duplicate genes, we can easily define (and almost always efficiently compute) a variety of distance measures, but the problem is NP-hard under most models when genomes contain duplicate genes. To tackle duplicate genes, three formulations (exemplar, maximum matching, and any matching) have been proposed, all of which aim to build a matching between homologous genes so as to minimize some distance measure. Of the many distance measures, the breakpoint distance (the number of nonconserved adjacencies) was the first one to be studied and remains of significant interest because of its simplicity and model-free property. The three breakpoint distance problems corresponding to the three formulations have been widely studied. Although we provided last year a solution for the exemplar problem that runs very fast on full genomes, computing optimal solutions for the other two problems has remained challenging. In this article, we describe very fast, exact algorithms for these two problems. Our algorithms rely on a compact integer-linear program that we further simplify by developing an algorithm to remove variables, based on new results on the structure of adjacencies and matchings. Through extensive experiments using both simulations and biological data sets, we show that our algorithms run very fast (in seconds) on mammalian genomes and scale well beyond. We also apply these algorithms (as well as the classic orthology tool MSOAR) to create orthology assignment, then compare their quality in terms of both accuracy and coverage. We find that our algorithm for the "any matching" formulation significantly outperforms other methods in terms of accuracy while achieving nearly maximum coverage.

  17. Evolutionary diversification of plant shikimate kinase gene duplicates.

    Directory of Open Access Journals (Sweden)

    Geoffrey Fucile


    Full Text Available Shikimate kinase (SK; EC catalyzes the fifth reaction of the shikimate pathway, which directs carbon from the central metabolism pool to a broad range of secondary metabolites involved in plant development, growth, and stress responses. In this study, we demonstrate the role of plant SK gene duplicate evolution in the diversification of metabolic regulation and the acquisition of novel and physiologically essential function. Phylogenetic analysis of plant SK homologs resolves an orthologous cluster of plant SKs and two functionally distinct orthologous clusters. These previously undescribed genes, shikimate kinase-like 1 (SKL1 and -2 (SKL2, do not encode SK activity, are present in all major plant lineages, and apparently evolved under positive selection following SK gene duplication over 400 MYA. This is supported by functional assays using recombinant SK, SKL1, and SKL2 from Arabidopsis thaliana (At and evolutionary analyses of the diversification of SK-catalytic and -substrate binding sites based on theoretical structure models. AtSKL1 mutants yield albino and novel variegated phenotypes, which indicate SKL1 is required for chloroplast biogenesis. Extant SKL2 sequences show a strong genetic signature of positive selection, which is enriched in a protein-protein interaction module not found in other SK homologs. We also report the first kinetic characterization of plant SKs and show that gene expression diversification among the AtSK inparalogs is correlated with developmental processes and stress responses. This study examines the functional diversification of ancient and recent plant SK gene duplicates and highlights the utility of SKs as scaffolds for functional innovation.

  18. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes. (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C; Fan, Chuanzhu


    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. © 2016 American Society of Plant Biologists. All rights reserved.

  19. Evolutionary Fates and Dynamic Functionalization of Young Duplicate Genes in Arabidopsis Genomes1[OPEN (United States)

    Wang, Jun; Tao, Feng; Marowsky, Nicholas C.; Fan, Chuanzhu


    Gene duplication is a primary means to generate genomic novelties, playing an essential role in speciation and adaptation. Particularly in plants, a high abundance of duplicate genes has been maintained for significantly long periods of evolutionary time. To address the manner in which young duplicate genes were derived primarily from small-scale gene duplication and preserved in plant genomes and to determine the underlying driving mechanisms, we generated transcriptomes to produce the expression profiles of five tissues in Arabidopsis thaliana and the closely related species Arabidopsis lyrata and Capsella rubella. Based on the quantitative analysis metrics, we investigated the evolutionary processes of young duplicate genes in Arabidopsis. We determined that conservation, neofunctionalization, and specialization are three main evolutionary processes for Arabidopsis young duplicate genes. We explicitly demonstrated the dynamic functionalization of duplicate genes along the evolutionary time scale. Upon origination, duplicates tend to maintain their ancestral functions; but as they survive longer, they might be likely to develop distinct and novel functions. The temporal evolutionary processes and functionalization of plant duplicate genes are associated with their ancestral functions, dynamic DNA methylation levels, and histone modification abundances. Furthermore, duplicate genes tend to be initially expressed in pollen and then to gain more interaction partners over time. Altogether, our study provides novel insights into the dynamic retention processes of young duplicate genes in plant genomes. PMID:27485883

  20. STRIDE: Species Tree Root Inference from Gene Duplication Events. (United States)

    Emms, David M; Kelly, Steven


    The correct interpretation of any phylogenetic tree is dependent on that tree being correctly rooted. We present STRIDE, a fast, effective, and outgroup-free method for identification of gene duplication events and species tree root inference in large-scale molecular phylogenetic analyses. STRIDE identifies sets of well-supported in-group gene duplication events from a set of unrooted gene trees, and analyses these events to infer a probability distribution over an unrooted species tree for the location of its root. We show that STRIDE correctly identifies the root of the species tree in multiple large-scale molecular phylogenetic data sets spanning a wide range of timescales and taxonomic groups. We demonstrate that the novel probability model implemented in STRIDE can accurately represent the ambiguity in species tree root assignment for data sets where information is limited. Furthermore, application of STRIDE to outgroup-free inference of the origin of the eukaryotic tree resulted in a root probability distribution that provides additional support for leading hypotheses for the origin of the eukaryotes. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  1. Neutral and Non-Neutral Evolution of Duplicated Genes with Gene Conversion

    Directory of Open Access Journals (Sweden)

    Jeffrey A. Fawcett


    Full Text Available Gene conversion is one of the major mutational mechanisms involved in the DNA sequence evolution of duplicated genes. It contributes to create unique patters of DNA polymorphism within species and divergence between species. A typical pattern is so-called concerted evolution, in which the divergence between duplicates is maintained low for a long time because of frequent exchanges of DNA fragments. In addition, gene conversion affects the DNA evolution of duplicates in various ways especially when selection operates. Here, we review theoretical models to understand the evolution of duplicates in both neutral and non-neutral cases. We also explain how these theories contribute to interpreting real polymorphism and divergence data by using some intriguing examples.

  2. Biased exonization of transposed elements in duplicated genes: A lesson from the TIF-IA gene

    Directory of Open Access Journals (Sweden)

    Shomron Noam


    Full Text Available Abstract Background Gene duplication and exonization of intronic transposed elements are two mechanisms that enhance genomic diversity. We examined whether there is less selection against exonization of transposed elements in duplicated genes than in single-copy genes. Results Genome-wide analysis of exonization of transposed elements revealed a higher rate of exonization within duplicated genes relative to single-copy genes. The gene for TIF-IA, an RNA polymerase I transcription initiation factor, underwent a humanoid-specific triplication, all three copies of the gene are active transcriptionally, although only one copy retains the ability to generate the TIF-IA protein. Prior to TIF-IA triplication, an Alu element was inserted into the first intron. In one of the non-protein coding copies, this Alu is exonized. We identified a single point mutation leading to exonization in one of the gene duplicates. When this mutation was introduced into the TIF-IA coding copy, exonization was activated and the level of the protein-coding mRNA was reduced substantially. A very low level of exonization was detected in normal human cells. However, this exonization was abundant in most leukemia cell lines evaluated, although the genomic sequence is unchanged in these cancerous cells compared to normal cells. Conclusion The definition of the Alu element within the TIF-IA gene as an exon is restricted to certain types of cancers; the element is not exonized in normal human cells. These results further our understanding of the delicate interplay between gene duplication and alternative splicing and of the molecular evolutionary mechanisms leading to genetic innovations. This implies the existence of purifying selection against exonization in single copy genes, with duplicate genes free from such constrains.

  3. Duplication and Diversification of the Hypoxia-Inducible IGFBP-1 Gene in Zebrafish

    DEFF Research Database (Denmark)

    Kamei, Hiroyasu; Lu, Ling; Jiao, Shuang


    Background: Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenabilit...

  4. Resolution and reconciliation of non-binary gene trees with transfers, duplications and losses. (United States)

    Jacox, Edwin; Weller, Mathias; Tannier, Eric; Scornavacca, Celine


    Gene trees reconstructed from sequence alignments contain poorly supported branches when the phylogenetic signal in the sequences is insufficient to determine them all. When a species tree is available, the signal of gains and losses of genes can be used to correctly resolve the unsupported parts of the gene history. However finding a most parsimonious binary resolution of a non-binary tree obtained by contracting the unsupported branches is NP-hard if transfer events are considered as possible gene scale events, in addition to gene origination, duplication and loss. We propose an exact, parameterized algorithm to solve this problem in single-exponential time, where the parameter is the number of connected branches of the gene tree that show low support from the sequence alignment or, equivalently, the maximum number of children of any node of the gene tree once the low-support branches have been collapsed. This improves on the best known algorithm by an exponential factor. We propose a way to choose among optimal solutions based on the available information. We show the usability of this principle on several simulated and biological datasets. The results are comparable in quality to several other tested methods having similar goals, but our approach provides a lower running time and a guarantee that the produced solution is optimal. Our algorithm has been integrated into the ecceTERA phylogeny package, available at and which can be run online at . Supplementary data are available at Bioinformatics online. © The Author 2017. Published by Oxford University Press. All rights reserved. For Permissions, please e-mail:

  5. Phylogenetic detection of numerous gene duplications shared by animals, fungi and plants


    Zhou, Xiaofan; Lin, Zhenguo; Ma, Hong


    Background Gene duplication is considered a major driving force for evolution of genetic novelty, thereby facilitating functional divergence and organismal diversity, including the process of speciation. Animals, fungi and plants are major eukaryotic kingdoms and the divergences between them are some of the most significant evolutionary events. Although gene duplications in each lineage have been studied extensively in various contexts, the extent of gene duplication prior to the split of pla...

  6. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes. (United States)

    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich


    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix-loop-helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks emerging through single-gene duplications, the dominant importance of molecular modularity in the bottom-up construction of complex biological entities, and the convergent evolution of networks.

  7. Are duplicated genes responsible for anthracnose resistance in common bean? (United States)

    Costa, Larissa Carvalho; Nalin, Rafael Storto; Ramalho, Magno Antonio Patto; de Souza, Elaine Aparecida


    The race 65 of Colletotrichum lindemuthianum, etiologic agent of anthracnose in common bean, is distributed worldwide, having great importance in breeding programs for anthracnose resistance. Several resistance alleles have been identified promoting resistance to this race. However, the variability that has been detected within race has made it difficult to obtain cultivars with durable resistance, because cultivars may have different reactions to each strain of race 65. Thus, this work aimed at studying the resistance inheritance of common bean lines to different strains of C. lindemuthianum, race 65. We used six C. lindemuthianum strains previously characterized as belonging to the race 65 through the international set of differential cultivars of anthracnose and nine commercial cultivars, adapted to the Brazilian growing conditions and with potential ability to discriminate the variability within this race. To obtain information on the resistance inheritance related to nine commercial cultivars to six strains of race 65, these cultivars were crossed two by two in all possible combinations, resulting in 36 hybrids. Segregation in the F2 generations revealed that the resistance to each strain is conditioned by two independent genes with the same function, suggesting that they are duplicated genes, where the dominant allele promotes resistance. These results indicate that the specificity between host resistance genes and pathogen avirulence genes is not limited to races, it also occurs within strains of the same race. Further research may be carried out in order to establish if the alleles identified in these cultivars are different from those described in the literature.

  8. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    International Nuclear Information System (INIS)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles


    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society

  9. Predictions of Gene Family Distributions in Microbial Genomes: Evolution by Gene Duplication and Modification

    Energy Technology Data Exchange (ETDEWEB)

    Yanai, Itai; Camacho, Carlos J.; DeLisi, Charles


    A universal property of microbial genomes is the considerable fraction of genes that are homologous to other genes within the same genome. The process by which these homologues are generated is not well understood, but sequence analysis of 20 microbial genomes unveils a recurrent distribution of gene family sizes. We show that a simple evolutionary model based on random gene duplication and point mutations fully accounts for these distributions and permits predictions for the number of gene families in genomes not yet complete. Our findings are consistent with the notion that a genome evolves from a set of precursor genes to a mature size by gene duplications and increasing modifications. (c) 2000 The American Physical Society.

  10. Recurrent Gene Duplication Leads to Diverse Repertoires of Centromeric Histones in Drosophila Species. (United States)

    Kursel, Lisa E; Malik, Harmit S


    Despite their essential role in the process of chromosome segregation in most eukaryotes, centromeric histones show remarkable evolutionary lability. Not only have they been lost in multiple insect lineages, but they have also undergone gene duplication in multiple plant lineages. Based on detailed study of a handful of model organisms including Drosophila melanogaster, centromeric histone duplication is considered to be rare in animals. Using a detailed phylogenomic study, we find that Cid, the centromeric histone gene, has undergone at least four independent gene duplications during Drosophila evolution. We find duplicate Cid genes in D. eugracilis (Cid2), in the montium species subgroup (Cid3, Cid4) and in the entire Drosophila subgenus (Cid5). We show that Cid3, Cid4, and Cid5 all localize to centromeres in their respective species. Some Cid duplicates are primarily expressed in the male germline. With rare exceptions, Cid duplicates have been strictly retained after birth, suggesting that they perform nonredundant centromeric functions, independent from the ancestral Cid. Indeed, each duplicate encodes a distinct N-terminal tail, which may provide the basis for distinct protein-protein interactions. Finally, we show some Cid duplicates evolve under positive selection whereas others do not. Taken together, our results support the hypothesis that Drosophila Cid duplicates have subfunctionalized. Thus, these gene duplications provide an unprecedented opportunity to dissect the multiple roles of centromeric histones. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  11. Comparative inference of duplicated genes produced by polyploidization in soybean genome. (United States)

    Yang, Yanmei; Wang, Jinpeng; Di, Jianyong


    Soybean (Glycine max) is one of the most important crop plants for providing protein and oil. It is important to investigate soybean genome for its economic and scientific value. Polyploidy is a widespread and recursive phenomenon during plant evolution, and it could generate massive duplicated genes which is an important resource for genetic innovation. Improved sequence alignment criteria and statistical analysis are used to identify and characterize duplicated genes produced by polyploidization in soybean. Based on the collinearity method, duplicated genes by whole genome duplication account for 70.3% in soybean. From the statistical analysis of the molecular distances between duplicated genes, our study indicates that the whole genome duplication event occurred more than once in the genome evolution of soybean, which is often distributed near the ends of chromosomes.

  12. Divergence of gene body DNA methylation and evolution of plant duplicate genes.

    Directory of Open Access Journals (Sweden)

    Jun Wang

    Full Text Available It has been shown that gene body DNA methylation is associated with gene expression. However, whether and how deviation of gene body DNA methylation between duplicate genes can influence their divergence remains largely unexplored. Here, we aim to elucidate the potential role of gene body DNA methylation in the fate of duplicate genes. We identified paralogous gene pairs from Arabidopsis and rice (Oryza sativa ssp. japonica genomes and reprocessed their single-base resolution methylome data. We show that methylation in paralogous genes nonlinearly correlates with several gene properties including exon number/gene length, expression level and mutation rate. Further, we demonstrated that divergence of methylation level and pattern in paralogs indeed positively correlate with their sequence and expression divergences. This result held even after controlling for other confounding factors known to influence the divergence of paralogs. We observed that methylation level divergence might be more relevant to the expression divergence of paralogs than methylation pattern divergence. Finally, we explored the mechanisms that might give rise to the divergence of gene body methylation in paralogs. We found that exonic methylation divergence more closely correlates with expression divergence than intronic methylation divergence. We show that genomic environments (e.g., flanked by transposable elements and repetitive sequences of paralogs generated by various duplication mechanisms are associated with the methylation divergence of paralogs. Overall, our results suggest that the changes in gene body DNA methylation could provide another avenue for duplicate genes to develop differential expression patterns and undergo different evolutionary fates in plant genomes.

  13. Evolution of vertebrate central nervous system is accompanied by novel expression changes of duplicate genes. (United States)

    Chen, Yuan; Ding, Yun; Zhang, Zuming; Wang, Wen; Chen, Jun-Yuan; Ueno, Naoto; Mao, Bingyu


    The evolution of the central nervous system (CNS) is one of the most striking changes during the transition from invertebrates to vertebrates. As a major source of genetic novelties, gene duplication might play an important role in the functional innovation of vertebrate CNS. In this study, we focused on a group of CNS-biased genes that duplicated during early vertebrate evolution. We investigated the tempo-spatial expression patterns of 33 duplicate gene families and their orthologs during the embryonic development of the vertebrate Xenopus laevis and the cephalochordate Brachiostoma belcheri. Almost all the identified duplicate genes are differentially expressed in the CNS in Xenopus embryos, and more than 50% and 30% duplicate genes are expressed in the telencephalon and mid-hindbrain boundary, respectively, which are mostly considered as two innovations in the vertebrate CNS. Interestingly, more than 50% of the amphioxus orthologs do not show apparent expression in the CNS in amphioxus embryos as detected by in situ hybridization, indicating that some of the vertebrate CNS-biased duplicate genes might arise from non-CNS genes in invertebrates. Our data accentuate the functional contribution of gene duplication in the CNS evolution of vertebrate and uncover an invertebrate non-CNS history for some vertebrate CNS-biased duplicate genes. Copyright © 2011. Published by Elsevier Ltd.

  14. Selective Constraints on Coding Sequences of Nervous System Genes Are a Major Determinant of Duplicate Gene Retention in Vertebrates. (United States)

    Roux, Julien; Liu, Jialin; Robinson-Rechavi, Marc


    The evolutionary history of vertebrates is marked by three ancient whole-genome duplications: two successive rounds in the ancestor of vertebrates, and a third one specific to teleost fishes. Biased loss of most duplicates enriched the genome for specific genes, such as slow evolving genes, but this selective retention process is not well understood. To understand what drives the long-term preservation of duplicate genes, we characterized duplicated genes in terms of their expression patterns. We used a new method of expression enrichment analysis, TopAnat, applied to in situ hybridization data from thousands of genes from zebrafish and mouse. We showed that the presence of expression in the nervous system is a good predictor of a higher rate of retention of duplicate genes after whole-genome duplication. Further analyses suggest that purifying selection against the toxic effects of misfolded or misinteracting proteins, which is particularly strong in nonrenewing neural tissues, likely constrains the evolution of coding sequences of nervous system genes, leading indirectly to the preservation of duplicate genes after whole-genome duplication. Whole-genome duplications thus greatly contributed to the expansion of the toolkit of genes available for the evolution of profound novelties of the nervous system at the base of the vertebrate radiation. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  15. Gene duplication and divergence affecting drug content in Cannabis sativa. (United States)

    Weiblen, George D; Wenger, Jonathan P; Craft, Kathleen J; ElSohly, Mahmoud A; Mehmedic, Zlatko; Treiber, Erin L; Marks, M David


    Cannabis sativa is an economically important source of durable fibers, nutritious seeds, and psychoactive drugs but few economic plants are so poorly understood genetically. Marijuana and hemp were crossed to evaluate competing models of cannabinoid inheritance and to explain the predominance of tetrahydrocannabinolic acid (THCA) in marijuana compared with cannabidiolic acid (CBDA) in hemp. Individuals in the resulting F2 population were assessed for differential expression of cannabinoid synthase genes and were used in linkage mapping. Genetic markers associated with divergent cannabinoid phenotypes were identified. Although phenotypic segregation and a major quantitative trait locus (QTL) for the THCA/CBDA ratio were consistent with a simple model of codominant alleles at a single locus, the diversity of THCA and CBDA synthase sequences observed in the mapping population, the position of enzyme coding loci on the map, and patterns of expression suggest multiple linked loci. Phylogenetic analysis further suggests a history of duplication and divergence affecting drug content. Marijuana is distinguished from hemp by a nonfunctional CBDA synthase that appears to have been positively selected to enhance psychoactivity. An unlinked QTL for cannabinoid quantity may also have played a role in the recent escalation of drug potency. © 2015 The Authors. New Phytologist © 2015 New Phytologist Trust.

  16. Gene duplication, modularity and adaptation in the evolution of the aflatoxin gene cluster

    Directory of Open Access Journals (Sweden)

    Jakobek Judy L


    Full Text Available Abstract Background The biosynthesis of aflatoxin (AF involves over 20 enzymatic reactions in a complex polyketide pathway that converts acetate and malonate to the intermediates sterigmatocystin (ST and O-methylsterigmatocystin (OMST, the respective penultimate and ultimate precursors of AF. Although these precursors are chemically and structurally very similar, their accumulation differs at the species level for Aspergilli. Notable examples are A. nidulans that synthesizes only ST, A. flavus that makes predominantly AF, and A. parasiticus that generally produces either AF or OMST. Whether these differences are important in the evolutionary/ecological processes of species adaptation and diversification is unknown. Equally unknown are the specific genomic mechanisms responsible for ordering and clustering of genes in the AF pathway of Aspergillus. Results To elucidate the mechanisms that have driven formation of these clusters, we performed systematic searches of aflatoxin cluster homologs across five Aspergillus genomes. We found a high level of gene duplication and identified seven modules consisting of highly correlated gene pairs (aflA/aflB, aflR/aflS, aflX/aflY, aflF/aflE, aflT/aflQ, aflC/aflW, and aflG/aflL. With the exception of A. nomius, contrasts of mean Ka/Ks values across all cluster genes showed significant differences in selective pressure between section Flavi and non-section Flavi species. A. nomius mean Ka/Ks values were more similar to partial clusters in A. fumigatus and A. terreus. Overall, mean Ka/Ks values were significantly higher for section Flavi than for non-section Flavi species. Conclusion Our results implicate several genomic mechanisms in the evolution of ST, OMST and AF cluster genes. Gene modules may arise from duplications of a single gene, whereby the function of the pre-duplication gene is retained in the copy (aflF/aflE or the copies may partition the ancestral function (aflA/aflB. In some gene modules, the

  17. Co-expression network analysis of duplicate genes in maize (Zea mays L.) reveals no subgenome bias. (United States)

    Li, Lin; Briskine, Roman; Schaefer, Robert; Schnable, Patrick S; Myers, Chad L; Flagel, Lex E; Springer, Nathan M; Muehlbauer, Gary J


    Gene duplication is prevalent in many species and can result in coding and regulatory divergence. Gene duplications can be classified as whole genome duplication (WGD), tandem and inserted (non-syntenic). In maize, WGD resulted in the subgenomes maize1 and maize2, of which maize1 is considered the dominant subgenome. However, the landscape of co-expression network divergence of duplicate genes in maize is still largely uncharacterized. To address the consequence of gene duplication on co-expression network divergence, we developed a gene co-expression network from RNA-seq data derived from 64 different tissues/stages of the maize reference inbred-B73. WGD, tandem and inserted gene duplications exhibited distinct regulatory divergence. Inserted duplicate genes were more likely to be singletons in the co-expression networks, while WGD duplicate genes were likely to be co-expressed with other genes. Tandem duplicate genes were enriched in the co-expression pattern where co-expressed genes were nearly identical for the duplicates in the network. Older gene duplications exhibit more extensive co-expression variation than younger duplications. Overall, non-syntenic genes primarily from inserted duplications show more co-expression divergence. Also, such enlarged co-expression divergence is significantly related to duplication age. Moreover, subgenome dominance was not observed in the co-expression networks - maize1 and maize2 exhibit similar levels of intra subgenome correlations. Intriguingly, the level of inter subgenome co-expression was similar to the level of intra subgenome correlations, and genes from specific subgenomes were not likely to be the enriched in co-expression network modules and the hub genes were not predominantly from any specific subgenomes in maize. Our work provides a comprehensive analysis of maize co-expression network divergence for three different types of gene duplications and identifies potential relationships between duplication types

  18. Circular DNA Intermediate in the Duplication of Nile Tilapia vasa Genes (United States)

    Fujimura, Koji; Conte, Matthew A.; Kocher, Thomas D.


    vasa is a highly conserved RNA helicase involved in animal germ cell development. Among vertebrate species, it is typically present as a single copy per genome. Here we report the isolation and sequencing of BAC clones for Nile tilapia vasa genes. Contrary to a previous report that Nile tilapia have a single copy of the vasa gene, we find evidence for at least three vasa gene loci. The vasa gene locus was duplicated from the original site and integrated into two distant novel sites. For one of these insertions we find evidence that the duplication was mediated by a circular DNA intermediate. This mechanism of gene duplication may explain the origin of isolated gene duplicates during the evolution of fish genomes. These data provide a foundation for studying the role of multiple vasa genes in the development of tilapia gonads, and will contribute to investigations of the molecular mechanisms of sex determination and evolution in cichlid fishes. PMID:22216289

  19. Convergent evolution of gene networks by single-gene duplications in higher eukaryotes


    Amoutzias, Gregory D; Robertson, David L; Oliver, Stephen G; Bornberg-Bauer, Erich


    By combining phylogenetic, proteomic and structural information, we have elucidated the evolutionary driving forces for the gene-regulatory interaction networks of basic helix–loop–helix transcription factors. We infer that recurrent events of single-gene duplication and domain rearrangement repeatedly gave rise to distinct networks with almost identical hub-based topologies, and multiple activators and repressors. We thus provide the first empirical evidence for scale-free protein networks e...

  20. Prevalent Role of Gene Features in Determining Evolutionary Fates of Whole-Genome Duplication Duplicated Genes in Flowering Plants1[W][OA (United States)

    Jiang, Wen-kai; Liu, Yun-long; Xia, En-hua; Gao, Li-zhi


    The evolution of genes and genomes after polyploidization has been the subject of extensive studies in evolutionary biology and plant sciences. While a significant number of duplicated genes are rapidly removed during a process called fractionation, which operates after the whole-genome duplication (WGD), another considerable number of genes are retained preferentially, leading to the phenomenon of biased gene retention. However, the evolutionary mechanisms underlying gene retention after WGD remain largely unknown. Through genome-wide analyses of sequence and functional data, we comprehensively investigated the relationships between gene features and the retention probability of duplicated genes after WGDs in six plant genomes, Arabidopsis (Arabidopsis thaliana), poplar (Populus trichocarpa), soybean (Glycine max), rice (Oryza sativa), sorghum (Sorghum bicolor), and maize (Zea mays). The results showed that multiple gene features were correlated with the probability of gene retention. Using a logistic regression model based on principal component analysis, we resolved evolutionary rate, structural complexity, and GC3 content as the three major contributors to gene retention. Cluster analysis of these features further classified retained genes into three distinct groups in terms of gene features and evolutionary behaviors. Type I genes are more prone to be selected by dosage balance; type II genes are possibly subject to subfunctionalization; and type III genes may serve as potential targets for neofunctionalization. This study highlights that gene features are able to act jointly as primary forces when determining the retention and evolution of WGD-derived duplicated genes in flowering plants. These findings thus may help to provide a resolution to the debate on different evolutionary models of gene fates after WGDs. PMID:23396833

  1. Do orthologous gene phylogenies really support tree-thinking?

    Directory of Open Access Journals (Sweden)

    Leigh J


    Full Text Available Abstract Background Since Darwin's Origin of Species, reconstructing the Tree of Life has been a goal of evolutionists, and tree-thinking has become a major concept of evolutionary biology. Practically, building the Tree of Life has proven to be tedious. Too few morphological characters are useful for conducting conclusive phylogenetic analyses at the highest taxonomic level. Consequently, molecular sequences (genes, proteins, and genomes likely constitute the only useful characters for constructing a phylogeny of all life. For this reason, tree-makers expect a lot from gene comparisons. The simultaneous study of the largest number of molecular markers possible is sometimes considered to be one of the best solutions in reconstructing the genealogy of organisms. This conclusion is a direct consequence of tree-thinking: if gene inheritance conforms to a tree-like model of evolution, sampling more of these molecules will provide enough phylogenetic signal to build the Tree of Life. The selection of congruent markers is thus a fundamental step in simultaneous analysis of many genes. Results Heat map analyses were used to investigate the congruence of orthologues in four datasets (archaeal, bacterial, eukaryotic and alpha-proteobacterial. We conclude that we simply cannot determine if a large portion of the genes have a common history. In addition, none of these datasets can be considered free of lateral gene transfer. Conclusion Our phylogenetic analyses do not support tree-thinking. These results have important conceptual and practical implications. We argue that representations other than a tree should be investigated in this case because a non-critical concatenation of markers could be highly misleading.

  2. Evolution of Cis-Regulatory Elements and Regulatory Networks in Duplicated Genes of Arabidopsis. (United States)

    Arsovski, Andrej A; Pradinuk, Julian; Guo, Xu Qiu; Wang, Sishuo; Adams, Keith L


    Plant genomes contain large numbers of duplicated genes that contribute to the evolution of new functions. Following duplication, genes can exhibit divergence in their coding sequence and their expression patterns. Changes in the cis-regulatory element landscape can result in changes in gene expression patterns. High-throughput methods developed recently can identify potential cis-regulatory elements on a genome-wide scale. Here, we use a recent comprehensive data set of DNase I sequencing-identified cis-regulatory binding sites (footprints) at single-base-pair resolution to compare binding sites and network connectivity in duplicated gene pairs in Arabidopsis (Arabidopsis thaliana). We found that duplicated gene pairs vary greatly in their cis-regulatory element architecture, resulting in changes in regulatory network connectivity. Whole-genome duplicates (WGDs) have approximately twice as many footprints in their promoters left by potential regulatory proteins than do tandem duplicates (TDs). The WGDs have a greater average number of footprint differences between paralogs than TDs. The footprints, in turn, result in more regulatory network connections between WGDs and other genes, forming denser, more complex regulatory networks than shown by TDs. When comparing regulatory connections between duplicates, WGDs had more pairs in which the two genes are either partially or fully diverged in their network connections, but fewer genes with no network connections than the TDs. There is evidence of younger TDs and WGDs having fewer unique connections compared with older duplicates. This study provides insights into cis-regulatory element evolution and network divergence in duplicated genes. © 2015 American Society of Plant Biologists. All Rights Reserved.

  3. Spider Transcriptomes Identify Ancient Large-Scale Gene Duplication Event Potentially Important in Silk Gland Evolution. (United States)

    Clarke, Thomas H; Garb, Jessica E; Hayashi, Cheryl Y; Arensburger, Peter; Ayoub, Nadia A


    The evolution of specialized tissues with novel functions, such as the silk synthesizing glands in spiders, is likely an influential driver of adaptive success. Large-scale gene duplication events and subsequent paralog divergence are thought to be required for generating evolutionary novelty. Such an event has been proposed for spiders, but not tested. We de novo assembled transcriptomes from three cobweb weaving spider species. Based on phylogenetic analyses of gene families with representatives from each of the three species, we found numerous duplication events indicative of a whole genome or segmental duplication. We estimated the age of the gene duplications relative to several speciation events within spiders and arachnids and found that the duplications likely occurred after the divergence of scorpions (order Scorpionida) and spiders (order Araneae), but before the divergence of the spider suborders Mygalomorphae and Araneomorphae, near the evolutionary origin of spider silk glands. Transcripts that are expressed exclusively or primarily within black widow silk glands are more likely to have a paralog descended from the ancient duplication event and have elevated amino acid replacement rates compared with other transcripts. Thus, an ancient large-scale gene duplication event within the spider lineage was likely an important source of molecular novelty during the evolution of silk gland-specific expression. This duplication event may have provided genetic material for subsequent silk gland diversification in the true spiders (Araneomorphae). © The Author(s) 2015. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  4. The natural history of class I primate alcohol dehydrogenases includes gene duplication, gene loss, and gene conversion.

    Directory of Open Access Journals (Sweden)

    Matthew A Carrigan

    Full Text Available Gene duplication is a source of molecular innovation throughout evolution. However, even with massive amounts of genome sequence data, correlating gene duplication with speciation and other events in natural history can be difficult. This is especially true in its most interesting cases, where rapid and multiple duplications are likely to reflect adaptation to rapidly changing environments and life styles. This may be so for Class I of alcohol dehydrogenases (ADH1s, where multiple duplications occurred in primate lineages in Old and New World monkeys (OWMs and NWMs and hominoids.To build a preferred model for the natural history of ADH1s, we determined the sequences of nine new ADH1 genes, finding for the first time multiple paralogs in various prosimians (lemurs, strepsirhines. Database mining then identified novel ADH1 paralogs in both macaque (an OWM and marmoset (a NWM. These were used with the previously identified human paralogs to resolve controversies relating to dates of duplication and gene conversion in the ADH1 family. Central to these controversies are differences in the topologies of trees generated from exonic (coding sequences and intronic sequences.We provide evidence that gene conversions are the primary source of difference, using molecular clock dating of duplications and analyses of microinsertions and deletions (micro-indels. The tree topology inferred from intron sequences appear to more correctly represent the natural history of ADH1s, with the ADH1 paralogs in platyrrhines (NWMs and catarrhines (OWMs and hominoids having arisen by duplications shortly predating the divergence of OWMs and NWMs. We also conclude that paralogs in lemurs arose independently. Finally, we identify errors in database interpretation as the source of controversies concerning gene conversion. These analyses provide a model for the natural history of ADH1s that posits four ADH1 paralogs in the ancestor of Catarrhine and Platyrrhine primates

  5. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts. (United States)

    Martínez-Alberola, Fernando; Del Campo, Eva M; Lázaro-Gimeno, David; Mezquita-Claramonte, Sergio; Molins, Arantxa; Mateu-Andrés, Isabel; Pedrola-Monfort, Joan; Casano, Leonardo M; Barreno, Eva


    Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt) in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  6. Balanced gene losses, duplications and intensive rearrangements led to an unusual regularly sized genome in Arbutus unedo chloroplasts.

    Directory of Open Access Journals (Sweden)

    Fernando Martínez-Alberola

    Full Text Available Completely sequenced plastomes provide a valuable source of information about the duplication, loss, and transfer events of chloroplast genes and phylogenetic data for resolving relationships among major groups of plants. Moreover, they can also be useful for exploiting chloroplast genetic engineering technology. Ericales account for approximately six per cent of eudicot diversity with 11,545 species from which only three complete plastome sequences are currently available. With the aim of increasing the number of ericalean complete plastome sequences, and to open new perspectives in understanding Mediterranean plant adaptations, a genomic study on the basis of the complete chloroplast genome sequencing of Arbutus unedo and an updated phylogenomic analysis of Asteridae was implemented. The chloroplast genome of A. unedo shows extensive rearrangements but a medium size (150,897 nt in comparison to most of angiosperms. A number of remarkable distinct features characterize the plastome of A. unedo: five-fold dismissing of the SSC region in relation to most angiosperms; complete loss or pseudogenization of a number of essential genes; duplication of the ndhH-D operon and its location within the two IRs; presence of large tandem repeats located near highly re-arranged regions and pseudogenes. All these features outline the primary evolutionary split between Ericaceae and other ericalean families. The newly sequenced plastome of A. unedo with the available asterid sequences allowed the resolution of some uncertainties in previous phylogenies of Asteridae.

  7. The prevalence of gene duplications and their ancient origin in Rhodobacter sphaeroides 2.4.1

    Directory of Open Access Journals (Sweden)

    Cho Hyuk


    Full Text Available Abstract Background Rhodobacter sphaeroides 2.4.1 is a metabolically versatile organism that belongs to α-3 subdivision of Proteobacteria. The present study was to identify the extent, history, and role of gene duplications in R. sphaeroides 2.4.1, an organism that possesses two chromosomes. Results A protein similarity search (BLASTP identified 1247 orfs (~29.4% of the total protein coding orfs that are present in 2 or more copies, 37.5% (234 gene-pairs of which exist in duplicate copies. The distribution of the duplicate gene-pairs in all Clusters of Orthologous Groups (COGs differed significantly when compared to the COG distribution across the whole genome. Location plots revealed clusters of gene duplications that possessed the same COG classification. Phylogenetic analyses were performed to determine a tree topology predicting either a Type-A or Type-B phylogenetic relationship. A Type-A phylogenetic relationship shows that a copy of the protein-pair matches more with an ortholog from a species closely related to R. sphaeroides while a Type-B relationship predicts the highest match between both copies of the R. sphaeroides protein-pair. The results revealed that ~77% of the proteins exhibited a Type-A phylogenetic relationship demonstrating the ancient origin of these gene duplications. Additional analyses on three other strains of R. sphaeroides revealed varying levels of gene loss and retention in these strains. Also, analyses on common gene pairs among the four strains revealed that these genes experience similar functional constraints and undergo purifying selection. Conclusions Although the results suggest that the level of gene duplication in organisms with complex genome structuring (more than one chromosome seems to be not markedly different from that in organisms with only a single chromosome, these duplications may have aided in genome reorganization in this group of eubacteria prior to the formation of R. sphaeroides as gene

  8. Whole-gene positive selection, elevated synonymous substitution rates, duplication, and indel evolution of the chloroplast clpP1 gene.

    Directory of Open Access Journals (Sweden)

    Per Erixon

    Full Text Available BACKGROUND: Synonymous DNA substitution rates in the plant chloroplast genome are generally relatively slow and lineage dependent. Non-synonymous rates are usually even slower due to purifying selection acting on the genes. Positive selection is expected to speed up non-synonymous substitution rates, whereas synonymous rates are expected to be unaffected. Until recently, positive selection has seldom been observed in chloroplast genes, and large-scale structural rearrangements leading to gene duplications are hitherto supposed to be rare. METHODOLOGY/PRINCIPLE FINDINGS: We found high substitution rates in the exons of the plastid clpP1 gene in Oenothera (the Evening Primrose family and three separate lineages in the tribe Sileneae (Caryophyllaceae, the Carnation family. Introns have been lost in some of the lineages, but where present, the intron sequences have substitution rates similar to those found in other introns of their genomes. The elevated substitution rates of clpP1 are associated with statistically significant whole-gene positive selection in three branches of the phylogeny. In two of the lineages we found multiple copies of the gene. Neighboring genes present in the duplicated fragments do not show signs of elevated substitution rates or positive selection. Although non-synonymous substitutions account for most of the increase in substitution rates, synonymous rates are also markedly elevated in some lineages. Whereas plant clpP1 genes experiencing negative (purifying selection are characterized by having very conserved lengths, genes under positive selection often have large insertions of more or less repetitive amino acid sequence motifs. CONCLUSIONS/SIGNIFICANCE: We found positive selection of the clpP1 gene in various plant lineages to correlated with repeated duplication of the clpP1 gene and surrounding regions, repetitive amino acid sequences, and increase in synonymous substitution rates. The present study sheds light on the

  9. Diversification, phylogeny and evolution of auxin response factor (ARF) family: insights gained from analyzing maize ARF genes. (United States)

    Wang, Yijun; Deng, Dexiang; Shi, Yating; Miao, Nan; Bian, Yunlong; Yin, Zhitong


    Auxin response factors (ARFs), member of the plant-specific B3 DNA binding superfamily, target specifically to auxin response elements (AuxREs) in promoters of primary auxin-responsive genes and heterodimerize with Aux/IAA proteins in auxin signaling transduction cascade. In previous research, we have isolated and characterized maize Aux/IAA genes in whole-genome scale. Here, we report the comprehensive analysis of ARF genes in maize. A total of 36 ARF genes were identified and validated from the B73 maize genome through an iterative strategy. Thirty-six maize ARF genes are distributed in all maize chromosomes except chromosome 7. Maize ARF genes expansion is mainly due to recent segmental duplications. Maize ARF proteins share one B3 DNA binding domain which consists of seven-stranded β sheets and two short α helixes. Twelve maize ARFs with glutamine-rich middle regions could be as activators in modulating expression of auxin-responsive genes. Eleven maize ARF proteins are lack of homo- and heterodimerization domains. Putative cis-elements involved in phytohormones and light signaling responses, biotic and abiotic stress adaption locate in promoters of maize ARF genes. Expression patterns vary greatly between clades and sister pairs of maize ARF genes. The B3 DNA binding and auxin response factor domains of maize ARF proteins are primarily subjected to negative selection during selective sweep. The mixed selective forces drive the diversification and evolution of genomic regions outside of B3 and ARF domains. Additionally, the dicot-specific proliferation of ARF genes was detected. Comparative genomics analysis indicated that maize, sorghum and rice duplicate chromosomal blocks containing ARF homologs are highly syntenic. This study provides insights into the distribution, phylogeny and evolution of ARF gene family.

  10. Divergence of recently duplicated M{gamma}-type MADS-box genes in Petunia. (United States)

    Bemer, Marian; Gordon, Jonathan; Weterings, Koen; Angenent, Gerco C


    The MADS-box transcription factor family has expanded considerably in plants via gene and genome duplications and can be subdivided into type I and MIKC-type genes. The two gene classes show a different evolutionary history. Whereas the MIKC-type genes originated during ancient genome duplications, as well as during more recent events, the type I loci appear to experience high turnover with many recent duplications. This different mode of origin also suggests a different fate for the type I duplicates, which are thought to have a higher chance to become silenced or lost from the genome. To get more insight into the evolution of the type I MADS-box genes, we isolated nine type I genes from Petunia, which belong to the Mgamma subclass, and investigated the divergence of their coding and regulatory regions. The isolated genes could be subdivided into two categories: two genes were highly similar to Arabidopsis Mgamma-type genes, whereas the other seven genes showed less similarity to Arabidopsis genes and originated more recently. Two of the recently duplicated genes were found to contain deleterious mutations in their coding regions, and expression analysis revealed that a third paralog was silenced by mutations in its regulatory region. However, in addition to the three genes that were subjected to nonfunctionalization, we also found evidence for neofunctionalization of one of the Petunia Mgamma-type genes. Our study shows a rapid divergence of recently duplicated Mgamma-type MADS-box genes and suggests that redundancy among type I paralogs may be less common than expected.

  11. Restriction and Recruitment—Gene Duplication and the Origin and Evolution of Snake Venom Toxins (United States)

    Hargreaves, Adam D.; Swain, Martin T.; Hegarty, Matthew J.; Logan, Darren W.; Mulley, John F.


    Snake venom has been hypothesized to have originated and diversified through a process that involves duplication of genes encoding body proteins with subsequent recruitment of the copy to the venom gland, where natural selection acts to develop or increase toxicity. However, gene duplication is known to be a rare event in vertebrate genomes, and the recruitment of duplicated genes to a novel expression domain (neofunctionalization) is an even rarer process that requires the evolution of novel combinations of transcription factor binding sites in upstream regulatory regions. Therefore, although this hypothesis concerning the evolution of snake venom is very unlikely and should be regarded with caution, it is nonetheless often assumed to be established fact, hindering research into the true origins of snake venom toxins. To critically evaluate this hypothesis, we have generated transcriptomic data for body tissues and salivary and venom glands from five species of venomous and nonvenomous reptiles. Our comparative transcriptomic analysis of these data reveals that snake venom does not evolve through the hypothesized process of duplication and recruitment of genes encoding body proteins. Indeed, our results show that many proposed venom toxins are in fact expressed in a wide variety of body tissues, including the salivary gland of nonvenomous reptiles and that these genes have therefore been restricted to the venom gland following duplication, not recruited. Thus, snake venom evolves through the duplication and subfunctionalization of genes encoding existing salivary proteins. These results highlight the danger of the elegant and intuitive “just-so story” in evolutionary biology. PMID:25079342

  12. Processes of fungal proteome evolution and gain of function: gene duplication and domain rearrangement

    International Nuclear Information System (INIS)

    Cohen-Gihon, Inbar; Nussinov, Ruth; Sharan, Roded


    During evolution, organisms have gained functional complexity mainly by modifying and improving existing functioning systems rather than creating new ones ab initio. Here we explore the interplay between two processes which during evolution have had major roles in the acquisition of new functions: gene duplication and protein domain rearrangements. We consider four possible evolutionary scenarios: gene families that have undergone none of these event types; only gene duplication; only domain rearrangement, or both events. We characterize each of the four evolutionary scenarios by functional attributes. Our analysis of ten fungal genomes indicates that at least for the fungi clade, species significantly appear to gain complexity by gene duplication accompanied by the expansion of existing domain architectures via rearrangements. We show that paralogs gaining new domain architectures via duplication tend to adopt new functions compared to paralogs that preserve their domain architectures. We conclude that evolution of protein families through gene duplication and domain rearrangement is correlated with their functional properties. We suggest that in general, new functions are acquired via the integration of gene duplication and domain rearrangements rather than each process acting independently

  13. The enrichment of TATA box and the scarcity of depleted proximal nucleosome in the promoters of duplicated yeast genes. (United States)

    Kim, Yuseob; Lee, Jang H; Babbitt, Gregory A


    Population genetic theory of gene duplication suggests that the preservation of duplicate copies requires functional divergence upon duplication. Genes that can be readily modified to produce new gene expression patterns may thus be duplicated often. In yeast, genes exhibit dichotomous expression patterns based on their promoter architectures. The expression of genes that contain TATA box or occupied proximal nucleosome (OPN) tends to be variable and respond to external signals. On the other hand, genes without TATA box or with depleted proximal nucleosome (DPN) are expressed constitutively. We find that recent duplicates in the yeast genome are heavily biased to be TATA box containing genes and not to be DPN genes. This suggests that variably expressed genes, due to the functional organization in their promoters, have higher duplicability than constitutively expressed genes.

  14. Local synteny and codon usage contribute to asymmetric sequence divergence of Saccharomyces cerevisiae gene duplicates

    Directory of Open Access Journals (Sweden)

    Bergthorsson Ulfar


    Full Text Available Abstract Background Duplicated genes frequently experience asymmetric rates of sequence evolution. Relaxed selective constraints and positive selection have both been invoked to explain the observation that one paralog within a gene-duplicate pair exhibits an accelerated rate of sequence evolution. In the majority of studies where asymmetric divergence has been established, there is no indication as to which gene copy, ancestral or derived, is evolving more rapidly. In this study we investigated the effect of local synteny (gene-neighborhood conservation and codon usage on the sequence evolution of gene duplicates in the S. cerevisiae genome. We further distinguish the gene duplicates into those that originated from a whole-genome duplication (WGD event (ohnologs versus small-scale duplications (SSD to determine if there exist any differences in their patterns of sequence evolution. Results For SSD pairs, the derived copy evolves faster than the ancestral copy. However, there is no relationship between rate asymmetry and synteny conservation (ancestral-like versus derived-like in ohnologs. mRNA abundance and optimal codon usage as measured by the CAI is lower in the derived SSD copies relative to ancestral paralogs. Moreover, in the case of ohnologs, the faster-evolving copy has lower CAI and lowered expression. Conclusions Together, these results suggest that relaxation of selection for codon usage and gene expression contribute to rate asymmetry in the evolution of duplicated genes and that in SSD pairs, the relaxation of selection stems from the loss of ancestral regulatory information in the derived copy.

  15. Evolution dynamics of a model for gene duplication under adaptive conflict (United States)

    Ancliff, Mark; Park, Jeong-Man


    We present and solve the dynamics of a model for gene duplication showing escape from adaptive conflict. We use a Crow-Kimura quasispecies model of evolution where the fitness landscape is a function of Hamming distances from two reference sequences, which are assumed to optimize two different gene functions, to describe the dynamics of a mixed population of individuals with single and double copies of a pleiotropic gene. The evolution equations are solved through a spin coherent state path integral, and we find two phases: one is an escape from an adaptive conflict phase, where each copy of a duplicated gene evolves toward subfunctionalization, and the other is a duplication loss of function phase, where one copy maintains its pleiotropic form and the other copy undergoes neutral mutation. The phase is determined by a competition between the fitness benefits of subfunctionalization and the greater mutational load associated with maintaining two gene copies. In the escape phase, we find a dynamics of an initial population of single gene sequences only which escape adaptive conflict through gene duplication and find that there are two time regimes: until a time t* single gene sequences dominate, and after t* double gene sequences outgrow single gene sequences. The time t* is identified as the time necessary for subfunctionalization to evolve and spread throughout the double gene sequences, and we show that there is an optimum mutation rate which minimizes this time scale.

  16. Partial duplication of the APBA2 gene in chromosome 15q13 corresponds to duplicon structures

    Directory of Open Access Journals (Sweden)

    Kesterson Robert A


    Full Text Available Abstract Background Chromosomal abnormalities affecting human chromosome 15q11-q13 underlie multiple genomic disorders caused by deletion, duplication and triplication of intervals in this region. These events are mediated by highly homologous segments of DNA, or duplicons, that facilitate mispairing and unequal cross-over in meiosis. The gene encoding an amyloid precursor protein-binding protein (APBA2 was previously mapped to the distal portion of the interval commonly deleted in Prader-Willi and Angelman syndromes and duplicated in cases of autism. Results We show that this gene actually maps to a more telomeric location and is partially duplicated within the broader region. Two highly homologous copies of an interval containing a large 5' exon and downstream sequence are located ~5 Mb distal to the intact locus. The duplicated copies, containing the first coding exon of APBA2, can be distinguished by single nucleotide sequence differences and are transcriptionally inactive. Adjacent to APBA2 maps a gene termed KIAA0574. The protein encoded by this gene is weakly homologous to a protein termed X123 that in turn maps adjacent to APBA1 on 9q21.12; APBA1 is highly homologous to APBA2 in the C-terminal region and is distinguished from APBA2 by the N-terminal region encoded by this duplicated exon. Conclusion The duplication of APBA2 sequences in this region adds to a complex picture of different low copy repeats present across this region and elsewhere on the chromosome.

  17. Differential transcriptional modulation of duplicated fatty acid-binding protein genes by dietary fatty acids in zebrafish (Danio rerio: evidence for subfunctionalization or neofunctionalization of duplicated genes

    Directory of Open Access Journals (Sweden)

    Denovan-Wright Eileen M


    Full Text Available Abstract Background In the Duplication-Degeneration-Complementation (DDC model, subfunctionalization and neofunctionalization have been proposed as important processes driving the retention of duplicated genes in the genome. These processes are thought to occur by gain or loss of regulatory elements in the promoters of duplicated genes. We tested the DDC model by determining the transcriptional induction of fatty acid-binding proteins (Fabps genes by dietary fatty acids (FAs in zebrafish. We chose zebrafish for this study for two reasons: extensive bioinformatics resources are available for zebrafish at and zebrafish contains many duplicated genes owing to a whole genome duplication event that occurred early in the ray-finned fish lineage approximately 230-400 million years ago. Adult zebrafish were fed diets containing either fish oil (12% lipid, rich in highly unsaturated fatty acid, sunflower oil (12% lipid, rich in linoleic acid, linseed oil (12% lipid, rich in linolenic acid, or low fat (4% lipid, low fat diet for 10 weeks. FA profiles and the steady-state levels of fabp mRNA and heterogeneous nuclear RNA in intestine, liver, muscle and brain of zebrafish were determined. Result FA profiles assayed by gas chromatography differed in the intestine, brain, muscle and liver depending on diet. The steady-state level of mRNA for three sets of duplicated genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, and fabp11a/fabp11b, was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. In brain, the steady-state level of fabp7b mRNAs was induced in fish fed the linoleic acid-rich diet; in intestine, the transcript level of fabp1b.1 and fabp7b were elevated in fish fed the linolenic acid-rich diet; in liver, the level of fabp7a mRNAs was elevated in fish fed the low fat diet; and in muscle, the level of fabp7a and fabp11a mRNAs were elevated in fish fed the linolenic acid-rich or the low fat diets. In all cases

  18. Independent Origin and Global Distribution of Distinct Plasmodium vivax Duffy Binding Protein Gene Duplications.

    Directory of Open Access Journals (Sweden)

    Jessica B Hostetler


    Full Text Available Plasmodium vivax causes the majority of malaria episodes outside Africa, but remains a relatively understudied pathogen. The pathology of P. vivax infection depends critically on the parasite's ability to recognize and invade human erythrocytes. This invasion process involves an interaction between P. vivax Duffy Binding Protein (PvDBP in merozoites and the Duffy antigen receptor for chemokines (DARC on the erythrocyte surface. Whole-genome sequencing of clinical isolates recently established that some P. vivax genomes contain two copies of the PvDBP gene. The frequency of this duplication is particularly high in Madagascar, where there is also evidence for P. vivax infection in DARC-negative individuals. The functional significance and global prevalence of this duplication, and whether there are other copy number variations at the PvDBP locus, is unknown.Using whole-genome sequencing and PCR to study the PvDBP locus in P. vivax clinical isolates, we found that PvDBP duplication is widespread in Cambodia. The boundaries of the Cambodian PvDBP duplication differ from those previously identified in Madagascar, meaning that current molecular assays were unable to detect it. The Cambodian PvDBP duplication did not associate with parasite density or DARC genotype, and ranged in prevalence from 20% to 38% over four annual transmission seasons in Cambodia. This duplication was also present in P. vivax isolates from Brazil and Ethiopia, but not India.PvDBP duplications are much more widespread and complex than previously thought, and at least two distinct duplications are circulating globally. The same duplication boundaries were identified in parasites from three continents, and were found at high prevalence in human populations where DARC-negativity is essentially absent. It is therefore unlikely that PvDBP duplication is associated with infection of DARC-negative individuals, but functional tests will be required to confirm this hypothesis.

  19. Rapid sequence divergence rates in the 5 prime regulatory regions of young Drosophila melanogaster duplicate gene pairs

    Directory of Open Access Journals (Sweden)

    Michael H. Kohn


    Full Text Available While it remains a matter of some debate, rapid sequence evolution of the coding sequences of duplicate genes is characteristic for early phases past duplication, but long established duplicates generally evolve under constraint, much like the rest of the coding genome. As for coding sequences, it may be possible to infer evolutionary rate, selection, and constraint via contrasts between duplicate gene divergence in the 5 prime regions and in the corresponding synonymous site divergence in the coding regions. Finding elevated rates for the 5 prime regions of duplicated genes, in addition to the coding regions, would enable statements regarding the early processes of duplicate gene evolution. Here, 1 kb of each of the 5 prime regulatory regions of Drosophila melanogaster duplicate gene pairs were mapped onto one another to isolate shared sequence blocks. Genetic distances within shared sequence blocks (d5’ were found to increase as a function of synonymous (dS, and to a lesser extend, amino-acid (dA site divergence between duplicates. The rate d5’/dS was found to rapidly decay from values > 1 in young duplicate pairs (dS 0.8. Such rapid rates of 5 prime evolution exceeding 1 (~neutral predominantly were found to occur in duplicate pairs with low amino-acid site divergence and that tended to be co-regulated when assayed on microarrays. Conceivably, functional redundancy and relaxation of selective constraint facilitates subsequent positive selection on the 5 prime regions of young duplicate genes. This might promote the evolution of new functions (neofunctionalization or division of labor among duplicate genes (subfunctionalization. In contrast, similar to the vast portion of the non-coding genome, the 5 prime regions of long-established gene duplicates appear to evolve under selective constraint, indicating that these long-established gene duplicates have assumed critical functions.

  20. Whole genome duplications and expansion of the vertebrate GATA transcription factor gene family

    Directory of Open Access Journals (Sweden)

    Bowerman Bruce


    Full Text Available Abstract Background GATA transcription factors influence many developmental processes, including the specification of embryonic germ layers. The GATA gene family has significantly expanded in many animal lineages: whereas diverse cnidarians have only one GATA transcription factor, six GATA genes have been identified in many vertebrates, five in many insects, and eleven to thirteen in Caenorhabditis nematodes. All bilaterian animal genomes have at least one member each of two classes, GATA123 and GATA456. Results We have identified one GATA123 gene and one GATA456 gene from the genomic sequence of two invertebrate deuterostomes, a cephalochordate (Branchiostoma floridae and a hemichordate (Saccoglossus kowalevskii. We also have confirmed the presence of six GATA genes in all vertebrate genomes, as well as additional GATA genes in teleost fish. Analyses of conserved sequence motifs and of changes to the exon-intron structure, and molecular phylogenetic analyses of these deuterostome GATA genes support their origin from two ancestral deuterostome genes, one GATA 123 and one GATA456. Comparison of the conserved genomic organization across vertebrates identified eighteen paralogous gene families linked to multiple vertebrate GATA genes (GATA paralogons, providing the strongest evidence yet for expansion of vertebrate GATA gene families via genome duplication events. Conclusion From our analysis, we infer the evolutionary birth order and relationships among vertebrate GATA transcription factors, and define their expansion via multiple rounds of whole genome duplication events. As the genomes of four independent invertebrate deuterostome lineages contain single copy GATA123 and GATA456 genes, we infer that the 0R (pre-genome duplication invertebrate deuterostome ancestor also had two GATA genes, one of each class. Synteny analyses identify duplications of paralogous chromosomal regions (paralogons, from single ancestral vertebrate GATA123 and GATA456

  1. Three neuropeptide Y receptor genes in the spiny dogfish, Squalus acanthias, support en bloc duplications in early vertebrate evolution. (United States)

    Salaneck, Erik; Ardell, David H; Larson, Earl T; Larhammar, Dan


    It has been debated whether the increase in gene number during early vertebrate evolution was due to multiple independent gene duplications or synchronous duplications of many genes. We describe here the cloning of three neuropeptide Y (NPY) receptor genes belonging to the Y1 subfamily in the spiny dogfish, Squalus acanthias, a cartilaginous fish. The three genes are orthologs of the mammalian subtypes Y1, Y4, and Y6, which are located in paralogous gene regions on different chromosomes in mammals. Thus, these genes arose by duplications of a chromosome region before the radiation of gnathostomes (jawed vertebrates). Estimates of duplication times from linearized trees together with evidence from other gene families supports two rounds of chromosome duplications or tetraploidizations early in vertebrate evolution. The anatomical distribution of mRNA was determined by reverse-transcriptase PCR and was found to differ from mammals, suggesting differential functional diversification of the new gene copies during the radiation of the vertebrate classes.

  2. Molecular phylogeny of the Oriental butterfly genus Arhopala (Lycaenidae, Theclinae) inferred from mitochondrial and nuclear genes

    NARCIS (Netherlands)

    Megens, H.J.W.C.; Nes, Van W.J.; Moorsel, van C.H.M.; Pierce, N.E.; Jong, de R.


    We present a phylogeny for a selection of species of the butterfly genus Arhopala Boisduval, 1832 based on molecular characters. We sequenced 1778 bases of the mitochondrial genes Cytochrome Oxidase 1 and 2 including tRNALeu, and a 393-bp fragment of the nuclear wingless gene for a total of 42

  3. Duplication and relocation of the functional DPY19L2 gene within low copy repeats

    Directory of Open Access Journals (Sweden)

    Cheung Joseph


    Full Text Available Abstract Background Low copy repeats (LCRs are thought to play an important role in recent gene evolution, especially when they facilitate gene duplications. Duplicate genes are fundamental to adaptive evolution, providing substrates for the development of new or shared gene functions. Moreover, silencing of duplicate genes can have an indirect effect on adaptive evolution by causing genomic relocation of functional genes. These changes are theorized to have been a major factor in speciation. Results Here we present a novel example showing functional gene relocation within a LCR. We characterize the genomic structure and gene content of eight related LCRs on human Chromosomes 7 and 12. Two members of a novel transmembrane gene family, DPY19L, were identified in these regions, along with six transcribed pseudogenes. One of these genes, DPY19L2, is found on Chromosome 12 and is not syntenic with its mouse orthologue. Instead, the human locus syntenic to mouse Dpy19l2 contains a pseudogene, DPY19L2P1. This indicates that the ancestral copy of this gene has been silenced, while the descendant copy has remained active. Thus, the functional copy of this gene has been relocated to a new genomic locus. We then describe the expansion and evolution of the DPY19L gene family from a single gene found in invertebrate animals. Ancient duplications have led to multiple homologues in different lineages, with three in fish, frogs and birds and four in mammals. Conclusion Our results show that the DPY19L family has expanded throughout the vertebrate lineage and has undergone recent primate-specific evolution within LCRs.

  4. Neofunctionalization of Duplicated P450 Genes Drives the Evolution of Insecticide Resistance in the Brown Planthopper. (United States)

    Zimmer, Christoph T; Garrood, William T; Singh, Kumar Saurabh; Randall, Emma; Lueke, Bettina; Gutbrod, Oliver; Matthiesen, Svend; Kohler, Maxie; Nauen, Ralf; Davies, T G Emyr; Bass, Chris


    Gene duplication is a major source of genetic variation that has been shown to underpin the evolution of a wide range of adaptive traits [1, 2]. For example, duplication or amplification of genes encoding detoxification enzymes has been shown to play an important role in the evolution of insecticide resistance [3-5]. In this context, gene duplication performs an adaptive function as a result of its effects on gene dosage and not as a source of functional novelty [3, 6-8]. Here, we show that duplication and neofunctionalization of a cytochrome P450, CYP6ER1, led to the evolution of insecticide resistance in the brown planthopper. Considerable genetic variation was observed in the coding sequence of CYP6ER1 in populations of brown planthopper collected from across Asia, but just two sequence variants are highly overexpressed in resistant strains and metabolize imidacloprid. Both variants are characterized by profound amino-acid alterations in substrate recognition sites, and the introduction of these mutations into a susceptible P450 sequence is sufficient to confer resistance. CYP6ER1 is duplicated in resistant strains with individuals carrying paralogs with and without the gain-of-function mutations. Despite numerical parity in the genome, the susceptible and mutant copies exhibit marked asymmetry in their expression with the resistant paralogs overexpressed. In the primary resistance-conferring CYP6ER1 variant, this results from an extended region of novel sequence upstream of the gene that provides enhanced expression. Our findings illustrate the versatility of gene duplication in providing opportunities for functional and regulatory innovation during the evolution of an adaptive trait. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  5. Duplication and diversification of the hypoxia-inducible IGFBP-1 gene in zebrafish.

    Directory of Open Access Journals (Sweden)

    Hiroyasu Kamei


    Full Text Available Gene duplication is the primary force of new gene evolution. Deciphering whether a pair of duplicated genes has evolved divergent functions is often challenging. The zebrafish is uniquely positioned to provide insight into the process of functional gene evolution due to its amenability to genetic and experimental manipulation and because it possess a large number of duplicated genes.We report the identification and characterization of two hypoxia-inducible genes in zebrafish that are co-ortholgs of human IGF binding protein-1 (IGFBP-1. IGFBP-1 is a secreted protein that binds to IGF and modulates IGF actions in somatic growth, development, and aging. Like their human and mouse counterparts, in adult zebrafish igfbp-1a and igfbp-1b are exclusively expressed in the liver. During embryogenesis, the two genes are expressed in overlapping spatial domains but with distinct temporal patterns. While zebrafish IGFBP-1a mRNA was easily detected throughout embryogenesis, IGFBP-1b mRNA was detectable only in advanced stages. Hypoxia induces igfbp-1a expression in early embryogenesis, but induces the igfbp-1b expression later in embryogenesis. Both IGFBP-1a and -b are capable of IGF binding, but IGFBP-1b has much lower affinities for IGF-I and -II because of greater dissociation rates. Overexpression of IGFBP-1a and -1b in zebrafish embryos caused significant decreases in growth and developmental rates. When tested in cultured zebrafish embryonic cells, IGFBP-1a and -1b both inhibited IGF-1-induced cell proliferation but the activity of IGFBP-1b was significantly weaker.These results indicate subfunction partitioning of the duplicated IGFBP-1 genes at the levels of gene expression, physiological regulation, protein structure, and biological actions. The duplicated IGFBP-1 may provide additional flexibility in fine-tuning IGF signaling activities under hypoxia and other catabolic conditions.

  6. Gene Duplication and Gene Expression Changes Play a Role in the Evolution of Candidate Pollen Feeding Genes in Heliconius Butterflies. (United States)

    Smith, Gilbert; Macias-Muñoz, Aide; Briscoe, Adriana D


    Heliconius possess a unique ability among butterflies to feed on pollen. Pollen feeding significantly extends their lifespan, and is thought to have been important to the diversification of the genus. We used RNA sequencing to examine feeding-related gene expression in the mouthparts of four species of Heliconius and one nonpollen feeding species, Eueides isabella We hypothesized that genes involved in morphology and protein metabolism might be upregulated in Heliconius because they have longer proboscides than Eueides, and because pollen contains more protein than nectar. Using de novo transcriptome assemblies, we tested these hypotheses by comparing gene expression in mouthparts against antennae and legs. We first looked for genes upregulated in mouthparts across all five species and discovered several hundred genes, many of which had functional annotations involving metabolism of proteins (cocoonase), lipids, and carbohydrates. We then looked specifically within Heliconius where we found eleven common upregulated genes with roles in morphology (CPR cuticle proteins), behavior (takeout-like), and metabolism (luciferase-like). Closer examination of these candidates revealed that cocoonase underwent several duplications along the lineage leading to heliconiine butterflies, including two Heliconius-specific duplications. Luciferase-like genes also underwent duplication within lepidopterans, and upregulation in Heliconius mouthparts. Reverse-transcription PCR confirmed that three cocoonases, a peptidase, and one luciferase-like gene are expressed in the proboscis with little to no expression in labial palps and salivary glands. Our results suggest pollen feeding, like other dietary specializations, was likely facilitated by adaptive expansions of preexisting genes-and that the butterfly proboscis is involved in digestive enzyme production. © The Author(s) 2016. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  7. Age distribution of human gene families shows significant roles of both large- and small-scale duplications in vertebrate evolution. (United States)

    Gu, Xun; Wang, Yufeng; Gu, Jianying


    The classical (two-round) hypothesis of vertebrate genome duplication proposes two successive whole-genome duplication(s) (polyploidizations) predating the origin of fishes, a view now being seriously challenged. As the debate largely concerns the relative merits of the 'big-bang mode' theory (large-scale duplication) and the 'continuous mode' theory (constant creation by small-scale duplications), we tested whether a significant proportion of paralogous genes in the contemporary human genome was indeed generated in the early stage of vertebrate evolution. After an extensive search of major databases, we dated 1,739 gene duplication events from the phylogenetic analysis of 749 vertebrate gene families. We found a pattern characterized by two waves (I, II) and an ancient component. Wave I represents a recent gene family expansion by tandem or segmental duplications, whereas wave II, a rapid paralogous gene increase in the early stage of vertebrate evolution, supports the idea of genome duplication(s) (the big-bang mode). Further analysis indicated that large- and small-scale gene duplications both make a significant contribution during the early stage of vertebrate evolution to build the current hierarchy of the human proteome.

  8. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia. (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G


    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  9. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  10. Zebrafish IGF genes: gene duplication, conservation and divergence, and novel roles in midline and notochord development.

    Directory of Open Access Journals (Sweden)

    Shuming Zou

    Full Text Available Insulin-like growth factors (IGFs are key regulators of development, growth, and longevity. In most vertebrate species including humans, there is one IGF-1 gene and one IGF-2 gene. Here we report the identification and functional characterization of 4 distinct IGF genes (termed as igf-1a, -1b, -2a, and -2b in zebrafish. These genes encode 4 structurally distinct and functional IGF peptides. IGF-1a and IGF-2a mRNAs were detected in multiple tissues in adult fish. IGF-1b mRNA was detected only in the gonad and IGF-2b mRNA only in the liver. Functional analysis showed that all 4 IGFs caused similar developmental defects but with different potencies. Many of these embryos had fully or partially duplicated notochords, suggesting that an excess of IGF signaling causes defects in the midline formation and an expansion of the notochord. IGF-2a, the most potent IGF, was analyzed in depth. IGF-2a expression caused defects in the midline formation and expansion of the notochord but it did not alter the anterior neural patterning. These results not only provide new insights into the functional conservation and divergence of the multiple igf genes but also reveal a novel role of IGF signaling in midline formation and notochord development in a vertebrate model.

  11. Early vertebrate chromosome duplications and the evolution of the neuropeptide Y receptor gene regions

    Directory of Open Access Journals (Sweden)

    Brenner Sydney


    Full Text Available Abstract Background One of the many gene families that expanded in early vertebrate evolution is the neuropeptide (NPY receptor family of G-protein coupled receptors. Earlier work by our lab suggested that several of the NPY receptor genes found in extant vertebrates resulted from two genome duplications before the origin of jawed vertebrates (gnathostomes and one additional genome duplication in the actinopterygian lineage, based on their location on chromosomes sharing several gene families. In this study we have investigated, in five vertebrate genomes, 45 gene families with members close to the NPY receptor genes in the compact genomes of the teleost fishes Tetraodon nigroviridis and Takifugu rubripes. These correspond to Homo sapiens chromosomes 4, 5, 8 and 10. Results Chromosome regions with conserved synteny were identified and confirmed by phylogenetic analyses in H. sapiens, M. musculus, D. rerio, T. rubripes and T. nigroviridis. 26 gene families, including the NPY receptor genes, (plus 3 described recently by other labs showed a tree topology consistent with duplications in early vertebrate evolution and in the actinopterygian lineage, thereby supporting expansion through block duplications. Eight gene families had complications that precluded analysis (such as short sequence length or variable number of repeated domains and another eight families did not support block duplications (because the paralogs in these families seem to have originated in another time window than the proposed genome duplication events. RT-PCR carried out with several tissues in T. rubripes revealed that all five NPY receptors were expressed in the brain and subtypes Y2, Y4 and Y8 were also expressed in peripheral organs. Conclusion We conclude that the phylogenetic analyses and chromosomal locations of these gene families support duplications of large blocks of genes or even entire chromosomes. Thus, these results are consistent with two early vertebrate

  12. Gene duplication as a major force in evolution

    Indian Academy of Sciences (India)

    ers were developed, and the 1990s, when genome sequenc- ing became ... transposed gene copies have been maintained in the human genome over the past 63 ..... competent artificial chromosome (TAC) libraries as the pri- mary substrates ...

  13. Rapid bursts of androgen-binding protein (Abp) gene duplication occurred independently in diverse mammals. (United States)

    Laukaitis, Christina M; Heger, Andreas; Blakley, Tyler D; Munclinger, Pavel; Ponting, Chris P; Karn, Robert C


    The draft mouse (Mus musculus) genome sequence revealed an unexpected proliferation of gene duplicates encoding a family of secretoglobin proteins including the androgen-binding protein (ABP) alpha, beta and gamma subunits. Further investigation of 14 alpha-like (Abpa) and 13 beta- or gamma-like (Abpbg) undisrupted gene sequences revealed a rich diversity of developmental stage-, sex- and tissue-specific expression. Despite these studies, our understanding of the evolution of this gene family remains incomplete. Questions arise from imperfections in the initial mouse genome assembly and a dearth of information about the gene family structure in other rodents and mammals. Here, we interrogate the latest 'finished' mouse (Mus musculus) genome sequence assembly to show that the Abp gene repertoire is, in fact, twice as large as reported previously, with 30 Abpa and 34 Abpbg genes and pseudogenes. All of these have arisen since the last common ancestor with rat (Rattus norvegicus). We then demonstrate, by sequencing homologs from species within the Mus genus, that this burst of gene duplication occurred very recently, within the past seven million years. Finally, we survey Abp orthologs in genomes from across the mammalian clade and show that bursts of Abp gene duplications are not specific to the murid rodents; they also occurred recently in the lagomorph (rabbit, Oryctolagus cuniculus) and ruminant (cattle, Bos taurus) lineages, although not in other mammalian taxa. We conclude that Abp genes have undergone repeated bursts of gene duplication and adaptive sequence diversification driven by these genes' participation in chemosensation and/or sexual identification.

  14. Segmental Duplication, Microinversion, and Gene Loss Associated with a Complex Inversion Breakpoint Region in Drosophila (United States)

    Calvete, Oriol; González, Josefa; Betrán, Esther; Ruiz, Alfredo


    Chromosomal inversions are usually portrayed as simple two-breakpoint rearrangements changing gene order but not gene number or structure. However, increasing evidence suggests that inversion breakpoints may often have a complex structure and entail gene duplications with potential functional consequences. Here, we used a combination of different techniques to investigate the breakpoint structure and the functional consequences of a complex rearrangement fixed in Drosophila buzzatii and comprising two tandemly arranged inversions sharing the middle breakpoint: 2m and 2n. By comparing the sequence in the breakpoint regions between D. buzzatii (inverted chromosome) and D. mojavensis (noninverted chromosome), we corroborate the breakpoint reuse at the molecular level and infer that inversion 2m was associated with a duplication of a ∼13 kb segment and likely generated by staggered breaks plus repair by nonhomologous end joining. The duplicated segment contained the gene CG4673, involved in nuclear transport, and its two nested genes CG5071 and CG5079. Interestingly, we found that other than the inversion and the associated duplication, both breakpoints suffered additional rearrangements, that is, the proximal breakpoint experienced a microinversion event associated at both ends with a 121-bp long duplication that contains a promoter. As a consequence of all these different rearrangements, CG5079 has been lost from the genome, CG5071 is now a single copy nonnested gene, and CG4673 has a transcript ∼9 kb shorter and seems to have acquired a more complex gene regulation. Our results illustrate the complex effects of chromosomal rearrangements and highlight the need of complementing genomic approaches with detailed sequence-level and functional analyses of breakpoint regions if we are to fully understand genome structure, function, and evolutionary dynamics. PMID:22328714

  15. Exact Algorithms for Duplication-Transfer-Loss Reconciliation with Non-Binary Gene Trees. (United States)

    Kordi, Misagh; Bansal, Mukul S


    Duplication-Transfer-Loss (DTL) reconciliation is a powerful method for studying gene family evolution in the presence of horizontal gene transfer. DTL reconciliation seeks to reconcile gene trees with species trees by postulating speciation, duplication, transfer, and loss events. Efficient algorithms exist for finding optimal DTL reconciliations when the gene tree is binary. In practice, however, gene trees are often non-binary due to uncertainty in the gene tree topologies, and DTL reconciliation with non-binary gene trees is known to be NP-hard. In this paper, we present the first exact algorithms for DTL reconciliation with non-binary gene trees. Specifically, we (i) show that the DTL reconciliation problem for non-binary gene trees is fixed-parameter tractable in the maximum degree of the gene tree, (ii) present an exponential-time, but in-practice efficient, algorithm to track and enumerate all optimal binary resolutions of a non-binary input gene tree, and (iii) apply our algorithms to a large empirical data set of over 4700 gene trees from 100 species to study the impact of gene tree uncertainty on DTL-reconciliation and to demonstrate the applicability and utility of our algorithms. The new techniques and algorithms introduced in this paper will help biologists avoid incorrect evolutionary inferences caused by gene tree uncertainty.

  16. A duplicated PLP gene causing Pelizaeus-Merzbacher disease detected by comparative multiplex PCR

    Energy Technology Data Exchange (ETDEWEB)

    Inoue, K.; Sugiyama, N.; Kawanishi, C. [Yokohama City Univ., Yokohama (Japan)] [and others


    Pelizaeus-Merzbacher disease (PMD) is an X-linked dysmyelinating disorder caused by abnormalities in the proteolipid protein (PLP) gene, which is essential for oligodendrocyte differentiation and CNS myelin formation. Although linkage analysis has shown the homogeneity at the PLP locus in patients with PMD, exonic mutations in the PLP gene have been identified in only 10% - 25% of all cases, which suggests the presence of other genetic aberrations, including gene duplication. In this study, we examined five families with PMD not carrying exonic mutations in PLP gene, using comparative multiplex PCR (CM-PCR) as a semiquantitative assay of gene dosage. PLP gene duplications were identified in four families by CM-PCR and confirmed in three families by densitometric RFLP analysis. Because a homologous myelin protein gene, PMP22, is duplicated in the majority of patients with Charcot-Marie-Tooth 1A, PLP gene overdosage may be an important genetic abnormality in PMD and affect myelin formation. 38 ref., 5 figs., 2 tabs.

  17. Multiplex Ligation-dependent Probe Amplification Identification of Deletions and Duplications of the Duchenne Muscular Dystrophy Gene in Taiwanese Subjects

    Directory of Open Access Journals (Sweden)

    Hsiao-Lin Hwa


    Conclusion: MLPA was proven to be a powerful tool for the detection of DMD gene deletions and duplications in male patients and female carriers. There was a relatively lower frequency of deletion and a higher frequency of duplication of DMD gene in this population compared to previous reports.

  18. Ascorbate peroxidase-related (APx-R) is not a duplicable gene. (United States)

    Dunand, Christophe; Mathé, Catherine; Lazzarotto, Fernanda; Margis, Rogério; Margis-Pinheiro, Marcia


    Phylogenetic, genomic and functional analyses have allowed the identification of a new class of putative heme peroxidases, so called APx-R (APx-Related). These new class, mainly present in the green lineage (including green algae and land plants), can also be detected in other unicellular chloroplastic organisms. Except for recent polyploid organisms, only single-copy of APx-R gene was detected in each genome, suggesting that the majority of the APx-R extra-copies were lost after chromosomal or segmental duplications. In a similar way, most APx-R co-expressed genes in Arabidopsis genome do not have conserved extra-copies after chromosomal duplications and are predicted to be localized in organelles, as are the APx-R. The member of this gene network can be considered as unique gene, well conserved through the evolution due to a strong negative selection pressure and a low evolution rate. © 2011 Landes Bioscience

  19. A six-gene phylogeny provides new insights into choanoflagellate evolution. (United States)

    Carr, Martin; Richter, Daniel J; Fozouni, Parinaz; Smith, Timothy J; Jeuck, Alexandra; Leadbeater, Barry S C; Nitsche, Frank


    Recent studies have shown that molecular phylogenies of the choanoflagellates (Class Choanoflagellatea) are in disagreement with their traditional taxonomy, based on morphology, and that Choanoflagellatea requires considerable taxonomic revision. Furthermore, phylogenies suggest that the morphological and ecological evolution of the group is more complex than has previously been recognized. Here we address the taxonomy of the major choanoflagellate order Craspedida, by erecting four new genera. The new genera are shown to be morphologically, ecologically and phylogenetically distinct from other choanoflagellate taxa. Furthermore, we name five novel craspedid species, as well as formally describe ten species that have been shown to be either misidentified or require taxonomic revision. Our revised phylogeny, including 18 new species and sequence data for two additional genes, provides insights into the morphological and ecological evolution of the choanoflagellates. We examine the distribution within choanoflagellates of these two additional genes, EF-1A and EFL, closely related translation GTPases which are required for protein synthesis. Mapping the presence and absence of these genes onto the phylogeny highlights multiple events of gene loss within the choanoflagellates. Copyright © 2016 The Authors. Published by Elsevier Inc. All rights reserved.

  20. A single enhancer regulating the differential expression of duplicated red-sensitive opsin genes in zebrafish.

    Directory of Open Access Journals (Sweden)

    Taro Tsujimura


    Full Text Available A fundamental step in the evolution of the visual system is the gene duplication of visual opsins and differentiation between the duplicates in absorption spectra and expression pattern in the retina. However, our understanding of the mechanism of expression differentiation is far behind that of spectral tuning of opsins. Zebrafish (Danio rerio have two red-sensitive cone opsin genes, LWS-1 and LWS-2. These genes are arrayed in a tail-to-head manner, in this order, and are both expressed in the long member of double cones (LDCs in the retina. Expression of the longer-wave sensitive LWS-1 occurs later in development and is thus confined to the peripheral, especially ventral-nasal region of the adult retina, whereas expression of LWS-2 occurs earlier and is confined to the central region of the adult retina, shifted slightly to the dorsal-temporal region. In this study, we employed a transgenic reporter assay using fluorescent proteins and P1-artificial chromosome (PAC clones encompassing the two genes and identified a 0.6-kb "LWS-activating region" (LAR upstream of LWS-1, which regulates expression of both genes. Under the 2.6-kb flanking upstream region containing the LAR, the expression pattern of LWS-1 was recapitulated by the fluorescent reporter. On the other hand, when LAR was directly conjugated to the LWS-2 upstream region, the reporter was expressed in the LDCs but also across the entire outer nuclear layer. Deletion of LAR from the PAC clones drastically lowered the reporter expression of the two genes. These results suggest that LAR regulates both LWS-1 and LWS-2 by enhancing their expression and that interaction of LAR with the promoters is competitive between the two genes in a developmentally restricted manner. Sharing a regulatory region between duplicated genes could be a general way to facilitate the expression differentiation in duplicated visual opsins.

  1. Host Mitochondrial Association Evolved in the Human Parasite Toxoplasma gondii via Neofunctionalization of a Gene Duplicate. (United States)

    Adomako-Ankomah, Yaw; English, Elizabeth D; Danielson, Jeffrey J; Pernas, Lena F; Parker, Michelle L; Boulanger, Martin J; Dubey, Jitender P; Boyle, Jon P


    In Toxoplasma gondii, an intracellular parasite of humans and other animals, host mitochondrial association (HMA) is driven by a gene family that encodes multiple mitochondrial association factor 1 (MAF1) proteins. However, the importance of MAF1 gene duplication in the evolution of HMA is not understood, nor is the impact of HMA on parasite biology. Here we used within- and between-species comparative analysis to determine that the MAF1 locus is duplicated in T. gondii and its nearest extant relative Hammondia hammondi, but not another close relative, Neospora caninum Using cross-species complementation, we determined that the MAF1 locus harbors multiple distinct paralogs that differ in their ability to mediate HMA, and that only T. gondii and H. hammondi harbor HMA(+) paralogs. Additionally, we found that exogenous expression of an HMA(+) paralog in T. gondii strains that do not normally exhibit HMA provides a competitive advantage over their wild-type counterparts during a mouse infection. These data indicate that HMA likely evolved by neofunctionalization of a duplicate MAF1 copy in the common ancestor of T. gondii and H. hammondi, and that the neofunctionalized gene duplicate is selectively advantageous. Copyright © 2016 by the Genetics Society of America.

  2. Polytomy refinement for the correction of dubious duplications in gene trees. (United States)

    Lafond, Manuel; Chauve, Cedric; Dondi, Riccardo; El-Mabrouk, Nadia


    Large-scale methods for inferring gene trees are error-prone. Correcting gene trees for weakly supported features often results in non-binary trees, i.e. trees with polytomies, thus raising the natural question of refining such polytomies into binary trees. A feature pointing toward potential errors in gene trees are duplications that are not supported by the presence of multiple gene copies. We introduce the problem of refining polytomies in a gene tree while minimizing the number of created non-apparent duplications in the resulting tree. We show that this problem can be described as a graph-theoretical optimization problem. We provide a bounded heuristic with guaranteed optimality for well-characterized instances. We apply our algorithm to a set of ray-finned fish gene trees from the Ensembl database to illustrate its ability to correct dubious duplications. The C++ source code for the algorithms and simulations described in the article are available at Supplementary data are available at Bioinformatics online. © The Author 2014. Published by Oxford University Press.

  3. Targeted Exon Skipping to Correct Exon Duplications in the Dystrophin Gene

    Directory of Open Access Journals (Sweden)

    Kane L Greer


    Full Text Available Duchenne muscular dystrophy is a severe muscle-wasting disease caused by mutations in the dystrophin gene that ablate functional protein expression. Although exonic deletions are the most common Duchenne muscular dystrophy lesion, duplications account for 10–15% of reported disease-causing mutations, and exon 2 is the most commonly duplicated exon. Here, we describe the in vitro evaluation of phosphorodiamidate morpholino oligomers coupled to a cell-penetrating peptide and 2′-O-methyl phosphorothioate oligonucleotides, using three distinct strategies to reframe the dystrophin transcript in patient cells carrying an exon 2 duplication. Differences in exon-skipping efficiencies in vitro were observed between oligomer analogues of the same sequence, with the phosphorodiamidate morpholino oligomer coupled to a cell-penetrating peptide proving the most effective. Differences in exon 2 excision efficiency between normal and exon 2 duplication cells, were apparent, indicating that exon context influences oligomer-induced splice switching. Skipping of a single copy of exon 2 was induced in the cells carrying an exon 2 duplication, the simplest strategy to restore the reading frame and generate a normal dystrophin transcript. In contrast, multiexon skipping of exons 2–7 to generate a Becker muscular dystrophy-like dystrophin transcript was more challenging and could only be induced efficiently with the phosphorodiamidate morpholino oligomer chemistry.

  4. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals. (United States)

    Popova, Olga V; Mikhailov, Kirill V; Nikitin, Mikhail A; Logacheva, Maria D; Penin, Aleksey A; Muntyan, Maria S; Kedrova, Olga S; Petrov, Nikolai B; Panchin, Yuri V; Aleoshin, Vladimir V


    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida) and Pycnophyes kielensis (Allomalorhagida). Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even Protostomia.

  5. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals.

    Directory of Open Access Journals (Sweden)

    Olga V Popova

    Full Text Available Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the early-branching lineages of Ecdysozoa, and their mitochondrial genomes may be important for resolving evolutionary relations between major animal taxa. Here we present the results of sequencing and analysis of mitochondrial genomes from two members of Kinorhyncha, Echinoderes svetlanae (Cyclorhagida and Pycnophyes kielensis (Allomalorhagida. Their mitochondrial genomes are circular molecules approximately 15 Kbp in size. The kinorhynch mitochondrial gene sequences are highly divergent, which precludes accurate phylogenetic inference. The mitogenomes of both species encode a typical metazoan complement of 37 genes, which are all positioned on the major strand, but the gene order is distinct and unique among Ecdysozoa or animals as a whole. We predict four types of start codons for protein-coding genes in E. svetlanae and five in P. kielensis with a consensus DTD in single letter code. The mitochondrial genomes of E. svetlanae and P. kielensis encode duplicated methionine tRNA genes that display compensatory nucleotide substitutions. Two distant species of Kinorhyncha demonstrate similar patterns of gene arrangements in their mitogenomes. Both genomes have duplicated methionine tRNA genes; the duplication predates the divergence of two species. The kinorhynchs share a few features pertaining to gene order that align them with Priapulida. Gene order analysis reveals that gene arrangement specific of Priapulida may be ancestral for Scalidophora, Ecdysozoa, and even

  6. Microevolution of Duplications and Deletions and Their Impact on Gene Expression in the Nematode Pristionchus pacificus.

    Directory of Open Access Journals (Sweden)

    Praveen Baskaran

    Full Text Available The evolution of diversity across the animal kingdom has been accompanied by tremendous gene loss and gain. While comparative genomics has been fruitful to characterize differences in gene content across highly diverged species, little is known about the microevolution of structural variations that cause these differences in the first place. In order to investigate the genomic impact of structural variations, we made use of genomic and transcriptomic data from the nematode Pristionchus pacificus, which has been established as a satellite model to Caenorhabditis elegans for comparative biology. We exploit the fact that P. pacificus is a highly diverse species for which various genomic data including the draft genome of a sister species P. exspectatus is available. Based on resequencing coverage data for two natural isolates we identified large (> 2 kb deletions and duplications relative to the reference strain. By restriction to completely syntenic regions between P. pacificus and P. exspectatus, we were able to polarize the comparison and to assess the impact of structural variations on expression levels. We found that while loss of genes correlates with lack of expression, duplication of genes has virtually no effect on gene expression. Further investigating expression of individual copies at sites that segregate between the duplicates, we found in the majority of cases only one of the copies to be expressed. Nevertheless, we still find that certain gene classes are strongly depleted in deletions as well as duplications, suggesting evolutionary constraint acting on synteny. In summary, our results are consistent with a model, where most structural variations are either deleterious or neutral and provide first insights into the microevolution of structural variations in the P. pacificus genome.

  7. Origin of a function by tandem gene duplication limits the evolutionary capability of its sister copy. (United States)

    Hasselmann, Martin; Lechner, Sarah; Schulte, Christina; Beye, Martin


    The most remarkable outcome of a gene duplication event is the evolution of a novel function. Little information exists on how the rise of a novel function affects the evolution of its paralogous sister gene copy, however. We studied the evolution of the feminizer (fem) gene from which the gene complementary sex determiner (csd) recently derived by tandem duplication within the honey bee (Apis) lineage. Previous studies showed that fem retained its sex determination function, whereas the rise of csd established a new primary signal of sex determination. We observed a specific reduction of nonsynonymous to synonymous substitution ratios in Apis to non-Apis fem. We found a contrasting pattern at two other genetically linked genes, suggesting that hitchhiking effects to csd, the locus under balancing selection, is not the cause of this evolutionary pattern. We also excluded higher synonymous substitution rates by relative rate testing. These results imply that stronger purifying selection is operating at the fem gene in the presence of csd. We propose that csd's new function interferes with the function of Fem protein, resulting in molecular constraints and limited evolvability of fem in the Apis lineage. Elevated silent nucleotide polymorphism in fem relative to the genome-wide average suggests that genetic linkage to the csd gene maintained more nucleotide variation in today's population. Our findings provide evidence that csd functionally and genetically interferes with fem, suggesting that a newly evolved gene and its functions can limit the evolutionary capability of other genes in the genome.

  8. From gene trees to organismal phylogeny in prokaryotes: the case of the gamma-Proteobacteria.

    Directory of Open Access Journals (Sweden)

    Emmanuelle Lerat


    Full Text Available The rapid increase in published genomic sequences for bacteria presents the first opportunity to reconstruct evolutionary events on the scale of entire genomes. However, extensive lateral gene transfer (LGT may thwart this goal by preventing the establishment of organismal relationships based on individual gene phylogenies. The group for which cases of LGT are most frequently documented and for which the greatest density of complete genome sequences is available is the gamma-Proteobacteria, an ecologically diverse and ancient group including free-living species as well as pathogens and intracellular symbionts of plants and animals. We propose an approach to multigene phylogeny using complete genomes and apply it to the case of the gamma-Proteobacteria. We first applied stringent criteria to identify a set of likely gene orthologs and then tested the compatibilities of the resulting protein alignments with several phylogenetic hypotheses. Our results demonstrate phylogenetic concordance among virtually all (203 of 205 of the selected gene families, with each of the exceptions consistent with a single LGT event. The concatenated sequences of the concordant families yield a fully resolved phylogeny. This topology also received strong support in analyses aimed at excluding effects of heterogeneity in nucleotide base composition across lineages. Our analysis indicates that single-copy orthologous genes are resistant to horizontal transfer, even in ancient bacterial groups subject to high rates of LGT. This gene set can be identified and used to yield robust hypotheses for organismal phylogenies, thus establishing a foundation for reconstructing the evolutionary transitions, such as gene transfer, that underlie diversity in genome content and organization.

  9. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications. (United States)

    Ganot, Philippe; Moya, Aurélie; Magnone, Virginie; Allemand, Denis; Furla, Paola; Sabourault, Cécile


    Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion), which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays) from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones) or aposymbiotic (also called bleached) A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm). A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i) a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii) two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii) host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both in the

  10. Adaptations to endosymbiosis in a cnidarian-dinoflagellate association: differential gene expression and specific gene duplications.

    Directory of Open Access Journals (Sweden)

    Philippe Ganot


    Full Text Available Trophic endosymbiosis between anthozoans and photosynthetic dinoflagellates forms the key foundation of reef ecosystems. Dysfunction and collapse of symbiosis lead to bleaching (symbiont expulsion, which is responsible for the severe worldwide decline of coral reefs. Molecular signals are central to the stability of this partnership and are therefore closely related to coral health. To decipher inter-partner signaling, we developed genomic resources (cDNA library and microarrays from the symbiotic sea anemone Anemonia viridis. Here we describe differential expression between symbiotic (also called zooxanthellate anemones or aposymbiotic (also called bleached A. viridis specimens, using microarray hybridizations and qPCR experiments. We mapped, for the first time, transcript abundance separately in the epidermal cell layer and the gastrodermal cells that host photosynthetic symbionts. Transcriptomic profiles showed large inter-individual variability, indicating that aposymbiosis could be induced by different pathways. We defined a restricted subset of 39 common genes that are characteristic of the symbiotic or aposymbiotic states. We demonstrated that transcription of many genes belonging to this set is specifically enhanced in the symbiotic cells (gastroderm. A model is proposed where the aposymbiotic and therefore heterotrophic state triggers vesicular trafficking, whereas the symbiotic and therefore autotrophic state favors metabolic exchanges between host and symbiont. Several genetic pathways were investigated in more detail: i a key vitamin K-dependant process involved in the dinoflagellate-cnidarian recognition; ii two cnidarian tissue-specific carbonic anhydrases involved in the carbon transfer from the environment to the intracellular symbionts; iii host collagen synthesis, mostly supported by the symbiotic tissue. Further, we identified specific gene duplications and showed that the cnidarian-specific isoform was also up-regulated both

  11. The evolution of pepsinogen C genes in vertebrates: duplication, loss and functional diversification.

    Directory of Open Access Journals (Sweden)

    Luís Filipe Costa Castro

    Full Text Available BACKGROUND: Aspartic proteases comprise a large group of enzymes involved in peptide proteolysis. This collection includes prominent enzymes globally categorized as pepsins, which are derived from pepsinogen precursors. Pepsins are involved in gastric digestion, a hallmark of vertebrate physiology. An important member among the pepsinogens is pepsinogen C (Pgc. A particular aspect of Pgc is its apparent single copy status, which contrasts with the numerous gene copies found for example in pepsinogen A (Pga. Although gene sequences with similarity to Pgc have been described in some vertebrate groups, no exhaustive evolutionary framework has been considered so far. METHODOLOGY/PRINCIPAL FINDINGS: By combining phylogenetics and genomic analysis, we find an unexpected Pgc diversity in the vertebrate sub-phylum. We were able to reconstruct gene duplication timings relative to the divergence of major vertebrate clades. Before tetrapod divergence, a single Pgc gene tandemly expanded to produce two gene lineages (Pgbc and Pgc2. These have been differentially retained in various classes. Accordingly, we find Pgc2 in sauropsids, amphibians and marsupials, but not in eutherian mammals. Pgbc was retained in amphibians, but duplicated in the ancestor of amniotes giving rise to Pgb and Pgc1. The latter was retained in mammals and probably in reptiles and marsupials but not in birds. Pgb was kept in all of the amniote clade with independent episodes of loss in some mammalian species. Lineage specific expansions of Pgc2 and Pgbc have also occurred in marsupials and amphibians respectively. We find that teleost and tetrapod Pgc genes reside in distinct genomic regions hinting at a possible translocation. CONCLUSIONS: We conclude that the repertoire of Pgc genes is larger than previously reported, and that tandem duplications have modelled the history of Pgc genes. We hypothesize that gene expansion lead to functional divergence in tetrapods, coincident with the

  12. Genome Wide Identification, Phylogeny, and Expression of Aquaporin Genes in Common Carp (Cyprinus carpio.

    Directory of Open Access Journals (Sweden)

    Chuanju Dong

    Full Text Available Aquaporins (Aqps are integral membrane proteins that facilitate the transport of water and small solutes across cell membranes. Among vertebrate species, Aqps are highly conserved in both gene structure and amino acid sequence. These proteins are vital for maintaining water homeostasis in living organisms, especially for aquatic animals such as teleost fish. Studies on teleost Aqps are mainly limited to several model species with diploid genomes. Common carp, which has a tetraploidized genome, is one of the most common aquaculture species being adapted to a wide range of aquatic environments. The complete common carp genome has recently been released, providing us the possibility for gene evolution of aqp gene family after whole genome duplication.In this study, we identified a total of 37 aqp genes from common carp genome. Phylogenetic analysis revealed that most of aqps are highly conserved. Comparative analysis was performed across five typical vertebrate genomes. We found that almost all of the aqp genes in common carp were duplicated in the evolution of the gene family. We postulated that the expansion of the aqp gene family in common carp was the result of an additional whole genome duplication event and that the aqp gene family in other teleosts has been lost in their evolution history with the reason that the functions of genes are redundant and conservation. Expression patterns were assessed in various tissues, including brain, heart, spleen, liver, intestine, gill, muscle, and skin, which demonstrated the comprehensive expression profiles of aqp genes in the tetraploidized genome. Significant gene expression divergences have been observed, revealing substantial expression divergences or functional divergences in those duplicated aqp genes post the latest WGD event.To some extent, the gene families are also considered as a unique source for evolutionary studies. Moreover, the whole set of common carp aqp gene family provides an

  13. Simulating evolution of protein complexes through gene duplication and co-option. (United States)

    Haarsma, Loren; Nelesen, Serita; VanAndel, Ethan; Lamine, James; VandeHaar, Peter


    We present a model of the evolution of protein complexes with novel functions through gene duplication, mutation, and co-option. Under a wide variety of input parameters, digital organisms evolve complexes of 2-5 bound proteins which have novel functions but whose component proteins are not independently functional. Evolution of complexes with novel functions happens more quickly as gene duplication rates increase, point mutation rates increase, protein complex functional probability increases, protein complex functional strength increases, and protein family size decreases. Evolution of complexity is inhibited when the metabolic costs of making proteins exceeds the fitness gain of having functional proteins, or when point mutation rates get so large the functional proteins undergo deleterious mutations faster than new functional complexes can evolve. Copyright © 2016 Elsevier Ltd. All rights reserved.

  14. A gene duplication led to specialized gamma-aminobutyrate and beta-alanine aminotransferase in yeast

    DEFF Research Database (Denmark)

    Andersen, Gorm; Andersen, Birgit; Dobritzsch, D.


    and related yeasts have two different genes/enzymes to apparently 'distinguish' between the two reactions in a single cell. It is likely that upon duplication similar to 200 million years ago, a specialized Uga1p evolved into a 'novel' transaminase enzyme with broader substrate specificity.......In humans, beta-alanine (BAL) and the neurotransmitter gamma-aminobutyrate (GABA) are transaminated by a single aminotransferase enzyme. Apparently, yeast originally also had a single enzyme, but the corresponding gene was duplicated in the Saccharomyces kluyveri lineage. SkUGA1 encodes a homologue...... to characterize the substrate specificity and kinetic parameters of the four enzymes. It was found that the cofactor pyridoxal 5'-phosphate is needed for enzymatic activity and alpha-ketoglutarate, and not pyruvate, as the amino group acceptor. SkPyd4p preferentially uses BAL as the amino group donor (V...

  15. Approximating the edit distance for genomes with duplicate genes under DCJ, insertion and deletion

    Directory of Open Access Journals (Sweden)

    Shao Mingfu


    Full Text Available Abstract Computing the edit distance between two genomes under certain operations is a basic problem in the study of genome evolution. The double-cut-and-join (DCJ model has formed the basis for most algorithmic research on rearrangements over the last few years. The edit distance under the DCJ model can be easily computed for genomes without duplicate genes. In this paper, we study the edit distance for genomes with duplicate genes under a model that includes DCJ operations, insertions and deletions. We prove that computing the edit distance is equivalent to finding the optimal cycle decomposition of the corresponding adjacency graph, and give an approximation algorithm with an approximation ratio of 1.5 + ∈.

  16. Hypertension and Biliary Ductopenia in a Patient with Duplication of Exon 6 of the Gene

    Directory of Open Access Journals (Sweden)

    J. Uberos


    Full Text Available We describe a neonatal patient with biliary ductopenia featuring duplication of exon 6 of the JAG1 gene. Facial alterations were observed, consisting of a prominent forehead, sunken eyes, upward slanting palpebral fissures, hypertelorism, flat nasal root and prominent chin. From birth, these were accompanied by the development of haematuria and renal failure and by renal Doppler findings indicative of peripheral renal artery stenosis. JAG1 gene mutations on chromosome 20 have been associated with various anomalies, including biliary cholestasis, vertebral abnormalities, eye disorders, heart defects and facial dysmorphia. This syndrome, first described by Alagille, is an infrequent congenital disorder caused by a dominant autosomal inheritance with variable expressivity. Anatomopathological effects include the destruction and disappearance of hepatic bile ducts (ductopenia. The duplication of exon 6 of JAG1 has not previously been described as an alteration related to the Alagille syndrome with peripheral renal artery stenosis.

  17. Estimating variation within the genes and inferring the phylogeny of 186 sequenced diverse Escherichia coli genomes

    DEFF Research Database (Denmark)

    Kaas, Rolf Sommer; Rundsten, Carsten Friis; Ussery, David


    Background Escherichia coli exists in commensal and pathogenic forms. By measuring the variation of individual genes across more than a hundred sequenced genomes, gene variation can be studied in detail, including the number of mutations found for any given gene. This knowledge will be useful...... for creating better phylogenies, for determination of molecular clocks and for improved typing techniques. Results We find 3,051 gene clusters/families present in at least 95% of the genomes and 1,702 gene clusters present in 100% of the genomes. The former 'soft core' of about 3,000 gene families is perhaps...... more biologically relevant, especially considering that many of these genome sequences are draft quality. The E. coli pan-genome for this set of isolates contains 16,373 gene clusters. A core-gene tree, based on alignment and a pan-genome tree based on gene presence/absence, maps the relatedness...

  18. Duplication of 7q36.3 encompassing the Sonic Hedgehog (SHH) gene is associated with congenital muscular hypertrophy

    DEFF Research Database (Denmark)

    Kristensen, Lone Krøldrup; Kjaergaard, S; Kirchhoff, Marianne


    with muscular hypertrophy and mildly retarded psychomotor development. Array-CGH identified a small duplication of 7q36.3 including the Sonic Hedgehog (SHH) gene in both the aborted foetus and the live born male sib. Neither of the parents carried the 7q36.3 duplication. The consequences of overexpression...

  19. Sox genes in grass carp (Ctenopharyngodon idella with their implications for genome duplication and evolution

    Directory of Open Access Journals (Sweden)

    Tong Jingou


    Full Text Available Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella, one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes has two co-orthologs in grass carp, and the duplication of Sox4 and Sox11 occurred before the divergence of grass carp and zebrafish, which support the "fish-specific whole-genome duplication" theory. An estimation for the origin of grass carp based on the molecular clock using Sox1, Sox3 and Sox11 genes as markers indicates that grass carp (subfamily Leuciscinae and zebrafish (subfamily Danioninae diverged approximately 60 million years ago. The potential uses of Sox genes as markers in revealing the evolutionary history of grass carp are discussed.

  20. Dose effect of the uvsA+ gene product in duplication strains of Aspergillus nidulans

    International Nuclear Information System (INIS)

    Majerfeld, I.H.; Roper, J.A.


    Strains of Aspergillus nidulans which carry a particular segment of chromosome I in duplicate - one segment in normal position, the other translocated to chromosome II - are more resistant to uv light than are strains with a balanced haploid genome. A double dose of the uvsA + allele, carried on the duplicate segment, determines this enhanced resistance; this is shown by the descending order of resistance of duplication haploids uvsA + /uvsA + , uvsA1/uvsA + and uvsA1/uvsA1. An unbalanced diploid with three doses of the uvsA + allele also shows greater resistance than a balanced uvsA + //uvsA + diploid. However, in balanced diploids the uvsA1 allele appears to be completely recessive; uvsA + //uvsA + and uvsA + //uvsA1 diploids produce indistinguishable survival curves after uv irradiation. Thus, the uvsA + gene product is not rate-limiting in repair processes in strains with a balanced genome. The rate-limiting effect observed in these unbalanced strains presumably reflects an interaction of the uvsA + product and other functions determined by the rest of the genome. Duplication haploids and normal haploids lose photorepairable lesions at similar rates. This observation may be interpreted to indicate that differences in survival are not due to differences in the efficiency of excision of uv-induced pyrimidime dimers

  1. Dissecting a hidden gene duplication: the Arabidopsis thaliana SEC10 locus.

    Directory of Open Access Journals (Sweden)

    Nemanja Vukašinović

    Full Text Available Repetitive sequences present a challenge for genome sequence assembly, and highly similar segmental duplications may disappear from assembled genome sequences. Having found a surprising lack of observable phenotypic deviations and non-Mendelian segregation in Arabidopsis thaliana mutants in SEC10, a gene encoding a core subunit of the exocyst tethering complex, we examined whether this could be explained by a hidden gene duplication. Re-sequencing and manual assembly of the Arabidopsis thaliana SEC10 (At5g12370 locus revealed that this locus, comprising a single gene in the reference genome assembly, indeed contains two paralogous genes in tandem, SEC10a and SEC10b, and that a sequence segment of 7 kb in length is missing from the reference genome sequence. Differences between the two paralogs are concentrated in non-coding regions, while the predicted protein sequences exhibit 99% identity, differing only by substitution of five amino acid residues and an indel of four residues. Both SEC10 genes are expressed, although varying transcript levels suggest differential regulation. Homozygous T-DNA insertion mutants in either paralog exhibit a wild-type phenotype, consistent with proposed extensive functional redundancy of the two genes. By these observations we demonstrate that recently duplicated genes may remain hidden even in well-characterized genomes, such as that of A. thaliana. Moreover, we show that the use of the existing A. thaliana reference genome sequence as a guide for sequence assembly of new Arabidopsis accessions or related species has at least in some cases led to error propagation.

  2. Molecular evolution of a Y chromosome to autosome gene duplication in Drosophila. (United States)

    Dyer, Kelly A; White, Brooke E; Bray, Michael J; Piqué, Daniel G; Betancourt, Andrea J


    In contrast to the rest of the genome, the Y chromosome is restricted to males and lacks recombination. As a result, Y chromosomes are unable to respond efficiently to selection, and newly formed Y chromosomes degenerate until few genes remain. The rapid loss of genes from newly formed Y chromosomes has been well studied, but gene loss from highly degenerate Y chromosomes has only recently received attention. Here, we identify and characterize a Y to autosome duplication of the male fertility gene kl-5 that occurred during the evolution of the testacea group species of Drosophila. The duplication was likely DNA based, as other Y-linked genes remain on the Y chromosome, the locations of introns are conserved, and expression analyses suggest that regulatory elements remain linked. Genetic mapping reveals that the autosomal copy of kl-5 resides on the dot chromosome, a tiny autosome with strongly suppressed recombination. Molecular evolutionary analyses show that autosomal copies of kl-5 have reduced polymorphism and little recombination. Importantly, the rate of protein evolution of kl-5 has increased significantly in lineages where it is on the dot versus Y linked. Further analyses suggest this pattern is a consequence of relaxed purifying selection, rather than adaptive evolution. Thus, although the initial fixation of the kl-5 duplication may have been advantageous, slightly deleterious mutations have accumulated in the dot-linked copies of kl-5 faster than in the Y-linked copies. Because the dot chromosome contains seven times more genes than the Y and is exposed to selection in both males and females, these results suggest that the dot suffers the deleterious effects of genetic linkage to more selective targets compared with the Y chromosome. Thus, a highly degenerate Y chromosome may not be the worst environment in the genome, as is generally thought, but may in fact be protected from the accumulation of deleterious mutations relative to other nonrecombining

  3. Duplications and losses in gene families of rust pathogens highlight putative effectors

    Directory of Open Access Journals (Sweden)

    Amanda L. Pendleton


    Full Text Available Rust fungi are a group of fungal pathogens that cause some of the world’s most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host’s cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of sixteen diverse fungal species, which include fifteen basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: i arose or expanded in rust pathogens relative to other fungi, or ii contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  4. Duplications and losses in gene families of rust pathogens highlight putative effectors. (United States)

    Pendleton, Amanda L; Smith, Katherine E; Feau, Nicolas; Martin, Francis M; Grigoriev, Igor V; Hamelin, Richard; Nelson, C Dana; Burleigh, J Gordon; Davis, John M


    Rust fungi are a group of fungal pathogens that cause some of the world's most destructive diseases of trees and crops. A shared characteristic among rust fungi is obligate biotrophy, the inability to complete a lifecycle without a host. This dependence on a host species likely affects patterns of gene expansion, contraction, and innovation within rust pathogen genomes. The establishment of disease by biotrophic pathogens is reliant upon effector proteins that are encoded in the fungal genome and secreted from the pathogen into the host's cell apoplast or within the cells. This study uses a comparative genomic approach to elucidate putative effectors and determine their evolutionary histories. We used OrthoMCL to identify nearly 20,000 gene families in proteomes of 16 diverse fungal species, which include 15 basidiomycetes and one ascomycete. We inferred patterns of duplication and loss for each gene family and identified families with distinctive patterns of expansion/contraction associated with the evolution of rust fungal genomes. To recognize potential contributors for the unique features of rust pathogens, we identified families harboring secreted proteins that: (i) arose or expanded in rust pathogens relative to other fungi, or (ii) contracted or were lost in rust fungal genomes. While the origin of rust fungi appears to be associated with considerable gene loss, there are many gene duplications associated with each sampled rust fungal genome. We also highlight two putative effector gene families that have expanded in Cqf that we hypothesize have roles in pathogenicity.

  5. Divergent Evolutionary Patterns of NAC Transcription Factors Are Associated with Diversification and Gene Duplications in Angiosperm

    Directory of Open Access Journals (Sweden)

    Xiaoli Jin


    Full Text Available NAC (NAM/ATAF/CUC proteins constitute one of the biggest plant-specific transcription factor (TF families and have crucial roles in diverse developmental programs during plant growth. Phylogenetic analyses have revealed both conserved and lineage-specific NAC subfamilies, among which various origins and distinct features were observed. It is reasonable to hypothesize that there should be divergent evolutionary patterns of NAC TFs both between dicots and monocots, and among NAC subfamilies. In this study, we compared the gene duplication and loss, evolutionary rate, and selective pattern among non-lineage specific NAC subfamilies, as well as those between dicots and monocots, through genome-wide analyses of sequence and functional data in six dicot and five grass lineages. The number of genes gained in the dicot lineages was much larger than that in the grass lineages, while fewer gene losses were observed in the grass than that in the dicots. We revealed (1 uneven constitution of Clusters of Orthologous Groups (COGs and contrasting birth/death rates among subfamilies, and (2 two distinct evolutionary scenarios of NAC TFs between dicots and grasses. Our results demonstrated that relaxed selection, resulting from concerted gene duplications, may have permitted substitutions responsible for functional divergence of NAC genes into new lineages. The underlying mechanism of distinct evolutionary fates of NAC TFs shed lights on how evolutionary divergence contributes to differences in establishing NAC gene subfamilies and thus impacts the distinct features between dicots and grasses.

  6. GENE-dosage effects on fitness in recent adaptive duplications: ace-1 in the mosquito Culex pipiens. (United States)

    Labbé, Pierrick; Milesi, Pascal; Yébakima, André; Pasteur, Nicole; Weill, Mylène; Lenormand, Thomas


    Gene duplications have long been advocated to contribute to the evolution of new functions. The role of selection in their early spread is more controversial. Unless duplications are favored for a direct benefit of increased expression, they are likely detrimental. In this article, we investigated the case of duplications favored because they combine already functionally divergent alleles. Their gene-dosage/fitness relations are poorly known because selection may operate on both overall expression and duplicates relative dosage. Using the well-documented case of Culex pipiens resistance to insecticides, we compared strains with various ace-1 allele combinations, including two duplicated alleles carrying both susceptible and resistant copies. The overall protein activity was nearly additive, but, surprisingly, fitness correlated better with the relative proportion of susceptible and resistant copies rather than any absolute measure of activity. Gene dosage is thus crucial, duplications stabilizing a "heterozygote" phenotype. It corroborates the view that these were favored because they fix a permanent heterosis, thereby solving the irreducible trade-off between resistance and synaptic transmission. Moreover, we showed that the contrasted successes of the two duplicated alleles in natural populations depend on genetic changes unrelated to ace-1, confirming the probable implication of recessive sublethal mutations linked to structural rearrangements in some duplications. © 2014 The Author(s). Evolution © 2014 The Society for the Study of Evolution.

  7. Functional evolution of ADAMTS genes: Evidence from analyses of phylogeny and gene organization

    Directory of Open Access Journals (Sweden)

    Van Meir Erwin G


    Full Text Available Abstract Background The ADAMTS (A Disintegrin-like and Metalloprotease with Thrombospondin motifs proteins are a family of metalloproteases with sequence similarity to the ADAM proteases, that contain the thrombospondin type 1 sequence repeat motifs (TSRs common to extracellular matrix proteins. ADAMTS proteins have recently gained attention with the discovery of their role in a variety of diseases, including tissue and blood disorders, cancer, osteoarthritis, Alzheimer's and the genetic syndromes Weill-Marchesani syndrome (ADAMTS10, thrombotic thrombocytopenic purpura (ADAMTS13, and Ehlers-Danlos syndrome type VIIC (ADAMTS2 in humans and belted white-spotting mutation in mice (ADAMTS20. Results Phylogenetic analysis and comparison of the exon/intron organization of vertebrate (Homo, Mus, Fugu, chordate (Ciona and invertebrate (Drosophila and Caenorhabditis ADAMTS homologs has elucidated the evolutionary relationships of this important gene family, which comprises 19 members in humans. Conclusions The evolutionary history of ADAMTS genes in vertebrate genomes has been marked by rampant gene duplication, including a retrotransposition that gave rise to a distinct ADAMTS subfamily (ADAMTS1, -4, -5, -8, -15 that may have distinct aggrecanase and angiogenesis functions.

  8. Clinical and molecular characterization of duplications encompassing the human SHOX gene reveal a variable effect on stature. (United States)

    Thomas, N Simon; Harvey, John F; Bunyan, David J; Rankin, Julia; Grigelioniene, Giedre; Bruno, Damien L; Tan, Tiong Y; Tomkins, Susan; Hastings, Robert


    Deletions of the SHOX gene are well documented and cause disproportionate short stature and variable skeletal abnormalities. In contrast interstitial SHOX duplications limited to PAR1 appear to be very rare and the clinical significance of the only case report in the literature is unclear. Mapping of this duplication has now shown that it includes the entire SHOX gene but little flanking sequence and so will not encompass any of the long-range enhancers required for SHOX transcription. We now describe the clinical and molecular characterization of three additional cases. The duplications all included the SHOX coding sequence but varied in the amount of flanking sequence involved. The probands were ascertained for a variety of reasons: hypotonia and features of Asperger syndrome, Leri-Weill dyschondrosteosis (LWD), and a family history of cleft palate. However, the presence of a duplication did not correlate with any of these features or with evidence of skeletal abnormality. Remarkably, the proband with LWD had inherited both a SHOX deletion and a duplication. The effect of the duplications on stature was variable: height appeared to be elevated in some carriers, particularly in those with the largest duplications, but was still within the normal range. SHOX duplications are likely to be under ascertained and more cases need to be identified and characterized in detail in order to accurately determine their phenotypic consequences.

  9. Extensive lineage-specific gene duplication and evolution of the spiggin multi-gene family in stickleback

    Directory of Open Access Journals (Sweden)

    Nishida Mutsumi


    Full Text Available Abstract Background The threespine stickleback (Gasterosteus aculeatus has a characteristic reproductive mode; mature males build nests using a secreted glue-like protein called spiggin. Although recent studies reported multiple occurrences of genes that encode this glue-like protein spiggin in threespine and ninespine sticklebacks, it is still unclear how many genes compose the spiggin multi-gene family. Results Genome sequence analysis of threespine stickleback showed that there are at least five spiggin genes and two pseudogenes, whereas a single spiggin homolog occurs in the genomes of other fishes. Comparative genome sequence analysis demonstrated that Muc19, a single-copy mucous gene in human and mouse, is an ortholog of spiggin. Phylogenetic and molecular evolutionary analyses of these sequences suggested that an ancestral spiggin gene originated from a member of the mucin gene family as a single gene in the common ancestor of teleosts, and gene duplications of spiggin have occurred in the stickleback lineage. There was inter-population variation in the copy number of spiggin genes and positive selection on some codons, indicating that additional gene duplication/deletion events and adaptive evolution at some amino acid sites may have occurred in each stickleback population. Conclusion A number of spiggin genes exist in the threespine stickleback genome. Our results provide insight into the origin and dynamic evolutionary process of the spiggin multi-gene family in the threespine stickleback lineage. The dramatic evolution of genes for mucous substrates may have contributed to the generation of distinct characteristics such as "bio-glue" in vertebrates.

  10. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers (United States)

    Harding, Tommy; Roger, Andrew J.; Simpson, Alastair G. B.


    The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles) grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones), ion homeostasis (e.g., Na+/H+ transporter), metabolism and transport of lipids (e.g., sterol biosynthetic genes), carbohydrate metabolism (e.g., glycosidases), and signal transduction pathways (e.g., transcription factors). A significantly high proportion (43%) of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs), as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like membrane

  11. Adaptations to High Salt in a Halophilic Protist: Differential Expression and Gene Acquisitions through Duplications and Gene Transfers

    Directory of Open Access Journals (Sweden)

    Tommy Harding


    Full Text Available The capacity of halophiles to thrive in extreme hypersaline habitats derives partly from the tight regulation of ion homeostasis, the salt-dependent adjustment of plasma membrane fluidity, and the increased capability to manage oxidative stress. Halophilic bacteria, and archaea have been intensively studied, and substantial research has been conducted on halophilic fungi, and the green alga Dunaliella. By contrast, there have been very few investigations of halophiles that are phagotrophic protists, i.e., protozoa. To gather fundamental knowledge about salt adaptation in these organisms, we studied the transcriptome-level response of Halocafeteria seosinensis (Stramenopiles grown under contrasting salinities. We provided further evolutionary context to our analysis by identifying genes that underwent recent duplications. Genes that were highly responsive to salinity variations were involved in stress response (e.g., chaperones, ion homeostasis (e.g., Na+/H+ transporter, metabolism and transport of lipids (e.g., sterol biosynthetic genes, carbohydrate metabolism (e.g., glycosidases, and signal transduction pathways (e.g., transcription factors. A significantly high proportion (43% of duplicated genes were also differentially expressed, accentuating the importance of gene expansion in adaptation by H. seosinensis to high salt environments. Furthermore, we found two genes that were lateral acquisitions from bacteria, and were also highly up-regulated and highly expressed at high salt, suggesting that this evolutionary mechanism could also have facilitated adaptation to high salt. We propose that a transition toward high-salt adaptation in the ancestors of H. seosinensis required the acquisition of new genes via duplication, and some lateral gene transfers (LGTs, as well as the alteration of transcriptional programs, leading to increased stress resistance, proper establishment of ion gradients, and modification of cell structure properties like

  12. Novel duplication mutation of the DYSF gene in a Pakistani family with Miyoshi Myopathy

    Directory of Open Access Journals (Sweden)

    Muhammad I. Ullah


    Full Text Available Objectives: To identify the underlying gene mutation in a large consanguineous Pakistani family. Methods: This is an observational descriptive study carried out at the Department of Biochemistry, Shifa International Hospital, Quaid-i-Azam University, and Atta-ur-Rahman School of Applied Biosciences, National University of Sciences and Technology, Islamabad, Pakistan from 2013-2016. Genomic DNA of all recruited family members was extracted and the Trusight one sequencing panel was used to assess genes associated with a neuro-muscular phenotype. Comparative modeling of mutated and wild-type protein was carried out by PyMOL tool. Results: Clinical investigations of an affected individual showed typical features of Miyoshi myopathy (MM like elevated serum creatine kinase (CK levels, distal muscle weakness, myopathic changes in electromyography (EMG and muscle histopathology. Sequencing with the Ilumina Trusight one sequencing panel revealed a novel 22 nucleotide duplication (CTTCAACTTGTTTGACTCTCCT in the DYSF gene (NM_001130987.1_c.897-918dup; p.Gly307Leufs5X, which results in a truncating frameshift mutation and perfectly segregated with the disease in this family. Protein modeling studies suggested a disruption in spatial configuration of the putative mutant protein. Conclusion: A novel duplication of 22 bases (c.897_918dup; p.Gly307Leufs5X in the DYSF gene was identified in a family suffering from Miyoshi myopathy. Protein homology analysis proposes a disruptive impact of this mutation on protein function.

  13. Inferring kangaroo phylogeny from incongruent nuclear and mitochondrial genes.

    Directory of Open Access Journals (Sweden)

    Matthew J Phillips

    Full Text Available The marsupial genus Macropus includes three subgenera, the familiar large grazing kangaroos and wallaroos of M. (Macropus and M. (Osphranter, as well as the smaller mixed grazing/browsing wallabies of M. (Notamacropus. A recent study of five concatenated nuclear genes recommended subsuming the predominantly browsing Wallabia bicolor (swamp wallaby into Macropus. To further examine this proposal we sequenced partial mitochondrial genomes for kangaroos and wallabies. These sequences strongly favour the morphological placement of W. bicolor as sister to Macropus, although place M. irma (black-gloved wallaby within M. (Osphranter rather than as expected, with M. (Notamacropus. Species tree estimation from separately analysed mitochondrial and nuclear genes favours retaining Macropus and Wallabia as separate genera. A simulation study finds that incomplete lineage sorting among nuclear genes is a plausible explanation for incongruence with the mitochondrial placement of W. bicolor, while mitochondrial introgression from a wallaroo into M. irma is the deepest such event identified in marsupials. Similar such coalescent simulations for interpreting gene tree conflicts will increase in both relevance and statistical power as species-level phylogenetics enters the genomic age. Ecological considerations in turn, hint at a role for selection in accelerating the fixation of introgressed or incompletely sorted loci. More generally the inclusion of the mitochondrial sequences substantially enhanced phylogenetic resolution. However, we caution that the evolutionary dynamics that enhance mitochondria as speciation indicators in the presence of incomplete lineage sorting may also render them especially susceptible to introgression.

  14. Allotetraploid origin and divergence in Eleusine (Chloridoideae, Poaceae): evidence from low-copy nuclear gene phylogenies and a plastid gene chronogram. (United States)

    Liu, Qing; Triplett, Jimmy K; Wen, Jun; Peterson, Paul M


    Eleusine (Poaceae) is a small genus of the subfamily Chloridoideae exhibiting considerable morphological and ecological diversity in East Africa and the Americas. The interspecific phylogenetic relationships of Eleusine are investigated in order to identify its allotetraploid origin, and a chronogram is estimated to infer temporal relationships between palaeoenvironment changes and divergence of Eleusine in East Africa. Two low-copy nuclear (LCN) markers, Pepc4 and EF-1α, were analysed using parsimony, likelihood and Bayesian approaches. A chronogram of Eleusine was inferred from a combined data set of six plastid DNA markers (ndhA intron, ndhF, rps16-trnK, rps16 intron, rps3, and rpl32-trnL) using the Bayesian dating method. The monophyly of Eleusine is strongly supported by sequence data from two LCN markers. In the cpDNA phylogeny, three tetraploid species (E. africana, E. coracana and E. kigeziensis) share a common ancestor with the E. indica-E. tristachya clade, which is considered a source of maternal parents for allotetraploids. Two homoeologous loci are isolated from three tetraploid species in the Pepc4 phylogeny, and the maternal parents receive further support. The A-type EF-1α sequences possess three characters, i.e. a large number of variations of intron 2; clade E-A distantly diverged from clade E-B and other diploid species; and seven deletions in intron 2, implying a possible derivation through a gene duplication event. The crown age of Eleusine and the allotetraploid lineage are 3·89 million years ago (mya) and 1·40 mya, respectively. The molecular data support independent allotetraploid origins for E. kigeziensis and the E. africana-E. coracana clade. Both events may have involved diploids E. indica and E. tristachya as the maternal parents, but the paternal parents remain unidentified. The habitat-specific hypothesis is proposed to explain the divergence of Eleusine and its allotetraploid lineage.

  15. Phylogeny Inference of Closely Related Bacterial Genomes: Combining the Features of Both Overlapping Genes and Collinear Genomic Regions (United States)

    Zhang, Yan-Cong; Lin, Kui


    Overlapping genes (OGs) represent one type of widespread genomic feature in bacterial genomes and have been used as rare genomic markers in phylogeny inference of closely related bacterial species. However, the inference may experience a decrease in performance for phylogenomic analysis of too closely or too distantly related genomes. Another drawback of OGs as phylogenetic markers is that they usually take little account of the effects of genomic rearrangement on the similarity estimation, such as intra-chromosome/genome translocations, horizontal gene transfer, and gene losses. To explore such effects on the accuracy of phylogeny reconstruction, we combine phylogenetic signals of OGs with collinear genomic regions, here called locally collinear blocks (LCBs). By putting these together, we refine our previous metric of pairwise similarity between two closely related bacterial genomes. As a case study, we used this new method to reconstruct the phylogenies of 88 Enterobacteriale genomes of the class Gammaproteobacteria. Our results demonstrated that the topological accuracy of the inferred phylogeny was improved when both OGs and LCBs were simultaneously considered, suggesting that combining these two phylogenetic markers may reduce, to some extent, the influence of gene loss on phylogeny inference. Such phylogenomic studies, we believe, will help us to explore a more effective approach to increasing the robustness of phylogeny reconstruction of closely related bacterial organisms. PMID:26715828

  16. Differential contributions to the transcriptome of duplicated genes in response to abiotic stresses in natural and synthetic polyploids. (United States)

    Dong, Shaowei; Adams, Keith L


    Polyploidy has occurred throughout plant evolution and can result in considerable changes to gene expression when it takes place and over evolutionary time. Little is known about the effects of abiotic stress conditions on duplicate gene expression patterns in polyploid plants. We examined the expression patterns of 60 duplicated genes in leaves, roots and cotyledons of allotetraploid Gossypium hirsutum in response to five abiotic stress treatments (heat, cold, drought, high salt and water submersion) using single-strand conformation polymorphism assays, and 20 genes in a synthetic allotetraploid. Over 70% of the genes showed stress-induced changes in the relative expression levels of the duplicates under one or more stress treatments with frequent variability among treatments. Twelve pairs showed opposite changes in expression levels in response to different abiotic stress treatments. Stress-induced expression changes occurred in the synthetic allopolyploid, but there was little correspondence in patterns between the natural and synthetic polyploids. Our results indicate that abiotic stress conditions can have considerable effects on duplicate gene expression in a polyploid, with the effects varying by gene, stress and organ type. Differential expression in response to environmental stresses may be a factor in the preservation of some duplicated genes in polyploids. © 2011 The Authors. New Phytologist © 2011 New Phytologist Trust.

  17. Gene duplication and fragmentation in the zebra finch major histocompatibility complex. (United States)

    Balakrishnan, Christopher N; Ekblom, Robert; Völker, Martin; Westerdahl, Helena; Godinez, Ricardo; Kotkiewicz, Holly; Burt, David W; Graves, Tina; Griffin, Darren K; Warren, Wesley C; Edwards, Scott V


    Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC) has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC) sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH) evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving chromosomal fission, gene duplication and translocation in the

  18. Expression response of duplicated metallothionein 3 gene to copper stress in Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Nevrtalová, Eva; Baloun, Jiří; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Doležel, Jaroslav; Šafář, Jan; Milde, D.; Hobza, Roman


    Roč. 251, č. 6 (2014), s. 1427-1439 ISSN 0033-183X R&D Projects: GA ČR(CZ) GAP501/12/2220; GA ČR(CZ) GBP501/12/G090; GA ČR(CZ) GP13-34962P; GA ČR(CZ) GA522/09/0083 Institutional support: RVO:68081707 Keywords : Copper * Gene duplication * Metallothionein Subject RIV: BO - Biophysics; EF - Botanics (UEB-Q) Impact factor: 2.651, year: 2014

  19. Saccharomyces cerevisiae ribosomal protein L37 is encoded by duplicate genes that are differentially expressed. (United States)

    Tornow, J; Santangelo, G M


    A duplicate copy of the RPL37A gene (encoding ribosomal protein L37) was cloned and sequenced. The coding region of RPL37B is very similar to that of RPL37A, with only one conservative amino-acid difference. However, the intron and flanking sequences of the two genes are extremely dissimilar. Disruption experiments indicate that the two loci are not functionally equivalent: disruption of RPL37B was insignificant, but disruption of RPL37A severely impaired the growth rate of the cell. When both RPL37 loci are disrupted, the cell is unable to grow at all, indicating that rpL37 is an essential protein. The functional disparity between the two RPL37 loci could be explained by differential gene expression. The results of two experiments support this idea: gene fusion of RPL37A to a reporter gene resulted in six-fold higher mRNA levels than was generated by the same reporter gene fused to RPL37B, and a modest increase in gene dosage of RPL37B overcame the lack of a functional RPL37A gene.

  20. Gene duplication and the evolution of hemoglobin isoform differentiation in birds. (United States)

    Grispo, Michael T; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E; Storz, Jay F


    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the α(A)-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the α(D)-globin gene). The α(D)-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O(2) affinity in the presence of allosteric effectors such as organic phosphates and Cl(-) ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O(2) affinity stems primarily from changes in the O(2) association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the α(D)-globin gene that is shared with the embryonic α-like globin gene.

  1. Gene Duplication and the Evolution of Hemoglobin Isoform Differentiation in Birds* (United States)

    Grispo, Michael T.; Natarajan, Chandrasekhar; Projecto-Garcia, Joana; Moriyama, Hideaki; Weber, Roy E.; Storz, Jay F.


    The majority of bird species co-express two functionally distinct hemoglobin (Hb) isoforms in definitive erythrocytes as follows: HbA (the major adult Hb isoform, with α-chain subunits encoded by the αA-globin gene) and HbD (the minor adult Hb isoform, with α-chain subunits encoded by the αD-globin gene). The αD-globin gene originated via tandem duplication of an embryonic α-like globin gene in the stem lineage of tetrapod vertebrates, which suggests the possibility that functional differentiation between the HbA and HbD isoforms may be attributable to a retained ancestral character state in HbD that harkens back to a primordial, embryonic function. To investigate this possibility, we conducted a combined analysis of protein biochemistry and sequence evolution to characterize the structural and functional basis of Hb isoform differentiation in birds. Functional experiments involving purified HbA and HbD isoforms from 11 different bird species revealed that HbD is characterized by a consistently higher O2 affinity in the presence of allosteric effectors such as organic phosphates and Cl− ions. In the case of both HbA and HbD, analyses of oxygenation properties under the two-state Monod-Wyman-Changeux allosteric model revealed that the pH dependence of Hb-O2 affinity stems primarily from changes in the O2 association constant of deoxy (T-state)-Hb. Ancestral sequence reconstructions revealed that the amino acid substitutions that distinguish the adult-expressed Hb isoforms are not attributable to the retention of an ancestral (pre-duplication) character state in the αD-globin gene that is shared with the embryonic α-like globin gene. PMID:22962007

  2. An ace-1 gene duplication resorbs the fitness cost associated with resistance in Anopheles gambiae, the main malaria mosquito. (United States)

    Assogba, Benoît S; Djogbénou, Luc S; Milesi, Pascal; Berthomieu, Arnaud; Perez, Julie; Ayala, Diego; Chandre, Fabrice; Makoutodé, Michel; Labbé, Pierrick; Weill, Mylène


    Widespread resistance to pyrethroids threatens malaria control in Africa. Consequently, several countries switched to carbamates and organophophates insecticides for indoor residual spraying. However, a mutation in the ace-1 gene conferring resistance to these compounds (ace-1(R) allele), is already present. Furthermore, a duplicated allele (ace-1(D)) recently appeared; characterizing its selective advantage is mandatory to evaluate the threat. Our data revealed that a unique duplication event, pairing a susceptible and a resistant copy of the ace-1 gene spread through West Africa. Further investigations revealed that, while ace-1(D) confers less resistance than ace-1(R), the high fitness cost associated with ace-1(R) is almost completely suppressed by the duplication for all traits studied. ace-1 duplication thus represents a permanent heterozygote phenotype, selected, and thus spreading, due to the mosaic nature of mosquito control. It provides malaria mosquito with a new evolutionary path that could hamper resistance management.

  3. Combined analysis of fourteen nuclear genes refines the Ursidae phylogeny. (United States)

    Pagès, Marie; Calvignac, Sébastien; Klein, Catherine; Paris, Mathilde; Hughes, Sandrine; Hänni, Catherine


    Despite numerous studies, questions remain about the evolutionary history of Ursidae and additional independent genetic markers were needed to elucidate these ambiguities. For this purpose, we sequenced ten nuclear genes for all the eight extant bear species. By combining these new sequences with those of four other recently published nuclear markers, we provide new insights into the phylogenetic relationships of the Ursidae family members. The hypothesis that the giant panda was the first species to diverge among ursids is definitively confirmed and the precise branching order within the Ursus genus is clarified for the first time. Moreover, our analyses indicate that the American and the Asiatic black bears do not cluster as sister taxa, as had been previously hypothesised. Sun and sloth bears clearly appear as the most basal ursine species but uncertainties about their exact relationships remain. Since our larger dataset did not enable us to clarify this last question, identifying rare genomic changes in bear genomes could be a promising solution for further studies.

  4. Gene duplication and adaptive evolution of digestive proteases in Drosophila arizonae female reproductive tracts.

    Directory of Open Access Journals (Sweden)

    Erin S Kelleher


    Full Text Available It frequently has been postulated that intersexual coevolution between the male ejaculate and the female reproductive tract is a driving force in the rapid evolution of reproductive proteins. The dearth of research on female tracts, however, presents a major obstacle to empirical tests of this hypothesis. Here, we employ a comparative EST approach to identify 241 candidate female reproductive proteins in Drosophila arizonae, a repleta group species in which physiological ejaculate-female coevolution has been documented. Thirty-one of these proteins exhibit elevated amino acid substitution rates, making them candidates for molecular coevolution with the male ejaculate. Strikingly, we also discovered 12 unique digestive proteases whose expression is specific to the D. arizonae lower female reproductive tract. These enzymes belong to classes most commonly found in the gastrointestinal tracts of a diverse array of organisms. We show that these proteases are associated with recent, lineage-specific gene duplications in the Drosophila repleta species group, and exhibit strong signatures of positive selection. Observation of adaptive evolution in several female reproductive tract proteins indicates they are active players in the evolution of reproductive tract interactions. Additionally, pervasive gene duplication, adaptive evolution, and rapid acquisition of a novel digestive function by the female reproductive tract points to a novel coevolutionary mechanism of ejaculate-female interaction.

  5. Rapid duplication and loss of nbs-encoding genes in eurosids II

    International Nuclear Information System (INIS)

    Si, W.; Gu, L.; Yang, S.; Zhang, X.; Memon, S.


    Eurosids basically evolved from the core Eudicots Rosids. The Rosids consist of two large assemblages, Eurosids I (Fabids) and Eurosids II (Malvids), which belong to the largest group of Angiosperms, comprising of >40,000 and ∼ 15,000 species, respectively. Although the evolutionary patterns of the largest class of disease resistance genes consisting of a nucleotide binding site (NBS) and leucine-rich repeats (LRRs) have been studied in many species, systemic research of NBS-encoding genes has not been performed in different orders of Eurosids II. Here, five Eurosids II species, Gossypium raimondii, Theobroma cacao, Carica papaya, Citrus clementina, and Arabidopsis thaliana, distributing in three orders, were used to gain insights into the evolutionary patterns of the NBS-encoding genes. Our data showed that frequent copy number variations of NBS-encoding genes were found among these species. Phylogenetic tree analysis and the numbers of the NBS-encoding genes in the common ancestor of these species showed that species-specific NBS clades, including multi-copy and single copy numbers are dominant among these genes. However, not a single clade was found with only five copies, which come from all of the five species, respectively, suggesting rapid turn-over with birth and death of the NBS-encoding genes among Eurosids II species. In addition, a strong positive correlation was observed between the Toll/interleukin receptor (TIR)) type NBS-encoding genes and species-specific genes, indicating rapid gene loss and duplication. Whereas, non- TIR type NBS-encoding genes in these five species showed two distinct evolutionary patterns. (author)

  6. When naked became armored: an eight-gene phylogeny reveals monophyletic origin of theca in dinoflagellates.

    Directory of Open Access Journals (Sweden)

    Russell J S Orr

    Full Text Available The dinoflagellates are a diverse lineage of microbial eukaryotes. Dinoflagellate monophyly and their position within the group Alveolata are well established. However, phylogenetic relationships between dinoflagellate orders remain unresolved. To date, only a limited number of dinoflagellate studies have used a broad taxon sample with more than two concatenated markers. This lack of resolution makes it difficult to determine the evolution of major phenotypic characters such as morphological features or toxin production e.g. saxitoxin. Here we present an improved dinoflagellate phylogeny, based on eight genes, with the broadest taxon sampling to date. Fifty-five sequences for eight phylogenetic markers from nuclear and mitochondrial regions were amplified from 13 species, four orders, and concatenated phylogenetic inferences were conducted with orthologous sequences. Phylogenetic resolution is increased with addition of support for the deepest branches, though can be improved yet further. We show for the first time that the characteristic dinoflagellate thecal plates, cellulosic material that is present within the sub-cuticular alveoli, appears to have had a single origin. In addition, the monophyly of most dinoflagellate orders is confirmed: the Dinophysiales, the Gonyaulacales, the Prorocentrales, the Suessiales, and the Syndiniales. Our improved phylogeny, along with results of PCR to detect the sxtA gene in various lineages, allows us to suggest that this gene was probably acquired separately in Gymnodinium and the common ancestor of Alexandrium and Pyrodinium and subsequently lost in some descendent species of Alexandrium.

  7. When Naked Became Armored: An Eight-Gene Phylogeny Reveals Monophyletic Origin of Theca in Dinoflagellates (United States)

    Orr, Russell J. S.; Murray, Shauna A.; Stüken, Anke; Rhodes, Lesley; Jakobsen, Kjetill S.


    The dinoflagellates are a diverse lineage of microbial eukaryotes. Dinoflagellate monophyly and their position within the group Alveolata are well established. However, phylogenetic relationships between dinoflagellate orders remain unresolved. To date, only a limited number of dinoflagellate studies have used a broad taxon sample with more than two concatenated markers. This lack of resolution makes it difficult to determine the evolution of major phenotypic characters such as morphological features or toxin production e.g. saxitoxin. Here we present an improved dinoflagellate phylogeny, based on eight genes, with the broadest taxon sampling to date. Fifty-five sequences for eight phylogenetic markers from nuclear and mitochondrial regions were amplified from 13 species, four orders, and concatenated phylogenetic inferences were conducted with orthologous sequences. Phylogenetic resolution is increased with addition of support for the deepest branches, though can be improved yet further. We show for the first time that the characteristic dinoflagellate thecal plates, cellulosic material that is present within the sub-cuticular alveoli, appears to have had a single origin. In addition, the monophyly of most dinoflagellate orders is confirmed: the Dinophysiales, the Gonyaulacales, the Prorocentrales, the Suessiales, and the Syndiniales. Our improved phylogeny, along with results of PCR to detect the sxtA gene in various lineages, allows us to suggest that this gene was probably acquired separately in Gymnodinium and the common ancestor of Alexandrium and Pyrodinium and subsequently lost in some descendent species of Alexandrium. PMID:23185516

  8. A 380-kb Duplication in 7p22.3 Encompassing the LFNG Gene in a Boy with Asperger Syndrome

    NARCIS (Netherlands)

    Vulto-van Silfhout, A.T.; de Brouwer, A.F.; de Leeuw, N.; Obihara, C.C.; Brunner, H.G.; Vries, L.B.A. de


    De novo genomic aberrations are considered an important cause of autism spectrum disorders. We describe a de novo 380-kb gain in band p22.3 of chromosome 7 in a patient with Asperger syndrome. This duplicated region contains 9 genes including the LNFG gene that is an important regulator of NOTCH

  9. The polyphenol oxidase gene family in land plants: Lineage-specific duplication and expansion

    Directory of Open Access Journals (Sweden)

    Tran Lan T


    Full Text Available Abstract Background Plant polyphenol oxidases (PPOs are enzymes that typically use molecular oxygen to oxidize ortho-diphenols to ortho-quinones. These commonly cause browning reactions following tissue damage, and may be important in plant defense. Some PPOs function as hydroxylases or in cross-linking reactions, but in most plants their physiological roles are not known. To better understand the importance of PPOs in the plant kingdom, we surveyed PPO gene families in 25 sequenced genomes from chlorophytes, bryophytes, lycophytes, and flowering plants. The PPO genes were then analyzed in silico for gene structure, phylogenetic relationships, and targeting signals. Results Many previously uncharacterized PPO genes were uncovered. The moss, Physcomitrella patens, contained 13 PPO genes and Selaginella moellendorffii (spike moss and Glycine max (soybean each had 11 genes. Populus trichocarpa (poplar contained a highly diversified gene family with 11 PPO genes, but several flowering plants had only a single PPO gene. By contrast, no PPO-like sequences were identified in several chlorophyte (green algae genomes or Arabidopsis (A. lyrata and A. thaliana. We found that many PPOs contained one or two introns often near the 3’ terminus. Furthermore, N-terminal amino acid sequence analysis using ChloroP and TargetP 1.1 predicted that several putative PPOs are synthesized via the secretory pathway, a unique finding as most PPOs are predicted to be chloroplast proteins. Phylogenetic reconstruction of these sequences revealed that large PPO gene repertoires in some species are mostly a consequence of independent bursts of gene duplication, while the lineage leading to Arabidopsis must have lost all PPO genes. Conclusion Our survey identified PPOs in gene families of varying sizes in all land plants except in the genus Arabidopsis. While we found variation in intron numbers and positions, overall PPO gene structure is congruent with the phylogenetic

  10. Gene duplication and fragmentation in the zebra finch major histocompatibility complex

    Directory of Open Access Journals (Sweden)

    Burt David W


    Full Text Available Abstract Background Due to its high polymorphism and importance for disease resistance, the major histocompatibility complex (MHC has been an important focus of many vertebrate genome projects. Avian MHC organization is of particular interest because the chicken Gallus gallus, the avian species with the best characterized MHC, possesses a highly streamlined minimal essential MHC, which is linked to resistance against specific pathogens. It remains unclear the extent to which this organization describes the situation in other birds and whether it represents a derived or ancestral condition. The sequencing of the zebra finch Taeniopygia guttata genome, in combination with targeted bacterial artificial chromosome (BAC sequencing, has allowed us to characterize an MHC from a highly divergent and diverse avian lineage, the passerines. Results The zebra finch MHC exhibits a complex structure and history involving gene duplication and fragmentation. The zebra finch MHC includes multiple Class I and Class II genes, some of which appear to be pseudogenes, and spans a much more extensive genomic region than the chicken MHC, as evidenced by the presence of MHC genes on each of seven BACs spanning 739 kb. Cytogenetic (FISH evidence and the genome assembly itself place core MHC genes on as many as four chromosomes with TAP and Class I genes mapping to different chromosomes. MHC Class II regions are further characterized by high endogenous retroviral content. Lastly, we find strong evidence of selection acting on sites within passerine MHC Class I and Class II genes. Conclusion The zebra finch MHC differs markedly from that of the chicken, the only other bird species with a complete genome sequence. The apparent lack of synteny between TAP and the expressed MHC Class I locus is in fact reminiscent of a pattern seen in some mammalian lineages and may represent convergent evolution. Our analyses of the zebra finch MHC suggest a complex history involving

  11. Spotting and validation of a genome wide oligonucleotide chip with duplicate measurement of each gene

    International Nuclear Information System (INIS)

    Thomassen, Mads; Skov, Vibe; Eiriksdottir, Freyja; Tan, Qihua; Jochumsen, Kirsten; Fritzner, Niels; Brusgaard, Klaus; Dahlgaard, Jesper; Kruse, Torben A.


    The quality of DNA microarray based gene expression data relies on the reproducibility of several steps in a microarray experiment. We have developed a spotted genome wide microarray chip with oligonucleotides printed in duplicate in order to minimise undesirable biases, thereby optimising detection of true differential expression. The validation study design consisted of an assessment of the microarray chip performance using the MessageAmp and FairPlay labelling kits. Intraclass correlation coefficient (ICC) was used to demonstrate that MessageAmp was significantly more reproducible than FairPlay. Further examinations with MessageAmp revealed the applicability of the system. The linear range of the chips was three orders of magnitude, the precision was high, as 95% of measurements deviated less than 1.24-fold from the expected value, and the coefficient of variation for relative expression was 13.6%. Relative quantitation was more reproducible than absolute quantitation and substantial reduction of variance was attained with duplicate spotting. An analysis of variance (ANOVA) demonstrated no significant day-to-day variation

  12. Tubulin evolution in insects: gene duplication and subfunctionalization provide specialized isoforms in a functionally constrained gene family

    Directory of Open Access Journals (Sweden)

    Gadagkar Sudhindra R


    Full Text Available Abstract Background The completion of 19 insect genome sequencing projects spanning six insect orders provides the opportunity to investigate the evolution of important gene families, here tubulins. Tubulins are a family of eukaryotic structural genes that form microtubules, fundamental components of the cytoskeleton that mediate cell division, shape, motility, and intracellular trafficking. Previous in vivo studies in Drosophila find a stringent relationship between tubulin structure and function; small, biochemically similar changes in the major alpha 1 or testis-specific beta 2 tubulin protein render each unable to generate a motile spermtail axoneme. This has evolutionary implications, not a single non-synonymous substitution is found in beta 2 among 17 species of Drosophila and Hirtodrosophila flies spanning 60 Myr of evolution. This raises an important question, How do tubulins evolve while maintaining their function? To answer, we use molecular evolutionary analyses to characterize the evolution of insect tubulins. Results Sixty-six alpha tubulins and eighty-six beta tubulin gene copies were retrieved and subjected to molecular evolutionary analyses. Four ancient clades of alpha and beta tubulins are found in insects, a major isoform clade (alpha 1, beta 1 and three minor, tissue-specific clades (alpha 2-4, beta 2-4. Based on a Homarus americanus (lobster outgroup, these were generated through gene duplication events on major beta and alpha tubulin ancestors, followed by subfunctionalization in expression domain. Strong purifying selection acts on all tubulins, yet maximum pairwise amino acid distances between tubulin paralogs are large (0.464 substitutions/site beta tubulins, 0.707 alpha tubulins. Conversely orthologs, with the exception of reproductive tissue isoforms, show little sequence variation except in the last 15 carboxy terminus tail (CTT residues, which serve as sites for post-translational modifications (PTMs and interactions

  13. XX male sex reversal with genital abnormalities associated with a de novo SOX3 gene duplication. (United States)

    Moalem, Sharon; Babul-Hirji, Riyana; Stavropolous, Dmitri J; Wherrett, Diane; Bägli, Darius J; Thomas, Paul; Chitayat, David


    Differentiation of the bipotential gonad into testis is initiated by the Y chromosome-linked gene SRY (Sex-determining Region Y) through upregulation of its autosomal direct target gene SOX9 (Sry-related HMG box-containing gene 9). Sequence and chromosome homology studies have shown that SRY most probably evolved from SOX3, which in humans is located at Xq27.1. Mutations causing SOX3 loss-of-function do not affect the sex determination in mice or humans. However, transgenic mouse studies have shown that ectopic expression of Sox3 in the bipotential gonad results in upregulation of Sox9, resulting in testicular induction and XX male sex reversal. However, the mechanism by which these rearrangements cause sex reversal and the frequency with which they are associated with disorders of sex development remains unclear. Rearrangements of the SOX3 locus were identified recently in three cases of human XX male sex reversal. We report on a case of XX male sex reversal associated with a novel de novo duplication of the SOX3 gene. These data provide additional evidence that SOX3 gain-of-function in the XX bipotential gonad causes XX male sex reversal and further support the hypothesis that SOX3 is the evolutionary antecedent of SRY. Copyright © 2012 Wiley Periodicals, Inc.

  14. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    International Nuclear Information System (INIS)

    Graña, Martin; Bellinzoni, Marco; Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William; Buschiazzo, Alejandro; Alzari, Pedro M.


    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family

  15. Structure of Mycobacterium tuberculosis Rv2714, a representative of a duplicated gene family in Actinobacteria

    Energy Technology Data Exchange (ETDEWEB)

    Graña, Martin; Bellinzoni, Marco [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France); Miras, Isabelle; Fiez-Vandal, Cedric; Haouz, Ahmed; Shepard, William [Institut Pasteur, Plate-forme de Cristallogenèse et Diffraction des Rayons X, 25 Rue du Dr Roux, 75724 Paris (France); Buschiazzo, Alejandro; Alzari, Pedro M., E-mail: [Institut Pasteur, Unité de Biochimie Structurale, URA CNRS 2185, 25 Rue du Dr Roux, 75724 Paris (France)


    The crystal structure of Rv2714, a protein of unknown function from M. tuberculosis, has been determined at 2.6 Å resolution using single-wavelength anomalous diffraction methods. The gene Rv2714 from Mycobacterium tuberculosis, which codes for a hypothetical protein of unknown function, is a representative member of a gene family that is largely confined to the order Actinomycetales of Actinobacteria. Sequence analysis indicates the presence of two paralogous genes in most mycobacterial genomes and suggests that gene duplication was an ancient event in bacterial evolution. The crystal structure of Rv2714 has been determined at 2.6 Å resolution, revealing a trimer in which the topology of the protomer core is similar to that observed in a functionally diverse set of enzymes, including purine nucleoside phosphorylases, some carboxypeptidases, bacterial peptidyl-tRNA hydrolases and even the plastidic form of an intron splicing factor. However, some structural elements, such as a β-hairpin insertion involved in protein oligomerization and a C-terminal α-helical domain that serves as a lid to the putative substrate-binding (or ligand-binding) site, are only found in Rv2714 bacterial homologues and represent specific signatures of this protein family.

  16. Gene Duplication Leads to Altered Membrane Topology of a Cytochrome P450 Enzyme in Seed Plants. (United States)

    Renault, Hugues; De Marothy, Minttu; Jonasson, Gabriella; Lara, Patricia; Nelson, David R; Nilsson, IngMarie; André, François; von Heijne, Gunnar; Werck-Reichhart, Danièle


    Evolution of the phenolic metabolism was critical for the transition of plants from water to land. A cytochrome P450, CYP73, with cinnamate 4-hydroxylase (C4H) activity, catalyzes the first plant-specific and rate-limiting step in this pathway. The CYP73 gene is absent from green algae, and first detected in bryophytes. A CYP73 duplication occurred in the ancestor of seed plants and was retained in Taxaceae and most angiosperms. In spite of a clear divergence in primary sequence, both paralogs can fulfill comparable cinnamate hydroxylase roles both in vitro and in vivo. One of them seems dedicated to the biosynthesis of lignin precursors. Its N-terminus forms a single membrane spanning helix and its properties and length are highly constrained. The second is characterized by an elongated and variable N-terminus, reminiscent of ancestral CYP73s. Using as proxies the Brachypodium distachyon proteins, we show that the elongation of the N-terminus does not result in an altered subcellular localization, but in a distinct membrane topology. Insertion in the membrane of endoplasmic reticulum via a double-spanning open hairpin structure allows reorientation to the lumen of the catalytic domain of the protein. In agreement with participation to a different functional unit and supramolecular organization, the protein displays modified heme proximal surface. These data suggest the evolution of divergent C4H enzymes feeding different branches of the phenolic network in seed plants. It shows that specialization required for retention of gene duplicates may result from altered protein topology rather than change in enzyme activity. © The Author 2017. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Evolutionary history and functional divergence of the cytochrome P450 gene superfamily between Arabidopsis thaliana and Brassica species uncover effects of whole genome and tandem duplications. (United States)

    Yu, Jingyin; Tehrim, Sadia; Wang, Linhai; Dossa, Komivi; Zhang, Xiurong; Ke, Tao; Liao, Boshou


    The cytochrome P450 monooxygenase (P450) superfamily is involved in the biosynthesis of various primary and secondary metabolites. However, little is known about the effects of whole genome duplication (WGD) and tandem duplication (TD) events on the evolutionary history and functional divergence of P450s in Brassica after splitting from a common ancestor with Arabidopsis thaliana. Using Hidden Markov Model search and manual curation, we detected that Brassica species have nearly 1.4-fold as many P450 members as A. thaliana. Most P450s in A. thaliana and Brassica species were located on pseudo-chromosomes. The inferred phylogeny indicated that all P450s were clustered into two different subgroups. Analysis of WGD event revealed that different P450 gene families had appeared after evolutionary events of species. For the TD event analyses, the P450s from TD events in Brassica species can be divided into ancient and recent parts. Our comparison of influence of WGD and TD events on the P450 gene superfamily between A. thaliana and Brassica species indicated that the family-specific evolution in the Brassica lineage can be attributed to both WGD and TD, whereas WGD was recognized as the major mechanism for the recent evolution of the P450 super gene family. Expression analysis of P450s from A. thaliana and Brassica species indicated that WGD-type P450s showed the same expression pattern but completely different expression with TD-type P450s across different tissues in Brassica species. Selection force analysis suggested that P450 orthologous gene pairs between A. thaliana and Brassica species underwent negative selection, but no significant differences were found between P450 orthologous gene pairs in A. thaliana-B. rapa and A. thaliana-B. oleracea lineages, as well as in different subgenomes in B. rapa or B. oleracea compared with A. thaliana. This study is the first to investigate the effects of WGD and TD on the evolutionary history and functional divergence of P450

  18. Delineation of the species Haemophilus influenzae by phenotype, multilocus sequence phylogeny, and detection of marker genes

    DEFF Research Database (Denmark)

    Nørskov-Lauritsen, Niels; Overballe, MD; Kilian, Mogens


    To obtain more information on the much-debated definition of prokaryotic species, we investigated the borders of Haemophilus influenzae by comparative analysis of H. influenzae reference strains with closely related bacteria including strains assigned to Haemophilus haemolyticus, cryptic genospec......To obtain more information on the much-debated definition of prokaryotic species, we investigated the borders of Haemophilus influenzae by comparative analysis of H. influenzae reference strains with closely related bacteria including strains assigned to Haemophilus haemolyticus, cryptic...... genospecies biotype IV, and the never formally validated species "Haemophilus intermedius". Multilocus sequence phylogeny based on six housekeeping genes separated a cluster encompassing the type and the reference strains of H. influenzae from 31 more distantly related strains. Comparison of 16S rRNA gene...

  19. Genome-wide analysis of the Dof transcription factor gene family reveals soybean-specific duplicable and functional characteristics.

    Directory of Open Access Journals (Sweden)

    Yong Guo

    Full Text Available The Dof domain protein family is a classic plant-specific zinc-finger transcription factor family involved in a variety of biological processes. There is great diversity in the number of Dof genes in different plants. However, there are only very limited reports on the characterization of Dof transcription factors in soybean (Glycine max. In the present study, 78 putative Dof genes were identified from the whole-genome sequence of soybean. The predicted GmDof genes were non-randomly distributed within and across 19 out of 20 chromosomes and 97.4% (38 pairs were preferentially retained duplicate paralogous genes located in duplicated regions of the genome. Soybean-specific segmental duplications contributed significantly to the expansion of the soybean Dof gene family. These Dof proteins were phylogenetically clustered into nine distinct subgroups among which the gene structure and motif compositions were considerably conserved. Comparative phylogenetic analysis of these Dof proteins revealed four major groups, similar to those reported for Arabidopsis and rice. Most of the GmDofs showed specific expression patterns based on RNA-seq data analyses. The expression patterns of some duplicate genes were partially redundant while others showed functional diversity, suggesting the occurrence of sub-functionalization during subsequent evolution. Comprehensive expression profile analysis also provided insights into the soybean-specific functional divergence among members of the Dof gene family. Cis-regulatory element analysis of these GmDof genes suggested diverse functions associated with different processes. Taken together, our results provide useful information for the functional characterization of soybean Dof genes by combining phylogenetic analysis with global gene-expression profiling.

  20. Functional analysis of duplicated Symbiosis Receptor Kinase (SymRK) genes during nodulation and mycorrhizal infection in soybean (Glycine max). (United States)

    Indrasumunar, Arief; Wilde, Julia; Hayashi, Satomi; Li, Dongxue; Gresshoff, Peter M


    Association between legumes and rhizobia results in the formation of root nodules, where symbiotic nitrogen fixation occurs. The early stages of this association involve a complex of signalling events between the host and microsymbiont. Several genes dealing with early signal transduction have been cloned, and one of them encodes the leucine-rich repeat (LRR) receptor kinase (SymRK; also termed NORK). The Symbiosis Receptor Kinase gene is required by legumes to establish a root endosymbiosis with Rhizobium bacteria as well as mycorrhizal fungi. Using degenerate primer and BAC sequencing, we cloned duplicated SymRK homeologues in soybean called GmSymRKα and GmSymRKβ. These duplicated genes have high similarity of nucleotide (96%) and amino acid sequence (95%). Sequence analysis predicted a malectin-like domain within the extracellular domain of both genes. Several putative cis-acting elements were found in promoter regions of GmSymRKα and GmSymRKβ, suggesting a participation in lateral root development, cell division and peribacteroid membrane formation. The mutant of SymRK genes is not available in soybean; therefore, to know the functions of these genes, RNA interference (RNAi) of these duplicated genes was performed. For this purpose, RNAi construct of each gene was generated and introduced into the soybean genome by Agrobacterium rhizogenes-mediated hairy root transformation. RNAi of GmSymRKβ gene resulted in an increased reduction of nodulation and mycorrhizal infection than RNAi of GmSymRKα, suggesting it has the major activity of the duplicated gene pair. The results from the important crop legume soybean confirm the joint phenotypic action of GmSymRK genes in both mycorrhizal and rhizobial infection seen in model legumes. Copyright © 2015 Elsevier GmbH. All rights reserved.

  1. Gene structure, phylogeny and expression profile of the sucrose synthase gene family in cacao (Theobroma cacao L.). (United States)

    Li, Fupeng; Hao, Chaoyun; Yan, Lin; Wu, Baoduo; Qin, Xiaowei; Lai, Jianxiong; Song, Yinghui


    In higher plants, sucrose synthase (Sus, EC is widely considered as a key enzyme involved in sucrose metabolism. Although, several paralogous genes encoding different isozymes of Sus have been identified and characterized in multiple plant genomes, to date detailed information about the Sus genes is lacking for cacao. This study reports the identification of six novel Sus genes from economically important cacao tree. Analyses of the gene structure and phylogeny of the Sus genes demonstrated evolutionary conservation in the Sus family across cacao and other plant species. The expression of cacao Sus genes was investigated via real-time PCR in various tissues, different developmental phases of leaf, flower bud and pod. The Sus genes exhibited distinct but partially redundant expression profiles in cacao, with TcSus1, TcSus5 and TcSus6, being the predominant genes in the bark with phloem, TcSus2 predominantly expressing in the seed during the stereotype stage. TcSus3 and TcSus4 were significantly detected more in the pod husk and seed coat along the pod development, and showed development dependent expression profiles in the cacao pod. These results provide new insights into the evolution, and basic information that will assist in elucidating the functions of cacao Sus gene family.

  2. Phylogeny and biogeography of hawkmoths (Lepidoptera: Sphingidae: evidence from five nuclear genes.

    Directory of Open Access Journals (Sweden)

    Akito Y Kawahara


    Full Text Available The 1400 species of hawkmoths (Lepidoptera: Sphingidae comprise one of most conspicuous and well-studied groups of insects, and provide model systems for diverse biological disciplines. However, a robust phylogenetic framework for the family is currently lacking. Morphology is unable to confidently determine relationships among most groups. As a major step toward understanding relationships of this model group, we have undertaken the first large-scale molecular phylogenetic analysis of hawkmoths representing all subfamilies, tribes and subtribes.The data set consisted of 131 sphingid species and 6793 bp of sequence from five protein-coding nuclear genes. Maximum likelihood and parsimony analyses provided strong support for more than two-thirds of all nodes, including strong signal for or against nearly all of the fifteen current subfamily, tribal and sub-tribal groupings. Monophyly was strongly supported for some of these, including Macroglossinae, Sphinginae, Acherontiini, Ambulycini, Philampelini, Choerocampina, and Hemarina. Other groupings proved para- or polyphyletic, and will need significant redefinition; these include Smerinthinae, Smerinthini, Sphingini, Sphingulini, Dilophonotini, Dilophonotina, Macroglossini, and Macroglossina. The basal divergence, strongly supported, is between Macroglossinae and Smerinthinae+Sphinginae. All genes contribute significantly to the signal from the combined data set, and there is little conflict between genes. Ancestral state reconstruction reveals multiple separate origins of New World and Old World radiations.Our study provides the first comprehensive phylogeny of one of the most conspicuous and well-studied insects. The molecular phylogeny challenges current concepts of Sphingidae based on morphology, and provides a foundation for a new classification. While there are multiple independent origins of New World and Old World radiations, we conclude that broad-scale geographic distribution in hawkmoths

  3. Phylogeny of the cycads based on multiple single copy nuclear genes: congruence of concatenation and species tree inference methods (United States)

    Despite a recent new classification, a stable tree of life for the cycads has been elusive, particularly regarding resolution of Bowenia, Stangeria and Dioon. In this study we apply five single copy nuclear genes (SCNGs) to the phylogeny of the order Cycadales. We specifically aim to evaluate seve...

  4. Duplications of the neuropeptide receptor gene VIPR2 confer significant risk for schizophrenia.

    LENUS (Irish Health Repository)

    Vacic, Vladimir


    Rare copy number variants (CNVs) have a prominent role in the aetiology of schizophrenia and other neuropsychiatric disorders. Substantial risk for schizophrenia is conferred by large (>500-kilobase) CNVs at several loci, including microdeletions at 1q21.1 (ref. 2), 3q29 (ref. 3), 15q13.3 (ref. 2) and 22q11.2 (ref. 4) and microduplication at 16p11.2 (ref. 5). However, these CNVs collectively account for a small fraction (2-4%) of cases, and the relevant genes and neurobiological mechanisms are not well understood. Here we performed a large two-stage genome-wide scan of rare CNVs and report the significant association of copy number gains at chromosome 7q36.3 with schizophrenia. Microduplications with variable breakpoints occurred within a 362-kilobase region and were detected in 29 of 8,290 (0.35%) patients versus 2 of 7,431 (0.03%) controls in the combined sample. All duplications overlapped or were located within 89 kilobases upstream of the vasoactive intestinal peptide receptor gene VIPR2. VIPR2 transcription and cyclic-AMP signalling were significantly increased in cultured lymphocytes from patients with microduplications of 7q36.3. These findings implicate altered vasoactive intestinal peptide signalling in the pathogenesis of schizophrenia and indicate the VPAC2 receptor as a potential target for the development of new antipsychotic drugs.

  5. Mirror-image duplication of the primary axis and heart in Xenopus embryos by the overexpression of Msx-1 gene. (United States)

    Chen, Y; Solursh, M


    The Msx-1 gene (formerly known as Hox-7) is a member of a discrete subclass of homeobox-containing genes. Examination of the expression pattern of Msx-1 in murine and avian embryos suggests that this gene may be involved in the regionalization of the medio-lateral axis during earlier development. We have examined the possible functions of Xenopus Msx-1 during early Xenopus embryonic development by overexpression of the Msx-1 gene. Overexpression of Msx-1 causes a left-right mirror-image duplication of primary axial structures, including notochord, neural tube, somites, suckers, and foregut. The embryonic developing heart is also mirror-image duplicated, including looping directions and polarity. These results indicate that Msx-1 may be involved in the mesoderm formation as well as left-right patterning in the early Xenopus embryonic development.

  6. Segmental duplications and evolutionary acquisition of UV damage response in the SPATA31 gene family of primates and humans. (United States)

    Bekpen, Cemalettin; Künzel, Sven; Xie, Chen; Eaaswarkhanth, Muthukrishnan; Lin, Yen-Lung; Gokcumen, Omer; Akdis, Cezmi A; Tautz, Diethard


    Segmental duplications are an abundant source for novel gene functions and evolutionary adaptations. This mechanism of generating novelty was very active during the evolution of primates particularly in the human lineage. Here, we characterize the evolution and function of the SPATA31 gene family (former designation FAM75A), which was previously shown to be among the gene families with the strongest signal of positive selection in hominoids. The mouse homologue for this gene family is a single copy gene expressed during spermatogenesis. We show that in primates, the SPATA31 gene duplicated into SPATA31A and SPATA31C types and broadened the expression into many tissues. Each type became further segmentally duplicated in the line towards humans with the largest number of full-length copies found for SPATA31A in humans. Copy number estimates of SPATA31A based on digital PCR show an average of 7.5 with a range of 5-11 copies per diploid genome among human individuals. The primate SPATA31 genes also acquired new protein domains that suggest an involvement in UV response and DNA repair. We generated antibodies and show that the protein is re-localized from the nucleolus to the whole nucleus upon UV-irradiation suggesting a UV damage response. We used CRISPR/Cas mediated mutagenesis to knockout copies of the gene in human primary fibroblast cells. We find that cell lines with reduced functional copies as well as naturally occurring low copy number HFF cells show enhanced sensitivity towards UV-irradiation. The acquisition of new SPATA31 protein functions and its broadening of expression may be related to the evolution of the diurnal life style in primates that required a higher UV tolerance. The increased segmental duplications in hominoids as well as its fast evolution suggest the acquisition of further specific functions particularly in humans.

  7. Duplication of the dystroglycan gene in most branches of teleost fish

    Directory of Open Access Journals (Sweden)

    Giardina Bruno


    Full Text Available Abstract Background The dystroglycan (DG complex is a major non-integrin cell adhesion system whose multiple biological roles involve, among others, skeletal muscle stability, embryonic development and synapse maturation. DG is composed of two subunits: α-DG, extracellular and highly glycosylated, and the transmembrane β-DG, linking the cytoskeleton to the surrounding basement membrane in a wide variety of tissues. A single copy of the DG gene (DAG1 has been identified so far in humans and other mammals, encoding for a precursor protein which is post-translationally cleaved to liberate the two DG subunits. Similarly, D. rerio (zebrafish seems to have a single copy of DAG1, whose removal was shown to cause a severe dystrophic phenotype in adult animals, although it is known that during evolution, due to a whole genome duplication (WGD event, many teleost fish acquired multiple copies of several genes (paralogues. Results Data mining of pufferfish (T. nigroviridis and T. rubripes and other teleost fish (O. latipes and G. aculeatus available nucleotide sequences revealed the presence of two functional paralogous DG sequences. RT-PCR analysis proved that both the DG sequences are transcribed in T. nigroviridis. One of the two DG sequences harbours an additional mini-intronic sequence, 137 bp long, interrupting the uncomplicated exon-intron-exon pattern displayed by DAG1 in mammals and D. rerio. A similar scenario emerged also in D. labrax (sea bass, from whose genome we have cloned and sequenced a new DG sequence that also harbours a shorter additional intronic sequence of 116 bp. Western blot analysis confirmed the presence of DG protein products in all the species analysed including two teleost Antarctic species (T. bernacchii and C. hamatus. Conclusion Our evolutionary analysis has shown that the whole-genome duplication event in the Class Actinopterygii (ray-finned fish involved also DAG1. We unravelled new important molecular genetic details

  8. Cumulative Impact of Polychlorinated Biphenyl and Large Chromosomal Duplications on DNA Methylation, Chromatin, and Expression of Autism Candidate Genes. (United States)

    Dunaway, Keith W; Islam, M Saharul; Coulson, Rochelle L; Lopez, S Jesse; Vogel Ciernia, Annie; Chu, Roy G; Yasui, Dag H; Pessah, Isaac N; Lott, Paul; Mordaunt, Charles; Meguro-Horike, Makiko; Horike, Shin-Ichi; Korf, Ian; LaSalle, Janine M


    Rare variants enriched for functions in chromatin regulation and neuronal synapses have been linked to autism. How chromatin and DNA methylation interact with environmental exposures at synaptic genes in autism etiologies is currently unclear. Using whole-genome bisulfite sequencing in brain tissue and a neuronal cell culture model carrying a 15q11.2-q13.3 maternal duplication, we find that significant global DNA hypomethylation is enriched over autism candidate genes and affects gene expression. The cumulative effect of multiple chromosomal duplications and exposure to the pervasive persistent organic pollutant PCB 95 altered methylation of more than 1,000 genes. Hypomethylated genes were enriched for H2A.Z, increased maternal UBE3A in Dup15q corresponded to reduced levels of RING1B, and bivalently modified H2A.Z was altered by PCB 95 and duplication. These results demonstrate the compounding effects of genetic and environmental insults on the neuronal methylome that converge upon dysregulation of chromatin and synaptic genes. Copyright © 2016 The Author(s). Published by Elsevier Inc. All rights reserved.

  9. Biological consequences of ancient gene acquisition and duplication in the large genome soil bacterium, ""solibacter usitatus"" strain Ellin6076

    Energy Technology Data Exchange (ETDEWEB)

    Challacombe, Jean F [Los Alamos National Laboratory; Eichorst, Stephanie A [Los Alamos National Laboratory; Xie, Gary [Los Alamos National Laboratory; Kuske, Cheryl R [Los Alamos National Laboratory; Hauser, Loren [ORNL; Land, Miriam [ORNL


    Bacterial genome sizes range from ca. 0.5 to 10Mb and are influenced by gene duplication, horizontal gene transfer, gene loss and other evolutionary processes. Sequenced genomes of strains in the phylum Acidobacteria revealed that 'Solibacter usistatus' strain Ellin6076 harbors a 9.9 Mb genome. This large genome appears to have arisen by horizontal gene transfer via ancient bacteriophage and plasmid-mediated transduction, as well as widespread small-scale gene duplications. This has resulted in an increased number of paralogs that are potentially ecologically important (ecoparalogs). Low amino acid sequence identities among functional group members and lack of conserved gene order and orientation in the regions containing similar groups of paralogs suggest that most of the paralogs were not the result of recent duplication events. The genome sizes of cultured subdivision 1 and 3 strains in the phylum Acidobacteria were estimated using pulsed-field gel electrophoresis to determine the prevalence of the large genome trait within the phylum. Members of subdivision 1 were estimated to have smaller genome sizes ranging from ca. 2.0 to 4.8 Mb, whereas members of subdivision 3 had slightly larger genomes, from ca. 5.8 to 9.9 Mb. It is hypothesized that the large genome of strain Ellin6076 encodes traits that provide a selective metabolic, defensive and regulatory advantage in the variable soil environment.

  10. Phylogeny of Symbiotic Genes and the Symbiotic Properties of Rhizobia Specific to Astragalus glycyphyllos L. (United States)

    Gnat, Sebastian; Małek, Wanda; Oleńska, Ewa; Wdowiak-Wróbel, Sylwia; Kalita, Michał; Łotocka, Barbara; Wójcik, Magdalena


    The phylogeny of symbiotic genes of Astragalus glycyphyllos L. (liquorice milkvetch) nodule isolates was studied by comparative sequence analysis of nodA, nodC, nodH and nifH loci. In all these genes phylograms, liquorice milkvetch rhizobia (closely related to bacteria of three species, i.e. Mesorhizobium amorphae, Mesorhizobium septentrionale and Mesorhizobium ciceri) formed one clearly separate cluster suggesting the horizontal transfer of symbiotic genes from a single ancestor to the bacteria being studied. The high sequence similarity of the symbiotic genes of A. glycyphyllos rhizobia (99-100% in the case of nodAC and nifH genes, and 98-99% in the case of nodH one) points to the relatively recent (in evolutionary scale) lateral transfer of these genes. In the nodACH and nifH phylograms, A. glycyphyllos nodule isolates were grouped together with the genus Mesorhizobium species in one monophyletic clade, close to M. ciceri, Mesorhizobium opportunistum and Mesorhizobium australicum symbiovar biserrulae bacteria, which correlates with the close relationship of these rhizobia host plants. Plant tests revealed the narrow host range of A. glycyphyllos rhizobia. They formed effective symbiotic interactions with their native host (A. glycyphyllos) and Amorpha fruticosa but not with 11 other fabacean species. The nodules induced on A. glycyphyllos roots were indeterminate with apical, persistent meristem, an age gradient of nodule tissues and cortical vascular bundles. To reflect the symbiosis-adaptive phenotype of rhizobia, specific for A. glycyphyllos, we propose for these bacteria the new symbiovar "glycyphyllae", based on nodA and nodC genes sequences.

  11. North Carolina macular dystrophy (MCDR1) caused by a novel tandem duplication of the PRDM13 gene. (United States)

    Bowne, Sara J; Sullivan, Lori S; Wheaton, Dianna K; Locke, Kirsten G; Jones, Kaylie D; Koboldt, Daniel C; Fulton, Robert S; Wilson, Richard K; Blanton, Susan H; Birch, David G; Daiger, Stephen P


    To identify the underlying cause of disease in a large family with North Carolina macular dystrophy (NCMD). A large four-generation family (RFS355) with an autosomal dominant form of NCMD was ascertained. Family members underwent comprehensive visual function evaluations. Blood or saliva from six affected family members and three unaffected spouses was collected and DNA tested for linkage to the MCDR1 locus on chromosome 6q12. Three affected family members and two unaffected spouses underwent whole exome sequencing (WES) and subsequently, custom capture of the linkage region followed by next-generation sequencing (NGS). Standard PCR and dideoxy sequencing were used to further characterize the mutation. Of the 12 eyes examined in six affected individuals, all but two had Gass grade 3 macular degeneration features. Large central excavation of the retinal and choroid layers, referred to as a macular caldera, was seen in an age-independent manner in the grade 3 eyes. The calderas are unique to affected individuals with MCDR1. Genome-wide linkage mapping and haplotype analysis of markers from the chromosome 6q region were consistent with linkage to the MCDR1 locus. Whole exome sequencing and custom-capture NGS failed to reveal any rare coding variants segregating with the phenotype. Analysis of the custom-capture NGS sequencing data for copy number variants uncovered a tandem duplication of approximately 60 kb on chromosome 6q. This region contains two genes, CCNC and PRDM13 . The duplication creates a partial copy of CCNC and a complete copy of PRDM13 . The duplication was found in all affected members of the family and is not present in any unaffected members. The duplication was not seen in 200 ethnically matched normal chromosomes. The cause of disease in the original family with MCDR1 and several others has been recently reported to be dysregulation of the PRDM13 gene, caused by either single base substitutions in a DNase 1 hypersensitive site upstream of the CCNC

  12. Expression Pattern Similarities Support the Prediction of Orthologs Retaining Common Functions after Gene Duplication Events1[OPEN (United States)

    Haberer, Georg; Panda, Arup; Das Laha, Shayani; Ghosh, Tapas Chandra; Schäffner, Anton R.


    The identification of functionally equivalent, orthologous genes (functional orthologs) across genomes is necessary for accurate transfer of experimental knowledge from well-characterized organisms to others. This frequently relies on automated, coding sequence-based approaches such as OrthoMCL, Inparanoid, and KOG, which usually work well for one-to-one homologous states. However, this strategy does not reliably work for plants due to the occurrence of extensive gene/genome duplication. Frequently, for one query gene, multiple orthologous genes are predicted in the other genome, and it is not clear a priori from sequence comparison and similarity which one preserves the ancestral function. We have studied 11 organ-dependent and stress-induced gene expression patterns of 286 Arabidopsis lyrata duplicated gene groups and compared them with the respective Arabidopsis (Arabidopsis thaliana) genes to predict putative expressologs and nonexpressologs based on gene expression similarity. Promoter sequence divergence as an additional tool to substantiate functional orthology only partially overlapped with expressolog classification. By cloning eight A. lyrata homologs and complementing them in the respective four Arabidopsis loss-of-function mutants, we experimentally proved that predicted expressologs are indeed functional orthologs, while nonexpressologs or nonfunctionalized orthologs are not. Our study demonstrates that even a small set of gene expression data in addition to sequence homologies are instrumental in the assignment of functional orthologs in the presence of multiple orthologs. PMID:27303025

  13. New insights into the nutritional regulation of gluconeogenesis in carnivorous rainbow trout (Oncorhynchus mykiss): a gene duplication trail. (United States)

    Marandel, Lucie; Seiliez, Iban; Véron, Vincent; Skiba-Cassy, Sandrine; Panserat, Stéphane


    The rainbow trout (Oncorhynchus mykiss) is considered to be a strictly carnivorous fish species that is metabolically adapted for high catabolism of proteins and low utilization of dietary carbohydrates. This species consequently has a "glucose-intolerant" phenotype manifested by persistent hyperglycemia when fed a high-carbohydrate diet. Gluconeogenesis in adult fish is also poorly, if ever, regulated by carbohydrates, suggesting that this metabolic pathway is involved in this specific phenotype. In this study, we hypothesized that the fate of duplicated genes after the salmonid-specific 4th whole genome duplication (Ss4R) may have led to adaptive innovation and that their study might provide new elements to enhance our understanding of gluconeogenesis and poor dietary carbohydrate use in this species. Our evolutionary analysis of gluconeogenic genes revealed that pck1, pck2, fbp1a, and g6pca were retained as singletons after Ss4r, while g6pcb1, g6pcb2, and fbp1b ohnolog pairs were maintained. For all genes, duplication may have led to sub- or neofunctionalization. Expression profiles suggest that the gluconeogenesis pathway remained active in trout fed a no-carbohydrate diet. When trout were fed a high-carbohydrate diet (30%), most of the gluconeogenic genes were non- or downregulated, except for g6pbc2 ohnologs, whose RNA levels were surprisingly increased. This study demonstrates that Ss4R in trout involved adaptive innovation via gene duplication and via the outcome of the resulting ohnologs. Indeed, maintenance of ohnologous g6pcb2 pair may contribute in a significant way to the glucose-intolerant phenotype of trout and may partially explain its poor use of dietary carbohydrates. Copyright © 2015 the American Physiological Society.

  14. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template. (United States)

    Gouran, Hossein; Chakraborty, Sandeep; Rao, Basuthkar J; Asgeirsson, Bjarni; Dandekar, Abhaya


    Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC), implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF). In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  15. Evolutionary history of glucose-6-phosphatase encoding genes in vertebrate lineages: towards a better understanding of the functions of multiple duplicates. (United States)

    Marandel, Lucie; Panserat, Stéphane; Plagnes-Juan, Elisabeth; Arbenoits, Eva; Soengas, José Luis; Bobe, Julien


    Glucose-6-phosphate (G6pc) is a key enzyme involved in the regulation of the glucose homeostasis. The present study aims at revisiting and clarifying the evolutionary history of g6pc genes in vertebrates. g6pc duplications happened by successive rounds of whole genome duplication that occurred during vertebrate evolution. g6pc duplicated before or around Osteichthyes/Chondrichthyes radiation, giving rise to g6pca and g6pcb as a consequence of the second vertebrate whole genome duplication. g6pca was lost after this duplication in Sarcopterygii whereas both g6pca and g6pcb then duplicated as a consequence of the teleost-specific whole genome duplication. One g6pca duplicate was lost after this duplication in teleosts. Similarly one g6pcb2 duplicate was lost at least in the ancestor of percomorpha. The analysis of the evolution of spatial expression patterns of g6pc genes in vertebrates showed that all g6pc were mainly expressed in intestine and liver whereas teleost-specific g6pcb2 genes were mainly and surprisingly expressed in brain and heart. g6pcb2b, one gene previously hypothesised to be involved in the glucose intolerant phenotype in trout, was unexpectedly up-regulated (as it was in liver) by carbohydrates in trout telencephalon without showing significant changes in other brain regions. This up-regulation is in striking contrast with expected glucosensing mechanisms suggesting that its positive response to glucose relates to specific unknown processes in this brain area. Our results suggested that the fixation and the divergence of g6pc duplicated genes during vertebrates' evolution may lead to adaptive novelty and probably to the emergence of novel phenotypes related to glucose homeostasis.

  16. FGFR3 gene mutation plus GRB10 gene duplication in a patient with achondroplasia plus growth delay with prenatal onset. (United States)

    Yuan, Haiming; Huang, Linhuan; Hu, Xizi; Li, Qian; Sun, Xiaofang; Xie, Yingjun; Kong, Shu; Wang, Xiaoman


    Achondroplasia is a well-defined and common bone dysplasia. Genotype- and phenotype-level correlations have been found between the clinical symptoms of achondroplasia and achondroplasia-specific FGFR3 mutations. A 2-year-old boy with clinical features consistent with achondroplasia and Silver-Russell syndrome-like symptoms was found to carry a mutation in the fibroblast growth factor receptor-3 (FGFR3) gene at c.1138G > A (p.Gly380Arg) and a de novo 574 kb duplication at chromosome 7p12.1 that involved the entire growth-factor receptor bound protein 10 (GRB10) gene. Using quantitative real-time PCR analysis, GRB10 was over-expressed, and, using enzyme-linked immunosorbent assays for IGF1 and IGF-binding protein-3 (IGFBP3), we found that IGF1 and IGFBP3 were low-expressed in this patient. We demonstrate that a combination of uncommon, rare and exceptional molecular defects related to the molecular bases of particular birth defects can be analyzed and diagnosed to potentially explain the observed variability in the combination of molecular defects.

  17. Teleost Fish-Specific Preferential Retention of Pigmentation Gene-Containing Families After Whole Genome Duplications in Vertebrates (United States)

    Lorin, Thibault; Brunet, Frédéric G.; Laudet, Vincent; Volff, Jean-Nicolas


    Vertebrate pigmentation is a highly diverse trait mainly determined by neural crest cell derivatives. It has been suggested that two rounds (1R/2R) of whole-genome duplications (WGDs) at the basis of vertebrates allowed changes in gene regulation associated with neural crest evolution. Subsequently, the teleost fish lineage experienced other WGDs, including the teleost-specific Ts3R before teleost radiation and the more recent Ss4R at the basis of salmonids. As the teleost lineage harbors the highest number of pigment cell types and pigmentation diversity in vertebrates, WGDs might have contributed to the evolution and diversification of the pigmentation gene repertoire in teleosts. We have compared the impact of the basal vertebrate 1R/2R duplications with that of the teleost-specific Ts3R and salmonid-specific Ss4R WGDs on 181 gene families containing genes involved in pigmentation. We show that pigmentation genes (PGs) have been globally more frequently retained as duplicates than other genes after Ts3R and Ss4R but not after the early 1R/2R. This is also true for non-pigmentary paralogs of PGs, suggesting that the function in pigmentation is not the sole key driver of gene retention after WGDs. On the long-term, specific categories of PGs have been repeatedly preferentially retained after ancient 1R/2R and Ts3R WGDs, possibly linked to the molecular nature of their proteins (e.g., DNA binding transcriptional regulators) and their central position in protein-protein interaction networks. Taken together, our results support a major role of WGDs in the diversification of the pigmentation gene repertoire in the teleost lineage, with a possible link with the diversity of pigment cell lineages observed in these animals compared to other vertebrates. PMID:29599177

  18. Selecting Question-Specific Genes to Reduce Incongruence in Phylogenomics: A Case Study of Jawed Vertebrate Backbone Phylogeny. (United States)

    Chen, Meng-Yun; Liang, Dan; Zhang, Peng


    Incongruence between different phylogenomic analyses is the main challenge faced by phylogeneticists in the genomic era. To reduce incongruence, phylogenomic studies normally adopt some data filtering approaches, such as reducing missing data or using slowly evolving genes, to improve the signal quality of data. Here, we assembled a phylogenomic data set of 58 jawed vertebrate taxa and 4682 genes to investigate the backbone phylogeny of jawed vertebrates under both concatenation and coalescent-based frameworks. To evaluate the efficiency of extracting phylogenetic signals among different data filtering methods, we chose six highly intractable internodes within the backbone phylogeny of jawed vertebrates as our test questions. We found that our phylogenomic data set exhibits substantial conflicting signal among genes for these questions. Our analyses showed that non-specific data sets that are generated without bias toward specific questions are not sufficient to produce consistent results when there are several difficult nodes within a phylogeny. Moreover, phylogenetic accuracy based on non-specific data is considerably influenced by the size of data and the choice of tree inference methods. To address such incongruences, we selected genes that resolve a given internode but not the entire phylogeny. Notably, not only can this strategy yield correct relationships for the question, but it also reduces inconsistency associated with data sizes and inference methods. Our study highlights the importance of gene selection in phylogenomic analyses, suggesting that simply using a large amount of data cannot guarantee correct results. Constructing question-specific data sets may be more powerful for resolving problematic nodes. © The Author(s) 2015. Published by Oxford University Press, on behalf of the Society of Systematic Biologists. All rights reserved. For Permissions, please email:

  19. The chimeric gene CHRFAM7A, a partial duplication of the CHRNA7 gene, is a dominant negative regulator of α7*nAChR function. (United States)

    Araud, Tanguy; Graw, Sharon; Berger, Ralph; Lee, Michael; Neveu, Estele; Bertrand, Daniel; Leonard, Sherry


    The human α7 neuronal nicotinic acetylcholine receptor gene (CHRNA7) is a candidate gene for schizophrenia and an important drug target for cognitive deficits in the disorder. Activation of the α7*nAChR, results in opening of the channel and entry of mono- and divalent cations, including Ca(2+), that presynaptically participates to neurotransmitter release and postsynaptically to down-stream changes in gene expression. Schizophrenic patients have low levels of α7*nAChR, as measured by binding of the ligand [(125)I]-α-bungarotoxin (I-BTX). The structure of the gene, CHRNA7, is complex. During evolution, CHRNA7 was partially duplicated as a chimeric gene (CHRFAM7A), which is expressed in the human brain and elsewhere in the body. The association between a 2bp deletion in CHRFAM7A and schizophrenia suggested that this duplicate gene might contribute to cognitive impairment. To examine the putative contribution of CHRFAM7A on receptor function, co-expression of α7 and the duplicate genes was carried out in cell lines and Xenopus oocytes. Expression of the duplicate alone yielded protein expression but no functional receptor and co-expression with α7 caused a significant reduction of the amplitude of the ACh-evoked currents. Reduced current amplitude was not correlated with a reduction of I-BTX binding, suggesting the presence of non-functional (ACh-silent) receptors. This hypothesis is supported by a larger increase of the ACh-evoked current by the allosteric modulator 1-(5-chloro-2,4-dimethoxy-phenyl)-3-(5-methyl-isoxazol-3-yl)-urea (PNU-120596) in cells expressing the duplicate than in the control. These results suggest that CHRFAM7A acts as a dominant negative modulator of CHRNA7 function and is critical for receptor regulation in humans. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Multiple independent origins of mitochondrial control region duplications in the order Psittaciformes (United States)

    Schirtzinger, Erin E.; Tavares, Erika S.; Gonzales, Lauren A.; Eberhard, Jessica R.; Miyaki, Cristina Y.; Sanchez, Juan J.; Hernandez, Alexis; Müeller, Heinrich; Graves, Gary R.; Fleischer, Robert C.; Wright, Timothy F.


    Mitochondrial genomes are generally thought to be under selection for compactness, due to their small size, consistent gene content, and a lack of introns or intergenic spacers. As more animal mitochondrial genomes are fully sequenced, rearrangements and partial duplications are being identified with increasing frequency, particularly in birds (Class Aves). In this study, we investigate the evolutionary history of mitochondrial control region states within the avian order Psittaciformes (parrots and cockatoos). To this aim, we reconstructed a comprehensive multi-locus phylogeny of parrots, used PCR of three diagnostic fragments to classify the mitochondrial control region state as single or duplicated, and mapped these states onto the phylogeny. We further sequenced 44 selected species to validate these inferences of control region state. Ancestral state reconstruction using a range of weighting schemes identified six independent origins of mitochondrial control region duplications within Psittaciformes. Analysis of sequence data showed that varying levels of mitochondrial gene and tRNA homology and degradation were present within a given clade exhibiting duplications. Levels of divergence between control regions within an individual varied from 0–10.9% with the differences occurring mainly between 51 and 225 nucleotides 3′ of the goose hairpin in domain I. Further investigations into the fates of duplicated mitochondrial genes, the potential costs and benefits of having a second control region, and the complex relationship between evolutionary rates, selection, and time since duplication are needed to fully explain these patterns in the mitochondrial genome. PMID:22543055

  1. Positive selection and ancient duplications in the evolution of class B floral homeotic genes of orchids and grasses

    Directory of Open Access Journals (Sweden)

    Koch Marcus A


    Full Text Available Abstract Background Positive selection is recognized as the prevalence of nonsynonymous over synonymous substitutions in a gene. Models of the functional evolution of duplicated genes consider neofunctionalization as key to the retention of paralogues. For instance, duplicate transcription factors are specifically retained in plant and animal genomes and both positive selection and transcriptional divergence appear to have played a role in their diversification. However, the relative impact of these two factors has not been systematically evaluated. Class B MADS-box genes, comprising DEF-like and GLO-like genes, encode developmental transcription factors essential for establishment of perianth and male organ identity in the flowers of angiosperms. Here, we contrast the role of positive selection and the known divergence in expression patterns of genes encoding class B-like MADS-box transcription factors from monocots, with emphasis on the family Orchidaceae and the order Poales. Although in the monocots these two groups are highly diverse and have a strongly canalized floral morphology, there is no information on the role of positive selection in the evolution of their distinctive flower morphologies. Published research shows that in Poales, class B-like genes are expressed in stamens and in lodicules, the perianth organs whose identity might also be specified by class B-like genes, like the identity of the inner tepals of their lily-like relatives. In orchids, however, the number and pattern of expression of class B-like genes have greatly diverged. Results The DEF-like genes from Orchidaceae form four well-supported, ancient clades of orthologues. In contrast, orchid GLO-like genes form a single clade of ancient orthologues and recent paralogues. DEF-like genes from orchid clade 2 (OMADS3-like genes are under less stringent purifying selection than the other orchid DEF-like and GLO-like genes. In comparison with orchids, purifying selection

  2. Rapid genome reshaping by multiple-gene loss after whole-genome duplication in teleost fish suggested by mathematical modeling (United States)

    Sato, Yukuto; Tsukamoto, Katsumi; Nishida, Mutsumi


    Whole-genome duplication (WGD) is believed to be a significant source of major evolutionary innovation. Redundant genes resulting from WGD are thought to be lost or acquire new functions. However, the rates of gene loss and thus temporal process of genome reshaping after WGD remain unclear. The WGD shared by all teleost fish, one-half of all jawed vertebrates, was more recent than the two ancient WGDs that occurred before the origin of jawed vertebrates, and thus lends itself to analysis of gene loss and genome reshaping. Using a newly developed orthology identification pipeline, we inferred the post–teleost-specific WGD evolutionary histories of 6,892 protein-coding genes from nine phylogenetically representative teleost genomes on a time-calibrated tree. We found that rapid gene loss did occur in the first 60 My, with a loss of more than 70–80% of duplicated genes, and produced similar genomic gene arrangements within teleosts in that relatively short time. Mathematical modeling suggests that rapid gene loss occurred mainly by events involving simultaneous loss of multiple genes. We found that the subsequent 250 My were characterized by slow and steady loss of individual genes. Our pipeline also identified about 1,100 shared single-copy genes that are inferred to have become singletons before the divergence of clupeocephalan teleosts. Therefore, our comparative genome analysis suggests that rapid gene loss just after the WGD reshaped teleost genomes before the major divergence, and provides a useful set of marker genes for future phylogenetic analysis. PMID:26578810

  3. Exploiting a Reference Genome in Terms of Duplications: The Network of Paralogs and Single Copy Genes in Arabidopsis thaliana

    Directory of Open Access Journals (Sweden)

    Mara Sangiovanni


    Full Text Available Arabidopsis thaliana became the model organism for plant studies because of its small diploid genome, rapid lifecycle and short adult size. Its genome was the first among plants to be sequenced, becoming the reference in plant genomics. However, the Arabidopsis genome is characterized by an inherently complex organization, since it has undergone ancient whole genome duplications, followed by gene reduction, diploidization events and extended rearrangements, which relocated and split up the retained portions. These events, together with probable chromosome reductions, dramatically increased the genome complexity, limiting its role as a reference. The identification of paralogs and single copy genes within a highly duplicated genome is a prerequisite to understand its organization and evolution and to improve its exploitation in comparative genomics. This is still controversial, even in the widely studied Arabidopsis genome. This is also due to the lack of a reference bioinformatics pipeline that could exhaustively identify paralogs and singleton genes. We describe here a complete computational strategy to detect both duplicated and single copy genes in a genome, discussing all the methodological issues that may strongly affect the results, their quality and their reliability. This approach was used to analyze the organization of Arabidopsis nuclear protein coding genes, and besides classifying computationally defined paralogs into networks and single copy genes into different classes, it unraveled further intriguing aspects concerning the genome annotation and the gene relationships in this reference plant species. Since our results may be useful for comparative genomics and genome functional analyses, we organized a dedicated web interface to make them accessible to the scientific community.

  4. An ancient history of gene duplications, fusions and losses in the evolution of APOBEC3 mutators in mammals (United States)


    Background The APOBEC3 (A3) genes play a key role in innate antiviral defense in mammals by introducing directed mutations in the DNA. The human genome encodes for seven A3 genes, with multiple splice alternatives. Different A3 proteins display different substrate specificity, but the very basic question on how discerning self from non-self still remains unresolved. Further, the expression of A3 activity/ies shapes the way both viral and host genomes evolve. Results We present here a detailed temporal analysis of the origin and expansion of the A3 repertoire in mammals. Our data support an evolutionary scenario where the genome of the mammalian ancestor encoded for at least one ancestral A3 gene, and where the genome of the ancestor of placental mammals (and possibly of the ancestor of all mammals) already encoded for an A3Z1-A3Z2-A3Z3 arrangement. Duplication events of the A3 genes have occurred independently in different lineages: humans, cats and horses. In all of them, gene duplication has resulted in changes in enzyme activity and/or substrate specificity, in a paradigmatic example of convergent adaptive evolution at the genomic level. Finally, our results show that evolutionary rates for the three A3Z1, A3Z2 and A3Z3 motifs have significantly decreased in the last 100 Mya. The analysis constitutes a textbook example of the evolution of a gene locus by duplication and sub/neofunctionalization in the context of virus-host arms race. Conclusions Our results provide a time framework for identifying ancestral and derived genomic arrangements in the APOBEC loci, and to date the expansion of this gene family for different lineages through time, as a response to changes in viral/retroviral/retrotransposon pressure. PMID:22640020

  5. Annelid Distal-less/Dlx duplications reveal varied post-duplication fates

    Directory of Open Access Journals (Sweden)

    Korchagina Natalia


    Full Text Available Abstract Background Dlx (Distal-less genes have various developmental roles and are widespread throughout the animal kingdom, usually occurring as single copy genes in non-chordates and as multiple copies in most chordate genomes. While the genomic arrangement and function of these genes is well known in vertebrates and arthropods, information about Dlx genes in other organisms is scarce. We investigate the presence of Dlx genes in several annelid species and examine Dlx gene expression in the polychaete Pomatoceros lamarckii. Results Two Dlx genes are present in P. lamarckii, Capitella teleta and Helobdella robusta. The C. teleta Dlx genes are closely linked in an inverted tail-to-tail orientation, reminiscent of the arrangement of vertebrate Dlx pairs, and gene conversion appears to have had a role in their evolution. The H. robusta Dlx genes, however, are not on the same genomic scaffold and display divergent sequences, while, if the P. lamarckii genes are linked in a tail-to-tail orientation they are a minimum of 41 kilobases apart and show no sign of gene conversion. No expression in P. lamarckii appendage development has been observed, which conflicts with the supposed conserved role of these genes in animal appendage development. These Dlx duplications do not appear to be annelid-wide, as the polychaete Platynereis dumerilii likely possesses only one Dlx gene. Conclusions On the basis of the currently accepted annelid phylogeny, we hypothesise that one Dlx duplication occurred in the annelid lineage after the divergence of P. dumerilii from the other lineages and these duplicates then had varied evolutionary fates in different species. We also propose that the ancestral role of Dlx genes is not related to appendage development.

  6. Duplication of the IGFBP-2 gene in teleost fish: protein structure and functionality conservation and gene expression divergence.

    Directory of Open Access Journals (Sweden)

    Jianfeng Zhou

    growth and development primarily by binding to and inhibiting IGF actions in vivo. The duplicated IGFBP-2 genes may provide additional flexibility in the regulation of IGF activities.

  7. Duplication and Loss of Function of Genes Encoding RNA Polymerase III Subunit C4 Causes Hybrid Incompatibility in Rice

    Directory of Open Access Journals (Sweden)

    Giao Ngoc Nguyen


    Full Text Available Reproductive barriers are commonly observed in both animals and plants, in which they maintain species integrity and contribute to speciation. This report shows that a combination of loss-of-function alleles at two duplicated loci, DUPLICATED GAMETOPHYTIC STERILITY 1 (DGS1 on chromosome 4 and DGS2 on chromosome 7, causes pollen sterility in hybrid progeny derived from an interspecific cross between cultivated rice, Oryza sativa, and an Asian annual wild rice, O. nivara. Male gametes carrying the DGS1 allele from O. nivara (DGS1-nivaras and the DGS2 allele from O. sativa (DGS2-T65s were sterile, but female gametes carrying the same genotype were fertile. We isolated the causal gene, which encodes a protein homologous to DNA-dependent RNA polymerase (RNAP III subunit C4 (RPC4. RPC4 facilitates the transcription of 5S rRNAs and tRNAs. The loss-of-function alleles at DGS1-nivaras and DGS2-T65s were caused by weak or nonexpression of RPC4 and an absence of RPC4, respectively. Phylogenetic analysis demonstrated that gene duplication of RPC4 at DGS1 and DGS2 was a recent event that occurred after divergence of the ancestral population of Oryza from other Poaceae or during diversification of AA-genome species.

  8. Phylogeny of haemosporidian blood parasites revealed by a multi-gene approach. (United States)

    Borner, Janus; Pick, Christian; Thiede, Jenny; Kolawole, Olatunji Matthew; Kingsley, Manchang Tanyi; Schulze, Jana; Cottontail, Veronika M; Wellinghausen, Nele; Schmidt-Chanasit, Jonas; Bruchhaus, Iris; Burmester, Thorsten


    The apicomplexan order Haemosporida is a clade of unicellular blood parasites that infect a variety of reptilian, avian and mammalian hosts. Among them are the agents of human malaria, parasites of the genus Plasmodium, which pose a major threat to human health. Illuminating the evolutionary history of Haemosporida may help us in understanding their enormous biological diversity, as well as tracing the multiple host switches and associated acquisitions of novel life-history traits. However, the deep-level phylogenetic relationships among major haemosporidian clades have remained enigmatic because the datasets employed in phylogenetic analyses were severely limited in either gene coverage or taxon sampling. Using a PCR-based approach that employs a novel set of primers, we sequenced fragments of 21 nuclear genes from seven haemosporidian parasites of the genera Leucocytozoon, Haemoproteus, Parahaemoproteus, Polychromophilus and Plasmodium. After addition of genomic data from 25 apicomplexan species, the unreduced alignment comprised 20,580 bp from 32 species. Phylogenetic analyses were performed based on nucleotide, codon and amino acid data employing Bayesian inference, maximum likelihood and maximum parsimony. All analyses resulted in highly congruent topologies. We found consistent support for a basal position of Leucocytozoon within Haemosporida. In contrast to all previous studies, we recovered a sister group relationship between the genera Polychromophilus and Plasmodium. Within Plasmodium, the sauropsid and mammal-infecting lineages were recovered as sister clades. Support for these relationships was high in nearly all trees, revealing a novel phylogeny of Haemosporida, which is robust to the choice of the outgroup and the method of tree inference. Copyright © 2015 Elsevier Inc. All rights reserved.

  9. Phylogeny Reconstruction with Alignment-Free Method That Corrects for Horizontal Gene Transfer.

    Directory of Open Access Journals (Sweden)

    Raquel Bromberg


    Full Text Available Advances in sequencing have generated a large number of complete genomes. Traditionally, phylogenetic analysis relies on alignments of orthologs, but defining orthologs and separating them from paralogs is a complex task that may not always be suited to the large datasets of the future. An alternative to traditional, alignment-based approaches are whole-genome, alignment-free methods. These methods are scalable and require minimal manual intervention. We developed SlopeTree, a new alignment-free method that estimates evolutionary distances by measuring the decay of exact substring matches as a function of match length. SlopeTree corrects for horizontal gene transfer, for composition variation and low complexity sequences, and for branch-length nonlinearity caused by multiple mutations at the same site. We tested SlopeTree on 495 bacteria, 73 archaea, and 72 strains of Escherichia coli and Shigella. We compared our trees to the NCBI taxonomy, to trees based on concatenated alignments, and to trees produced by other alignment-free methods. The results were consistent with current knowledge about prokaryotic evolution. We assessed differences in tree topology over different methods and settings and found that the majority of bacteria and archaea have a core set of proteins that evolves by descent. In trees built from complete genomes rather than sets of core genes, we observed some grouping by phenotype rather than phylogeny, for instance with a cluster of sulfur-reducing thermophilic bacteria coming together irrespective of their phyla. The source-code for SlopeTree is available at:

  10. Phylogeny Reconstruction with Alignment-Free Method That Corrects for Horizontal Gene Transfer (United States)

    Grishin, Nick V.; Otwinowski, Zbyszek


    Advances in sequencing have generated a large number of complete genomes. Traditionally, phylogenetic analysis relies on alignments of orthologs, but defining orthologs and separating them from paralogs is a complex task that may not always be suited to the large datasets of the future. An alternative to traditional, alignment-based approaches are whole-genome, alignment-free methods. These methods are scalable and require minimal manual intervention. We developed SlopeTree, a new alignment-free method that estimates evolutionary distances by measuring the decay of exact substring matches as a function of match length. SlopeTree corrects for horizontal gene transfer, for composition variation and low complexity sequences, and for branch-length nonlinearity caused by multiple mutations at the same site. We tested SlopeTree on 495 bacteria, 73 archaea, and 72 strains of Escherichia coli and Shigella. We compared our trees to the NCBI taxonomy, to trees based on concatenated alignments, and to trees produced by other alignment-free methods. The results were consistent with current knowledge about prokaryotic evolution. We assessed differences in tree topology over different methods and settings and found that the majority of bacteria and archaea have a core set of proteins that evolves by descent. In trees built from complete genomes rather than sets of core genes, we observed some grouping by phenotype rather than phylogeny, for instance with a cluster of sulfur-reducing thermophilic bacteria coming together irrespective of their phyla. The source-code for SlopeTree is available at: PMID:27336403

  11. Gene duplications and losses among vertebrate deoxyribonucleoside kinases of the non-TK1 Family

    DEFF Research Database (Denmark)

    Mutahir, Zeeshan; Christiansen, Louise Slot; Clausen, Anders R.


    , among vertebrates only four mammalian dNKs have been studied for their substrate specificity and kinetic properties. However, some vertebrates, such as fish, frogs, and birds, apparently possess a duplicated homolog of deoxycytidine kinase (dCK). In this study, we characterized a family of d...... substrate specificities and subcellular localization are likely the drivers behind the evolution of vertebrate dNKs...

  12. Phylogeny and mitochondrial gene order variation in Lophotrochozoa in the light of new mitogenomic data from Nemertea

    Directory of Open Access Journals (Sweden)

    von Döhren Jörn


    Full Text Available Abstract Background The new animal phylogeny established several taxa which were not identified by morphological analyses, most prominently the Ecdysozoa (arthropods, roundworms, priapulids and others and Lophotrochozoa (molluscs, annelids, brachiopods and others. Lophotrochozoan interrelationships are under discussion, e.g. regarding the position of Nemertea (ribbon worms, which were discussed to be sister group to e.g. Mollusca, Brachiozoa or Platyhelminthes. Mitochondrial genomes contributed well with sequence data and gene order characters to the deep metazoan phylogeny debate. Results In this study we present the first complete mitochondrial genome record for a member of the Nemertea, Lineus viridis. Except two trnP and trnT, all genes are located on the same strand. While gene order is most similar to that of the brachiopod Terebratulina retusa, sequence based analyses of mitochondrial genes place nemerteans close to molluscs, phoronids and entoprocts without clear preference for one of these taxa as sister group. Conclusion Almost all recent analyses with large datasets show good support for a taxon comprising Annelida, Mollusca, Brachiopoda, Phoronida and Nemertea. But the relationships among these taxa vary between different studies. The analysis of gene order differences gives evidence for a multiple independent occurrence of a large inversion in the mitochondrial genome of Lophotrochozoa and a re-inversion of the same part in gastropods. We hypothesize that some regions of the genome have a higher chance for intramolecular recombination than others and gene order data have to be analysed carefully to detect convergent rearrangement events.

  13. A molecular phylogeny of the Cephinae (Hymenoptera, Cephidae based on mtDNA COI gene: a test of traditional classification

    Directory of Open Access Journals (Sweden)

    Mahir Budak


    Full Text Available Cephinae is traditionally divided into three tribes and about 24 genera based on morphology and host utilization. There has been no study testing the monophyly of taxa under a strict phylogenetic criterion. A molecular phylogeny of Cephinae based on a total of 68 sequences of mtDNA COI gene, representing seven genera of Cephinae, is reconstructed to test the traditional limits and relationships of taxa. Monophyly of the traditional tribes is not supported. Monophyly of the genera are largely supported except for Pachycephus. A few host shift events are suggested based on phylogenetic relationships among taxa. These results indicate that a more robust phylogeny is required for a more plausible conclusion. We also report two species of Cephus for the first time from Turkey.

  14. Mixed heterolobosean and novel gregarine lineage genes from culture ATCC 50646: Long-branch artefacts, not lateral gene transfer, distort α-tubulin phylogeny. (United States)

    Cavalier-Smith, Thomas


    Contradictory and confusing results can arise if sequenced 'monoprotist' samples really contain DNA of very different species. Eukaryote-wide phylogenetic analyses using five genes from the amoeboflagellate culture ATCC 50646 previously implied it was an undescribed percolozoan related to percolatean flagellates (Stephanopogon, Percolomonas). Contrastingly, three phylogenetic analyses of 18S rRNA alone, did not place it within Percolozoa, but as an isolated deep-branching excavate. I resolve that contradiction by sequence phylogenies for all five genes individually, using up to 652 taxa. Its 18S rRNA sequence (GQ377652) is near-identical to one from stained-glass windows, somewhat more distant from one from cooling-tower water, all three related to terrestrial actinocephalid gregarines Hoplorhynchus and Pyxinia. All four protein-gene sequences (Hsp90; α-tubulin; β-tubulin; actin) are from an amoeboflagellate heterolobosean percolozoan, not especially deeply branching. Contrary to previous conclusions from trees combining protein and rRNA sequences or rDNA trees including Eozoa only, this culture does not represent a major novel deep-branching eukaryote lineage distinct from Heterolobosea, and thus lacks special significance for deep eukaryote phylogeny, though the rDNA sequence is important for gregarine phylogeny. α-Tubulin trees for over 250 eukaryotes refute earlier suggestions of lateral gene transfer within eukaryotes, being largely congruent with morphology and other gene trees. Copyright © 2015. Published by Elsevier GmbH.

  15. Divergence of the bZIP Gene Family in Strawberry, Peach, and Apple Suggests Multiple Modes of Gene Evolution after Duplication

    Directory of Open Access Journals (Sweden)

    Xiao-Long Wang


    Full Text Available The basic leucine zipper (bZIP transcription factors are the most diverse members of dimerizing transcription factors. In the present study, 50, 116, and 47 bZIP genes were identified in Malus domestica (apple, Prunus persica (peach, and Fragaria vesca (strawberry, respectively. Species-specific duplication was the main contributor to the large number of bZIPs observed in apple. After WGD in apple genome, orthologous bZIP genes corresponding to strawberry on duplicated regions in apple genome were retained. However, in peach ancestor, these syntenic regions were quickly lost or deleted. Maybe the positive selection contributed to the expansion of clade S to adapt to the development and environment stresses. In addition, purifying selection was mainly responsible for bZIP sequence-specific DNA binding. The analysis of orthologous pairs between chromosomes indicates that these orthologs derived from one gene duplication located on one of the nine ancient chromosomes in the Rosaceae. The comparative analysis of bZIP genes in three species provides information on the evolutionary fate of bZIP genes in apple and peach after they diverged from strawberry.

  16. An ancient duplication of exon 5 in the Snap25 gene is required for complex neuronal development/function.

    Directory of Open Access Journals (Sweden)

    Jenny U Johansson


    Full Text Available Alternative splicing is an evolutionary innovation to create functionally diverse proteins from a limited number of genes. SNAP-25 plays a central role in neuroexocytosis by bridging synaptic vesicles to the plasma membrane during regulated exocytosis. The SNAP-25 polypeptide is encoded by a single copy gene, but in higher vertebrates a duplication of exon 5 has resulted in two mutually exclusive splice variants, SNAP-25a and SNAP-25b. To address a potential physiological difference between the two SNAP-25 proteins, we generated gene targeted SNAP-25b deficient mouse mutants by replacing the SNAP-25b specific exon with a second SNAP-25a equivalent. Elimination of SNAP-25b expression resulted in developmental defects, spontaneous seizures, and impaired short-term synaptic plasticity. In adult mutants, morphological changes in hippocampus and drastically altered neuropeptide expression were accompanied by severe impairment of spatial learning. We conclude that the ancient exon duplication in the Snap25 gene provides additional SNAP-25-function required for complex neuronal processes in higher eukaryotes.

  17. A new resource for characterizing X-linked genes in Drosophila melanogaster: systematic coverage and subdivision of the X chromosome with nested, Y-linked duplications. (United States)

    Cook, R Kimberley; Deal, Megan E; Deal, Jennifer A; Garton, Russell D; Brown, C Adam; Ward, Megan E; Andrade, Rachel S; Spana, Eric P; Kaufman, Thomas C; Cook, Kevin R


    Interchromosomal duplications are especially important for the study of X-linked genes. Males inheriting a mutation in a vital X-linked gene cannot survive unless there is a wild-type copy of the gene duplicated elsewhere in the genome. Rescuing the lethality of an X-linked mutation with a duplication allows the mutation to be used experimentally in complementation tests and other genetic crosses and it maps the mutated gene to a defined chromosomal region. Duplications can also be used to screen for dosage-dependent enhancers and suppressors of mutant phenotypes as a way to identify genes involved in the same biological process. We describe an ongoing project in Drosophila melanogaster to generate comprehensive coverage and extensive breakpoint subdivision of the X chromosome with megabase-scale X segments borne on Y chromosomes. The in vivo method involves the creation of X inversions on attached-XY chromosomes by FLP-FRT site-specific recombination technology followed by irradiation to induce large internal X deletions. The resulting chromosomes consist of the X tip, a medial X segment placed near the tip by an inversion, and a full Y. A nested set of medial duplicated segments is derived from each inversion precursor. We have constructed a set of inversions on attached-XY chromosomes that enable us to isolate nested duplicated segments from all X regions. To date, our screens have provided a minimum of 78% X coverage with duplication breakpoints spaced a median of nine genes apart. These duplication chromosomes will be valuable resources for rescuing and mapping X-linked mutations and identifying dosage-dependent modifiers of mutant phenotypes.

  18. Dinoflagellate phylogeny as inferred from heat shock protein 90 and ribosomal gene sequences.

    Directory of Open Access Journals (Sweden)

    Mona Hoppenrath


    Full Text Available Interrelationships among dinoflagellates in molecular phylogenies are largely unresolved, especially in the deepest branches. Ribosomal DNA (rDNA sequences provide phylogenetic signals only at the tips of the dinoflagellate tree. Two reasons for the poor resolution of deep dinoflagellate relationships using rDNA sequences are (1 most sites are relatively conserved and (2 there are different evolutionary rates among sites in different lineages. Therefore, alternative molecular markers are required to address the deeper phylogenetic relationships among dinoflagellates. Preliminary evidence indicates that the heat shock protein 90 gene (Hsp90 will provide an informative marker, mainly because this gene is relatively long and appears to have relatively uniform rates of evolution in different lineages.We more than doubled the previous dataset of Hsp90 sequences from dinoflagellates by generating additional sequences from 17 different species, representing seven different orders. In order to concatenate the Hsp90 data with rDNA sequences, we supplemented the Hsp90 sequences with three new SSU rDNA sequences and five new LSU rDNA sequences. The new Hsp90 sequences were generated, in part, from four additional heterotrophic dinoflagellates and the type species for six different genera. Molecular phylogenetic analyses resulted in a paraphyletic assemblage near the base of the dinoflagellate tree consisting of only athecate species. However, Noctiluca was never part of this assemblage and branched in a position that was nested within other lineages of dinokaryotes. The phylogenetic trees inferred from Hsp90 sequences were consistent with trees inferred from rDNA sequences in that the backbone of the dinoflagellate clade was largely unresolved.The sequence conservation in both Hsp90 and rDNA sequences and the poor resolution of the deepest nodes suggests that dinoflagellates reflect an explosive radiation in morphological diversity in their recent

  19. Phylogeny of Celastraceae tribe Euonymeae inferred from morphological characters and nuclear and plastid genes. (United States)

    Simmons, Mark P; McKenna, Miles J; Bacon, Christine D; Yakobson, Kendra; Cappa, Jennifer J; Archer, Robert H; Ford, Andrew J


    The phylogeny of Celastraceae tribe Euonymeae (≈ 230 species in eight genera in both the Old and New Worlds) was inferred using morphological characters together with plastid (matK, trnL-F) and nuclear (ITS and 26S rDNA) genes. Tribe Euonymeae has been defined as those genera of Celastraceae with generally opposite leaves, isomerous carpels, loculicidally dehiscent capsules, and arillate seeds (except Microtropis). Euonymus is the most diverse (129 species) and widely cultivated genus in the tribe. We infer that tribe Euonymeae consists of at least six separate lineages within Celastraceae and that a revised natural classification of the family is needed. Microtropis and Quetzalia are inferred to be distinct sister groups that together are sister to Zinowiewia. The endangered Monimopetalum chinense is an isolated and early derived lineage of Celastraceae that represents an important component of phylogenetic diversity within the family. Hedraianthera is sister to Brassiantha, and we describe a second species (Brassiantha hedraiantheroides A.J. Ford) that represents the first reported occurrence of this genus in Australia. Euonymus globularis, from eastern Australia, is sister to Menepetalum, which is endemic to New Caledonia, and we erect a new genus (Dinghoua R.H. Archer) for it. The Madagascan species of Euonymus are sister to Pleurostylia and recognized as a distinct genus (Astrocassine ined.). Glyptopetalum, Torralbasia, and Xylonymus are all closely related to Euonymus sensu stricto and are questionably distinct from it. Current intrageneric classifications of Euonymus are not completely natural and require revision. Copyright © 2011 Elsevier Inc. All rights reserved.

  20. Phylogeny of the Celastraceae inferred from phytochrome B gene sequence and morphology. (United States)

    Simmons, M P; Clevinger, C C; Savolainen, V; Archer, R H; Mathews, S; Doyle, J J


    Phylogenetic relationships within Celastraceae were inferred using a simultaneous analysis of 61 morphological characters and 1123 base pairs of phytochrome B exon 1 from the nuclear genome. No gaps were inferred, and the gene tree topology suggests that the primers were specific to a single locus that did not duplicate among the lineages sampled. This region of phytochrome B was most useful for examining relationships among closely related genera. Fifty-one species from 38 genera of Celastraceae were sampled. The Celastraceae sensu lato (including Hippocrateaceae) were resolved as a monophyletic group. Loesener's subfamilies and tribes of Celastraceae were not supported. The Hippocrateaceae were resolved as a monophyletic group nested within a paraphyletic Celastraceae sensu stricto. Goupia was resolved as more closely related to Euphorbiaceae, Corynocarpaceae, and Linaceae than to Celastraceae. Plagiopteron (Flacourtiaceae) was resolved as the sister group of Hippocrateoideae. Brexia (Brexiaceae) was resolved as closely related to Elaeodendron and Pleurostylia. Canotia was resolved as the sister group of Acanthothamnus within Celastraceae. Perrottetia and Mortonia were resolved as the sister group of the rest of the Celastraceae. Siphonodon was resolved as a derived member of Celastraceae. Maytenus was resolved as three disparate groups, suggesting that this large genus needs to be recircumscribed.

  1. Dissecting a Hidden Gene Duplication: The Arabidopsis thaliana SEC10 Locus

    Czech Academy of Sciences Publication Activity Database

    Vukašinović, Nemanja; Cvrčková, F.; Eliáš, M.; Cole, R.; Fowler, J.E.; Žárský, Viktor; Synek, Lukáš


    Roč. 9, č. 4 (2014) E-ISSN 1932-6203 R&D Projects: GA ČR GPP501/11/P853; GA ČR(CZ) GAP305/11/1629 Grant - others:GA MŠk ME10033 Institutional support: RVO:61389030 Keywords : WHOLE-GENOME * ARABIDOPSIS-THALIANA * RECENT SEGMENTAL DUPLICATIONS Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.234, year: 2014

  2. Phylogeny of Mycobacterium tuberculosis Beijing strains constructed from polymorphisms in genes involved in DNA replication, recombination and repair. (United States)

    Mestre, Olga; Luo, Tao; Dos Vultos, Tiago; Kremer, Kristin; Murray, Alan; Namouchi, Amine; Jackson, Céline; Rauzier, Jean; Bifani, Pablo; Warren, Rob; Rasolofo, Voahangy; Mei, Jian; Gao, Qian; Gicquel, Brigitte


    The Beijing family is a successful group of M. tuberculosis strains, often associated with drug resistance and widely distributed throughout the world. Polymorphic genetic markers have been used to type particular M. tuberculosis strains. We recently identified a group of polymorphic DNA repair replication and recombination (3R) genes. It was shown that evolution of M. tuberculosis complex strains can be studied using 3R SNPs and a high-resolution tool for strain discrimination was developed. Here we investigated the genetic diversity and propose a phylogeny for Beijing strains by analyzing polymorphisms in 3R genes. A group of 3R genes was sequenced in a collection of Beijing strains from different geographic origins. Sequence analysis and comparison with the ones of non-Beijing strains identified several SNPs. These SNPs were used to type a larger collection of Beijing strains and allowed identification of 26 different sequence types for which a phylogeny was constructed. Phylogenetic relationships established by sequence types were in agreement with evolutionary pathways suggested by other genetic markers, such as Large Sequence Polymorphisms (LSPs). A recent Beijing genotype (Bmyc10), which included 60% of strains from distinct parts of the world, appeared to be predominant. We found SNPs in 3R genes associated with the Beijing family, which enabled discrimination of different groups and the proposal of a phylogeny. The Beijing family can be divided into different groups characterized by particular genetic polymorphisms that may reflect pathogenic features. These SNPs are new, potential genetic markers that may contribute to better understand the success of the Beijing family.

  3. Phylogeny of Mycobacterium tuberculosis Beijing strains constructed from polymorphisms in genes involved in DNA replication, recombination and repair.

    Directory of Open Access Journals (Sweden)

    Olga Mestre


    Full Text Available The Beijing family is a successful group of M. tuberculosis strains, often associated with drug resistance and widely distributed throughout the world. Polymorphic genetic markers have been used to type particular M. tuberculosis strains. We recently identified a group of polymorphic DNA repair replication and recombination (3R genes. It was shown that evolution of M. tuberculosis complex strains can be studied using 3R SNPs and a high-resolution tool for strain discrimination was developed. Here we investigated the genetic diversity and propose a phylogeny for Beijing strains by analyzing polymorphisms in 3R genes.A group of 3R genes was sequenced in a collection of Beijing strains from different geographic origins. Sequence analysis and comparison with the ones of non-Beijing strains identified several SNPs. These SNPs were used to type a larger collection of Beijing strains and allowed identification of 26 different sequence types for which a phylogeny was constructed. Phylogenetic relationships established by sequence types were in agreement with evolutionary pathways suggested by other genetic markers, such as Large Sequence Polymorphisms (LSPs. A recent Beijing genotype (Bmyc10, which included 60% of strains from distinct parts of the world, appeared to be predominant.We found SNPs in 3R genes associated with the Beijing family, which enabled discrimination of different groups and the proposal of a phylogeny. The Beijing family can be divided into different groups characterized by particular genetic polymorphisms that may reflect pathogenic features. These SNPs are new, potential genetic markers that may contribute to better understand the success of the Beijing family.

  4. Resolution of deep eudicot phylogeny and their temporal diversification using nuclear genes from transcriptomic and genomic datasets. (United States)

    Zeng, Liping; Zhang, Ning; Zhang, Qiang; Endress, Peter K; Huang, Jie; Ma, Hong


    Explosive diversification is widespread in eukaryotes, making it difficult to resolve phylogenetic relationships. Eudicots contain c. 75% of extant flowering plants, are important for human livelihood and terrestrial ecosystems, and have probably experienced explosive diversifications. The eudicot phylogenetic relationships, especially among those of the Pentapetalae, remain unresolved. Here, we present a highly supported eudicot phylogeny and diversification rate shifts using 31 newly generated transcriptomes and 88 other datasets covering 70% of eudicot orders. A highly supported eudicot phylogeny divided Pentapetalae into two groups: one with rosids, Saxifragales, Vitales and Santalales; the other containing asterids, Caryophyllales and Dilleniaceae, with uncertainty for Berberidopsidales. Molecular clock analysis estimated that crown eudicots originated c. 146 Ma, considerably earlier than earliest tricolpate pollen fossils and most other molecular clock estimates, and Pentapetalae sequentially diverged into eight major lineages within c. 15 Myr. Two identified increases of diversification rate are located in the stems leading to Pentapetalae and asterids, and lagged behind the gamma hexaploidization. The nuclear genes from newly generated transcriptomes revealed a well-resolved eudicot phylogeny, sequential separation of major core eudicot lineages and temporal mode of diversifications, providing new insights into the evolutionary trend of morphologies and contributions to the diversification of eudicots. © 2017 The Authors. New Phytologist © 2017 New Phytologist Trust.

  5. RANGER-DTL 2.0: Rigorous Reconstruction of Gene-Family Evolution by Duplication, Transfer, and Loss. (United States)

    Bansal, Mukul S; Kellis, Manolis; Kordi, Misagh; Kundu, Soumya


    RANGER-DTL 2.0 is a software program for inferring gene family evolution using Duplication-Transfer-Loss reconciliation. This new software is highly scalable and easy to use, and offers many new features not currently available in any other reconciliation program. RANGER-DTL 2.0 has a particular focus on reconciliation accuracy and can account for many sources of reconciliation uncertainty including uncertain gene tree rooting, gene tree topological uncertainty, multiple optimal reconciliations, and alternative event cost assignments. RANGER-DTL 2.0 is open-source and written in C ++ and Python. Pre-compiled executables, source code (open-source under GNU GPL), and a detailed manual are freely available from

  6. Selection shaped the evolution of mouse androgen-binding protein (ABP) function and promoted the duplication of Abp genes. (United States)

    Karn, Robert C; Laukaitis, Christina M


    In the present article, we summarize two aspects of our work on mouse ABP (androgen-binding protein): (i) the sexual selection function producing incipient reinforcement on the European house mouse hybrid zone, and (ii) the mechanism behind the dramatic expansion of the Abp gene region in the mouse genome. Selection unifies these two components, although the ways in which selection has acted differ. At the functional level, strong positive selection has acted on key sites on the surface of one face of the ABP dimer, possibly to influence binding to a receptor. A different kind of selection has apparently driven the recent and rapid expansion of the gene region, probably by increasing the amount of Abp transcript, in one or both of two ways. We have shown previously that groups of Abp genes behave as LCRs (low-copy repeats), duplicating as relatively large blocks of genes by NAHR (non-allelic homologous recombination). The second type of selection involves the close link between the accumulation of L1 elements and the expansion of the Abp gene family by NAHR. It is probably predicated on an initial selection for increased transcription of existing Abp genes and/or an increase in Abp gene number providing more transcriptional sites. Either or both could increase initial transcript production, a quantitative change similar to increasing the volume of a radio transmission. In closing, we also provide a note on Abp gene nomenclature.

  7. Identification of a rare 17p13.3 duplication including the BHLHA9 and YWHAE genes in a family with developmental delay and behavioural problems

    Directory of Open Access Journals (Sweden)

    Capra Valeria


    Full Text Available Abstract Background Deletions and duplications of the PAFAH1B1 and YWHAE genes in 17p13.3 are associated with different clinical phenotypes. In particular, deletion of PAFAH1B1 causes isolated lissencephaly while deletions involving both PAFAH1B1 and YWHAE cause Miller-Dieker syndrome. Isolated duplications of PAFAH1B1 have been associated with mild developmental delay and hypotonia, while isolated duplications of YWHAE have been associated with autism. In particular, different dysmorphic features associated with PAFAH1B1 or YWHAE duplication have suggested the need to classify the patient clinical features in two groups according to which gene is involved in the chromosomal duplication. Methods We analyze the proband and his family by classical cytogenetic and array-CGH analyses. The putative rearrangement was confirmed by fluorescence in situ hybridization. Results We have identified a family segregating a 17p13.3 duplication extending 329.5 kilobases by FISH and array-CGH involving the YWHAE gene, but not PAFAH1B1, affected by a mild dysmorphic phenotype with associated autism and mental retardation. We propose that BHLHA9, YWHAE, and CRK genes contribute to the phenotype of our patient. The small chromosomal duplication was inherited from his mother who was affected by a bipolar and borderline disorder and was alcohol addicted. Conclusions We report an additional familial case of small 17p13.3 chromosomal duplication including only BHLHA9, YWHAE, and CRK genes. Our observation and further cases with similar microduplications are expected to be diagnosed, and will help better characterise the clinical spectrum of phenotypes associated with 17p13.3 microduplications.

  8. BPhyOG: An interactive server for genome-wide inference of bacterial phylogenies based on overlapping genes

    Directory of Open Access Journals (Sweden)

    Lin Kui


    Full Text Available Abstract Background Overlapping genes (OGs in bacterial genomes are pairs of adjacent genes of which the coding sequences overlap partly or entirely. With the rapid accumulation of sequence data, many OGs in bacterial genomes have now been identified. Indeed, these might prove a consistent feature across all microbial genomes. Our previous work suggests that OGs can be considered as robust markers at the whole genome level for the construction of phylogenies. An online, interactive web server for inferring phylogenies is needed for biologists to analyze phylogenetic relationships among a set of bacterial genomes of interest. Description BPhyOG is an online interactive server for reconstructing the phylogenies of completely sequenced bacterial genomes on the basis of their shared overlapping genes. It provides two tree-reconstruction methods: Neighbor Joining (NJ and Unweighted Pair-Group Method using Arithmetic averages (UPGMA. Users can apply the desired method to generate phylogenetic trees, which are based on an evolutionary distance matrix for the selected genomes. The distance between two genomes is defined by the normalized number of their shared OG pairs. BPhyOG also allows users to browse the OGs that were used to infer the phylogenetic relationships. It provides detailed annotation for each OG pair and the features of the component genes through hyperlinks. Users can also retrieve each of the homologous OG pairs that have been determined among 177 genomes. It is a useful tool for analyzing the tree of life and overlapping genes from a genomic standpoint. Conclusion BPhyOG is a useful interactive web server for genome-wide inference of any potential evolutionary relationship among the genomes selected by users. It currently includes 177 completely sequenced bacterial genomes containing 79,855 OG pairs, the annotation and homologous OG pairs of which are integrated comprehensively. The reliability of phylogenies complemented by

  9. Gene Duplication of the zebrafish kit ligand and partitioning of melanocyte development functions to kit ligand a.

    Directory of Open Access Journals (Sweden)

    Keith A Hultman


    Full Text Available The retention of particular genes after the whole genome duplication in zebrafish has given insights into how genes may evolve through partitioning of ancestral functions. We examine the partitioning of expression patterns and functions of two zebrafish kit ligands, kit ligand a (kitla and kit ligand b (kitlb, and discuss their possible coevolution with the duplicated zebrafish kit receptors (kita and kitb. In situ hybridizations show that kitla mRNA is expressed in the trunk adjacent to the notochord in the middle of each somite during stages of melanocyte migration and later expressed in the skin, when the receptor is required for melanocyte survival. kitla is also expressed in other regions complementary to kita receptor expression, including the pineal gland, tail bud, and ear. In contrast, kitlb mRNA is expressed in brain ventricles, ear, and cardinal vein plexus, in regions generally not complementary to either zebrafish kit receptor ortholog. However, like kitla, kitlb is expressed in the skin during stages consistent with melanocyte survival. Thus, it appears that kita and kitla have maintained congruent expression patterns, while kitb and kitlb have evolved divergent expression patterns. We demonstrate the interaction of kita and kitla by morpholino knockdown analysis. kitla morphants, but not kitlb morphants, phenocopy the null allele of kita, with defects for both melanocyte migration and survival. Furthermore, kitla morpholino, but not kitlb morpholino, interacts genetically with a sensitized allele of kita, confirming that kitla is the functional ligand to kita. Last, we examine kitla overexpression in embryos, which results in hyperpigmentation caused by an increase in the number and size of melanocytes. This hyperpigmentation is dependent on kita function. We conclude that following genome duplication, kita and kitla have maintained their receptor-ligand relationship, coevolved complementary expression patterns, and that

  10. Duplication and independent selection of cell-wall invertase genes GIF1 and OsCIN1 during rice evolution and domestication

    Directory of Open Access Journals (Sweden)

    Ge Song


    Full Text Available Abstract Background Various evolutionary models have been proposed to interpret the fate of paralogous duplicates, which provides substrates on which evolution selection could act. In particular, domestication, as a special selection, has played important role in crop cultivation with divergence of many genes controlling important agronomic traits. Recent studies have indicated that a pair of duplicate genes was often sub-functionalized from their ancestral functions held by the parental genes. We previously demonstrated that the rice cell-wall invertase (CWI gene GIF1 that plays an important role in the grain-filling process was most likely subjected to domestication selection in the promoter region. Here, we report that GIF1 and another CWI gene OsCIN1 constitute a pair of duplicate genes with differentiated expression and function through independent selection. Results Through synteny analysis, we show that GIF1 and another cell-wall invertase gene OsCIN1 were paralogues derived from a segmental duplication originated during genome duplication of grasses. Results based on analyses of population genetics and gene phylogenetic tree of 25 cultivars and 25 wild rice sequences demonstrated that OsCIN1 was also artificially selected during rice domestication with a fixed mutation in the coding region, in contrast to GIF1 that was selected in the promoter region. GIF1 and OsCIN1 have evolved into different expression patterns and probable different kinetics parameters of enzymatic activity with the latter displaying less enzymatic activity. Overexpression of GIF1 and OsCIN1 also resulted in different phenotypes, suggesting that OsCIN1 might regulate other unrecognized biological process. Conclusion How gene duplication and divergence contribute to genetic novelty and morphological adaptation has been an interesting issue to geneticists and biologists. Our discovery that the duplicated pair of GIF1 and OsCIN1 has experienced sub

  11. Relaxin gene family in teleosts: phylogeny, syntenic mapping, selective constraint, andexpression analysis

    Directory of Open Access Journals (Sweden)

    Glen Peter


    Full Text Available Abstract Background In recent years, the relaxin family of signaling molecules has been shown to play diverse roles in mammalian physiology, but little is known about its diversity or physiology in teleosts, an infraclass of the bony fishes comprising ~ 50% of all extant vertebrates. In this paper, 32 relaxin family sequences were obtained by searching genomic and cDNA databases from eight teleost species; phylogenetic, molecular evolutionary, and syntenic data analyses were conducted to understand the relationship and differential patterns of evolution of relaxin family genes in teleosts compared with mammals. Additionally, real-time quantitative PCR was used to confirm and assess the tissues of expression of five relaxin family genes in Danio rerio and in situ hybridization used to assess the site-specific expression of the insulin 3-like gene in D. rerio testis. Results Up to six relaxin family genes were identified in each teleost species. Comparative syntenic mapping revealed that fish possess two paralogous copies of human RLN3, which we call rln3a and rln3b, an orthologue of human RLN2, rln, two paralogous copies of human INSL5, insl5a and insl5b, and an orthologue of human INSL3, insl3. Molecular evolutionary analyses indicated that: rln3a, rln3b and rln are under strong evolutionary constraint, that insl3 has been subject to moderate rates of sequence evolution with two amino acids in insl3/INSL3 showing evidence of positively selection, and that insl5b exhibits a higher rate of sequence evolution than its paralogue insl5a suggesting that it may have been neo-functionalized after the teleost whole genome duplication. Quantitative PCR analyses in D. rerio indicated that rln3a and rln3b are expressed in brain, insl3 is highly expressed in gonads, and that there was low expression of both insl5 genes in adult zebrafish. Finally, in situ hybridization of insl3 in D. rerio testes showed highly specific hybridization to interstitial Leydig

  12. A multi gene sequence-based phylogeny of the Musaceae (banana) family

    Czech Academy of Sciences Publication Activity Database

    Christelová, Pavla; Valárik, Miroslav; Hřibová, Eva; De Langhe, E.; Doležel, Jaroslav


    Roč. 11, č. 103 (2011), s. 1-13 ISSN 1471-2148 R&D Projects: GA AV ČR IAA600380703 Institutional research plan: CEZ:AV0Z50380511 Keywords : MOLECULAR PHYLOGENY * FLOWERING PLANTS * RIBOSOMAL DNA Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.521, year: 2011

  13. Discrimination of Deletion and Duplication Subtypes of the Deleted in Azoospermia Gene Family in the Context of Frequent Interloci Gene Conversion (United States)

    Vaszkó, Tibor; Papp, János; Krausz, Csilla; Casamonti, Elena; Géczi, Lajos; Olah, Edith


    Due to its palindromic setup, AZFc (Azoospermia Factor c) region of chromosome Y is one of the most unstable regions of the human genome. It contains eight gene families expressed mainly in the testes. Several types of rearrangement resulting in changes in the cumulative copy number of the gene families were reported to be associated with diseases such as male infertility and testicular germ cell tumors. The best studied AZFc rearrangement is gr/gr deletion. Its carriers show widespread phenotypic variation from azoospermia to normospermia. This phenomenon was initially attributed to different gr/gr subtypes that would eliminate distinct members of the affected gene families. However, studies conducted to confirm this hypothesis have brought controversial results, perhaps, in part, due to the shortcomings of the utilized subtyping methodology. This proof-of-concept paper is meant to introduce here a novel method aimed at subtyping AZFc rearrangements. It is able to differentiate the partial deletion and partial duplication subtypes of the Deleted in Azoospermia (DAZ) gene family. The keystone of the method is the determination of the copy number of the gene family member-specific variant(s) in a series of sequence family variant (SFV) positions. Most importantly, we present a novel approach for the correct interpretation of the variant copy number data to determine the copy number of the individual DAZ family members in the context of frequent interloci gene conversion.Besides DAZ1/DAZ2 and DAZ3/DAZ4 deletions, not yet described rearrangements such as DAZ2/DAZ4 deletion and three duplication subtypes were also found by the utilization of the novel approach. A striking feature is the extremely high concordance among the individual data pointing to a certain type of rearrangement. In addition to being able to identify DAZ deletion subtypes more reliably than the methods used previously, this approach is the first that can discriminate DAZ duplication subtypes as well

  14. A case report: Becker muscular dystrophy presenting with epilepsy and dysgnosia induced by duplication mutation of Dystrophin gene. (United States)

    Miao, Jing; Feng, Jia-Chun; Zhu, Dan; Yu, Xue-Fan


    Becker muscular dystrophy (BMD), a genetic disorder of X-linked recessive inheritance, typically presents with gradually progressive muscle weakness. The condition is caused by mutations of Dystrophin gene located at Xp21.2. Epilepsy is an infrequent manifestation of BMD, while cases of BMD with dysgnosia are extremely rare. We describe a 9-year-old boy with BMD, who presented with epilepsy and dysgnosia. Serum creatine kinase level was markedly elevated (3665 U/L). Wechsler intelligence tests showed a low intelligence quotient (IQ = 65). Electromyogram showed slight myogenic changes and skeletal muscle biopsy revealed muscular dystrophy. Immunohistochemical staining showed partial positivity of sarcolemma for dystrophin-N. Multiplex ligation-dependent probe amplification revealed a duplication mutation in exons 37-44 in the Dystrophin gene. The present case report helps to better understand the clinical and genetic features of BMD.

  15. Genomic evidence of gene duplication and adaptive evolution of Toll like receptors (TLR2 and TLR4) in reptiles. (United States)

    Shang, Shuai; Zhong, Huaming; Wu, Xiaoyang; Wei, Qinguo; Zhang, Huanxin; Chen, Jun; Chen, Yao; Tang, Xuexi; Zhang, Honghai


    Toll-like receptors (TLRs) encoded by the TLR multigene family play an important role in initial pathogen recognition in vertebrates. Among the TLRs, TLR2 and TLR4 may be of particular importance to reptiles. In order to study the evolutionary patterns and structural characteristics of TLRs, we explored the available genomes of several representative members of reptiles. 25 TLR2 genes and 19 TLR4 genes from reptiles were obtained in this study. Phylogenetic results showed that the TLR2 gene duplication occurred in several species. Evolutionary analysis by at least two methods identified 30 and 13 common positively selected codons in TLR2 and TLR4, respectively. Most positively selected sites of TLR2 and TLR4 were located in the Leucine-rich repeat (LRRs). Branch model analysis showed that TLR2 genes were under different evolutionary forces in reptiles, while the TLR4 genes showed no significant selection pressure. The different evolutionary adaptation of TLR2 and TLR4 among the reptiles might be due to their different function in recognizing bacteria. Overall, we explored the structure and evolution of TLR2 and TLR4 genes in reptiles for the first time. Our study revealed valuable information regarding TLR2 and TLR4 in reptiles, and provided novel insights into the conservation concern of natural populations. Copyright © 2017 Elsevier B.V. All rights reserved.

  16. A case report of two male siblings with autism and duplication of Xq13-q21, a region including three genes predisposing for autism. (United States)

    Wentz, Elisabet; Vujic, Mihailo; Kärrstedt, Ewa-Lotta; Erlandsson, Anna; Gillberg, Christopher


    Autism spectrum disorder, severe behaviour problems and duplication of the Xq12 to Xq13 region have recently been described in three male relatives. To describe the psychiatric comorbidity and dysmorphic features, including craniosynostosis, of two male siblings with autism and duplication of the Xq13 to Xq21 region, and attempt to narrow down the number of duplicated genes proposed to be leading to global developmental delay and autism. We performed DNA sequencing of certain exons of the TWIST1 gene, the FGFR2 gene and the FGFR3 gene. We also performed microarray analysis of the DNA. In addition to autism, the two male siblings exhibited severe learning disability, self-injurious behaviour, temper tantrums and hyperactivity, and had no communicative language. Chromosomal analyses were normal. Neither of the two siblings showed mutations of the sequenced exons known to produce craniosynostosis. The microarray analysis detected an extra copy of a region on the long arm of chromosome X, chromosome band Xq13.1-q21.1. Comparison of our two cases with previously described patients allowed us to identify three genes predisposing for autism in the duplicated chromosomal region. Sagittal craniosynostosis is also a new finding linked to the duplication.

  17. Deletion/duplication mutation screening of TP53 gene in patients with transitional cell carcinoma of urinary bladder using multiplex ligation-dependent probe amplification. (United States)

    Bazrafshani, Mohammad Reza R; Nowshadi, Pouriaali A; Shirian, Sadegh; Daneshbod, Yahya; Nabipour, Fatemeh; Mokhtari, Maral; Hosseini, Fatemehsadat; Dehghan, Somayeh; Saeedzadeh, Abolfazl; Mosayebi, Ziba


    Bladder cancer is a molecular disease driven by the accumulation of genetic, epigenetic, and environmental factors. The aim of this study was to detect the deletions/duplication mutations in TP53 gene exons using multiplex ligation-dependent probe amplification (MLPA) method in the patients with transitional cell carcinoma (TCC). The achieved formalin-fixed paraffin-embedded tissues from 60 patients with TCC of bladder were screened for exonal deletions or duplications of every 12 TP53 gene exons using MLPA. The pathological sections were examined by three pathologists and categorized according to the WHO scoring guideline as 18 (30%) grade I, 22 (37%) grade II, 13 (22%) grade III, and 7 (11%) grade IV cases of TCC. None mutation changes of TP53 gene were detected in 24 (40%) of the patients. Furthermore, mutation changes including, 15 (25%) deletion, 17 (28%) duplication, and 4 (7%) both deletion and duplication cases were observed among 60 samples. From 12 exons of TP53 gene, exon 1 was more subjected to exonal deletion. Deletion of exon 1 of TP53 gene has occurred in 11 (35.4%) patients with TCC. In general, most mutations of TP53, either deletion or duplication, were found in exon 1, which was statistically significant. In addition, no relation between the TCC tumor grade and any type of mutation were observed in this research. MLPA is a simple and efficient method to analyze genomic deletions and duplications of all 12 exons of TP53 gene. The finding of this report that most of the mutations of TP53 occur in exon 1 is in contrast to that of the other reports suggesting that exons 5-8 are the most (frequently) mutated exons of TP53 gene. The mutations of exon 1 of TP53 gene may play an important role in the tumorogenesis of TCC. © 2015 The Authors. Cancer Medicine published by John Wiley & Sons Ltd.

  18. Tandem duplication of 11p12-p13 in a child with borderline development delay and eye abnormalities: dose effect of the PAX6 gene product?

    NARCIS (Netherlands)

    Aalfs, C. M.; Fantes, J. A.; Wenniger-Prick, L. J.; Sluijter, S.; Hennekam, R. C.; van Heyningen, V.; Hoovers, J. M.


    We report on a girl with a duplication of chromosome band 11p12-->13, which includes the Wilms tumor gene (WT1) and the aniridia gene (PAX6). The girl had borderline developmental delay, mild facial anomalies, and eye abnormalities. Eye findings were also present in most of the 11 other published

  19. Plasticity and innovation of regulatory mechanisms underlying seed oil content mediated by duplicated genes in the palaeopolyploid soybean. (United States)

    Zhang, Dajian; Zhao, Meixia; Li, Shuai; Sun, Lianjun; Wang, Weidong; Cai, Chunmei; Dierking, Emily C; Ma, Jianxin


    Many plants have undergone whole genome duplication (WGD). However, how regulatory networks underlying a particular trait are reshaped in polyploids has not been experimentally investigated. Here we show that the regulatory pathways modulating seed oil content, which involve WRINKLED1 (WRI1), LEAFY COTYLEDON1 (LEC1), and LEC2 in Arabidopsis, have been modified in the palaeopolyploid soybean. Such modifications include functional reduction of GmWRI1b of the GmWRI1a/GmWRI1b homoeologous pair relevant to WRI1, complementary non-allelic dosage effects of the GmLEC1a/GmLEC1b homoeologous pair relevant to LEC1, pseudogenization of the singleton GmLEC2 relevant to LEC2, and the rise of the LEC2-like function of GmABI3b, contrasting to its homoeolog GmABI3a, which maintains the ABSCISIC ACID INSENSITIVE 3 (ABI3)-like function in modulating seed maturation and dormancy. The function of GmABI3b in modulating seed oil biosynthesis was fulfilled by direct binding to a RY (CATGCA) cis-regulatory element in the GmWRI1a promoter, which was absent in the GmWRI1b promoter, resulting in reduction of the GmWRI1b expression. Nevertheless, the three regulators each exhibited similar intensities of purifying selection to their respective duplicates since these pairs were formed by a WGD event that is proposed to have occurred approximately 13 million years ago (mya), suggesting that the differentiation in spatiotemporal expression between the duplicated genes is more likely to be the outcome of neutral variation in regulatory sequences. This study thus exemplifies the plasticity, dynamics, and novelty of regulatory networks mediated by WGD. © 2017 The Authors The Plant Journal © 2017 John Wiley & Sons Ltd.

  20. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes. (United States)

    Biedler, James K; Tu, Zhijian


    codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  1. Evolutionary analysis of the kinesin light chain genes in the yellow fever mosquito Aedes aegypti: gene duplication as a source for novel early zygotic genes

    Directory of Open Access Journals (Sweden)

    Tu Zhijian


    1 kb fragment upstream of the AaKLC2.1 start codon shows promoter activity at least as early as 3 hours in the developing Ae. aegypti embryo. The AaKLC2.1 promoter activity reached ~1600 fold over the negative control at 5 hr after egg deposition. Conclusions Transcriptome profiling by use of high throughput sequencing technologies has proven to be a valuable method for the identification and discovery of early and transient zygotic genes. The evolutionary investigation of the KLC gene family reveals that duplication is a source for the evolution of new genes that play a role in the dynamic process of early embryonic development. AaKLC2.1 may provide a promoter for early zygotic-specific transgene expression, which is a key component of the Medea gene drive system.

  2. Study of duplication 24bp of ARX gene among patients presenting a Mental Retardation with a syndromic and non syndromic forms

    International Nuclear Information System (INIS)

    Essouissi, Imen


    Mental Retardation (MR) is the most frequent handicap. It touches 3% of the general population. The genetic causes of this handicap account for 40% of these cases. ARX gene (Aristaless related homeobox gene) belongs to the family of the genes homeobox located in Xp22.1. It is considered as the most frequently muted gene after the FMR1 gene. It is implicated in various forms of syndromic and nonsyndromic MR. Several types of mutation were identified on the level of this gene, including deletions/insertions, duplications, missense and nonsense mutations, responsible for a wide spectrum of phenotypes. The goal of this work is to seek the most frequent change of gene ARX: duplication 24pb (at the origin of an expansion of the field poly has protein ARX in the position 144-155AA) among Tunisian boys presenting in particular family forms of non specific MR, sporadic forms of non specific MR like certain patients presenting a West syndrome.To prove the duplication of 24 Pb, we used in this work the Pcr technique. The change of duplication 24pb was not found in our series, this could be explained by the low number of cases family studied (38 families) and by the absence of connection studies accusing a mode of transmission related to X chromosome in particular for the sporadic cases. (Author)

  3. Sox genes in grass carp (Ctenopharyngodon idella) with their implications for genome duplication and evolution


    Zhong , Lei; Yu , Xiaomu; Tong , Jingou


    Abstract The Sox gene family is found in a broad range of animal taxa and encodes important gene regulatory proteins involved in a variety of developmental processes. We have obtained clones representing the HMG boxes of twelve Sox genes from grass carp (Ctenopharyngodon idella), one of the four major domestic carps in China. The cloned Sox genes belong to group B1, B2 and C. Our analyses show that whereas the human genome contains a single copy of Sox4, Sox11 and Sox14, each of these genes h...

  4. Enteric Duplication. (United States)

    Jeziorczak, Paul M; Warner, Brad W


    Enteric duplications have been described throughout the entire gastrointestinal tract. The usual perinatal presentation is an abdominal mass. Duplications associated with the foregut have associated respiratory symptoms, whereas duplications in the midgut and hindgut can present with obstructive symptoms, perforation, nausea, emesis, hemorrhage, or be asymptomatic, and identified as an incidental finding. These are differentiated from other cystic lesions by the presence of a normal gastrointestinal mucosal epithelium. Enteric duplications are located on the mesenteric side of the native structures and are often singular with tubular or cystic characteristics. Management of enteric duplications often requires operative intervention with preservation of the native blood supply and intestine. These procedures are usually very well tolerated with low morbidity.

  5. The phylogeny of Myxosporea (Myxozoa) based on small subunit ribosomal RNA gene analysis

    Czech Academy of Sciences Publication Activity Database

    Fiala, Ivan


    Roč. 36, č. 14 (2006), s. 1521-1534 ISSN 0020-7519 R&D Projects: GA MŠk LC522 Grant - others:Grantová agentura Jihočeské univerzity(CZ) 58/2002//P-BF Institutional research plan: CEZ:AV0Z60220518 Keywords : Myxosporea * SSU rDNA * phylogeny Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.337, year: 2006

  6. Single-copy genes define a conserved order between rice and wheat for understanding differences caused by duplication, deletion, and transposition of genes. (United States)

    Singh, Nagendra K; Dalal, Vivek; Batra, Kamlesh; Singh, Binay K; Chitra, G; Singh, Archana; Ghazi, Irfan A; Yadav, Mahavir; Pandit, Awadhesh; Dixit, Rekha; Singh, Pradeep K; Singh, Harvinder; Koundal, Kirpa R; Gaikwad, Kishor; Mohapatra, Trilochan; Sharma, Tilak R


    The high-quality rice genome sequence is serving as a reference for comparative genome analysis in crop plants, especially cereals. However, early comparisons with bread wheat showed complex patterns of conserved synteny (gene content) and colinearity (gene order). Here, we show the presence of ancient duplicated segments in the progenitor of wheat, which were first identified in the rice genome. We also show that single-copy (SC) rice genes, those representing unique matches with wheat expressed sequence tag (EST) unigene contigs in the whole rice genome, show more than twice the proportion of genes mapping to syntenic wheat chromosome as compared to the multicopy (MC) or duplicated rice genes. While 58.7% of the 1,244 mapped SC rice genes were located in single syntenic wheat chromosome groups, the remaining 41.3% were distributed randomly to the other six non-syntenic wheat groups. This could only be explained by a background dispersal of genes in the genome through transposition or other unknown mechanism. The breakdown of rice-wheat synteny due to such transpositions was much greater near the wheat centromeres. Furthermore, the SC rice genes revealed a conserved primordial gene order that gives clues to the origin of rice and wheat chromosomes from a common ancestor through polyploidy, aneuploidy, centromeric fusions, and translocations. Apart from the bin-mapped wheat EST contigs, we also compared 56,298 predicted rice genes with 39,813 wheat EST contigs assembled from 409,765 EST sequences and identified 7,241 SC rice gene homologs of wheat. Based on the conserved colinearity of 1,063 mapped SC rice genes across the bins of individual wheat chromosomes, we predicted the wheat bin location of 6,178 unmapped SC rice gene homologs and validated the location of 213 of these in the telomeric bins of 21 wheat chromosomes with 35.4% initial success. This opens up the possibility of directed mapping of a large number of conserved SC rice gene homologs in wheat

  7. Yeast Interspecies Comparative Proteomics Reveals Divergence in Expression Profiles and Provides Insights into Proteome Resource Allocation and Evolutionary Roles of Gene Duplication* (United States)

    Kito, Keiji; Ito, Haruka; Nohara, Takehiro; Ohnishi, Mihoko; Ishibashi, Yuko; Takeda, Daisuke


    Omics analysis is a versatile approach for understanding the conservation and diversity of molecular systems across multiple taxa. In this study, we compared the proteome expression profiles of four yeast species (Saccharomyces cerevisiae, Saccharomyces mikatae, Kluyveromyces waltii, and Kluyveromyces lactis) grown on glucose- or glycerol-containing media. Conserved expression changes across all species were observed only for a small proportion of all proteins differentially expressed between the two growth conditions. Two Kluyveromyces species, both of which exhibited a high growth rate on glycerol, a nonfermentative carbon source, showed distinct species-specific expression profiles. In K. waltii grown on glycerol, proteins involved in the glyoxylate cycle and gluconeogenesis were expressed in high abundance. In K. lactis grown on glycerol, the expression of glycolytic and ethanol metabolic enzymes was unexpectedly low, whereas proteins involved in cytoplasmic translation, including ribosomal proteins and elongation factors, were highly expressed. These marked differences in the types of predominantly expressed proteins suggest that K. lactis optimizes the balance of proteome resource allocation between metabolism and protein synthesis giving priority to cellular growth. In S. cerevisiae, about 450 duplicate gene pairs were retained after whole-genome duplication. Intriguingly, we found that in the case of duplicates with conserved sequences, the total abundance of proteins encoded by a duplicate pair in S. cerevisiae was similar to that of protein encoded by nonduplicated ortholog in Kluyveromyces yeast. Given the frequency of haploinsufficiency, this observation suggests that conserved duplicate genes, even though minor cases of retained duplicates, do not exhibit a dosage effect in yeast, except for ribosomal proteins. Thus, comparative proteomic analyses across multiple species may reveal not only species-specific characteristics of metabolic processes under

  8. Phylogenetic relationships among Perissodactyla: secretoglobin 1A1 gene duplication and triplication in the Equidae family. (United States)

    Côté, Olivier; Viel, Laurent; Bienzle, Dorothee


    Secretoglobin family 1A member 1 (SCGB 1A1) is a small anti-inflammatory and immunomodulatory protein that is abundantly secreted in airway surface fluids. We recently reported the existence of three distinct SCGB1A1 genes in the domestic horse genome as opposed to the single gene copy consensus present in other mammals. The origin of SCGB1A1 gene triplication and the evolutionary relationship of the three genes amongst Equidae family members are unknown. For this study, SCGB1A1 genomic data were collected from various Equus individuals including E. caballus, E. przewalskii, E. asinus, E. grevyi, and E. quagga. Three SCGB1A1 genes in E. przewalskii, two SCGB1A1 genes in E. asinus, and a single SCGB1A1 gene in E. grevyi and E. quagga were identified. Sequence analysis revealed that the non-synonymous nucleotide substitutions between the different equid genes coded for 17 amino acid changes. Most of these changes localized to the SCGB 1A1 central cavity that binds hydrophobic ligands, suggesting that this area of SCGB 1A1 evolved to accommodate diverse molecular interactions. Three-dimensional modeling of the proteins revealed that the size of the SCGB 1A1 central cavity is larger than that of SCGB 1A1A. Altogether, these findings suggest that evolution of the SCGB1A1 gene may parallel the separation of caballine and non-caballine species amongst Equidae, and may indicate an expansion of function for SCGB1A1 gene products. Copyright © 2013 Elsevier Inc. All rights reserved.

  9. Genome-wide identification, phylogeny and expression analysis of SUN, OFP and YABBY gene family in tomato. (United States)

    Huang, Zejun; Van Houten, Jason; Gonzalez, Geoffrey; Xiao, Han; van der Knaap, Esther


    Members of the plant-specific gene families IQD/SUN, OFP and YABBY are thought to play important roles in plant growth and development. YABBY family members are involved in lateral organ polarity and growth; OFP members encode transcriptional repressors, whereas the role of IQD/SUN members is less clear. The tomato fruit shape genes SUN, OVATE, and FASCIATED belong to IQD/SUN, OFP and the YABBY gene family, respectively. A gene duplication resulting in high expression of SUN leads to elongated fruit, whereas a premature stop codon in OVATE and a large inversion within FASCIATED control fruit elongation and a flat fruit shape, respectively. In this study, we identified 34 SlSUN, 31 SlOFP and 9 SlYABBY genes in tomato and identified their position on 12 chromosomes. Genome mapping analysis showed that the SlSUN, SlOFP, and SlYABBY genes were enriched on the top and bottom segments of several chromosomes. In particular, on chromosome 10, a cluster of SlOFPs were found to originate from tandem duplication events. We also constructed three phylogenetic trees based on the protein sequences of the IQ67, OVATE and YABBY domains, respectively, from members of these families in Arabidopsis and tomato. The closest putative orthologs of the Arabidopsis and tomato genes were determined by the position on the phylogenetic tree and sequence similarity. Furthermore, expression analysis showed that some family members exhibited tissue-specific expression, whereas others were more ubiquitously expressed. Also, certain family members overlapped with known QTLs controlling fruit shape in Solanaceous plants. Combined, these results may help elucidate the roles of SUN, OFP and YABBY family members in plant growth and development.

  10. A molecular phylogeny of the marine red algae (Rhodophyta) based on the nuclear small-subunit rRNA gene. (United States)

    Ragan, M A; Bird, C J; Rice, E L; Gutell, R R; Murphy, C A; Singh, R K


    A phylogeny of marine Rhodophyta has been inferred by a number of methods from nucleotide sequences of nuclear genes encoding small subunit rRNA from 39 species in 15 orders. Sequence divergences are relatively large, especially among bangiophytes and even among congeners in this group. Subclass Bangiophycidae appears polyphyletic, encompassing at least three lineages, with Porphyridiales distributed between two of these. Subclass Florideophycidae is monophyletic, with Hildenbrandiales, Corallinales, Ahnfeltiales, and a close association of Nemaliales, Acrochaetiales, and Palmariales forming the four deepest branches. Cermiales may represent a convergence of vegetative and reproductive morphologies, as family Ceramiaceae is at best weakly related to the rest of the order, and one of its members appears to be allied to Gelidiales. Except for Gigartinales, for which more data are required, the other florideophyte orders appear distinct and taxonomically justified. A good correlation was observed with taxonomy based on pit-plug ultrastructure. Tests under maximum-likelihood and parsimony of alternative phylogenies based on structure and chemistry refuted suggestions that Acrochaetiales is the most primitive florideophyte order and that Gelidiales and Hildenbrandiales are sister groups. PMID:8041780

  11. Origin, evolution, and population genetics of the selfish Segregation Distorter gene duplication in European and African populations of Drosophila melanogaster. (United States)

    Brand, Cara L; Larracuente, Amanda M; Presgraves, Daven C


    Meiotic drive elements are a special class of evolutionarily "selfish genes" that subvert Mendelian segregation to gain preferential transmission at the expense of homologous loci. Many drive elements appear to be maintained in populations as stable polymorphisms, their equilibrium frequencies determined by the balance between drive (increasing frequency) and selection (decreasing frequency). Here we show that a classic, seemingly balanced, drive system is instead characterized by frequent evolutionary turnover giving rise to dynamic, rather than stable, equilibrium frequencies. The autosomal Segregation Distorter (SD) system of the fruit fly Drosophila melanogaster is a selfish coadapted meiotic drive gene complex in which the major driver corresponds to a partial duplication of the gene Ran-GTPase activating protein (RanGAP). SD chromosomes segregate at similar, low frequencies of 1-5% in natural populations worldwide, consistent with a balanced polymorphism. Surprisingly, our population genetic analyses reveal evidence for parallel, independent selective sweeps of different SD chromosomes in populations on different continents. These findings suggest that, rather than persisting at a single stable equilibrium, SD chromosomes turn over frequently within populations. © 2015 The Author(s). Evolution published by Wiley Periodicals, Inc. on behalf of The Society for the Study of Evolution.

  12. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae. (United States)

    Jabbour, Florian; Cossard, Guillaume; Le Guilloux, Martine; Sannier, Julie; Nadot, Sophie; Damerval, Catherine


    Floral bilateral symmetry (zygomorphy) has evolved several times independently in angiosperms from radially symmetrical (actinomorphic) ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc) have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like) lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  13. Specific duplication and dorsoventrally asymmetric expression patterns of Cycloidea-like genes in zygomorphic species of Ranunculaceae.

    Directory of Open Access Journals (Sweden)

    Florian Jabbour

    Full Text Available Floral bilateral symmetry (zygomorphy has evolved several times independently in angiosperms from radially symmetrical (actinomorphic ancestral states. Homologs of the Antirrhinum majus Cycloidea gene (Cyc have been shown to control floral symmetry in diverse groups in core eudicots. In the basal eudicot family Ranunculaceae, there is a single evolutionary transition from actinomorphy to zygomorphy in the stem lineage of the tribe Delphinieae. We characterized Cyc homologs in 18 genera of Ranunculaceae, including the four genera of Delphinieae, in a sampling that represents the floral morphological diversity of this tribe, and reconstructed the evolutionary history of this gene family in Ranunculaceae. Within each of the two RanaCyL (Ranunculaceae Cycloidea-like lineages previously identified, an additional duplication possibly predating the emergence of the Delphinieae was found, resulting in up to four gene copies in zygomorphic species. Expression analyses indicate that the RanaCyL paralogs are expressed early in floral buds and that the duration of their expression varies between species and paralog class. At most one RanaCyL paralog was expressed during the late stages of floral development in the actinomorphic species studied whereas all paralogs from the zygomorphic species were expressed, composing a species-specific identity code for perianth organs. The contrasted asymmetric patterns of expression observed in the two zygomorphic species is discussed in relation to their distinct perianth architecture.

  14. TRPV5 and TRPV6 in transcellular Ca(2+) transport: regulation, gene duplication, and polymorphisms in African populations. (United States)

    Peng, Ji-Bin


    TRPV5 and TRPV6 are unique members of the TRP super family. They are highly selective for Ca(2+) ions with multiple layers of Ca(2+)-dependent inactivation mechanisms, expressed at the apical membrane of Ca(2+) transporting epithelia, and robustly responsive to 1,25-dihydroxivitamin D(3). These features are well suited for their roles as Ca(2+) entry channels in the first step of transcellular Ca(2+) transport pathways, which are involved in intestinal absorption, renal reabsorption of Ca(2+), placental transfer of Ca(2+) to fetus, and many other processes. While TRPV6 is more broadly expressed in a variety of tissues such as esophagus, stomach, small intestine, colon, kidney, placenta, pancreas, prostate, uterus, salivary gland, and sweat gland, TRPV5 expression is relatively restricted to the distal convoluted tubule and connecting tubule of the kidney. There is only one TRPV6-like gene in fish and birds in comparison to both TRPV5 and TRPV6 genes in mammals, indicating TRPV5 gene was likely generated from duplication of TRPV6 gene during the evolution of mammals to meet the needs of complex renal function. TRPV5 and TRPV6 are subjected to vigorous regulations under physiological, pathological, and therapeutic conditions. The elevated TRPV6 level in malignant tumors such as prostate and breast cancers makes it a potential therapeutic target. TRPV6, and to a lesser extent TRPV5, exhibit unusually high levels of single nucleotide polymorphisms (SNPs) in African populations as compared to other populations, indicating TRPV6 gene was under selective pressure during or after humans migrated out of Africa. The SNPs of TRPV6 and TRPV5 likely contribute to the Ca(2+) conservation mechanisms in African populations.

  15. Tissue-specific differential induction of duplicated fatty acid-binding protein genes by the peroxisome proliferator, clofibrate, in zebrafish (Danio rerio

    Directory of Open Access Journals (Sweden)

    Venkatachalam Ananda B


    Full Text Available Abstract Background Force, Lynch and Conery proposed the duplication-degeneration-complementation (DDC model in which partitioning of ancestral functions (subfunctionalization and acquisition of novel functions (neofunctionalization were the two primary mechanisms for the retention of duplicated genes. The DDC model was tested by analyzing the transcriptional induction of the duplicated fatty acid-binding protein (fabp genes by clofibrate in zebrafish. Clofibrate is a specific ligand of the peroxisome proliferator-activated receptor (PPAR; it activates PPAR which then binds to a peroxisome proliferator response element (PPRE to induce the transcriptional initiation of genes primarily involved in lipid homeostasis. Zebrafish was chosen as our model organism as it has many duplicated genes owing to a whole genome duplication (WGD event that occurred ~230-400 million years ago in the teleost fish lineage. We assayed the steady-state levels of fabp mRNA and heterogeneous nuclear RNA (hnRNA transcripts in liver, intestine, muscle, brain and heart for four sets of duplicated fabp genes, fabp1a/fabp1b.1/fabp1b.2, fabp7a/fabp7b, fabp10a/fabp10b and fabp11a/fabp11b in zebrafish fed different concentrations of clofibrate. Result Electron microscopy showed an increase in the number of peroxisomes and mitochondria in liver and heart, respectively, in zebrafish fed clofibrate. Clofibrate also increased the steady-state level of acox1 mRNA and hnRNA transcripts in different tissues, a gene with a functional PPRE. These results demonstrate that zebrafish is responsive to clofibrate, unlike some other fishes. The levels of fabp mRNA and hnRNA transcripts for the four sets of duplicated fabp genes was determined by reverse transcription, quantitative polymerase chain reaction (RT-qPCR. The level of hnRNA coded by a gene is an indirect estimate of the rate of transcriptional initiation of that gene. Clofibrate increased the steady-state level of fabp mRNAs and hn

  16. Duplicate editorial on duplicate publication. (United States)

    Corson, Stephen L; Decherney, Alan H


    The authors define and discuss the various forms taken by duplicate publications, and provide suggested remedies to help authors, editors, reviewers, and readers avoid this form of internal plagiarism.

  17. Targeted Enrichment of Large Gene Families for Phylogenetic Inference: Phylogeny and Molecular Evolution of Photosynthesis Genes in the Portullugo Clade (Caryophyllales). (United States)

    Moore, Abigail J; Vos, Jurriaan M De; Hancock, Lillian P; Goolsby, Eric; Edwards, Erika J


    Hybrid enrichment is an increasingly popular approach for obtaining hundreds of loci for phylogenetic analysis across many taxa quickly and cheaply. The genes targeted for sequencing are typically single-copy loci, which facilitate a more straightforward sequence assembly and homology assignment process. However, this approach limits the inclusion of most genes of functional interest, which often belong to multi-gene families. Here, we demonstrate the feasibility of including large gene families in hybrid enrichment protocols for phylogeny reconstruction and subsequent analyses of molecular evolution, using a new set of bait sequences designed for the "portullugo" (Caryophyllales), a moderately sized lineage of flowering plants (~ 2200 species) that includes the cacti and harbors many evolutionary transitions to C$_{\\mathrm{4}}$ and CAM photosynthesis. Including multi-gene families allowed us to simultaneously infer a robust phylogeny and construct a dense sampling of sequences for a major enzyme of C$_{\\mathrm{4}}$ and CAM photosynthesis, which revealed the accumulation of adaptive amino acid substitutions associated with C$_{\\mathrm{4}}$ and CAM origins in particular paralogs. Our final set of matrices for phylogenetic analyses included 75-218 loci across 74 taxa, with ~ 50% matrix completeness across data sets. Phylogenetic resolution was greatly improved across the tree, at both shallow and deep levels. Concatenation and coalescent-based approaches both resolve the sister lineage of the cacti with strong support: Anacampserotaceae $+$ Portulacaceae, two lineages of mostly diminutive succulent herbs of warm, arid regions. In spite of this congruence, BUCKy concordance analyses demonstrated strong and conflicting signals across gene trees. Our results add to the growing number of examples illustrating the complexity of phylogenetic signals in genomic-scale data.

  18. Duplication of Dio3 genes in teleost fish and their divergent expression in skin during flatfish metamorphosis. (United States)

    Alves, R N; Cardoso, J C R; Harboe, T; Martins, R S T; Manchado, M; Norberg, B; Power, D M


    Deiodinase 3 (Dio3) plays an essential role during early development in vertebrates by controlling tissue thyroid hormone (TH) availability. The Atlantic halibut (Hippoglossus hippoglossus) possesses duplicate dio3 genes (dio3a and dio3b). Expression analysis indicates that dio3b levels change in abocular skin during metamorphosis and this suggests that this enzyme is associated with the divergent development of larval skin to the juvenile phenotype. In larvae exposed to MMI, a chemical that inhibits TH production, expression of dio3b in ocular skin is significantly up-regulated suggesting that THs normally modulate this genes expression during this developmental event. The molecular basis for divergent dio3a and dio3b expression and responsiveness to MMI treatment is explained by the multiple conserved TREs in the proximal promoter region of teleost dio3b and their absence from the promoter of dio3a. We propose that the divergent expression of dio3 in ocular and abocular skin during halibut metamorphosis contributes to the asymmetric pigment development in response to THs. Copyright © 2017 Elsevier Inc. All rights reserved.

  19. Functional diversification of duplicated CYC2 clade genes in regulation of inflorescence development in Gerbera hybrida (Asteraceae). (United States)

    Juntheikki-Palovaara, Inka; Tähtiharju, Sari; Lan, Tianying; Broholm, Suvi K; Rijpkema, Anneke S; Ruonala, Raili; Kale, Liga; Albert, Victor A; Teeri, Teemu H; Elomaa, Paula


    The complex inflorescences (capitula) of Asteraceae consist of different types of flowers. In Gerbera hybrida (gerbera), the peripheral ray flowers are bilaterally symmetrical and lack functional stamens while the central disc flowers are more radially symmetrical and hermaphroditic. Proteins of the CYC2 subclade of the CYC/TB1-like TCP domain transcription factors have been recruited several times independently for parallel evolution of bilaterally symmetrical flowers in various angiosperm plant lineages, and have also been shown to regulate flower-type identity in Asteraceae. The CYC2 subclade genes in gerbera show largely overlapping gene expression patterns. At the level of single flowers, their expression domain in petals shows a spatial shift from the dorsal pattern known so far in species with bilaterally symmetrical flowers, suggesting that this change in expression may have evolved after the origin of Asteraceae. Functional analysis indicates that GhCYC2, GhCYC3 and GhCYC4 mediate positional information at the proximal-distal axis of the inflorescence, leading to differentiation of ray flowers, but that they also regulate ray flower petal growth by affecting cell proliferation until the final size and shape of the petals is reached. Moreover, our data show functional diversification for the GhCYC5 gene. Ectopic activation of GhCYC5 increases flower density in the inflorescence, suggesting that GhCYC5 may promote the flower initiation rate during expansion of the capitulum. Our data thus indicate that modification of the ancestral network of TCP factors has, through gene duplications, led to the establishment of new expression domains and to functional diversification. © 2014 The Authors The Plant Journal © 2014 John Wiley & Sons Ltd.

  20. Gene fusions with lacZ by duplication insertion in the radioresistant bacterium Deinococcus radiodurans

    International Nuclear Information System (INIS)

    Lennon, E.; Minton, K.W.


    Deinococcus radiodurans is the most-studied species of a eubacterial family characterized by extreme resistance to DNA damage. We have focused on developing molecular biological techniques to investigate the genetics of this organism. We report construction of lacZ gene fusions by a method involving both in vitro splicing and the natural transformation of D. radiodurans. Numerous fusion strains were identified by expression of beta-galactosidase. Among these fusion strains, several were inducible by exposure to the DNA-damaging agent mitomycin C, and four of the inducible fusion constructs were cloned in Escherichia coli. Hybridization studies indicate that one of the damage-inducible genes contains a sequence reiterated throughout the D. radiodurans chromosome. Survival measurements show that two of the fusion strains have increased sensitivity to mitomycin C, suggesting that the fusions within these strains inactivate repair functions

  1. Mitochondrial Genomes of Kinorhyncha: trnM Duplication and New Gene Orders within Animals


    Popova, Olga V.; Mikhailov, Kirill V.; Nikitin, Mikhail A.; Logacheva, Maria D.; Penin, Aleksey A.; Muntyan, Maria S.; Kedrova, Olga S.; Petrov, Nikolai B.; Panchin, Yuri V.; Aleoshin, Vladimir V.


    Many features of mitochondrial genomes of animals, such as patterns of gene arrangement, nucleotide content and substitution rate variation are extensively used in evolutionary and phylogenetic studies. Nearly 6,000 mitochondrial genomes of animals have already been sequenced, covering the majority of animal phyla. One of the groups that escaped mitogenome sequencing is phylum Kinorhyncha-an isolated taxon of microscopic worm-like ecdysozoans. The kinorhynchs are thought to be one of the earl...

  2. Accounting for horizontal gene transfers explains conflicting hypotheses regarding the position of aquificales in the phylogeny of Bacteria

    Directory of Open Access Journals (Sweden)

    Gouy Manolo


    Full Text Available Abstract Background Despite a large agreement between ribosomal RNA and concatenated protein phylogenies, the phylogenetic tree of the bacterial domain remains uncertain in its deepest nodes. For instance, the position of the hyperthermophilic Aquificales is debated, as their commonly observed position close to Thermotogales may proceed from horizontal gene transfers, long branch attraction or compositional biases, and may not represent vertical descent. Indeed, another view, based on the analysis of rare genomic changes, places Aquificales close to epsilon-Proteobacteria. Results To get a whole genome view of Aquifex relationships, all trees containing sequences from Aquifex in the HOGENOM database were surveyed. This study revealed that Aquifex is most often found as a neighbour to Thermotogales. Moreover, informational genes, which appeared to be less often transferred to the Aquifex lineage than non-informational genes, most often placed Aquificales close to Thermotogales. To ensure these results did not come from long branch attraction or compositional artefacts, a subset of carefully chosen proteins from a wide range of bacterial species was selected for further scrutiny. Among these genes, two phylogenetic hypotheses were found to be significantly more likely than the others: the most likely hypothesis placed Aquificales as a neighbour to Thermotogales, and the second one with epsilon-Proteobacteria. We characterized the genes that supported each of these two hypotheses, and found that differences in rates of evolution or in amino-acid compositions could not explain the presence of two incongruent phylogenetic signals in the alignment. Instead, evidence for a large Horizontal Gene Transfer between Aquificales and epsilon-Proteobacteria was found. Conclusion Methods based on concatenated informational proteins and methods based on character cladistics led to different conclusions regarding the position of Aquificales because this lineage

  3. A multi-gene phylogeny of Chlorophyllum (Agaricaceae, Basidiomycota: new species, new combination and infrageneric classification

    Directory of Open Access Journals (Sweden)

    Zai-Wei Ge


    Full Text Available Taxonomic and phylogenetic studies of Chlorophyllum were carried out on the basis of morphological differences and molecular phylogenetic analyses. Based on the phylogeny inferred from the internal transcribed spacer (ITS, the partial large subunit nuclear ribosomal DNA (nrLSU, the second largest subunit of RNA polymerase II (rpb2 and translation elongation factor 1-α (tef1 sequences, six well-supported clades and 17 phylogenetic species are recognised. Within this phylogenetic framework and considering the diagnostic morphological characters, two new species, C. africanum and C. palaeotropicum, are described. In addition, a new infrageneric classification of Chlorophyllum is proposed, in which the genus is divided into six sections. One new combination is also made. This study provides a robust basis for a more detailed investigation of diversity and biogeography of Chlorophyllum.

  4. Rectal duplication.

    Directory of Open Access Journals (Sweden)

    Kulkarni B


    Full Text Available Duplications of the alimentary tract are of a great rarity, particularly so in the rectum. Because of its rarity, the difficulty of making a correct diagnosis and of selection of proper approach for treatment, this entity bears a special significance. The present case report deals with a female newborn who presented with imperforate anus and a rectovestibular fistula and a mass prolapsing at the introitus. Complete excision of the mass was carried out through the perineal approach and the child then underwent, a PSARP for the correction of the rectal anomaly. Histology confirmed the mass to be a rectal duplication.

  5. Identification of Ohnolog Genes Originating from Whole Genome Duplication in Early Vertebrates, Based on Synteny Comparison across Multiple Genomes. (United States)

    Singh, Param Priya; Arora, Jatin; Isambert, Hervé


    Whole genome duplications (WGD) have now been firmly established in all major eukaryotic kingdoms. In particular, all vertebrates descend from two rounds of WGDs, that occurred in their jawless ancestor some 500 MY ago. Paralogs retained from WGD, also coined 'ohnologs' after Susumu Ohno, have been shown to be typically associated with development, signaling and gene regulation. Ohnologs, which amount to about 20 to 35% of genes in the human genome, have also been shown to be prone to dominant deleterious mutations and frequently implicated in cancer and genetic diseases. Hence, identifying ohnologs is central to better understand the evolution of vertebrates and their susceptibility to genetic diseases. Early computational analyses to identify vertebrate ohnologs relied on content-based synteny comparisons between the human genome and a single invertebrate outgroup genome or within the human genome itself. These approaches are thus limited by lineage specific rearrangements in individual genomes. We report, in this study, the identification of vertebrate ohnologs based on the quantitative assessment and integration of synteny conservation between six amniote vertebrates and six invertebrate outgroups. Such a synteny comparison across multiple genomes is shown to enhance the statistical power of ohnolog identification in vertebrates compared to earlier approaches, by overcoming lineage specific genome rearrangements. Ohnolog gene families can be browsed and downloaded for three statistical confidence levels or recompiled for specific, user-defined, significance criteria at In the light of the importance of WGD on the genetic makeup of vertebrates, our analysis provides a useful resource for researchers interested in gaining further insights on vertebrate evolution and genetic diseases.

  6. Genome-Wide Identification, Phylogeny, and Expression Analysis of ARF Genes Involved in Vegetative Organs Development in Switchgrass

    Directory of Open Access Journals (Sweden)

    Jianli Wang


    Full Text Available Auxin response factors (ARFs have been reported to play vital roles during plant growth and development. In order to reveal specific functions related to vegetative organs in grasses, an in-depth study of the ARF gene family was carried out in switchgrass (Panicum virgatum L., a warm-season C4 perennial grass that is mostly used as bioenergy and animal feedstock. A total of 47 putative ARF genes (PvARFs were identified in the switchgrass genome (2n = 4x = 36, 42 of which were anchored to the seven pairs of chromosomes and found to be unevenly distributed. Sixteen PvARFs were predicted to be potential targets of small RNAs (microRNA160 and 167. Phylogenetically speaking, PvARFs were divided into seven distinct subgroups based on the phylogeny, exon/intron arrangement, and conserved motif distribution. Moreover, 15 pairs of PvARFs have different temporal-spatial expression profiles in vegetative organs (2nd, 3rd, and 4th internode and leaves, which implies that different PvARFs have specific functions in switchgrass growth and development. In addition, at least 14 pairs of PvARFs respond to naphthylacetic acid (NAA treatment, which might be helpful for us to study on auxin response in switchgrass. The comprehensive analysis, described here, will facilitate the future functional analysis of ARF genes in grasses.

  7. A search for RNA insertions and NS3 gene duplication in the genome of cytopathic isolates of bovine viral diarrhea virus

    Directory of Open Access Journals (Sweden)

    V.L. Quadros


    Full Text Available Calves born persistently infected with non-cytopathic bovine viral diarrhea virus (ncpBVDV frequently develop a fatal gastroenteric illness called mucosal disease. Both the original virus (ncpBVDV and an antigenically identical but cytopathic virus (cpBVDV can be isolated from animals affected by mucosal disease. Cytopathic BVDVs originate from their ncp counterparts by diverse genetic mechanisms, all leading to the expression of the non-structural polypeptide NS3 as a discrete protein. In contrast, ncpBVDVs express only the large precursor polypeptide, NS2-3, which contains the NS3 sequence within its carboxy-terminal half. We report here the investigation of the mechanism leading to NS3 expression in 41 cpBVDV isolates. An RT-PCR strategy was employed to detect RNA insertions within the NS2-3 gene and/or duplication of the NS3 gene, two common mechanisms of NS3 expression. RT-PCR amplification revealed insertions in the NS2-3 gene of three cp isolates, with the inserts being similar in size to that present in the cpBVDV NADL strain. Sequencing of one such insert revealed a 296-nucleotide sequence with a central core of 270 nucleotides coding for an amino acid sequence highly homologous (98% to the NADL insert, a sequence corresponding to part of the cellular J-Domain gene. One cpBVDV isolate contained a duplication of the NS3 gene downstream from the original locus. In contrast, no detectable NS2-3 insertions or NS3 gene duplications were observed in the genome of 37 cp isolates. These results demonstrate that processing of NS2-3 without bulk mRNA insertions or NS3 gene duplications seems to be a frequent mechanism leading to NS3 expression and BVDV cytopathology.

  8. A false single nucleotide polymorphism generated by gene duplication compromises meat traceability. (United States)

    Sanz, Arianne; Ordovás, Laura; Zaragoza, Pilar; Sanz, Albina; de Blas, Ignacio; Rodellar, Clementina


    Controlling meat traceability using SNPs is an effective method of ensuring food safety. We have analyzed several SNPs to create a panel for bovine genetic identification and traceability studies. One of these was the transversion g.329C>T (Genbank accession no. AJ496781) on the cytochrome P450 17A1 gene, which has been included in previously published panels. Using minisequencing reactions, we have tested 701 samples belonging to eight Spanish cattle breeds. Surprisingly, an excess of heterozygotes was detected, implying an extreme departure from Hardy-Weinberg equilibrium (PT SNP is a false positive polymorphism, which allows us to explain the inflated heterozygotic value. We recommend that this ambiguous SNP, as well as other polymorphisms located in this region, should not be used in identification, traceability or disease association studies. Annotation of these false SNPs should improve association studies and avoid misinterpretations. Copyright © 2012 Elsevier Ltd. All rights reserved.

  9. Gallbladder duplication

    Directory of Open Access Journals (Sweden)

    Yagan Pillay


    Conclusion: Duplication of the gallbladder is a rare congenital abnormality, which requires special attention to the biliary ductal and arterial anatomy. Laparoscopic cholecystectomy with intraoperative cholangiography is the appropriate treatment in a symptomatic gallbladder. The removal of an asymptomatic double gallbladder remains controversial.

  10. RNA-Mediated Gene Duplication and Retroposons: Retrogenes, LINEs, SINEs, and Sequence Specificity (United States)


    A substantial number of “retrogenes” that are derived from the mRNA of various intron-containing genes have been reported. A class of mammalian retroposons, long interspersed element-1 (LINE1, L1), has been shown to be involved in the reverse transcription of retrogenes (or processed pseudogenes) and non-autonomous short interspersed elements (SINEs). The 3′-end sequences of various SINEs originated from a corresponding LINE. As the 3′-untranslated regions of several LINEs are essential for retroposition, these LINEs presumably require “stringent” recognition of the 3′-end sequence of the RNA template. However, the 3′-ends of mammalian L1s do not exhibit any similarity to SINEs, except for the presence of 3′-poly(A) repeats. Since the 3′-poly(A) repeats of L1 and Alu SINE are critical for their retroposition, L1 probably recognizes the poly(A) repeats, thereby mobilizing not only Alu SINE but also cytosolic mRNA. Many flowering plants only harbor L1-clade LINEs and a significant number of SINEs with poly(A) repeats, but no homology to the LINEs. Moreover, processed pseudogenes have also been found in flowering plants. I propose that the ancestral L1-clade LINE in the common ancestor of green plants may have recognized a specific RNA template, with stringent recognition then becoming relaxed during the course of plant evolution. PMID:23984183

  11. Phylogeny and divergence-date estimates of rapid radiations in muroid rodents based on multiple nuclear genes. (United States)

    Steppan, Scott; Adkins, Ronald; Anderson, Joel


    The muroid rodents are the largest superfamily of mammals, containing nearly one third of all mammal species. We report on a phylogenetic study comprising 53 genera sequenced for four nuclear genes, GHR, BRCA1, RAG1, and c-myc, totaling up to 6400 nucleotides. Most relationships among the subfamilies are resolved. All four genes yield nearly identical phylogenies, differing only in five key regions, four of which may represent particularly rapid radiations. Support is very strong for a fundamental division of the mole rats of the subfamilies Spalacinae and Rhizomyinae from all other muroids. Among the other "core" muroids, a rapid radiation led to at least four distinct lineages: Asian Calomyscus, an African clade of at least four endemic subfamilies, including the diverse Nesomyinae of Madagascar, a hamster clade with maximum diversity in the New World, and an Old World clade including gerbils and the diverse Old World mice and rats (Murinae). The Deomyinae, recently removed from the Murinae, is well supported as the sister group to the gerbils (Gerbillinae). Four key regions appear to represent rapid radiations and, despite a large amount of sequence data, remain poorly resolved: the base of the "core" muroids, among the five cricetid (hamster) subfamilies, within a large clade of Sigmodontinae endemic to South America, and among major geographic lineages of Old World Murinae. Because of the detailed taxon sampling within the Murinae, we are able to refine the fossil calibration of a rate-smoothed molecular clock and apply this clock to date key events in muroid evolution. We calculate rate differences among the gene regions and relate those differences to relative contribution of each gene to the support for various nodes. The among-gene variance in support is greatest for the shortest branches. We present a revised classification for this largest but most unsettled mammalian superfamily.

  12. Genetic variability of human respiratory syncytial virus A strains circulating in Ontario: a novel genotype with a 72 nucleotide G gene duplication.

    Directory of Open Access Journals (Sweden)

    Alireza Eshaghi

    Full Text Available Human respiratory syncytial virus (HRSV is the main cause of acute lower respiratory infections in children under 2 years of age and causes repeated infections throughout life. We investigated the genetic variability of RSV-A circulating in Ontario during 2010-2011 winter season by sequencing and phylogenetic analysis of the G glycoprotein gene.Among the 201 consecutive RSV isolates studied, RSV-A (55.7% was more commonly observed than RSV-B (42.3%. 59.8% and 90.1% of RSV-A infections were among children ≤12 months and ≤5 years old, respectively. On phylogenetic analysis of the second hypervariable region of the 112 RSV-A strains, 110 (98.2% clustered within or adjacent to the NA1 genotype; two isolates were GA5 genotype. Eleven (10% NA1-related isolates clustered together phylogenetically as a novel RSV-A genotype, named ON1, containing a 72 nucleotide duplication in the C-terminal region of the attachment (G glycoprotein. The predicted polypeptide is lengthened by 24 amino acids and includes a23 amino acid duplication. Using RNA secondary structural software, a possible mechanism of duplication occurrence was derived. The 23 amino acid ON1 G gene duplication results in a repeat of 7 potential O-glycosylation sites including three O-linked sugar acceptors at residues 270, 275, and 283. Using Phylogenetic Analysis by Maximum Likelihood analysis, a total of 19 positively selected sites were observed among Ontario NA1 isolates; six were found to be codons which reverted to the previous state observed in the prototype RSV-A2 strain. The tendency of codon regression in the G-ectodomain may infer a decreased avidity of antibody to the current circulating strains. Further work is needed to document and further understand the emergence, virulence, pathogenicity and transmissibility of this novel RSV-A genotype with a72 nucleotide G gene duplication.

  13. A gene phylogeny of the red algae (Rhodophyta) based on plastid rbcL. (United States)

    Freshwater, D W; Fredericq, S; Butler, B S; Hommersand, M H; Chase, M W


    A phylogeny for the Rhodophyta has been inferred by parsimony analysis of plastid rbcL sequences representing 81 species, 68 genera, 38 families, and 17 orders of red algae; rbcL encodes the large subunit of ribulose-1,5-bisphosphate carboxylase/oxygenase. Levels of sequence divergence among species, genera, and families are high in red algae, typically much greater than those reported for flowering plants. The Rhodophyta traditionally consists of one class, Rhodophyceae, and two subclasses, Bangiophycidae and Florideophycidae. The Bangiophycidae with three orders (Porphyridiales, Compsopogonales, and Bangiales) appears to be polyphyletic, and the Florideophycidae with 17 orders is monophyletic in this study. The current classification of the Florideophycidae based on ultrastructure of pit connections is supported. With the exception of the Rhodogorgonales, which appears to be misplaced, orders with one or two pit-plug cap layers (Hildenbrandiales, Corallinales, Acrochaetiales, Palmanales, Batrachospermales, and Nemaliales) terminate long branches of basal position within Florideophycidae in the most parsimonious rbcL tree. Orders that lack typical cap layers but possess a cap membrane are resolved as a monophyletic clade sister to the Ahnfeltiales. The large order Gigartinales, which is distributed among five rbcL clades, is polyphyletic. Families that possess typical carrageenan in their cell walls are resolved as a terminal clade containing two family complexes centered around the Solieriaceae and Gigartinaceae. PMID:8041781

  14. Molecular phylogeny and character evolution in terete-stemmed Andean opuntias (Cactaceae-Opuntioideae). (United States)

    Ritz, C M; Reiker, J; Charles, G; Hoxey, P; Hunt, D; Lowry, M; Stuppy, W; Taylor, N


    The cacti of tribe Tephrocacteae (Cactaceae-Opuntioideae) are adapted to diverse climatic conditions over a wide area of the southern Andes and adjacent lowlands. They exhibit a range of life forms from geophytes and cushion-plants to dwarf shrubs, shrubs or small trees. To confirm or challenge previous morphology-based classifications and molecular phylogenies, we sampled DNA sequences from the chloroplast trnK/matK region and the nuclear low copy gene phyC and compared the resulting phylogenies with previous data gathered from nuclear ribosomal DNA sequences. The here presented chloroplast and nuclear low copy gene phylogenies were mutually congruent and broadly coincident with the classification based on gross morphology and seed micro-morphology and anatomy. Reconstruction of hypothetical ancestral character states suggested that geophytes and cushion-forming species probably evolved several times from dwarf shrubby precursors. We also traced an increase of embryo size at the expense of the nucellus-derived storage tissue during the evolution of the Tephrocacteae, which is thought to be an evolutionary advantage because nutrients are then more rapidly accessible for the germinating embryo. In contrast to these highly concordant phylogenies, nuclear ribosomal DNA data sampled by a previous study yielded conflicting phylogenetic signals. Secondary structure predictions of ribosomal transcribed spacers suggested that this phylogeny is strongly influenced by the inclusion of paralogous sequence probably arisen by genome duplication during the evolution of this plant group. Copyright © 2012 Elsevier Inc. All rights reserved.

  15. The complete mitochondrial genomes of three parasitic nematodes of birds: a unique gene order and insights into nematode phylogeny (United States)


    Background Analyses of mitochondrial (mt) genome sequences in recent years challenge the current working hypothesis of Nematoda phylogeny proposed from morphology, ecology and nuclear small subunit rRNA gene sequences, and raise the need to sequence additional mt genomes for a broad range of nematode lineages. Results We sequenced the complete mt genomes of three Ascaridia species (family Ascaridiidae) that infest chickens, pigeons and parrots, respectively. These three Ascaridia species have an identical arrangement of mt genes to each other but differ substantially from other nematodes. Phylogenetic analyses of the mt genome sequences of the Ascaridia species, together with 62 other nematode species, support the monophylies of seven high-level taxa of the phylum Nematoda: 1) the subclass Dorylaimia; 2) the orders Rhabditida, Trichinellida and Mermithida; 3) the suborder Rhabditina; and 4) the infraorders Spiruromorpha and Oxyuridomorpha. Analyses of mt genome sequences, however, reject the monophylies of the suborders Spirurina and Tylenchina, and the infraorders Rhabditomorpha, Panagrolaimomorpha and Tylenchomorpha. Monophyly of the infraorder Ascaridomorpha varies depending on the methods of phylogenetic analysis. The Ascaridomorpha was more closely related to the infraorders Rhabditomorpha and Diplogasteromorpha (suborder Rhabditina) than they were to the other two infraorders of the Spirurina: Oxyuridorpha and Spiruromorpha. The closer relationship among Ascaridomorpha, Rhabditomorpha and Diplogasteromorpha was also supported by a shared common pattern of mitochondrial gene arrangement. Conclusions Analyses of mitochondrial genome sequences and gene arrangement has provided novel insights into the phylogenetic relationships among several major lineages of nematodes. Many lineages of nematodes, however, are underrepresented or not represented in these analyses. Expanding taxon sampling is necessary for future phylogenetic studies of nematodes with mt genome

  16. Expansion of banana (Musa acuminata) gene families involved in ethylene biosynthesis and signalling after lineage-specific whole-genome duplications. (United States)

    Jourda, Cyril; Cardi, Céline; Mbéguié-A-Mbéguié, Didier; Bocs, Stéphanie; Garsmeur, Olivier; D'Hont, Angélique; Yahiaoui, Nabila


    Whole-genome duplications (WGDs) are widespread in plants, and three lineage-specific WGDs occurred in the banana (Musa acuminata) genome. Here, we analysed the impact of WGDs on the evolution of banana gene families involved in ethylene biosynthesis and signalling, a key pathway for banana fruit ripening. Banana ethylene pathway genes were identified using comparative genomics approaches and their duplication modes and expression profiles were analysed. Seven out of 10 banana ethylene gene families evolved through WGD and four of them (1-aminocyclopropane-1-carboxylate synthase (ACS), ethylene-insensitive 3-like (EIL), ethylene-insensitive 3-binding F-box (EBF) and ethylene response factor (ERF)) were preferentially retained. Banana orthologues of AtEIN3 and AtEIL1, two major genes for ethylene signalling in Arabidopsis, were particularly expanded. This expansion was paralleled by that of EBF genes which are responsible for control of EIL protein levels. Gene expression profiles in banana fruits suggested functional redundancy for several MaEBF and MaEIL genes derived from WGD and subfunctionalization for some of them. We propose that EIL and EBF genes were co-retained after WGD in banana to maintain balanced control of EIL protein levels and thus avoid detrimental effects of constitutive ethylene signalling. In the course of evolution, subfunctionalization was favoured to promote finer control of ethylene signalling. © 2014 CIRAD New Phytologist © 2014 New Phytologist Trust.

  17. Comparative genomic analysis reveals occurrence of genetic recombination in virulent Cryptosporidium hominis subtypes and telomeric gene duplications in Cryptosporidium parvum. (United States)

    Guo, Yaqiong; Tang, Kevin; Rowe, Lori A; Li, Na; Roellig, Dawn M; Knipe, Kristine; Frace, Michael; Yang, Chunfu; Feng, Yaoyu; Xiao, Lihua


    Cryptosporidium hominis is a dominant species for human cryptosporidiosis. Within the species, IbA10G2 is the most virulent subtype responsible for all C. hominis-associated outbreaks in Europe and Australia, and is a dominant outbreak subtype in the United States. In recent yearsIaA28R4 is becoming a major new subtype in the United States. In this study, we sequenced the genomes of two field specimens from each of the two subtypes and conducted a comparative genomic analysis of the obtained sequences with those from the only fully sequenced Cryptosporidium parvum genome. Altogether, 8.59-9.05 Mb of Cryptosporidium sequences in 45-767 assembled contigs were obtained from the four specimens, representing 94.36-99.47% coverage of the expected genome. These genomes had complete synteny in gene organization and 96.86-97.0% and 99.72-99.83% nucleotide sequence similarities to the published genomes of C. parvum and C. hominis, respectively. Several major insertions and deletions were seen between C. hominis and C. parvum genomes, involving mostly members of multicopy gene families near telomeres. The four C. hominis genomes were highly similar to each other and divergent from the reference IaA25R3 genome in some highly polymorphic regions. Major sequence differences among the four specimens sequenced in this study were in the 5' and 3' ends of chromosome 6 and the gp60 region, largely the result of genetic recombination. The sequence similarity among specimens of the two dominant outbreak subtypes and genetic recombination in chromosome 6, especially around the putative virulence determinant gp60 region, suggest that genetic recombination plays a potential role in the emergence of hyper-transmissible C. hominis subtypes. The high sequence conservation between C. parvum and C. hominis genomes and significant differences in copy numbers of MEDLE family secreted proteins and insulinase-like proteases indicate that telomeric gene duplications could potentially contribute to

  18. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    Energy Technology Data Exchange (ETDEWEB)

    Pejcha, Robert; Ludwig, Martha L. (Michigan)


    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two ({beta}{alpha}){sub 8} barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys){sub 3}Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E {center_dot} Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  19. Cobalamin-Independent Methionine Synthase (MetE): A Face-to-Face Double Barrel that Evolved by Gene Duplication

    International Nuclear Information System (INIS)

    Pejcha, Robert; Ludwig, Martha L.


    Cobalamin-independent methionine synthase (MetE) catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy) without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH), both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (βα) 8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys) 3 Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E · Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  20. Cobalamin-independent methionine synthase (MetE: a face-to-face double barrel that evolved by gene duplication.

    Directory of Open Access Journals (Sweden)

    Robert Pejchal


    Full Text Available Cobalamin-independent methionine synthase (MetE catalyzes the transfer of a methyl group from methyltetrahydrofolate to L-homocysteine (Hcy without using an intermediate methyl carrier. Although MetE displays no detectable sequence homology with cobalamin-dependent methionine synthase (MetH, both enzymes require zinc for activation and binding of Hcy. Crystallographic analyses of MetE from T. maritima reveal an unusual dual-barrel structure in which the active site lies between the tops of the two (betaalpha(8 barrels. The fold of the N-terminal barrel confirms that it has evolved from the C-terminal polypeptide by gene duplication; comparisons of the barrels provide an intriguing example of homologous domain evolution in which binding sites are obliterated. The C-terminal barrel incorporates the zinc ion that binds and activates Hcy. The zinc-binding site in MetE is distinguished from the (Cys(3Zn site in the related enzymes, MetH and betaine-homocysteine methyltransferase, by its position in the barrel and by the metal ligands, which are histidine, cysteine, glutamate, and cysteine in the resting form of MetE. Hcy associates at the face of the metal opposite glutamate, which moves away from the zinc in the binary E.Hcy complex. The folate substrate is not intimately associated with the N-terminal barrel; instead, elements from both barrels contribute binding determinants in a binary complex in which the folate substrate is incorrectly oriented for methyl transfer. Atypical locations of the Hcy and folate sites in the C-terminal barrel presumably permit direct interaction of the substrates in a ternary complex. Structures of the binary substrate complexes imply that rearrangement of folate, perhaps accompanied by domain rearrangement, must occur before formation of a ternary complex that is competent for methyl transfer.

  1. [Molecular phylogeny of Turbellaria, based on data from comparing the nucleotide sequences of 18S ribosomal RNA genes]. (United States)

    Kuznedelov, K D; Timoshkin, O A


    Polymerase chain reaction and direct sequencing of the 5'-end region of the 18S ribosomal RNA gene were used to infer phylogenetic relationship among turbellarian flatworms from Lake Baikal. Representatives of 5 orders (Tricladida--10 spp., Lecithoepitheliata--5 spp., Prolecithophora--3 spp., Proseriata and Kalyptorhynchia one for each) were studied; nucleotide sequence of more than 340 nucleotides was determined for each species. Consensus sequence for each order having more than one representative species was determined. Distance matrix and maximum parsimony approaches were applied to infer phylogenies. Bootstrap procedure was used to estimate confidence limits, at the 100% level by bootstrapping, the group of three orders: Kalyptorhynchia, Proseriata and Lecithoepitheliata was found to be monophyletic. However, subsets inside the group had no significant support to be preferred or rejected. Our data do not support traditional systematics which joins two suborders Tricladida and Proseriata into the single order Seriata, and also do not support comparative anatomical data which show close relationship of Lecithoepitheliata and lower Prolecithophora.

  2. Molecular phylogeny, population genetics, and evolution of heterocystous cyanobacteria using nifH gene sequences

    Czech Academy of Sciences Publication Activity Database

    Singh, P.; Singh, S. S.; Elster, Josef; Mishra, A. K.


    Roč. 250, č. 3 (2013), s. 751-764 ISSN 0033-183X Institutional support: RVO:67985939 Keywords : evolution * heterocystous cyanobacteria * nifH gene Subject RIV: EH - Ecology, Behaviour Impact factor: 3.171, year: 2013

  3. Antibiotic resistance profile and virulence genes of uropathogenic Escherichia coli isolates in relation to phylogeny. (United States)

    Adib, N; Ghanbarpour, R; Solatzadeh, H; Alizade, H


    Escherichia coli (E. coli) strains are the major cause of urinary tract infections (UTI) and belong to the large group of extra-intestinal pathogenic E. coli. The purposes of this study were to determine the antibiotic resistance profile, virulence genes and phylogenetic background of E. coli isolates from UTI cases. A total of 137 E. coli isolates were obtained from UTI samples. The antimicrobial susceptibility of confirmed isolates was determined by disk diffusion method against eight antibiotics. The isolates were examined to determine the presence and prevalence of selected virulence genes including iucD, sfa/focDE, papEF and hly. ECOR phylo-groups of isolates were determined by detection of yjaA and chuA genes and fragment TspE4.C2. The antibiogram results showed that 71% of the isolates were resistant to cefazolin, 60.42% to co-trimoxazole, 54.16% to nalidixic acid, 36.45% to gentamicin, 29.18% to ciprofloxacin, 14.58% to cefepime, 6.25% to nitrofurantoin and 0.00% to imipenem. Twenty-two antibiotic resistance patterns were observed among the isolates. Virulence genotyping of isolates revealed that 58.39% isolates had at least one of the four virulence genes. The iucD gene was the most prevalent gene (43.06%). The other genes including sfa/focDE, papEF and hly genes were detected in 35.76%, 18.97% and 2.18% isolates, respectively. Nine combination patterns of the virulence genes were detected in isolates. Phylotyping of 137 isolates revealed that the isolates fell into A (45.99%), B1 (13.14%), B2 (19.71%) and D (21.16%) groups. Phylotyping of multidrug resistant isolates indicated that these isolates are mostly in A (60.34%) and D (20.38%) groups. In conclusion, the isolates that possessed the iucD, sfa/focDE, papEF and hly virulence genes mostly belonged to A and B2 groups, whereas antibiotic resistant isolates were in groups A and D. Escherichia coli strains carrying virulence factors and antibiotic resistance are distributed in specific phylogenetic

  4. Insertional translocation leading to a 4q13 duplication including the EPHA5 gene in two siblings with attention-deficit hyperactivity disorder. (United States)

    Matoso, Eunice; Melo, Joana B; Ferreira, Susana I; Jardim, Ana; Castelo, Teresa M; Weise, Anja; Carreira, Isabel M


    An insertional translocation (IT) can result in pure segmental aneusomy for the inserted genomic segment allowing to define a more accurate clinical phenotype. Here, we report on two siblings sharing an unbalanced IT inherited from the mother with a history of learning difficulty. An 8-year-old girl with developmental delay, speech disability, and attention-deficit hyperactivity disorder (ADHD), showed by GTG banding analysis a subtle interstitial alteration in 21q21. Oligonucleotide array comparative genomic hybridization (array-CGH) analysis showed a 4q13.1-q13.3 duplication spanning 8.6 Mb. Fluorescence in situ hybridization (FISH) with bacterial artificial chromosome (BAC) clones confirmed the rearrangement, a der(21)ins(21;4)(q21;q13.1q13.3). The duplication described involves 50 RefSeq genes including the EPHA5 gene that encodes for the EphA5 receptor involved in embryonic development of the brain and also in synaptic remodeling and plasticity thought to underlie learning and memory. The same rearrangement was observed in a younger brother with behavioral problems and also exhibiting ADHD. ADHD is among the most heritable of neuropsychiatric disorders. There are few reports of patients with duplications involving the proximal region of 4q and a mild phenotype. To the best of our knowledge this is the first report of a duplication restricted to band 4q13. This abnormality could be easily missed in children who have nonspecific cognitive impairment. The presence of this behavioral disorder in the two siblings reinforces the hypothesis that the region involved could include genes involved in ADHD. Copyright © 2013 Wiley Periodicals, Inc.

  5. Phylogeny of species and cytotypes of mole rats (Spalacidae) in Turkey inferred from mitochondrial cytochrome b gene sequencees

    Czech Academy of Sciences Publication Activity Database

    Kandemir, I.; Sozen, M.; Matur, F.; Kankilic, T.; Martínková, Natália; Colak, F.; Ozkurt, S. O.; Colak, E.


    Roč. 61, č. 1 (2012), s. 25-33 ISSN 0139-7893 Institutional support: RVO:68081766 Keywords : Nannospalax * molecular phylogeny * chromosomal form * Anatolia * Thrace Subject RIV: EG - Zoology Impact factor: 0.494, year: 2012

  6. A comprehensive phylogeny of auxin homeostasis genes involved in adventitious root formation in carnation stem cuttings.

    Directory of Open Access Journals (Sweden)

    Ana Belén Sánchez-García

    Full Text Available Understanding the functional basis of auxin homeostasis requires knowledge about auxin biosynthesis, auxin transport and auxin catabolism genes, which is not always directly available despite the recent whole-genome sequencing of many plant species. Through sequence homology searches and phylogenetic analyses on a selection of 11 plant species with high-quality genome annotation, we identified the putative gene homologs involved in auxin biosynthesis, auxin catabolism and auxin transport pathways in carnation (Dianthus caryophyllus L.. To deepen our knowledge of the regulatory events underlying auxin-mediated adventitious root formation in carnation stem cuttings, we used RNA-sequencing data to confirm the expression profiles of some auxin homeostasis genes during the rooting of two carnation cultivars with different rooting behaviors. We also confirmed the presence of several auxin-related metabolites in the stem cutting tissues. Our findings offer a comprehensive overview of auxin homeostasis genes in carnation and provide a solid foundation for further experiments investigating the role of auxin homeostasis in the regulation of adventitious root formation in carnation.

  7. Species limits and relationships within Otidea inferred from multiple gene phylogenies

    NARCIS (Netherlands)

    Hansen, K.; Olariaga, I.


    The genus Otidea is one of the more conspicuous members of the Pyronemataceae, with high species diversity in hemiboreal and boreal forests. The genus is morphologically coherent and in previous higher-level multi-gene analyses it formed a highly supported monophyletic group. Species delimitation

  8. Phylogenetic utility of ribosomal genes for reconstructing the phylogeny of five Chinese satyrine tribes (Lepidoptera, Nymphalidae

    Directory of Open Access Journals (Sweden)

    Mingsheng Yang


    Full Text Available Satyrinae is one of twelve subfamilies of the butterfly family Nymphalidae, which currently includes nine tribes. However, phylogenetic relationships among them remain largely unresolved, though different researches have been conducted based on both morphological and molecular data. However, ribosomal genes have never been used in tribe level phylogenetic analyses of Satyrinae. In this study we investigate for the first time the phylogenetic relationships among the tribes Elymniini, Amathusiini, Zetherini and Melanitini which are indicated to be a monophyletic group, and the Satyrini, using two ribosomal genes (28s rDNA and 16s rDNA and four protein-coding genes (EF-1α, COI, COII and Cytb. We mainly aim to assess the phylogenetic informativeness of the ribosomal genes as well as clarify the relationships among different tribes. Our results show the two ribosomal genes generally have the same high phylogenetic informativeness compared with EF-1α; and we infer the 28s rDNA would show better informativeness if the 28s rDNA sequence data for each sampling taxon are obtained in this study. The placement of the monotypic genus Callarge Leech in Zetherini is confirmed for the first time based on molecular evidence. In addition, our maximum likelihood (ML and Bayesian inference (BI trees consistently show that the involved Satyrinae including the Amathusiini is monophyletic with high support values. Although the relationships among the five tribes are identical among ML and BI analyses and are mostly strongly-supported in BI analysis, those in ML analysis are lowly- or moderately- supported. Therefore, the relationships among the related five tribes recovered herein need further verification based on more sampling taxa.

  9. Using paleogenomics to study the evolution of gene families: origin and duplication history of the relaxin family hormones and their receptors.

    Directory of Open Access Journals (Sweden)

    Sergey Yegorov

    Full Text Available Recent progress in the analysis of whole genome sequencing data has resulted in the emergence of paleogenomics, a field devoted to the reconstruction of ancestral genomes. Ancestral karyotype reconstructions have been used primarily to illustrate the dynamic nature of genome evolution. In this paper, we demonstrate how they can also be used to study individual gene families by examining the evolutionary history of relaxin hormones (RLN/INSL and relaxin family peptide receptors (RXFP. Relaxin family hormones are members of the insulin superfamily, and are implicated in the regulation of a variety of primarily reproductive and neuroendocrine processes. Their receptors are G-protein coupled receptors (GPCR's and include members of two distinct evolutionary groups, an unusual characteristic. Although several studies have tried to elucidate the origins of the relaxin peptide family, the evolutionary origin of their receptors and the mechanisms driving the diversification of the RLN/INSL-RXFP signaling systems in non-placental vertebrates has remained elusive. Here we show that the numerous vertebrate RLN/INSL and RXFP genes are products of an ancestral receptor-ligand system that originally consisted of three genes, two of which apparently trace their origins to invertebrates. Subsequently, diversification of the system was driven primarily by whole genome duplications (WGD, 2R and 3R followed by almost complete retention of the ligand duplicates in most vertebrates but massive loss of receptor genes in tetrapods. Interestingly, the majority of 3R duplicates retained in teleosts are potentially involved in neuroendocrine regulation. Furthermore, we infer that the ancestral AncRxfp3/4 receptor may have been syntenically linked to the AncRln-like ligand in the pre-2R genome, and show that syntenic linkages among ligands and receptors have changed dynamically in different lineages. This study ultimately shows the broad utility, with some caveats, of

  10. In Silico Analysis of Putative Sugar Transporter Genes in Aspergillus niger Using Phylogeny and Comparative Transcriptomics

    Directory of Open Access Journals (Sweden)

    Mao Peng


    Full Text Available Aspergillus niger is one of the most widely used fungi to study the conversion of the lignocellulosic feedstocks into fermentable sugars. Understanding the sugar uptake system of A. niger is essential to improve the efficiency of the process of fungal plant biomass degradation. In this study, we report a comprehensive characterization of the sugar transportome of A. niger by combining phylogenetic and comparative transcriptomic analyses. We identified 86 putative sugar transporter (ST genes based on a conserved protein domain search. All these candidates were then classified into nine subfamilies and their functional motifs and possible sugar-specificity were annotated according to phylogenetic analysis and literature mining. Furthermore, we comparatively analyzed the ST gene expression on a large set of fungal growth conditions including mono-, di- and polysaccharides, and mutants of transcriptional regulators. This revealed that transporter genes from the same phylogenetic clade displayed very diverse expression patterns and were regulated by different transcriptional factors. The genome-wide study of STs of A. niger provides new insights into the mechanisms underlying an extremely flexible metabolism and high nutritional versatility of A. niger and will facilitate further biochemical characterization and industrial applications of these candidate STs.

  11. Angiosperm phylogeny inferred from multiple genes as a tool for comparative biology. (United States)

    Soltis, P S; Soltis, D E; Chase, M W


    Comparative biology requires a firm phylogenetic foundation to uncover and understand patterns of diversification and evaluate hypotheses of the processes responsible for these patterns. In the angiosperms, studies of diversification in floral form, stamen organization, reproductive biology, photosynthetic pathway, nitrogen-fixing symbioses and life histories have relied on either explicit or implied phylogenetic trees. Furthermore, to understand the evolution of specific genes and gene families, evaluate the extent of conservation of plant genomes and make proper sense of the huge volume of molecular genetic data available for model organisms such as Arabidopsis, Antirrhinum, maize, rice and wheat, a phylogenetic perspective is necessary. Here we report the results of parsimony analyses of DNA sequences of the plastid genes rbcL and atpB and the nuclear 18S rDNA for 560 species of angiosperms and seven non-flowering seed plants and show a well-resolved and well-supported phylogenetic tree for the angiosperms for use in comparative biology.

  12. Phylogeny and adaptive evolution of the brain-development gene microcephalin (MCPH1 in cetaceans

    Directory of Open Access Journals (Sweden)

    Montgomery Stephen H


    Full Text Available Abstract Background Representatives of Cetacea have the greatest absolute brain size among animals, and the largest relative brain size aside from humans. Despite this, genes implicated in the evolution of large brain size in primates have yet to be surveyed in cetaceans. Results We sequenced ~1240 basepairs of the brain development gene microcephalin (MCPH1 in 38 cetacean species. Alignments of these data and a published complete sequence from Tursiops truncatus with primate MCPH1 were utilized in phylogenetic analyses and to estimate ω (rate of nonsynonymous substitution/rate of synonymous substitution using site and branch models of molecular evolution. We also tested the hypothesis that selection on MCPH1 was correlated with brain size in cetaceans using a continuous regression analysis that accounted for phylogenetic history. Our analyses revealed widespread signals of adaptive evolution in the MCPH1 of Cetacea and in other subclades of Mammalia, however, there was not a significant positive association between ω and brain size within Cetacea. Conclusion In conjunction with a recent study of Primates, we find no evidence to support an association between MCPH1 evolution and the evolution of brain size in highly encephalized mammalian species. Our finding of significant positive selection in MCPH1 may be linked to other functions of the gene.

  13. Assessment and Reconstruction of Novel HSP90 Genes: Duplications, Gains and Losses in Fungal and Animal Lineages

    Czech Academy of Sciences Publication Activity Database

    Pantzartzi, Chrysoula; Drosopoulou, E.; Scouras, Z.


    Roč. 8, č. 9 (2013), s. 1-11 E-ISSN 1932-6203 R&D Projects: GA MŠk(CZ) ED1.1.00/02.0109 Institutional support: RVO:68378050 Keywords : Hsp90s * Fungi * duplication events Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 3.534, year: 2013

  14. Delineation of a new chromosome 20q11.2 duplication syndrome including the ASXL1 gene

    DEFF Research Database (Denmark)

    Avila, Magali; Kirchhoff, Eva Maria; Marle, Nathalie


    We report on three males with de novo overlapping 7.5, 9.8, and 10 Mb duplication of chromosome 20q11.2. Together with another patient previously published in the literature with overlapping 20q11 microduplication, we show that such patients display common clinical features including metopic ridg...

  15. [Approach to Spodoptera (Lepidoptera: Noctuidae) phylogeny based on the sequence of the cytocrhome oxydase I (COI) mitochondrial gene]. (United States)

    Saldamando, Clara Inés; Marquez, Edna Judith


    The genus Spodoptera includes 30 species of moths considered important pests worldwide, with a great representation in the Western Hemisphere. In general, Noctuidae species have morphological similarities that have caused some difficulties for assertive species identification by conventional methods. The purpose of this work was to generate an approach to the genus phylogeny from several species of the genus Spodoptera and the species Bombyx mori as an out group, with the use of molecular tools. For this, a total of 102 S. frugiperda larvae were obtained at random in corn, cotton, rice, grass and sorghum, during late 2006 and early 2009, from Colombia. We took ADN samples from the larval posterior part and we analyzed a fragment of 451 base pairs of the mitochondrial gene cytochrome oxydase I (COI), to produce a maximum likelihood (ML) tree by using 62 sequences (29 Colombian haplotypes were used). Our results showed a great genetic differentiation (K2 distances) amongst S. frugiperda haplotypes from Colombia and the United States, condition supported by the estimators obtained for haplotype diversity and polymorphism. The obtained ML tree clustered most of the species with bootstrapping values from 73-99% in the interior branches; with low values also observed in some of the branches. In addition, this tree clustered two species of the Eastern hemisphere (S littoralis and S. litura) and eight species of the Western hemisphere (S. androgea, S. dolichos, S. eridania, S. exigua, S. frugiperda, S. latifascia, S. ornithogalli and S. pulchella). In Colombia, S. frugiperda, S. ornithogalli and S. albula represent a group of species referred as "the Spodoptera complex" of cotton crops, and our work demonstrated that sequencing a fragment of the COI gene, allows researchers to differentiate the first two species, and thus it can be used as an alternative method to taxonomic keys based on morphology. Finally, the ML tree did not cluster S. frugiperda with S. ornithogalli

  16. Analysis of genetic variation and phylogeny of the predatory bug, Pilophorus typicus, in Japan using mitochondrial gene sequences. (United States)

    Ito, Katsura; Nishikawa, Hiroshi; Shimada, Takuji; Ogawa, Kohei; Minamiya, Yukio; Tomoda, Masafumi; Nakahira, Kengo; Kodama, Rika; Fukuda, Tatsuya; Arakawa, Ryo


    Pilophorus typicus (Distant) (Heteroptera: Miridae) is a predatory bug occurring in East, Southeast, and South Asia. Because the active stages of P. typicus prey on various agricultural pest insects and mites, this species is a candidate insect as an indigenous natural enemy for use in biological control programs. However, the mass releasing of introduced natural enemies into agricultural fields may incur the risk of affecting the genetic integrity of species through hybridization with a local population. To clarify the genetic characteristics of the Japanese populations of P. typicus two portions of the mitochondrial DNA, the cytochrome oxidase subunit I (COI) (534 bp) and the cytochrome B (cytB) (217 bp) genes, were sequenced for 64 individuals collected from 55 localities in a wide range of Japan. Totals of 18 and 10 haplotypes were identified for the COI and cytB sequences, respectively (25 haplotypes over regions). Phylogenetic analysis using the maximum likelihood method revealed the existence of two genetically distinct groups in P. typicus in Japan. These groups were distributed in different geographic ranges: one occurred mainly from the Pacific coastal areas of the Kii Peninsula, the Shikoku Island, and the Ryukyu Islands; whereas the other occurred from the northern Kyushu district to the Kanto and Hokuriku districts of mainland Japan. However, both haplotypes were found in a single locality of the southern coast of the Shikoku Island. COI phylogeny incorporating other Pilophorus species revealed that these groups were only recently differentiated. Therefore, use of a certain population of P. typicus across its distribution range should be done with caution because genetic hybridization may occur.

  17. Prevalence and spectrum of large deletions or duplications in the major long QT syndrome-susceptibility genes and implications for long QT syndrome genetic testing. (United States)

    Tester, David J; Benton, Amber J; Train, Laura; Deal, Barbara; Baudhuin, Linnea M; Ackerman, Michael J


    Long QT syndrome (LQTS) is a cardiac channelopathy associated with syncope, seizures, and sudden death. Approximately 75% of LQTS is due to mutations in genes encoding for 3 cardiac ion channel α-subunits (LQT1 to LQT3). However, traditional mutational analyses have limited detection capabilities for atypical mutations such as large gene rearrangements. We set out to determine the prevalence and spectrum of large deletions/duplications in the major LQTS-susceptibility genes in unrelated patients who were mutation negative after point mutation analysis of LQT1- to LQT12-susceptibility genes. Forty-two unrelated, clinically strong LQTS patients were analyzed using multiplex ligation-dependent probe amplification, a quantitative fluorescent technique for detecting multiple exon deletions and duplications. The SALSA multiplex ligation-dependent probe amplification LQTS kit from MRC-Holland was used to analyze the 3 major LQTS-associated genes, KCNQ1, KCNH2, and SCN5A, and the 2 minor genes, KCNE1 and KCNE2. Overall, 2 gene rearrangements were found in 2 of 42 unrelated patients (4.8%, confidence interval 1.7 to 11). A deletion of KCNQ1 exon 3 was identified in a 10-year-old Caucasian boy with a corrected QT duration of 660 ms, a personal history of exercise-induced syncope, and a family history of syncope. A deletion of KCNQ1 exon 7 was identified in a 17-year-old Caucasian girl with a corrected QT duration of 480 ms, a personal history of exercise-induced syncope, and a family history of sudden cardiac death. In conclusion, because nearly 5% of patients with genetically elusive LQTS had large genomic rearrangements involving the canonical LQTS-susceptibility genes, reflex genetic testing to investigate genomic rearrangements may be of clinical value. Copyright © 2010 Elsevier Inc. All rights reserved.

  18. Molecular phylogeny of some avian species using Cytochrome b gene sequence analysis (United States)

    Awad, A; Khalil, S. R; Abd-Elhakim, Y. M


    Veritable identification and differentiation of avian species is a vital step in conservative, taxonomic, forensic, legal and other ornithological interventions. Therefore, this study involved the application of molecular approach to identify some avian species i.e. Chicken (Gallus gallus), Muskovy duck (Cairina moschata), Japanese quail (Coturnix japonica), Laughing dove (Streptopelia senegalensis), and Rock pigeon (Columba livia). Genomic DNA was extracted from blood samples and partial sequence of the mitochondrial cytochrome b gene (358 bp) was amplified and sequenced using universal primers. Sequences alignment and phylogenetic analyses were performed by CLC main workbench program. The obtained five sequences were deposited in GenBank and compared with those previously registered in GenBank. The similarity percentage was 88.60% between Gallus gallus and Coturnix japonica and 80.46% between Gallus gallus and Columba livia. The percentage of identity between the studied species and GenBank species ranged from 77.20% (Columba oenas and Anas platyrhynchos) to 100% (Gallus gallus and Gallus sonneratii, Coturnix coturnix and Coturnix japonica, Meleagris gallopavo and Columba livia). Amplification of the partial sequence of mitochondrial cytochrome b gene proved to be practical for identification of an avian species unambiguously. PMID:27175180

  19. MultiLoc2: integrating phylogeny and Gene Ontology terms improves subcellular protein localization prediction

    Directory of Open Access Journals (Sweden)

    Kohlbacher Oliver


    Full Text Available Abstract Background Knowledge of subcellular localization of proteins is crucial to proteomics, drug target discovery and systems biology since localization and biological function are highly correlated. In recent years, numerous computational prediction methods have been developed. Nevertheless, there is still a need for prediction methods that show more robustness and higher accuracy. Results We extended our previous MultiLoc predictor by incorporating phylogenetic profiles and Gene Ontology terms. Two different datasets were used for training the system, resulting in two versions of this high-accuracy prediction method. One version is specialized for globular proteins and predicts up to five localizations, whereas a second version covers all eleven main eukaryotic subcellular localizations. In a benchmark study with five localizations, MultiLoc2 performs considerably better than other methods for animal and plant proteins and comparably for fungal proteins. Furthermore, MultiLoc2 performs clearly better when using a second dataset that extends the benchmark study to all eleven main eukaryotic subcellular localizations. Conclusion MultiLoc2 is an extensive high-performance subcellular protein localization prediction system. By incorporating phylogenetic profiles and Gene Ontology terms MultiLoc2 yields higher accuracies compared to its previous version. Moreover, it outperforms other prediction systems in two benchmarks studies. MultiLoc2 is available as user-friendly and free web-service, available at:

  20. A Multi-Gene Phylogeny of Ceratocystis Manginecans Infecting Mango in Pakistan

    International Nuclear Information System (INIS)

    Rashid, A.; Ahmad, I.; Iram, S.


    Mango trees (Mangifera indica L.) are affected by a serious wilt disease, recognized as mango sudden death first time reported in Muzafargargh Punjab, Pakistan in 1995. Its prevalent is in almost all mango growing areas with severity ranged from 2-5 percent in Punjab and 5-10 percent in Sindh. Survey and sampling was conducted during the year 2011-12, on mango orchids in different distracts of Punjab and Sindh and no location was found free from this Disease. For molecular identification, DNA was successfully extracted and was then amplified by using ITS, BT, TEF (600-800)primers through Polymerase Chain Reaction (PCR) assay and nucleotide evidence of Pakistani isolates (45 for each gene) exhibiting the maximum genetic homology with Ceratocystis manginecans (99-100 percent) followed by C. fimbriata (97 percent) and C. omanensis (80 percent) respectively. On the basics of morphological tools and comparison of nucleotide evidence of multi-genes, C. manginecans is different from C. fimbriata and C. omanensis which infect mango in Pakistan. The availability of disease-free planting material and management in combination with fertilization and proper irrigation system would help in improving orchard management system. (author)

  1. Phylogenies of symbiotic genes of Bradyrhizobium symbionts of legumes of economic and environmental importance in Brazil support the definition of the new symbiovars pachyrhizi and sojae. (United States)

    Delamuta, Jakeline Renata Marçon; Menna, Pâmela; Ribeiro, Renan Augusto; Hungria, Mariangela


    Bradyrhizobium comprises most tropical symbiotic nitrogen-fixing strains, but the correlation between symbiotic and core genes with host specificity is still unclear. In this study, the phylogenies of the nodY/K and nifH genes of 45 Bradyrhizobium strains isolated from legumes of economic and environmental importance in Brazil (Arachis hypogaea, Acacia auriculiformis, Glycine max, Lespedeza striata, Lupinus albus, Stylosanthes sp. and Vigna unguiculata) were compared to 16S rRNA gene phylogeny and genetic diversity by rep-PCR. In the 16S rRNA tree, strains were distributed into two superclades-B. japonicum and B. elkanii-with several strains being very similar within each clade. The rep-PCR analysis also revealed high intra-species diversity. Clustering of strains in the nodY/K and nifH trees was identical: 39 strains isolated from soybean grouped with Bradyrhizobium type species symbionts of soybean, whereas five others occupied isolated positions. Only one strain isolated from Stylosanthes sp. showed similar nodY/K and nifH sequences to soybean strains, and it also nodulated soybean. Twenty-one representative strains of the 16S rRNA phylogram were selected and taxonomically classified using a concatenated glnII-recA phylogeny; nodC sequences were also compared and revealed the same clusters as observed in the nodY/K and nifH phylograms. The analyses of symbiotic genes indicated that a large group of strains from the B. elkanii superclade comprised the novel symbiovar sojae, whereas for another group, including B. pachyrhizi, the symbiovar pachyrhizi could be proposed. Other potential new symbiovars were also detected. The co-evolution hypotheses is discussed and it is suggested that nodY/K analysis would be useful for investigating the symbiotic diversity of the genus Bradyrhizobium. Copyright © 2017 Elsevier GmbH. All rights reserved.

  2. Evolutionary Relationship of the Scale-Bearing Kraken (incertae sedis, Monadofilosa, Cercozoa, Rhizaria): Combining Ultrastructure Data and a Two-Gene Phylogeny. (United States)

    Dumack, Kenneth; Mylnikov, Alexander P; Bonkowski, Michael


    The genus Kraken represents a distinct lineage of filose amoebae within the Cercozoa. Currently a single species, Kraken carinae, has been described. SSU rDNA phylogeny showed an affiliation to the Cercomonadida, branching with weak support at its base, close to Paracercomonas, Metabolomonas, and Brevimastigomonas. Light microscopical analyses showed several unique features of the genus Kraken, but ultrastructure data were lacking. In this study, K. carinae has been studied by electron microscopy, these data conjoined with a two-gene phylogeny were used to give more insight into the evolutionary relationship of the genus Kraken within Cercozoa. The data confirmed the absence of flagella, but also showed novel characteristics, such as the presence of extrusomes, osmiophilic bodies, and mitochondria with flat cristae. Surprising was the presence of single-tier scales which are carried by cell outgrowths, much of what is expected of the last common ancestor of the class Imbricatea. The phylogenetic analyses however confirmed previous results, indicating Kraken as a sister group to Paracercomonas in Sarcomonadea with an increased but still low support of 0.98 PP/63 BP. Based on the unique features of Kraken we establish the Krakenidae fam. nov. that we, due to contradictory results in morphology and phylogeny, assign incertae sedis, Monadofilosa. Copyright © 2017 Elsevier GmbH. All rights reserved.

  3. New Insights into the Phylogeny and Gene Context Analysis of Binder of Sperm Proteins (BSPs.

    Directory of Open Access Journals (Sweden)

    Edith Serrano

    Full Text Available Seminal plasma (SP proteins support the survival of spermatozoa acting not only at the plasma membrane but also by inhibition of capacitation, resulting in higher fertilizing ability. Among SP proteins, BSP (binder of sperm proteins are the most studied, since they may be useful for the improvement of semen diluents, storage and subsequent fertilization results. However, an updated and detailed phylogenetic analysis of the BSP protein superfamily has not been carried out with all the sequences described in the main databases. The update view shows for the first time an equally distributed number of sequences between the three families: BSP, and their homologs 1 (BSPH1 and 2 (BSPH2. The BSP family is divided in four subfamilies, BSP1 subfamily being the predominant, followed by subfamilies BSP3, BSP5 and BSP2. BSPH proteins were found among placental mammals (Eutheria belonging to the orders Proboscidea, Primates, Lagomorpha, Rodentia, Chiroptera, Perissodactyla and Cetartiodactyla. However, BSPH2 proteins were also found in the Scandentia order and Metatheria clade. This phylogenetic analysis, when combined with a gene context analysis, showed a completely new evolutionary scenario for the BSP superfamily of proteins with three defined different gene patterns, one for BSPs, one for BSPH1/BSPH2/ELSPBP1 and another one for BSPH1/BSPH2 without ELSPBP1. In addition, the study has permitted to define concise conserved blocks for each family (BSP, BSPH1 and BSPH2, which could be used for a more reliable assignment for the incoming sequences, for data curation of current databases, and for cloning new BSPs, as the one described in this paper, ram seminal vesicle 20 kDa protein (RSVP20, Ovis aries BSP5b.

  4. A plastid gene phylogeny of the non-photosynthetic parasitic Orobanche (Orobanchaceae) and related genera. (United States)

    Park, Jeong-Mi; Manen, Jean-François; Colwell, Alison E; Schneeweiss, Gerald M


    The phylogenetic relationships of the non-photosynthetic Orobanche sensu lato (Orobanchaceae), which includes some of the economically most important parasitic weeds, remain insufficiently understood and controversial. This concerns both the phylogenetic relationships within the genus, in particular its monophyly or lack thereof, and the relationships to other holoparasitic genera such as Cistanche or Conopholis. Here we present the first comprehensive phylogenetic study of this group based on a region from the plastid genome (rps2 gene). Although substitution rates appear to be elevated compared to the photosynthetic members of Orobanchaceae, relationships among the major lineages Cistanche, Conopholis plus Epifagus, Boschniakia rossica (Cham. & Schltdl.) B. Fedtsch., B. himalaica Hook. f. & Thomson, B. hookeri Walp. plus B. strobilacea A. Gray, and Orobanche s. l. remain unresolved. Resolution within Orobanche, however, is much better. In agreement with morphological, cytological and other molecular phylogenetic evidence, five lineages, corresponding to the four traditionally recognised sections (Gymnocaulis, Myzorrhiza, Orobanche, Trionychon) and O. latisquama Reut. ex Boiss. (of sect. Orobanche), can be distinguished. A combined analysis of plastid rps2 and nuclear ITS sequences of the holoparasitic genera results in more resolved and better supported trees, although the relationships among Orobanche s. l., Cistanche, and the clade including the remaining genera is unresolved. Therefore, rps2 is a marker from the plastid genome that is well-suited to be used in combination with other already established nuclear markers for resolving generic relationships of Orobanche and related genera.

  5. Phylogeny and evolution of Digitulati ground beetles (Coleoptera, Carabidae) inferred from mitochondrial ND5 gene sequences. (United States)

    Su, Zhi-Hui; Imura, Yûki; Okamoto, Munehiro; Kim, Choong-Gon; Zhou, Hong-Zhang; Paik, Jong-Cheol; Osawa, Syozo


    Genealogical trees have been constructed using mitochondrial ND5 gene sequences of 87 specimens consisting of 32 species which have been believed to belong to the division Digitulati (one of the lineages of the subtribe Carabina) of the world. There have been recognized six lineages, which are well separated from each other. Each lineage contains the following genus: (1) the lineage A: Ohomopterus from Japan; (2) the lineage B: Isiocarabus from eastern Eurasian Continent; (3) the lineage C: Carabus from China which are further subdivided into three sublineages; (4) the lineage D: Carabus from USA; (5) the lineage E: Carabus from the Eurasian Continent, Japan and North America; and (6) the lineage F: Eucarabus from the Eurasian Continent. Additionally, the genus Acrocarabus which had been treated as a constituent of the division Archicarabomorphi has been recognized to be the 7th lineage of the division Digitulati from the ND5 genealogical analysis as well as morphology. These lineages are assumed to have radiated within a short period and are largely linked to their geographic distribution.

  6. A plastid gene phylogeny of the non-photosynthetic parasitic Orobanche (Orobanchaceae) and related genera (United States)

    Park, J.-M.; Manen, J.-F.; Colwell, A.E.; Schneeweiss, G.M.


    The phylogenetic relationships of the non-photosynthetic Orobanche sensu lato (Orobanchaceae), which includes some of the economically most important parasitic weeds, remain insufficiently understood and controversial. This concerns both the phylogenetic relationships within the genus, in particular its monophyly or lack thereof, and the relationships to other holoparasitic genera such as Cistanche or Conopholis. Here we present the first comprehensive phylogenetic study of this group based on a region from the plastid genome (rps2 gene). Although substitution rates appear to be elevated compared to the photosynthetic members of Orobanchaceae, relationships among the major lineages Cistanche, Conopholis plus Epifagus, Boschniakia rossica (Cham. & Schltdl.) B. Fedtsch., B. himalaica Hook. f. & Thomson, B. hookeri Walp. plus B. strobilacea A. Gray, and Orobanche s. l. remain unresolved. Resolution within Orobanche, however, is much better. In agreement with morphological, cytological and other molecular phylogenetic evidence, five lineages, corresponding to the four traditionally recognised sections (Gymnocaulis, Myzorrhiza, Orobanche, Trionychon) and O. latisquama Reut. ex Boiss. (of sect. Orobanche), can be distinguished. A combined analysis of plastid rps2 and nuclear ITS sequences of the holoparasitic genera results in more resolved and better supported trees, although the relationships among Orobanche s. l., Cistanche, and the clade including the remaining genera is unresolved. Therefore, rps2 is a marker from the plastid genome that is well-suited to be used in combination with other already established nuclear markers for resolving generic relationships of Orobanche and related genera. ?? 2008 The Botanical Society of Japan and Springer.

  7. A 12.3-kb Duplication Within the VWF Gene in Pigs Affected by Von Willebrand Disease Type 3

    Directory of Open Access Journals (Sweden)

    Stefanie Lehner


    Full Text Available Von Willebrand Disease (VWD type 3 is a serious and sometimes fatal hereditary bleeding disorder. In pigs, the disease has been known for decades, and affected animals are used as models for the human disease. Due to the recessive mode of inheritance of VWD type 3, severe bleeding is typically seen in homozygous individuals. We sequenced the complete porcine VWF (Von Willebrand Factor complementary DNA (cDNA and detected a tandem duplication of exons 17 and 18, causing a frameshift and a premature termination codon (p.Val814LeufsTer3 in the affected pig. Subsequent next generation sequencing on genomic DNA proved the existence of a 12.3-kb tandem duplication associated with VWD. This duplication putatively originates from porcine Short Interspersed Nuclear Elements (SINEs located within VWF introns 16 and 18 with high identity. The premature termination truncates the VWF open reading frame by a large part, resulting in an almost entire loss of the mature peptide. It is therefore supposed to account for the severe VWD type 3. Our results further indicate the presence of strong, nonsense-mediated decay in VWF messenger RNA (mRNA containing the duplication, which was supported by the almost complete absence of the complete VWF protein in immunohistochemistry analysis of the VWD-affected pig. In the past, differentiation of wild-type and heterozygous pigs in this VWD colony had to rely on clinical examinations and additional laboratory methods. The present study provides the basis to distinguish both genotypes by performing a rapid and simple genetic analysis.

  8. Genome-wide identification and comparative expression analysis reveal a rapid expansion and functional divergence of duplicated genes in the WRKY gene family of cabbage, Brassica oleracea var. capitata. (United States)

    Yao, Qiu-Yang; Xia, En-Hua; Liu, Fei-Hu; Gao, Li-Zhi


    WRKY transcription factors (TFs), one of the ten largest TF families in higher plants, play important roles in regulating plant development and resistance. To date, little is known about the WRKY TF family in Brassica oleracea. Recently, the completed genome sequence of cabbage (B. oleracea var. capitata) allows us to systematically analyze WRKY genes in this species. A total of 148 WRKY genes were characterized and classified into seven subgroups that belong to three major groups. Phylogenetic and synteny analyses revealed that the repertoire of cabbage WRKY genes was derived from a common ancestor shared with Arabidopsis thaliana. The B. oleracea WRKY genes were found to be preferentially retained after the whole-genome triplication (WGT) event in its recent ancestor, suggesting that the WGT event had largely contributed to a rapid expansion of the WRKY gene family in B. oleracea. The analysis of RNA-Seq data from various tissues (i.e., roots, stems, leaves, buds, flowers and siliques) revealed that most of the identified WRKY genes were positively expressed in cabbage, and a large portion of them exhibited patterns of differential and tissue-specific expression, demonstrating that these gene members might play essential roles in plant developmental processes. Comparative analysis of the expression level among duplicated genes showed that gene expression divergence was evidently presented among cabbage WRKY paralogs, indicating functional divergence of these duplicated WRKY genes. Copyright © 2014 Elsevier B.V. All rights reserved.

  9. Single-copy nuclear genes resolve the phylogeny of the holometabolous insects

    Directory of Open Access Journals (Sweden)

    Bertone Matthew A


    Full Text Available Abstract Background Evolutionary relationships among the 11 extant orders of insects that undergo complete metamorphosis, called Holometabola, remain either unresolved or contentious, but are extremely important as a context for accurate comparative biology of insect model organisms. The most phylogenetically enigmatic holometabolan insects are Strepsiptera or twisted wing parasites, whose evolutionary relationship to any other insect order is unconfirmed. They have been controversially proposed as the closest relatives of the flies, based on rDNA, and a possible homeotic transformation in the common ancestor of both groups that would make the reduced forewings of Strepsiptera homologous to the reduced hindwings of Diptera. Here we present evidence from nucleotide sequences of six single-copy nuclear protein coding genes used to reconstruct phylogenetic relationships and estimate evolutionary divergence times for all holometabolan orders. Results Our results strongly support Hymenoptera as the earliest branching holometabolan lineage, the monophyly of the extant orders, including the fleas, and traditionally recognized groupings of Neuropteroidea and Mecopterida. Most significantly, we find strong support for a close relationship between Coleoptera (beetles and Strepsiptera, a previously proposed, but analytically controversial relationship. Exploratory analyses reveal that this relationship cannot be explained by long-branch attraction or other systematic biases. Bayesian divergence times analysis, with reference to specific fossil constraints, places the origin of Holometabola in the Carboniferous (355 Ma, a date significantly older than previous paleontological and morphological phylogenetic reconstructions. The origin and diversification of most extant insect orders began in the Triassic, but flourished in the Jurassic, with multiple adaptive radiations producing the astounding diversity of insect species for which these groups are so well

  10. Aspergillus is monophyletic: Evidence from multiple gene phylogenies and extrolites profiles

    Directory of Open Access Journals (Sweden)

    S. Kocsubé


    Full Text Available Aspergillus is one of the economically most important fungal genera. Recently, the ICN adopted the single name nomenclature which has forced mycologists to choose one name for fungi (e.g. Aspergillus, Fusarium, Penicillium, etc.. Previously two proposals for the single name nomenclature in Aspergillus were presented: one attributes the name “Aspergillus” to clades comprising seven different teleomorphic names, by supporting the monophyly of this genus; the other proposes that Aspergillus is a non-monophyletic genus, by preserving the Aspergillus name only to species belonging to subgenus Circumdati and maintaining the sexual names in the other clades. The aim of our study was to test the monophyly of Aspergilli by two independent phylogenetic analyses using a multilocus phylogenetic approach. One test was run on the publicly available coding regions of six genes (RPB1, RPB2, Tsr1, Cct8, BenA, CaM, using 96 species of Penicillium, Aspergillus and related taxa. Bayesian (MrBayes and Ultrafast Maximum Likelihood (IQ-Tree and Rapid Maximum Likelihood (RaxML analyses gave the same conclusion highly supporting the monophyly of Aspergillus. The other analyses were also performed by using publicly available data of the coding sequences of nine loci (18S rRNA, 5,8S rRNA, 28S rRNA (D1-D2, RPB1, RPB2, CaM, BenA, Tsr1, Cct8 of 204 different species. Both Bayesian (MrBayes and Maximum Likelihood (RAxML trees obtained by this second round of independent analyses strongly supported the monophyly of the genus Aspergillus. The stability test also confirmed the robustness of the results obtained. In conclusion, statistical analyses have rejected the hypothesis that the Aspergilli are non-monophyletic, and provided robust arguments that the genus is monophyletic and clearly separated from the monophyletic genus Penicillium. There is no phylogenetic evidence to split Aspergillus into several genera and the name Aspergillus can be used for all the species

  11. New higher taxa in the lichen family Graphidaceae (lichenized Ascomycota: Ostropales) based on a three-gene skeleton phylogeny (United States)

    H. Thorsten Lumbsch; Ekaphan Kraichak; Sittiporn Parnmen; Eimy Rivas Plata; Andre Aptroot; Marcela E.S. Caceres; Damien Ertz; Shirley Cunha Feuerstein; Joel A. Mercado-Diaz; Bettina Staiger; Dries Van den Broeck; Robert. Lücking


    We provide an updated skeleton phylogeny of the lichenized family Graphidaceae (excluding subfamily Gomphilloideae), based on three loci (mtSSU, nuLSU, RPB2), to elucidate the position of four new genera, Aggregatorygma, Borinquenotrema, Corticorygma, and Paratopeliopsis, as well as the placement of the enigmatic species Diorygma erythrellum, Fissurina monilifera, and...

  12. Intron-exon organization of the active human protein S gene PS. alpha. and its pseudogene PS. beta. : Duplication and silencing during primate evolution

    Energy Technology Data Exchange (ETDEWEB)

    Ploos van Amstel, H.; Reitsma, P.H.; van der Logt, C.P.; Bertina, R.M. (University Hospital, Leiden (Netherlands))


    The human protein S locus on chromosome 3 consists of two protein S genes, PS{alpha} and PS{beta}. Here the authors report the cloning and characterization of both genes. Fifteen exons of the PS{alpha} gene were identified that together code for protein S mRNA as derived from the reported protein S cDNAs. Analysis by primer extension of liver protein S mRNA, however, reveals the presence of two mRNA forms that differ in the length of their 5{prime}-noncoding region. Both transcripts contain a 5{prime}-noncoding region longer than found in the protein S cDNAs. The two products may arise from alternative splicing of an additional intron in this region or from the usage of two start sites for transcription. The intron-exon organization of the PS{alpha} gene fully supports the hypothesis that the protein S gene is the product of an evolutional assembling process in which gene modules coding for structural/functional protein units also found in other coagulation proteins have been put upstream of the ancestral gene of a steroid hormone binding protein. The PS{beta} gene is identified as a pseudogene. It contains a large variety of detrimental aberrations, viz., the absence of exon I, a splice site mutation, three stop codons, and a frame shift mutation. Overall the two genes PS{alpha} and PS{beta} show between their exonic sequences 96.5% homology. Southern analysis of primate DNA showed that the duplication of the ancestral protein S gene has occurred after the branching of the orangutan from the African apes. A nonsense mutation that is present in the pseudogene of man also could be identified in one of the two protein S genes of both chimpanzee and gorilla. This implicates that silencing of one of the two protein S genes must have taken place before the divergence of the three African apes.

  13. A 20 bp Duplication in Exon 2 of the Aristaless-Like Homeobox 4 Gene (ALX4 Is the Candidate Causative Mutation for Tibial Hemimelia Syndrome in Galloway Cattle.

    Directory of Open Access Journals (Sweden)

    Bertram Brenig

    Full Text Available Aristaless-like homeobox 4 (ALX4 gene is an important transcription regulator in skull and limb development. In humans and mice ALX4 mutations or loss of function result in a number of skeletal and organ malformations, including polydactyly, tibial hemimelia, omphalocele, biparietal foramina, impaired mammary epithelial morphogenesis, alopecia, coronal craniosynostosis, hypertelorism, depressed nasal bridge and ridge, bifid nasal tip, hypogonadism, and body agenesis. Here we show that a complex skeletal malformation of the hind limb in Galloway cattle together with other developmental anomalies is a recessive autosomal disorder most likely caused by a duplication of 20 bp in exon 2 of the bovine ALX4 gene. A second duplication of 34 bp in exon 4 of the same gene has no known effect, although both duplications result in a frameshift and premature stop codon leading to a truncated protein. Genotyping of 1,688 Black/Red/Belted/Riggit Galloway (GA and 289 White Galloway (WGA cattle showed that the duplication in exon 2 has allele frequencies of 1% in GA and 6% in WGA and the duplication in exon 4 has frequencies of 23% in GA and 38% in WGA. Both duplications were not detected in 876 randomly selected German Holstein Friesian and 86 cattle of 21 other breeds. Hence, we have identified a candidate causative mutation for tibial hemimelia syndrome in Galloway cattle and selection against this mutation can be used to eliminate the mutant allele from the breed.

  14. The roles of gene duplication, gene conversion and positive selection in rodent Esp and Mup pheromone gene families with comparison to the Abp family. (United States)

    Karn, Robert C; Laukaitis, Christina M


    Three proteinaceous pheromone families, the androgen-binding proteins (ABPs), the exocrine-gland secreting peptides (ESPs) and the major urinary proteins (MUPs) are encoded by large gene families in the genomes of Mus musculus and Rattus norvegicus. We studied the evolutionary histories of the Mup and Esp genes and compared them with what is known about the Abp genes. Apparently gene conversion has played little if any role in the expansion of the mouse Class A and Class B Mup genes and pseudogenes, and the rat Mups. By contrast, we found evidence of extensive gene conversion in many Esp genes although not in all of them. Our studies of selection identified at least two amino acid sites in β-sheets as having evolved under positive selection in the mouse Class A and Class B MUPs and in rat MUPs. We show that selection may have acted on the ESPs by determining K(a)/K(s) for Exon 3 sequences with and without the converted sequence segment. While it appears that purifying selection acted on the ESP signal peptides, the secreted portions of the ESPs probably have undergone much more rapid evolution. When the inner gene converted fragment sequences were removed, eleven Esp paralogs were present in two or more pairs with K(a)/K(s) >1.0 and thus we propose that positive selection is detectable by this means in at least some mouse Esp paralogs. We compare and contrast the evolutionary histories of all three mouse pheromone gene families in light of their proposed functions in mouse communication.

  15. The phylogeny of the mammalian heme peroxidases and the evolution of their diverse functions

    Directory of Open Access Journals (Sweden)

    Ó'Fágáin Ciarán


    Full Text Available Abstract Background The mammalian heme peroxidases (MHPs are a medically important group of enzymes. Included in this group are myeloperoxidase, eosinophil peroxidase, lactoperoxidase, and thyroid peroxidase. These enzymes are associated with such diverse diseases as asthma, Alzheimer's disease and inflammatory vascular disease. Despite much effort to elucidate a clearer understanding of the function of the 4 major groups of this multigene family, we still do not have a clear understanding of their relationships to each other. Results Sufficient signal exists for the resolution of the evolutionary relationships of this family of enzymes. We demonstrate, using a root mean squared deviation statistic, how the removal of the fastest evolving sites aids in the minimisation of the effect of long branch attraction and the generation of a highly supported phylogeny. Based on this phylogeny we have pinpointed the amino acid positions that have most likely contributed to the diverse functions of these enzymes. Many of these residues are in close proximity to sites implicated in protein misfolding, loss of function or disease. Conclusion Our analysis of all available genomic sequence data for the MHPs from all available completed mammalian genomes, involved sophisticated methods of phylogeny reconstruction and data treatment. Our study has (i fully resolved the phylogeny of the MHPs and the subsequent pattern of gene duplication, and (ii, we have detected amino acids under positive selection that have most likely contributed to the observed functional shifts in each type of MHP.

  16. Mammals from ‘down under’: a multi-gene species-level phylogeny of marsupial mammals (Mammalia, Metatheria

    Directory of Open Access Journals (Sweden)

    Laura J. May-Collado


    Full Text Available Marsupials or metatherians are a group of mammals that are distinct in giving birth to young at early stages of development and in having a prolonged investment in lactation. The group consists of nearly 350 extant species, including kangaroos, koala, possums, and their relatives. Marsupials are an old lineage thought to have diverged from early therian mammals some 160 million years ago in the Jurassic, and have a remarkable evolutionary and biogeographical history, with extant species restricted to the Americas, mostly South America, and to Australasia. Although the group has been the subject of decades of phylogenetic research, the marsupial tree of life remains controversial, with most studies focusing on only a fraction of the species diversity within the infraclass. Here we present the first Methaterian species-level phylogeny to include 80% of the extant marsupial species and five nuclear and five mitochondrial markers obtained from Genbank and a recently published retroposon matrix. Our primary goal is to provide a summary phylogeny that will serve as a tool for comparative research. We evaluate the extent to which the phylogeny recovers current phylogenetic knowledge based on the recovery of “benchmark clades” from prior studies—unambiguously supported key clades and undisputed traditional taxonomic groups. The Bayesian phylogenetic analyses recovered nearly all benchmark clades but failed to find support for the suborder Phalagiformes. The most significant difference with previous published topologies is the support for Australidelphia as a group containing Microbiotheriidae, nested within American marsupials. However, a likelihood ratio test shows that alternative topologies with monophyletic Australidelphia and Ameridelphia are not significantly different than the preferred tree. Although further data are needed to solidify understanding of Methateria phylogeny, the new phylogenetic hypothesis provided here offers a well

  17. MADS-box gene evolution - structure and transcription patterns

    DEFF Research Database (Denmark)

    Johansen, Bo; Pedersen, Louise Buchholt; Skipper, Martin


    Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs......Mads-box genes, ABC model, Evolution, Phylogeny, Transcription patterns, Gene structure, Conserved motifs...

  18. The evolution and appearance of C3 duplications in fish originate an exclusive teleost c3 gene form with anti-inflammatory activity.

    Directory of Open Access Journals (Sweden)

    Gabriel Forn-Cuní

    Full Text Available The complement system acts as a first line of defense and promotes organism homeostasis by modulating the fates of diverse physiological processes. Multiple copies of component genes have been previously identified in fish, suggesting a key role for this system in aquatic organisms. Herein, we confirm the presence of three different previously reported complement c3 genes (c3.1, c3.2, c3.3 and identify five additional c3 genes (c3.4, c3.5, c3.6, c3.7, c3.8 in the zebrafish genome. Additionally, we evaluate the mRNA expression levels of the different c3 genes during ontogeny and in different tissues under steady-state and inflammatory conditions. Furthermore, while reconciling the phylogenetic tree with the fish species tree, we uncovered an event of c3 duplication common to all teleost fishes that gave rise to an exclusive c3 paralog (c3.7 and c3.8. These paralogs showed a distinct ability to regulate neutrophil migration in response to injury compared with the other c3 genes and may play a role in maintaining the balance between inflammatory and homeostatic processes in zebrafish.

  19. Insights into the phylogeny or arylamine N-acetyltransferases in fungi. (United States)

    Martins, Marta; Dairou, Julien; Rodrigues-Lima, Fernando; Dupret, Jean-Marie; Silar, Philippe


    Previous studies have shown that Eumycetes fungi can acylate arylamine thanks to arylamine N-acetyltransferases, xenobiotic-metabolizing enzymes also found in animals and bacteria. In this article, we present the results of mining 96 available fungal genome sequences for arylamine N-acetyltransferase genes and propose their phylogeny. The filamentous Pezizomycotina are shown to possess many putative N-acetyltransferases, whilst these are often lacking in other fungal groups. The evolution of the N-acetyltransferases is best explained by the presence of at least one gene in the opisthokont ancestor of the fungi and animal kingdoms, followed by recurrent gene losses and gene duplications. A possible horizontal gene transfer event may have occurred from bacteria to the basidiomycetous yeast Malassezia globosa.

  20. The first multi-gene phylogeny of the Macrostomorpha sheds light on the evolution of sexual and asexual reproduction in basal Platyhelminthes. (United States)

    Janssen, Toon; Vizoso, Dita B; Schulte, Gregor; Littlewood, D Timothy J; Waeschenbach, Andrea; Schärer, Lukas


    The Macrostomorpha-an early branching and species-rich clade of free-living flatworms-is attracting interest because it contains Macrostomum lignano, a versatile model organism increasingly used in evolutionary, developmental, and molecular biology. We elucidate the macrostomorphan molecular phylogeny inferred from both nuclear (18S and 28S rDNA) and mitochondrial (16S rDNA and COI) marker genes from 40 representatives. Although our phylogeny does not recover the Macrostomorpha as a statistically supported monophyletic grouping, it (i) confirms many taxa previously proposed based on morphological evidence, (ii) permits the first placement of many families and genera, and (iii) reveals a number of unexpected placements. Specifically, Myozona and Bradynectes are outside the three classic families (Macrostomidae, Microstomidae and Dolichomacrostomidae) and the asexually fissioning Myomacrostomum belongs to a new subfamily, the Myozonariinae nov. subfam. (Dolichomacrostomidae), rather than diverging early. While this represents the first evidence for asexuality among the Dolichomacrostomidae, we show that fissioning also occurs in another Myozonariinae, Myozonaria fissipara nov. sp. Together with the placement of the (also fissioning) Microstomidae, namely as the sister taxon of Dolichomacrostomidae, this suggests that fissioning is not basal within the Macrostomorpha, but rather restricted to the new taxon Dolichomicrostomida (Dolichomacrostomidae+Microstomidae). Furthermore, our phylogeny allows new insights into the evolution of the reproductive system, as ancestral state reconstructions reveal convergent evolution of gonads, and male and female genitalia. Finally, the convergent evolution of sperm storage organs in the female genitalia appears to be linked to the widespread occurrence of hypodermic insemination among the Macrostomorpha. Copyright © 2015 Elsevier Inc. All rights reserved.

  1. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes (United States)

    Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.


    The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

  2. Phylogeny and biogeography of 91 species of heroine cichlids (Teleostei: Cichlidae) based on sequences of the cytochrome b gene. (United States)

    Pérez, Gustavo A Concheiro; Rícan, Oldrich; Ortí, Guillermo; Bermingham, Eldredge; Doadrio, Ignacio; Zardoya, Rafael


    Heroini constitute the second largest tribe of Neotropical cichlids and show their greatest diversity in Mesoamerica. Although heroine species are morphologically and ecologically very diverse, they were all historically assigned to one single genus, Cichlasoma that was never formally revised from a phylogenetic point of view. Here, we present the most comprehensive molecular phylogeny of the tribe Heroini to date, based on the complete DNA sequence of the mitochondrial gene cytochrome b, and the analysis of 204 individuals representing 91 species. Phylogenetic analyses did not support the monophyly of heroines because the genus Pterophyllum was placed as the sister group of all remaining heroines plus cichlasomatines. However, the recovered relative position of Pterophyllum was without strong statistical support. Within the remaining heroines, Hyspelecara and Hoplarchus are recovered with low support in a basal position with respect to a clade that includes Heros, Uaru, Mesonauta, and Symphysodon, and the circumamazonian (CAM) heroines. The first clade is restricted to South America. The largest clade of heroines, the CAM heroines, include more than 85% of the species within the tribe. This clade is mostly Mesoamerican, but also contains four species found in the Greater Antilles (Nandopsis), and three genera found in South America (the 'Heros' festae group, Australoheros, and Caquetaia). Up to eight major lineages can be recovered within the CAM heroines, but the phylogenetic relationships among them remain unresolved. Two large suprageneric groups can be distinguished, the amphilophines and the herichthyines. The amphilophines include Amphilophus, Archocentrus, Hypsophrys, Neetroplus, Parachromis, Petenia, and five additional unnamed genera (the 'Heros' istlanus group, the 'Amphilophus' calobrensis group, the 'Heros' urophthalmus group, the 'Heros' wesseli group, and the 'Heros' sieboldii group). The herichthyines include the crown-group herichthyines

  3. Phylogeny of nodulation genes and symbiotic diversity of Acacia senegal (L.) Willd. and A. seyal (Del.) Mesorhizobium strains from different regions of Senegal. (United States)

    Bakhoum, Niokhor; Galiana, Antoine; Le Roux, Christine; Kane, Aboubacry; Duponnois, Robin; Ndoye, Fatou; Fall, Dioumacor; Noba, Kandioura; Sylla, Samba Ndao; Diouf, Diégane


    Acacia senegal and Acacia seyal are small, deciduous legume trees, most highly valued for nitrogen fixation and for the production of gum arabic, a commodity of international trade since ancient times. Symbiotic nitrogen fixation by legumes represents the main natural input of atmospheric N2 into ecosystems which may ultimately benefit all organisms. We analyzed the nod and nif symbiotic genes and symbiotic properties of root-nodulating bacteria isolated from A. senegal and A. seyal in Senegal. The symbiotic genes of rhizobial strains from the two Acacia species were closed to those of Mesorhizobium plurifarium and grouped separately in the phylogenetic trees. Phylogeny of rhizobial nitrogen fixation gene nifH was similar to those of nodulation genes (nodA and nodC). All A. senegal rhizobial strains showed identical nodA, nodC, and nifH gene sequences. By contrast, A. seyal rhizobial strains exhibited different symbiotic gene sequences. Efficiency tests demonstrated that inoculation of both Acacia species significantly affected nodulation, total dry weight, acetylene reduction activity (ARA), and specific acetylene reduction activity (SARA) of plants. However, these cross-inoculation tests did not show any specificity of Mesorhizobium strains toward a given Acacia host species in terms of infectivity and efficiency as stated by principal component analysis (PCA). This study demonstrates that large-scale inoculation of A. senegal and A. seyal in the framework of reafforestation programs requires a preliminary step of rhizobial strain selection for both Acacia species.

  4. Finding all sorting tandem duplication random loss operations

    DEFF Research Database (Denmark)

    Bernt, Matthias; Chen, Kuan Yu; Chen, Ming Chiang


    A tandem duplication random loss (TDRL) operation duplicates a contiguous segment of genes, followed by the random loss of one copy of each of the duplicated genes. Although the importance of this operation is founded by several recent biological studies, it has been investigated only rarely from...

  5. Expression of embryonic hemoglobin genes in mice heterozygous for α-thalassemia or β-duplication traits and in mice heterozygous for both traits

    International Nuclear Information System (INIS)

    Popp, R.A.; Marsh, C.L.; Skow, L.C.


    Hemoglobins of mouse embryos at 11.5 through 16.5 days of gestation were separated by electrophoresis on cellulose acetate and quantitated by a scanning densitometer to study the effects of two radiation-induced mutations on the expression of embryonic hemoglobin genes in mice. Normal mice produce three kinds of embryonic hemoglobins. In heterozygous α-thalassemic embryos, expression of EI (x 2 y 2 ) and EII (α 2 y 2 ) is deficient because the x- and α-globin genes of one of the allelic pairs of Hba on chromosome 11 was deleted or otherwise inactivated by X irradiation. Simultaneous inactivation of the x- and α-globin genes indicates that these genes must be closely linked. Reduced x- and α-chain synthesis results in an excess of y chains that associate as homotetramers. This unique y 4 hemoglobin also appears in β-duplication embryos where excess y chains are produced by the presence of three rather than two functional alleles of y- and β-globin genes. In double heterozygotes, which have a single functional allele of x- and α-globin genes and three functional alleles of y- and β-globin genes, synthesis of α and non-α chains is severely imbalanced and half of the total hemoglobin is y 4 . Mouse y 4 has a high affinity for oxygen, P 50 of less than 10 mm Hg, but it lacks cooperativity so is inefficient for oxygen transport. The death of double heterozygotes in late fetal or neonatal life may be in large part to oxygen deprivation to the tissues

  6. Life-threatening Arrhythmias in a Becker Muscular Dystrophy Family due to the Duplication of Exons 3-4 of the Dystrophin Gene. (United States)

    Ishizaki, Masatoshi; Fujimoto, Akiko; Ueyama, Hidetsugu; Nishida, Yasuto; Imamura, Shigehiro; Uchino, Makoto; Ando, Yukio


    We herein present a report of three patients with Becker muscular dystrophy in the same family who developed complete atrioventricular block or ventricular tachycardia with severe cardiomyopathy. Our cases became unable to walk in their teens, and were introduced to mechanical ventilation due to respiratory muscle weakness in their twenties and thirties. In all three cases, a medical device such as a permanent cardiac pacemaker or an implantable cardiac defibrillator was considered to be necessary. The duplication of exons 3-4 in the dystrophin gene was detected in two of the patients. In patients with Becker muscular dystrophy, complete atrioventricular block or ventricular tachycardia within a family has rarely been reported. Thus attention should be paid to the possibility of severe arrhythmias in the severe phenotype of Becker muscular dystrophy.

  7. Gene arrangement and sequence of mitochondrial genomes yield insights into the phylogeny and evolution of bees and sphecid wasps (Hymenoptera: Apoidea). (United States)

    Zheng, Bo-Ying; Cao, Li-Jun; Tang, Pu; van Achterberg, Kees; Hoffmann, Ary A; Chen, Hua-Yan; Chen, Xue-Xin; Wei, Shu-Jun


    The Apoidea represent a large and common superfamily of the Hymenoptera including the bees and sphecid wasps. A robust phylogenetic tree is essential to understanding the diversity, taxonomy and evolution of the Apoidea. In this study, features of apoid mitochondrial genomes were used to reconstruct phylogenetic relationships. Twelve apoid mitochondrial genomes were newly sequenced, representing six families and nine subfamilies. Gene rearrangement events have occurred in all apoid mitochondrial genomes sequenced to date. Sphecid wasps have both tRNA and protein-coding gene rearrangements in 5 of 8 species. In bees, the only rearranged genes are tRNAs; long-tongued bees (Apidae + Megachilidae) are characterized by movement of trnA to the trnI-trnQ-trnM tRNA cluster. Phylogenetic analyses of mitochondrial gene sequences support the known paraphyly of sphecid wasps, with bees nested within this clade. The Ampulicidae is sister to the remaining Apoidea. Crabronidae is paraphyletic, split into Crabronidae s.s. and Philanthidae, with the latter group a sister clade to bees. The monophyletic bees are either classified into two clades, long-tongued bees (Apidae + Megachilidae) and short-tongued bees (Andrenidae + Halictidae + Colletidae + Melitidae), or three groups with the Melitidae sister to the other bees. Our study showed that both gene sequences and arrangements provide information on the phylogeny of apoid families. Copyright © 2018 Elsevier Inc. All rights reserved.

  8. Functional Annotation, Genome Organization and Phylogeny of the Grapevine (Vitis vinifera Terpene Synthase Gene Family Based on Genome Assembly, FLcDNA Cloning, and Enzyme Assays

    Directory of Open Access Journals (Sweden)

    Toub Omid


    about gene structure and phylogeny for the entire currently known VvTPS gene family.

  9. Role of the duplicated CCAAT box region in γ-globin gene regulation and hereditary persistence of fetal haemoglobin.

    NARCIS (Netherlands)

    A. Ronchi (Antonella); M. Berry (Meera); S. Raguz (Selina); A.M.A. Imam (Ali); N. Yannoutsos (Nikos); S. Ottolenghi (Sergio); F.G. Grosveld (Frank); N.O. Dillon (Niall)


    textabstractHereditary persistence of fetal haemoglobin (HPFH) is a clinically important condition in which a change in the developmental specificity of the gamma-globin genes results in varying levels of expression of fetal haemoglobin in the adult. The condition is benign and can significantly

  10. MECP2 Duplication Syndrome

    DEFF Research Database (Denmark)

    Signorini, Cinzia; De Felice, Claudio; Leoncini, Silvia


    Rett syndrome (RTT) and MECP2 duplication syndrome (MDS) are neurodevelopmental disorders caused by alterations in the methyl-CpG binding protein 2 (MECP2) gene expression. A relationship between MECP2 loss-of-function mutations and oxidative stress has been previously documented in RTT patients...... and murine models. To date, no data on oxidative stress have been reported for the MECP2 gain-of-function mutations in patients with MDS. In the present work, the pro-oxidant status and oxidative fatty acid damage in MDS was investigated (subjects n = 6) and compared to RTT (subjects n = 24) and healthy...... similar to those observed in RTT patients except for higher plasma F2-isoprostanes levels (P work shows unique data in patients affected by MDS. For the first...

  11. Molecular phylogeny of Cyclophyllidea (Cestoda: Eucestoda): an in-silico analysis based on mtCOI gene. (United States)

    Sharma, Sunil; Lyngdoh, Damanbha; Roy, Bishnupada; Tandon, Veena


    Order Cyclophyllidea (of cestode platyhelminths) has a rich diversity of parasites and includes many families and species that are known to cause serious medical condition in humans and domestic and wild animals. Despite various attempts to resolve phylogenetic relationships at the inter-family level, uncertainty remains. In order to add resolution to the existing phylogeny of the order, we generated partial mtCO1 sequences for some commonly occurring cyclophyllidean cestodes and combined them with available sequences from GenBank. Phylogeny was inferred taking a total 83 representative species spanning 8 families using Bayesian analysis. The phylogenetic tree revealed Dilepididae as the most basal taxon and showed early divergence in the phylogenetic tree. Paruterinidae, Taeniidae and Anoplocephalidae showed non-monophyletic assemblage; our result suggests that the family Paruterinidae may represent a polyphyletic group. The diverse family Taeniidae appeared in two separate clades; while one of them included all the members of the genus Echinococcus and also Versteria, the representatives of the genera Taenia and Hydatigera clubbed in the other clade. A close affinity of Dipylidiidae with Taenia and Hydatigera was seen, whereas existence of a close relationship between Mesocestoididae and Echinococcus (of Taeniidae) is also demonstrated. The crown group comprised the families Anoplocephalidae, Davaineidae, Hymenolepididae and Mesocestoididae, and also all species of the genus Echinococcus and Versteria mustelae; monophyly of these families (excepting Anolplocephalidae) and the genus Echinococcus as well as its sister-taxon relation with V. mustelae is also confirmed. Furthermore, non-monophyly of Anoplocephalidae is suggested to be correlated with divergence in the host selection.

  12. Genome-wide identification, phylogeny and expression analyses of SCARECROW-LIKE(SCL) genes in millet (Setaria italica). (United States)

    Liu, Hongyun; Qin, Jiajia; Fan, Hui; Cheng, Jinjin; Li, Lin; Liu, Zheng


    As a member of the GRAS gene family, SCARECROW - LIKE ( SCL ) genes encode transcriptional regulators that are involved in plant information transmission and signal transduction. In this study, 44 SCL genes including two SCARECROW genes in millet were identified to be distributed on eight chromosomes, except chromosome 6. All the millet genes contain motifs 6-8, indicating that these motifs are conserved during the evolution. SCL genes of millet were divided into eight groups based on the phylogenetic relationship and classification of Arabidopsis SCL genes. Several putative millet orthologous genes in Arabidopsis , maize and rice were identified. High throughput RNA sequencing revealed that the expressions of millet SCL genes in root, stem, leaf, spica, and along leaf gradient varied greatly. Analyses combining the gene expression patterns, gene structures, motif compositions, promoter cis -elements identification, alternative splicing of transcripts and phylogenetic relationship of SCL genes indicate that the these genes may play diverse functions. Functionally characterized SCL genes in maize, rice and Arabidopsis would provide us some clues for future characterization of their homologues in millet. To the best of our knowledge, this is the first study of millet SCL genes at the genome wide level. Our work provides a useful platform for functional analysis of SCL genes in millet, a model crop for C 4 photosynthesis and bioenergy studies.

  13. Disease association with two Helicobacter pylori duplicate outer membrane protein genes, homB and homA. (United States)

    Oleastro, Monica; Cordeiro, Rita; Yamaoka, Yoshio; Queiroz, Dulciene; Mégraud, Francis; Monteiro, Lurdes; Ménard, Armelle


    homB encodes a Helicobacter pylori outer membrane protein. This gene was previously associated with peptic ulcer disease (PUD) and was shown to induce activation of interleukin-8 secretion in vitro, as well as contributing to bacterial adherence. Its 90%-similar gene, homA, was previously correlated with gastritis. The present study aimed to evaluate the gastric disease association with homB and homA, as well as with the H. pylori virulence factors cagA, babA and vacA, in 415 H. pylori strains isolated from patients from East Asian and Western countries. The correlation among these genotypes was also evaluated. Both homB and homA genes were heterogeneously distributed worldwide, with a marked difference between East Asian and Western strains. In Western strains (n = 234, 124 PUD and 110 non-ulcer dyspepsia (NUD), homB, cagA and vacA s1 were all significantly associated with PUD (p = 0.025, p = 0.014, p = 0.039, respectively), and homA was closely correlated with NUD (p = 0.072). In East Asian strains (n = 138, 73 PUD and 65 NUD), homB was found more frequently than homA, and none of these genes was associated with the clinical outcome. Overall, homB was associated with the presence of cagA (p = 0.043) and vacA s1 (p homA was found more frequently in cagA-negative (p = 0.062) and vacA s2 (p homA copy number were observed, with a clear geographical specificity, suggesting an involvement of these genes in host adaptation. A correlation between the homB two-copy genotype and PUD was also observed, emphasizing the role of homB in the virulence of the strain. The global results suggest that homB and homA contribute to the determination of clinical outcome.

  14. Startling mosaicism of the Y-chromosome and tandem duplication of the SRY and DAZ genes in patients with Turner Syndrome.

    Directory of Open Access Journals (Sweden)

    Sanjay Premi

    Full Text Available Presence of the human Y-chromosome in females with Turner Syndrome (TS enhances the risk of development of gonadoblastoma besides causing several other phenotypic abnormalities. In the present study, we have analyzed the Y chromosome in 15 clinically diagnosed Turner Syndrome (TS patients and detected high level of mosaicisms ranging from 45,XO:46,XY = 100:0% in 4; 45,XO:46,XY:46XX = 4:94:2 in 8; and 45,XO:46,XY:46XX = 50:30:20 cells in 3 TS patients, unlike previous reports showing 5-8% cells with Y- material. Also, no ring, marker or di-centric Y was observed in any of the cases. Of the two TS patients having intact Y chromosome in >85% cells, one was exceptionally tall. Both the patients were positive for SRY, DAZ, CDY1, DBY, UTY and AZFa, b and c specific STSs. Real Time PCR and FISH demonstrated tandem duplication/multiplication of the SRY and DAZ genes. At sequence level, the SRY was normal in 8 TS patients while the remaining 7 showed either absence of this gene or known and novel mutations within and outside of the HMG box. SNV/SFV analysis showed normal four copies of the DAZ genes in these 8 patients. All the TS patients showed aplastic uterus with no ovaries and no symptom of gonadoblastoma. Present study demonstrates new types of polymorphisms indicating that no two TS patients have identical genotype-phenotype. Thus, a comprehensive analysis of more number of samples is warranted to uncover consensus on the loci affected, to be able to use them as potential diagnostic markers.

  15. Duplicated Gephyrin Genes Showing Distinct Tissue Distribution and Alternative Splicing Patterns Mediate Molybdenum Cofactor Biosynthesis, Glycine Receptor Clustering, and Escape Behavior in Zebrafish* (United States)

    Ogino, Kazutoyo; Ramsden, Sarah L.; Keib, Natalie; Schwarz, Günter; Harvey, Robert J.; Hirata, Hiromi


    Gephyrin mediates the postsynaptic clustering of glycine receptors (GlyRs) and GABAA receptors at inhibitory synapses and molybdenum-dependent enzyme (molybdoenzyme) activity in non-neuronal tissues. Gephyrin knock-out mice show a phenotype resembling both defective glycinergic transmission and molybdenum cofactor (Moco) deficiency and die within 1 day of birth due to starvation and dyspnea resulting from deficits in motor and respiratory networks, respectively. To address whether gephyrin function is conserved among vertebrates and whether gephyrin deficiency affects molybdoenzyme activity and motor development, we cloned and characterized zebrafish gephyrin genes. We report here that zebrafish have two gephyrin genes, gphna and gphnb. The former is expressed in all tissues and has both C3 and C4 cassette exons, and the latter is expressed predominantly in the brain and spinal cord and harbors only C4 cassette exons. We confirmed that all of the gphna and gphnb splicing isoforms have Moco synthetic activity. Antisense morpholino knockdown of either gphna or gphnb alone did not disturb synaptic clusters of GlyRs in the spinal cord and did not affect touch-evoked escape behaviors. However, on knockdown of both gphna and gphnb, embryos showed impairments in GlyR clustering in the spinal cord and, as a consequence, demonstrated touch-evoked startle response behavior by contracting antagonistic muscles simultaneously, instead of displaying early coiling and late swimming behaviors, which are executed by side-to-side muscle contractions. These data indicate that duplicated gephyrin genes mediate Moco biosynthesis and control postsynaptic clustering of GlyRs, thereby mediating key escape behaviors in zebrafish. PMID:20843816

  16. Myxococcus xanthus DK1622 Coordinates Expressions of the Duplicate groEL and Single groES Genes for Synergistic Functions of GroELs and GroES

    Directory of Open Access Journals (Sweden)

    Yue-zhong Li


    Full Text Available Chaperonin GroEL (Cpn60 requires cofactor GroES (Cpn10 for protein refolding in bacteria that possess single groEL and groES genes in a bicistronic groESL operon. Among 4,861 completely-sequenced prokaryotic genomes, 884 possess duplicate groEL genes and 770 possess groEL genes with no neighboring groES. It is unclear whether stand-alone groEL requires groES in order to function and, if required, how duplicate groEL genes and unequal groES genes balance their expressions. In Myxococcus xanthus DK1622, we determined that, while duplicate groELs were alternatively deletable, the single groES that clusters with groEL1 was essential for cell survival. Either GroEL1 or GroEL2 required interactions with GroES for in vitro and in vivo functions. Deletion of groEL1 or groEL2 resulted in decreased expressions of both groEL and groES; and ectopic complementation of groEL recovered not only the groEL but also groES expressions. The addition of an extra groES gene upstream groEL2 to form a bicistronic operon had almost no influence on groES expression and the cell survival rate, whereas over-expression of groES using a self-replicating plasmid simultaneously increased the groEL expressions. The results indicated that M. xanthus DK1622 cells coordinate expressions of the duplicate groEL and single groES genes for synergistic functions of GroELs and GroES. We proposed a potential regulation mechanism for the expression coordination.

  17. Analysis of phylogeny and codon usage bias and relationship of GC content, amino acid composition with expression of the structural nif genes. (United States)

    Mondal, Sunil Kanti; Kundu, Sudip; Das, Rabindranath; Roy, Sujit


    Bacteria and archaea have evolved with the ability to fix atmospheric dinitrogen in the form of ammonia, catalyzed by the nitrogenase enzyme complex which comprises three structural genes nifK, nifD and nifH. The nifK and nifD encodes for the beta and alpha subunits, respectively, of component 1, while nifH encodes for component 2 of nitrogenase. Phylogeny based on nifDHK have indicated that Cyanobacteria is closer to Proteobacteria alpha and gamma but not supported by the tree based on 16SrRNA. The evolutionary ancestor for the different trees was also different. The GC1 and GC2% analysis showed more consistency than GC3% which appeared to below for Firmicutes, Cyanobacteria and Euarchaeota while highest in Proteobacteria beta and clearly showed the proportional effect on the codon usage with a few exceptions. Few genes from Firmicutes, Euryarchaeota, Proteobacteria alpha and delta were found under mutational pressure. These nif genes with low and high GC3% from different classes of organisms showed similar expected number of codons. Distribution of the genes and codons, based on codon usage demonstrated opposite pattern for different orientation of mirror plane when compared with each other. Overall our results provide a comprehensive analysis on the evolutionary relationship of the three structural nif genes, nifK, nifD and nifH, respectively, in the context of codon usage bias, GC content relationship and amino acid composition of the encoded proteins and exploration of crucial statistical method for the analysis of positive data with non-constant variance to identify the shape factors of codon adaptation index.

  18. Molecular phylogeny of the higher and lower taxonomy of the Fusarium genus and differences in the evolutionary histories of multiple genes (United States)


    Background Species of the Fusarium genus are important fungi which is associated with health hazards in human and animals. The taxonomy of this genus has been a subject of controversy for many years. Although many researchers have applied molecular phylogenetic analysis to examine the taxonomy of Fusarium species, their phylogenetic relationships remain unclear only few comprehensive phylogenetic analyses of the Fusarium genus and a lack of suitable nucleotides and amino acid substitution rates. A previous stugy with whole genome comparison among Fusairum species revealed the possibility that each gene in Fusarium genomes has a unique evolutionary history, and such gene may bring difficulty to the reconstruction of phylogenetic tree of Fusarium. There is a need not only to check substitution rates of genes but also to perform the exact evaluation of each gene-evolution. Results We performed phylogenetic analyses based on the nucleotide sequences of the rDNA cluster region (rDNA cluster), and the β-tubulin gene (β-tub), the elongation factor 1α gene (EF-1α), and the aminoadipate reductase gene (lys2). Although incongruence of the tree topologies between lys2 and the other genes was detected, all genes supported the classification of Fusarium species into 7 major clades, I to VII. To obtain a reliable phylogeny for Fusarium species, we excluded the lys2 sequences from our dataset, and re-constructed a maximum likelihood (ML) tree based on the combined data of the rDNA cluster, β-tub, and EF-1α. Our ML tree indicated some interesting relationships in the higher and lower taxa of Fusarium species and related genera. Moreover, we observed a novel evolutionary history of lys2. We suggest that the unique tree topologies of lys2 are not due to an analytical artefact, but due to differences in the evolutionary history of genomes caused by positive selection of particular lineages. Conclusion This study showed the reliable species tree of the higher and lower taxonomy

  19. Phylogeny of fungal hemoglobins and expression analysis of the Aspergillus oryzae flavohemoglobin gene fhbA during hyphal growth

    NARCIS (Netherlands)

    Biesebeke, R. te; Levasseur, A.; Boussier, A.; Record, E.; Hondel, C.A.M.J.J. van den; Punt, P.J.


    The fhbA genes encoding putative flavohemoglobins (FHb) from Aspergillus niger and Aspergillus oryzae were isolated. Comparison of the deduced amino acid sequence of the A. niger fhbA gene and other putative filamentous fungal FHb-encoding genes to that of Ralstonia eutropha shows an overall

  20. Ancestral genomic duplication of the insulin gene in tilapia: An analysis of possible implications for clinical islet xenotransplantation using donor islets from transgenic tilapia expressing a humanized insulin gene. (United States)

    Hrytsenko, Olga; Pohajdak, Bill; Wright, James R


    Tilapia, a teleost fish, have multiple large anatomically discrete islets which are easy to harvest, and when transplanted into diabetic murine recipients, provide normoglycemia and mammalian-like glucose tolerance profiles. Tilapia insulin differs structurally from human insulin which could preclude their use as islet donors for xenotransplantation. Therefore, we produced transgenic tilapia with islets expressing a humanized insulin gene. It is now known that fish genomes may possess an ancestral duplication and so tilapia may have a second insulin gene. Therefore, we cloned, sequenced, and characterized the tilapia insulin 2 transcript and found that its expression is negligible in islets, is not islet-specific, and would not likely need to be silenced in our transgenic fish.

  1. Analysis of the ergosterol biosynthesis pathway cloning, molecular characterization and phylogeny of lanosterol 14α-demethylase (ERG11 gene of Moniliophthora perniciosa

    Directory of Open Access Journals (Sweden)

    Geruza de Oliveira Ceita


    Full Text Available The phytopathogenic fungus Moniliophthora perniciosa (Stahel Aime & Philips-Mora, causal agent of witches' broom disease of cocoa, causes countless damage to cocoa production in Brazil. Molecular studies have attempted to identify genes that play important roles in fungal survival and virulence. In this study, sequences deposited in the M. perniciosa Genome Sequencing Project database were analyzed to identify potential biological targets. For the first time, the ergosterol biosynthetic pathway in M. perniciosa was studied and the lanosterol 14α-demethylase gene (ERG11 that encodes the main enzyme of this pathway and is a target for fungicides was cloned, characterized molecularly and its phylogeny analyzed. ERG11 genomic DNA and cDNA were characterized and sequence analysis of the ERG11 protein identified highly conserved domains typical of this enzyme, such as SRS1, SRS4, EXXR and the heme-binding region (HBR. Comparison of the protein sequences and phylogenetic analysis revealed that the M. perniciosa enzyme was most closely related to that of Coprinopsis cinerea.

  2. Duplication and concerted evolution of MiSp-encoding genes underlie the material properties of minor ampullate silks of cobweb weaving spiders. (United States)

    Vienneau-Hathaway, Jannelle M; Brassfield, Elizabeth R; Lane, Amanda Kelly; Collin, Matthew A; Correa-Garhwal, Sandra M; Clarke, Thomas H; Schwager, Evelyn E; Garb, Jessica E; Hayashi, Cheryl Y; Ayoub, Nadia A


    Orb-web weaving spiders and their relatives use multiple types of task-specific silks. The majority of spider silk studies have focused on the ultra-tough dragline silk synthesized in major ampullate glands, but other silk types have impressive material properties. For instance, minor ampullate silks of orb-web weaving spiders are as tough as draglines, due to their higher extensibility despite lower strength. Differences in material properties between silk types result from differences in their component proteins, particularly members of the spidroin (spider fibroin) gene family. However, the extent to which variation in material properties within a single silk type can be explained by variation in spidroin sequences is unknown. Here, we compare the minor ampullate spidroins (MiSp) of orb-weavers and cobweb weavers. Orb-web weavers use minor ampullate silk to form the auxiliary spiral of the orb-web while cobweb weavers use it to wrap prey, suggesting that selection pressures on minor ampullate spidroins (MiSp) may differ between the two groups. We report complete or nearly complete MiSp sequences from five cobweb weaving spider species and measure material properties of minor ampullate silks in a subset of these species. We also compare MiSp sequences and silk properties of our cobweb weavers to published data for orb-web weavers. We demonstrate that all our cobweb weavers possess multiple MiSp loci and that one locus is more highly expressed in at least two species. We also find that the proportion of β-spiral-forming amino acid motifs in MiSp positively correlates with minor ampullate silk extensibility across orb-web and cobweb weavers. MiSp sequences vary dramatically within and among spider species, and have likely been subject to multiple rounds of gene duplication and concerted evolution, which have contributed to the diverse material properties of minor ampullate silks. Our sequences also provide templates for recombinant silk proteins with tailored

  3. Algorithms for MDC-based multi-locus phylogeny inference: beyond rooted binary gene trees on single alleles. (United States)

    Yu, Yun; Warnow, Tandy; Nakhleh, Luay


    One of the criteria for inferring a species tree from a collection of gene trees, when gene tree incongruence is assumed to be due to incomplete lineage sorting (ILS), is Minimize Deep Coalescence (MDC). Exact algorithms for inferring the species tree from rooted, binary trees under MDC were recently introduced. Nevertheless, in phylogenetic analyses of biological data sets, estimated gene trees may differ from true gene trees, be incompletely resolved, and not necessarily rooted. In this article, we propose new MDC formulations for the cases where the gene trees are unrooted/binary, rooted/non-binary, and unrooted/non-binary. Further, we prove structural theorems that allow us to extend the algorithms for the rooted/binary gene tree case to these cases in a straightforward manner. In addition, we devise MDC-based algorithms for cases when multiple alleles per species may be sampled. We study the performance of these methods in coalescent-based computer simulations.

  4. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia) gene family: tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes. (United States)

    Harduin-Lepers, Anne; Petit, Daniel; Mollicone, Rosella; Delannoy, Philippe; Petit, Jean-Michel; Oriol, Rafael


    initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD) R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  5. Evolutionary history of the alpha2,8-sialyltransferase (ST8Sia gene family: Tandem duplications in early deuterostomes explain most of the diversity found in the vertebrate ST8Sia genes

    Directory of Open Access Journals (Sweden)

    Petit Jean-Michel


    activities, in both invertebrates and vertebrates. The initial expansion and subsequent divergence of the ST8Sia genes resulted as a consequence of a series of ancient duplications and translocations in the invertebrate genome long before the emergence of vertebrates. A second subset of ST8sia genes in the vertebrate genome arose from whole genome duplication (WGD R1 and R2. Subsequent selective ST8Sia gene loss is responsible for the characteristic ST8Sia gene expression pattern observed today in individual species.

  6. Directed evolution induces tributyrin hydrolysis in a virulence factor of Xylella fastidiosa using a duplicated gene as a template [v1; ref status: indexed,

    Directory of Open Access Journals (Sweden)

    Hossein Gouran


    Full Text Available Duplication of genes is one of the preferred ways for natural selection to add advantageous functionality to the genome without having to reinvent the wheel with respect to catalytic efficiency and protein stability. The duplicated secretory virulence factors of Xylella fastidiosa (LesA, LesB and LesC, implicated in Pierce's disease of grape and citrus variegated chlorosis of citrus species, epitomizes the positive selection pressures exerted on advantageous genes in such pathogens. A deeper insight into the evolution of these lipases/esterases is essential to develop resistance mechanisms in transgenic plants. Directed evolution, an attempt to accelerate the evolutionary steps in the laboratory, is inherently simple when targeted for loss of function. A bigger challenge is to specify mutations that endow a new function, such as a lost functionality in a duplicated gene. Previously, we have proposed a method for enumerating candidates for mutations intended to transfer the functionality of one protein into another related protein based on the spatial and electrostatic properties of the active site residues (DECAAF. In the current work, we present in vivo validation of DECAAF by inducing tributyrin hydrolysis in LesB based on the active site similarity to LesA. The structures of these proteins have been modeled using RaptorX based on the closely related LipA protein from Xanthomonas oryzae. These mutations replicate the spatial and electrostatic conformation of LesA in the modeled structure of the mutant LesB as well, providing in silico validation before proceeding to the laborious in vivo work. Such focused mutations allows one to dissect the relevance of the duplicated genes in finer detail as compared to gene knockouts, since they do not interfere with other moonlighting functions, protein expression levels or protein-protein interaction.

  7. Duplication of the oesophagus

    International Nuclear Information System (INIS)

    Lingg, G.; Nebel, G.


    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined. (orig.) [de

  8. Duplication of the oesophagus

    Energy Technology Data Exchange (ETDEWEB)

    Lingg, G; Nebel, G


    The article reports on the authors' own observation of a patient with duplication of the oesophagus. Basing on this case, the possibilities of the evolutionary origin are discussed briefly. The significance and decisive importance of X-ray film diagnosis in gastro-intestinal duplications is underlined.

  9. Quantifying The Relative Importance Of Phylogeny And Environmental Preferences As Drivers Of Gene Content In Prokaryotic Microorganisms

    Directory of Open Access Journals (Sweden)

    Javier eTamames


    Full Text Available Two complementary forces shape microbial genomes: vertical inheritance of genes by phylogenetic descent, and acquisition of new genes related to adaptation to particular habitats and lifestyles. Quantification of the relative importance of each driving force proved difficult. We determined the contribution of each factor, and identified particular genes or biochemical/cellular processes linked to environmental preferences (i.e., propensity of a taxon to live in particular habitats. Three types of data were confronted: [i] complete genomes, which provide gene content of different taxa; [ii] phylogenetic information, via alignment of 16S rRNA sequences, which allowed determination of the distance between taxa, and [iii] distribution of species in environments via 16S rRNA sampling experiments, reflecting environmental preferences of different taxa. The combination of these three datasets made it possible to describe and quantify the relationships among them. We found that, although phylogenetic descent was responsible for shaping most genomes, a discernible part of the latter was correlated to environmental adaptations. Particular families of genes were identified as environmental markers, as supported by direct studies such as metagenomic sequencing. These genes are likely important for adaptation of bacteria to particular conditions or habitats, such as carbohydrate or glycan metabolism genes being linked to host-associated environments.

  10. Duplication in DNA Sequences (United States)

    Ito, Masami; Kari, Lila; Kincaid, Zachary; Seki, Shinnosuke

    The duplication and repeat-deletion operations are the basis of a formal language theoretic model of errors that can occur during DNA replication. During DNA replication, subsequences of a strand of DNA may be copied several times (resulting in duplications) or skipped (resulting in repeat-deletions). As formal language operations, iterated duplication and repeat-deletion of words and languages have been well studied in the literature. However, little is known about single-step duplications and repeat-deletions. In this paper, we investigate several properties of these operations, including closure properties of language families in the Chomsky hierarchy and equations involving these operations. We also make progress toward a characterization of regular languages that are generated by duplicating a regular language.

  11. Phylogeny of the Celastreae (Celastraceae) and the relationships of Catha edulis (qat) inferred from morphological characters and nuclear and plastid genes. (United States)

    Simmons, Mark P; Cappa, Jennifer J; Archer, Robert H; Ford, Andrew J; Eichstedt, Dedra; Clevinger, Curtis C


    The phylogeny of Celastraceae tribe Celastreae, which includes about 350 species of trees and shrubs in 15 genera, was inferred in a simultaneous analysis of morphological characters together with nuclear (ITS and 26S rDNA) and plastid (matK, trnL-F) genes. A strong correlation was found between the geography of the species sampled and their inferred relationships. Species of Maytenus and Gymnosporia from different regions were resolved as polyphyletic groups. Maytenus was resolved in three lineages (New World, African, and Austral-Pacific), while Gymnosporia was resolved in two lineages (New World and Old World). Putterlickia was resolved as nested within the Old World Gymnosporia. Catha edulis (qat, khat) was resolved as sister to the clade of Allocassine, Cassine, Lauridia, and Maurocenia. Gymnosporia cassinoides, which is reportedly chewed as a stimulant in the Canary Islands, was resolved as a derived member of Gymnosporia and is more closely related to Lydenburgia and Putterlickia than it is to Catha. Therefore, all eight of these genera are candidates for containing cathinone- and/or cathine-related alkaloids.

  12. Phylogeny and phylogeography of functional genes shared among seven terrestrial subsurface metagenomes reveal N-cycling and microbial evolutionary relationships

    Directory of Open Access Journals (Sweden)

    Maggie CY Lau


    Full Text Available Comparative studies on community phylogenetics and phylogeography of microorganisms living in extreme environments are rare. Terrestrial subsurface habitats are valuable for studying microbial biogeographical patterns due to their isolation and the restricted dispersal mechanisms. Since the taxonomic identity of a microorganism does not always correspond well with its functional role in a particular community, the use of taxonomic assignments or patterns may give limited inference on how microbial functions are affected by historical, geographical and environmental factors. With seven metagenomic libraries generated from fracture water samples collected from five South African mines, this study was carried out to (1 screen for ubiquitous functions or pathways of biogeochemical cycling of CH4, S and N; (2 to characterize the biodiversity represented by the common functional genes; (3 to investigate the subsurface biogeography as revealed by this subset of genes; and (4 to explore the possibility of using metagenomic data for evolutionary study. The ubiquitous functional genes are NarV, NPD, PAP reductase, NifH, NifD, NifK, NifE and NifN genes. Although these 8 common functional genes were taxonomically and phylogenetically diverse and distinct from each other, the dissimilarity between samples did not correlate strongly with either geographical, environmental or residence time of the water. Por genes homologous to those of Thermodesulfovibrio yellowstonii detected in all metagenomes were deep lineages of Nitrospirae, suggesting that subsurface habitats have preserved ancestral genetic signatures that inform the study of the origin and evolution of prokaryotes.

  13. A multi-gene phylogeny of Cephalopoda supports convergent morphological evolution in association with multiple habitat shifts in the marine environment

    Directory of Open Access Journals (Sweden)

    Lindgren Annie R


    Full Text Available Abstract Background The marine environment is comprised of numerous divergent organisms living under similar selective pressures, often resulting in the evolution of convergent structures such as the fusiform body shape of pelagic squids, fishes, and some marine mammals. However, little is known about the frequency of, and circumstances leading to, convergent evolution in the open ocean. Here, we present a comparative study of the molluscan class Cephalopoda, a marine group known to occupy habitats from the intertidal to the deep sea. Several lineages bear features that may coincide with a benthic or pelagic existence, making this a valuable group for testing hypotheses of correlated evolution. To test for convergence and correlation, we generate the most taxonomically comprehensive multi-gene phylogeny of cephalopods to date. We then create a character matrix of habitat type and morphological characters, which we use to infer ancestral character states and test for correlation between habitat and morphology. Results Our study utilizes a taxonomically well-sampled phylogeny to show convergent evolution in all six morphological characters we analyzed. Three of these characters also correlate with habitat. The presence of an autogenic photophore (those relying upon autonomous enzymatic light reactions is correlated with a pelagic habitat, while the cornea and accessory nidamental gland correlate with a benthic lifestyle. Here, we present the first statistical tests for correlation between convergent traits and habitat in cephalopods to better understand the evolutionary history of characters that are adaptive in benthic or pelagic environments, respectively. Discussion Our study supports the hypothesis that habitat has influenced convergent evolution in the marine environment: benthic organisms tend to exhibit similar characteristics that confer protection from invasion by other benthic taxa, while pelagic organisms possess features that

  14. Neofunctionalization of Duplicated Tic40 Genes Caused a Gain-of-Function Variation Related to Male Fertility in Brassica oleracea Lineages1[W][OPEN (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf


    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. PMID:25185122

  15. Neofunctionalization of duplicated Tic40 genes caused a gain-of-function variation related to male fertility in Brassica oleracea lineages. (United States)

    Dun, Xiaoling; Shen, Wenhao; Hu, Kaining; Zhou, Zhengfu; Xia, Shengqian; Wen, Jing; Yi, Bin; Shen, Jinxiong; Ma, Chaozhi; Tu, Jinxing; Fu, Tingdong; Lagercrantz, Ulf


    Gene duplication followed by functional divergence in the event of polyploidization is a major contributor to evolutionary novelties. The Brassica genus evolved from a common ancestor after whole-genome triplication. Here, we studied the evolutionary and functional features of Brassica spp. homologs to Tic40 (for translocon at the inner membrane of chloroplasts with 40 kDa). Four Tic40 loci were identified in allotetraploid Brassica napus and two loci in each of three basic diploid Brassica spp. Although these Tic40 homologs share high sequence identities and similar expression patterns, they exhibit altered functional features. Complementation assays conducted on Arabidopsis thaliana tic40 and the B. napus male-sterile line 7365A suggested that all Brassica spp. Tic40 homologs retain an ancestral function similar to that of AtTic40, whereas BolC9.Tic40 in Brassica oleracea and its ortholog in B. napus, BnaC9.Tic40, in addition, evolved a novel function that can rescue the fertility of 7365A. A homologous chromosomal rearrangement placed bnac9.tic40 originating from the A genome (BraA10.Tic40) as an allele of BnaC9.Tic40 in the C genome, resulting in phenotypic variation for male sterility in the B. napus near-isogenic two-type line 7365AB. Assessment of the complementation activity of chimeric B. napus Tic40 domain-swapping constructs in 7365A suggested that amino acid replacements in the carboxyl terminus of BnaC9.Tic40 cause this functional divergence. The distribution of these amino acid replacements in 59 diverse Brassica spp. accessions demonstrated that the neofunctionalization of Tic40 is restricted to B. oleracea and its derivatives and thus occurred after the divergence of the Brassica spp. A, B, and C genomes. © 2014 American Society of Plant Biologists. All Rights Reserved.

  16. Gene duplication and neo-functionalization in the evolutionary and functional divergence of the metazoan copper transporters Ctr1 and Ctr2. (United States)

    Logeman, Brandon L; Wood, L Kent; Lee, Jaekwon; Thiele, Dennis J


    Copper is an essential element for proper organismal development and is involved in a range of processes, including oxidative phosphorylation, neuropeptide biogenesis, and connective tissue maturation. The copper transporter (Ctr) family of integral membrane proteins is ubiquitously found in eukaryotes and mediates the high-affinity transport of Cu + across both the plasma membrane and endomembranes. Although mammalian Ctr1 functions as a Cu + transporter for Cu acquisition and is essential for embryonic development, a homologous protein, Ctr2, has been proposed to function as a low-affinity Cu transporter, a lysosomal Cu exporter, or a regulator of Ctr1 activity, but its functional and evolutionary relationship to Ctr1 is unclear. Here we report a biochemical, genetic, and phylogenetic comparison of metazoan Ctr1 and Ctr2, suggesting that Ctr2 arose over 550 million years ago as a result of a gene duplication event followed by loss of Cu + transport activity. Using a random mutagenesis and growth selection approach, we identified amino acid substitutions in human and mouse Ctr2 proteins that support copper-dependent growth in yeast and enhance copper accumulation in Ctr1 -/- mouse embryonic fibroblasts. These mutations revert Ctr2 to a more ancestral Ctr1-like state while maintaining endogenous functions, such as stimulating Ctr1 cleavage. We suggest key structural aspects of metazoan Ctr1 and Ctr2 that discriminate between their biological roles, providing mechanistic insights into the evolutionary, biochemical, and functional relationships between these two related proteins. © 2017 by The American Society for Biochemistry and Molecular Biology, Inc.

  17. Complete mitochondrial genome of Clistocoeloma sinensis (Brachyura: Grapsoidea): Gene rearrangements and higher-level phylogeny of the Brachyura. (United States)

    Xin, Zhao-Zhe; Liu, Yu; Zhang, Dai-Zhen; Chai, Xin-Yue; Wang, Zheng-Fei; Zhang, Hua-Bin; Zhou, Chun-Lin; Tang, Bo-Ping; Liu, Qiu-Ning


    Deciphering the animal mitochondrial genome (mitogenome) is very important to understand their molecular evolution and phylogenetic relationships. In this study, the complete mitogenome of Clistocoeloma sinensis was determined. The mitogenome of C. sinensis was 15,706 bp long, and its A+T content was 75.7%. The A+T skew of the mitogenome of C. sinensis was slightly negative (-0.020). All the transfer RNA genes had the typical cloverleaf structure, except for the trnS1 gene, which lacked a dihydroxyuridine arm. The two ribosomal RNA genes had 80.2% A+T content. The A+T-rich region spanned 684 bp. The gene order within the complete mitogenome of C. sinensis was identical to the pancrustacean ground pattern except for the translocation of trnH. Additionally, the gene order of trnI-trnQ-trnM in the pancrustacean ground pattern becomes trnQ-trnI-trnM in C. sinensis. Our phylogenetic analysis showed that C. sinensis and Sesarmops sinensis cluster together with high nodal support values, indicating that C. sinensis and S. sinensis have a sister group relationship. The results support that C. sinensis belongs to Grapsoidea, Sesarmidae. Our findings also indicate that Varunidae and Sesarmidae species share close relationships. Thus, mitogenomes are likely to be valuable tools for systematics in other groups of Crustacea.

  18. Annotation, Phylogeny and Expression Analysis of the Nuclear Factor Y Gene Families in Common Bean (Phaseolus vulgaris

    Directory of Open Access Journals (Sweden)

    Carolina eRípodas


    Full Text Available In the past decade, plant nuclear factor Y (NF-Y genes have gained major interest due to their roles in many biological processes in plant development or adaptation to environmental conditions, particularly in the root nodule symbiosis established between legume plants and nitrogen fixing bacteria. NF-Ys are heterotrimeric transcriptional complexes composed of three subunits, NF-YA, NF-YB and NF-YC, which bind with high affinity and specificity to the CCAAT box, a cis element present in many eukaryotic promoters. In plants, NF-Y subunits consist of gene families with about ten members each. In this study, we have identified and characterized the NF-Y gene families of common bean (Phaseolus vulgaris, a grain legume of worldwide economical importance and the main source of dietary protein of developing countries. Expression analysis showed that some members of each family are up-regulated at early or late stages of the nitrogen fixing symbiotic interaction with its partner Rhizobium etli. We also showed that some genes are differentially accumulated in response to inoculation with high or less efficient R. etli strains, constituting excellent candidates to participate in the strain-specific response during symbiosis. Genes of the NF-YA family exhibit a highly structured intron-exon organization. Moreover, this family is characterized by the presence of upstream ORFs when introns in the 5' UTR are retained and miRNA target sites in their 3' UTR, suggesting that these genes might be subjected to a complex post-transcriptional regulation. Multiple protein alignments indicated the presence of highly conserved domains in each of the NF-Y families, presumably involved in subunit interactions and DNA binding. The analysis presented here constitutes a starting point to understand the regulation and biological function of individual members of the NF-Y families in different developmental processes in this grain legume.

  19. Phylogeny and historical biogeography of the cocosoid palms (Arecaceae, Arecoideae, Cocoseae) inferred from sequences of six WRKY gene family loci (United States)

    Arecaceae tribe Cocoseae is the most economically important tribe of palms, including both coconut and African oil palm. It is mostly represented in the Neotropics, with one and two genera endemic to South Africa and Madagascar, respectively. Using primers for six single copy WRKY gene family loci...

  20. Advances toward DNA-based identification and phylogeny of North American Armillaria species using elongation factor-1 alpha gene (United States)

    Amy L. Ross-Davis; John W. Hanna; Mee-Sook Kim; Ned B. Klopfenstein


    The translation elongation factor-1 alpha gene was used to examine the phylogenetic relationships among 30 previously characterized isolates representing ten North American Armillaria species: A. solidipes (=A. ostoyae), A. gemina, A. calvescens, A. sinapina, A. mellea, A. gallica, A. nabsnona, North American biological species X, A. cepistipes, and A. tabescens. The...

  1. Empirical phylogenies and species abundance distributions are consistent with pre-equilibrium dynamics of neutral community models with gene flow

    KAUST Repository

    Bonnet-Lebrun, Anne-Sophie


    Community characteristics reflect past ecological and evolutionary dynamics. Here, we investigate whether it is possible to obtain realistically shaped modelled communities - i.e., with phylogenetic trees and species abundance distributions shaped similarly to typical empirical bird and mammal communities - from neutral community models. To test the effect of gene flow, we contrasted two spatially explicit individual-based neutral models: one with protracted speciation, delayed by gene flow, and one with point mutation speciation, unaffected by gene flow. The former produced more realistic communities (shape of phylogenetic tree and species-abundance distribution), consistent with gene flow being a key process in macro-evolutionary dynamics. Earlier models struggled to capture the empirically observed branching tempo in phylogenetic trees, as measured by the gamma statistic. We show that the low gamma values typical of empirical trees can be obtained in models with protracted speciation, in pre-equilibrium communities developing from an initially abundant and widespread species. This was even more so in communities sampled incompletely, particularly if the unknown species are the youngest. Overall, our results demonstrate that the characteristics of empirical communities that we have studied can, to a large extent, be explained through a purely neutral model under pre-equilibrium conditions. This article is protected by copyright. All rights reserved.

  2. Phylogeny of the New World diploid cottons (Gossypium L., Malvaceae) based on sequences of three low-copy nuclear genes. (United States)

    I. Alvarez; R. Cronn; J.F. Wendel


    American diploid cottons (Gossypium L., subgenus Houzingenia Fryxell) form a monophyletic group of 13 species distributed mainly in western Mexico, extending into Arizona, Baja California, and with one disjunct species each in the Galapagos Islands and Peru. Prior phylogenetic analyses based on an alcohol dehydrogenase gene (...

  3. Empirical phylogenies and species abundance distributions are consistent with pre-equilibrium dynamics of neutral community models with gene flow

    KAUST Repository

    Bonnet-Lebrun, Anne-Sophie; Manica, Andrea; Eriksson, Anders; Rodrigues, Ana S.L.


    Community characteristics reflect past ecological and evolutionary dynamics. Here, we investigate whether it is possible to obtain realistically shaped modelled communities - i.e., with phylogenetic trees and species abundance distributions shaped similarly to typical empirical bird and mammal communities - from neutral community models. To test the effect of gene flow, we contrasted two spatially explicit individual-based neutral models: one with protracted speciation, delayed by gene flow, and one with point mutation speciation, unaffected by gene flow. The former produced more realistic communities (shape of phylogenetic tree and species-abundance distribution), consistent with gene flow being a key process in macro-evolutionary dynamics. Earlier models struggled to capture the empirically observed branching tempo in phylogenetic trees, as measured by the gamma statistic. We show that the low gamma values typical of empirical trees can be obtained in models with protracted speciation, in pre-equilibrium communities developing from an initially abundant and widespread species. This was even more so in communities sampled incompletely, particularly if the unknown species are the youngest. Overall, our results demonstrate that the characteristics of empirical communities that we have studied can, to a large extent, be explained through a purely neutral model under pre-equilibrium conditions. This article is protected by copyright. All rights reserved.

  4. Typewriting: Toward Duplicating Success (United States)

    Orsborn, Karen J.


    A description of two projects (secretarial handbook and memo pad and personalized stationery) for use in teaching the duplication process that will capture the interests of students in an advanced typewriting class. (HD)

  5. [Phylogeny of protostome moulting animals (Ecdysozoa) inferred from 18 and 28S rRNA gene sequences]. (United States)

    Petrov, N B; Vladychenskaia, N S


    Reliability of reconstruction of phylogenetic relationships within a group of protostome moulting animals was evaluated by means of comparison of 18 and 28S rRNA gene sequences sets both taken separately and combined. Reliability of reconstructions was evaluated by values of the bootstrap support of major phylogenetic tree nodes and by degree of congruence of phylogenetic trees inferred by various methods. By both criteria, phylogenetic trees reconstructed from the combined 18 and 28S rRNA gene sequences were better than those inferred from 18 and 28S sequences taken separately. Results obtained are consistent with phylogenetic hypothesis separating protostome animals into two major clades, moulting Ecdysozoa (Priapulida + Kinorhyncha, Nematoda + Nematomorpha, Onychophora + Tardigrada, Myriapoda + Chelicerata, Crustacea + Hexapoda) and unmoulting Lophotrochozoa (Plathelminthes, Nemertini, Annelida, Mollusca, Echiura, Sipuncula). Clade Cephalorhyncha does not include nematomorphs (Nematomorpha). Conclusion was taken that it is necessary to use combined 18 and 28S data in phylogenetic studies.

  6. Genomic identification, phylogeny, and expression analysis of MLO genes involved in susceptibility to powdery mildew in Fragaria vesca. (United States)

    Miao, L X; Jiang, M; Zhang, Y C; Yang, X F; Zhang, H Q; Zhang, Z F; Wang, Y Z; Jiang, G H


    The MLO (powdery mildew locus O) gene family is important in resistance to powdery mildew (PM). In this study, all of the members of the MLO family were identified and analyzed in the strawberry (Fragaria vesca) genome. The strawberry contains at least 20 members of the MLO family, and the protein sequence contained between 171 and 1485 amino acids, with 0-34 introns. Chromosomal localization showed that the MLOs were unevenly distributed on each of the chromosomes, except for chromosome 4. The greatest number of MLOs (seven) was found on chromosome 3. A phylogenetic tree showed that the MLOs were divided into seven groups (I-VII), four of which consisted of MLOs from strawberry, Arabidopsis thaliana, rice, and maize, suggesting that these genes may have evolved after the divergence of monocots and dicots. Multiple sequence alignment showed that strawberry MLO candidates related to powdery mildew resistance possessed seven highly conserved transmembrane domains, a calmodulin-binding domain, and two conserved regions, all of which are important domains for powdery mildew resistance genes. Expressed sequence tag analysis revealed that the MLOs were induced by multiple abiotic stressors, including low and high temperature, drought, and high salinity. These findings will contribute to the functional characterization of MLOs related to PM susceptibility, and will assist in the development of disease resistance in strawberries.

  7. Nuclear counterparts of the cytoplasmic mitochondrial 12S rRNA gene: a problem of ancient DNA and molecular phylogenies. (United States)

    van der Kuyl, A C; Kuiken, C L; Dekker, J T; Perizonius, W R; Goudsmit, J


    Monkey mummy bones and teeth originating from the North Saqqara Baboon Galleries (Egypt), soft tissue from a mummified baboon in a museum collection, and nineteenth/twentieth-century skin fragments from mangabeys were used for DNA extraction and PCR amplification of part of the mitochondrial 12S rRNA gene. Sequences aligning with the 12S rRNA gene were recovered but were only distantly related to contemporary monkey mitochondrial 12S rRNA sequences. However, many of these sequences were identical or closely related to human nuclear DNA sequences resembling mitochondrial 12S rRNA (isolated from a cell line depleted in mitochondria) and therefore have to be considered contamination. Subsequently in a separate study we were able to recover genuine mitochondrial 12S rRNA sequences from many extant species of nonhuman Old World primates and sequences closely resembling the human nuclear integrations. Analysis of all sequences by the neighbor-joining (NJ) method indicated that mitochondrial DNA sequences and their nuclear counterparts can be divided into two distinct clusters. One cluster contained all temporary cytoplasmic mitochondrial DNA sequences and approximately half of the monkey nuclear mitochondriallike sequences. A second cluster contained most human nuclear sequences and the other half of monkey nuclear sequences with a separate branch leading to human and gorilla mitochondrial and nuclear sequences. Sequences recovered from ancient materials were equally divided between the two clusters. These results constitute a warning for when working with ancient DNA or performing phylogenetic analysis using mitochondrial DNA as a target sequence: Nuclear counterparts of mitochondrial genes may lead to faulty interpretation of results.

  8. Enteric and rectal duplications and duplication cysts in the adult. (United States)

    Simsek, Abdurrahman; Zeybek, Nazif; Yagci, Gokhan; Kaymakcioglu, Nihat; Tas, Huseyin; Saglam, Mutlu; Cetiner, Sadettin


    Alimentary tract duplication and duplication cysts are rare congenital malformations. The ileum is the most frequently affected site. However, alimentary tract duplication and duplication cysts can occur at any point along the gastrointestinal tract. Early diagnosis and prompt surgical treatment is the best way to prevent associated morbidity. This article presents the cases of three patients admitted to Gulhane Military Medical Academy with signs of acute abdomen, intra-abdominal mass and chronic abdominal pain. These patients were found to have enteric duplication, duplication cyst and/or retro-rectal cyst. The literature on alimentary tract duplications is reviewed.

  9. The zebrafish maternal-effect gene cellular atoll encodes the centriolar component sas-6 and defects in its paternal function promote whole genome duplication. (United States)

    Yabe, Taijiro; Ge, Xiaoyan; Pelegri, Francisco


    A female-sterile zebrafish maternal-effect mutation in cellular atoll (cea) results in defects in the initiation of cell division starting at the second cell division cycle. This phenomenon is caused by defects in centrosome duplication, which in turn affect the formation of a bipolar spindle. We show that cea encodes the centriolar coiled-coil protein Sas-6, and that zebrafish Cea/Sas-6 protein localizes to centrosomes. cea also has a genetic paternal contribution, which when mutated results in an arrested first cell division followed by normal cleavage. Our data supports the idea that, in zebrafish, paternally inherited centrosomes are required for the first cell division while maternally derived factors are required for centrosomal duplication and cell divisions in subsequent cell cycles. DNA synthesis ensues in the absence of centrosome duplication, and the one-cycle delay in the first cell division caused by cea mutant sperm leads to whole genome duplication. We discuss the potential implications of these findings with regards to the origin of polyploidization in animal species. In addition, the uncoupling of developmental time and cell division count caused by the cea mutation suggests the presence of a time window, normally corresponding to the first two cell cycles, which is permissive for germ plasm recruitment.

  10. Cloning and characterization of two duplicated interleukin-17A/F2 genes in common carp (Cyprinus carpio L.): Transcripts expression and bioactivity of recombinant IL-17A/F2. (United States)

    Li, Hongxia; Yu, Juhua; Li, Jianlin; Tang, Yongkai; Yu, Fan; Zhou, Jie; Yu, Wenjuan


    Interleukin-17 (IL-17) plays an important role in inflammation and host defense in mammals. In this study, we identified two duplicated IL-17A/F2 genes in the common carp (Cyprinus carpio) (ccIL-17A/F2a and ccIL-17A/F2b), putative encoded proteins contain 140 amino acids (aa) with conserved IL-17 family motifs. Expression analysis revealed high constitutive expression of ccIL-17A/F2s in mucosal tissues, including gill, skin and intestine, their expression could be induced by Aeromonas hydrophila, suggesting a potential role in mucosal immunity. Recombinant ccIL-17A/F2a protein (rccIL-17A/F2a) produced in Escherichia coli could induce the expression of proinflammatory cytokines (IL-1β) and the antimicrobial peptides S100A1, S100A10a and S100A10b in the primary kidney in a dose- and time-dependent manner. Above findings suggest that ccIL-17A/F2 plays an important role in both proinflammatory and innate immunity. Two duplicated ccIL-17A/F2s showed different expression level with ccIL-17A/F2a higher than b, comparison of two 5' regulatory regions indicated the length from anticipated promoter to transcriptional start site (TSS) and putative transcription factor binding site (TFBS) were different. Promoter activity of ccIL-17A/F2a was 2.5 times of ccIL-17A/F2b which consistent with expression results of two genes. These suggest mutations in 5'regulatory region contributed to the differentiation of duplicated genes. To our knowledge, this is the first report to analyze 5'regulatory region of piscine IL-17 family genes. Copyright © 2016 Elsevier Ltd. All rights reserved.

  11. Transcriptome mining, functional characterization, and phylogeny of a large terpene synthase gene family in spruce (Picea spp.

    Directory of Open Access Journals (Sweden)

    Dullat Harpreet K


    Full Text Available Abstract Background In conifers, terpene synthases (TPSs of the gymnosperm-specific TPS-d subfamily form a diverse array of mono-, sesqui-, and diterpenoid compounds, which are components of the oleoresin secretions and volatile emissions. These compounds contribute to defence against herbivores and pathogens and perhaps also protect against abiotic stress. Results The availability of extensive transcriptome resources in the form of expressed sequence tags (ESTs and full-length cDNAs in several spruce (Picea species allowed us to estimate that a conifer genome contains at least 69 unique and transcriptionally active TPS genes. This number is comparable to the number of TPSs found in any of the sequenced and well-annotated angiosperm genomes. We functionally characterized a total of 21 spruce TPSs: 12 from Sitka spruce (P. sitchensis, 5 from white spruce (P. glauca, and 4 from hybrid white spruce (P. glauca × P. engelmannii, which included 15 monoterpene synthases, 4 sesquiterpene synthases, and 2 diterpene synthases. Conclusions The functional diversity of these characterized TPSs parallels the diversity of terpenoids found in the oleoresin and volatile emissions of Sitka spruce and provides a context for understanding this chemical diversity at the molecular and mechanistic levels. The comparative characterization of Sitka spruce and Norway spruce diterpene synthases revealed the natural occurrence of TPS sequence variants between closely related spruce species, confirming a previous prediction from site-directed mutagenesis and modelling.

  12. Molecular phylogeny of Japanese Rhinolophidae based on variations in the complete sequence of the mitochondrial cytochrome b gene. (United States)

    Sakai, Takahiro; Kikkawa, Yoshiaki; Tsuchiya, Kimiyuki; Harada, Masashi; Kanoe, Masamitsu; Yoshiyuki, Mizuko; Yonekawa, Hiromichi


    Microchiroptera have diversified into many species whose size and the shapes of the complicated ear and nose have been adapted to their echolocation abilities. Their speciation processes, and intra- and interspecies relationships are still under discussion. Here we report on the geographical variation of Japanese Rhinolophus ferrumequinum and R. cornutus using the complete sequence of the mitochondrial cytochrome b gene to clarify the phylogenetic positions of the 2 species as well as that of Rhinolophidae within the Microchiroptera. We have found that sequence divergence values within each of the 2 species are unexpectedly low (0.07%-0.94%). We have also found that there is no local specificity of their mtCytb alleles. On the other hand, the divergence values for Japanese Microchiroptera (12.7%-16.6%) are much higher than those for other mammalian genera. Similarly, the values among five genera of Vespertilionidae were 20.5%-27.3%. Phylogenetic analysis shows that the 2 species of family Rhinolophidae in the suborder Microchiroptera belong to the Megachiroptera cluster in the constructed maximum parsimony tree. These results suggest that the speciation of Rhinolophidae involved its divergence as an independent lineage from other Microchiroptera, and other microbats might be paraphyletic. In addition, the tree also shows that the order Chiroptera is monophylitic, and the closest group to Chiroptera is the ungulates.

  13. 9-genes reinforce the phylogeny of holometabola and yield alternate views on the phylogenetic placement of Strepsiptera.

    Directory of Open Access Journals (Sweden)

    Duane D McKenna


    Full Text Available The extraordinary morphology, reproductive and developmental biology, and behavioral ecology of twisted wing parasites (order Strepsiptera have puzzled biologists for centuries. Even today, the phylogenetic position of these enigmatic "insects from outer space" [1] remains uncertain and contentious. Recent authors have argued for the placement of Strepsiptera within or as a close relative of beetles (order Coleoptera, as sister group of flies (order Diptera, or even outside of Holometabola.Here, we combine data from several recent studies with new data (for a total of 9 nuclear genes and approximately 13 kb of aligned data for 34 taxa, to help clarify the phylogenetic placement of Strepsiptera. Our results unequivocally support the monophyly of Neuropteroidea (=Neuropterida+Coleoptera+Strepsiptera, but recover Strepsiptera either derived from within polyphagan beetles (order Coleoptera, or in a position sister to Neuropterida. All other supra-ordinal- and ordinal-level relationships recovered with strong nodal support were consistent with most other recent studies.These results, coupled with the recent proposed placement of Strepsiptera sister to Coleoptera, suggest that while the phylogenetic neighborhood of Strepsiptera has been identified, unequivocal placement to a specific branch within Neuropteroidea will require additional study.

  14. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers. (United States)

    Finnerty, John R; Mazza, Maureen E; Jezewski, Peter A


    Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx) in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal), were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  15. Domain duplication, divergence, and loss events in vertebrate Msx paralogs reveal phylogenomically informed disease markers

    Directory of Open Access Journals (Sweden)

    Finnerty John R


    Full Text Available Abstract Background Msx originated early in animal evolution and is implicated in human genetic disorders. To reconstruct the functional evolution of Msx and inform the study of human mutations, we analyzed the phylogeny and synteny of 46 metazoan Msx proteins and tracked the duplication, diversification and loss of conserved motifs. Results Vertebrate Msx sequences sort into distinct Msx1, Msx2 and Msx3 clades. The sister-group relationship between MSX1 and MSX2 reflects their derivation from the 4p/5q chromosomal paralogon, a derivative of the original "MetaHox" cluster. We demonstrate physical linkage between Msx and other MetaHox genes (Hmx, NK1, Emx in a cnidarian. Seven conserved domains, including two Groucho repression domains (N- and C-terminal, were present in the ancestral Msx. In cnidarians, the Groucho domains are highly similar. In vertebrate Msx1, the N-terminal Groucho domain is conserved, while the C-terminal domain diverged substantially, implying a novel function. In vertebrate Msx2 and Msx3, the C-terminal domain was lost. MSX1 mutations associated with ectodermal dysplasia or orofacial clefting disorders map to conserved domains in a non-random fashion. Conclusion Msx originated from a MetaHox ancestor that also gave rise to Tlx, Demox, NK, and possibly EHGbox, Hox and ParaHox genes. Duplication, divergence or loss of domains played a central role in the functional evolution of Msx. Duplicated domains allow pleiotropically expressed proteins to evolve new functions without disrupting existing interaction networks. Human missense sequence variants reside within evolutionarily conserved domains, likely disrupting protein function. This phylogenomic evaluation of candidate disease markers will inform clinical and functional studies.

  16. Six subgroups and extensive recent duplications characterize the evolution of the eukaryotic tubulin protein family. (United States)

    Findeisen, Peggy; Mühlhausen, Stefanie; Dempewolf, Silke; Hertzog, Jonny; Zietlow, Alexander; Carlomagno, Teresa; Kollmar, Martin


    Tubulins belong to the most abundant proteins in eukaryotes providing the backbone for many cellular substructures like the mitotic and meiotic spindles, the intracellular cytoskeletal network, and the axonemes of cilia and flagella. Homologs have even been reported for archaea and bacteria. However, a taxonomically broad and whole-genome-based analysis of the tubulin protein family has never been performed, and thus, the number of subfamilies, their taxonomic distribution, and the exact grouping of the supposed archaeal and bacterial homologs are unknown. Here, we present the analysis of 3,524 tubulins from 504 species. The tubulins formed six major subfamilies, α to ζ. Species of all major kingdoms of the eukaryotes encode members of these subfamilies implying that they must have already been present in the last common eukaryotic ancestor. The proposed archaeal homologs grouped together with the bacterial TubZ proteins as sister clade to the FtsZ proteins indicating that tubulins are unique to eukaryotes. Most species contained α- and/or β-tubulin gene duplicates resulting from recent branch- and species-specific duplication events. This shows that tubulins cannot be used for constructing species phylogenies without resolving their ortholog-paralog relationships. The many gene duplicates and also the independent loss of the δ-, ε-, or ζ-tubulins, which have been shown to be part of the triplet microtubules in basal bodies, suggest that tubulins can functionally substitute each other. © The Author(s) 2014. Published by Oxford University Press on behalf of the Society for Molecular Biology and Evolution.

  17. Molecular phylogeny of the genus Saguinus (Platyrrhini, Primates based on the ND1 mitochondrial gene and implications for conservation

    Directory of Open Access Journals (Sweden)

    Claudia Helena Tagliaro


    Full Text Available The systematics of the subfamily Callitrichinae (Platyrrhini, Primates, a group of small monkeys from South America and Panama, remains an area of considerable discussion despite many investigations, there being continuing controversy over subgeneric taxonomic classifications based on morphological characters. The purpose of our research was to help elucidate the phylogenetic relationships within the monkey genus Saguinus (Callitrichinae using a molecular approach to discover whether or not the two different sections containing hairy-faced and bare-faced species are monophyletic, whether Saguinus midas midas and Saguinus bicolor are more closely related than are S. midas midas and Saguinus midas niger, and if Saguinus fuscicollis melanoleucus and Saguinus fuscicollis weddelli really are different species. We sequenced the 957 bp ND1 mitochondrial gene of 21 Saguinus monkeys (belonging to six species and nine morphotypes and one Cebus monkey (the outgroup and constructed phylogenetic trees using maximum parsimony, neighbor joining, and maximum likelihood methods. The phylogenetic trees obtained divided the genus Saguinus into two groups, one containing the small-bodied species S. fuscicollis and the other, the large-bodied species S. mystax, S. leucopus, S. oedipus, S. midas, S. bicolor. The most derived taxa, S. midas and S. bicolor, grouped together, while S. fuscicollis melanoleucus and S. f. weddelli showed divergence values that did not support the division of these morphotypes into subspecies. On the other hand, S. midas individuals showed divergence compatible with the existence of three subspecies, two of them with the same morphotype as the subspecies S. midas niger. The results of our study suggest that there is at least one Saguinus subspecies that has not yet been described and that the conservation status of Saguinus species and subspecies should be carefully revised using modern molecular approaches.

  18. Positive selection of a duplicated UV-sensitive visual pigment coincides with wing pigment evolution in Heliconius butterflies (United States)

    Briscoe, Adriana D.; Bybee, Seth M.; Bernard, Gary D.; Yuan, Furong; Sison-Mangus, Marilou P.; Reed, Robert D.; Warren, Andrew D.; Llorente-Bousquets, Jorge; Chiao, Chuan-Chin


    The butterfly Heliconius erato can see from the UV to the red part of the light spectrum with color vision proven from 440 to 640 nm. Its eye is known to contain three visual pigments, rhodopsins, produced by an 11-cis-3-hydroxyretinal chromophore together with long wavelength (LWRh), blue (BRh) and UV (UVRh1) opsins. We now find that H. erato has a second UV opsin mRNA (UVRh2)—a previously undescribed duplication of this gene among Lepidoptera. To investigate its evolutionary origin, we screened eye cDNAs from 14 butterfly species in the subfamily Heliconiinae and found both copies only among Heliconius. Phylogeny-based tests of selection indicate positive selection of UVRh2 following duplication, and some of the positively selected sites correspond to vertebrate visual pigment spectral tuning residues. Epi-microspectrophotometry reveals two UV-absorbing rhodopsins in the H. erato eye with λmax = 355 nm and 398 nm. Along with the additional UV opsin, Heliconius have also evolved 3-hydroxy-DL-kynurenine (3-OHK)-based yellow wing pigments not found in close relatives. Visual models of how butterflies perceive wing color variation indicate this has resulted in an expansion of the number of distinguishable yellow colors on Heliconius wings. Functional diversification of the UV-sensitive visual pigments may help explain why the yellow wing pigments of Heliconius are so colorful in the UV range compared to the yellow pigments of close relatives lacking the UV opsin duplicate. PMID:20133601

  19. The vertebrate ancestral repertoire of visual opsins, transducin alpha subunits and oxytocin/vasopressin receptors was established by duplication of their shared genomic region in the two rounds of early vertebrate genome duplications. (United States)

    Lagman, David; Ocampo Daza, Daniel; Widmark, Jenny; Abalo, Xesús M; Sundström, Görel; Larhammar, Dan


    Vertebrate color vision is dependent on four major color opsin subtypes: RH2 (green opsin), SWS1 (ultraviolet opsin), SWS2 (blue opsin), and LWS (red opsin). Together with the dim-light receptor rhodopsin (RH1), these form the family of vertebrate visual opsins. Vertebrate genomes contain many multi-membered gene families that can largely be explained by the two rounds of whole genome duplication (WGD) in the vertebrate ancestor (2R) followed by a third round in the teleost ancestor (3R). Related chromosome regions resulting from WGD or block duplications are said to form a paralogon. We describe here a paralogon containing the genes for visual opsins, the G-protein alpha subunit families for transducin (GNAT) and adenylyl cyclase inhibition (GNAI), the oxytocin and vasopressin receptors (OT/VP-R), and the L-type voltage-gated calcium channels (CACNA1-L). Sequence-based phylogenies and analyses of conserved synteny show that the above-mentioned gene families, and many neighboring gene families, expanded in the early vertebrate WGDs. This allows us to deduce the following evolutionary scenario: The vertebrate ancestor had a chromosome containing the genes for two visual opsins, one GNAT, one GNAI, two OT/VP-Rs and one CACNA1-L gene. This chromosome was quadrupled in 2R. Subsequent gene losses resulted in a set of five visual opsin genes, three GNAT and GNAI genes, six OT/VP-R genes and four CACNA1-L genes. These regions were duplicated again in 3R resulting in additional teleost genes for some of the families. Major chromosomal rearrangements have taken place in the teleost genomes. By comparison with the corresponding chromosomal regions in the spotted gar, which diverged prior to 3R, we could time these rearrangements to post-3R. We present an extensive analysis of the paralogon housing the visual opsin, GNAT and GNAI, OT/VP-R, and CACNA1-L gene families. The combined data imply that the early vertebrate WGD events contributed to the evolution of vision and the

  20. Molecular data and phylogeny of family

    International Nuclear Information System (INIS)

    Shinwari, Z.K.; Shinwari, S.


    Family Smilacaceae's higher order taxonomy remained disputed for many years. It was treated as an order 'Smilacales' and was also placed under Liliales by several taxonomists. Even some considered as part of family Liliacaeae. In present paper, we investigated the family's higher order phylogeny and also compared its rbcL gene sequence data with related taxa to elucidate its phylogeny. The data suggests that its family stature is beyond dispute because of its advanced karyotype, woody climbing habit and DNA sequence data. The data suggest that Smilacaceae may be a sister group of order Liliales and it forms a clear clade with the order. (author)

  1. A conserved segmental duplication within ELA. (United States)

    Brinkmeyer-Langford, C L; Murphy, W J; Childers, C P; Skow, L C


    The assembled genomic sequence of the horse major histocompatibility complex (MHC) (equine lymphocyte antigen, ELA) is very similar to the homologous human HLA, with the notable exception of a large segmental duplication at the boundary of ELA class I and class III that is absent in HLA. The segmental duplication consists of a ∼ 710 kb region of at least 11 repeated blocks: 10 blocks each contain an MHC class I-like sequence and the helicase domain portion of a BAT1-like sequence, and the remaining unit contains the full-length BAT1 gene. Similar genomic features were found in other Perissodactyls, indicating an ancient origin, which is consistent with phylogenetic analyses. Reverse-transcriptase PCR (RT-PCR) of mRNA from peripheral white blood cells of healthy and chronically or acutely infected horses detected transcription from predicted open reading frames in several of the duplicated blocks. This duplication is not present in the sequenced MHCs of most other mammals, although a similar feature at the same relative position is present in the feline MHC (FLA). Striking sequence conservation throughout Perissodactyl evolution is consistent with a functional role for at least some of the genes included within this segmental duplication. © 2010 The Authors, Journal compilation © 2010 Stichting International Foundation for Animal Genetics.

  2. The phylogeny of marine and freshwater species of the genus Chloromyxum Mingazzini, 1890 (Myxosporea: Bivalvulida) based on small subunit ribosomal RNA gene sequences

    Czech Academy of Sciences Publication Activity Database

    Fiala, Ivan; Dyková, Iva


    Roč. 51, 2/3 (2004), s. 211-214 ISSN 0015-5683 R&D Projects: GA ČR GD524/03/H133 Institutional research plan: CEZ:AV0Z6022909 Keywords : Myxosporea * Chloromyxum * phylogeny Subject RIV: EA - Cell Biology Impact factor: 0.837, year: 2004

  3. Phylogeny of Rhus gall aphids (Hemiptera:Pemphigidae) based on combined molecular analysis of nuclear EF1α and mitochondrial COII genes (United States)

    Zi-xiang Yang; Xiao-ming Chen; Nathan P. Havill; Ying Feng; Hang. Chen


    Rhus gall aphids (Fordinae : Melaphidini) have a disjunct distribution in East Asia and North America and have specific host plant relationships. Some of them are of economic importance and all species form sealed galls which show great variation in shape, size, structure, and galling-site. We present a phylogeny incorporating ten species and four...

  4. The centriole duplication cycle (United States)

    Fırat-Karalar, Elif Nur; Stearns, Tim


    Centrosomes are the main microtubule-organizing centre of animal cells and are important for many critical cellular and developmental processes from cell polarization to cell division. At the core of the centrosome are centrioles, which recruit pericentriolar material to form the centrosome and act as basal bodies to nucleate formation of cilia and flagella. Defects in centriole structure, function and number are associated with a variety of human diseases, including cancer, brain diseases and ciliopathies. In this review, we discuss recent advances in our understanding of how new centrioles are assembled and how centriole number is controlled. We propose a general model for centriole duplication control in which cooperative binding of duplication factors defines a centriole ‘origin of duplication’ that initiates duplication, and passage through mitosis effects changes that license the centriole for a new round of duplication in the next cell cycle. We also focus on variations on the general theme in which many centrioles are created in a single cell cycle, including the specialized structures associated with these variations, the deuterosome in animal cells and the blepharoplast in lower plant cells. PMID:25047614

  5. Glutamine synthetase gene evolution: A good molecular clock

    International Nuclear Information System (INIS)

    Pesole, G.; Lanvave, C.; Saccone, C.; Bozzetti, M.P.; Preparata, G.


    Glutamine synthetase gene evolution in various animals, plants, and bacteria was evaluated by a general stationary Markov model. The evolutionary process proved to be unexpectedly regular even for a time span as long as that between the divergence of prokaryotes from eukaryotes. This enabled us to draw phylogenetic trees for species whose phylogeny cannot be easily reconstructed from the fossil record. The calculation of the times of divergence of the various organelle-specific enzymes led us to hypothesize that the pea and bean chloroplast genes for these enzymes originated from the duplication of nuclear genes as a result of the different metabolic needs of the various species. The data indicate that the duplication of plastid glutamine synthetase genes occurred long after the endosymbiotic events that produced the organelles themselves

  6. A robust molecular phylogeny of the Tricladida (Platyhelminthes: Seriata) with a discussion on morphological synapomorphies. (United States)

    Carranza, S; Littlewood, D T; Clough, K A; Ruiz-Trillo, I; Baguñà, J; Riutort, M


    The suborder Tricladida (Platyhelminthes: Turbellaria, Seriata) comprises most well-known species of free-living flatworms. Four infraorders are recognized: (i) the Maricola (marine planarians); (ii) the Cavernicola (a group of primarily cavernicolan planarians); (iii) the Paludicola (freshwater planarians); and (iv) the Terricola (land planarians). The phylogenetic relationships among these infraorders have been analysed using morphological characters, but they remain uncertain. Here we analyse the phylogeny and classification of the Tricladida, with additional, independent, molecular data from complete sequences of 18S rDNA and 18S rRNA. We use maximum parsimony and neighbour-joining methods and the characterization of a unique gene duplication event involving the Terricola and the dugesiids to reconstruct the phylogeny. The results show that the Maricola is monophyletic and is the primitive sister group to the rest of the Tricladida (the Paludicola plus the Terricola). The Paludicola are paraphyletic since the Terricola and one paludicolan family, the Dugesiidae, share a more recent common ancestor than the dugesiids with other paludicolans (dendrocoelids and planariids). A reassessment of morphological evidence may confirm the apparent redundancy of the existing infraorders Paludicola and Terricola. In the meantime, we suggest replacing the Paludicola and Terricola with a new clade, the Continenticola, which comprises the families Dugesiidae, Planariidae, Dendrocoelidae and the Terricola. PMID:9881470

  7. Sorting by Cuts, Joins, and Whole Chromosome Duplications. (United States)

    Zeira, Ron; Shamir, Ron


    Genome rearrangement problems have been extensively studied due to their importance in biology. Most studied models assumed a single copy per gene. However, in reality, duplicated genes are common, most notably in cancer. In this study, we make a step toward handling duplicated genes by considering a model that allows the atomic operations of cut, join, and whole chromosome duplication. Given two linear genomes, [Formula: see text] with one copy per gene and [Formula: see text] with two copies per gene, we give a linear time algorithm for computing a shortest sequence of operations transforming [Formula: see text] into [Formula: see text] such that all intermediate genomes are linear. We also show that computing an optimal sequence with fewest duplications is NP-hard.

  8. Craniofacial duplication (diprosopus). (United States)

    Turpin, I M; Furnas, D W; Amlie, R N


    No congenital malformation in infants is more profound than anterior craniofacial duplication. The precise term for this rare anomaly is diprosopus, referring to a fetus with a single trunk, normal limbs, and varying degrees of facial duplication. A search of the world literature produced only 16 cases of diprosopus since 1864. Despite the rarity of this anomaly, three such infants were born in the Southern California area during the past year, making this the largest reported series to date. The three infants were born with two distinctly formed faces. Each had four separate eyes, two mouths, two noses, and two ears with a primitive ear or sinus tract at the plane of fusion. In addition, multiple congenital aberrations existed which involved a variety of internal organs. The pathogenesis of diprosopus is not well understood, but environmental stress early in embryologic development has been suggested as a possible factor. The apparent mechanism is a slowing of pregastrulation oxidation with resultant focal developmental arrests.

  9. Centrioles: duplicating precariously. (United States)

    Pelletier, Laurence


    To assemble a mitotic spindle and accurately segregate chromosomes to progeny, a cell needs to precisely regulate its centrosome number, a feat largely accomplished through the tight control of centriole duplication. Recent work showing that the overexpression of centriolar proteins can lead to the formation of multiple centrioles in the absence of pre-existing centrioles challenges the idea that it is a self-replicating organelle.

  10. Rectal duplication: a case report. (United States)

    Didden, K; Masereel, B; Geyskens, P


    Gastrointestinal tract duplications are uncommon congenital abnormalities, that may occur anywhere along the alimentary tract. Most frequently they occur at the level of the small bowel tract and are symptomatic before the age of two. In our case we report the history of a 68-years old women with a colon duplication, especially a rectal duplication. This is very exceptional.

  11. Embryonic duplications in sheep. (United States)

    Dennis, S M


    Twenty-seven embryonic duplications were examined during a 3-year investigation into the causes of perinatal lamb mortality. Twenty of the 27 were anomalous twins with 19 being conjoined (diplopagus 9 and heteropagus 10). The various duplications were: haloacardius acephalus 1, diprosopus 2, dicephalus 2, dipypus 3, diprosopus dipygus 1, syncephalus dipygus 1, pygopagus parasiticus 1, heteropagus dipygus 3, melodidymus 6, polyury 4, penile duplication 2, and bilateral otognathia 1. Four lambs were living and the time of death of the others was: parturient 8, and post-parturient 15. Average dry weight of the lambs was 3.35 kg (range 1.59 to 5.45 kg). Breed distribution was: Merino 77.8%, Crossbred 14.8%, Dorset Horn 3.7%, and Corriedale 3.7%. The caudal region was involved in 10 of the conjoined twins (52.6%), anterior region in 7 (36.9%), and both anterior and caudal regions in 2 (10.5%). Associated defects were present in 70.4% of the 27 lambs, the most common being atresia ani.

  12. The sequence and analysis of duplication rich human chromosome 16

    Energy Technology Data Exchange (ETDEWEB)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.


    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  13. The Sequence and Analysis of Duplication Rich Human Chromosome 16 (United States)

    Martin, Joel; Han, Cliff; Gordon, Laurie A.; Terry, Astrid; Prabhakar, Shyam; She, Xinwei; Xie, Gary; Hellsten, Uffe; Man Chan, Yee; Altherr, Michael; Couronne, Olivier; Aerts, Andrea; Bajorek, Eva; Black, Stacey; Blumer, Heather; Branscomb, Elbert; Brown, Nancy C.; Bruno, William J.; Buckingham, Judith M.; Callen, David F.; Campbell, Connie S.; Campbell, Mary L.; Campbell, Evelyn W.; Caoile, Chenier; Challacombe, Jean F.; Chasteen, Leslie A.; Chertkov, Olga; Chi, Han C.; Christensen, Mari; Clark, Lynn M.; Cohn, Judith D.; Denys, Mirian; Detter, John C.; Dickson, Mark; Dimitrijevic-Bussod, Mira; Escobar, Julio; Fawcett, Joseph J.; Flowers, Dave; Fotopulos, Dea; Glavina, Tijana; Gomez, Maria; Gonzales, Eidelyn; Goodstein, David; Goodwin, Lynne A.; Grady, Deborah L.; Grigoriev, Igor; Groza, Matthew; Hammon, Nancy; Hawkins, Trevor; Haydu, Lauren; Hildebrand, Carl E.; Huang, Wayne; Israni, Sanjay; Jett, Jamie; Jewett, Phillip E.; Kadner, Kristen; Kimball, Heather; Kobayashi, Arthur; Krawczyk, Marie-Claude; Leyba, Tina; Longmire, Jonathan L.; Lopez, Frederick; Lou, Yunian; Lowry, Steve; Ludeman, Thom; Mark, Graham A.; Mcmurray, Kimberly L.; Meincke, Linda J.; Morgan, Jenna; Moyzis, Robert K.; Mundt, Mark O.; Munk, A. Christine; Nandkeshwar, Richard D.; Pitluck, Sam; Pollard, Martin; Predki, Paul; Parson-Quintana, Beverly; Ramirez, Lucia; Rash, Sam; Retterer, James; Ricke, Darryl O.; Robinson, Donna L.; Rodriguez, Alex; Salamov, Asaf; Saunders, Elizabeth H.; Scott, Duncan; Shough, Timothy; Stallings, Raymond L.; Stalvey, Malinda; Sutherland, Robert D.; Tapia, Roxanne; Tesmer, Judith G.; Thayer, Nina; Thompson, Linda S.; Tice, Hope; Torney, David C.; Tran-Gyamfi, Mary; Tsai, Ming; Ulanovsky, Levy E.; Ustaszewska, Anna; Vo, Nu; White, P. Scott; Williams, Albert L.; Wills, Patricia L.; Wu, Jung-Rung; Wu, Kevin; Yang, Joan; DeJong, Pieter; Bruce, David; Doggett, Norman; Deaven, Larry; Schmutz, Jeremy; Grimwood, Jane; Richardson, Paul; et al.


    We report here the 78,884,754 base pairs of finished human chromosome 16 sequence, representing over 99.9 percent of its euchromatin. Manual annotation revealed 880 protein coding genes confirmed by 1,637 aligned transcripts, 19 tRNA genes, 341 pseudogenes and 3 RNA pseudogenes. These genes include metallothionein, cadherin and iroquois gene families, as well as the disease genes for polycystic kidney disease and acute myelomonocytic leukemia. Several large-scale structural polymorphisms spanning hundreds of kilobasepairs were identified and result in gene content differences across humans. One of the unique features of chromosome 16 is its high level of segmental duplication, ranked among the highest of the human autosomes. While the segmental duplications are enriched in the relatively gene poor pericentromere of the p-arm, some are involved in recent gene duplication and conversion events which are likely to have had an impact on the evolution of primates and human disease susceptibility.

  14. Plastome phylogeny and early diversification of Brassicaceae. (United States)

    Guo, Xinyi; Liu, Jianquan; Hao, Guoqian; Zhang, Lei; Mao, Kangshan; Wang, Xiaojuan; Zhang, Dan; Ma, Tao; Hu, Quanjun; Al-Shehbaz, Ihsan A; Koch, Marcus A


    The family Brassicaceae encompasses diverse species, many of which have high scientific and economic importance. Early diversifications and phylogenetic relationships between major lineages or clades remain unclear. Here we re-investigate Brassicaceae phylogeny with complete plastomes from 51 species representing all four lineages or 5 of 6 major clades (A, B, C, E and F) as identified in earlier studies. Bayesian and maximum likelihood phylogenetic analyses using a partitioned supermatrix of 77 protein coding genes resulted in nearly identical tree topologies exemplified by highly supported relationships between clades. All four lineages were well identified and interrelationships between them were resolved. The previously defined Clade C was found to be paraphyletic (the genus Megadenia formed a separate lineage), while the remaining clades were monophyletic. Clade E (lineage III) was sister to clades B + C rather than to all core Brassicaceae (clades A + B + C or lineages I + II), as suggested by a previous transcriptome study. Molecular dating based on plastome phylogeny supported the origin of major lineages or clades between late Oligocene and early Miocene, and the following radiative diversification across the family took place within a short timescale. In addition, gene losses in the plastomes occurred multiple times during the evolutionary diversification of the family. Plastome phylogeny illustrates the early diversification of cruciferous species. This phylogeny will facilitate our further understanding of evolution and adaptation of numerous species in the model family Brassicaceae.

  15. Genome-Wide Analyses of the NAC Transcription Factor Gene Family in Pepper (Capsicum annuum L.: Chromosome Location, Phylogeny, Structure, Expression Patterns, Cis-Elements in the Promoter, and Interaction Network

    Directory of Open Access Journals (Sweden)

    Weiping Diao


    Full Text Available The NAM, ATAF1/2, and CUC2 (NAC transcription factors form a large plant-specific gene family, which is involved in the regulation of tissue development in response to biotic and abiotic stress. To date, there have been no comprehensive studies investigating chromosomal location, gene structure, gene phylogeny, conserved motifs, or gene expression of NAC in pepper (Capsicum annuum L.. The recent release of the complete genome sequence of pepper allowed us to perform a genome-wide investigation of Capsicum annuum L. NAC (CaNAC proteins. In the present study, a comprehensive analysis of the CaNAC gene family in pepper was performed, and a total of 104 CaNAC genes were identified. Genome mapping analysis revealed that CaNAC genes were enriched on four chromosomes (chromosomes 1, 2, 3, and 6. In addition, phylogenetic analysis of the NAC domains from pepper, potato, Arabidopsis, and rice showed that CaNAC genes could be clustered into three groups (I, II, and III. Group III, which contained 24 CaNAC genes, was exclusive to the Solanaceae plant family. Gene structure and protein motif analyses showed that these genes were relatively conserved within each subgroup. The number of introns in CaNAC genes varied from 0 to 8, with 83 (78.9% of CaNAC genes containing two or less introns. Promoter analysis confirmed that CaNAC genes are involved in pepper growth, development, and biotic or abiotic stress responses. Further, the expression of 22 selected CaNAC genes in response to seven different biotic and abiotic stresses [salt, heat shock, drought, Phytophthora capsici, abscisic acid, salicylic acid (SA, and methyl jasmonate (MeJA] was evaluated by quantitative RT-PCR to determine their stress-related expression patterns. Several putative stress-responsive CaNAC genes, including CaNAC72 and CaNAC27, which are orthologs of the known stress-responsive Arabidopsis gene ANAC055 and potato gene StNAC30, respectively, were highly regulated by treatment with

  16. Genetics Home Reference: 7q11.23 duplication syndrome (United States)

    ... Duplication Syndrome. 2015 Nov 25. In: Pagon RA, Adam MP, Ardinger HH, Wallace SE, Amemiya A, Bean LJH, Bird TD, Ledbetter N, Mefford HC, Smith RJH, Stephens K, editors. GeneReviews® [Internet]. Seattle (WA): ...

  17. Craniofacial duplication: a case report. (United States)

    Suryawanshi, Pradeep; Deshpande, Mandar; Verma, Nitin; Mahendrakar, Vivek; Mahendrakar, Sandhya


    A craniofacial duplication or diprosopus is an unusual variant of conjoined twinning. The reported incidence is one in 180,000-15 million births and 35 cases have been reported till date. The phenotype is wide, with the partial duplication of a few facial structures to complete dicephalus. A complete duplication is associated with a high incidence of anomalies in the central nervous system, cardiovascular system, gastrointestinal system and the respiratory system, whereas no major anomalies are found in the infants with a partial duplication. A term baby with the features of a craniofacial duplication has been described, with the proposed theories on embryogenesis and a brief review of the literature.

  18. Rectal duplication with sciatic hernia. (United States)

    Nosek, Marzena; Golonka, Anna; Kalińska-Lipert, Anita; Nachulewicz, Paweł


    Rectal duplications represent 5% of all duplications in the alimentary tract, and they are very rarely diagnosed during the neonatal period. The authors present the method of investigation and the results of surgical treatment of a full-term neonate with a sciatic hernia containing a rectal duplication. The procedure started with three-port laparoscopy, but excision of the tubular duplication of the rectum was possible only by a transanal endorectal pull-through approach. The sciatic hernia was closed, and plastic sutures on the buttock finished the procedure. The coincidence of sciatic hernia with rectal duplication is extremely rare, and the method of treatment depends exclusively on the anatomical conditions.

  19. Polyphyly, gene-duplication and extensive allopolyploidy framed the evolution of the ephemeral Vulpia grasses and other fine-leaved Loliinae (Poaceae). (United States)

    Díaz-Pérez, A J; Sharifi-Tehrani, M; Inda, L A; Catalán, P


    The fine-leaved Loliinae is one of the temperate grass lineages that is richest in number of evolutionary switches from perennial to annual life-cycle, and also shows one of the most complex reticulate patterns involving distinct diploid and allopolyploid lineages. Eight distinct annual lineages, that have traditionally been placed in the genus Vulpia and in other fine-leaved ephemeral genera, have apparently emerged from different perennial Festuca ancestors. The phenotypically similar Vulpia taxa have been reconstructed as polyphyletic, with polyploid lineages showing unclear relationships to their purported diploid relatives. Interspecific and intergeneric hybridization is, however, rampant across different lineages. An evolutionary analysis based on cloned nuclear low-copy GBSSI (Granule-Bound Starch Synthase I) and multicopy ITS (Internal Transcribed Spacer) sequences has been conducted on representatives of most Vulpia species and other fine-leaved lineages, using Bayesian consensus and agreement trees, networking split graphs and species tree-based approaches, to disentangle their phylogenetic relationships and to identify the parental genome donors of the allopolyploids. Both data sets were able to reconstruct a congruent phylogeny in which Vulpia was resolved as polyphyletic from at least three main ancestral diploid lineages. These, in turn, participated in the origin of the derived allopolyploid Vulpia lineages together with other Festuca-like, Psilurus-like and some unknown genome donors. Long-distance dispersal events were inferred to explain the polytopic origin of the Mediterranean and American Vulpia lineages. Copyright © 2014 Elsevier Inc. All rights reserved.

  20. Whole Genome and Tandem Duplicate Retention facilitated Glucosinolate Pathway Diversification in the Mustard Family.

    NARCIS (Netherlands)

    Hofberger, J.A.; Lyons, E.; Edger, P.P.; Pires, J.C.; Schranz, M.E.


    Plants share a common history of successive whole genome duplication (WGD) events retaining genomic patterns of duplicate gene copies (ohnologs) organized in conserved syntenic blocks. Duplication was often proposed to affect the origin of novel traits during evolution. However, genetic evidence

  1. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation

    NARCIS (Netherlands)

    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.

    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes.

  2. The phylogeny of Arthrotardigrada

    DEFF Research Database (Denmark)

    Hansen, Jesper Guldberg


    The order Arthrotardigrada, or water bears, constitutes a small group of 160 species of marine, microscopical invertebrates, within the phylum Tardigrada. Although the position of tardigrades in the Animal Kingdom has received much attention focusing on the metazoan phylogeny, the phylogenetic...

  3. Fossils and decapod phylogeny

    NARCIS (Netherlands)

    Schram, Frederick R.; Dixon, Christopher


    An expanded series of morphological characters developed for a cladistic analysis of extant decapods has yielded a new hypothesis for the phylogeny of the group. Application of this database to selected fossil genera produces some interesting results and demonstrates the feasibility of treating

  4. Building a Twig Phylogeny (United States)

    Flinn, Kathryn M.


    In this classroom activity, students build a phylogeny for woody plant species based on the morphology of their twigs. Using any available twigs, students can practice the process of cladistics to test evolutionary hypotheses for real organisms. They identify homologous characters, determine polarity through outgroup comparison, and construct a…

  5. A novel phylogeny of the Gelidiales (Rhodophyta) based on five genes including the nuclear CesA, with descriptions of Orthogonacladia gen. nov. and Orthogonacladiaceae fam. nov. (United States)

    Boo, Ga Hun; Le Gall, Line; Miller, Kathy Ann; Freshwater, D Wilson; Wernberg, Thomas; Terada, Ryuta; Yoon, Kyung Ju; Boo, Sung Min


    Although the Gelidiales are economically important marine red algae producing agar and agarose, the phylogeny of this order remains poorly resolved. The present study provides a molecular phylogeny based on a novel marker, nuclear-encoded CesA, plus plastid-encoded psaA, psbA, rbcL, and mitochondria-encoded cox1 from subsets of 107 species from all ten genera within the Gelidiales. Analyses of individual and combined datasets support the monophyly of three currently recognized families, and reveal a new clade. On the basis of these results, the new family Orthogonacladiaceae is described to accommodate Aphanta and a new genus Orthogonacladia that includes species previously classified as Gelidium madagascariense and Pterocladia rectangularis. Acanthopeltis is merged with Gelidium, which has nomenclatural priority. Nuclear-encoded CesA was found to be useful for improving the resolution of phylogenetic relationships within the Gelidiales and is likely to be valuable for the inference of phylogenetic relationship among other red algal taxa. Copyright © 2016 Elsevier Inc. All rights reserved.

  6. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae) based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments. (United States)

    Wang, Zhaoshan; Du, Shuhui; Dayanandan, Selvadurai; Wang, Dongsheng; Zeng, Yanfei; Zhang, Jianguo


    Populus (Salicaceae) is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1) the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2) three advanced sections (Populus, Aigeiros and Tacamahaca) are of hybrid origin; (3) species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4) many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  7. Phylogeny reconstruction and hybrid analysis of populus (Salicaceae based on nucleotide sequences of multiple single-copy nuclear genes and plastid fragments.

    Directory of Open Access Journals (Sweden)

    Zhaoshan Wang

    Full Text Available Populus (Salicaceae is one of the most economically and ecologically important genera of forest trees. The complex reticulate evolution and lack of highly variable orthologous single-copy DNA markers have posed difficulties in resolving the phylogeny of this genus. Based on a large data set of nuclear and plastid DNA sequences, we reconstructed robust phylogeny of Populus using parsimony, maximum likelihood and Bayesian inference methods. The resulting phylogenetic trees showed better resolution at both inter- and intra-sectional level than previous studies. The results revealed that (1 the plastid-based phylogenetic tree resulted in two main clades, suggesting an early divergence of the maternal progenitors of Populus; (2 three advanced sections (Populus, Aigeiros and Tacamahaca are of hybrid origin; (3 species of the section Tacamahaca could be divided into two major groups based on plastid and nuclear DNA data, suggesting a polyphyletic nature of the section; and (4 many species proved to be of hybrid origin based on the incongruence between plastid and nuclear DNA trees. Reticulate evolution may have played a significant role in the evolution history of Populus by facilitating rapid adaptive radiations into different environments.

  8. Gene Structures, Classification, and Expression Models of the DREB Transcription Factor Subfamily in Populus trichocarpa

    Directory of Open Access Journals (Sweden)

    Yunlin Chen


    Full Text Available We identified 75 dehydration-responsive element-binding (DREB protein genes in Populus trichocarpa. We analyzed gene structures, phylogenies, domain duplications, genome localizations, and expression profiles. The phylogenic construction suggests that the PtrDREB gene subfamily can be classified broadly into six subtypes (DREB A-1 to A-6 in Populus. The chromosomal localizations of the PtrDREB genes indicated 18 segmental duplication events involving 36 genes and six redundant PtrDREB genes were involved in tandem duplication events. There were fewer introns in the PtrDREB subfamily. The motif composition of PtrDREB was highly conserved in the same subtype. We investigated expression profiles of this gene subfamily from different tissues and/or developmental stages. Sixteen genes present in the digital expression analysis had high levels of transcript accumulation. The microarray results suggest that 18 genes were upregulated. We further examined the stress responsiveness of 15 genes by qRT-PCR. A digital northern analysis showed that the PtrDREB17, 18, and 32 genes were highly induced in leaves under cold stress, and the same expression trends were shown by qRT-PCR. Taken together, these observations may lay the foundation for future functional analyses to unravel the biological roles of Populus’ DREB genes.

  9. New progress in snake mitochondrial gene rearrangement. (United States)

    Chen, Nian; Zhao, Shujin


    To further understand the evolution of snake mitochondrial genomes, the complete mitochondrial DNA (mtDNA) sequences were determined for representative species from two snake families: the Many-banded krait, the Banded krait, the Chinese cobra, the King cobra, the Hundred-pace viper, the Short-tailed mamushi, and the Chain viper. Thirteen protein-coding genes, 22-23 tRNA genes, 2 rRNA genes, and 2 control regions were identified in these mtDNAs. Duplication of the control region and translocation of the tRNAPro gene were two notable features of the snake mtDNAs. These results from the gene rearrangement comparisons confirm the correctness of traditional classification schemes and validate the utility of comparing complete mtDNA sequences for snake phylogeny reconstruction.

  10. A case study for effects of operational taxonomic units from intracellular endoparasites and ciliates on the eukaryotic phylogeny: phylogenetic position of the haptophyta in analyses of multiple slowly evolving genes.

    Directory of Open Access Journals (Sweden)

    Hisayoshi Nozaki

    Full Text Available Recent multigene phylogenetic analyses have contributed much to our understanding of eukaryotic phylogeny. However, the phylogenetic positions of various lineages within the eukaryotes have remained unresolved or in conflict between different phylogenetic studies. These phylogenetic ambiguities might have resulted from mixtures or integration from various factors including limited taxon sampling, missing data in the alignment, saturations of rapidly evolving genes, mixed analyses of short- and long-branched operational taxonomic units (OTUs, intracellular endoparasite and ciliate OTUs with unusual substitution etc. In order to evaluate the effects from intracellular endoparasite and ciliate OTUs co-analyzed on the eukaryotic phylogeny and simplify the results, we here used two different sets of data matrices of multiple slowly evolving genes with small amounts of missing data and examined the phylogenetic position of the secondary photosynthetic chromalveolates Haptophyta, one of the most abundant groups of oceanic phytoplankton and significant primary producers. In both sets, a robust sister relationship between Haptophyta and SAR (stramenopiles, alveolates, rhizarians, or SA [stramenopiles and alveolates] was resolved when intracellular endoparasite/ciliate OTUs were excluded, but not in their presence. Based on comparisons of character optimizations on a fixed tree (with a clade composed of haptophytes and SAR or SA, disruption of the monophyly between haptophytes and SAR (or SA in the presence of intracellular endoparasite/ciliate OTUs can be considered to be a result of multiple evolutionary reversals of character positions that supported the synapomorphy of the haptophyte and SAR (or SA clade in the absence of intracellular endoparasite/ciliate OTUs.

  11. Duplicated middle cerebral artery (United States)

    Perez, Jesus; Machado, Calixto; Scherle, Claudio; Hierro, Daniel


    Duplicated middle cerebral artery (DMCA) is an anomalous vessel arising from the internal carotid artery. The incidence DMCA is relatively law, and an association between this anomaly and cerebral aneurysms has been documented. There is a controversy whether DMCA may have perforating arteries. This is an important fact to consider in aneurysm surgery. We report the case of a 34-year-old black woman who suffered a subarachnoid hemorrhage and the angiography a left DMCA, and an aneurysm in an inferior branch of the main MCA. The DMCA and the MCA had perforating arteries. The aneurysm was clipped without complications. The observation of perforating arteries in our patient confirms that the DMCA may have perforating arteries. This is very important to be considered in cerebral aneurysms surgery. Moreover, the DMCA may potentially serve as a collateral blood supply to the MCA territory in cases of MCA occlusion. PMID:22140405

  12. Duplication at Xq28 involving IKBKG is associated with progressive macrocephaly, recurrent infections, ectodermal dysplasia, benign tumors, and neuropathy

    NARCIS (Netherlands)

    Asbeck, E. Van; Ramalingam, A.; Dvorak, C.; Chen, T.J.; Morava, E.


    Duplications on Xq28 are common, although quite variable in size, but usually include the MECP2 gene. Here, we present a patient with a unique, small, 167-kb duplication at Xq28, not including MECP2. The most important gene in the duplicated region was IKBKG, mutations in which can cause a variety

  13. Phylogeny of the Paracalanidae Giesbrecht, 1888 (Crustacea: Copepoda: Calanoida). (United States)

    Cornils, Astrid; Blanco-Bercial, Leocadio


    The Paracalanidae are ecologically-important marine planktonic copepods that occur in the epipelagic zone in temperate and tropical waters. They are often the dominant taxon - in terms of biomass and abundance - in continental shelf regions. As primary consumers, they form a vital link in the pelagic food web between primary producers and higher trophic levels. Despite the ecological importance of the taxon, evolutionary and systematic relationships within the family remain largely unknown. A multigene phylogeny including 24 species, including representatives for all seven genera, was determined based on two nuclear genes, small-subunit (18S) ribosomal RNA and Histone 3 (H3) and one mitochondrial gene, cytochrome c oxidase subunit I (COI). The molecular phylogeny was well supported by Maximum likelihood and Bayesian inference analysis; all genera were found to be monophyletic, except for Paracalanus, which was separated into two distinct clades: the Paracalanus aculeatus group and Paracalanus parvus group. The molecular phylogeny also confirmed previous findings that Mecynocera and Calocalanus are genera of the family Paracalanidae. For comparison, a morphological phylogeny was created for 35 paracalanid species based on 54 morphological characters derived from published descriptions. The morphological phylogeny did not resolve all genera as monophyletic and bootstrap support was not strong. Molecular and morphological phylogenies were not congruent in the positioning of Bestiolina and the Paracalanus species groups, possibly due to the lack of sufficient phylogenetically-informative morphological characters. Copyright © 2013 Elsevier Inc. All rights reserved.

  14. Colonic duplication in an adult

    International Nuclear Information System (INIS)

    Baro, P.; Dario Casas, J.; Sanchez, D.


    A case of colonic duplication that was diagnosed radiologically in an adult is reported. A long duplicated segment below the normal transverse colon, with a wide anastomosis at the hepatic flexure level, was observed on barium enema. The rarity of this anomaly unassociated with other malformations is emphasized. (orig.)

  15. Complete colonic duplication in children. (United States)

    Khaleghnejad Tabari, Ahmad; Mirshemirani, Alireza; Khaleghnejad Tabari, Nasibeh


    Complete colonic duplication is a very rare congenital anomaly that may have different presentations according to its location and size. Complete colonic duplication can occur in 15% of gastrointestinal duplication. We report two cases of complete colonic duplications, and their characteristics. We present two patients with complete colonic duplication with different types and presentations. Case 1: A 2- year old boy presented to the clinic with abdominal protrusion, difficulty to defecate, chronic constipation and mucosal prolaps covered bulging (rectocele) since he was 6 months old. The patient had palpable pelvic mass with doughy consistency. Rectal exam confirmed perirectal mass with soft consistency. The patient underwent a surgical operation that had total tubular colorectal duplication with one blind end and was treated with simple fenestration of distal end, and was discharged without complication. After two years follow up, he had normal defecation and good weight gain. Case 2: A 2 -day old infant was referred with imperforate anus and complete duplication of recto-sigmoid colon, diphallus, double bladder, and hypospadiasis. After clinical and paraclinical investigations, he underwent operations in several stages in different periods, and was discharged without complications. After four years follow up, he led a normal life. The patients with complete duplication have to be examined carefully because of the high incidence of other systemic anomalies. Treatment includes simple resection of distal common wall, fenestration, and repair other associated anomalies.

  16. A survey of innovation through duplication in the reduced genomes of twelve parasites.

    Directory of Open Access Journals (Sweden)

    Jeremy D DeBarry

    Full Text Available We characterize the prevalence, distribution, divergence, and putative functions of detectable two-copy paralogs and segmental duplications in the Apicomplexa, a phylum of parasitic protists. Apicomplexans are mostly obligate intracellular parasites responsible for human and animal diseases (e.g. malaria and toxoplasmosis. Gene loss is a major force in the phylum. Genomes are small and protein-encoding gene repertoires are reduced. Despite this genomic streamlining, duplications and gene family amplifications are present. The potential for innovation introduced by duplications is of particular interest. We compared genomes of twelve apicomplexans across four lineages and used orthology and genome cartography to map distributions of duplications against genome architectures. Segmental duplications appear limited to five species. Where present, they correspond to regions enriched for multi-copy and species-specific genes, pointing toward roles in adaptation and innovation. We found a phylum-wide association of duplications with dynamic chromosome regions and syntenic breakpoints. Trends in the distribution of duplicated genes indicate that recent, species-specific duplicates are often tandem while most others have been dispersed by genome rearrangements. These trends show a relationship between genome architecture and gene duplication. Functional analysis reveals: proteases, which are vital to a parasitic lifecycle, to be prominent in putative recent duplications; a pair of paralogous genes in Toxoplasma gondii previously shown to produce the rate-limiting step in dopamine synthesis in mammalian cells, a possible link to the modification of host behavior; and phylum-wide differences in expression and subcellular localization, indicative of modes of divergence. We have uncovered trends in multiple modes of duplicate divergence including sequence, intron content, expression, subcellular localization, and functions of putative recent duplicates that

  17. Mitochondrial phylogeny and biogeographic history of the Greek endemic land-snail genus Codringtonia Kobelt 1898 (Gastropoda, Pulmonata, Helicidae). (United States)

    Kotsakiozi, Panayiota; Parmakelis, Aristeidis; Giokas, Sinos; Papanikolaou, Irene; Valakos, Efstratios D


    The aim of this work was to infer the phylogeny of the Greek endemic land-snail genus Codringtonia Kobelt 1898, estimate the time frame of the radiation of the genus, and propose a biogeographic scenario that could explain the contemporary distribution of Codringtonia lineages. The study took place in the districts of Peloponnese, Central Greece and Epirus of mainland Greece. Sequence data originating from three mtDNA genes (COI, COII, and 16S rDNA) were used to infer the phylogeny of the eight nominal Codringtonia species. Furthermore, the radiation time-frame of extant Codringtonia species was estimated using a relaxed molecular clock analysis and mtDNA substitution rates of land snails. The phylogenetic analysis supported the existence of six Codringtonia lineages in Greece and indicated that one nominal species (Codringtonia neocrassa) might belong to a separate genus distantly related to Codringtonia. The time frame of differentiation of Codringtonia species was placed in the Late Miocene-Pleistocene epoch. The dispersal-vicariance analysis performed indicated that most probably Codringtonia exhibited a north-to-south spread with the ancestral area being that of central Greek mainland, accompanied with duplication (speciation) and vicariance events. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Genomic organization and molecular phylogenies of the beta (β keratin multigene family in the chicken (Gallus gallus and zebra finch (Taeniopygia guttata: implications for feather evolution

    Directory of Open Access Journals (Sweden)

    Sawyer Roger H


    Full Text Available Abstract Background The epidermal appendages of reptiles and birds are constructed of beta (β keratins. The molecular phylogeny of these keratins is important to understanding the evolutionary origin of these appendages, especially feathers. Knowing that the crocodilian β-keratin genes are closely related to those of birds, the published genomes of the chicken and zebra finch provide an opportunity not only to compare the genomic organization of their β-keratins, but to study their molecular evolution in archosaurians. Results The subfamilies (claw, feather, feather-like, and scale of β-keratin genes are clustered in the same 5' to 3' order on microchromosome 25 in chicken and zebra finch, although the number of claw and feather genes differs between the species. Molecular phylogenies show that the monophyletic scale genes are the basal group within birds and that the monophyletic avian claw genes form the basal group to all feather and feather-like genes. Both species have a number of feather clades on microchromosome 27 that form monophyletic groups. An additional monophyletic cluster of feather genes exist on macrochromosome 2 for each species. Expression sequence tag analysis for the chicken demonstrates that all feather β-keratin clades are expressed. Conclusions Similarity in the overall genomic organization of β-keratins in Galliformes and Passeriformes suggests similar organization in all Neognathae birds, and perhaps in the ancestral lineages leading to modern birds, such as the paravian Anchiornis huxleyi. Phylogenetic analyses demonstrate that evolution of archosaurian epidermal appendages in the lineage leading to birds was accompanied by duplication and divergence of an ancestral β-keratin gene cluster. As morphological diversification of epidermal appendages occurred and the β-keratin multigene family expanded, novel β-keratin genes were selected for novel functions within appendages such as feathers.

  19. Skipper genome sheds light on unique phenotypic traits and phylogeny. (United States)

    Cong, Qian; Borek, Dominika; Otwinowski, Zbyszek; Grishin, Nick V


    Butterflies and moths are emerging as model organisms in genetics and evolutionary studies. The family Hesperiidae (skippers) was traditionally viewed as a sister to other butterflies based on its moth-like morphology and darting flight habits with fast wing beats. However, DNA studies suggest that the family Papilionidae (swallowtails) may be the sister to other butterflies including skippers. The moth-like features and the controversial position of skippers in Lepidoptera phylogeny make them valuable targets for comparative genomics. We obtained the 310 Mb draft genome of the Clouded Skipper (Lerema accius) from a wild-caught specimen using a cost-effective strategy that overcomes the high (1.6 %) heterozygosity problem. Comparative analysis of Lerema accius and the highly heterozygous genome of Papilio glaucus revealed differences in patterns of SNP distribution, but similarities in functions of genes that are enriched in non-synonymous SNPs. Comparison of Lepidoptera genomes revealed possible molecular bases for unique traits of skippers: a duplication of electron transport chain components could result in efficient energy supply for their rapid flight; a diversified family of predicted cellulases might allow them to feed on cellulose-enriched grasses; an expansion of pheromone-binding proteins and enzymes for pheromone synthesis implies a more efficient mate-recognition system, which compensates for the lack of clear visual cues due to the similarities in wing colors and patterns of many species of skippers. Phylogenetic analysis of several Lepidoptera genomes suggested that the position of Hesperiidae remains uncertain as the tree topology varied depending on the evolutionary model. Completion of the first genome from the family Hesperiidae allowed comparative analyses with other Lepidoptera that revealed potential genetic bases for the unique phenotypic traits of skippers. This work lays the foundation for future experimental studies of skippers and

  20. Phylogeny of Indonesian Nostoc (Cyanobac teria Isolated from Paddy Fields as Inferred from Partial Se quence of 16S rRNA Gene

    Directory of Open Access Journals (Sweden)

    Dian Hendrayanti


    Full Text Available In order to collect Indonesian Nostoc, isolation of soil microflora from several paddy fields in West Java, Bali, andSouth Celebes was carried out. Fast-growing isolates of Nostoc were selected to describe and perform molecular identification using partial sequences of 16S rRNA. The results showed that partial sequences of 16S rRNA could not resolve the phylogeny of the isolates. However, it supported the morphological studies that recognize isolates as different species of Nostoc. Potential use of Nostoc as a nitrogen source for paddy growth was carried out using six strains as single inoculums. A total biomass of 2 g (fresh weight for each strain was inoculated, respectively, into the pot planted with three paddy plants. This experiment was conducted in the green house for 115 days. Statistical analyses (ANOVA; α = 0.05 showed that of six strains tested in this study, only strain GIA13a had influence on the augmentation of root length and the total number of filled grains.

  1. Molecular phylogeny of the neritidae (Gastropoda: Neritimorpha) based on the mitochondrial genes cytochrome oxidase I (COI) and 16S rRNA

    International Nuclear Information System (INIS)

    Quintero Galvis, Julian Fernando; Castro, Lyda Raquel


    The family Neritidae has representatives in tropical and subtropical regions that occur in a variety of environments, and its known fossil record dates back to the late Cretaceous. However there have been few studies of molecular phylogeny in this family. We performed a phylogenetic reconstruction of the family Neritidae using the COI (722 bp) and the 16S rRNA (559 bp) regions of the mitochondrial genome. Neighbor-joining, maximum parsimony and Bayesian inference were performed. The best phylogenetic reconstruction was obtained using the COI region, and we consider it an appropriate marker for phylogenetic studies within the group. Consensus analysis (COI +16S rRNA) generally obtained the same tree topologies and confirmed that the genus Nerita is monophyletic. The consensus analysis using parsimony recovered a monophyletic group consisting of the genera Neritina, Septaria, Theodoxus, Puperita, and Clithon, while in the Bayesian analyses Theodoxus is separated from the other genera. The phylogenetic status of the species from the genus Nerita from the Colombian Caribbean generated in this study was consistent with that reported for the genus in previous studies. In the resulting consensus tree obtained using maximum parsimony, we included information on habitat type for each species, to map the evolution by habitat. Species of the family Neritidae possibly have their origin in marine environments, which is consistent with conclusions from previous reports based on anatomical studies.

  2. Combining phylogenetic and syntenic analyses for understanding the evolution of TCP ECE genes in eudicots.

    Directory of Open Access Journals (Sweden)

    Hélène L Citerne

    Full Text Available TCP ECE genes encode transcription factors which have received much attention for their repeated recruitment in the control of floral symmetry in core eudicots, and more recently in monocots. Major duplications of TCP ECE genes have been described in core eudicots, but the evolutionary history of this gene family is unknown in basal eudicots. Reconstructing the phylogeny of ECE genes in basal eudicots will help set a framework for understanding the functional evolution of these genes. TCP ECE genes were sequenced in all major lineages of basal eudicots and Gunnera which belongs to the sister clade to all other core eudicots. We show that in these lineages they have a complex evolutionary history with repeated duplications. We estimate the timing of the two major duplications already identified in the core eudicots within a timeframe before the divergence of Gunnera and after the divergence of Proteales. We also use a synteny-based approach to examine the extent to which the expansion of TCP ECE genes in diverse eudicot lineages may be due to genome-wide duplications. The three major core-eudicot specific clades share a number of collinear genes, and their common evolutionary history may have originated at the γ event. Genomic comparisons in Arabidopsis thaliana and Solanumlycopersicum highlight their separate polyploid origin, with syntenic fragments with and without TCP ECE genes showing differential gene loss and genomic rearrangements. Comparison between recently available genomes from two basal eudicots Aquilegiacoerulea and Nelumbonucifera suggests that the two TCP ECE paralogs in these species are also derived from large-scale duplications. TCP ECE loci from basal eudicots share many features with the three main core eudicot loci, and allow us to infer the makeup of the ancestral eudicot locus.

  3. Molecular phylogeny of diplomonads and enteromonads based on SSU rRNA, alpha-tubulin and HSP90 genes: Implications for the evolutionary history of the double karyomastigont of diplomonads

    Directory of Open Access Journals (Sweden)

    Roger Andrew J


    Full Text Available Abstract Background Fornicata is a relatively recently established group of protists that includes the diplokaryotic diplomonads (which have two similar nuclei per cell, and the monokaryotic enteromonads, retortamonads and Carpediemonas, with the more typical one nucleus per cell. The monophyly of the group was confirmed by molecular phylogenetic studies, but neither the internal phylogeny nor its position on the eukaryotic tree has been clearly resolved. Results Here we have introduced data for three genes (SSU rRNA, α-tubulin and HSP90 with a wide taxonomic sampling of Fornicata, including ten isolates of enteromonads, representing the genera Trimitus and Enteromonas, and a new undescribed enteromonad genus. The diplomonad sequences formed two main clades in individual gene and combined gene analyses, with Giardia (and Octomitus on one side of the basal divergence and Spironucleus, Hexamita and Trepomonas on the other. Contrary to earlier evolutionary scenarios, none of the studied enteromonads appeared basal to diplokaryotic diplomonads. Instead, the enteromonad isolates were all robustly situated within the second of the two diplomonad clades. Furthermore, our analyses suggested that enteromonads do not constitute a monophyletic group, and enteromonad monophyly was statistically rejected in 'approximately unbiased' tests of the combined gene data. Conclusion We suggest that all higher taxa intended to unite multiple enteromonad genera be abandoned, that Trimitus and Enteromonas be considered as part of Hexamitinae, and that the term 'enteromonads' be used in a strictly utilitarian sense. Our result suggests either that the diplokaryotic condition characteristic of diplomonads arose several times independently, or that the monokaryotic cell of enteromonads originated several times independently by secondary reduction from the diplokaryotic state. Both scenarios are evolutionarily complex. More comparative data on the similarity of the

  4. p53 protects against genome instability following centriole duplication failure (United States)

    Lambrus, Bramwell G.; Uetake, Yumi; Clutario, Kevin M.; Daggubati, Vikas; Snyder, Michael; Sluder, Greenfield


    Centriole function has been difficult to study because of a lack of specific tools that allow persistent and reversible centriole depletion. Here we combined gene targeting with an auxin-inducible degradation system to achieve rapid, titratable, and reversible control of Polo-like kinase 4 (Plk4), a master regulator of centriole biogenesis. Depletion of Plk4 led to a failure of centriole duplication that produced an irreversible cell cycle arrest within a few divisions. This arrest was not a result of a prolonged mitosis, chromosome segregation errors, or cytokinesis failure. Depleting p53 allowed cells that fail centriole duplication to proliferate indefinitely. Washout of auxin and restoration of endogenous Plk4 levels in cells that lack centrioles led to the penetrant formation of de novo centrioles that gained the ability to organize microtubules and duplicate. In summary, we uncover a p53-dependent surveillance mechanism that protects against genome instability by preventing cell growth after centriole duplication failure. PMID:26150389

  5. The duplication 17p13.3 phenotype

    DEFF Research Database (Denmark)

    Curry, Cynthia J; Rosenfeld, Jill A; Grant, Erica


    . Older patients were often overweight. Three variant phenotypes included cleft lip/palate (CLP), split hand/foot with long bone deficiency (SHFLD), and a connective tissue phenotype resembling Marfan syndrome. The duplications in patients with clefts appear to disrupt ABR, while the SHFLD phenotype......Chromosome 17p13.3 is a gene rich region that when deleted is associated with the well-known Miller-Dieker syndrome. A recently described duplication syndrome involving this region has been associated with intellectual impairment, autism and occasional brain MRI abnormalities. We report 34...... was associated with duplication of BHLHA9 as noted in two recent reports. The connective tissue phenotype did not have a convincing critical region. Our experience with this large cohort expands knowledge of this diverse duplication syndrome....

  6. Two duplicated chicken-type lysozyme genes in disc abalone Haliotis discus discus: molecular aspects in relevance to structure, genomic organization, mRNA expression and bacteriolytic function. (United States)

    Umasuthan, Navaneethaiyer; Bathige, S D N K; Kasthuri, Saranya Revathy; Wan, Qiang; Whang, Ilson; Lee, Jehee


    Lysozymes are crucial antibacterial proteins that are associated with catalytic cleavage of peptidoglycan and subsequent bacteriolysis. The present study describes the identification of two lysozyme genes from disc abalone Haliotis discus discus and their characterization at sequence-, genomic-, transcriptional- and functional-levels. Two cDNAs and BAC clones bearing lysozyme genes were isolated from abalone transcriptome and BAC genomic libraries, respectively and sequences were determined. Corresponding deduced amino acid sequences harbored a chicken-type lysozyme (LysC) family profile and exhibited conserved characteristics of LysC family members including active residues (Glu and Asp) and GS(S/T)DYGIFQINS motif suggested that they are LysC counterparts in disc abalone and designated as abLysC1 and abLysC2. While abLysC1 represented the homolog recently reported in Ezo abalone [1], abLysC2 shared significant identity with LysC homologs. Unlike other vertebrate LysCs, coding sequence of abLysCs were distributed within five exons interrupted by four introns. Both abLysCs revealed a broader mRNA distribution with highest levels in mantle (abLysC1) and hepatopancreas (abLysC2) suggesting their likely main role in defense and digestion, respectively. Investigation of temporal transcriptional profiles post-LPS and -pathogen challenges revealed induced-responses of abLysCs in gills and hemocytes. The in vitro muramidase activity of purified recombinant (r) abLysCs proteins was evaluated, and findings indicated that they are active in acidic pH range (3.5-6.5) and over a broad temperature range (20-60 °C) and influenced by ionic strength. When the antibacterial spectra of (r)abLysCs were examined, they displayed differential activities against both Gram positive and Gram negative strains providing evidence for their involvement in bacteriolytic function in abalone physiology. Copyright © 2013 Elsevier Ltd. All rights reserved.

  7. Reconstructing the Backbone of the Saccharomycotina Yeast Phylogeny Using Genome-Scale Data

    Directory of Open Access Journals (Sweden)

    Xing-Xing Shen


    Full Text Available Understanding the phylogenetic relationships among the yeasts of the subphylum Saccharomycotina is a prerequisite for understanding the evolution of their metabolisms and ecological lifestyles. In the last two decades, the use of rDNA and multilocus data sets has greatly advanced our understanding of the yeast phylogeny, but many deep relationships remain unsupported. In contrast, phylogenomic analyses have involved relatively few taxa and lineages that were often selected with limited considerations for covering the breadth of yeast biodiversity. Here we used genome sequence data from 86 publicly available yeast genomes representing nine of the 11 known major lineages and 10 nonyeast fungal outgroups to generate a 1233-gene, 96-taxon data matrix. Species phylogenies reconstructed using two different methods (concatenation and coalescence and two data matrices (amino acids or the first two codon positions yielded identical and highly supported relationships between the nine major lineages. Aside from the lineage comprised by the family Pichiaceae, all other lineages were monophyletic. Most interrelationships among yeast species were robust across the two methods and data matrices. However, eight of the 93 internodes conflicted between analyses or data sets, including the placements of: the clade defined by species that have reassigned the CUG codon to encode serine, instead of leucine; the clade defined by a whole genome duplication; and the species Ascoidea rubescens. These phylogenomic analyses provide a robust roadmap for future comparative work across the yeast subphylum in the disciplines of taxonomy, molecular genetics, evolutionary biology, ecology, and biotechnology. To further this end, we have also provided a BLAST server to query the 86 Saccharomycotina genomes, which can be found at

  8. Reconstructing the Backbone of the Saccharomycotina Yeast Phylogeny Using Genome-Scale Data (United States)

    Shen, Xing-Xing; Zhou, Xiaofan; Kominek, Jacek; Kurtzman, Cletus P.; Hittinger, Chris Todd; Rokas, Antonis


    Understanding the phylogenetic relationships among the yeasts of the subphylum Saccharomycotina is a prerequisite for understanding the evolution of their metabolisms and ecological lifestyles. In the last two decades, the use of rDNA and multilocus data sets has greatly advanced our understanding of the yeast phylogeny, but many deep relationships remain unsupported. In contrast, phylogenomic analyses have involved relatively few taxa and lineages that were often selected with limited considerations for covering the breadth of yeast biodiversity. Here we used genome sequence data from 86 publicly available yeast genomes representing nine of the 11 known major lineages and 10 nonyeast fungal outgroups to generate a 1233-gene, 96-taxon data matrix. Species phylogenies reconstructed using two different methods (concatenation and coalescence) and two data matrices (amino acids or the first two codon positions) yielded identical and highly supported relationships between the nine major lineages. Aside from the lineage comprised by the family Pichiaceae, all other lineages were monophyletic. Most interrelationships among yeast species were robust across the two methods and data matrices. However, eight of the 93 internodes conflicted between analyses or data sets, including the placements of: the clade defined by species that have reassigned the CUG codon to encode serine, instead of leucine; the clade defined by a whole genome duplication; and the species Ascoidea rubescens. These phylogenomic analyses provide a robust roadmap for future comparative work across the yeast subphylum in the disciplines of taxonomy, molecular genetics, evolutionary biology, ecology, and biotechnology. To further this end, we have also provided a BLAST server to query the 86 Saccharomycotina genomes, which can be found at PMID:27672114

  9. In silico reversal of repeat-induced point mutation (RIP identifies the origins of repeat families and uncovers obscured duplicated genes

    Directory of Open Access Journals (Sweden)

    Hane James K


    Full Text Available Abstract Background Repeat-induced point mutation (RIP is a fungal genome defence mechanism guarding against transposon invasion. RIP mutates the sequence of repeated DNA and over time renders the affected regions unrecognisable by similarity search tools such as BLAST. Results DeRIP is a new software tool developed to predict the original sequence of a RIP-mutated region prior to the occurrence of RIP. In this study, we apply deRIP to the genome of the wheat pathogen Stagonospora nodorum SN15 and predict the origin of several previously uncharacterised classes of repetitive DNA. Conclusions Five new classes of transposon repeats and four classes of endogenous gene repeats were identified after deRIP. The deRIP process is a new tool for fungal genomics that facilitates the identification and understanding of the role and origin of fungal repetitive DNA. DeRIP is open-source and is available as part of the RIPCAL suite at

  10. A Comprehensive Analysis of the Phylogeny, Genomic Organization and Expression of Immunoglobulin Light Chain Genes in Alligator sinensis, an Endangered Reptile Species (United States)

    Lu, Yan; Zhang, Chenglin; Wu, Xiaobing; Han, Haitang; Zhao, Yaofeng; Ren, Liming


    Crocodilians are evolutionarily distinct reptiles that are distantly related to lizards and are thought to be the closest relatives of birds. Compared with birds and mammals, few studies have investigated the Ig light chain of crocodilians. Here, employing an Alligator sinensis genomic bacterial artificial chromosome (BAC) library and available genome data, we characterized the genomic organization of the Alligator sinensis IgL gene loci. The Alligator sinensis has two IgL isotypes, λ and κ, the same as Anolis carolinensis. The Igλ locus contains 6 Cλ genes, each preceded by a Jλ gene, and 86 potentially functional Vλ genes upstream of (Jλ-Cλ)n. The Igκ locus contains a single Cκ gene, 6 Jκs and 62 functional Vκs. All VL genes are classified into a total of 31 families: 19 Vλ families and 12 Vκ families. Based on an analysis of the chromosomal location of the light chain genes among mammals, birds, lizards and frogs, the data further confirm that there are two IgL isotypes in the Alligator sinensis: Igλ and Igκ. By analyzing the cloned Igλ/κ cDNA, we identified a biased usage pattern of V families in the expressed Vλ and Vκ. An analysis of the junctions of the recombined VJ revealed the presence of N and P nucleotides in both expressed λ and κ sequences. Phylogenetic analysis of the V genes revealed V families shared by mammals, birds, reptiles and Xenopus, suggesting that these conserved V families are orthologous and have been retained during the evolution of IgL. Our data suggest that the Alligator sinensis IgL gene repertoire is highly diverse and complex and provide insight into immunoglobulin gene evolution in vertebrates. PMID:26901135

  11. A Comprehensive Analysis of the Phylogeny, Genomic Organization and Expression of Immunoglobulin Light Chain Genes in Alligator sinensis, an Endangered Reptile Species.

    Directory of Open Access Journals (Sweden)

    Xifeng Wang

    Full Text Available Crocodilians are evolutionarily distinct reptiles that are distantly related to lizards and are thought to be the closest relatives of birds. Compared with birds and mammals, few studies have investigated the Ig light chain of crocodilians. Here, employing an Alligator sinensis genomic bacterial artificial chromosome (BAC library and available genome data, we characterized the genomic organization of the Alligator sinensis IgL gene loci. The Alligator sinensis has two IgL isotypes, λ and κ, the same as Anolis carolinensis. The Igλ locus contains 6 Cλ genes, each preceded by a Jλ gene, and 86 potentially functional Vλ genes upstream of (Jλ-Cλn. The Igκ locus contains a single Cκ gene, 6 Jκs and 62 functional Vκs. All VL genes are classified into a total of 31 families: 19 Vλ families and 12 Vκ families. Based on an analysis of the chromosomal location of the light chain genes among mammals, birds, lizards and frogs, the data further confirm that there are two IgL isotypes in the Alligator sinensis: Igλ and Igκ. By analyzing the cloned Igλ/κ cDNA, we identified a biased usage pattern of V families in the expressed Vλ and Vκ. An analysis of the junctions of the recombined VJ revealed the presence of N and P nucleotides in both expressed λ and κ sequences. Phylogenetic analysis of the V genes revealed V families shared by mammals, birds, reptiles and Xenopus, suggesting that these conserved V families are orthologous and have been retained during the evolution of IgL. Our data suggest that the Alligator sinensis IgL gene repertoire is highly diverse and complex and provide insight into immunoglobulin gene evolution in vertebrates.

  12. Horizontal transfer, not duplication, drives the expansion of protein families in prokaryotes.

    Directory of Open Access Journals (Sweden)

    Todd J Treangen


    Full Text Available Gene duplication followed by neo- or sub-functionalization deeply impacts the evolution of protein families and is regarded as the main source of adaptive functional novelty in eukaryotes. While there is ample evidence of adaptive gene duplication in prokaryotes, it is not clear whether duplication outweighs the contribution of horizontal gene transfer in the expansion of protein families. We analyzed closely related prokaryote strains or species with small genomes (Helicobacter, Neisseria, Streptococcus, Sulfolobus, average-sized genomes (Bacillus, Enterobacteriaceae, and large genomes (Pseudomonas, Bradyrhizobiaceae to untangle the effects of duplication and horizontal transfer. After removing the effects of transposable elements and phages, we show that the vast majority of expansions of protein families are due to transfer, even among large genomes. Transferred genes--xenologs--persist longer in prokaryotic lineages possibly due to a higher/longer adaptive role. On the other hand, duplicated genes--paralogs--are expressed more, and, when persistent, they evolve slower. This suggests that gene transfer and gene duplication have very different roles in shaping the evolution of biological systems: transfer allows the acquisition of new functions and duplication leads to higher gene dosage. Accordingly, we show that paralogs share most protein-protein interactions and genetic regulators, whereas xenologs share very few of them. Prokaryotes invented most of life's biochemical diversity. Therefore, the study of the evolution of biology systems should explicitly account for the predominant role of horizontal gene transfer in the diversification of protein families.

  13. Molecular phylogeny, morphology, pigment chemistry and ecology in Hygrophoraceae (Agaricales) (United States)

    D. Jean Lodge; Mahajabeen Padamsee; P. Brandon Matheny; M. Catherine Aime; Sharon A. Cantrell; David Boertmann; Alexander Kovalenko; Alfredo Vizzini; Bryn T.M. Dentinger; Paul M. Kirk; A. Martin Ainsworth; Jean-Marc Moncalvo; Rytas Vilgalys; Ellen Larsson; Robert Lucking; Gareth W. Griffith; Matthew E. Smith; Lorilei L. Norvell; Dennis E. Desjardin; Scott A. Redhead; Clark L. Ovrebo; Edgar B. Lickey; Enrico Ercole; Karen W. Hughes; Regis Courtecuisse; Anthony Young; Manfred Binder; Andrew M. Minnis; Daniel L. Lindner; Beatriz Ortiz-Santana; John Haight; Thomas Laessoe; Timothy J. Baroni; Jozsef Geml; Tsutomu Hattori


    Molecular phylogenies using 1–4 gene regions and information on ecology, morphology and pigment chemistry were used in a partial revision of the agaric family Hygrophoraceae. The phylogenetically supported genera we recognize here in the Hygrophoraceae based on these and previous analyses are: Acantholichen, Ampulloclitocybe, Arrhenia, Cantharellula, Cantharocybe,...

  14. Phylogeny of not-yet-cultured spirochetes from termite guts

    DEFF Research Database (Denmark)

    Paster, B.J.; Dewhirst, F.E.; Cooke, S.M.


    Comparisons of 16S rDNA sequences were used to determine the phylogeny of not-yet-cultured spirochetes from hindguts of the African higher termite, Nasutitermes lujae (Wasmann). The 16S rRNA genes were amplified directly from spirochete-rich hindguts by using universal primers, and the amplified...

  15. Anterior colorectal duplication presenting as rectal prolapse. (United States)

    Ramirez-Resendiz, Amador; Asz, Jose; Medina-Vega, F Antonio; Ortega-Salgado, J Arturo


    Duplications of the gastrointestinal (GI) tract are rare. Only 5% of them are rectal and there are very few reports of rectal prolapse (RP) caused by a duplication. An 11 month-old female presented with a RP caused by a blind-ended anterior tubular colorectal duplication. The duplication was successfully opened and connected to the normal rectum without complications. Although infrequent, a rectal duplication should be considered in the differential diagnosis of RP.

  16. Duplicate retention in signalling proteins and constraints from network dynamics. (United States)

    Soyer, O S; Creevey, C J


    Duplications are a major driving force behind evolution. Most duplicates are believed to fix through genetic drift, but it is not clear whether this process affects all duplications equally or whether there are certain gene families that are expected to show neutral expansions under certain circumstances. Here, we analyse the neutrality of duplications in different functional classes of signalling proteins based on their effects on response dynamics. We find that duplications involving intermediary proteins in a signalling network are neutral more often than those involving receptors. Although the fraction of neutral duplications in all functional classes increase with decreasing population size and selective pressure on dynamics, this effect is most pronounced for receptors, indicating a possible expansion of receptors in species with small population size. In line with such an expectation, we found a statistically significant increase in the number of receptors as a fraction of genome size in eukaryotes compared with prokaryotes. Although not confirmative, these results indicate that neutral processes can be a significant factor in shaping signalling networks and affect proteins from different functional classes differently. © 2010 The Authors. Journal Compilation © 2010 European Society For Evolutionary Biology.

  17. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation


    Cuypers, Thomas D; Hogeweg, Paulien; Hogeweg, P.


    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  18. A synergism between adaptive effects and evolvability drives whole genome duplication to fixation.


    Thomas D Cuypers; Paulien Hogeweg


    Whole genome duplication has shaped eukaryotic evolutionary history and has been associated with drastic environmental change and species radiation. While the most common fate of WGD duplicates is a return to single copy, retained duplicates have been found enriched for highly interacting genes. This pattern has been explained by a neutral process of subfunctionalization and more recently, dosage balance selection. However, much about the relationship between environmental change, WGD and ada...

  19. External cystic rectal duplication: an unusual presentation of rectal duplication cyst. (United States)

    Karaman, I; Karaman, A; Arda, N; Cakmak, O


    Duplications of gastrointestinal tract are rare anomalies, and rectal duplications account for five percent of the alimentary tract duplications. We present an unusual case of rectal duplication, which was located externally in a newborn female, and discuss the types of distal hindgut duplications.

  20. Topological congruence between phylogenies of Anacanthorus spp. (Monogenea: Dactylogyridae) and their Characiformes (Actinopterygii) hosts: A case of host-parasite cospeciation. (United States)

    da Graça, Rodrigo J; Fabrin, Thomaz M C; Gasques, Luciano S; Prioli, Sônia M A P; Balbuena, Juan A; Prioli, Alberto J; Takemoto, Ricardo M


    Cophylogenetic studies aim at testing specific hypotheses to understand the nature of coevolving associations between sets of organisms, such as host and parasites. Monogeneans and their hosts provide and interesting platform for these studies due to their high host specificity. In this context, the objective of the present study was to establish whether the relationship between Anacanthorus spp. with their hosts from the upper Paraná River and its tributaries can be explained by means of cospeciation processes. Nine fish species and 14 monogenean species, most of them host specific, were studied. Partial DNA sequences of the genes RAG1, 16S and COI of the fish hosts and of the genes ITS2, COI and 5.8S of the parasite species were used for phylogenetic reconstruction. Maximum likelihood phylogenetic trees of the host and parasite species were built and used for analyses of topological congruence with PACo and ParaFit. The program Jane was used to estimate the nature of cospeciation events. The comparison of the two phylogenies revealed high topological congruence between them. Both PACo and ParaFit supported the hypothesis of global cospeciation. Results from Jane pointed to duplications as the most frequent coevolutionary event, followed by cospeciation, whereas duplications followed by host-switching were the least common event in Anacanthorus spp. studied. Host-sharing (spreading) was also identified but only between congeneric host species.

  1. Ancient duplications and functional divergence in the interferon regulatory factors of vertebrates provide insights into the evolution of vertebrate immune systems. (United States)

    Du, Kang; Zhong, Zaixuan; Fang, Chengchi; Dai, Wei; Shen, Yanjun; Gan, Xiaoni; He, Shunping


    Interferon regulatory factors (IRFs) were first discovered as transcription factors that regulate the transcription of human interferon (IFN)-β. Increasing evidence shows that they might be important players involved in Adaptive immune system (AIS) evolution. Although numbers of IRFs have been identified in chordates, the evolutionary history and functional diversity of this gene family during the early evolution of vertebrates have remained obscure. Using IRF HMM profile and HMMER searches, we identified 148 IRFs in 11 vertebrates and 4 protochordates. For them, we reconstructed the phylogenetic relationships, determined the synteny conservation, investigated the profile of natural selection, and analyzed the expression patterns in four "living fossil" vertebrates: lamprey, elephant shark, coelacanth and bichir. The results from phylogeny and synteny analysis imply that vertebrate IRFs evolved from three predecessors, instead of four as suggested in a previous study, as results from an ancient duplication followed by special expansions and lost during the vertebrate evolution. The profile of natural selection and expression reveals functional dynamics during the process. Together, they suggest that the 2nd whole-genome duplication (2WGD) provided raw materials for innovation in the IRF family, and that the birth of type-I IFN might be an important factor inducing the establishment of IRF-mediated immune networks. As a member involved in the AIS evolution, IRF provide insights into the process and mechanism involved in the complexity and novelties of vertebrate immune systems. Copyright © 2017 The Authors. Published by Elsevier Ltd.. All rights reserved.

  2. Mega-phylogeny approach for comparative biology: an alternative to supertree and supermatrix approaches

    Directory of Open Access Journals (Sweden)

    Beaulieu Jeremy M


    required many more genes. These demonstrations underscore the importance of using large phylogenies to uncover important evolutionary patterns and we present a fast and simple method for constructing these phylogenies.

  3. Mega-phylogeny approach for comparative biology: an alternative to supertree and supermatrix approaches. (United States)

    Smith, Stephen A; Beaulieu, Jeremy M; Donoghue, Michael J


    Biology has increasingly recognized the necessity to build and utilize larger phylogenies to address broad evolutionary questions. Large phylogenies have facilitated the discovery of differential rates of molecular evolution between trees and herbs. They have helped us understand the diversification patterns of mammals as well as the patterns of seed evolution. In addition to these broad evolutionary questions there is increasing awareness of the importance of large phylogenies for addressing conservation issues such as biodiversity hotspots and response to global change. Two major classes of methods have been employed to accomplish the large tree-building task: supertrees and supermatrices. Although these methods are continually being developed, they have yet to be made fully accessible to comparative biologists making extremely large trees rare. Here we describe and demonstrate a modified supermatrix method termed mega-phylogeny that uses databased sequences as well as taxonomic hierarchies to make extremely large trees with denser matrices than supermatrices. The two major challenges facing large-scale supermatrix phylogenetics are assembling large data matrices from databases and reconstructing trees from those datasets. The mega-phylogeny approach addresses the former as the latter is accomplished by employing recently developed methods that have greatly reduced the run time of large phylogeny construction. We present an algorithm that requires relatively little human intervention. The implemented algorithm is demonstrated with a dataset and phylogeny for Asterales (within Campanulidae) containing 4954 species and 12,033 sites and an rbcL matrix for green plants (Viridiplantae) with 13,533 species and 1,401 sites. By examining much larger phylogenies, patterns emerge that were otherwise unseen. The phylogeny of Viridiplantae successfully reconstructs major relationships of vascular plants that previously required many more genes. These demonstrations

  4. Intragenic duplication: a novel mutational mechanism in hereditary pancreatitis

    DEFF Research Database (Denmark)

    Joergensen, Maiken T; Geisz, Andrea; Brusgaard, Klaus


    In a hereditary pancreatitis family from Denmark, we identified a novel intragenic duplication of 9 nucleotides in exon-2 of the human cationic trypsinogen (PRSS1) gene (c.63_71dup) which at the amino-acid level resulted in the insertion of 3 amino acids within the activation peptide of cationic...

  5. The hidden duplication past of the plant pathogen Phytophthora and its consequences for infection

    Directory of Open Access Journals (Sweden)

    Martens Cindy


    Full Text Available Abstract Background Oomycetes of the genus Phytophthora are pathogens that infect a wide range of plant species. For dicot hosts such as tomato, potato and soybean, Phytophthora is even the most important pathogen. Previous analyses of Phytophthora genomes uncovered many genes, large gene families and large genome sizes that can partially be explained by significant repeat expansion patterns. Results Analysis of the complete genomes of three different Phytophthora species, using a newly developed approach, unveiled a large number of small duplicated blocks, mainly consisting of two or three consecutive genes. Further analysis of these duplicated genes and comparison with the known gene and genome duplication history of ten other eukaryotes including parasites, algae, plants, fungi, vertebrates and invertebrates, suggests that the ancestor of P. infestans, P. sojae and P. ramorum most likely underwent a whole genome duplication (WGD. Genes that have survived in duplicate are mainly genes that are known to be preferentially retained following WGDs, but also genes important for pathogenicity and infection of the different hosts seem to have been retained in excess. As a result, the WGD might have contributed to the evolutionary and pathogenic success of Phytophthora. Conclusions The fact that we find many small blocks of duplicated genes indicates that the genomes of Phytophthora species have been heavily rearranged following the WGD. Most likely, the high repeat content in these genomes have played an important role in this rearrangement process. As a consequence, the paucity of retained larger duplicated blocks has greatly complicated previous attempts to detect remnants of a large-scale duplication event in Phytophthora. However, as we show here, our newly developed strategy to identify very small duplicated blocks might be a useful approach to uncover ancient polyploidy events, in particular for heavily rearranged genomes.

  6. Radiological findings of male urethral duplication associated with bladder duplication: case report

    International Nuclear Information System (INIS)

    Kim, Hyoung Jung; Lim, Joo Won; Lee, Dong Ho; Ko, Young Tae


    Urethral duplication or accessory urethra is a rare congenital anomaly. Even rarer, is its association with bladder duplication. We report a case of urethral duplication associated with bladder duplication in a seven-year-old boy who underwent retrograde urethrography, sonography and magnetic resonance (MR) imaging. WhiIe retrograde urethrography can demonstrate the extent of the duplicated urethra, MR imaging and sonography can provide detailed information on the anatomy of the adjacent tissues as well as urethral duplication

  7. Evaluation of contrast in duplicated radiographs

    International Nuclear Information System (INIS)

    Thunthy, K.H.; Weinberg, R.


    This investigation evaluated changes in the contrast of duplicated radiographs made at different ultraviolet light exposures. Increasing ultraviolet light exposure had different effects on the duplicates of originals of different background densities. When correctly exposed, a duplicate radiograph enhanced contrast. When originals had the same contrast but different background densities, their duplicates did not have the same contrast. It was not possible to duplicate accurately all the different contrasts measured on an original. It was possible, however, to produce duplicates with all contrasts greater than those of the original

  8. Targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. (United States)

    Takahashi, Tadashi; Sato, Atsushi; Ogawa, Masahiro; Hanya, Yoshiki; Oguma, Tetsuya


    We describe here the first successful construction of a targeted tandem duplication of a large chromosomal segment in Aspergillus oryzae. The targeted tandem chromosomal duplication was achieved by using strains that had a 5'-deleted pyrG upstream of the region targeted for tandem chromosomal duplication and a 3'-deleted pyrG downstream of the target region. Consequently,strains bearing a 210-kb targeted tandem chromosomal duplication near the centromeric region of chromosome 8 and strains bearing a targeted tandem chromosomal duplication of a 700-kb region of chromosome 2 were successfully constructed. The strains bearing the tandem chromosomal duplication were efficiently obtained from the regenerated protoplast of the parental strains. However, the generation of the chromosomal duplication did not depend on the introduction of double-stranded breaks(DSBs) by I-SceI. The chromosomal duplications of these strains were stably maintained after five generations of culture under nonselective conditions. The strains bearing the tandem chromosomal duplication in the 700-kb region of chromosome 2 showed highly increased protease activity in solid-state culture, indicating that the duplication of large chromosomal segments could be a useful new breeding technology and gene analysis method.

  9. Sequence diversity in the Dickeya fliC gene: phylogeny of the Dickeya genus and TaqMan® PCR for 'D. solani', new biovar 3 variant on potato in Europe. (United States)

    Van Vaerenbergh, Johan; Baeyen, Steve; De Vos, Paul; Maes, Martine


    Worldwide, Dickeya (formerly Erwinia chrysanthemi) is causing soft rot diseases on a large diversity of crops and ornamental plants. Strains affecting potato are mainly found in D. dadantii, D. dianthicola and D. zeae, which appear to have a marked geographical distribution. Furthermore, a few Dickeya isolates from potato are attributed to D. chrysanthemi and D. dieffenbachiae. In Europe, isolates of Erwinia chrysanthemi biovar 1 and biovar 7 from potato are now classified in D. dianthicola. However, in the past few years, a new Dickeya biovar 3 variant, tentatively named 'Dickeya solani', has emerged as a common major threat, in particular in seed potatoes. Sequences of a fliC gene fragment were used to generate a phylogeny of Dickeya reference strains from culture collections and with this reference backbone, to classify pectinolytic isolates, i.e. Dickeya spp. from potato and ornamental plants. The reference strains of the currently recognized Dickeya species and 'D. solani' were unambiguously delineated in the fliC phylogram. D. dadantii, D. dianthicola and 'D. solani' displayed unbranched clades, while D. chrysanthemi, D. zeae and D. dieffenbachiae branched into subclades and lineages. Moreover, Dickeya isolates from diagnostic samples, in particular biovar 3 isolates from greenhouse ornamentals, formed several new lineages. Most of these isolates were positioned between the clade of 'D. solani' and D. dadantii as transition variants. New lineages also appeared in D. dieffenbachiae and in D. zeae. The strains and isolates of D. dianthicola and 'D. solani' were differentiated by a fliC sequence useful for barcode identification. A fliC TaqMan®real-time PCR was developed for 'D. solani' and the assay was provisionally evaluated in direct analysis of diagnostic potato samples. This molecular tool can support the efforts to control this particular phytopathogen in seed potato certification.

  10. Sequence diversity in the Dickeya fliC gene: phylogeny of the Dickeya genus and TaqMan® PCR for 'D. solani', new biovar 3 variant on potato in Europe.

    Directory of Open Access Journals (Sweden)

    Johan Van Vaerenbergh

    Full Text Available Worldwide, Dickeya (formerly Erwinia chrysanthemi is causing soft rot diseases on a large diversity of crops and ornamental plants. Strains affecting potato are mainly found in D. dadantii, D. dianthicola and D. zeae, which appear to have a marked geographical distribution. Furthermore, a few Dickeya isolates from potato are attributed to D. chrysanthemi and D. dieffenbachiae. In Europe, isolates of Erwinia chrysanthemi biovar 1 and biovar 7 from potato are now classified in D. dianthicola. However, in the past few years, a new Dickeya biovar 3 variant, tentatively named 'Dickeya solani', has emerged as a common major threat, in particular in seed potatoes. Sequences of a fliC gene fragment were used to generate a phylogeny of Dickeya reference strains from culture collections and with this reference backbone, to classify pectinolytic isolates, i.e. Dickeya spp. from potato and ornamental plants. The reference strains of the currently recognized Dickeya species and 'D. solani' were unambiguously delineated in the fliC phylogram. D. dadantii, D. dianthicola and 'D. solani' displayed unbranched clades, while D. chrysanthemi, D. zeae and D. dieffenbachiae branched into subclades and lineages. Moreover, Dickeya isolates from diagnostic samples, in particular biovar 3 isolates from greenhouse ornamentals, formed several new lineages. Most of these isolates were positioned between the clade of 'D. solani' and D. dadantii as transition variants. New lineages also appeared in D. dieffenbachiae and in D. zeae. The strains and isolates of D. dianthicola and 'D. solani' were differentiated by a fliC sequence useful for barcode identification. A fliC TaqMan®real-time PCR was developed for 'D. solani' and the assay was provisionally evaluated in direct analysis of diagnostic potato samples. This molecular tool can support the efforts to control this particular phytopathogen in seed potato certification.

  11. Facial duplication: case, review, and embryogenesis. (United States)

    Barr, M


    The craniofacial anatomy of an infant with facial duplication is described. There were four eyes, two noses, two maxillae, and one mandible. Anterior to the single pituitary the brain was duplicated and there was bilateral arhinencephaly. Portions of the brain were extruded into a large frontal encephalocele. Cases of symmetrical facial duplication reported in the literature range from two complete faces on a single head (diprosopus) to simple nasal duplication. The variety of patterns of duplication suggests that the doubling of facial components arises in several different ways: Forking of the notochord, duplication of the prosencephalon, duplication of the olfactory placodes, and duplication of maxillary and/or mandibular growth centers around the margins of the stomatodeal plate. Among reported cases, the female:male ratio is 2:1.

  12. Phylogeny and evolutionary history of Leymus (Triticeae; Poaceae based on a single-copy nuclear gene encoding plastid acetyl-CoA carboxylase

    Directory of Open Access Journals (Sweden)

    Ding Cun-Bang


    Full Text Available Abstract Background Single- and low- copy genes are less likely subject to concerted evolution, thus making themselves ideal tools for studying the origin and evolution of polyploid taxa. Leymus is a polyploid genus with a diverse array of morphology, ecology and distribution in Triticeae. The genomic constitution of Leymus was assigned as NsXm, where Ns was presumed to be originated from Psathyrostachys, while Xm represented a genome of unknown origin. In addition, little is known about the evolutionary history of Leymus. Here, we investigate the phylogenetic relationship, genome donor, and evolutionary history of Leymus based on a single-copy nuclear Acc1 gene. Results Two homoeologues of the Acc1 gene were isolated from nearly all the sampled Leymus species using allele-specific primer and were analyzed with those from 35 diploid taxa representing 18 basic genomes in Triticeae. Sequence diversity patterns and genealogical analysis suggested that (1 Leymus is closely related to Psathyrostachys, Agropyron, and Eremopyrum; (2 Psathyrostachys juncea is an ancestral Ns-genome donor of Leymus species; (3 the Xm genome in Leymus may be originated from an ancestral lineage of Agropyron and Eremopyrum triticeum; (4 the Acc1 sequences of Leymus species from the Qinghai-Tibetan plateau are evolutionarily distinct; (5 North America Leymus species might originate from colonization via the Bering land bridge; (6 Leymus originated about 11-12MYA in Eurasia, and adaptive radiation might have occurred in Leymus during the period of 3.7-4.3 MYA and 1.7-2.1 MYA. Conclusion Leymus species have allopolyploid origin. It is hypothesized that the adaptive radiation of Leymus species might have been triggered by the recent upliftings of the Qinghai-Tibetan plateau and subsequent climatic oscillations. Adaptive radiation may have promoted the rapid speciation, as well as the fixation of unique morphological characters in Leymus. Our results shed new light on our

  13. Driving south: a multi-gene phylogeny of the brown algal family Fucaceae reveals relationships and recent drivers of a marine radiation

    Directory of Open Access Journals (Sweden)

    Cánovas Fernando G


    Full Text Available Abstract Background Understanding the processes driving speciation in marine ecosystems remained a challenge until recently, due to the unclear nature of dispersal boundaries. However, recent evidence for marine adaptive radiations and ecological speciation, as well as previously undetected patterns of cryptic speciation is overturning this view. Here, we use multi-gene phylogenetics to infer the family-level evolutionary history of Fucaceae (intertidal brown algae of the northern Pacific and Atlantic in order to investigate recent and unique patterns of radiative speciation in the genus Fucus in the Atlantic, in contrast with the mainly monospecific extant genera. Results We developed a set of markers from 13 protein coding genes based on polymorphic cDNA from EST libraries, which provided novel resolution allowing estimation of ancestral character states and a detailed reconstruction of the recent radiative history. Phylogenetic reconstructions yielded similar topologies and revealed four independent trans-Arctic colonization events by Fucaceae lineages, two of which also involved transitions from hermaphroditism to dioecy associated with Atlantic invasions. More recently, reversion of dioecious ancestral lineages towards hermaphroditism has occurred in the genus Fucus, particularly coinciding with colonization of more extreme habitats. Novel lineages in the genus Fucus were also revealed in association with southern habitats. These most recent speciation events occurred during the Pleistocene glaciations and coincided with a shift towards selfing mating systems, generally southward shifts in distribution, and invasion of novel habitats. Conclusions Diversification of the family occurred in the Late-Mid Miocene, with at least four independent trans-Artic lineage crossings coincident with two reproductive mode transitions. The genus Fucus arose in the Pliocene but radiated within a relatively short time frame about 2.5 million years ago

  14. Biliary tract duplication cyst with gastric heterotopia

    Energy Technology Data Exchange (ETDEWEB)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.


    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst.

  15. Biliary tract duplication cyst with gastric heterotopia

    International Nuclear Information System (INIS)

    Grumbach, K.; Baker, D.H.; Weigert, J.; Altman, R.P.


    Cystic duplications of the biliary tract are rare anomalies, easily mistaken for choledochal cysts. Surgical drainage is the preferred therapy for choledochal cyst, but cystic duplication necessitates surgical excision as duplications may contain heterotopic gastric mucosa leading to peptic ulceration of the biliary tract. We report a case of biliary tract duplication cyst containing heterotopic alimentary mucosa which had initially been diagnosed and surgically treated as a choledochal cyst. (orig.)

  16. Preliminary experiments of electronic duplication

    International Nuclear Information System (INIS)

    Fay, Bernard


    Systems of electron sputtering (at the unit scale) use as master mask a photocathode with localized emitting zones. Emitted electrons are accelerated and focussed on a silicon substrate covered with an electrosensitive resin. The very high definition associated with electron masking is obtained whatever the complexity of the master mask is, for a printing duration of the order of the minute. This is a duplication method without any contact that prevents the master mask from any mechanical erosion. Alignment of the successive masks is obtained from an electric signal directly usable through an automatic alignment system. Experiments using the apparatus for reproducing masks through an electronic image or ''electronic duplicator'' developed in Thomson-CSF Laboratory at Corbeville, are presented [fr

  17. Noncommunicating Isolated Enteric Duplication Cyst in the ...

    African Journals Online (AJOL)

    Noncommunicating isolated enteric duplications in the abdomen are an extremely rare variant of enteric duplications with their own blood supply. We report a case of a noncommunicating isolated ileal duplication in a 10-month-old boy. He was admitted because of severe abdominal distension and developed irritability ...

  18. Host shifts enhance diversification of ectomycorrhizal fungi: diversification rate analysis of the ectomycorrhizal fungal genera Strobilomyces and Afroboletus with an 80-gene phylogeny. (United States)

    Sato, Hirotoshi; Tanabe, Akifumi S; Toju, Hirokazu


    Mutualisms with new host lineages can provide symbionts with novel ecological opportunities to expand their geographical distribution, thereby leading to evolutionary diversification. Because ectomycorrhizal (ECM) fungi provide ideal opportunities to test the relationship between host shifts and diversification, we tested whether mutualism with new host lineages could increase the diversification rates of ECM fungi. Using a Bayesian tree inferred from 23 027-base nucleotide sequences of 80 single-copy genes, we tested whether the diversification rate had changed through host-shift events in the monophyletic clade containing the ECM fungal genera Strobilomyces and Afroboletus. The results indicated that these fungi were initially associated with Caesalpinioideae/Monotoideae in Africa, acquired associations with Dipterocarpoideae in tropical Asia, and then switched to Fagaceae/Pinaceae and Nothofagaceae/Eucalyptus. Fungal lineages associated with Fagaceae/Pinaceae were inferred to have approximately four-fold and two-fold greater diversification rates than those associated with Caesalpinioideae/Monotoideae and Dipterocarpoideae or Nothofagaceae/Eucalyptus, respectively. Moreover, the diversification rate shift was inferred to follow the host shift to Fagaceae/Pinaceae. Our study suggests that host-shift events, particularly those occurring with respect to Fagaceae/Pinaceae, can provide ecological opportunities for the rapid diversification of Strobilomyces-Afroboletus. Although further studies are needed for generalization, we propose a possible diversification scenario of ECM fungi. © 2016 The Authors. New Phytologist © 2016 New Phytologist Trust.

  19. Effects of methodology and analysis strategy on robustness of pestivirus phylogeny. (United States)

    Liu, Lihong; Xia, Hongyan; Baule, Claudia; Belák, Sándor; Wahlberg, Niklas


    Phylogenetic analysis of pestiviruses is a useful tool for classifying novel pestiviruses and for revealing their phylogenetic relationships. In