WorldWideScience

Sample records for genes characterized asia

  1. The Asia 2 specific signal peptide region and other domains in fusion protein genes characterized Asia 1 and Asia 2 canine distemper viruses

    Science.gov (United States)

    Sultan, Serageldeen; Charoenvisal, Nataya; Lan, Nguyen Thi; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige

    2009-01-01

    Background Although the presence of Asia 2 group of canine distemper virus (CDV) was known by the sequencing and phylogenetic analysis of hemagglutinin (H) gene, the fusion (F) protein gene sequence of Asia 2 group had not been identified. So, the sequence analysis of F gene was carried out to elucidate the genotypic varaitons among Asian isolates. Results The phylogenetic analysis of F and H gene sequences from fourteen CDV isolates obtained from diseased dogs in Japan and Thailand indicated that the F genes had a new initiation codon and extra 27 nucleotides upstream of the usual open reading frame (ORF) and the F proteins had extra 9 amino acids at the N-terminal position only in Asia 2 isolates. On the contrary, the Asia 1 isolates had three extra putative N-glycosylation sites (two sites in the signal peptide region and one site in the F1 region) except for two strains of Th12 and Ac96I (two sites in signal peptide region) adding to four putative N-glycosylation sites that were conserved among all Asian isolates and Onderstepoort strain. In addition to this difference in N-glycosylation sites, the signal peptide region had a great diversity between Asia 1 and Asia 2 isolates. Also, characteristic amino acids were detected for some strains. Conclusion Asia 2 isolates were distinguished from other CDV lineages by the extra 27 nucleotide sequence. The signal peptide region of F gene gives a remarkable differentiation between Asia 1 and Asia 2 isolates. Strains Th12 and Ac96I were differentiated from other Asia 1 strains by the F protein glycosylation sites. PMID:19807927

  2. Quantification and characterization of β-lactam resistance genes in 15 sewage treatment plants from East Asia and North America.

    Science.gov (United States)

    Yang, Ying; Zhang, Tong; Zhang, Xu-Xiang; Liang, Da-Wei; Zhang, Ming; Gao, Da-Wen; Zhu, He-Guang; Huang, Qing-Guo; Fang, Herbert H P

    2012-09-01

    The emerging antibiotic resistance genes in the aquatic environment have aroused public concern. As β-lactam is the most widely used group of antibiotics, β-lactam resistance genes were selected to investigate their distribution and diversity in the activated sludge from 15 geographically different sewage treatment plants (STPs) of China, Singapore, USA, and Canada. Specific PCR and quantitative real-time PCR (q-PCR) were used to investigate the occurrence and abundance of nine β-lactam resistance genes. Five genes (OXA-1, OXA-2, OXA-10, ampC, and TEM-1) were detected in most of the sludge collected, while three genes (mecA, CTX-M-1, and SME) were not found in any sludge sample. The total abundances of the six detected β-lactam resistance genes in the 15 STPs varied from 5.34 × 10(1) copies/ng DNA (ampC) to 5.49 × 10(4) copies/ng DNA (OXA-1). Overall, OXA-1 had the highest total concentration, followed by IMP and OXA-10. Noticeably, the abundances of TEM-1 in Chinese STPs were generally higher than those in the STPs of other countries, while the abundances of OXA-2 and IMP in the STPs of North America were much greater than those of East Asia. A total of 78 clones carrying β-lactam resistance genes were randomly selected from six clone libraries for phylogenetic diversity analysis; the similarity of these cloned genes to known β-lactam resistance genes with sequence identities ranged from 96% to 100%. Furthermore, OXA-1, ampC, and IMP were found to be more diverse than the other β-lactam resistance genes.

  3. Asia

    OpenAIRE

    Lindsay, Richard

    2014-01-01

    This document explores some of the examples of peatland restoration under different circumstances around the World in order to present an overview of the variety of benefits and inspiring ways in which peatland restoration can be delivered, and so avoid serious and costly consequences for society. Richard Lindsay wrote the Asia and Americas sections of this edited publication.

  4. Evolutionary Analysis of Structural Protein Gene VP1 of Foot-and-Mouth Disease Virus Serotype Asia 1

    Science.gov (United States)

    Zhang, Qingxun; Liu, Xinsheng; Fang, Yuzhen; Pan, Li; Lv, Jianliang; Zhang, Zhongwang; Zhou, Peng; Ding, Yaozhong; Chen, Haotai; Shao, Junjun; Zhao, Furong; Lin, Tong; Chang, Huiyun; Zhang, Jie; Wang, Yonglu; Zhang, Yongguang

    2015-01-01

    Foot-and-mouth disease virus (FMDV) serotype Asia 1 was mostly endemic in Asia and then was responsible for economically important viral disease of cloven-hoofed animals, but the study on its selection and evolutionary process is comparatively rare. In this study, we characterized 377 isolates from Asia collected up until 2012, including four vaccine strains. Maximum likelihood analysis suggested that the strains circulating in Asia were classified into 8 different groups (groups I–VIII) or were unclassified (viruses collected before 2000). On the basis of divergence time analyses, we infer that the TMRCA of Asia 1 virus existed approximately 86.29 years ago. The result suggested that the virus had a high mutation rate (5.745 × 10−3 substitutions/site/year) in comparison to the other serotypes of FMDV VP1 gene. Furthermore, the structural protein VP1 was under lower selection pressure and the positive selection occurred at many sites, and four codons (positions 141, 146, 151, and 169) were located in known critical antigenic residues. The remaining sites were not located in known functional regions and were moderately conserved, and the reason for supporting all sites under positive selection remains to be elucidated because the power of these analyses was largely unknown. PMID:25793223

  5. COGNATE: comparative gene annotation characterizer.

    Science.gov (United States)

    Wilbrandt, Jeanne; Misof, Bernhard; Niehuis, Oliver

    2017-07-17

    The comparison of gene and genome structures across species has the potential to reveal major trends of genome evolution. However, such a comparative approach is currently hampered by a lack of standardization (e.g., Elliott TA, Gregory TR, Philos Trans Royal Soc B: Biol Sci 370:20140331, 2015). For example, testing the hypothesis that the total amount of coding sequences is a reliable measure of potential proteome diversity (Wang M, Kurland CG, Caetano-Anollés G, PNAS 108:11954, 2011) requires the application of standardized definitions of coding sequence and genes to create both comparable and comprehensive data sets and corresponding summary statistics. However, such standard definitions either do not exist or are not consistently applied. These circumstances call for a standard at the descriptive level using a minimum of parameters as well as an undeviating use of standardized terms, and for software that infers the required data under these strict definitions. The acquisition of a comprehensive, descriptive, and standardized set of parameters and summary statistics for genome publications and further analyses can thus greatly benefit from the availability of an easy to use standard tool. We developed a new open-source command-line tool, COGNATE (Comparative Gene Annotation Characterizer), which uses a given genome assembly and its annotation of protein-coding genes for a detailed description of the respective gene and genome structure parameters. Additionally, we revised the standard definitions of gene and genome structures and provide the definitions used by COGNATE as a working draft suggestion for further reference. Complete parameter lists and summary statistics are inferred using this set of definitions to allow down-stream analyses and to provide an overview of the genome and gene repertoire characteristics. COGNATE is written in Perl and freely available at the ZFMK homepage ( https://www.zfmk.de/en/COGNATE ) and on github ( https

  6. Unusual conservation of mitochondrial gene order in Crassostrea oysters: evidence for recent speciation in Asia

    Science.gov (United States)

    2010-01-01

    Background Oysters are morphologically plastic and hence difficult subjects for taxonomic and evolutionary studies. It is long been suspected, based on the extraordinary species diversity observed, that Asia Pacific is the epicenter of oyster speciation. To understand the species diversity and its evolutionary history, we collected five Crassostrea species from Asia and sequenced their complete mitochondrial (mt) genomes in addition to two newly released Asian oysters (C. iredalei and Saccostrea mordax) for a comprehensive analysis. Results The six Asian Crassostrea mt genomes ranged from 18,226 to 22,446 bp in size, and all coded for 39 genes (12 proteins, 2 rRNAs and 25 tRNAs) on the same strand. Their genomes contained a split of the rrnL gene and duplication of trnM, trnK and trnQ genes. They shared the same gene order that differed from an Atlantic sister species by as many as nine tRNA changes (6 transpositions and 3 duplications) and even differed significantly from S. mordax in protein-coding genes. Phylogenetic analysis indicates that the six Asian Crassostrea species emerged between 3 and 43 Myr ago, while the Atlantic species evolved 83 Myr ago. Conclusions The complete conservation of gene order in the six Asian Crassostrea species over 43 Myr is highly unusual given the remarkable rate of rearrangements in their sister species and other bivalves. It provides strong evidence for the recent speciation of the six Crassostrea species in Asia. It further indicates that changes in mt gene order may not be strictly a function of time but subject to other constraints that are presently not well understood. PMID:21189147

  7. The promise of discovering population-specific disease-associated genes in South Asia.

    Science.gov (United States)

    Nakatsuka, Nathan; Moorjani, Priya; Rai, Niraj; Sarkar, Biswanath; Tandon, Arti; Patterson, Nick; Bhavani, Gandham SriLakshmi; Girisha, Katta Mohan; Mustak, Mohammed S; Srinivasan, Sudha; Kaushik, Amit; Vahab, Saadi Abdul; Jagadeesh, Sujatha M; Satyamoorthy, Kapaettu; Singh, Lalji; Reich, David; Thangaraj, Kumarasamy

    2017-09-01

    The more than 1.5 billion people who live in South Asia are correctly viewed not as a single large population but as many small endogamous groups. We assembled genome-wide data from over 2,800 individuals from over 260 distinct South Asian groups. We identified 81 unique groups, 14 of which had estimated census sizes of more than 1 million, that descend from founder events more extreme than those in Ashkenazi Jews and Finns, both of which have high rates of recessive disease due to founder events. We identified multiple examples of recessive diseases in South Asia that are the result of such founder events. This study highlights an underappreciated opportunity for decreasing disease burden among South Asians through discovery of and testing for recessive disease-associated genes.

  8. Characterization of Isolates of Salmonella enterica Serovar Stanley, a Serovar Endemic to Asia and Associated with Travel

    Science.gov (United States)

    Le Hello, Simon; Bortolaia, Valeria; Pulsrikarn, Chaiwat; Nielsen, Eva Møller; Pornruangmong, Srirat; Chaichana, Phattharaporn; Svendsen, Christina Aaby; Weill, François-Xavier; Aarestrup, Frank M.

    2012-01-01

    Salmonella enterica serovar Stanley (S. Stanley) is a common serovar in Southeast Asia and was the second most common serovar implicated in human salmonellosis in Thailand in the years 2002 to 2007. In contrast, this serovar is relatively uncommon in Europe. The objective of this study was to characterize a collection of S. Stanley strains isolated from Thai (n = 62), Danish (n = 39), and French (n = 24) patients to gain a broader understanding of the genetic diversity, population dynamics, and susceptibility to antimicrobials. All isolates were characterized by pulsed-field gel electrophoresis and antimicrobial susceptibility testing. The molecular mechanisms of resistance to extended-spectrum cephalosporins and plasmid-mediated resistance to quinolones were characterized by PCR and sequencing. Plasmid profiling, replicon typing, and microarray analysis were used to characterize the genetic mechanisms of antimicrobial resistance in 10 extended-spectrum cephalosporinase-producing isolates. Considerable genetic diversity was observed among the isolates characterized with 91 unique XbaI pulsed-field gel electrophoresis (PFGE) patterns, including 17 distinct clusters consisting of two to seven indistinguishable isolates. We found some of the S. Stanley isolates isolated from patients in Europe were acquired during travel to Southeast Asia, including Thailand. The presence of multiple plasmid lineages carrying the extended-spectrum cephalosporinase-encoding blaCMY-2 gene in S. Stanley isolates from the central part of Thailand was confirmed. Our results emphasize that Thai authorities, as well as authorities in other countries lacking prudent use of antimicrobials, should improve the ongoing efforts to regulate antimicrobial use in agriculture and in clinical settings to limit the spread of multidrug-resistant Salmonella isolates and plasmids among humans and pigs in Thailand and abroad. PMID:22205822

  9. Epidemiology and molecular characterization of multidrug-resistant Gram-negative bacteria in Southeast Asia

    Directory of Open Access Journals (Sweden)

    Nuntra Suwantarat

    2016-05-01

    Full Text Available Abstract Background Multidrug-resistant Gram-negative bacteria (MDRGN, including extended-spectrum β-lactamases (ESBLs and multidrug-resistant glucose-nonfermenting Gram-negative bacilli (nonfermenters, have emerged and spread throughout Southeast Asia. Methods We reviewed and summarized current critical knowledge on the epidemiology and molecular characterization of MDRGN in Southeast Asia by PubMed searches for publications prior to 10 March 2016 with the term related to “MDRGN definition” combined with specific Southeast Asian country names (Thailand, Singapore, Malaysia, Vietnam, Indonesia, Philippines, Laos, Cambodia, Myanmar, Brunei. Results There were a total of 175 publications from the following countries: Thailand (77, Singapore (35, Malaysia (32, Vietnam (23, Indonesia (6, Philippines (1, Laos (1, and Brunei (1. We did not find any publications on MDRGN from Myanmar and Cambodia. We did not include publications related to Shigella spp., Salmonella spp., and Vibrio spp. and non-human related studies in our review. English language articles and abstracts were included for analysis. After the abstracts were reviewed, data on MDRGN in Southeast Asia from 54 publications were further reviewed and included in this study. Conclusions MDRGNs are a major contributor of antimicrobial-resistant bacteria in Southeast Asia. The high prevalence of ESBLs has been a major problem since 2005 and is possibly related to the development of carbapenem resistant organisms in this region due to the overuse of carbapenem therapy. Carbapenem–resistant Acinetobacter baumannii is the most common pathogen associated with nosocomial infections in this region followed by carbapenem-resistant Pseudomonas aeruginosa. Although Southeast Asia is not an endemic area for carbapenem-resistant Enterobacteriaceae (CRE, recently, the rate of CRE detection has been increasing. Limited infection control measures, lack of antimicrobial control, such as the presence of

  10. Characterization of Dust Properties at the Source Region During ACE-Asia

    Science.gov (United States)

    Tsay, Si-Chee; Lau, William (Technical Monitor)

    2001-01-01

    ACE (Aerosol Characterization Experiment)-Asia is designed to study the compelling variability in spatial and temporal scale of both pollution-derived and naturally-occurring aerosols, which often exist in high concentrations over eastern Asia and along the rim of the western Pacific. The phase-I of ACE-Asia was conducted from March-May 2001 in the vicinity of the Gobi desert, east coast of China, Yellow Sea, Korea, and Japan, along the pathway of Kosa (severe events that blanket East Asia with yellow desert dust, peaked in the Spring season). Asian dust typically originates in desert areas far from polluted urban regions. During transport, dust layers can interact with anthropogenic sulfate and soot aerosols from heavily polluted urban areas. Added to the complex effects of clouds and natural marine aerosols, dust particles reaching the marine environment can have drastically different properties than those from the source. Thus, understanding the unique temporal and spatial variations of Asian dust is of special importance in regional-to-global climate issues such as radiative forcing, the hydrological cycle, and primary biological productivity in the mid-Pacific Ocean. During ACE-Asia we have measured continuously aerosol optical/radiative properties, column precipitable water amount, and surface reflectivity over homogeneous areas from surface. The inclusion of flux measurements permits the determination of dust aerosol radiative flux in addition to measurements of loading and optical thickness. At the time of the Terra/MODIS overpass, these ground-based observations can provide valuable data to compare with MODIS retrievals over land. Preliminary results will be presented and discussed their implications in regional climatic effects.

  11. Characterization of Dust Properties during ACE-Asia and PRIDE: A Column Satellite-Surface Perspective

    Science.gov (United States)

    Lau, William K. M. (Technical Monitor); Tsay, Si-Chee; Hsu, N. Christina; Herman, Jay R.; Ji, Q. Jack

    2002-01-01

    Many recent field experiments are designed to study the compelling variability in spatial and temporal scale of both pollution-derived and naturally occurring aerosols, which often exist in high concentration over particular pathways around the globe. For example, the ACE-Asia (Aerosol Characterization Experiment-Asia) was conducted from March-May 2001 in the vicinity of the Taklimakan and Gobi deserts, East Coast of China, Yellow Sea, Korea, and Japan, along the pathway of Kosa (severe events that blanket East Asia with yellow desert dust, peaked in the Spring season). The PRIDE (Puerto RIco Dust Experiment, July 2000) was designed to measure the properties of Saharan dust transported across the Atlantic Ocean to the Caribbean. Dust particles typically originate in desert areas far from polluted urban regions. During transport, dust layers can interact with anthropogenic sulfate and soot aerosols from heavily polluted urban areas. Added to the complex effects of clouds and natural marine aerosols, dust particles reaching the marine environment can have drastically different properties than those from the source. Thus, understanding the unique temporal and spatial variations of dust aerosols is of special importance in regional-to-global climate issues such as radiative forcing, the hydrological cycle, and primary biological productivity in the ocean. During ACE-Asia and PRIDE we had measured aerosol physical/optical/radiative properties, column precipitable water amount, and surface reflectivity over homogeneous areas from ground-based remote sensing. The inclusion of flux measurements permits the determination of aerosol radiative flux in addition to measurements of loading and optical depth. At the time of the Terra/MODIS, SeaWiFS, TOMS and other satellite overpasses, these ground-based observations can provide valuable data to compare with satellite retrievals over land. We will present the results and discuss their implications in regional climatic effects.

  12. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae)

    OpenAIRE

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-01-01

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...

  13. Integrated spatiotemporal characterization of dust sources and outbreaks in Central and East Asia

    Science.gov (United States)

    Darmenova, Kremena T.

    The potential of atmospheric dust aerosols to modify the Earth's environment and climate has been recognized for some time. However, predicting the diverse impact of dust has several significant challenges. One is to quantify the complex spatial and temporal variability of dust burden in the atmosphere. Another is to quantify the fraction of dust originating from human-made sources. This thesis focuses on the spatiotemporal characterization of sources and dust outbreaks in Central and East Asia by integrating ground-based data, satellite multisensor observations, and modeling. A new regional dust modeling system capable of operating over a span of scales was developed. The modeling system consists of a dust module DuMo, which incorporates several dust emission schemes of different complexity, and the PSU/NCAR mesoscale model MM5, which offers a variety of physical parameterizations and flexible nesting capability. The modeling system was used to perform for the first time a comprehensive study of the timing, duration, and intensity of individual dust events in Central and East Asia. Determining the uncertainties caused by the choice of model physics, especially the boundary layer parameterization, and the dust production scheme was the focus of our study. Implications to assessments of the anthropogenic dust fraction in these regions were also addressed. Focusing on Spring 2001, an analysis of routine surface meteorological observations and satellite multi-sensor data was carried out in conjunction with modeling to determine the extent to which integrated data set can be used to characterize the spatiotemporal distribution of dust plumes at a range of temporal scales, addressing the active dust sources in China and Mongolia, mid-range transport and trans-Pacific, long-range transport of dust outbreaks on a case-by-case basis. This work demonstrates that adequate and consistent characterization of individual dust events is central to establishing a reliable

  14. Characterizing the anthropogenic signature in the LCLU dynamics in the Central Asia region

    Science.gov (United States)

    Tatarskii, V.; Sokolik, I. N.; de Beurs, K.; Shiklomanov, A. I.

    2017-12-01

    Humans have been changing the LCLU dynamics over time through the world. In the Central Asia region, these changes have been especially pronounced due to the political and economic transformation. We present a detailed analysis, focusing on identifying and quantifying the anthropogenic signature in the water and land use across the region. We have characterized the anthropogenic dust emission by combining the modeling and observations. The model is a fully coupled model called WRF-Chem-DuMo that takes explicitly into account the vegetation treatment in modeling the dust emission. We have reconstructed the anthropogenic dust sources in the region, such as the retreat of the Aral Sea, changes in agricultural fields, etc. In addition, we characterize the anthropogenic water use dynamics, including the changes in the water use for the agricultural production. Furthermore, we perform an analysis to identify the anthropogenic signature in the NDVI pattern. The NDVI were analyzed in conjunction with the meteorological fields that were simulated at the high special resolution using the WRF model. Meteorological fields of precipitation and temperature were used for the correlation analysis to separate the natural vs. anthropogenic changes. In this manner, we were able to identify the regions that have been affected by human activities. We will present the quantitative assessment of the anthropogenic changes. The diverse consequences for the economy of the region, as well as, the environment will be addressed.

  15. Sediment dynamics in a large shallow lake characterized by seasonal flood pulse in Southeast Asia.

    Science.gov (United States)

    Siev, Sokly; Yang, Heejun; Sok, Ty; Uk, Sovannara; Song, Layheang; Kodikara, Dilini; Oeurng, Chantha; Hul, Seingheng; Yoshimura, Chihiro

    2018-08-01

    Most of studies on sediment dynamics in stable shallow lakes focused on the resuspension process as it is the dominant process. However, understanding of sediment dynamics in a shallow lake influenced by flood pulse is unclear. We tested a hypothesis that floodplain vegetation plays as a significant role in lessening the intensity of resuspension process in a shallow lake characterized by the flood pulse system. Therefore, this study aimed to investigate sediment dynamics in this type of shallow lake. The target was Tonle Sap Lake (TSL), which is a large shallow lake influenced by a flood pulse system of Mekong River located in Southeast Asia. An extensive and seasonal sampling survey was conducted to measure total suspended solid (TSS) concentrations, sedimentation and resuspension rates in TSL and its 4 floodplain areas. The study revealed that sedimentation process was dominant (TSS ranged: 3-126mgL -1 ) in the high water period (September-December) while resuspension process was dominant (TSS ranged: 4-652mgL -1 ) only in the low water period (March-June). In addition, floodplain vegetation reduced the resuspension of sediment (up to 26.3%) in water. The implication of the study showed that resuspension is a seasonally dominant process in shallow lake influenced by the flood pulse system at least for the case of TSL. Copyright © 2018 Elsevier B.V. All rights reserved.

  16. Human serum amyloid genes--molecular characterization

    International Nuclear Information System (INIS)

    Sack, G.H.; Lease, J.J.

    1986-01-01

    Three clones containing human genes for serum amyloid A protein (SAA) have been isolated and characterized. Each of two clones, GSAA 1 and 2 (of 12.8 and 15.9 kilobases, respectively), contains two exons, accouting for amino acids 12-58 and 58-103 of mature SAA; the extreme 5' termini and 5' untranslated regions have not yet been defined but are anticipated to be close based on studies of murine SAA genes. Initial amino acid sequence comparisons show 78/89 identical residues. At 4 of the 11 discrepant residues, the amino acid specified by the codon is the same as the corresponding residue in murine SAA. Identification of regions containing coding regions has permitted use of selected subclones for blot hybridization studies of larger human SAA chromosomal gene organization. The third clone, GSAA 3 also contains SAA coding information by DNA sequence analysis but has a different organization which has not yet been fully described. We have reported the isolation of clones of human DNA hybridizing with pRS48 - a plasmid containing a complementary DNA (cDNA) clone for murine serum amyloid A (SAA; 1, 2). We now present more detailed data confirming the identity and defining some of the organizational features of these clones

  17. [Construction and characterization of an epitope-mutated Asia 1 type foot-and-mouth disease virus].

    Science.gov (United States)

    Zhang, Yan; Hu, Yonghao; Yang, Fan; Yang, Bo; Wang, Songhao; Zhu, Zixiang; Zheng, Haixue

    2015-01-01

    To generate an epitope-mutated foot-and-mouth disease virus (FMDV) as a marker vaccine, the infectious clone pAsia 1-FMDV containing the complete genomic cDNA of Asia 1 type FMDV was used as backbone, the residues at positions 27 and 31 in the 3D gene were mutated (H27Y and N31R). The resulting plasmid pAsia 1-FMDV-3DM encoding a mutated epitope was transfected into BHK-21 cells and the recombinant virus rAsia 1-3DM was rescued. The recombinant virus showed similar biological characteristics comparable with the parental virus. In serological neutralization test the antisera against recombine virus have a good reactivity with parental virus. The antisera against the mutant virus were shown to be reactive with the mutated epitope but not the wild-type one. The results indicated that the two virus strains could be distinguished by western blotting using synthetic peptides. This epitope-mutated FMDV strain will be evaluated as a potential marker vaccine against FMDV infections.

  18. Aircraft measurements over Europe of an air pollution plume from Southeast Asia ? aerosol and chemical characterization

    OpenAIRE

    Stohl , A.; Forster , C.; Huntrieser , H.; Mannstein , H.; Mcmillan , W. W.; Petzold , A.; Schlager , H.; Weinzierl , B.

    2006-01-01

    An air pollution plume from Southern and Eastern Asia, including regions in India and China, was predicted by the FLEXPART particle dispersion model to arrive in the upper troposphere over Europe on 24–25 March 2006. According to the model, the plume was exported from Southeast Asia only six days earlier, transported into the upper troposphere by a warm conveyor belt, and travelled to Europe in a fast zonal flow. This is confirmed by the retrievals of carbon monoxide (CO) from AIRS sate...

  19. Isolation and characterization of LHY homolog gene expressed in ...

    African Journals Online (AJOL)

    STORAGESEVER

    2008-05-02

    May 2, 2008 ... responsible in negative feedback loop reaction of central oscillator in plant circadian clock system. The level of gene expression was found to be high four hours after dawn in flowering shoots and flower. This paper reported the isolation and characterization of the gene. Key words: LHY gene, circadian ...

  20. Regional fire monitoring and characterization using global NASA MODIS fire products in dry lands of Central Asia

    Science.gov (United States)

    Loboda, Tatiana V.; Giglio, Louis; Boschetti, Luigi; Justice, Christopher O.

    2012-06-01

    Central Asian dry lands are grass- and desert shrub-dominated ecosystems stretching across Northern Eurasia. This region supports a population of more than 100 million which continues to grow at an average rate of 1.5% annually. Dry steppes are the primary grain and cattle growing zone within Central Asia. Degradation of this ecosystem through burning and overgrazing directly impacts economic growth and food supply in the region. Fire is a recurrent disturbance agent in dry lands contributing to soil erosion and air pollution. Here we provide an overview of inter-annual and seasonal fire dynamics in Central Asia obtained from remotely sensed data. We evaluate the accuracy of the Moderate Resolution Imaging Spectroradiometer (MODIS) global fire products within Central Asian dry lands and use these products to characterize fire occurrence between 2001 and 2009. The results show that on average ˜15 million ha of land burns annually across Central Asia with the majority of the area burned in August and September in grasslands. Fire is used as a common crop residue management practice across the region. Nearly 89% of all burning occurs in Kazakhstan, where 5% and 3% of croplands and grasslands, respectively, are burned annually.

  1. Construction of the BAC Library of Small Abalone (Haliotis diversicolor) for Gene Screening and Genome Characterization.

    Science.gov (United States)

    Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng

    2016-02-01

    The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.

  2. Characterizing Aerosols over Southeast Asia using the AERONET Data Synergy Tool

    Science.gov (United States)

    Giles, David M.; Holben, Brent N.; Eck, Thomas F.; Slutsker, Ilya; Slutsker, Ilya; Welton, Ellsworth, J.; Chin, Mian; Kucsera, Thomas; Schmaltz, Jeffery E.; Diehl, Thomas; hide

    2007-01-01

    Biomass burning, urban pollution and dust aerosols have significant impacts on the radiative forcing of the atmosphere over Asia. In order to better quanti@ these aerosol characteristics, the Aerosol Robotic Network (AERONET) has established over 200 sites worldwide with an emphasis in recent years on the Asian continent - specifically Southeast Asia. A total of approximately 15 AERONET sun photometer instruments have been deployed to China, India, Pakistan, Thailand, and Vietnam. Sun photometer spectral aerosol optical depth measurements as well as microphysical and optical aerosol retrievals over Southeast Asia will be analyzed and discussed with supporting ground-based instrument, satellite, and model data sets, which are freely available via the AERONET Data Synergy tool at the AERONET web site (http://aeronet.gsfc.nasa.gov). This web-based data tool provides access to groundbased (AERONET and MPLNET), satellite (MODIS, SeaWiFS, TOMS, and OMI) and model (GOCART and back trajectory analyses) databases via one web portal. Future development of the AERONET Data Synergy Tool will include the expansion of current data sets as well as the implementation of other Earth Science data sets pertinent to advancing aerosol research.

  3. Molecular characterization of serotype Asia-1 foot-and-mouth disease viruses in Pakistan and Afghanistan; emergence of a new genetic Group and evidence for a novel recombinant virus

    DEFF Research Database (Denmark)

    Jamal, Syed Muhammad; Ferrari, Giancarlo; Ahmed, Safia

    2011-01-01

    Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. The FMD virus serotypes O, A and Asia-1 are responsible for the outbreaks in these countries. Diverse strains of FMDV, even within the same serotype, co-circulate. Characterization of the viruses in circulation can facilitate...... appropriate vaccine selection and tracing of outbreaks.The present study characterized foot-and-mouth disease serotype Asia-1 viruses circulating in Pakistan and Afghanistan during the period 1998–2009. Phylogenetic analysis of FMDV type Asia-1 revealed that three different genetic Groups of serotype Asia-1...... of the A-Iran05AFG-07 sub-lineage. The Asia-1 FMDVs currently circulating in Pakistan and Afghanistan are not efficiently neutralized by antisera raised against the Asia-1/Shamir vaccine strain. Thus, new Asia-1 vaccine strains may be required to block the spread of the current Asia-1 viruses....

  4. Characterization and expression of genes encoding three small heat shock proteins in Sesamia inferens (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou

    2014-12-12

    The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  5. Characterization and Expression of Genes Encoding Three Small Heat Shock Proteins in Sesamia inferens (Lepidoptera: Noctuidae

    Directory of Open Access Journals (Sweden)

    Meng Sun

    2014-12-01

    Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.

  6. Using an Ablation Gradient Model to Characterize Annual Glacial Melt Contribution to Major Rivers in High Asia

    Science.gov (United States)

    Brodzik, M. J.; Armstrong, R. L.; Khalsa, S. J. S.; Painter, T. H.; Racoviteanu, A.; Rittger, K.

    2014-12-01

    Ice melt from mountain glaciers can represent a significant contribution to freshwater hydrological budgets, along with seasonal snow melt, rainfall and groundwater. In the rivers of High Asia, understanding the proportion of glacier ice melt is critical for water resource management of irrigation and planning for hydropower generation and human consumption. Current climate conditions are producing heterogeneous glacier responses across the Hindu Kush-Karakoram-Himalayan ranges. However, it is not yet clear how contrasting glacier patterns affect regional water resources. For example, in the Upper Indus basin, estimates of glacial contribution to runoff are often not distinguished from seasonal snow contribution, and vary widely, from as little as 15% to as much as 55%. While many studies are based on reasonable concepts, most are based on assumptions uninformed by actual snow or ice cover measurements. While straightforward temperature index models have been used to estimate glacier runoff in some Himalayan basins, application of these models in larger Himalayan basins is limited by difficulties in estimating key model parameters, particularly air temperature. Estimating glacial area from the MODIS Permanent Snow and Ice Extent (MODICE) product for the years 2000-2013, with recently released Shuttle Radar Topography Mission (SRTMGL3) elevation data, we use a simple ablation gradient approach to calculate an upper limit on the contribution of clean glacier ice melt to streamflow data. We present model results for the five major rivers with glaciated headwaters in High Asia: the Bramaputra, Ganges, Indus, Amu Darya and Syr Darya. Using GRDC historical discharge records, we characterize the annual contribution from glacier ice melt. We use MODICE interannual trends in each basin to estimate glacier ice melt uncertainties. Our results are being used in the USAID project, Contribution to High Asia Runoff from Ice and Snow (CHARIS), to inform regional-scale planning for

  7. Genetic Characterization of Serotypes A and Asia-1 Foot-and-mouth Disease Viruses in Balochistan, Pakistan, in 2011.

    Science.gov (United States)

    Ullah, A; Jamal, S M; Romey, A; Gorna, K; Kakar, M A; Abbas, F; Ahmad, J; Zientara, S; Bakkali Kassimi, L

    2017-10-01

    This study reports characterization of foot-and-mouth disease virus (FMDV) in samples collected from Balochistan, Pakistan. FMDV was detected by pan-FMDV real-time RT-PCR in 31 samples (epithelial and oral swabs) collected in 2011 from clinical suspect cases. Of these, 29 samples were serotyped by serotype-specific real-time RT-PCR assays and were confirmed by sequencing the VP1 coding region. Sixteen samples were found positive for serotype A and eight for serotype Asia-1, whereas five samples were found positive for both serotypes A and Asia-1. Two serotype A positive samples were found positive for two different strains of serotype A FMDV each. Phylogenetic analyses of serotype A FMDVs showed circulation of at least three different sublineages within the A-Iran05 lineage. These included two earlier reported sublineages, A-Iran05 HER -10 and A-Iran05 FAR -11 , and a new sublineage, designated here as A-Iran05 BAL -11 . This shows that viruses belonging to the A-Iran05 lineage are continuously evolving in the region. Viruses belonging to the A-Iran05 FAR -11 sublineage showed close identity with the viruses circulating in 2009 in Pakistan and Afghanistan. However, viruses belonging to the A-Iran05 HER -10 detected in Balochistan, Pakistan, showed close identity with the viruses circulating in Kyrgyzstan, Iran and Kazakhstan in 2011 and 2012, showing that viruses responsible for outbreak in these countries have a common origin. Serotype Asia-1 FMDVs reported in this study all belonged to the earlier reported Group-VII (Sindh-08), which is currently a dominant strain in the West Eurasian region. Detection of two different serotypes of FMDV or/and two different strains of the same serotype in one animal/sample shows complexity in occurrence of FMD in the region. © 2016 Blackwell Verlag GmbH.

  8. Characterization and phylogenetic analysis of α-gliadin gene ...

    Indian Academy of Sciences (India)

    Home; Journals; Journal of Genetics; Volume 93; Issue 3 ... Research Article Volume 93 Issue 3 December 2014 pp 725-731 ... Although the unique properties of wheat -gliadin gene family are well characterized, little is known about the evolution and genomic divergence of -gliadin gene family within the Triticeae.

  9. Isolation and characterization of resistant gene analogs in cassava ...

    African Journals Online (AJOL)

    These candidate sequences mapped to the draft cassava genome with high sequence similarity to predicted NBS-LRR genes. These novel sequences may serve as a stepping stone for further characterization and experimental validation of predicted R genes in the draft cassava genome, ultimately leading to the ...

  10. Bioinformatic prediction and functional characterization of human KIAA0100 gene

    Directory of Open Access Journals (Sweden)

    He Cui

    2017-02-01

    Full Text Available Our previous study demonstrated that human KIAA0100 gene was a novel acute monocytic leukemia-associated antigen (MLAA gene. But the functional characterization of human KIAA0100 gene has remained unknown to date. Here, firstly, bioinformatic prediction of human KIAA0100 gene was carried out using online softwares; Secondly, Human KIAA0100 gene expression was downregulated by the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR-associated (Cas 9 system in U937 cells. Cell proliferation and apoptosis were next evaluated in KIAA0100-knockdown U937 cells. The bioinformatic prediction showed that human KIAA0100 gene was located on 17q11.2, and human KIAA0100 protein was located in the secretory pathway. Besides, human KIAA0100 protein contained a signalpeptide, a transmembrane region, three types of secondary structures (alpha helix, extended strand, and random coil , and four domains from mitochondrial protein 27 (FMP27. The observation on functional characterization of human KIAA0100 gene revealed that its downregulation inhibited cell proliferation, and promoted cell apoptosis in U937 cells. To summarize, these results suggest human KIAA0100 gene possibly comes within mitochondrial genome; moreover, it is a novel anti-apoptotic factor related to carcinogenesis or progression in acute monocytic leukemia, and may be a potential target for immunotherapy against acute monocytic leukemia.

  11. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.

    Science.gov (United States)

    Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J

    2014-07-22

    Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.

  12. Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library

    Directory of Open Access Journals (Sweden)

    Eddy Edward M

    2007-07-01

    Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.

  13. Characterization of magnetic material in the mound-building termite Macrotermes gilvus in Southeast Asia

    Energy Technology Data Exchange (ETDEWEB)

    Esa, Mohammad Faris Mohammad; Hassan, Ibrahim Haji [School of Chemical Sciences and Food Technology, Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi, Selangor (Malaysia); Rahim, Faszly; Hanifah, Sharina Abu [School of Environmental Scieces and Natural Resources Faculty of Science and Technology, Universiti Kebangsaan Malaysia, Bangi, Selangor (Malaysia)

    2015-09-25

    Magnetic material such as magnetite are known as particles that respond to external magnetic field with their ferromagnetic properties as they are believed contribute to in responding to the geomagnetic field. These particles are used by terrestrial animals such as termites for navigation and orientation. Since our earth react as giant magnetic bar, the magnitude of this magnetic field present by intensity and direction (inclination and direction). The magnetic properties and presence of magnetite in termites Macrotermes gilvus, common mound-building termite were tested. M. gilvus termites was tested with a Vibrating Sample Magnetometer VSM to determine the magnetic properties of specimen. The crushed body sample was characterized with X-Ray Diffraction XRD to show the existent of magnetic material (magnetite) in the specimens. Results from VSM indicate that M. gilvus has diamagnetism properties. The characterization by XRD shows the existent of magnetic material in our specimen in low concentration.

  14. Characterization of magnetic material in the mound-building termite Macrotermes gilvus in Southeast Asia

    International Nuclear Information System (INIS)

    Esa, Mohammad Faris Mohammad; Hassan, Ibrahim Haji; Rahim, Faszly; Hanifah, Sharina Abu

    2015-01-01

    Magnetic material such as magnetite are known as particles that respond to external magnetic field with their ferromagnetic properties as they are believed contribute to in responding to the geomagnetic field. These particles are used by terrestrial animals such as termites for navigation and orientation. Since our earth react as giant magnetic bar, the magnitude of this magnetic field present by intensity and direction (inclination and direction). The magnetic properties and presence of magnetite in termites Macrotermes gilvus, common mound-building termite were tested. M. gilvus termites was tested with a Vibrating Sample Magnetometer VSM to determine the magnetic properties of specimen. The crushed body sample was characterized with X-Ray Diffraction XRD to show the existent of magnetic material (magnetite) in the specimens. Results from VSM indicate that M. gilvus has diamagnetism properties. The characterization by XRD shows the existent of magnetic material in our specimen in low concentration

  15. Characterization of magnetic material in the mound-building termite Macrotermes gilvus in Southeast Asia

    Science.gov (United States)

    Esa, Mohammad Faris Mohammad; Rahim, Faszly; Hassan, Ibrahim Haji; Hanifah, Sharina Abu

    2015-09-01

    Magnetic material such as magnetite are known as particles that respond to external magnetic field with their ferromagnetic properties as they are believed contribute to in responding to the geomagnetic field. These particles are used by terrestrial animals such as termites for navigation and orientation. Since our earth react as giant magnetic bar, the magnitude of this magnetic field present by intensity and direction (inclination and direction). The magnetic properties and presence of magnetite in termites Macrotermes gilvus, common mound-building termite were tested. M. gilvus termites was tested with a Vibrating Sample Magnetometer VSM to determine the magnetic properties of specimen. The crushed body sample was characterized with X-Ray Diffraction XRD to show the existent of magnetic material (magnetite) in the specimens. Results from VSM indicate that M. gilvus has diamagnetism properties. The characterization by XRD shows the existent of magnetic material in our specimen in low concentration.

  16. The cloning and characterization of a poplar stomatal density gene

    Science.gov (United States)

    Shaneka S. Lawson; Paula M. Pijut; Charles H. Michler

    2014-01-01

    EPIDERMAL PATTERNING FACTOR1 (EPF1) is a well characterized negative regulator of cell division in Arabidopsis thaliana (AtEPF1) where the primary region of localization is the leaf. However, little data have been reported on the role of EPF1 in other plant species. In this study, the EPF1 gene from ...

  17. Gene cloning and characterization of NADH oxidase from ...

    African Journals Online (AJOL)

    The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...

  18. Characterization and phylogenetic analysis of α-gliadin gene ...

    Indian Academy of Sciences (India)

    Supplementary data: Characterization and phylogenetic analysis of α-gliadin gene sequences reveals significant genomic divergence in Triticeae species. Guang-Rong Li, Tao Lang, En-Nian Yang, Cheng Liu ... The MITE insertion at the 3 UTR is boxed. Figure 2. The secondary structure of MITE insertion in HM452949.

  19. Molecular characterization of capsid protein gene of potato virus X ...

    African Journals Online (AJOL)

    Molecular characterization of capsid protein gene of potato virus X from Pakistan. Arshad Jamal, Idrees Ahmad Nasir, Bushra Tabassum, Muhammad Tariq, Abdul Munim Farooq, Zahida Qamar, Mohsin Ahmad Khan, Nadeem Ahmad, Muhammad Shafiq, Muhammad Saleem Haider, M. Arshad Javed, Tayyab Husnain ...

  20. Isolation and characterization of an isoamylase gene from rye

    Directory of Open Access Journals (Sweden)

    Ke Zheng

    2013-12-01

    Full Text Available Genomic DNA and cDNA sequences of an isoamylase gene were isolated and characterized from the rye genome. The full-lengths of the rye isoamylase gene are 7351 bp for genomic DNA and 2364 bp for cDNA. There are 18 exons and 17 introns in the genomic sequence, which shares a similar organization with homologous genes from Aegilops tauschii, maize, rice and Arabidopsis. Exon regions of rye and other plant isoamylase genes are more conserved than the introns. High sequence similarity (> 95% was observed in mature proteins of isoamylase genes originating from rye, Ae. tauschii, wheat and barley. The transcript profile revealed that rye isoamylase is mainly expressed in the seed endosperm with a maximum level at the middle developmental stage (15 DPA. A phylogenetic tree based on the deduced aa sequences of mature proteins from rye and other plant isoamylases indicated that rye isoamylase is more closely related to Ae. tauschii wDBE1 and wheat iso1. This is the first report on identification and characterization of the isoamylase gene from rye, making it possible to explore the roles of this enzyme for amylopectin development in rye and triticale.

  1. Characterization of MORE AXILLARY GROWTH genes in Populus.

    Directory of Open Access Journals (Sweden)

    Olaf Czarnecki

    Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.

  2. Cloning, characterization and targeting of the mouse HEXA gene

    Energy Technology Data Exchange (ETDEWEB)

    Wakamatsu, N.; Trasler, J.M.; Gravel, R.A. [McGill Univ., Quebec (Canada)] [and others

    1994-09-01

    The HEXA gene, encoding the {alpha} subunit of {beta}-hexosaminidase A, is essential for the metabolism of ganglioside G{sub M2}, and defects in this gene cause Tay-Sachs disease in humans. To elucidate the role of the gene in the nervous system of the mouse and to establish a mouse model of Tay-Sachs disease, we have cloned and characterized the HEXA gene and targeted a disruption of the gene in mouse ES cells. The mouse HEXA gene spans {approximately}26 kb and consists of 14 exons, similar to the human gene. A heterogeneous transcription initiation site was identified 21-42 bp 5{prime} of the initiator ATG, with two of the sites fitting the consensus CTCA (A = start) as seen for some weak initiator systems. Promoter analysis showed that the first 150 bp 5{prime} of the ATG contained 85% of promoter activity observed in constructs containing up to 1050 bp of 5{prime} sequence. The active region contained a sequence matching that of the adenovirus major late promoter upstream element factor. A survey of mouse tissues showed that the highest mRNA levels were in (max to min): testis (5.5 x brain cortex), adrenal, epididymis, heart, brain, lung, kidney, and liver (0.3 x brain cortex). A 12 kb BstI/SalI fragment containing nine exons was disrupted with the insertion of the bacterial neo{sup r} gene in exon 11 and was targeted into 129/Sv ES cells by homologous recombination. Nine of 153 G418 resistant clones were correctly targeted as confirmed by Southern blotting. The heterozygous ES cells were microinjected into mouse blastocysts and implanted into pseudo-pregnant mice. Nine male chimeric mice, showing that 40-95% chimerism for the 129/Sv agouti coat color marker, are being bred in an effort to generate germline transmission of the disrupted HEXA gene.

  3. Molecular characterization of barley 3H semi-dwarf genes.

    Directory of Open Access Journals (Sweden)

    Haobing Li

    Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.

  4. Characterization of transformation related genes in oral cancer cells.

    Science.gov (United States)

    Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M

    1998-04-16

    A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.

  5. Gene expression characterizes different nutritional strategies among three mixotrophic protists.

    Science.gov (United States)

    Liu, Zhenfeng; Campbell, Victoria; Heidelberg, Karla B; Caron, David A

    2016-07-01

    Mixotrophic protists, i.e. protists that can carry out both phototrophy and heterotrophy, are a group of organisms with a wide range of nutritional strategies. The ecological and biogeochemical importance of these species has recently been recognized. In this study, we investigated and compared the gene expression of three mixotrophic protists, Prymnesium parvum, Dinobyron sp. and Ochromonas sp. under light and dark conditions in the presence of prey using RNA-Seq. Gene expression of the obligately phototrophic P. parvum and Dinobryon sp. changed significantly between light and dark treatments, while that of primarily heterotrophic Ochromonas sp. was largely unchanged. Gene expression of P. parvum and Dinobryon sp. shared many similarities, especially in the expression patterns of genes related to reproduction. However, key genes involved in central carbon metabolism and phagotrophy had different expression patterns between these two species, suggesting differences in prey consumption and heterotrophic nutrition in the dark. Transcriptomic data also offered clues to other physiological traits of these organisms such as preference of nitrogen sources and photo-oxidative stress. These results provide potential target genes for further exploration of the mechanisms of mixotrophic physiology and demonstrate the potential usefulness of molecular approaches in characterizing the nutritional modes of mixotrophic protists. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.

  6. Morphological and molecular characterization of three Agaricus species from tropical Asia (Pakistan, Thailand) reveals a new group in section Xanthodermatei.

    Science.gov (United States)

    Thongklang, Naritsada; Nawaz, Rizwana; Khalid, Abdul N; Chen, Jie; Hyde, Kevin D; Zhao, Ruilin; Parra, Luis A; Hanif, Muhammad; Moinard, Magalie; Callac, Philippe

    2014-01-01

    The genus Agaricus is known for its medicinal and edible species but also includes toxic species that belong to section Xanthodermatei. Previous phylogenetic reconstruction for temperate species, based on sequence data of nuc rRNA gene (rDNA) internal transcribed spacers (ITS), has revealed two major groups in this section and a possible third lineage for A. pseudopratensis. Recent research in Agaricus has shown that classifications need improving with the addition of tropical taxa. In this study we add new tropical collections to section Xanthodermatei. We describe three species from collections made in Pakistan and Thailand and include them in a larger analysis using all available ITS data for section Xanthodermatei. Agaricus bisporiticus sp. nov. and A. fuscopunctatus sp. nov. are introduced based on molecular and morphological studies, whereas A. microvolvatulus is recorded for the first time in Asia. Specimens from Thailand however have a much larger pileus than the type specimens from Congo. In maximum likelihood (ML) and maximum parsimony (MP) phylogenetic analyses these three species cluster with A. pseudopratensis from the Mediterranean area and A. murinocephalus recently described from Thailand. In Agaricus section Xanthodermatei this new group is monophyletic and receives low bootstrap support whereas the two previously known groups receive strong support. Within the new group, the most closely related species share some traits, but we did not find any unifying morphological character; however the five species of the group share a unique short nucleotide sequence. Two putatively toxic species of section Xanthodermatei are now recognized in Pakistan and six in Thailand. © 2014 by The Mycological Society of America.

  7. Characterization of Genes for Beef Marbling Based on Applying Gene Coexpression Network

    Directory of Open Access Journals (Sweden)

    Dajeong Lim

    2014-01-01

    Full Text Available Marbling is an important trait in characterization beef quality and a major factor for determining the price of beef in the Korean beef market. In particular, marbling is a complex trait and needs a system-level approach for identifying candidate genes related to the trait. To find the candidate gene associated with marbling, we used a weighted gene coexpression network analysis from the expression value of bovine genes. Hub genes were identified; they were topologically centered with large degree and BC values in the global network. We performed gene expression analysis to detect candidate genes in M. longissimus with divergent marbling phenotype (marbling scores 2 to 7 using qRT-PCR. The results demonstrate that transmembrane protein 60 (TMEM60 and dihydropyrimidine dehydrogenase (DPYD are associated with increasing marbling fat. We suggest that the network-based approach in livestock may be an important method for analyzing the complex effects of candidate genes associated with complex traits like marbling or tenderness.

  8. Genetic characterization of the non-structural protein-3 gene of bluetongue virus serotype-2 isolate from India.

    Science.gov (United States)

    Pudupakam, Raghavendra Sumanth; Raghunath, Shobana; Pudupakam, Meghanath; Daggupati, Sreenivasulu

    2017-03-01

    Sequence analysis and phylogenetic studies based on non-structural protein-3 (NS3) gene are important in understanding the evolution and epidemiology of bluetongue virus (BTV). This study was aimed at characterizing the NS3 gene sequence of Indian BTV serotype-2 (BTV2) to elucidate its genetic relationship to global BTV isolates. The NS3 gene of BTV2 was amplified from infected BHK-21 cell cultures, cloned and subjected to sequence analysis. The generated NS3 gene sequence was compared with the corresponding sequences of different BTV serotypes across the world, and a phylogenetic relationship was established. The NS3 gene of BTV2 showed moderate levels of variability in comparison to different BTV serotypes, with nucleotide sequence identities ranging from 81% to 98%. The region showed high sequence homology of 93-99% at amino acid level with various BTV serotypes. The PPXY/PTAP late domain motifs, glycosylation sites, hydrophobic domains, and the amino acid residues critical for virus-host interactions were conserved in NS3 protein. Phylogenetic analysis revealed that BTV isolates segregate into four topotypes and that the Indian BTV2 in subclade IA is closely related to Asian and Australian origin strains. Analysis of the NS3 gene indicated that Indian BTV2 isolate is closely related to strains from Asia and Australia, suggesting a common origin of infection. Although the pattern of evolution of BTV2 isolate is different from other global isolates, the deduced amino acid sequence of NS3 protein demonstrated high molecular stability.

  9. Characterization of an ancient lepidopteran lateral gene transfer.

    Directory of Open Access Journals (Sweden)

    David Wheeler

    Full Text Available Bacteria to eukaryote lateral gene transfers (LGT are an important potential source of material for the evolution of novel genetic traits. The explosion in the number of newly sequenced genomes provides opportunities to identify and characterize examples of these lateral gene transfer events, and to assess their role in the evolution of new genes. In this paper, we describe an ancient lepidopteran LGT of a glycosyl hydrolase family 31 gene (GH31 from an Enterococcus bacteria. PCR amplification between the LGT and a flanking insect gene confirmed that the GH31 was integrated into the Bombyx mori genome and was not a result of an assembly error. Database searches in combination with degenerate PCR on a panel of 7 lepidopteran families confirmed that the GH31 LGT event occurred deep within the Order approximately 65-145 million years ago. The most basal species in which the LGT was found is Plutella xylostella (superfamily: Yponomeutoidea. Array data from Bombyx mori shows that GH31 is expressed, and low dN/dS ratios indicates the LGT coding sequence is under strong stabilizing selection. These findings provide further support for the proposition that bacterial LGTs are relatively common in insects and likely to be an underappreciated source of adaptive genetic material.

  10. Triticale powdery mildew: population characterization and wheat gene efficiency.

    Science.gov (United States)

    Bouguennec, Annaig; Trottet, Maxime; du Cheyron, Philippe; Lonnet, Philippe

    2014-01-01

    Powdery mildew has emerged on triticale in the early 2000s in many locations, probably due to a host range expansion of the wheat formae speciales, Blumeria graminis f.sp. tritici. Many triticale cultivars are highly susceptible to powdery mildew, mainly in seedling stage, revealing a probably narrow genetic basis for powdery mildew resistance genes (Pm). Moreover, as Blumeria graminis is an obligate biotrophic fungus, it is very time consuming and difficult to maintain powdery mildew isolates for a non-specialized laboratory and populations can evolve. In order to identify wheat Pm genes efficient against natural populations of powdery mildew, wheat differential hosts and triticale seedlings were inoculated below susceptible triticale crop naturally contaminated by mildew, in several locations and several years. Symptoms on seedlings were measured after approximately two weeks of incubation in favorable fungus growth conditions. According to these data, we classified the Pm genes presents in our wheat differential hosts set in 3 classes: Pm already overcame by triticale powdery mildew, Pm having variable effects and Pm still efficient against triticale mildew. Data on triticale seedlings allowed us to identify some few triticale cultivars resistant to Blumeria graminis in seedling stage. We will try to identify Pm genes present in those cultivars next year by testing them with the characterized isolates of powdery mildew from Gent University. Nevertheless, interspecific crossing of wheat, resistant to powdery mildew in seedling stage, and rye have been initiated to introduce potentially interesting genes for resistance in triticale.

  11. Genomic Characterization of Phenylalanine Ammonia Lyase Gene in Buckwheat.

    Directory of Open Access Journals (Sweden)

    Karthikeyan Thiyagarajan

    Full Text Available Phenylalanine Ammonia Lyase (PAL gene which plays a key role in bio-synthesis of medicinally important compounds, Rutin/quercetin was sequence characterized for its efficient genomics application. These compounds possessing anti-diabetic and anti-cancer properties and are predominantly produced by Fagopyrum spp. In the present study, PAL gene was sequenced from three Fagopyrum spp. (F. tataricum, F. esculentum and F. dibotrys and showed the presence of three SNPs and four insertion/deletions at intra and inter specific level. Among them, the potential SNP (position 949th bp G>C with Parsimony Informative Site was selected and successfully utilised to individuate the zygosity/allelic variation of 16 F. tataricum varieties. Insertion mutations were identified in coding region, which resulted the change of a stretch of 39 amino acids on the putative protein. Our Study revealed that autogamous species (F. tataricum has lower frequency of observed SNPs as compared to allogamous species (F. dibotrys and F. esculentum. The identified SNPs in F. tataricum didn't result to amino acid change, while in other two species it caused both conservative and non-conservative variations. Consistent pattern of SNPs across the species revealed their phylogenetic importance. We found two groups of F. tataricum and one of them was closely related with F. dibotrys. Sequence characterization information of PAL gene reported in present investigation can be utilized in genetic improvement of buckwheat in reference to its medicinal value.

  12. Aircraft measurements over Europe of an air pollution plume from Southeast Asia – aerosol and chemical characterization

    Directory of Open Access Journals (Sweden)

    A. Stohl

    2007-01-01

    Full Text Available An air pollution plume from Southern and Eastern Asia, including regions in India and China, was predicted by the FLEXPART particle dispersion model to arrive in the upper troposphere over Europe on 24–25 March 2006. According to the model, the plume was exported from Southeast Asia six days earlier, transported into the upper troposphere by a warm conveyor belt, and travelled to Europe in a fast zonal flow. This is confirmed by the retrievals of carbon monoxide (CO from AIRS satellite measurements, which are in excellent agreement with the model results over the entire transport history. The research aircraft DLR Falcon was sent into this plume west of Spain on 24 March and over Southern Europe on 25 March. On both days, the pollution plume was found close to the predicted locations and, thus, the measurements taken allowed the first detailed characterization of the aerosol content and chemical composition of an anthropogenic pollution plume after a nearly hemispheric transport event. The mixing ratios of CO, reactive nitrogen (NOy and ozone (O3 measured in the Asian plume were all clearly elevated over a background that was itself likely elevated by Asian emissions: CO by 17–34 ppbv on average (maximum 60 ppbv and O3 by 2–9 ppbv (maximum 22 ppbv. Positive correlations existed between these species, and a ΔO3/ΔCO slope of 0.25 shows that ozone was formed in this plume, albeit with moderate efficiency. Nucleation mode and Aitken particles were suppressed in the Asian plume, whereas accumulation mode aerosols were strongly elevated and correlated with CO. The suppression of the nucleation mode was likely due to the large pre-existing aerosol surface of the transported larger particles. Super-micron particles, likely desert dust, were found in part of the Asian pollution plume and also in surrounding cleaner air. The aerosol light absorption coefficient was enhanced in the plume (average values for individual plume encounters 0.25–0

  13. Characterization of hey bHLH genes in teleost fish.

    Science.gov (United States)

    Winkler, Christoph; Elmasri, Harun; Klamt, Barbara; Volff, Jean-Nicolas; Gessler, Manfred

    2003-11-01

    Hairy-related basic helix-loop-helix (bHLH) transcription factors are targets of Delta-Notch signaling and represent essential components for a number of cell fate decisions during vertebrate embryogenesis. Hey genes encode a subfamily of hairy-related proteins that have been implicated in processes like somitogenesis, blood vessel and heart development. We have identified and characterized hey genes in three teleost fish lineages using degenerate PCR and database searches. Phylogenetic analysis of Hey proteins suggests a complex pattern of evolution with high divergence of hey2 in Takifugu rubripes (Fugu, Japanese pufferfish) and possibly loss in the related Tetraodon nigroviridis (the freshwater pufferfish). In addition, duplication of hey1 in both pufferfishes, Fugu and Tetraodon, was observed. Conversely, zebrafish (Danio rerio) has the same complement of three hey genes as known from mammals. All three hey genes show much more restricted gene expression profiles in zebrafish when compared to mouse. Importantly, while all three murine Hey genes are expressed in overlapping patterns in the presomitic mesoderm (PSM) and somites, in zebrafish only hey1 shows PSM and somite expression in a highly dynamic fashion. Therefore, while overlapping expression might account for redundancy of hey function in higher vertebrates, this is unlikely to be the case in zebrafish. In deltaD (dlD) deficient after-eight zebrafish mutants, the dynamic expression of hey1 in the PSM is impaired and completely lost in newly formed somitomeres. Overexpression of dlD on the other hand results in the ectopic expression of hey1 in the axial mesoderm. Hence, hey1 represents a target of Delta-Notch signaling dynamically expressed during somite formation in zebrafish.

  14. Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene

    International Nuclear Information System (INIS)

    Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.

    1988-01-01

    The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region

  15. Theming Asia

    NARCIS (Netherlands)

    Erb, Maribeth; Ong, Chin Ee

    2017-01-01

    This paper introduces a special issue on Theme Parks in Asia with reflections on how the various theoretical ideas on theming and theme parks that are found in the social science literature can help us to understand the proliferation of theming and theme parks in contemporary Asia. How does theming

  16. Preparation and characterization of magnetic gene vectors for targeting gene delivery

    Energy Technology Data Exchange (ETDEWEB)

    Zheng, S.W.; Liu, G. [College of Chemistry, Chemical Engineering and Materials Science and Key Laboratory of Organic Synthesis of Jiangsu Province, Soochow University, SIP, Suzhou 215123 (China); Hong, R.Y., E-mail: rhong@suda.edu.cn [College of Chemistry, Chemical Engineering and Materials Science and Key Laboratory of Organic Synthesis of Jiangsu Province, Soochow University, SIP, Suzhou 215123 (China); State Key Laboratory of Multi-phase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100080 (China); Li, H.Z. [State Key Laboratory of Multi-phase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100080 (China); Li, Y.G., E-mail: ilguoliang@sohu.com [Department of radiology, the First Affiliated Hospital of Soochow University, Suzhou 215007 (China); Wei, D.G., E-mail: dougwei@deas.harvard.edu [Center for Nanoscale Systems, School of Engineering and Applied Science, Harvard University, 11 Oxford Street, Cambridge, MA 02139 (United States)

    2012-10-15

    Highlights: Black-Right-Pointing-Pointer PEI is ideal candidate polymer for the design of gene delivery systems. Black-Right-Pointing-Pointer PEI-CMD-MNPs exhibited a typical superparamagnetic behavior. Black-Right-Pointing-Pointer PEI-CMD-MNPs were well stable over the entire range of pH and NaCl concentration. Black-Right-Pointing-Pointer DNA-PEI-CMD-MNPs transfected cells by a magnet have higher transfection efficiency and gene expression efficiency. - Abstract: The PEI-CMD-MNPs were successfully prepared by the surface modification of magnetic Fe{sub 3}O{sub 4} nanoparticles with carboxymethyl dextran (CMD) and polyethyleneimine (PEI). The PEI-CMD-MNPs polyplexes exhibited a typical superparamagnetic behavior and were well stable over the entire range of pH and NaCl concentration. These PEI-CMD-MNPs were used as magnetic gene vectors for targeting gene delivery. The prepared MNPs at different surface modification stages were characterized using Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA), field emissions canning electron microscopy (FE-SEM), powder X-ray diffraction (XRD) and dynamic laser light scattering (DLS) analysis. The magnetic properties were studied by vibrating sample magnetometer (VSM). To evaluate the performance of the magnetic nanoparticles as gene transfer vector, the PEI-CMD-MNPs were used to delivery green fluorescent protein (GFP) gene into BHK21 cells. The expression of GFP gene was detected by fluorescence microscope. DNA-PEI-CMD-MNPs polyplexes absorbed by the cells were also monitored by Magnetic resonance imaging (MRI). The transfection efficiency and gene expression efficiency of that transfected with a magnet were much higher than that of standard transfection.

  17. Characterization of Isolates of Salmonella enterica Serovar Stanley, a Serovar Endemic to Asia and Associated with Travel

    DEFF Research Database (Denmark)

    Hendriksen, Rene S.; Le Hello, Simon; Bortolaia, Valeria

    2012-01-01

    Salmonella enterica serovar Stanley (S. Stanley) is a common serovar in Southeast Asia and was the second most common serovar implicated in human salmonellosis in Thailand in the years 2002 to 2007. In contrast, this serovar is relatively uncommon in Europe. The objective of this study was to cha...

  18. Clone and characterization of photolyase-gene from soybean

    International Nuclear Information System (INIS)

    Najrana, T.; Hirouchi, T.; Yamamoto, K.

    2003-01-01

    Full text: Cyclobutane pyrimidine dimer (CPD) and pyrimidine [6-4] pyrimidone photoproduct (6-4pp) are the major products of UV-radiation. Both CPD and 6-4pp posses lethal as well as mutagenic property. Excision repair and photoreactivation are involved as major pathways in repairing those photoproducts. To repair those products plant uses photoreactivation as a major pathway. In photoreactivation process photolyase (enzyme encoded by PHR-gene) catalyzes the splitting of the dimer into a monomer under blue light. Photolyase is specific for damage CPD or 6-4pp. The CPD and 6-4pp photolyases are responsible for repairing CPD and 6-4pp lesions respectively. Several investigators reported that removal of CPD lesion is necessary for survival in higher plants in the early development. Thus one should realize the importance of clone and characterization of CPD-photolyase gene from plants especially from those are lying in the list of foods such as wheat, corn, soybean etc. cDNA library (pSPORT-P) of soybean was amplified using the primers that designated as common for CPD-photolyase gene for plants. These primers gave the desire size of PCR product. Desirable PCR product inserted into TA-cloning vector and sequenced. Amino acid sequence revealed considerable homology with CPD-photolyases of rice, arabidopsis thaliana. Then using dilution-PCR amplification method (Hirouchi et al., MGG in press) I have identified the true clone from cDNA library of soybean that containing the full length of CPD-photolyase gene. Full length of cloned gene is about 1698 bps long and exist start and stop codon. Amino acid sequence of the cloned gene shows more than 70% homology with rice, arabidopsis thaliana. Cloned gene enables to complement the E. coli ( phr-uvrA-recA-) system that is completely defective in photoreactivation. The size of CPD-photolyase of soybean is about 56 KDa as identified by 12% SDS PAGE

  19. Analysis of shipboard aerosol optical thickness measurements from multiple sunphotometers aboard the R/V Ronald H. Brown during the Aerosol Characterization Experiment - Asia

    International Nuclear Information System (INIS)

    Miller, Mark A.; Knobelspiesse, Kirk; Frouin, Robert; Bartholomew, Mary Jane; Reynolds, R. Michael; Pietras, Christophe; Fargion, Giulietta; Quinn, Patricia; Thieuleux, Francois

    2005-01-01

    Marine sunphotometer measurements collected aboard the R/V Ronald H. Brown during the Aerosol Characterization Experiment - Asia (ACE-Asia) are used to evaluate the ability of complementary instrumentation to obtain the best possible estimates of aerosol optical thickness and Angstrom exponent from ships at sea. A wide range of aerosol conditions, including clean maritime conditions and highly polluted coastal environments, were encountered during the ACE-Asia cruise. The results of this study suggest that shipboard hand-held sunphotometers and fast-rotating shadow-band radiometers (FRSRs) yield similar measurements and uncertainties if proper measurement protocols are used and if the instruments are properly calibrated. The automated FRSR has significantly better temporal resolution (2 min) than the hand-held sunphotometers when standard measurement protocols are used, so it more faithfully represents the variability of the local aerosol structure in polluted regions. Conversely, results suggest that the hand-held sunphotometers may perform better in clean, maritime air masses for unknown reasons. Results also show that the statistical distribution of the Angstrom exponent measurements is different when the distributions from hand-held sunphotometers are compared with those from the FRSR and that the differences may arise from a combination of factors

  20. Characterization of Asia 1 sdAb from camels bactrianus (C. bactrianus and conjugation with quantum dots for imaging FMDV in BHK-21 cells.

    Directory of Open Access Journals (Sweden)

    Shuanghui Yin

    Full Text Available Foot-and-mouth disease (FMD, caused by FMD virus (FMDV, is a highly contagious viral disease affecting cloven-hoofed animals. Camelids have a unique immunoglobulin profile, with the smallest functional heavy-chain antibodies (sdAb or VHH naturally devoid of light chains with antigen-binding capacity. We screened and characterized five sdAbs against FMDV by immunized library from C. bactrianus with Asia 1 virus-like particles (VLPs. Three of five recombinant sdAbs were stably expressed in E.coli, remained highly soluble, and were serotype-specific for VP1 protein of FMDV Asia 1 by ELISA. These failed to completely neutralize the Asia 1 virus. According to the KD value of binding affinity to three sdAbs, which ranged from 0.44 to 0.71 nm by SPR, sdAb-C6 was selected and conjugated with Zn/CdSe quantum dots (QDs to form a QDs-C6 probe, which was used to trace and image the subcellular location of FMDV in BHK-21 cells. The results show that FMD virions were observed from 3 h.p.i., and most of virions were distributed on one side of the nucleus in the cytoplasm. We demonstrate the utility of sdAbs as functionalized QDs are powerful tools for FMDV research.

  1. Molecular characterization of serotype Asia-1 foot-and-mouth disease viruses in Pakistan and Afghanistan; emergence of a new genetic Group and evidence for a novel recombinant virus.

    Science.gov (United States)

    Jamal, Syed M; Ferrari, Giancarlo; Ahmed, Safia; Normann, Preben; Belsham, Graham J

    2011-12-01

    Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. The FMD virus serotypes O, A and Asia-1 are responsible for the outbreaks in these countries. Diverse strains of FMDV, even within the same serotype, co-circulate. Characterization of the viruses in circulation can facilitate appropriate vaccine selection and tracing of outbreaks. The present study characterized foot-and-mouth disease serotype Asia-1 viruses circulating in Pakistan and Afghanistan during the period 1998-2009. Phylogenetic analysis of FMDV type Asia-1 revealed that three different genetic Groups of serotype Asia-1 have circulated in Pakistan during this time. These are Group-II, -VI and, recently, a novel Group (designated here as Group-VII). This new Group has not been detected in neighbouring Afghanistan during the study period but viruses from Groups I and -II are in circulation there. Using near complete genome sequences, from FMD viruses of serotypes Asia-1 and A that are currently circulating in Pakistan, we have identified an interserotypic recombinant virus, which has the VP2-VP3-VP1-2A coding sequences derived from a Group-VII Asia-1 virus and the remainder of the genome from a serotype A virus of the A-Iran05(AFG-07) sub-lineage. The Asia-1 FMDVs currently circulating in Pakistan and Afghanistan are not efficiently neutralized by antisera raised against the Asia-1/Shamir vaccine strain. Thus, new Asia-1 vaccine strains may be required to block the spread of the current Asia-1 viruses. Copyright © 2011 Elsevier B.V. All rights reserved.

  2. Characterization of five partial deletions of the factor VIII gene

    International Nuclear Information System (INIS)

    Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.

    1987-01-01

    Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes

  3. Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.

    Science.gov (United States)

    Meng, C X; Wei, W; Su, Z- L; Qin, S

    2006-10-01

    Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.

  4. Characterization of Dust Properties Near Source Region During ACE-Asia: A Column Satellite-Surface Perspective

    Science.gov (United States)

    Tsay, S. -C.; Ji, Q.; Chu, A.; Hsu, C.; Holben, B.; Campbell, J.; Welton, E. J.; Shu, P. K.

    2002-01-01

    Many recent field experiments are designed to study the compelling variability in spatial and temporal scale of both pollution-derived and naturally occurring aerosols, which often exist in high concentrations over eastern/southeastern Asia and along the rim of the western Pacific. For example, the ACE-Asia was conducted from March-May 2001 in the vicinity of the Taklimakan and Gobi deserts, East Coast of China, Yellow Sea, Korea, and Japan, along the pathway of Kosa (severe events that blanket East Asia with yellow desert dust, peaked in the Spring season). Asian dust typically originates in desert areas far from polluted urban regions. During transport, dust layers can interact with anthropogenic sulfate and soot aerosols from heavily polluted urban areas. Added to the complex effects of clouds and natural marine aerosols, dust particles reaching the marine environment can have drastically different properties than those from the source. Thus, understanding the unique temporal and spatial variations of Asian aerosols is of special importance in regional-to-global climate issues such as radiative forcing, the hydrological cycle, and primary biological productivity in the mid-Pacific Ocean. During ACE-Asia we have measured continuously aerosol physical/optical/radiative properties, column precipitable water amount, and surface reflectivity over homogeneous areas from surface. The inclusion of flux measurements permits the determination of aerosol radiative flux in addition to measurements of loading and optical depth. At the time of the Terra/MODIS, SeaWiFS, TOMS and other satellite overpasses, these ground-based observations can provide valuable data to compare with satellite retrievals over land. Preliminary results will be presented and discussed their implications in regional climatic effects.

  5. Isolation and characterization of the human CDX1 gene: A candidate gene for diastrophic dysplasia

    Energy Technology Data Exchange (ETDEWEB)

    Bonner, C.; Loftus, S.; Wasmuth, J.J. [Univ. of California, Irvine, CA (United States)

    1994-09-01

    Diastrophic dysplasia is an autosomal recessive disorder characterized by short stature, dislocation of the joints, spinal deformities and malformation of the hands and feet. Multipoint linkage analysis places the diastrophic dysplasia (DTD) locus in 5q31-5q34. Linkage disequilibrium mapping places the DTD locus near CSFIR in the direction of PDGFRB (which is tandem to CSFIR). This same study tentatively placed PDGFRB and DTD proximal to CSFIR. Our results, as well as recently reported work from other laboratories, suggest that PDGFRB (and possibly DTD) is distal rather than proximal to CSFIR. We have constructed a cosmid contig covering approximately 200 kb of the region containing CSFIR. Several exons have been {open_quotes}trapped{close_quotes} from these cosmids using exon amplification. One of these exons was trapped from a cosmid isolated from a walk from PDGFRB, approximately 80 kb from CSFIR. This exon was sequenced and was determined to be 89% identical to the nucleotide sequence of exon two of the murine CDX1 gene (100% amino acid identity). The exon was used to isolate the human CDX gene. Sequence analysis of the human CDX1 gene indicates a very high degree of homology to the murine gene. CDX1 is a caudal type homeobox gene expressed during gastrulation. In the mouse, expression during gastrulation begins in the primitive streak and subsequently localizes to the ectodermal and mesodermal cells of the primitive streak, neural tube, somites, and limb buds. Later in gastrulation, CDX1 expression becomes most prominent in the mesoderm of the forelimbs, and, to a lesser extent, the hindlimbs. CDX1 is an intriguing candidate gene for diastrophic dysplasia. We are currently screening DNA from affected individuals and hope to shortly determine whether CDX1 is involved in this disorder.

  6. Systematically characterizing and prioritizing chemosensitivity related gene based on Gene Ontology and protein interaction network

    Directory of Open Access Journals (Sweden)

    Chen Xin

    2012-10-01

    Full Text Available Abstract Background The identification of genes that predict in vitro cellular chemosensitivity of cancer cells is of great importance. Chemosensitivity related genes (CRGs have been widely utilized to guide clinical and cancer chemotherapy decisions. In addition, CRGs potentially share functional characteristics and network features in protein interaction networks (PPIN. Methods In this study, we proposed a method to identify CRGs based on Gene Ontology (GO and PPIN. Firstly, we documented 150 pairs of drug-CCRG (curated chemosensitivity related gene from 492 published papers. Secondly, we characterized CCRGs from the perspective of GO and PPIN. Thirdly, we prioritized CRGs based on CCRGs’ GO and network characteristics. Lastly, we evaluated the performance of the proposed method. Results We found that CCRG enriched GO terms were most often related to chemosensitivity and exhibited higher similarity scores compared to randomly selected genes. Moreover, CCRGs played key roles in maintaining the connectivity and controlling the information flow of PPINs. We then prioritized CRGs using CCRG enriched GO terms and CCRG network characteristics in order to obtain a database of predicted drug-CRGs that included 53 CRGs, 32 of which have been reported to affect susceptibility to drugs. Our proposed method identifies a greater number of drug-CCRGs, and drug-CCRGs are much more significantly enriched in predicted drug-CRGs, compared to a method based on the correlation of gene expression and drug activity. The mean area under ROC curve (AUC for our method is 65.2%, whereas that for the traditional method is 55.2%. Conclusions Our method not only identifies CRGs with expression patterns strongly correlated with drug activity, but also identifies CRGs in which expression is weakly correlated with drug activity. This study provides the framework for the identification of signatures that predict in vitro cellular chemosensitivity and offers a valuable

  7. Characterization of the novel In1059 harbouring VIM gene cassette

    Directory of Open Access Journals (Sweden)

    Dongguo Wang

    2017-05-01

    Full Text Available Abstract Background VIM-type enzyme encodes the most widely acquired metallo-β-lactamases in Gram- negative bacteria. To obtain current epidemiological data for integrons from enterobacteriae in hospital, the study characterizes the genetic structure in In1059 by comparison with In846 integrons harbouring VIM gene and other class 1 integrons including In37, In62, In843 and In1021 with the aim of identifying the putative mechanisms involved integron mobilization and infer evolution of relevant integrons. Methods Six of 69 recombinant plasmids from clinical strains were found to be class 1 integrons by digestion with BamHI, drug susceptibility testing, conjugation experiments, PCR amplification, integron cloning and sequencing, genome comparison, and detection of carbapenemase activity. Results The sequences of the six recombinant plasmids encoding In1021, In843, In846, In37, In62, and the novel In1059 integron had approximate lengths of ~4.8-, 4.1-, 5.1-, 5.3-, 5.3- and 6.6- kb, respectively. The genetic structures of these integrons were mapped and characterized, and the carbapenemase activities of their parental strains were assessed. Conclusions Our results suggest that the six variable integron structures and regular variations that exist in the gene cassettes provide a putative mechanism for the integron changes. Our study has also shown that the genetic features in the integrons named above fall within a scheme involving the stepwise and parallel evolution of class 1 integron variation likely under antibiotic selection pressure in clinical settings.

  8. Molecular characterization and analysis of the porcine NURR1 gene

    Directory of Open Access Journals (Sweden)

    Knud Larsen

    2016-12-01

    Here we report the isolation and characterization of porcine NURR1 cDNA. The NURR1 cDNA was RT-PCR cloned using NURR1-specific oligonucleotide primers derived from in silico sequences. The porcine NURR1 cDNA encodes a polypeptide of 598 amino acids, displaying a very high similarity with bovine, human and mouse (99% NURR1 protein. Expression analysis revealed a differential NURR1 mRNA expression in various organs and tissues. NURR1 transcripts could be detected as early as at 60 days of embryo development in different brain tissues. A significant increase in NURR1 transcript in the cerebellum and a decrease in NURR1 transcript in the basal ganglia was observed during embryo development. The porcine NURR1 gene was mapped to chromosome 15. Two missense mutations were found in exon 3, the first coding exon of NURR1. Methylation analysis of the porcine NURR1 gene body revealed a high methylation degree in brain tissue, whereas methylation of the promoter was very low. A decrease in DNA methylation in a discrete region of the NURR1 promoter was observed in pig frontal cortex during pig embryo development. This observation correlated with an increase in NURR1 transcripts. Therefore, methylation might be a determinant of NURR1 expression at certain time points in embryo development.

  9. In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.

    Science.gov (United States)

    Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L

    2009-10-01

    To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the

  10. In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression

    International Nuclear Information System (INIS)

    Carlin, Sean; Pugachev, Andrei; Sun Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C. Clifton; Humm, John L.

    2009-01-01

    Purpose: To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer 18 F-fluoromisonidazole ( 18 F-FMISO). Methods: Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe 124 I-2'-fluoro-2'-deoxy-1-β-D-arabinofuranosyl-5-iodouracil ( 124 I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between 124 I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe 18 F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with 124 I-FIAU (3 h before sacrifice) and 18 F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between 18 F-FMISO and 124 I-FIAU on a pixel-by-pixel basis was performed. Results: Correlation coefficients between 124 I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between 18 F-FMISO and 124 I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. Conclusions: We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of

  11. Genetic characterization of the non-structural protein-3 gene of bluetongue virus serotype-2 isolate from India

    Directory of Open Access Journals (Sweden)

    Raghavendra Sumanth Pudupakam

    2017-03-01

    Full Text Available Aim: Sequence analysis and phylogenetic studies based on non-structural protein-3 (NS3 gene are important in understanding the evolution and epidemiology of bluetongue virus (BTV. This study was aimed at characterizing the NS3 gene sequence of Indian BTV serotype-2 (BTV2 to elucidate its genetic relationship to global BTV isolates. Materials and Methods: The NS3 gene of BTV2 was amplified from infected BHK-21 cell cultures, cloned and subjected to sequence analysis. The generated NS3 gene sequence was compared with the corresponding sequences of different BTV serotypes across the world, and a phylogenetic relationship was established. Results: The NS3 gene of BTV2 showed moderate levels of variability in comparison to different BTV serotypes, with nucleotide sequence identities ranging from 81% to 98%. The region showed high sequence homology of 93-99% at amino acid level with various BTV serotypes. The PPXY/PTAP late domain motifs, glycosylation sites, hydrophobic domains, and the amino acid residues critical for virus-host interactions were conserved in NS3 protein. Phylogenetic analysis revealed that BTV isolates segregate into four topotypes and that the Indian BTV2 in subclade IA is closely related to Asian and Australian origin strains. Conclusion: Analysis of the NS3 gene indicated that Indian BTV2 isolate is closely related to strains from Asia and Australia, suggesting a common origin of infection. Although the pattern of evolution of BTV2 isolate is different from other global isolates, the deduced amino acid sequence of NS3 protein demonstrated high molecular stability.

  12. Molecular characterization of enolase gene from Taenia multiceps.

    Science.gov (United States)

    Li, W H; Qu, Z G; Zhang, N Z; Yue, L; Jia, W Z; Luo, J X; Yin, H; Fu, B Q

    2015-10-01

    Taenia multiceps is a cestode parasite with its larval stage, known as Coenurus cerebralis, mainly encysts in the central nervous system of sheep and other livestocks. Enolase is a key glycolytic enzyme and represents multifunction in most organisms. In the present study, a 1617bp full-length cDNA encoding enolase was cloned from T. multiceps and designated as TmENO. A putative encoded protein of 433 amino acid residues that exhibited high similarity to helminth parasites. The recombinant TmENO protein (rTmENO) showed the catalytic and plasminogen-binding characteristics after the TmENO was subcloned and expressed in the pET30a(+) vector. The TmENO gene was transcribed during the adult and larval stages and was also identified in both cyst fluid and as a component of the adult worms and the metacestode by western blot analysis. Taken together, our results will facilitate further structural characterization for TmENO and new potential control strategies for T. multiceps. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Characterization of sources of lead in the urban air of Asia using ratios of stable lead isotopes

    Energy Technology Data Exchange (ETDEWEB)

    Mukai, H.; Furuta, N.; Fujii, T.; Ambe, Y.; Sakamoto, K.; Hashimoto, Y. (National Institute of Environmental Studies, Tsukuba (Japan). Environmental Chemistry Division)

    1993-07-01

    Airborne particulate matter was collected at urban sites in six Asian countries (Japan, South Korea, China, Thailand, Sri Lanka, and Indonesia), and the stable lead isotope ratios were measured. Some source-related materials, such as coal and leaded gasoline, were also analyzed and compared to the ratios observed in airborne lead. Airborne lead isotope ratios differed considerably from each other, and these differences corresponded to differences in the regional source of lead. Leaded gasoline was still the primary source of lead in some cities in Asia, and the lead isotope ratios were strongly influenced by those of leaded gasoline. In Chinese and Korean cities, however, the considerable effect from coal combustion and industrial activity was also observed in their isotope ratios, despite leaded gasoline use. On the other hand, only refuse incineration was a possible single source of lead in Japanese air from the view of lead isotope ratios. 49 refs., 13 figs., 3 tabs.

  14. Multi-gene phylogeny of the genus Lobaria: Evidence of species-pair and allopatric cryptic speciation in East Asia.

    Science.gov (United States)

    Cornejo, Carolina; Scheidegger, Christoph

    2015-12-01

    Accurate species delimitation has critical implications for ecological and conservation studies. The lichen genus Lobaria is widely distributed in old-growth forests. Particularly in East Asia, this genus includes many rare and poorly known taxa that are circumscribed as morpho- or chemospecies, as well as species-pairs. To critically examine the relationships between species identified via morphological and chemical criteria, phylogenetic species recognition (PSR) was applied to the genus Lobaria. Morphological and chemical patterns of 87 individuals were examined and three independent nuclear loci were sequenced. The East Asian L. meridionalis-group was additionally studied using split decomposition and haplotype network analysis. The genus Lobaria and most of its species were strongly supported statistically. Split decomposition and haplotype networks suggest complex evolutionary histories of species within the East Asian L. meridionalis-group. Phylogenetic analyses confirmed the monophyly of the genus Lobaria, including L. anomala. Within Lobaria, three major clades were found. These clades associate with different photobionts and comprise 18 known species and 5 undescribed species. Several chemical compounds were found to be neither stable nor invariant characters. Some taxa of the L. meridionalis-group appear to be monophyletic but remain as allopatric cryptic species. In three clades, this study found evidence for diversification processes between isidiate and nonisidiate specimens (species-pair). These findings are discussed in the context of evolutionary hypotheses for speciation processes. © 2015 Botanical Society of America.

  15. Characterizing gene responses to drought stress in fourwing saltbush [Atriplex canescens (Pursh.) Nutt.)

    Science.gov (United States)

    Linda S. Adair; David L. Andrews; John Cairney; Edward A. Funkhouser; Ronald J. Newton; Earl F. Aldon

    1992-01-01

    New techniques in molecular biology can be used to characterize genes whose expression is induced by drought stress. These techniques can be used to understand responses of range plants to environmental stresses at the biochemical and molecular level. For example, they can be used to characterize genes that respond to drought stress conditions in the native shrub

  16. Cloning and characterization of an insecticidal crystal protein gene ...

    Indian Academy of Sciences (India)

    Unknown

    The sequence of the cloned crystal protein gene showed almost complete homology with a mosquitocidal toxin gene from Bacillus .... diet or by topical application on food substrates as .... has very high similarity (99.74%) at DNA level with.

  17. Characterization and cloning of TMV resistance gene N homologues ...

    African Journals Online (AJOL)

    Tobacco cultivars Nicotiana tabacum cv. Samsun NN plants carrying the N gene contain a multitude of N-related genes. We cloned a few N homologues and isolated two full-length cDNAs of NL-C26 and NL-B69 genes from N. tabacum cv. Samsun NN. Nucleotide sequence analysis showed that the coding regions of ...

  18. Characterization of abiotic stress genes from different species of eucalyptus

    International Nuclear Information System (INIS)

    Naz, S.; Kausar, H.; Saleem, F.; Zafarullah, A.

    2015-01-01

    The stresses causing dehydration damage to the plant cell like cold, drought, and high salinity are the most frequent environmental stresses that influence plant growth, development and restraining productivity in cultivated areas world-wide. Many drought, salinity and cold inducible genes causing tolerance to environmental stresses in many plants include Dehydrin1 (DHN1), Dehydrin2 (DHN2), Dehydrin10 (DHN10), putative phosphate transporter (Ecpt2), choline monooxygenase (CMO) and DREB/CBF1c genes. Gene specific primer pairs were designed for each gene using DNAStar software. These genes were amplified from different species of eucalyptus such as Eucalyptus camaldulensis, E. globulus, E. tereticornis and E. gunii through PCR. Dehydrin2 gene of E. camaldulensis and dehydrin10 gene of E. globulus were cloned using the TA Cloning Kit with pCR 2.1 vector and sequenced. The Dehydrin genes sequences were submitted to GeneBank: Eucalyptus globulus dehydrin10 gene (Accession No. HG915712) and E. camaldulensis dehydrin 2 gene (Accession No. HG813113). The amino acid sequence of Dehydrin10 from E. globulus showed 97% homology to E. globulus DHN10 (JN052210) and Dehydrin2 from E. camaldulensis presented 94% homology to E. globulus DHN2 (JN052209). These genes can be employed in generating drought resistant crop plants. (author)

  19. Epilepsy: Asia versus Africa.

    Science.gov (United States)

    Bhalla, Devender; Tchalla, Achille Edem; Marin, Benoît; Ngoungou, Edgard Brice; Tan, Chong Tin; Preux, Pierre-Marie

    2014-09-01

    Is epilepsy truly an "African ailment"? We aimed to determine this, since international health agencies often refer to epilepsy as an African disease and the scientific literature has spoken the same tone. Various published materials, mainly reports, articles, were used to gather Asian and African evidence on various aspects of epilepsy and many of its risk and associated factors. Our results suggest that in no way can epilepsy be considered as an African ailment and such characterization is most likely based on popular beliefs rather than scientific evidence. In comparison to Africa, Asia has a 5.0% greater burden from all diseases, and is 17.0% more affected from neuropsychiatric disorders (that include epilepsy). Given that more countries in Asia are transitioning, there may be large demographic and lifestyle changes in the near future. However these changes are nowhere close to those expected in Africa. Moreover, 23 million Asians have epilepsy in comparison to 3.3 million Africans and 1.2 million sub-Saharan Africans. In comparison to Africa, Asia has more untreated patients, 55.0% more additional epilepsy cases every year, because of its larger population, with greater treatment cost and possibly higher premature mortality. Of several associated factors discussed herein, many have more importance for Asia than Africa. The current state of epilepsy in Asia is far less than ideal and there is an urgent need to recognize and accept the importance of epilepsy in Asia. In no way can epilepsy be considered as an African ailment. This is most likely based on popular beliefs rather than scientific evidence. A PowerPoint slide summarizing this article is available for download in the Supporting Information section here. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.

  20. Characterization of the FKBP12-Encoding Genes in Aspergillus fumigatus.

    Directory of Open Access Journals (Sweden)

    Katie Falloon

    Full Text Available Invasive aspergillosis, largely caused by Aspergillus fumigatus, is responsible for a growing number of deaths among immunosuppressed patients. Immunosuppressants such as FK506 (tacrolimus that target calcineurin have shown promise for antifungal drug development. FK506-binding proteins (FKBPs form a complex with calcineurin in the presence of FK506 (FKBP12-FK506 and inhibit calcineurin activity. Research on FKBPs in fungi is limited, and none of the FKBPs have been previously characterized in A. fumigatus. We identified four orthologous genes of FKBP12, the human FK506 binding partner, in A. fumigatus and designated them fkbp12-1, fkbp12-2, fkbp12-3, and fkbp12-4. Deletional analysis of the four genes revealed that the Δfkbp12-1 strain was resistant to FK506, indicating FKBP12-1 as the key mediator of FK506-binding to calcineurin. The endogenously expressed FKBP12-1-EGFP fusion protein localized to the cytoplasm and nuclei under normal growth conditions but also to the hyphal septa following FK506 treatment, revealing its interaction with calcineurin. The FKBP12-1-EGFP fusion protein didn't localize at the septa in the presence of FK506 in the cnaA deletion background, confirming its interaction with calcineurin. Testing of all deletion strains in the Galleria mellonella model of aspergillosis suggested that these proteins don't play an important role in virulence. While the Δfkbp12-2 and Δfkbp12-3 strains didn't show any discernable phenotype, the Δfkbp12-4 strain displayed slight growth defect under normal growth conditions and inhibition of the caspofungin-mediated "paradoxical growth effect" at higher concentrations of the antifungal caspofungin. Together, these results indicate that while only FKBP12-1 is the bona fide binding partner of FK506, leading to the inhibition of calcineurin in A. fumigatus, FKBP12-4 may play a role in basal growth and the caspofungin-mediated paradoxical growth response. Exploitation of differences between A

  1. Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression.

    Science.gov (United States)

    1996-10-01

    AD GRANT NUMBER DAMDI7-94-J-4041 TITLE: Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression PRINCIPAL...October 1996 Annual (1 Sep 95 - 31 Aug 96) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS Cloning and Characterizing Genes Involved in Monoterpene Induced... Monoterpene -induced/repressed genes were identified in regressing rat mammary carcinomas treated with dietary limonene using a newly developed method

  2. [Positional clonage and characterization of the bovine myostatin gene].

    Science.gov (United States)

    Grobet, L

    2000-01-01

    The double-muscled condition has been intensively selected for in the Belgian Blue cattle breed, where segregation studies have demonstrated the monogenic, autosomal and recessive determinism. This has been confirmed by genetic linkage which located the gene to the centromeric tip of chromosome 2. Our positional cloning strategy, and the discovery of a positional candidate in the mouse, led us to the identification of the causative gene now referred to as the Myostatin gene, since its product downregulates skeletal muscle mass. Disruptive mutations of the gene in cattle have been shown to be responsible for the muscular hypertrophy found in eight european beef breeds. A 15 Kilobases genomic region, including the myostatin gene, has been sequenced and compared in cattle and mice. The murine gene has undergone a complex genetic engineering in order to test different allelic variants in vivo after gene targeting transgenesis.

  3. Characterization of a novel splicing variant in the RAPTOR gene

    International Nuclear Information System (INIS)

    Sun Chang; Southard, Catherine; Di Rienzo, Anna

    2009-01-01

    The mammalian target of rapamycin (mTOR) plays an essential role in the regulation of cell growth, proliferation and apoptosis. Raptor, the regulatory associated protein of mTOR, is an important member in this signaling pathway. In the present report, we identified and characterized a novel splicing variant of this gene, RAPTOR v 2, in which exons 14-17, 474 bp in total, are omitted from the mRNA. This deletion does not change the open reading frame, but causes a nearly complete absence of HEAT repeats, which were shown to be involved in the binding of mTOR substrates. Real time PCR performed on 48 different human tissues demonstrated the ubiquitous presence of this splice variant. Quantification of mRNA levels in lymphoblastoid cell lines (LCL) from 56 unrelated HapMap individuals revealed that the expression of this splicing form is quite variable. One synonymous SNP, rs2289759 in exon 14, was predicted by ESEfinder to cause a significant gain/loss of SRp55 and/or SF2/ASF binding sites, and thus potentially influence splicing. This prediction was confirmed by linear regression analysis between the ratio of RAPTOR v 2 to total RAPTOR mRNA levels and the SNP genotype in the above 56 individuals (r = 0.281 and P = 0.036). Moreover, the functional evaluation indicated that this splicing isoform is expected to retain the ability to bind mTOR, but is unlikely to bind mTOR substrates, hence affecting signal transduction and further cell proliferation

  4. Physiological adaptations to osmotic stress and characterization of a polyethylene glycol-responsive gene in Braya humilis

    Directory of Open Access Journals (Sweden)

    Wang Lirong

    2016-03-01

    Full Text Available Braya humilis (Brassicaceae is a widely distributed plant in arid and semi-arid regions of northern Asia. This plant is well adapted to extremely arid conditions and is a promising candidate species to discover novel drought tolerance strategies. However, not much information about the mechanism(s mediating drought resistance in this species is currently available. Therefore, the present study aimed to characterize the physiological traits and expression patterns of a polyethylene glycol (PEG-responsive gene in B. humilis responding to different levels of osmotic stress induced by PEG-6000. Several important physiological parameters were examined, including the levels of relative water content, soluble protein, malondialdehyde, and antioxidant enzyme activity. A tolerance threshold between 20 and 30% PEG-6000 was identified for B. humilis. The water status and oxidative damage below this threshold were maintained at a relatively constant level during the 12 h of treatment. However, once the threshold was exceeded, the water status and oxidative damage were obviously affected after treatment for 4 h. The soluble protein results suggest that B. humilis maintains a vigorous resistance to osmotic stress and that it may play a greater role in osmotic regulation at late stages of stress. Moreover, superoxide dismutase and catalase may be important at preventing oxidative damage in plants at early stages of stress, while peroxidase may be more involved in some biological processes that resist osmotic stress at the late stage, especially in severely damaged plants. Furthermore, a PEG-responsive gene, BhCIPK12, was identified by differential display reverse transcription-polymerase chain reaction (PCR, cloned, and characterized by quantitative real-time PCR. We hypothesized that this gene may play an important role in mediating osmotic stress or drought resistance in plants. Altogether, these results provide valuable insights into the mechanism

  5. Characterization and functional analysis of a carboxylesterase gene associated with chlorpyrifos resistance in Nilaparvata lugens (Stål).

    Science.gov (United States)

    Lu, Kai; Wang, Ying; Chen, Xia; Zhang, Zhichao; Li, Yue; Li, Wenru; Zhou, Qiang

    2017-12-01

    The widespread and extensive application of insecticides have promoted the development of resistance in the brown planthopper Nilaparvata lugens (Stål), one of the most important rice pests in Asia. To better understand the underlying molecular mechanisms of metabolic resistance to insecticides, a chlorpyrifos-resistant (CR) strain of N. lugens was selected and its possible resistance mechanism was investigated. Synergistic tests using carboxylesterases (CarEs) inhibitor triphenyl phosphate (TPP) decreased the resistance of N. lugens to chlorpyrifos, and CarE activities could be induced by low concentrations of chlorpyrifos. Subsequently, a gene putatively encoding CarE, namely NlCarE, predominant in the midgut and ovary was isolated and characterized. The expression levels of NlCarE were detected and compared between the CR and a susceptible (SS) strain of N. lugens. Consistent with the increased CarE activity, this gene was overexpressed in the CR strain compared to the SS strain. The transcript levels of NlCarE were up-regulated by chlorpyrifos exposure, showing dose- and time-dependent expression patterns. Furthermore, RNA interference (RNAi)-mediated knockdown of NlCarE followed by insecticide application significantly increased the susceptibility of N. lugens to chlorpyrifos. These results demonstrate that NlCarE plays an important role in chlorpyrifos detoxification and its overexpression may be involved in chlorpyrifos resistance in N. lugens. Copyright © 2017 Elsevier Inc. All rights reserved.

  6. Passive air monitoring of PCBs and PCNs across East Asia: a comprehensive congener evaluation for source characterization.

    Science.gov (United States)

    Hogarh, Jonathan Nartey; Seike, Nobuyasu; Kobara, Yuso; Habib, Ahsan; Nam, Jae-Jak; Lee, Jong-Sik; Li, Qilu; Liu, Xiang; Li, Jun; Zhang, Gan; Masunaga, Shigeki

    2012-02-01

    A comprehensive congener specific evaluation of polychlorinated biphenyls (PCBs) and polychlorinated naphthalenes (PCNs) in the atmosphere was conducted across East Asia in spring 2008, applying polyurethane foam (PUF) disk passive air sampler (PAS) as monitoring device. Mean concentrations derived for Japan, China and Korea were 184 ± 24, 1100 ± 118, and 156 ± 20 pg m(-3) for ∑(202) PCBs, and 9.5 ± 1.5, 61 ± 6, and 16 ± 2.4 pg m(-3) for ∑(63) PCNs, respectively. Relative to reported data from 2004, the present results suggest that air PCBs concentrations have not changed much in Japan and Korea, while it has increased by one order of magnitude in China. From principal component analysis, combustion emerged highly culpable in contemporary emissions of both PCBs and PCNs across the East Asian sub-region. Another factor derived as important to air PCBs was re-emissions/volatilization. Signals from PCBs formulations were also picked, but their general importance was virtually consigned to the re-emissions/volatilization tendencies. On the contrary, counterpart PCNs formulations did not appear to contribute much to air PCNs. Copyright © 2011 Elsevier Ltd. All rights reserved.

  7. Partial characterization of nif genes from the bacterium Azospirillum amazonense

    Directory of Open Access Journals (Sweden)

    D.P. Potrich

    2001-09-01

    Full Text Available Azospirillum amazonense revealed genomic organization patterns of the nitrogen fixation genes similar to those of the distantly related species A. brasilense. Our work suggests that A. brasilense nifHDK, nifENX, fixABC operons and nifA and glnB genes may be structurally homologous to the counterpart genes of A. amazonense. This is the first analysis revealing homology between A. brasilense nif genes and the A. amazonense genome. Sequence analysis of PCR amplification products revealed similarities between the amino acid sequences of the highly conserved nifD and glnB genes of A. amazonense and related genes of A. brasilense and other bacteria. However, the A. amazonense non-coding regions (the upstream activator sequence region and the region between the nifH and nifD genes differed from related regions of A. brasilense even in nitrogenase structural genes which are highly conserved among diazotrophic bacteria. The feasibility of the 16S ribosomal RNA gene-based PCR system for specific detection of A. amazonense was shown. Our results indicate that the PCR primers for 16S rDNA defined in this article are highly specific to A. amazonense and can distinguish this species from A. brasilense.

  8. Combining MODIS, MISR, CALIOP, OMI, AERONET, and Models to Identify the Spatial and Temporal Distribution, Characterization, and Magnitude of Missing Urban and Wildfire Emissions Sources throughout Asia.

    Science.gov (United States)

    Cohen, J. B.

    2016-12-01

    Due to intense and changing levels of emissions as well as highly non-linear chemical processing, the concentrations of aerosols and thus their impacts are not well known. Urban areas consist of the majority of the emissions of these species and their precursors over large periods of time, while wildfires contribute very large spikes, concentrated in space and over a period of weeks to months. Yet due to urban and economic expansion, as well as clouds amd low intensity burning, the spatial and temporal profiles of these species are changing, with both new sources appearing and old sources decreasing. New work incorporates measurements at different spatial andboptical resolutions from MODIS, MISR, and OMI, coupled with new sampling approaches with CALIOP and AERONET to search for, characterize, and spatially and temporally constrain aerosols. An advanced modeling system including aerosol chemistry, physics, optics, and transport, using a multi-modal and both externally mixed and core-shell mixing is used to quantify the magnitudes of these missing sources. Comparisons between the model and additional dozens of ground stations show extreme improvement when these new sources are included. This new approach is shown to identify new source regions of emissions, many of which were previously non-urbanized or were not found to contain any fire hotspots. In addition, the use of new models run under conditions including both missing local sources from regions such as the expanded urban areas in Southeast and East Asia and advanced chemical and aerosol routines, allow for a comprehensive analysis to be performed. The impacts of insitu chemistry, horizontal, and vertical transport of species, both on the Regional and Continental scale are also included. It is shown that for proper identification, especially on intra-annual and inter-annual variations, this approach is a large improvement throughout Asia, ranging from India, to Indonesia, to China and Japan. Results specific

  9. Molecular Characterization of a stress-induced NAC Gene ...

    Indian Academy of Sciences (India)

    lenovo

    1Cotton Research Center, Shandong Academy of Agricultural Sciences, Jinan 250100, China. 2College of Life ... Running title: GhSNAC3 gene in Cotton ... Quantitative RT-PCR analysis indicated that GhSNAC3 was induced by high salinity, drought ..... simple and general method for transferring genes into plants. Science ...

  10. Cloning and characterization of human DNA repair genes

    International Nuclear Information System (INIS)

    Thompson, L.H.; Brookman, K.W.; Weber, C.A.; Salazar, E.P.; Stewart, S.A.; Carrano, A.V.

    1987-01-01

    The isolation of two addition human genes that give efficient restoration of the repair defects in other CHO mutant lines is reported. The gene designated ERCC2 (Excision Repair Complementing Chinese hamster) corrects mutant UV5 from complementation group 1. They recently cloned this gene by first constructing a secondary transformant in which the human gene was shown to have become physically linked to the bacterial gpt dominant-marker gene by cotransfer in calcium phosphate precipitates in the primary transfection. Transformants expressing both genes were recovered by selecting for resistance to both UV radiation and mycophenolic acid. Using similar methods, the human gene that corrects CHO mutant EM9 was isolated in cosmids and named XRCC1 (X-ray Repair Complementing Chinese hamster). In this case, transformants were recovered by selecting for resistance to CldUrd, which kills EM9 very efficiently. In both genomic and cosmid transformants, the XRCC1 gene restored resistance to the normal range. DNA repair was studied using the kinetics of strand-break rejoining, which was measured after exposure to 137 Cs γ-rays

  11. Cloning and characterization of NBS-LRR resistance gene ...

    African Journals Online (AJOL)

    biotech

    2013-07-03

    Jul 3, 2013 ... Rose using degernate primers designed from the conserved motifs of different plant resistance genes. A total of 40 sequences were hit with various R genes, of which 20 .... absorption ratio OD260 nm/OD280 nm between 1.80 and ..... status and outlook for small-holders agriculture in C S Gold and B.

  12. Characterization of chicken riboflavin carrier protein gene structure ...

    Indian Academy of Sciences (India)

    The chicken riboflavin carrier protein (RCP) is an estrogen induced egg yolk and white protein. Eggs from hens which have a splice mutation in RCP gene fail to hatch, indicating an absolute requirement of RCP for the transport of riboflavin to the oocyte. In order to understand the mechanism of regulation of this gene by ...

  13. RNA preparation and characterization for gene expression studies

    DEFF Research Database (Denmark)

    Stangegaard, Michael

    2009-01-01

    Much information can be obtained from knowledge of the relative expression level of each gene in the transcriptome. With the current advances in technology as little as a single cell is required as starting material for gene expression experiments. The mRNA from a single cell may be linearly...

  14. Preliminary characterization of a death-related gene in silkworm ...

    African Journals Online (AJOL)

    Through RT-PCR analysis of death-related protein gene in different tissues and different developmental stage of B. mori, it showed the distributed condition of the gene. It was widely expressed in various tissues and mainly expressed in testis, malphigian vessels, posterior intestine, silk gland. Meanwhile, it was widely ...

  15. Molecular and Functional Characterization of Broccoli EMBRYONIC FLOWER 2 Genes

    Science.gov (United States)

    Chen, Long-Fang O.; Lin, Chun-Hung; Lai, Ying-Mi; Huang, Jia-Yuan; Sung, Zinmay Renee

    2012-01-01

    Polycomb group (PcG) proteins regulate major developmental processes in Arabidopsis. EMBRYONIC FLOWER 2 (EMF2), the VEFS domain-containing PcG gene, regulates diverse genetic pathways and is required for vegetative development and plant survival. Despite widespread EMF2-like sequences in plants, little is known about their function other than in Arabidopsis and rice. To study the role of EMF2 in broccoli (Brassica oleracea var. italica cv. Elegance) development, we identified two broccoli EMF2 (BoEMF2) genes with sequence homology to and a similar gene expression pattern to that in Arabidopsis (AtEMF2). Reducing their expression in broccoli resulted in aberrant phenotypes and gene expression patterns. BoEMF2 regulates genes involved in diverse developmental and stress programs similar to AtEMF2 in Arabidopsis. However, BoEMF2 differs from AtEMF2 in the regulation of flower organ identity, cell proliferation and elongation, and death-related genes, which may explain the distinct phenotypes. The expression of BoEMF2.1 in the Arabidopsis emf2 mutant (Rescued emf2) partially rescued the mutant phenotype and restored the gene expression pattern to that of the wild type. Many EMF2-mediated molecular and developmental functions are conserved in broccoli and Arabidopsis. Furthermore, the restored gene expression pattern in Rescued emf2 provides insights into the molecular basis of PcG-mediated growth and development. PMID:22537758

  16. DNA Characterization and Polymorphism of KISS1 Gene in Egyptian ...

    African Journals Online (AJOL)

    The objective of this study was the detection of the restriction fragment length polymorphism (RFLP) and single nucleotide polymorphisms (SNPs) of KISS1 gene in six major Egyptian small ruminant breeds. The primers used in this study flanked a 377 bp fragment from intron 1 of KISS1 gene in sheep and goat. These PCR ...

  17. Characterization of rainwater chemical composition after a Southeast Asia haze event: insight of transboundary pollutant transport during the northeast monsoon.

    Science.gov (United States)

    Nadzir, Mohd Shahrul Mohd; Lin, Chin Yik; Khan, Md Firoz; Latif, Mohd Talib; Dominick, Doreena; Hamid, Haris Hafizal Abdul; Mohamad, Noorlin; Maulud, Khairul Nizam Abdul; Wahab, Muhammad Ikram Abdul; Kamaludin, Nurul Farahana; Lazim, Mohamad Azwani Shah Mat

    2017-06-01

    Open biomass burning in Peninsula Malaysia, Sumatra, and parts of the Indochinese region is a major source of transboundary haze pollution in the Southeast Asia. To study the influence of haze on rainwater chemistry, a short-term investigation was carried out during the occurrence of a severe haze episode from March to April 2014. Rainwater samples were collected after a prolonged drought and analyzed for heavy metals and major ion concentrations using inductively coupled plasma mass spectroscopy (ICP-MS) and ion chromatography (IC), respectively. The chemical composition and morphology of the solid particulates suspended in rainwater were examined using a scanning electron microscope coupled with energy-dispersive X-ray spectroscopy (SEM-EDS). The dataset was further interpreted using enrichment factors (EF), statistical analysis, and a back trajectory (BT) model to find the possible sources of the particulates and pollutants. The results show a drop in rainwater pH from near neutral (pH 6.54) to acidic (

  18. Characterization of human cardiac myosin heavy chain genes

    International Nuclear Information System (INIS)

    Yamauchi-Takihara, K.; Sole, M.J.; Liew, J.; Ing, D.; Liew, C.C.

    1989-01-01

    The authors have isolated and analyzed the structure of the genes coding for the α and β forms of the human cardiac myosin heavy chain (MYHC). Detailed analysis of four overlapping MYHC genomic clones shows that the α-MYHC and β-MYHC genes constitute a total length of 51 kilobases and are tandemly linked. The β-MYHC-encoding gene, predominantly expressed in the normal human ventricle and also in slow-twitch skeletal muscle, is located 4.5 kilobases upstream of the α-MYHC-encoding gene, which is predominantly expressed in normal human atrium. The authors have determined the nucleotide sequences of the β form of the MYHC gene, which is 100% homologous to the cardiac MYHC cDNA clone (pHMC3). It is unlikely that the divergence of a few nucleotide sequences from the cardiac β-MYHC cDNA clone (pHMC3) reported in a MYHC cDNA clone (PSMHCZ) from skeletal muscle is due to a splicing mechanism. This finding suggests that the same β form of the cardiac MYHC gene is expressed in both ventricular and slow-twitch skeletal muscle. The promoter regions of both α- and β-MYHC genes, as well as the first four coding regions in the respective genes, have also been sequenced. The sequences in the 5'-flanking region of the α- and β-MYHC-encoding genes diverge extensively from one another, suggesting that expression of the α- and β-MYHC genes is independently regulated

  19. Seasonal changes in antifreeze protein gene transcription and water content of beetle Microdera punctipennis (Coleoptera, Tenebrionidae) from Gurbantonggut desert in Central Asia.

    Science.gov (United States)

    Hou, F; Ma, J; Liu, X; Wang, Y; Liu, X N; Zhang, F C

    2010-01-01

    Desert beetle Microdera punctipennis (Coleoptera: Tenebriondae) is a special species in Gurbantonggut Desert in Central Asia. To investigate the possible strategy it employs for cold survival, seasonal changes in supercooling point (SCP), body water content, haemolymph osmolality and antifreeze protein gene (Mpafp) expression were measured over 13 months. Our results show SCPs in M. punctipennis adults changed from -8.0°C in summer to -18.7°C in winter. During winter, adults endured modest water loss; total water decreased from 65.4 percent in summer to 55.9% in winter. Mpafp mRNAs level increased by 13.1 fold from summer to early winter, and haemolymph osmolality increased accordingly from 550 mOsm to 1486 mOsm. Correlation coefficient of Mpafp mRNAs level and SCP indicates that Mpafp mRNA explained 65.3 percent of the variation in SCPs. The correlation between Mpafp mRNA level and total water reflected an indirect influence of antifreeze protein on water content via reducing SCP.

  20. Identification and Characterization of Renal Cell Carcinoma Gene Markers

    Directory of Open Access Journals (Sweden)

    Louis S. Liou

    2007-01-01

    Full Text Available Microarray gene expression profiling has been used to distinguish histological subtypes of renal cell carcinoma (RCC, and consequently to identify specific tumor markers. The analytical procedures currently in use find sets of genes whose average differential expression across the two categories differ significantly. In general each of the markers thus identifi ed does not distinguish tumor from normal with 100% accuracy, although the group as a whole might be able to do so. For the purpose of developing a widely used economically viable diagnostic signature, however, large groups of genes are not likely to be useful. Here we use two different methods, one a support vector machine variant, and the other an exhaustive search, to reanalyze data previously generated in our Lab (Lenburg et al. 2003. We identify 158 genes, each having an expression level that is higher (lower in every tumor sample than in any normal sample, and each having a minimum differential expression across the two categorie at a signifi cance of 0.01. The set is highly enriched in cancer related genes (p = 1.6 × 10 – 12, containing 43 genes previously associated with either RCC or other types of cancer. Many of the biomarkers appear to be associated with the central alterations known to be required for cancer transformation. These include the oncogenes JAZF1, AXL, ABL2; tumor suppressors RASD1, PTPRO, TFAP2A, CDKN1C; and genes involved in proteolysis or cell-adhesion such as WASF2, and PAPPA.

  1. Disease gene characterization through large-scale co-expression analysis.

    Directory of Open Access Journals (Sweden)

    Allen Day

    2009-12-01

    Full Text Available In the post genome era, a major goal of biology is the identification of specific roles for individual genes. We report a new genomic tool for gene characterization, the UCLA Gene Expression Tool (UGET.Celsius, the largest co-normalized microarray dataset of Affymetrix based gene expression, was used to calculate the correlation between all possible gene pairs on all platforms, and generate stored indexes in a web searchable format. The size of Celsius makes UGET a powerful gene characterization tool. Using a small seed list of known cartilage-selective genes, UGET extended the list of known genes by identifying 32 new highly cartilage-selective genes. Of these, 7 of 10 tested were validated by qPCR including the novel cartilage-specific genes SDK2 and FLJ41170. In addition, we retrospectively tested UGET and other gene expression based prioritization tools to identify disease-causing genes within known linkage intervals. We first demonstrated this utility with UGET using genetically heterogeneous disorders such as Joubert syndrome, microcephaly, neuropsychiatric disorders and type 2 limb girdle muscular dystrophy (LGMD2 and then compared UGET to other gene expression based prioritization programs which use small but discrete and well annotated datasets. Finally, we observed a significantly higher gene correlation shared between genes in disease networks associated with similar complex or Mendelian disorders.UGET is an invaluable resource for a geneticist that permits the rapid inclusion of expression criteria from one to hundreds of genes in genomic intervals linked to disease. By using thousands of arrays UGET annotates and prioritizes genes better than other tools especially with rare tissue disorders or complex multi-tissue biological processes. This information can be critical in prioritization of candidate genes for sequence analysis.

  2. Microbiological characterization of aquatic microbiomes targeting taxonomical marker genes and antibiotic resistance genes of opportunistic bacteria.

    Science.gov (United States)

    Alexander, Johannes; Bollmann, Anna; Seitz, Wolfram; Schwartz, Thomas

    2015-04-15

    The dissemination of medically relevant antibiotic resistance genes (ARGs) (blaVIM-1, vanA, ampC, ermB, and mecA) and opportunistic bacteria (Enterococcus faecium/faecalis, Pseudomonas aeruginosa, Enterobacteriaceae, Staphylococcus aureus, and CNS) was determined in different anthropogenically influenced aquatic habitats in a selected region of Germany. Over a period of two years, four differently sized wastewater treatment plants (WWTPs) with and without clinical influence, three surface waters, four rain overflow basins, and three groundwater sites were analyzed by quantitative Polymerase Chain Reaction (qPCR). Results were calculated in cell equivalents per 100 ng of total DNA extracted from water samples and per 100 mL sample volume, which seems to underestimate the abundance of antibiotic resistance and opportunistic bacteria. High abundances of opportunistic bacteria and ARG were quantified in clinical wastewaters and influents of the adjacent WWTP. The removal capacities of WWTP were up to 99% for some, but not all investigated bacteria. The abundances of most ARG targets were found to be increased in the bacterial population after conventional wastewater treatment. As a consequence, downstream surface water and also some groundwater compartments displayed high abundances of all four ARGs. It became obvious that the dynamics of the ARG differed from the fate of the opportunistic bacteria. This underlines the necessity of an advanced microbial characterization of anthropogenically influenced environments. Copyright © 2015 Elsevier B.V. All rights reserved.

  3. Identification and characterization of human GUKH2 gene in silico.

    Science.gov (United States)

    Katoh, Masuko; Katoh, Masaru

    2004-04-01

    Drosophila Guanylate-kinase holder (Gukh) is an adaptor molecule bridging Discs large (Dlg) and Scribble (Scrib), which are implicated in the establishment and maintenance of epithelial polarity. Here, we searched for human homologs of Drosophila gukh by using bioinformatics, and identified GUKH1 and GUKH2 genes. GUKH1 was identical to Nance-Horan syndrome (NHS) gene, while GUKH2 was a novel gene. FLJ35425 (AK092744.1), DKFZp686P1949 (BX647246.1) and KIAA1357 (AB037778.1) cDNAs were derived from human GUKH2 gene. Nucleotide sequence of GUKH2 cDNA was determined by assembling 5'-part of FLJ35425 cDNA and entire region of DKFZp686P1949 cDNA. Human GUKH2 gene consists of 8 exons. Exon 5 (132 bp) of GUKH2 gene was spliced out in GUKH2 cDNA due to alternative splicing. GUKH2-REPS1 locus at human chromosome 6q24.1 and GUKH1-REPS2 locus at human chromosome Xp22.22-p22.13 are paralogous regions within the human genome. Mouse Gukh2 and zebrafish gukh2 genes were also identified. N-terminal part of human GUKH2, mouse Gukh2 and zebrafish gukh2 proteins were completely divergent from human GUKH1 protein. Human GUKH2 and GUKH1, consisting of eight GUKH homology (GKH1-GKH8) domains and Proline-rich domain, showed 28.5% total-amino-acid identity. GKH1, GKH4, GKH5, GKH7 and GKH8 domains were conserved among human GUKH1, human GUKH2 and Drosophila Gukh. Because human homologs of Drosophila dlg (DLG1-DLG7) as well as human homologs of Drosophila scrib (SCRIB, ERBB2IP and Densin-180) are cancer-associated genes, human homologs of Drosophila gukh (GUKH1 and GUKH2) are predicted cancer-associated genes.

  4. Characterization of LeCOP1 gene in Lycopersicon esculentum ...

    African Journals Online (AJOL)

    uwerhiavwe

    mechanisms of stress tolerance (Yamaguchi and. Shinozaki, 2005 .... reverse transcribed in the presence of Oligo(dT) and 9-mer random primer in a volume ..... Engineering drought tolerance in plants: discovering and tailoring genes to unlock ...

  5. Cloning and characterization of a nitrite reductase gene related to ...

    African Journals Online (AJOL)

    STORAGESEVER

    2010-03-01

    Mar 1, 2010 ... Alexander et al., 2005) and heme-type nitrite reductase gene (Smith and ... owing to a genotype-dependent response (Zhang et al.,. 1991; Sakhanokho et al., ..... Improvement of cell culture conditions for rice. Jpn. Agric. Res.

  6. Characterization of low-molecular-weight glutenin subunit genes of ...

    Indian Academy of Sciences (India)

    2015-09-16

    Sep 16, 2015 ... 4Ministry of Education, Key Laboratory for Crop Genetic Resources and Improvement in Southwest China, ... gene mining have also been conducted in Aegilops genus, ... sites and pair-wise deletion for gaps/missing data.

  7. Isolation and characterization of a gene encoding a polyethylene ...

    Indian Academy of Sciences (India)

    Prakash

    Environmental stresses such as drought, cold and salinity have an enormous ... mechanisms is that a gene must be inducible in response to an external threat, to ..... of CPs known in plants. The others are legumain (C13), calcium-dependent.

  8. Molecular characterization of leptin (obese) gene in domesticated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-03-06

    Mar 6, 2009 ... National Bureau of Animal Genetic Resources, Karnal, ... Leptin is obesity gene involved in production and reproduction traits in domestic animals. In the ..... leptin concentration, growth, feed intake, feeding behavior, and.

  9. Molecular characterization, expression profile of the FSHR gene and ...

    Indian Academy of Sciences (India)

    2016-10-24

    Oct 24, 2016 ... gene(internal control), respectively.P5~P13 ... The obtained RNA quality was detected by 1.5% agarose gel electrophoresis and the concentration was ... sequenced by a commercial service (Majorbio Co. Ltd, Shanghai).

  10. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    xudelin

    2012-05-17

    May 17, 2012 ... Real-time polymerase chain reaction (PCR) showed that. CreV8 was expressed .... Two housekeeping genes (GAPDH and actin) were used as interior references for accuracy ..... Future world supply and demand. Loivoisier ...

  11. DNA characterization and polymorphism of KISS1 gene in Egyptian ...

    African Journals Online (AJOL)

    Aghomotsegin

    2015-07-29

    Jul 29, 2015 ... effect on litter size performance and many studies were carried out to identify ... gene (Wang et al., 2011), kit ligand (KITLG) gene (An et al., 2012) and bone ..... An XP, Han P, HouJX, Zhao HB, Yan Y, Ma T, Fang F, MengFX, Song. YX, Wang JG ... Chu MX, Zhao XH, Zhang YJ, Jin M (2010). Polymorphisms ...

  12. Characterization of the largest effector gene cluster of Ustilago maydis.

    Directory of Open Access Journals (Sweden)

    Thomas Brefort

    2014-07-01

    Full Text Available In the genome of the biotrophic plant pathogen Ustilago maydis, many of the genes coding for secreted protein effectors modulating virulence are arranged in gene clusters. The vast majority of these genes encode novel proteins whose expression is coupled to plant colonization. The largest of these gene clusters, cluster 19A, encodes 24 secreted effectors. Deletion of the entire cluster results in severe attenuation of virulence. Here we present the functional analysis of this genomic region. We show that a 19A deletion mutant behaves like an endophyte, i.e. is still able to colonize plants and complete the infection cycle. However, tumors, the most conspicuous symptoms of maize smut disease, are only rarely formed and fungal biomass in infected tissue is significantly reduced. The generation and analysis of strains carrying sub-deletions identified several genes significantly contributing to tumor formation after seedling infection. Another of the effectors could be linked specifically to anthocyanin induction in the infected tissue. As the individual contributions of these genes to tumor formation were small, we studied the response of maize plants to the whole cluster mutant as well as to several individual mutants by array analysis. This revealed distinct plant responses, demonstrating that the respective effectors have discrete plant targets. We propose that the analysis of plant responses to effector mutant strains that lack a strong virulence phenotype may be a general way to visualize differences in effector function.

  13. Cloning and Characterization of Genes that Inhibit TRAIL-Induced Apoptosis of Breast Cancer Cells

    National Research Council Canada - National Science Library

    Shu, Hong-Bing

    2003-01-01

    ...). However, some cancer cells are resistant to TRAIL-induced apoptosis (3, 4, 6-13). The purpose of this proposed study is to clone and characterize such inhibitory genes of TRAIL-induced apoptosis...

  14. A nucleotide substitution at the 5′ splice site of intron 1 of rice HEADING DATE 1 (HD1 gene homolog in foxtail millet, broadly found in landraces from Europe and Asia

    Directory of Open Access Journals (Sweden)

    Kenji Fukunaga

    2015-12-01

    Full Text Available We investigated genetic variation of a rice HEADING DATE 1(HD1 homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.

  15. Further characterization of the ABR gene in medulloblastoma

    Energy Technology Data Exchange (ETDEWEB)

    Wright-White, E.C.; Haken, M.S. von; McDonald J.D. [Univ. of Chicago, IL (United States)] [and others

    1994-09-01

    Although brain tumors are the most common type of solid cancer in children, little is known about their etiology at the molecular genetic level. Using a panel of 20 chromosome 17p markers, we have previously determined that loss of distal chromosome 17p DNA sequences occurs in 14 of 35 specimens (40%) of medulloblastoma, one of the most common pediatric intracranial neoplasms. Analysis of these same tumors using a PCR-denaturing gradient gel electrophoresis technique has shown only two p53 gene mutations. These results suggest that a tumor suppressor gene in addition to p53 may be located on distal chromosome 17p. Consensus deletion mapping of our specimens suggests that the smallest site of chromosomal loss in defined distally by marker 144-D6, the most telomeric probe as yet identified on chromosome 17p, and proximally by the ABR marker, a BCR homologous gene containing two highly polymorphic VNTR regions. We have used fluorescence in situ hybridization and pulsed-field gel electrophoresis to determine that the ABR gene lies transcriptionally oriented 5{prime} to 3{prime} at a distance of 240 kb from marker 144-D6. We have also constructed a cosmid contig map spanning 120 kb of this region. Using one of these cosmids as a probe, we have detected breakpoints in three of the tumor specimens that lie between the two VNTR regions within the ABR gene. We have subsequently designed PCR primers to cover the breakpoint region which include the ABR exons which have the strongest homology to the BCR gene (Mbcr region), and are screening our tumor specimens for mutations. These results suggest that loss of ABR gene sequences may be involved in the etiology of medulloblastoma.

  16. Characterization of a novel autophagy-specific gene, ATG29

    International Nuclear Information System (INIS)

    Kawamata, Tomoko; Kamada, Yoshiaki; Suzuki, Kuninori; Kuboshima, Norihiro; Akimatsu, Hiroshi; Ota, Shinichi; Ohsumi, Mariko; Ohsumi, Yoshinori

    2005-01-01

    Autophagy is a process whereby cytoplasmic proteins and organelles are sequestered for bulk degradation in the vacuole/lysosome. At present, 16 ATG genes have been found that are essential for autophagosome formation in the yeast Saccharomyces cerevisiae. Most of these genes are also involved in the cytoplasm to vacuole transport pathway, which shares machinery with autophagy. Most Atg proteins are colocalized at the pre-autophagosomal structure (PAS), from which the autophagosome is thought to originate, but the precise mechanism of autophagy remains poorly understood. During a genetic screen aimed to obtain novel gene(s) required for autophagy, we identified a novel ORF, ATG29/YPL166w. atg29Δ cells were sensitive to starvation and induction of autophagy was severely retarded. However, the Cvt pathway operated normally. Therefore, ATG29 is an ATG gene specifically required for autophagy. Additionally, an Atg29-GFP fusion protein was observed to localize to the PAS. From these results, we propose that Atg29 functions in autophagosome formation at the PAS in collaboration with other Atg proteins

  17. Generation and characterization of P gene-deficient rabies virus

    International Nuclear Information System (INIS)

    Shoji, Youko; Inoue, Satoshi; Nakamichi, Kazuo; Kurane, Ichiro; Sakai, Takeo; Morimoto, Kinjiro

    2004-01-01

    Rabies virus (RV) deficient in the P gene was generated by reverse genetics from cDNA of HEP-Flury strain lacking the entire P gene. The defective virus was propagated and amplified by rescue of virus, using a cell line that complemented the functions of the deficient gene. The P gene-deficient (def-P) virus replicated its genome and produced progeny viruses in the cell lines that constitutively expressed the P protein, although it grew at a slightly retarded rate compared to the parental strain. In contrast, no progeny virus was produced in the infected host when the def-P virus-infected cells that did not express the P protein. However, we found that the def-P virus had the ability to perform primary transcription (by the virion-associated polymerase) in the infected host without de novo P protein synthesis. The def-P virus was apathogenic in adult and suckling mice, even when inoculated intracranially. Inoculation of def-P virus in mice induced high levels of virus-neutralizing antibody (VNA) and conferred protective immunity against a lethal rabies infection. These results demonstrate the potential utility of gene-deficient virus as a novel live attenuated rabies vaccine

  18. Characterization and expression of the calpastatin gene in Cyprinus carpio.

    Science.gov (United States)

    Chen, W X; Ma, Y

    2015-07-03

    Calpastatin, an important protein used to regulate meat quality traits in animals, is encoded by the CAST gene. The aim of the present study was to clone the cDNA sequence of the CAST gene and detect the expression of CAST in the tissues of Cyprinus carpio. The cDNA of the C. carpio CAST gene, amplified using rapid amplification of cDNA ends PCR, is 2834 bp in length (accession No. JX275386), contains a 2634-bp open reading frame, and encodes a protein with 877 amino acid residues. The amino acid sequence of the C. carpio CAST gene was 88, 80, and 59% identical to the sequences observed in grass carp, zebrafish, and other fish, respectively. The C. carpio CAST was observed to contain four conserved domains with 54 serine phosphorylation loci, 28 threonine phosphorylation loci, 1 tyrosine phosphorylation loci, and 6 specific protein kinase C phosphorylation loci. The CAST gene showed widespread expression in different tissues of C. carpio. Surprisingly, the relative expression of the CAST transcript in the muscle and heart tissues of C. carpio was significantly higher than in other tissues (P < 0.01).

  19. Molecular characterization of the porcine surfactant, pulmonary-associated protein C gene

    DEFF Research Database (Denmark)

    Cirera, S.; Nygård, A.B.; Jensen, H.E.

    2006-01-01

    The surfactant, pulmonary-associated protein C (SFTPC) is a peptide secreted by the alveolar type II pneumocytes of the lung. We have characterized the porcine SFTPC gene at genomic, transcriptional, and protein levels. The porcine SFTPC is a single-copy gene on pig chromosome 14. Two transcripts...

  20. Isolation and characterization of CNGC17 gene from Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Yamagami, Mutsumi; Kobayashi, Daisuke; Hisamatsu, Shun'ichi

    2007-01-01

    Phytoremediation is a possible countermeasure for cleaning up soil contaminated by 137 Cs, and development of plants which can effectively absorb 137 Cs is important for it. It is expected that capability of Cs extraction from soil can be strengthened by genetic alteration of the Cs + root-uptake mechanism of plants. This study aimed at elucidating the uptake mechanism of Cs + for future genetic engineering. Plant roots take up Cs + from the soil solution via transport proteins at the plasma membrane of root cells. Voltage-insensitive cation channels (VICCs) are a possible transfer route of Cs + , and they are encoded by cyclic-nucleotide gated channel (CNGC) and glutamate receptor (GLR) gene families. The genome of Arabidopsis thaliana contains 20 CNGC genes. We have cloned a putative AtCNGC17 gene from cDNAs which were generated with total-RNA obtained from leaves of Arabidopsis thaliana by RT-PCR. The cDNA contained 2163 bp with an ORF that encoded a protein consisting of 721 amino acids residues. The plasmid prepared by the insertion of the gene under a Taq promoter was used to transform an E. coli deficient in the three major K + uptake systems (Kdp, Trk, and Kup). Only the E. coli with AtCNGC17 gene grew in low K + concentration minimal medium. This result suggested that the AtCNGC17 protein has a function of K + uptake. Growth rates of the E. coli cells expressing the gene were strongly inhibited by CsCl in low K + concentration minimal medium, suggesting that the AtCNGC17 transporter also carries Cs + . (author)

  1. Characterization of the human gene (TBXAS1) encoding thromboxane synthase.

    Science.gov (United States)

    Miyata, A; Yokoyama, C; Ihara, H; Bandoh, S; Takeda, O; Takahashi, E; Tanabe, T

    1994-09-01

    The gene encoding human thromboxane synthase (TBXAS1) was isolated from a human EMBL3 genomic library using human platelet thromboxane synthase cDNA as a probe. Nucleotide sequencing revealed that the human thromboxane synthase gene spans more than 75 kb and consists of 13 exons and 12 introns, of which the splice donor and acceptor sites conform to the GT/AG rule. The exon-intron boundaries of the thromboxane synthase gene were similar to those of the human cytochrome P450 nifedipine oxidase gene (CYP3A4) except for introns 9 and 10, although the primary sequences of these enzymes exhibited 35.8% identity each other. The 1.2-kb of the 5'-flanking region sequence contained potential binding sites for several transcription factors (AP-1, AP-2, GATA-1, CCAAT box, xenobiotic-response element, PEA-3, LF-A1, myb, basic transcription element and cAMP-response element). Primer-extension analysis indicated the multiple transcription-start sites, and the major start site was identified as an adenine residue located 142 bases upstream of the translation-initiation site. However, neither a typical TATA box nor a typical CAAT box is found within the 100-b upstream of the translation-initiation site. Southern-blot analysis revealed the presence of one copy of the thromboxane synthase gene per haploid genome. Furthermore, a fluorescence in situ hybridization study revealed that the human gene for thromboxane synthase is localized to band q33-q34 of the long arm of chromosome 7. A tissue-distribution study demonstrated that thromboxane synthase mRNA is widely expressed in human tissues and is particularly abundant in peripheral blood leukocyte, spleen, lung and liver. The low but significant levels of mRNA were observed in kidney, placenta and thymus.

  2. Molecular characterization of Azotobacter spp. nifH gene Isolated ...

    African Journals Online (AJOL)

    STORAGESEVER

    2009-12-15

    Dec 15, 2009 ... Available online at http://www.academicjournals.org/AJB. ISSN 1684–5315 ... Molecular characterization of Azotobacter spp. nifH .... MATERIALS AND METHODS ..... rapidly expanding and is currently composed of over.

  3. Molecular characterization of rpoB gene encoding the RNA ...

    African Journals Online (AJOL)

    Polymerase chain reaction (PCR) mediated direct DNA sequencing was evaluated for rapid detection of Rifampicin resistance (RMPr) of Mycobacterium tuberculosis. After amplification of the rpoB gene, the product was sequenced using ABI 310 Genetic Analyzer and the rifampicin resistance in M. tuberculosis were ...

  4. Characterization of Conserved and Nonconserved Imprinted Genes in Swine

    Science.gov (United States)

    Genomic imprinting results in the silencing of a subset of mammalian alleles due to parent-of-origin inheritance. Due to the nature of their expression patterns they play a critical role in placental and early embryonic development. In order to increase our understanding of imprinted genes specifi...

  5. Cloning and characterization of an insecticidal crystal protein gene ...

    Indian Academy of Sciences (India)

    A 1.9-kb DNA fragment, PCR-amplified from HD549 using cryII-gene-specific primers, was cloned and expressed in E. coli. The recombinant protein produced 92% mortality in first-instar larvae of Spodoptera litura and 86% inhibition of adult emergence in Phthorimaea operculella, but showed very low toxicity against ...

  6. Molecular cloning and characterization of a new peroxidase gene ...

    African Journals Online (AJOL)

    length cDNA of O.violaceus peroxidase gene (OvRCI, GenBank. Acc. No. AY428037) was 1220 bp and contained an 1128 bp open reading frame encoding a protein of 375 amino acids. Homology analysis and molecular modeling revealed that ...

  7. Molecular cloning and characterization of a gene encoding RING ...

    Indian Academy of Sciences (India)

    PRAKASH KUMAR G

    such as BRCA1 (a product of a breast cancer-associated gene) and Cb1 ... research has indicated that ubiquitination mediated by the ... environment and is unique to China. Since it is ..... benefit the normal biological function of the plant. We.

  8. Identification and characterization of a gene encoding a putative ...

    Indian Academy of Sciences (India)

    2012-10-30

    Oct 30, 2012 ... Genetic Improvement of Oil Crops, Ministry of Agriculture, Wuhan 430062, China. 2Institute of ... Its encoding gene is an essential candidate for oil crops to .... higher level in leaves than in other organs (Kim and Huang. 2004) ...

  9. Cloning and functional characterization of a class III chitinase gene ...

    African Journals Online (AJOL)

    Analysis of the VvChiF III amino acid sequence showed that this gene corresponds to the Glyco-hydro-18 super family that consisting of a signal peptide with the length of 25 amino acids. Purified VvChiF III showed chitinase activity toward the soluble substrate, glycolchitin and antifungal activity against Botrytis cinerea.

  10. Characterization of low-molecular-weight glutenin subunit genes of ...

    Indian Academy of Sciences (India)

    Supplementary data, J. Genet. 94, 497–501. Table 2. LMW-GS genes obtained in this study. Species. Accession no. Clone. Length (bp). Sequence similarity. Ae. bicornis. CIae 47. Sb47-1. 1053. EU189089 96% T. aestivum. (SbSb). Sb47-2. 1053. EU189089 96% T. aestivum. Sb47-3. 1053. EU305550 97% Ae. longissima.

  11. Isolation and characterization of a candidate gene for resistance to ...

    African Journals Online (AJOL)

    ARC) domain, and a leucine-rich repeat (LRR) domain, all of which are typical characteristics of resistance genes. We proposed the resistance mechanism of CreV8 based on functional analysis and predictions from its conserved domains and ...

  12. Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.

    Science.gov (United States)

    He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan

    2012-07-01

    WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.

  13. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS

    Directory of Open Access Journals (Sweden)

    Lawton Jennifer

    2012-03-01

    Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub

  14. Characterization of Soybean WRKY Gene Family and Identification of Soybean WRKY Genes that Promote Resistance to Soybean Cyst Nematode.

    Science.gov (United States)

    Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang

    2017-12-19

    WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.

  15. Isolation and characterization of the human uracil DNA glycosylase gene

    International Nuclear Information System (INIS)

    Vollberg, T.M.; Siegler, K.M.; Cool, B.L.; Sirover, M.A.

    1989-01-01

    A series of anti-human placental uracil DNA glycosylase monoclonal antibodies was used to screen a human placental cDNA library in phage λgt11. Twenty-seven immunopositive plaques were detected and purified. One clone containing a 1.2-kilobase (kb) human cDNA insert was chosen for further study by insertion into pUC8. The resultant recombinant plasmid selected by hybridization a human placental mRNA that encoded a 37-kDa polypeptide. This protein was immunoprecipitated specifically by an anti-human placenta uracil DNA glycosylase monoclonal antibody. RNA blot-hybridization (Northern) analysis using placental poly(A) + RNA or total RNA from four different human fibroblast cell strains revealed a single 1.6-kb transcript. Genomic blots using DNA from each cell strain digested with either EcoRI or PstI revealed a complex pattern of cDNA-hydridizing restriction fragments. The genomic analysis for each enzyme was highly similar in all four human cell strains. In contrast, a single band was observed when genomic analysis was performed with the identical DNA digests with an actin gene probe. During cell proliferation there was an increase in the level of glycosylase mRNA that paralleled the increase in uracil DNA glycosylase enzyme activity. The isolation of the human uracil DNA glycosylase gene permits an examination of the structure, organization, and expression of a human DNA repair gene

  16. Characterization of the hepcidin gene in eight species of bats.

    Science.gov (United States)

    Stasiak, Iga M; Smith, Dale A; Crawshaw, Graham J; Hammermueller, Jutta D; Bienzle, Dorothee; Lillie, Brandon N

    2014-02-01

    Hemochromatosis, or iron storage disease, has been associated with significant liver disease and mortality in captive Egyptian fruit bats (Rousettus aegyptiacus). The physiologic basis for this susceptibility has not been established. In humans, a deficiency or resistance to the iron regulatory hormone, hepcidin has been implicated in the development of hereditary hemochromatosis. In the present study, we compared the coding sequence of the hepcidin gene in eight species of bats representing three distinct taxonomic families with diverse life histories and dietary preferences. Bat hepcidin mRNA encoded a 23 amino acid signal peptide, a 34 or 35 amino acid pro-region, and a 25 amino acid mature peptide, similar to other mammalian species. Differences in the sequence of the portion of the hepcidin gene that encodes the mature peptide that might account for the increased susceptibility of the Egyptian fruit bat to iron storage disease were not identified. Variability in gene sequence corresponded to the taxonomic relationship amongst species. Copyright © 2013 Elsevier Ltd. All rights reserved.

  17. Molecular Characterization and Expression Analysis of Equine ( Gene in Horse (

    Directory of Open Access Journals (Sweden)

    Ki-Duk Song

    2014-05-01

    Full Text Available The objective of this study was to determine the molecular characteristics of the horse vascular endothelial growth factor alpha gene (VEGFα by constructing a phylogenetic tree, and to investigate gene expression profiles in tissues and blood leukocytes after exercise for development of suitable biomarkers. Using published amino acid sequences of other vertebrate species (human, chimpanzee, mouse, rat, cow, pig, chicken and dog, we constructed a phylogenetic tree which showed that equine VEGFα belonged to the same clade of the pig VEGFα. Analysis for synonymous (Ks and non-synonymous substitution ratios (Ka revealed that the horse VEGFα underwent positive selection. RNA was extracted from blood samples before and after exercise and different tissue samples of three horses. Expression analyses using reverse transcription-polymerase chain reaction (RT-PCR and quantitative-polymerase chain reaction (qPCR showed ubiquitous expression of VEGFα mRNA in skeletal muscle, kidney, thyroid, lung, appendix, colon, spinal cord, and heart tissues. Analysis of differential expression of VEGFα gene in blood leukocytes after exercise indicated a unimodal pattern. These results will be useful in developing biomarkers that can predict the recovery capacity of racing horses.

  18. WRKY domain-encoding genes of a crop legume chickpea (Cicer arietinum): comparative analysis with Medicago truncatula WRKY family and characterization of group-III gene(s).

    Science.gov (United States)

    Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar

    2016-06-01

    The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  19. Molecular cloning and characterization of genes required for nucleotide excision repair in yeast

    International Nuclear Information System (INIS)

    Friedberg, E.C.

    1987-01-01

    Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies

  20. Gene Co-expression Analysis to Characterize Genes Related to Marbling Trait in Hanwoo (Korean) Cattle.

    Science.gov (United States)

    Lim, Dajeong; Lee, Seung-Hwan; Kim, Nam-Kuk; Cho, Yong-Min; Chai, Han-Ha; Seong, Hwan-Hoo; Kim, Heebal

    2013-01-01

    Marbling (intramuscular fat) is an important trait that affects meat quality and is a casual factor determining the price of beef in the Korean beef market. It is a complex trait and has many biological pathways related to muscle and fat. There is a need to identify functional modules or genes related to marbling traits and investigate their relationships through a weighted gene co-expression network analysis based on the system level. Therefore, we investigated the co-expression relationships of genes related to the 'marbling score' trait and systemically analyzed the network topology in Hanwoo (Korean cattle). As a result, we determined 3 modules (gene groups) that showed statistically significant results for marbling score. In particular, one module (denoted as red) has a statistically significant result for marbling score (p = 0.008) and intramuscular fat (p = 0.02) and water capacity (p = 0.006). From functional enrichment and relationship analysis of the red module, the pathway hub genes (IL6, CHRNE, RB1, INHBA and NPPA) have a direct interaction relationship and share the biological functions related to fat or muscle, such as adipogenesis or muscle growth. This is the first gene network study with m.logissimus in Hanwoo to observe co-expression patterns in divergent marbling phenotypes. It may provide insights into the functional mechanisms of the marbling trait.

  1. Gene Co-expression Analysis to Characterize Genes Related to Marbling Trait in Hanwoo (Korean Cattle

    Directory of Open Access Journals (Sweden)

    Dajeong Lim

    2013-01-01

    Full Text Available Marbling (intramuscular fat is an important trait that affects meat quality and is a casual factor determining the price of beef in the Korean beef market. It is a complex trait and has many biological pathways related to muscle and fat. There is a need to identify functional modules or genes related to marbling traits and investigate their relationships through a weighted gene co-expression network analysis based on the system level. Therefore, we investigated the co-expression relationships of genes related to the ‘marbling score’ trait and systemically analyzed the network topology in Hanwoo (Korean cattle. As a result, we determined 3 modules (gene groups that showed statistically significant results for marbling score. In particular, one module (denoted as red has a statistically significant result for marbling score (p = 0.008 and intramuscular fat (p = 0.02 and water capacity (p = 0.006. From functional enrichment and relationship analysis of the red module, the pathway hub genes (IL6, CHRNE, RB1, INHBA and NPPA have a direct interaction relationship and share the biological functions related to fat or muscle, such as adipogenesis or muscle growth. This is the first gene network study with m.logissimus in Hanwoo to observe co-expression patterns in divergent marbling phenotypes. It may provide insights into the functional mechanisms of the marbling trait.

  2. Are South East Asia Countries Capital Markets Characterized by Nonlinear Structures? An Investigation from Indonesia, Philippine and Singapore Capital Market Indices

    OpenAIRE

    Minarnita Yanti Verawati Bakara; Bambang Hermanto

    2014-01-01

    This research paper tries to detect the nonlinear structure in the South East Asia Countries Capital Markets. The capital markets of three South East Asia Countries are chosen: Indonesia, Philippine, and Singapore. Daily return data of Capital Markets composite indices are observed: Straits Times Index (STI) of Singapore Exchange from January 04, 1985 to December 31, 2007, Pilipino Stock Exchange Index (PSEi) of Philippines Stock Exchange from March 1, 1990 to December 31, 2007 and Jakarta Co...

  3. Cloning and functional characterization of SAD genes in potato.

    Science.gov (United States)

    Li, Fei; Bian, Chun Song; Xu, Jian Fei; Pang, Wan Fu; Liu, Jie; Duan, Shao Guang; Lei, Zun-Guo; Jiwan, Palta; Jin, Li-Ping

    2015-01-01

    Stearoyl-acyl carrier protein desaturase (SAD), locating in the plastid stroma, is an important fatty acid biosynthetic enzyme in higher plants. SAD catalyzes desaturation of stearoyl-ACP to oleyl-ACP and plays a key role in determining the homeostasis between saturated fatty acids and unsaturated fatty acids, which is an important player in cold acclimation in plants. Here, four new full-length cDNA of SADs (ScoSAD, SaSAD, ScaSAD and StSAD) were cloned from four Solanum species, Solanum commersonii, S. acaule, S. cardiophyllum and S. tuberosum, respectively. The ORF of the four SADs were 1182 bp in length, encoding 393 amino acids. A sequence alignment indicated 13 amino acids varied among the SADs of three wild species. Further analysis showed that the freezing tolerance and cold acclimation capacity of S. commersonii are similar to S. acaule and their SAD amino acid sequences were identical but differed from that of S. cardiophyllum, which is sensitive to freezing. Furthermore, the sequence alignments between StSAD and ScoSAD indicated that only 7 different amino acids at residues were found in SAD of S. tuberosum (Zhongshu8) against the protein sequence of ScoSAD. A phylogenetic analysis showed the three wild potato species had the closest genetic relationship with the SAD of S. lycopersicum and Nicotiana tomentosiformis but not S. tuberosum. The SAD gene from S. commersonii (ScoSAD) was cloned into multiple sites of the pBI121 plant binary vector and transformed into the cultivated potato variety Zhongshu 8. A freeze tolerance analysis showed overexpression of the ScoSAD gene in transgenic plants significantly enhanced freeze tolerance in cv. Zhongshu 8 and increased their linoleic acid content, suggesting that linoleic acid likely plays a key role in improving freeze tolerance in potato plants. This study provided some new insights into how SAD regulates in the freezing tolerance and cold acclimation in potato.

  4. Molecular characterization of edestin gene family in Cannabis sativa L.

    Science.gov (United States)

    Docimo, Teresa; Caruso, Immacolata; Ponzoni, Elena; Mattana, Monica; Galasso, Incoronata

    2014-11-01

    Globulins are the predominant class of seed storage proteins in a wide variety of plants. In many plant species globulins are present in several isoforms encoded by gene families. The major seed storage protein of Cannabis sativa L. is the globulin edestin, widely known for its nutritional potential. In this work, we report the isolation of seven cDNAs encoding for edestin from the C. sativa variety Carmagnola. Southern blot hybridization is in agreement with the number of identified edestin genes. All seven sequences showed the characteristic globulin features, but they result to be divergent members/forms of two edestin types. According to their sequence similarity four forms named CsEde1A, CsEde1B, CsEde1C, CsEde1D have been assigned to the edestin type 1 and the three forms CsEde2A, CsEde2B, CsEde2C to the edestin type 2. Analysis of the coding sequences revealed a high percentage of similarity (98-99%) among the different forms belonging to the same type, which decreased significantly to approximately 64% between the forms belonging to different types. Quantitative RT-PCR analysis revealed that both edestin types are expressed in developing hemp seeds and the amount of CsEde1 was 4.44 ± 0.10 higher than CsEde2. Both edestin types exhibited a high percentage of arginine (11-12%), but CsEde2 resulted particularly rich in methionine residues (2.36%) respect to CsEde1 (0.82%). The amino acid composition determined in CsEde1 and CsEde2 types suggests that these seed proteins can be used to improve the nutritional quality of plant food-stuffs. Copyright © 2014 Elsevier Masson SAS. All rights reserved.

  5. Identification and Characterization of Mouse Otic Sensory Lineage Genes

    Directory of Open Access Journals (Sweden)

    Byron H. Hartman

    2015-03-01

    Full Text Available Vertebrate embryogenesis gives rise to all cell types of an organism through the development of many unique lineages derived from the three primordial germ layers. The otic sensory lineage arises from the otic vesicle, a structure formed through invagination of placodal non-neural ectoderm. This developmental lineage possesses unique differentiation potential, giving rise to otic sensory cell populations including hair cells, supporting cells, and ganglion neurons of the auditory and vestibular organs. Here we present a systematic approach to identify transcriptional features that distinguish the otic sensory lineage (from early otic progenitors to otic sensory populations from other major lineages of vertebrate development. We used a microarray approach to analyze otic sensory lineage populations including microdissected otic vesicles (embryonic day 10.5 as well as isolated neonatal cochlear hair cells and supporting cells at postnatal day 3. Non-otic tissue samples including periotic tissues and whole embryos with otic regions removed were used as reference populations to evaluate otic specificity. Otic populations shared transcriptome-wide correlations in expression profiles that distinguish members of this lineage from non-otic populations. We further analyzed the microarray data using comparative and dimension reduction methods to identify individual genes that are specifically expressed in the otic sensory lineage. This analysis identified and ranked top otic sensory lineage-specific transcripts including Fbxo2, Col9a2, and Oc90, and additional novel otic lineage markers. To validate these results we performed expression analysis on select genes using immunohistochemistry and in situ hybridization. Fbxo2 showed the most striking pattern of specificity to the otic sensory lineage, including robust expression in the early otic vesicle and sustained expression in prosensory progenitors and auditory and vestibular hair cells and supporting

  6. Cloning and functional characterization of SAD genes in potato.

    Directory of Open Access Journals (Sweden)

    Fei Li

    Full Text Available Stearoyl-acyl carrier protein desaturase (SAD, locating in the plastid stroma, is an important fatty acid biosynthetic enzyme in higher plants. SAD catalyzes desaturation of stearoyl-ACP to oleyl-ACP and plays a key role in determining the homeostasis between saturated fatty acids and unsaturated fatty acids, which is an important player in cold acclimation in plants. Here, four new full-length cDNA of SADs (ScoSAD, SaSAD, ScaSAD and StSAD were cloned from four Solanum species, Solanum commersonii, S. acaule, S. cardiophyllum and S. tuberosum, respectively. The ORF of the four SADs were 1182 bp in length, encoding 393 amino acids. A sequence alignment indicated 13 amino acids varied among the SADs of three wild species. Further analysis showed that the freezing tolerance and cold acclimation capacity of S. commersonii are similar to S. acaule and their SAD amino acid sequences were identical but differed from that of S. cardiophyllum, which is sensitive to freezing. Furthermore, the sequence alignments between StSAD and ScoSAD indicated that only 7 different amino acids at residues were found in SAD of S. tuberosum (Zhongshu8 against the protein sequence of ScoSAD. A phylogenetic analysis showed the three wild potato species had the closest genetic relationship with the SAD of S. lycopersicum and Nicotiana tomentosiformis but not S. tuberosum. The SAD gene from S. commersonii (ScoSAD was cloned into multiple sites of the pBI121 plant binary vector and transformed into the cultivated potato variety Zhongshu 8. A freeze tolerance analysis showed overexpression of the ScoSAD gene in transgenic plants significantly enhanced freeze tolerance in cv. Zhongshu 8 and increased their linoleic acid content, suggesting that linoleic acid likely plays a key role in improving freeze tolerance in potato plants. This study provided some new insights into how SAD regulates in the freezing tolerance and cold acclimation in potato.

  7. Molecular characterization and classification of Trypanosoma spp. Venezuelan isolates based on microsatellite markers and kinetoplast maxicircle genes.

    Science.gov (United States)

    Sánchez, E; Perrone, T; Recchimuzzi, G; Cardozo, I; Biteau, N; Aso, P M; Mijares, A; Baltz, T; Berthier, D; Balzano-Nogueira, L; Gonzatti, M I

    2015-10-15

    Livestock trypanosomoses, caused by three species of the Trypanozoon subgenus, Trypanosoma brucei brucei, T. evansi and T. equiperdum is widely distributed throughout the world and constitutes an important limitation for the production of animal protein. T. evansi and T. equiperdum are morphologically indistinguishable parasites that evolved from a common ancestor but acquired important biological differences, including host range, mode of transmission, distribution, clinical symptoms and pathogenicity. At a molecular level, T. evansi is characterized by the complete loss of the maxicircles of the kinetoplastic DNA, while T. equiperdum has retained maxicircle fragments similar to those present in T. brucei. T. evansi causes the disease known as Surra, Derrengadera or "mal de cadeiras", while T. equiperdum is the etiological agent of dourine or "mal du coit", characterized by venereal transmission and white patches in the genitalia. Nine Venezuelan Trypanosoma spp. isolates, from horse, donkey or capybara were genotyped and classified using microsatellite analyses and maxicircle genes. The variables from the microsatellite data and the Procyclin PE repeats matrices were combined using the Hill-Smith method and compared to a group of T. evansi, T. equiperdum and T. brucei reference strains from South America, Asia and Africa using Coinertia analysis. Four maxicircle genes (cytb, cox1, a6 and nd8) were amplified by PCRfrom TeAp-N/D1 and TeGu-N/D1, the two Venezuelan isolates that grouped with the T. equiperdum STIB841/OVI strain. These maxicircle sequences were analyzed by nucleotide BLAST and aligned toorthologous genes from the Trypanozoon subgenus by MUSCLE tools. Phylogenetic trees were constructed using Maximum Parsimony (MP) and Maximum Likelihood (ML) with the MEGA5.1® software. We characterized microsatellite markers and Procyclin PE repeats of nine Venezuelan Trypanosoma spp. isolates with various degrees of virulence in a mouse model, and compared them to a

  8. A novel binary T-vector with the GFP reporter gene for promoter characterization.

    Directory of Open Access Journals (Sweden)

    Shu-Ye Jiang

    Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.

  9. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Science.gov (United States)

    Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G

    2014-01-01

    Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  10. Functional characterization of duplicated Suppressor of Overexpression of Constans 1-like genes in petunia.

    Directory of Open Access Journals (Sweden)

    Jill C Preston

    Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.

  11. Molecular cloning and characterization of arginine kinase gene of Toxocara canis

    OpenAIRE

    Sahu, Shivani; Samanta, S.; Harish, D. R.; Sudhakar, N. R.; Raina, O. K.; Shantaveer, S. B.; Madhu, D. N.; Kumar, Ashok

    2013-01-01

    Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcripti...

  12. Isolation and characterization of gene sequences expressed in cotton fiber

    Directory of Open Access Journals (Sweden)

    Taciana de Carvalho Coutinho

    2016-06-01

    Full Text Available ABSTRACT Cotton fiber are tubular cells which develop from the differentiation of ovule epidermis. In addition to being one of the most important natural fiber of the textile group, cotton fiber afford an excellent experimental system for studying the cell wall. The aim of this work was to isolate and characterise the genes expressed in cotton fiber (Gossypium hirsutum L. to be used in future work in cotton breeding. Fiber of the cotton cultivar CNPA ITA 90 II were used to extract RNA for the subsequent generation of a cDNA library. Seventeen sequences were obtained, of which 14 were already described in the NCBI database (National Centre for Biotechnology Information, such as those encoding the lipid transfer proteins (LTPs and arabinogalactans (AGP. However, other cDNAs such as the B05 clone, which displays homology with the glycosyltransferases, have still not been described for this crop. Nevertheless, results showed that several clones obtained in this study are associated with cell wall proteins, wall-modifying enzymes and lipid transfer proteins directly involved in fiber development.

  13. Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica

    NARCIS (Netherlands)

    Pessina, S.; Pavan, S.N.C.; Catalano, D.; Gallotta, A.; Visser, R.G.F.; Bai, Y.; Malnoy, M.; Schouten, H.J.

    2014-01-01

    Background Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO

  14. The potential of virus-induced gene silencing for speeding up functional characterization of plant genes

    NARCIS (Netherlands)

    Benedito, V.A.; Visser, P.B.; Angenent, G.C.; Krens, F.A.

    2004-01-01

    Virus-induced gene silencing (VIGS) has been shown to be of great potential in plant reverse genetics. Advantages of VIGS over other approaches, such as T-DNA or transposon tagging, include the circumvention of plant transformation, methodological simplicity and robustness, and speedy results. These

  15. Characterization and distribution of repetitive elements in association with genes in the human genome.

    Science.gov (United States)

    Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny

    2015-08-01

    Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene

  16. Identification and Characterization of Genes That Interact with Lin-12 in Caenorhabditis Elegans

    OpenAIRE

    Tax, F. E.; Thomas, J. H.; Ferguson, E. L.; Horvitz, H. R.

    1997-01-01

    We identified and characterized 14 extragenic mutations that suppressed the dominant egg-laying defect of certain lin-12 gain-of-function mutations. These suppressors defined seven genes: sup-17, lag-2, sel-4, sel-5, sel-6, sel-7 and sel-8. Mutations in six of the genes are recessive suppressors, whereas the two mutations that define the seventh gene, lag-2, are semi-dominant suppressors. These suppressor mutations were able to suppress other lin-12 gain-of-function mutations. The suppressor ...

  17. Characterization of human septic sera induced gene expression modulation in human myocytes

    Science.gov (United States)

    Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem

    2009-01-01

    To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886

  18. Characterization of differentially expressed genes using high-dimensional co-expression networks

    DEFF Research Database (Denmark)

    Coelho Goncalves de Abreu, Gabriel; Labouriau, Rodrigo S.

    2010-01-01

    We present a technique to characterize differentially expressed genes in terms of their position in a high-dimensional co-expression network. The set-up of Gaussian graphical models is used to construct representations of the co-expression network in such a way that redundancy and the propagation...... that allow to make effective inference in problems with high degree of complexity (e.g. several thousands of genes) and small number of observations (e.g. 10-100) as typically occurs in high throughput gene expression studies. Taking advantage of the internal structure of decomposable graphical models, we...... construct a compact representation of the co-expression network that allows to identify the regions with high concentration of differentially expressed genes. It is argued that differentially expressed genes located in highly interconnected regions of the co-expression network are less informative than...

  19. Identification and characterization of antibiotic resistance genes in Lactobacillus reuteri and Lactobacillus plantarum.

    Science.gov (United States)

    Egervärn, M; Roos, S; Lindmark, H

    2009-11-01

    The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.

  20. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer

    2012-03-29

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  1. Characterization and gene expression analysis of the cir multi-gene family of plasmodium chabaudi chabaudi (AS)

    KAUST Repository

    Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean

    2012-01-01

    Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein

  2. Sequencing, de novo assembly and characterization of the spotted scat Scatophagus argus (Linnaeus 1766) transcriptome for discovery of reproduction related genes and SSRs

    Science.gov (United States)

    Yang, Wei; Chen, Huapu; Cui, Xuefan; Zhang, Kewei; Jiang, Dongneng; Deng, Siping; Zhu, Chunhua; Li, Guangli

    2017-09-01

    Spotted scat (Scatophagus argus) is an economically important farmed fish, particularly in East and Southeast Asia. Because there has been little research on reproductive development and regulation in this species, the lack of a mature artificial reproduction technology remains a barrier for the sustainable development of the aquaculture industry. More genetic and genomic background knowledge is urgently needed for an in-depth understanding of the molecular mechanism of reproductive process and identification of functional genes related to sexual differentiation, gonad maturation and gametogenesis. For these reasons, we performed transcriptomic analysis on spotted scat using a multiple tissue sample mixing strategy. The Illumina RNA sequencing generated 118 510 486 raw reads. After trimming, de novo assembly was performed and yielded 99 888 unigenes with an average length of 905.75 bp. A total of 45 015 unigenes were successfully annotated to the Nr, Swiss-Prot, KOG and KEGG databases. Additionally, 23 783 and 27 183 annotated unigenes were assigned to 56 Gene Ontology (GO) functional groups and 228 KEGG pathways, respectively. Subsequently, 2 474 transcripts associated with reproduction were selected using GO term and KEGG pathway assignments, and a number of reproduction-related genes involved in sex differentiation, gonad development and gametogenesis were identified. Furthermore, 22 279 simple sequence repeat (SSR) loci were discovered and characterized. The comprehensive transcript dataset described here greatly increases the genetic information available for spotted scat and contributes valuable sequence resources for functional gene mining and analysis. Candidate transcripts involved in reproduction would make good starting points for future studies on reproductive mechanisms, and the putative sex differentiation-related genes will be helpful for sex-determining gene identification and sex-specific marker isolation. Lastly, the SSRs can serve as marker

  3. Molecular characterization of a fungal gene paralogue of the penicillin penDE gene of Penicillium chrysogenum

    Science.gov (United States)

    2009-01-01

    Background Penicillium chrysogenum converts isopenicillin N (IPN) into hydrophobic penicillins by means of the peroxisomal IPN acyltransferase (IAT), which is encoded by the penDE gene. In silico analysis of the P. chrysogenum genome revealed the presence of a gene, Pc13g09140, initially described as paralogue of the IAT-encoding penDE gene. We have termed this gene ial because it encodes a protein with high similarity to IAT (IAL for IAT-Like). We have conducted an investigation to characterize the ial gene and to determine the role of the IAL protein in the penicillin biosynthetic pathway. Results The IAL contains motifs characteristic of the IAT such as the processing site, but lacks the peroxisomal targeting sequence ARL. Null ial mutants and overexpressing strains indicated that IAL lacks acyltransferase (penicillin biosynthetic) and amidohydrolase (6-APA forming) activities in vivo. When the canonical ARL motif (leading to peroxisomal targeting) was added to the C-terminus of the IAL protein (IALARL) by site-directed mutagenesis, no penicillin biosynthetic activity was detected. Since the IAT is only active after an accurate self-processing of the preprotein into α and β subunits, self-processing of the IAL was tested in Escherichia coli. Overexpression experiments and SDS-PAGE analysis revealed that IAL is also self-processed in two subunits, but despite the correct processing, the enzyme remained inactive in vitro. Conclusion No activity related to the penicillin biosynthesis was detected for the IAL. Sequence comparison among the P. chrysogenum IAL, the A. nidulans IAL homologue and the IAT, revealed that the lack of enzyme activity seems to be due to an alteration of the essential Ser309 in the thioesterase active site. Homologues of the ial gene have been found in many other ascomycetes, including non-penicillin producers. Our data suggest that like in A. nidulans, the ial and penDE genes might have been formed from a single ancestral gene that became

  4. Genome-wide identification and characterization of the bHLH gene family in tomato.

    Science.gov (United States)

    Sun, Hua; Fan, Hua-Jie; Ling, Hong-Qing

    2015-01-22

    The basic helix-loop-helix (bHLH) proteins are a large superfamily of transcription factors, and play a central role in a wide range of metabolic, physiological, and developmental processes in higher organisms. Tomato is an important vegetable crop, and its genome sequence has been published recently. However, the bHLH gene family of tomato has not been systematically identified and characterized yet. In this study, we identified 159 bHLH protein-encoding genes (SlbHLH) in tomato genome and analyzed their structures. Although bHLH domains were conserved among the bHLH proteins between tomato and Arabidopsis, the intron sequences and distribution of tomato bHLH genes were extremely different compared with Arabidopsis. The gene duplication analysis showed that 58.5% and 6.3% of SlbHLH genes belonged to low-stringency and high-stringency duplication, respectively, indicating that the SlbHLH genes are mainly generated via short low-stringency region duplication in tomato. Subsequently, we classified the SlbHLH genes into 21 subfamilies by phylogenetic tree analysis, and predicted their possible functions by comparison with their homologous genes of Arabidopsis. Moreover, the expression profile analysis of SlbHLH genes from 10 different tissues showed that 21 SlbHLH genes exhibited tissue-specific expression. Further, we identified that 11 SlbHLH genes were associated with fruit development and ripening (eight of them associated with young fruit development and three with fruit ripening). The evolutionary analysis revealed that 92% SlbHLH genes might be evolved from ancestor(s) originated from early land plant, and 8% from algae. In this work, we systematically identified SlbHLHs by analyzing the tomato genome sequence using a set of bioinformatics approaches, and characterized their chromosomal distribution, gene structures, duplication, phylogenetic relationship and expression profiles, as well predicted their possible biological functions via comparative analysis

  5. Ensemble attribute profile clustering: discovering and characterizing groups of genes with similar patterns of biological features

    Directory of Open Access Journals (Sweden)

    Bissell MJ

    2006-03-01

    Full Text Available Abstract Background Ensemble attribute profile clustering is a novel, text-based strategy for analyzing a user-defined list of genes and/or proteins. The strategy exploits annotation data present in gene-centered corpora and utilizes ideas from statistical information retrieval to discover and characterize properties shared by subsets of the list. The practical utility of this method is demonstrated by employing it in a retrospective study of two non-overlapping sets of genes defined by a published investigation as markers for normal human breast luminal epithelial cells and myoepithelial cells. Results Each genetic locus was characterized using a finite set of biological properties and represented as a vector of features indicating attributes associated with the locus (a gene attribute profile. In this study, the vector space models for a pre-defined list of genes were constructed from the Gene Ontology (GO terms and the Conserved Domain Database (CDD protein domain terms assigned to the loci by the gene-centered corpus LocusLink. This data set of GO- and CDD-based gene attribute profiles, vectors of binary random variables, was used to estimate multiple finite mixture models and each ensuing model utilized to partition the profiles into clusters. The resultant partitionings were combined using a unanimous voting scheme to produce consensus clusters, sets of profiles that co-occured consistently in the same cluster. Attributes that were important in defining the genes assigned to a consensus cluster were identified. The clusters and their attributes were inspected to ascertain the GO and CDD terms most associated with subsets of genes and in conjunction with external knowledge such as chromosomal location, used to gain functional insights into human breast biology. The 52 luminal epithelial cell markers and 89 myoepithelial cell markers are disjoint sets of genes. Ensemble attribute profile clustering-based analysis indicated that both lists

  6. Molecular characterization of ferulate 5-hydroxylase gene from kenaf (Hibiscus cannabinus L.)

    Science.gov (United States)

    The purpose of this research was to clone and characterize the expression pattern of a kenaf (Hibiscus cannabinus L.) F5H gene that encodes ferulate 5-hydroxylase in the phenylpropanoid pathway. Kenaf is well known as a fast growing dicotyledonous plant, which makes it a valuable biomass plant. The ...

  7. Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis

    NARCIS (Netherlands)

    Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.

    2000-01-01

    We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of

  8. Characterization of the promoter and upstream activating sequence from the Pseudomonas alcaligenes lipase gene

    NARCIS (Netherlands)

    Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.

    2001-01-01

    Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and

  9. Characterization of Gene Candidates for Vacuolar Sodium Transport from Hordeum Vulgare

    KAUST Repository

    Scheu, Arne Hagen August

    2017-01-01

    Various potential causes are discussed, including inaccuracies in the genome resource used as reference for primer design and issues inherent to the model system. Finally, I make suggestions on how to proceed to further characterize the candidate genes and hopefully identify novel sodium transporters from barley.

  10. Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance

    NARCIS (Netherlands)

    Schouten, H.J.; Brinkhuis, J.; Burgh, van der S.; Schaart, J.; Groenwold, R.; Broggini, G.A.L.; Gessler, C.

    2014-01-01

    Apple scab, caused by Venturia inaequalis, is a serious disease of apple. Previously, the scab resistance Rvi15 (Vr2) from the accession GMAL 2473 was genetically mapped, and three candidate resistance genes were identified. Here, we report the cloning and functional characterization of these three

  11. Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.

    Science.gov (United States)

    Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki

    2012-12-01

    Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.

  12. Isolation and characterization of the human parathyroid hormone-like peptide gene

    International Nuclear Information System (INIS)

    Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.

    1989-01-01

    A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors

  13. A genome-wide characterization of microRNA genes in maize.

    Directory of Open Access Journals (Sweden)

    Lifang Zhang

    2009-11-01

    Full Text Available MicroRNAs (miRNAs are small, non-coding RNAs that play essential roles in plant growth, development, and stress response. We conducted a genome-wide survey of maize miRNA genes, characterizing their structure, expression, and evolution. Computational approaches based on homology and secondary structure modeling identified 150 high-confidence genes within 26 miRNA families. For 25 families, expression was verified by deep-sequencing of small RNA libraries that were prepared from an assortment of maize tissues. PCR-RACE amplification of 68 miRNA transcript precursors, representing 18 families conserved across several plant species, showed that splice variation and the use of alternative transcriptional start and stop sites is common within this class of genes. Comparison of sequence variation data from diverse maize inbred lines versus teosinte accessions suggest that the mature miRNAs are under strong purifying selection while the flanking sequences evolve equivalently to other genes. Since maize is derived from an ancient tetraploid, the effect of whole-genome duplication on miRNA evolution was examined. We found that, like protein-coding genes, duplicated miRNA genes underwent extensive gene-loss, with approximately 35% of ancestral sites retained as duplicate homoeologous miRNA genes. This number is higher than that observed with protein-coding genes. A search for putative miRNA targets indicated bias towards genes in regulatory and metabolic pathways. As maize is one of the principal models for plant growth and development, this study will serve as a foundation for future research into the functional roles of miRNA genes.

  14. Genome-wide identification and characterization of the SBP-box gene family in Petunia.

    Science.gov (United States)

    Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng

    2018-03-12

    SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative

  15. Physical Mapping Technologies for the Identification and Characterization of Mutated Genes to Crop Quality

    International Nuclear Information System (INIS)

    2011-09-01

    The improvement of quality traits in food and industrial crops is an important breeding objective for both developed and developing countries in order to add value to the crop and thereby increasing farmers' income. It has been well established that the application of mutagens can be a very important approach for manipulating many crop characteristics including quality. While mutation induction using nuclear techniques such as gamma irradiation is a power tool in generating new genotypes with favourable alleles for improving crop quality in plant breeding, a more thorough understanding of gene expression, gene interactions, and physical location will improve ability to manipulate and control genes, and directly lead to crop improvement. Physical mapping technologies, molecular markers and molecular cytogenetic techniques are tools available with the potential to enhance the ability to tag genes and gene complexes to facilitate the selection of desirable genotypes in breeding programmes, including those based on mutation breeding. This Coordinated Research Project (CRP) on 'Physical Mapping Technologies for the Identification and Characterization of Mutated Genes Contributing to Crop Quality' was conducted under the overall IAEA project objective of 'Identification, Characterization and Transfer of Mutated Genes'. The specific objectives of the CRP were to assist Member States in accelerating crop breeding programmes through the application of physical mapping and complementary genomic approaches, and the characterization and utilization of induced mutants for improvement of crop quality. The IAEA-TECDOC describes the success obtained in the application of molecular cytology, molecular markers, physical mapping and mutation technologies since the inception of the CRP in 2003. The CRP also resulted in two book chapters, 35 peer reviewed papers, 25 conference proceedings, one PhD thesis, and 22 published abstracts. In addition, thirteen sequences were submitted to the

  16. ASIAS - Some History

    Data.gov (United States)

    National Aeronautics and Space Administration — The ASIAS effort builds on demonstrations that an open exchange of information contributes to improved aviation safety. ASIAS is a comprehensive effort, covering the...

  17. Integration of Genome-Wide TF Binding and Gene Expression Data to Characterize Gene Regulatory Networks in Plant Development.

    Science.gov (United States)

    Chen, Dijun; Kaufmann, Kerstin

    2017-01-01

    Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.

  18. Characterization of the bovine pregnancy-associated glycoprotein gene family – analysis of gene sequences, regulatory regions within the promoter and expression of selected genes

    Directory of Open Access Journals (Sweden)

    Walker Angela M

    2009-04-01

    Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed

  19. Identification and characterization of the genes encoding the core histones and histone variants of Neurospora crassa.

    OpenAIRE

    Hays, Shan M; Swanson, Johanna; Selker, Eric U

    2002-01-01

    We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...

  20. Identification and characterization of an autolysin gene, atlg, from Streptococcus sobrinus.

    Science.gov (United States)

    Yamada, Arisa; Tamura, Haruki; Kato, Hirohisa

    2009-02-01

    AtlA is a major cell-lytic enzyme called autolysin in Streptococcus mutans. In this study, we identified the atlg gene-encoding autolysin (Atlg), consisting of 863 residues from Streptococcus sobrinus 6715DP, and confirmed lytic activity of recombinant Atlg by zymography of S. sobrinus cells. An atlA-inactivated mutant was constructed in S. mutans Xc, and the atlg gene product was characterized by plasmid complementation. Microscopic analysis, saliva-induced aggregation assay and autolysis assay of static cultures in air revealed that the atlg gene product partially complemented the role of AtlA. Furthermore, the capability of biofilm formation of the atlA-deficient mutant cultivated in air was restored by plasmid comprising the atlg gene. These findings suggest that Atlg may be involved in cell separation and biofilm formation in S. sobrinus.

  1. Characterization of a gene from the EDM1-PSACH region of human chromosome 19p

    Energy Technology Data Exchange (ETDEWEB)

    Lennon, G.G.; Giorgi, D.; Martin, J.R. [Lawrence Livermore National Lab., CA (United States)] [and others

    1994-09-01

    Genetic linkage mapping has indicated that both multiple epiphyseal dysplasia (EDM1), a dominantly inherited chondrodysplasia, and pseudoachondroplasia (PSACH), a skeletal disorder associated with dwarfism, map to a 2-3 Mb region of human chromosome 19p. We have isolated a partial cDNA from this region using hybrid selection, and report on progress towards the characterization of the genomic structure and transcription of the corresponding gene. Sequence analysis of the cDNA to date indicates that this gene is likely to be expressed within extracellular matrix tissues. Defects in this gene or neighboring gene family members may therefore lead to EDM1, PSACH, or other connective tissue and skeletal disorders.

  2. Identification and network-enabled characterization of auxin response factor genes in Medicago truncatula

    Directory of Open Access Journals (Sweden)

    David J. Burks

    2016-12-01

    Full Text Available The Auxin Response Factor (ARF family of transcription factors is an important regulator of environmental response and symbiotic nodulation in the legume Medicago truncatula. While previous studies have identified members of this family, a recent spurt in gene expression data coupled with genome update and reannotation calls for a reassessment of the prevalence of ARF genes and their interaction networks in M. truncatula. We performed a comprehensive analysis of the M. truncatula genome and transcriptome that entailed search for novel ARF genes and the co-expression networks. Our investigation revealed 8 novel M. truncatula ARF (MtARF genes, of the total 22 identified, and uncovered novel gene co-expression networks as well. Furthermore, the topological clustering and single enrichment analysis of several network models revealed the roles of individual members of the MtARF family in nitrogen regulation, nodule initiation, and post-embryonic development through a specialized protein packaging and secretory pathway. In summary, this study not just shines new light on an important gene family, but also provides a guideline for identification of new members of gene families and their functional characterization through network analyses.

  3. Overexpressed Genes/ESTs and Characterization of Distinct Amplicons on 17823 in Breast Cancer Cells

    Directory of Open Access Journals (Sweden)

    Ayse E. Erson

    2001-01-01

    Full Text Available 17823 is a frequent site of gene amplification in breast cancer. Several lines of evidence suggest the presence of multiple amplicons on 17823. To characterize distinct amplicons on 17823 and localize putative oncogenes, we screened genes and expressed sequence tags (ESTs in existing physical and radiation hybrid maps for amplification and overexpression in breast cancer cell lines by semiquantitative duplex PCR, semiquantitative duplex RT-PCR, Southern blot, Northern blot analyses. We identified two distinct amplicons on 17823, one including TBX2 and another proximal region including RPS6KB1 (PS6K and MUL. In addition to these previously reported overexpressed genes, we also identified amplification and overexpression of additional uncharacterized genes and ESTs, some of which suggest potential oncogenic activity. In conclusion, we have further defined two distinct regions of gene amplification and overexpression on 17823 with identification of new potential oncogene candidates. Based on the amplification and overexpression patterns of known and as of yet unrecognized genes on 17823, it is likely that some of these genes mapping to the discrete amplicons function as oncogenes and contribute to tumor progression in breast cancer cells.

  4. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Directory of Open Access Journals (Sweden)

    Petar Petrov

    Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  5. Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.

    Science.gov (United States)

    Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W

    2015-01-01

    "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.

  6. Cloning and characterization of genes involved in nostoxanthin biosynthesis of Sphingomonas elodea ATCC 31461.

    Directory of Open Access Journals (Sweden)

    Liang Zhu

    Full Text Available Most Sphingomonas species synthesize the yellow carotenoid nostoxanthin. However, the carotenoid biosynthetic pathway of these species remains unclear. In this study, we cloned and characterized a carotenoid biosynthesis gene cluster containing four carotenogenic genes (crtG, crtY, crtI and crtB and a β-carotene hydroxylase gene (crtZ located outside the cluster, from the gellan-gum producing bacterium Sphingomonas elodea ATCC 31461. Each of these genes was inactivated, and the biochemical function of each gene was confirmed based on chromatographic and spectroscopic analysis of the intermediates accumulated in the knockout mutants. Moreover, the crtG gene encoding the 2,2'-β-hydroxylase and the crtZ gene encoding the β-carotene hydroxylase, both responsible for hydroxylation of β-carotene, were confirmed by complementation studies using Escherichia coli producing different carotenoids. Expression of crtG in zeaxanthin and β-carotene accumulating E. coli cells resulted in the formation of nostoxanthin and 2,2'-dihydroxy-β-carotene, respectively. Based on these results, a biochemical pathway for synthesis of nostoxanthin in S. elodea ATCC 31461 is proposed.

  7. Cloning and characterization of genes involved in nostoxanthin biosynthesis of Sphingomonas elodea ATCC 31461.

    Science.gov (United States)

    Zhu, Liang; Wu, Xuechang; Li, Ou; Qian, Chaodong; Gao, Haichun

    2012-01-01

    Most Sphingomonas species synthesize the yellow carotenoid nostoxanthin. However, the carotenoid biosynthetic pathway of these species remains unclear. In this study, we cloned and characterized a carotenoid biosynthesis gene cluster containing four carotenogenic genes (crtG, crtY, crtI and crtB) and a β-carotene hydroxylase gene (crtZ) located outside the cluster, from the gellan-gum producing bacterium Sphingomonas elodea ATCC 31461. Each of these genes was inactivated, and the biochemical function of each gene was confirmed based on chromatographic and spectroscopic analysis of the intermediates accumulated in the knockout mutants. Moreover, the crtG gene encoding the 2,2'-β-hydroxylase and the crtZ gene encoding the β-carotene hydroxylase, both responsible for hydroxylation of β-carotene, were confirmed by complementation studies using Escherichia coli producing different carotenoids. Expression of crtG in zeaxanthin and β-carotene accumulating E. coli cells resulted in the formation of nostoxanthin and 2,2'-dihydroxy-β-carotene, respectively. Based on these results, a biochemical pathway for synthesis of nostoxanthin in S. elodea ATCC 31461 is proposed.

  8. Characterization of a Crabs Claw Gene in Basal Eudicot Species Epimedium sagittatum (Berberidaceae

    Directory of Open Access Journals (Sweden)

    Wei Sun

    2013-01-01

    Full Text Available The Crabs Claw (CRC YABBY gene is required for regulating carpel development in angiosperms and has played an important role in nectary evolution during core eudicot speciation. The function or expression of CRC-like genes has been explored in two basal eudicots, Eschscholzia californica and Aquilegia formosa. To further investigate the function of CRC orthologous genes related to evolution of carpel and nectary development in basal eudicots, a CRC ortholog, EsCRC, was isolated and characterized from Epimedium sagittatum (Sieb. and Zucc. Maxim. A phylogenetic analysis of EsCRC and previously identified CRC-like genes placed EsCRC within the basal eudicot lineage. Gene expression results suggest that EsCRC is involved in the development of sepals and carpels, but not nectaries. Phenotypic complementation of the Arabidopsis mutant crc-1 was achieved by constitutive expression of EsCRC. In addition, over-expression of EsCRC in Arabidopsis and tobacco gave rise to abaxially curled leaves. Transgenic results together with the gene expression analysis suggest that EsCRC may maintain a conserved function in carpel development and also play a novel role related to sepal formation. Absence of EsCRC and ElCRC expression in nectaries further indicates that nectary development in non-core eudicots is unrelated to expression of CRC-like genes.

  9. Characterization of a Crabs Claw Gene in basal eudicot species Epimedium sagittatum (Berberidaceae).

    Science.gov (United States)

    Sun, Wei; Huang, Wenjun; Li, Zhineng; Lv, Haiyan; Huang, Hongwen; Wang, Ying

    2013-01-08

    The Crabs Claw (CRC) YABBY gene is required for regulating carpel development in angiosperms and has played an important role in nectary evolution during core eudicot speciation. The function or expression of CRC-like genes has been explored in two basal eudicots, Eschscholzia californica and Aquilegia formosa. To further investigate the function of CRC orthologous genes related to evolution of carpel and nectary development in basal eudicots, a CRC ortholog, EsCRC, was isolated and characterized from Epimedium sagittatum (Sieb. and Zucc.) Maxim. A phylogenetic analysis of EsCRC and previously identified CRC-like genes placed EsCRC within the basal eudicot lineage. Gene expression results suggest that EsCRC is involved in the development of sepals and carpels, but not nectaries. Phenotypic complementation of the Arabidopsis mutant crc-1 was achieved by constitutive expression of EsCRC. In addition, over-expression of EsCRC in Arabidopsis and tobacco gave rise to abaxially curled leaves. Transgenic results together with the gene expression analysis suggest that EsCRC may maintain a conserved function in carpel development and also play a novel role related to sepal formation. Absence of EsCRC and ElCRC expression in nectaries further indicates that nectary development in non-core eudicots is unrelated to expression of CRC-like genes.

  10. Discovery, characterization and expression of a novel zebrafish gene, znfr, important for notochord formation.

    Science.gov (United States)

    Xu, Yan; Zou, Peng; Liu, Yao; Deng, Fengjiao

    2010-06-01

    Genes specifically expressed in the notochord may be crucial for proper notochord development. Using the digital differential display program offered by the National Center for Biotechnology Information, we identified a novel EST sequence from a zebrafish ovary library (No. XM_701450). The full-length cDNA of this transcript was cloned by performing 3' and 5'-RACE and was further confirmed by PCR and sequencing. The resulting 614 bp gene was found to encode a novel 94 amino acid protein that did not share significant homology with any other known protein. Characterization of the genomic sequence revealed that the gene spanned 4.9 kb and was composed of four exons and three introns. RT-PCR gene expression analysis revealed that our gene of interest was expressed in ovary, kidney, brain, mature oocytes and during the early stages of embryogenesis. During embryonic development, znfr mRNA was found to be expressed in the embryonic shield, chordamesoderm and the vacuolated notochord cells by in situ hybridization. Based on this information, we hypothesize that this novel gene is an important maternal factor required for zebrafish notochord formation during early embryonic development. We have thus named this gene znfr (zebrafish notochord formation related).

  11. Evolutionary conservation and network structure characterize genes of phenotypic relevance for mitosis in human.

    Directory of Open Access Journals (Sweden)

    Marek Ostaszewski

    Full Text Available The impact of gene silencing on cellular phenotypes is difficult to establish due to the complexity of interactions in the associated biological processes and pathways. A recent genome-wide RNA knock-down study both identified and phenotypically characterized a set of important genes for the cell cycle in HeLa cells. Here, we combine a molecular interaction network analysis, based on physical and functional protein interactions, in conjunction with evolutionary information, to elucidate the common biological and topological properties of these key genes. Our results show that these genes tend to be conserved with their corresponding protein interactions across several species and are key constituents of the evolutionary conserved molecular interaction network. Moreover, a group of bistable network motifs is found to be conserved within this network, which are likely to influence the network stability and therefore the robustness of cellular functioning. They form a cluster, which displays functional homogeneity and is significantly enriched in genes phenotypically relevant for mitosis. Additional results reveal a relationship between specific cellular processes and the phenotypic outcomes induced by gene silencing. This study introduces new ideas regarding the relationship between genotype and phenotype in the context of the cell cycle. We show that the analysis of molecular interaction networks can result in the identification of genes relevant to cellular processes, which is a promising avenue for future research.

  12. Identification and characterization of amelogenin genes in monotremes, reptiles, and amphibians

    Science.gov (United States)

    Toyosawa, Satoru; O’hUigin, Colm; Figueroa, Felipe; Tichy, Herbert; Klein, Jan

    1998-01-01

    Two features make the tooth an excellent model in the study of evolutionary innovations: the relative simplicity of its structure and the fact that the major tooth-forming genes have been identified in eutherian mammals. To understand the nature of the innovation at the molecular level, it is necessary to identify the homologs of tooth-forming genes in other vertebrates. As a first step toward this goal, homologs of the eutherian amelogenin gene have been cloned and characterized in selected species of monotremes (platypus and echidna), reptiles (caiman), and amphibians (African clawed toad). Comparisons of the homologs reveal that the amelogenin gene evolves quickly in the repeat region, in which numerous insertions and deletions have obliterated any similarity among the genes, and slowly in other regions. The gene organization, the distribution of hydrophobic and hydrophilic segments in the encoded protein, and several other features have been conserved throughout the evolution of the tetrapod amelogenin gene. Clones corresponding to one locus only were found in caiman, whereas the clawed toad possesses at least two amelogenin-encoding loci. PMID:9789040

  13. Characterization of Ras k 1 a novel major allergen in Indian mackerel and identification of parvalbumin as the major fish allergen in 33 Asia-Pacific fish species.

    Science.gov (United States)

    Ruethers, T; Raith, M; Sharp, M F; Koeberl, M; Stephen, J N; Nugraha, R; Le, T T K; Quirce, S; Nguyen, H X M; Kamath, S D; Mehr, S S; Campbell, D E; Bridges, C R; Taki, A C; Swoboda, I; Lopata, A L

    2018-04-01

    Fish is a well-recognized cause of food allergy and anaphylaxis. The evolutionary and taxonomic diversity of the various consumed fish species pose a challenge in the identification and characterization of the major fish allergens critical for reliable diagnostics. Globally, fish is a rising cause of food allergy complicated by a large under-investigated variety of species as well as increasing global tourism and trade. This is the first comprehensive study on allergen profiles of heat-processed fish from Vietnam. The aim of this study was to identify the major heat-stable allergens from frequently exported Asia-Pacific freshwater and marine fish and to characterize the major allergen parvalbumin (PV) from one of the most consumed and exported fish species from Asia, the Indian mackerel (Rastrelliger kanagurta). Heated protein extracts from 33 fish species were separated by gel electrophoresis. PV isoforms were identified by immunoblotting utilizing 3 different PV-specific monoclonal and polyclonal antibodies and further characterized by mass spectrometry. IgE reactivity was investigated using sera from 21 patients with confirmed fish allergy. Heat-stable IgE-reactive PVs, with up to 5 isoforms per species, were identified in all 33 analysed fish species. In the Indian mackerel, 7 PV isoforms were identified by 2D-gel electrophoresis combined with mass spectrometric analyses. The amino acid sequence deduced from cDNA of the most expressed isoform showed a high identity (>90%) to PVs from 2 other mackerel species. Different PVs were identified as the major heat-stable allergens in all 33 analysed freshwater and marine fish species from Vietnam, many of which are exported world-wide and 21 species that have never been investigated before. The Indian mackerel PV represents a novel fish allergen, now officially registered as Ras k 1. Improved diagnostics for fish allergy against Asia-Pacific species should be developed with focus on PV. © 2017 John Wiley & Sons Ltd.

  14. Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.

    Science.gov (United States)

    Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning

    2016-01-01

    WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of

  15. Characterization, expression, and mutation of the Lactococcus lactis galPMKTE genes, involved in galactose utilization via the Leloir pathway

    NARCIS (Netherlands)

    Groossiord, B.P.; Luesink, E.J.; Vaughan, E.E.; Arnaud, A.; Vos, de W.M.

    2003-01-01

    A cluster containing five similarly oriented genes involved in the metabolism of galactose via the Leloir pathway in Lactococcus lactis subsp. cremoris MG1363 was cloned and characterized. The order of the genes is galPMKTE, and these genes encode a galactose permease (GalP), an aldose I-epimerase

  16. Cloning and identification of novel hydrolase genes from a dairy cow rumen metagenomic library and characterization of a cellulase gene

    Directory of Open Access Journals (Sweden)

    Gong Xia

    2012-10-01

    Full Text Available Abstract Background Interest in cellulose degrading enzymes has increased in recent years due to the expansion of the cellulosic biofuel industry. The rumen is a highly adapted environment for the degradation of cellulose and a promising source of enzymes for industrial use. To identify cellulase enzymes that may be of such use we have undertaken a functional metagenomic screen to identify cellulase enzymes from the bacterial community in the rumen of a grass-hay fed dairy cow. Results Twenty five clones specifying cellulose activity were identified. Subcloning and sequence analysis of a subset of these hydrolase-positive clones identified 10 endoglucanase genes. Preliminary characterization of the encoded cellulases was carried out using crude extracts of each of the subclones. Zymogram analysis using carboxymethylcellulose as a substrate showed a single positive band for each subclone, confirming that only one functional cellulase gene was present in each. One cellulase gene, designated Cel14b22, was expressed at a high level in Escherichia coli and purified for further characterization. The purified recombinant enzyme showed optimal activity at pH 6.0 and 50°C. It was stable over a broad pH range, from pH 4.0 to 10.0. The activity was significantly enhanced by Mn2+ and dramatically reduced by Fe3+ or Cu2+. The enzyme hydrolyzed a wide range of beta-1,3-, and beta-1,4-linked polysaccharides, with varying activities. Activities toward microcrystalline cellulose and filter paper were relatively high, while the highest activity was toward Oat Gum. Conclusion The present study shows that a functional metagenomic approach can be used to isolate previously uncharacterized cellulases from the rumen environment.

  17. Identification and characterization of NF-YB family genes in tung tree.

    Science.gov (United States)

    Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun

    2015-12-01

    The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.

  18. Isolation and Characterization of the Etheostoma tallapoosae (Teleostei: Percidae CENP-A Gene

    Directory of Open Access Journals (Sweden)

    Leos G. Kral

    2011-10-01

    Full Text Available Both centromeric alpha-satellite sequences as well as centromeric protein A (CENP-A are highly variable in eukaryotes. CENP-A, a histone H3 variant, is thought to act as the epigenetic “mark” for assembly of centromeric proteins. While most of the histone fold domain (HFD of the CENP-A is fairly well conserved, a portion of this HFD as well as the N-terminal tail show adaptive variation in both plants and animals. Such variation may establish reproductive barriers that may lead to speciation. The family Percidae contains over 200 species most of which are within the subfamily Etheostomatinae. This subfamily represents a species rich radiation of freshwater fishes in North America and these species exhibit both allopatric and sympatric distributions. In order to study the evolution of CENP-A in percid fish species, we have isolated and characterized the CENP-A gene from Etheostoma tallapoosae by PCR based gene walking. As a result of this study we have demonstrated that the Tallapoosa darter CENP-A gene HFD sequences can be isolated from genomic DNA by nested PCR in a manner that does not lead to the amplification of the highly sequence related histone H3 gene. We also demonstrated that PCR based walking can be subsequently used to isolate the rest of the CENP-A gene and adjacent gene sequences. These adjacent gene sequences provide us with a primer binding sites for PCR isolation of the CENP-A gene from other percid species of fishes. An initial comparison of three percid species shows that the N-terminal tail of the percid CENP-A gene shows adaptive evolution.

  19. [Characterization of Black and Dichothrix Cyanobacteria Based on the 16S Ribosomal RNA Gene Sequence

    Science.gov (United States)

    Ortega, Maya

    2010-01-01

    My project focuses on characterizing different cyanobacteria in thrombolitic mats found on the island of Highborn Cay, Bahamas. Thrombolites are interesting ecosystems because of the ability of bacteria in these mats to remove carbon dioxide from the atmosphere and mineralize it as calcium carbonate. In the future they may be used as models to develop carbon sequestration technologies, which could be used as part of regenerative life systems in space. These thrombolitic communities are also significant because of their similarities to early communities of life on Earth. I targeted two cyanobacteria in my research, Dichothrix spp. and whatever black is, since they are believed to be important to carbon sequestration in these thrombolitic mats. The goal of my summer research project was to molecularly identify these two cyanobacteria. DNA was isolated from each organism through mat dissections and DNA extractions. I ran Polymerase Chain Reactions (PCR) to amplify the 16S ribosomal RNA (rRNA) gene in each cyanobacteria. This specific gene is found in almost all bacteria and is highly conserved, meaning any changes in the sequence are most likely due to evolution. As a result, the 16S rRNA gene can be used for bacterial identification of different species based on the sequence of their 16S rRNA gene. Since the exact sequence of the Dichothrix gene was unknown, I designed different primers that flanked the gene based on the known sequences from other taxonomically similar cyanobacteria. Once the 16S rRNA gene was amplified, I cloned the gene into specialized Escherichia coli cells and sent the gene products for sequencing. Once the sequence is obtained, it will be added to a genetic database for future reference to and classification of other Dichothrix sp.

  20. Characterization of Gene Candidates for Vacuolar Sodium Transport from Hordeum Vulgare

    KAUST Repository

    Scheu, Arne Hagen August

    2017-05-01

    Soil salinity is a major abiotic stress for land plants, and multiple mechanisms of salt tolerance have evolved. Tissue tolerance is one of these mechanisms, which involves the sequestration of sodium into the vacuole to retain low cytosolic sodium concentrations. This enables the plant to maintain cellular functions, and ultimately maintain growth and yield. However, the molecular components involved in tissue tolerance remain elusive. Several candidate genes for vacuolar sodium sequestration have recently been identified by proteome analysis of vacuolar membranes purified from the salt-tolerant cereal Hordeum vulgare (barley). In this study, I aimed to characterize these candidates in more detail. I successfully cloned coding sequences for the majority of candidate genes with primers designed based on the barley reference genome sequence. During the course of this study a newer genome sequence with improved annotations was published, to which I also compared my observations. To study the candidate genes, I used the heterologous expression system Saccharomyces cerevisiae (yeast). I used several salt sensitive yeast strains (deficient in intrinsic sodium transporters) to test whether the candidate genes would affect their salt tolerance by mediating the sequestration of sodium into the yeast vacuole. I observed a reduction in growth upon expression for several of the gene candidate under salt-stress conditions. However, confocal microscopy suggests that most gene products are subject to degradation, and did not localize to the vacuolar membrane (tonoplast). Therefore, growth effects cannot be linked to protein function without further evidence. Various potential causes are discussed, including inaccuracies in the genome resource used as reference for primer design and issues inherent to the model system. Finally, I make suggestions on how to proceed to further characterize the candidate genes and hopefully identify novel sodium transporters from barley.

  1. [The isolation and characterization of beta-glucosidase gene and beta-glucosidase of Trichoderma viride]: Progress report

    International Nuclear Information System (INIS)

    Stafford, D.W.

    1983-01-01

    Our project was to isolate and characterize the enzyme β-glucosidase and to clone and characterize the β-glucosidase gene; our goal is to clone and characterize each of the cellulase genes from Trichoderma. The induction of the Trichoderma reesei cellulase complex by cellulose and by the soluble inducer, sophorose, has been demonstrated. Although the induction of the cellulase complex has previously been well documented, the induction of β-glucosidase had been questioned. 49 refs., 6 figs., 2 tabs

  2. Characterization of the interferon genes in homozygous rainbow trout reveals two novel genes, alternate splicing and differential regulation of duplicated genes

    Science.gov (United States)

    Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.

    2009-01-01

    The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.

  3. A second pectin lyase gene (pel2) from Aspergillus oryzae KBN616: its sequence analysis and overexpression, and characterization of the gene products.

    Science.gov (United States)

    Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N

    2001-01-01

    A second pectin lyase gene, designated pel2, was isolated from a shoyu koji mold Aspergillus oryzae KBN616 and characterized. The structural gene comprised 1306 bp with three introns. The ORF encoded 375 amino acids with a signal peptide of 19 amino acids. The deduced amino acid sequence showed high similarity to those of A. oryzae Pel1, Aspergillus niger pectin lyases and Glomerella cingulata Pn1A. The pel2 gene was overexpressed under the control of the promoter of the A. oryzae TEF1 gene for purification and enzymatic characterization of its gene product. The gene product exhibited two molecular masses of 48 and 44 kDa due to different degrees of glycosylation. Both proteins had the same pH optimum of 6.0 and temperature optimum of 50 degrees C.

  4. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period.

    Science.gov (United States)

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    'Hongyang' is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in 'Hongyang' kiwifruit during storage period. The results showed that low temperature could effectively enhance the anthocyanin accumulation of kiwifruit in the end of storage period (90 days), which related to the increase in mRNA levels of ANS1, ANS2, DRF1, DRF2 , and UGFT2 . Moreover, the transcript abundance of MYBA1-1 and MYB5-1 , the genes encoding an important component of MYB-bHLH-WD40 (MBW) complex, was up-regulated, possibly contributing to the induction of specific anthocyanin biosynthesis genes under the low temperature. To further investigate the roles of AcMYB5-1/5-2/A1-1 in regulation of anthocyanin biosynthesis, genes encoding the three transcription factors were transiently transformed in Nicotiana benthamiana leaves. Overexpression of AcMYB5-1/5-2/A1-1 activated the gene expression of NtANS and NtDFR in tobacco. Our results suggested that low temperature storage could stimulate the anthocyanin accumulation in harvested kiwifruit via regulating several structural and regulatory genes involved in anthocyanin biosynthesis.

  5. Identification and Characterization of Pathogen-Response Genes (repat) in Spodoptera frugiperda (Lepidoptera: Noctuidae).

    Science.gov (United States)

    Machado, Vilmar; Serrano, Jose; Galián, Jose

    2016-01-01

    The fall armyworm (Spodoptera frugiperda, Noctuidae, Lepidoptera) is one of the most important crop pests in the Americas, causing significant damage to maize, rice and sorghum. The mechanisms that determine its defences against pathogens are particularly relevant for the development of management and control strategies. We used an in silico approach to identify and characterize pathogen response genes (repat) present in different tissue libraries of S. fugiperda. The analyses revealed complete cDNA for nine repat genes; of these, repat15 and repat39 were found in libraries from a specific tissue--the midgut of larvae fed with xenobiotic substances. High expression levels of some genes were found in different libraries: 39 hits in repat30 in challenged hemocytes, 16 hits in repat31 in fat body, 10 hits in repat32 in fat body and 10 in challenged hemocytes, and 10 hits in repat38 in midgut of non-treated larvae and midgut of larvae fed with natural and xenobiotic substances. The genes corresponded to two ontology categories, stress response and immune response, and their phylogenetic relationships, nucleotide similarity, number of amino acid residues and molecular weights agree with what has been described for repat genes. It is noteworthy that proteins encoded by the repat genes of S. frugiperda have important defence functions in other tissues beyond midgut and that their functional categories are likely diverse, as they are related to cell envelope structure, energy metabolism, transport and binding.

  6. Identification and characterization of nuclear genes involved in photosynthesis in Populus

    Science.gov (United States)

    2014-01-01

    Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936

  7. Characterization of TALE genes expression during the first lineage segregation in mammalian embryos.

    Science.gov (United States)

    Sonnet, Wendy; Rezsöhazy, Rene; Donnay, Isabelle

    2012-11-01

    Three amino acid loop extension (TALE) homeodomain-containing transcription factors are generally recognized for their role in organogenesis and differentiation during embryogenesis. However, very little is known about the expression and function of Meis, Pbx, and Prep genes during early development. In order to determine whether TALE proteins could contribute to the early cell fate decisions in mammalian development, this study aimed to characterize in a systematic manner the pattern of expression of all Meis, Pbx, and Prep genes from the precompaction to blastocyst stage corresponding to the first step of cell differentiation in mammals. To reveal to what extent TALE genes expression at these early stages is a conserved feature among mammals, this study was performed in parallel in the bovine and mouse models. We demonstrated the transcription and translation of TALE genes, before gastrulation in the two species. At least one member of Meis, Pbx, and Prep subfamilies was found expressed at the RNA and protein levels but different patterns of expression were observed between genes and between species, suggesting specific gene regulations. Taken together, these results suggest a previously unexpected involvement of these factors during the early development in mammals. Copyright © 2012 Wiley Periodicals, Inc.

  8. Characterization of class II alpha genes and DLA-D region allelic associations in the dog.

    Science.gov (United States)

    Sarmiento, U M; Storb, R F

    1988-10-01

    Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.

  9. Genomic organization, tissue distribution and functional characterization of the rat Pate gene cluster.

    Directory of Open Access Journals (Sweden)

    Angireddy Rajesh

    Full Text Available The cysteine rich prostate and testis expressed (Pate proteins identified till date are thought to resemble the three fingered protein/urokinase-type plasminogen activator receptor proteins. In this study, for the first time, we report the identification, cloning and characterization of rat Pate gene cluster and also determine the expression pattern. The rat Pate genes are clustered on chromosome 8 and their predicted proteins retained the ten cysteine signature characteristic to TFP/Ly-6 protein family. PATE and PATE-F three dimensional protein structure was found to be similar to that of the toxin bucandin. Though Pate gene expression is thought to be prostate and testis specific, we observed that rat Pate genes are also expressed in seminal vesicle and epididymis and in tissues beyond the male reproductive tract. In the developing rats (20-60 day old, expression of Pate genes seem to be androgen dependent in the epididymis and testis. In the adult rat, androgen ablation resulted in down regulation of the majority of Pate genes in the epididymides. PATE and PATE-F proteins were found to be expressed abundantly in the male reproductive tract of rats and on the sperm. Recombinant PATE protein exhibited potent antibacterial activity, whereas PATE-F did not exhibit any antibacterial activity. Pate expression was induced in the epididymides when challenged with LPS. Based on our results, we conclude that rat PATE proteins may contribute to the reproductive and defense functions.

  10. Identification of chitinolytic bacteria isolated from shrimp pond sediment and characterization of their chitinase encoding gene

    Science.gov (United States)

    Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi

    2018-03-01

    Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).

  11. Cloning and characterization of the ONAC106 gene from Oryza sativa cultivar Kuku Belang

    Science.gov (United States)

    Basri, Khairunnisa; Sukiran, Noor Liyana; Zainal, Zamri

    2016-11-01

    Plants possess different mechanisms in stress response, where induction of stress-responsive genes provides tolerance to unfavorable conditions. Stress-responsive genes are characterized for functional and regulatory genes that help in overcoming stress by molecular, biochemical and morphological adaptations. NAC transcription factors are one of the regulatory proteins that involved in stress signaling pathway. A putative NAC transcription factor, ONAC016 was identified from drought transcriptomic data. Our data suggested that ONAC106 was induced by drought, but its function in abiotic stress is still unclear. In silico analysis of ONAC106 showed that this gene encodes 334 amino acids, and its protein consists of NAM (No Apical Meristem) domain. The orthologue of ONAC106 was present in several Poaceae family members, suggesting that ONAC106 is unique to monocot plants only. We found that ONAC106 was induced by salt and cold stresses, indicating that this gene involves in abiotic stress response. In addition, we also found that ONAC106 might function in defense response to pathogen invasion. The ABRE (Abscisic Acid Regulatory Element) cis-element was identified in the promoter region of ONAC106, suggesting that it may involve in the abscisic acid (ABA)-dependent signaling pathway. Based on this preliminary result, we hypothesize that ONAC106 may play a role in abiotic stress response by regulating ABA-responsive genes.

  12. Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.

    Science.gov (United States)

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-12-01

    Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.

  13. Molecular Characterization and Expression of a Phytase Gene from the Thermophilic Fungus Thermomyces lanuginosus

    Science.gov (United States)

    Berka, Randy M.; Rey, Michael W.; Brown, Kimberly M.; Byun, Tony; Klotz, Alan V.

    1998-01-01

    The phyA gene encoding an extracellular phytase from the thermophilic fungus Thermomyces lanuginosus was cloned and heterologously expressed, and the recombinant gene product was biochemically characterized. The phyA gene encodes a primary translation product (PhyA) of 475 amino acids (aa) which includes a putative signal peptide (23 aa) and propeptide (10 aa). The deduced amino acid sequence of PhyA has limited sequence identity (ca. 47%) with Aspergillus niger phytase. The phyA gene was inserted into an expression vector under transcriptional control of the Fusarium oxysporum trypsin gene promoter and used to transform a Fusarium venenatum recipient strain. The secreted recombinant phytase protein was enzymatically active between pHs 3 and 7.5, with a specific activity of 110 μmol of inorganic phosphate released per min per mg of protein at pH 6 and 37°C. The Thermomyces phytase retained activity at assay temperatures up to 75°C and demonstrated superior catalytic efficiency to any known fungal phytase at 65°C (the temperature optimum). Comparison of this new Thermomyces catalyst with the well-known Aspergillus niger phytase reveals other favorable properties for the enzyme derived from the thermophilic gene donor, including catalytic activity over an expanded pH range. PMID:9797301

  14. Genetic characterization of Italian field strains of Schmallenberg virus based on N and NSs genes.

    Science.gov (United States)

    Izzo, Francesca; Cosseddu, Gian Mario; Polci, Andrea; Iapaolo, Federica; Pinoni, Chiara; Capobianco Dondona, Andrea; Valleriani, Fabrizia; Monaco, Federica

    2016-08-01

    Following its first identification in Germany in 2011, the Schmallenberg virus (SBV) has rapidly spread to many other European countries. Despite the wide dissemination, the molecular characterization of the circulating strains is limited to German, Belgian, Dutch, and Swiss viruses. To fill this gap, partial genetic characterization of 15 Italian field strains was performed, based on S segment genes. Samples were collected in 2012 in two different regions where outbreaks occurred during distinct epidemic seasons. The comparative sequence analysis demonstrated a high molecular stability of the circulating viruses; nevertheless, we identified several variants of the N and NSs proteins not described in other SBV isolates circulating in Europe.

  15. Sequence characterization of heat shock protein gene of Cyclospora cayetanensis isolates from Nepal, Mexico, and Peru.

    Science.gov (United States)

    Sulaiman, Irshad M; Torres, Patricia; Simpson, Steven; Kerdahi, Khalil; Ortega, Ynes

    2013-04-01

    We have described the development of a 2-step nested PCR protocol based on the characterization of the 70-kDa heat shock protein (HSP70) gene for rapid detection of the human-pathogenic Cyclospora cayetanensis parasite. We tested and validated these newly designed primer sets by PCR amplification followed by nucleotide sequencing of PCR-amplified HSP70 fragments belonging to 16 human C. cayetanensis isolates from 3 different endemic regions that include Nepal, Mexico, and Peru. No genetic polymorphism was observed among the isolates at the characterized regions of the HSP70 locus. This newly developed HSP70 gene-based nested PCR protocol provides another useful genetic marker for the rapid detection of C. cayetanensis in the future.

  16. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China

    Directory of Open Access Journals (Sweden)

    Yongda Zhao

    2018-04-01

    Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target

  17. Characterization of antimicrobial resistance genes in Haemophilus parasuis isolated from pigs in China.

    Science.gov (United States)

    Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu

    2018-01-01

    Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel

  18. Characterization of Genes Encoding Key Enzymes Involved in Anthocyanin Metabolism of Kiwifruit during Storage Period

    OpenAIRE

    Li, Boqiang; Xia, Yongxiu; Wang, Yuying; Qin, Guozheng; Tian, Shiping

    2017-01-01

    ‘Hongyang’ is a red fleshed kiwifruit with high anthocyanin content. In this study, we mainly investigated effects of different temperatures (25 and 0°C) on anthocyanin biosynthesis in harvested kiwifruit, and characterized the genes encoding key enzymes involved in anthocyanin metabolism, as well as evaluated the mode of the action, by which low temperature regulates anthocyanin accumulation in ‘Hongyang’ kiwifruit during storage period. The results showed that low temperature could effectiv...

  19. Characterization of ORF89 - A latency-related gene of white spot syndrome virus

    International Nuclear Information System (INIS)

    Hossain, M.S.; Khadijah, Siti; Kwang, Jimmy

    2004-01-01

    Open reading frame 89 (ORF89) is one of the three genes that are believed to be involved in the latent infection of white spot syndrome virus (WSSV). Here, we report the structure and functional characterization of ORF89. cDNA sequencing, 5' RLM-RACE, and 3' RLM-RACE showed that ORF89 gene is transcribed into an unspliced mRNA of 4436 nucleotides, which is predicted to encode a protein of 1437 amino acids. ORF89 expressed an approximately 165-kDa protein in Sf9 cells that localized in the nucleus. Amino acids 678-683 were found to be essential for nuclear localization. Cotransfection assays demonstrated that ORF89 protein repressed its own promoter as well as those of a protein kinase and the thymidine-thymidylate kinase genes of WSSV. SYBR Green real-time PCR indicated that the repression occurred at the transcriptional level

  20. Cloning, characterization and sequence comparison of the gene coding for IMP dehydrogenase from Pyrococcus furiosus.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.

  1. Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.

    Science.gov (United States)

    Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E

    1996-10-03

    We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.

  2. Molecular cloning and characterization of recA-like gene from Schizosaccharomyces pombe

    International Nuclear Information System (INIS)

    Lee, J.S.; Kang, J.K.; Yoon, S.M.; Park, Y.; Yang, Y.K.; Kim, S.W.; Park, J.K.; Park, J.G.; Hong, S.H.; Park, S.D.

    1996-01-01

    We have previously purified and characterized a RecA-like protein from Schizosaccharomyces pombe (S. pombe). In the present study, we have cloned a gene encoding the RecA-like protein. The S. pombe recA-like gene was isolated by immunological screening of the expression library of S. pombe using anti-Escherichia coli (E. coli) RecA antibody as a probe. From 10(6) plaques screened, 6 putative clones were finally isolated. Five of the clones screened contained the same kinds of DNA inserts, as determined by crosshybridization analysis. Among the clones, TC-2 was selected for further studies. The pGEM3Zf(-)Delta 17 vector harboring the 4.3 kb DNA insert of TC-2 clone was capable of producing abeta-gal/RecA-like fusion protein, suggesting that the cloned gene encodes the RecA-like protein of S. pombe. It was also revealed by Southern hybridization analysis that the same DNA sequence as the cloned recA-like gene is located within the S. pombe chromosomal DNA. In addition, the cloned recA-like gene was transcribed into a 3.0 kb RNA transcript, as judged by Northern blot analysis. The level of the RNA transcript of recA-like gene was increased approximately 1.6 to 2.4-fold upon treatment with DNA damaging agents such as ultraviolet (UV)-light, methyl methanesulfonate (MMS), and mitomycin-C (MMC). This data suggests that the cloned S. pombe recA-like gene is slightly inducible to DNAdamage as in E. coli recA gene. These results suggest that an inducible repair mechanism analogous to that of E. coli may exist in fission yeast S. pombe

  3. Characterization of CG6178 gene product with high sequence similarity to firefly luciferase in Drosophila melanogaster.

    Science.gov (United States)

    Oba, Yuichi; Ojika, Makoto; Inouye, Satoshi

    2004-03-31

    This is the first identification of a long-chain fatty acyl-CoA synthetase in Drosophila by enzymatic characterization. The gene product of CG6178 (CG6178) in Drosophila melanogaster genome, which has a high sequence similarity to firefly luciferase, has been expressed and characterized. CG6178 showed long-chain fatty acyl-CoA synthetic activity in the presence of ATP, CoA and Mg(2+), suggesting a fatty acyl adenylate is an intermediate. Recently, it was revealed that firefly luciferase has two catalytic functions, monooxygenase (luciferase) and AMP-mediated CoA ligase (fatty acyl-CoA synthetase). However, unlike firefly luciferase, CG6178 did not show luminescence activity in the presence of firefly luciferin, ATP, CoA and Mg(2+). The enzymatic properties of CG6178 including substrate specificity, pH dependency and optimal temperature were close to those of firefly luciferase and rat fatty acyl-CoA synthetase. Further, phylogenic analyses strongly suggest that the firefly luciferase gene may have evolved from a fatty acyl-CoA synthetase gene as a common ancestral gene.

  4. Identification and characterization of rhizospheric microbial diversity by 16S ribosomal RNA gene sequencing

    Directory of Open Access Journals (Sweden)

    Muhammad Naveed

    2014-09-01

    Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.

  5. Characterization of the ovine ribosomal protein SA gene and its pseudogenes

    Directory of Open Access Journals (Sweden)

    Van Zeveren Alex

    2010-03-01

    Full Text Available Abstract Background The ribosomal protein SA (RPSA, previously named 37-kDa laminin receptor precursor/67-kDa laminin receptor (LRP/LR is a multifunctional protein that plays a role in a number of pathological processes, such as cancer and prion diseases. In all investigated species, RPSA is a member of a multicopy gene family consisting of one full length functional gene and several pseudogenes. Therefore, for studies on RPSA related pathways/pathologies, it is important to characterize the whole family and to address the possible function of the other RPSA family members. The present work aims at deciphering the RPSA family in sheep. Results In addition to the full length functional ovine RPSA gene, 11 other members of this multicopy gene family, all processed pseudogenes, were identified. Comparison between the RPSA transcript and these pseudogenes shows a large variety in sequence identities ranging from 99% to 74%. Only one of the 11 pseudogenes, i.e. RPSAP7, shares the same open reading frame (ORF of 295 amino acids with the RPSA gene, differing in only one amino acid. All members of the RPSA family were annotated by comparative mapping and fluorescence in situ hybridization (FISH localization. Transcription was investigated in the cerebrum, cerebellum, spleen, muscle, lymph node, duodenum and blood, and transcripts were detected for 6 of the 11 pseudogenes in some of these tissues. Conclusions In the present work we have characterized the ovine RPSA family. Our results have revealed the existence of 11 ovine RPSA pseudogenes and provide new data on their structure and sequence. Such information will facilitate molecular studies of the functional RPSA gene taking into account the existence of these pseudogenes in the design of experiments. It remains to be investigated if the transcribed members are functional as regulatory non-coding RNA or as functional proteins.

  6. Functional Gene Discovery and Characterization of Genes and Alleles Affecting Wood Biomass Yield and Quality in Populus

    Energy Technology Data Exchange (ETDEWEB)

    Busov, Victor [Michigan Technological Univ., Houghton, MI (United States)

    2017-02-12

    Adoption of biofuels as economically and environmentally viable alternative to fossil fuels would require development of specialized bioenergy varieties. A major goal in the breeding of such varieties is the improvement of lignocellulosic biomass yield and quality. These are complex traits and understanding the underpinning molecular mechanism can assist and accelerate their improvement. This is particularly important for tree bioenergy crops like poplars (species and hybrids from the genus Populus), for which breeding progress is extremely slow due to long generation cycles. A variety of approaches have been already undertaken to better understand the molecular bases of biomass yield and quality in poplar. An obvious void in these undertakings has been the application of mutagenesis. Mutagenesis has been instrumental in the discovery and characterization of many plant traits including such that affect biomass yield and quality. In this proposal we use activation tagging to discover genes that can significantly affect biomass associated traits directly in poplar, a premier bioenergy crop. We screened a population of 5,000 independent poplar activation tagging lines under greenhouse conditions for a battery of biomass yield traits. These same plants were then analyzed for changes in wood chemistry using pyMBMS. As a result of these screens we have identified nearly 800 mutants, which are significantly (P<0.05) different when compared to wild type. Of these majority (~700) are affected in one of ten different biomass yield traits and 100 in biomass quality traits (e.g., lignin, S/G ration and C6/C5 sugars). We successfully recovered the position of the tag in approximately 130 lines, showed activation in nearly half of them and performed recapitulation experiments with 20 genes prioritized by the significance of the phenotype. Recapitulation experiments are still ongoing for many of the genes but the results are encouraging. For example, we have shown successful

  7. Functional overexpression and characterization of lipogenesis-related genes in the oleaginous yeast Yarrowia lipolytica.

    Science.gov (United States)

    Silverman, Andrew M; Qiao, Kangjian; Xu, Peng; Stephanopoulos, Gregory

    2016-04-01

    Single cell oil (SCO) is an attractive energy source due to scalability, utilization of low-cost renewable feedstocks, and type of product(s) made. Engineering strains capable of producing high lipid titers and yields is crucial to the economic viability of these processes. However, lipid synthesis in cells is a complex phenomenon subject to multiple layers of regulation, making gene target identification a challenging task. In this study, we aimed to identify genes in the oleaginous yeast Yarrowia lipolytica whose overexpression enhances lipid production by this organism. To this end, we examined the effect of the overexpression of a set of 44 native genes on lipid production in Y. lipolytica, including those involved in glycerolipid synthesis, fatty acid synthesis, central carbon metabolism, NADPH generation, regulation, and metabolite transport and characterized each resulting strain's ability to produce lipids growing on both glucose and acetate as a sole carbon source. Our results suggest that a diverse subset of genes was effective at individually influencing lipid production in Y. lipolytica, sometimes in a substrate-dependent manner. The most productive strain on glucose overexpressed the diacylglycerol acyltransferase DGA2 gene, increasing lipid titer, cellular content, and yield by 236, 165, and 246 %, respectively, over our control strain. On acetate, our most productive strain overexpressed the acylglycerol-phosphate acyltransferase SLC1 gene, with a lipid titer, cellular content, and yield increase of 99, 91, and 151 %, respectively, over the control strain. Aside from genes encoding enzymes that directly catalyze the reactions of lipid synthesis, other ways by which lipogenesis was increased in these cells include overexpressing the glycerol-3-phosphate dehydrogenase (GPD1) gene to increase production of glycerol head groups and overexpressing the 6-phosphogluconolactonase (SOL3) gene from the oxidative pentose phosphate pathway to increase NADPH

  8. Isolation and characterization of CXC receptor genes in a range of elasmobranchs.

    Science.gov (United States)

    Goostrey, Anna; Jones, Gareth; Secombes, Christopher J

    2005-01-01

    The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.

  9. Characterization of the biosynthetic gene cluster for cryptic phthoxazolin A in Streptomyces avermitilis.

    Directory of Open Access Journals (Sweden)

    Dian Anggraini Suroto

    Full Text Available Phthoxazolin A, an oxazole-containing polyketide, has a broad spectrum of anti-oomycete activity and herbicidal activity. We recently identified phthoxazolin A as a cryptic metabolite of Streptomyces avermitilis that produces the important anthelmintic agent avermectin. Even though genome data of S. avermitilis is publicly available, no plausible biosynthetic gene cluster for phthoxazolin A is apparent in the sequence data. Here, we identified and characterized the phthoxazolin A (ptx biosynthetic gene cluster through genome sequencing, comparative genomic analysis, and gene disruption. Sequence analysis uncovered that the putative ptx biosynthetic genes are laid on an extra genomic region that is not found in the public database, and 8 open reading frames in the extra genomic region could be assigned roles in the biosynthesis of the oxazole ring, triene polyketide and carbamoyl moieties. Disruption of the ptxA gene encoding a discrete acyltransferase resulted in a complete loss of phthoxazolin A production, confirming that the trans-AT type I PKS system is responsible for the phthoxazolin A biosynthesis. Based on the predicted functional domains in the ptx assembly line, we propose the biosynthetic pathway of phthoxazolin A.

  10. Identification and molecular characterization of nitric oxide synthase (NOS) gene in the intertidal copepod Tigriopus japonicus.

    Science.gov (United States)

    Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong

    2016-02-10

    In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.

  11. Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family

    International Nuclear Information System (INIS)

    Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain

    2003-01-01

    The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA

  12. Identification and functional characterization of a solute carrier family 15, member 4 gene in Litopenaeus vannamei.

    Science.gov (United States)

    Chen, Yong-Gui; Yuan, Kai; Zhang, Ze-Zhi; Yuan, Feng-Hua; Weng, Shao-Ping; Yue, Hai-Tao; He, Jian-Guo; Chen, Yi-Hong

    2016-04-01

    Innate immunity in shrimp is important in resisting bacterial infection. The NF-κB pathway is pivotal in such an immune response. This study cloned and functionally characterized the solute carrier family (SLC) 15 member A 4 (LvSLC15A4) gene in Litopenaeus vannamei. The open reading frame of LvSLC15A4 is 1, 902 bp long and encodes a putative 633-amino acid protein, which is localized in the plasma membrane and intracellular vesicular compartments. Results of the reporter gene assay showed that LvSLC15A4 upregulated NF-κB target genes, including the immediate-early gene 1 of white spot syndrome virus, as well as several antimicrobial peptide genes, such as pen4, CecA, AttA, and Mtk in S2 cells. Moreover, knocked-down expression of LvSLC15A4 reduced pen4 expression in L. vannamei. LvSLC15A4 down-regulation also increased the cumulative mortality of Vibrio parahemolyticus-infected L. vannamei. Furthermore, LvSLC15A4 expression was induced by unfolded protein response (UPR) in L. vannamei hematocytes. These results suggest that LvSLC15A4 participates in L. vannamei innate immunity via the NF-κB pathway and thus may be related to UPR. Copyright © 2015 Elsevier Ltd. All rights reserved.

  13. Genetic characterization of complete open reading frame of glycoprotein C gene of bovine herpesvirus 1

    Directory of Open Access Journals (Sweden)

    Saurabh Majumder

    2013-10-01

    Full Text Available Aim: To characterize one of the major glycoprotein genes viz., glycoprotein C (gC; UL44, unique long region 44 of bovineherpesvirus 1(BoHV1 of Indian origin at genetic and phylogenetic level.Materials and Methods: A bovine herpesvirus 1 isolate viz., (BoHV1/IBR 216 II/ 1976/ India maintained at Division ofVirology, IVRI, Mukteswar was used for the current study. The DNA was extracted using commercial kit and the completeORF of gC gene was amplified, cloned, and sequenced by conventional Sanger sequencing method. The sequence wasgenetically and phylogenetically analysed using various bioinformatic tools. The sequence was submitted in the Genbankwith accession number Kc756965.Results: The complete ORF of gC gene was amplified and sequenced. It showed 100% sequence homology with referencecooper strain of BoHV1 and divergence varied from 0% to 2.7% with other isolates of BoHV1. The isolate under study haddivergence of 9.2%, 13%, 26.6%, and 9.2% with BoHV5 (Bovine herpesvirus 5, CvHV1 (Cervid herpesvirus 1, CpHV1(Caprine herpesvirus 1, and BuHV1 (Bubaline herpesvirus 1, respectively.Conclusion: This is the first genetic characterization of complete open reading frame (ORF of glycoprotein C gene (UL44 ofIndian isolate of BoHV1. The gC gene of BoHV1 is highly conserved among all BoHV1 isolates and it can be used as a targetfor designing diagnostic primers for the specific detection of BoHV1.

  14. Characterization of Salt Overly Sensitive 1 (SOS1) gene homoeologs in quinoa (Chenopodium quinoa Willd.).

    Science.gov (United States)

    Maughan, P J; Turner, T B; Coleman, C E; Elzinga, D B; Jellen, E N; Morales, J A; Udall, J A; Fairbanks, D J; Bonifacio, A

    2009-07-01

    Salt tolerance is an agronomically important trait that affects plant species around the globe. The Salt Overly Sensitive 1 (SOS1) gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in germination and growth of plants in saline environments. Quinoa (Chenopodium quinoa Willd.) is a halophytic, allotetraploid grain crop of the family Amaranthaceae with impressive nutritional content and an increasing worldwide market. Many quinoa varieties have considerable salt tolerance, and research suggests quinoa may utilize novel mechanisms to confer salt tolerance. Here we report the cloning and characterization of two homoeologous SOS1 loci (cqSOS1A and cqSOS1B) from C. quinoa, including full-length cDNA sequences, genomic sequences, relative expression levels, fluorescent in situ hybridization (FISH) analysis, and a phylogenetic analysis of SOS1 genes from 13 plant taxa. The cqSOS1A and cqSOS1B genes each span 23 exons spread over 3477 bp and 3486 bp of coding sequence, respectively. These sequences share a high level of similarity with SOS1 homologs of other species and contain two conserved domains, a Nhap cation-antiporter domain and a cyclic-nucleotide binding domain. Genomic sequence analysis of two BAC clones (98 357 bp and 132 770 bp) containing the homoeologous SOS1 genes suggests possible conservation of synteny across the C. quinoa sub-genomes. This report represents the first molecular characterization of salt-tolerance genes in a halophytic species in the Amaranthaceae as well as the first comparative analysis of coding and non-coding DNA sequences of the two homoeologous genomes of C. quinoa.

  15. Genomic characterization of putative allergen genes in peach/almond and their synteny with apple

    Science.gov (United States)

    Chen, Lin; Zhang, Shuiming; Illa, Eudald; Song, Lijuan; Wu, Shandong; Howad, Werner; Arús, Pere; Weg, Eric van de; Chen, Kunsong; Gao, Zhongshan

    2008-01-01

    Background Fruits from several species of the Rosaceae family are reported to cause allergic reactions in certain populations. The allergens identified belong to mainly four protein families: pathogenesis related 10 proteins, thaumatin-like proteins, lipid transfer proteins and profilins. These families of putative allergen genes in apple (Mal d 1 to 4) have been mapped on linkage maps and subsequent genetic study on allelic diversity and hypoallergenic traits has been carried out recently. In peach (Prunus persica), these allergen gene families are denoted as Pru p 1 to 4 and for almond (Prunus dulcis)Pru du 1 to 4. Genetic analysis using current molecular tools may be helpful to establish the cause of allergenicity differences observed among different peach cultivars. This study was to characterize putative peach allergen genes for their genomic sequences and linkage map positions, and to compare them with previously characterized homologous genes in apple (Malus domestica). Results Eight Pru p/du 1 genes were identified, four of which were new. All the Pru p/du 1 genes were mapped in a single bin on the top of linkage group 1 (G1). Five Pru p/du 2 genes were mapped on four different linkage groups, two very similar Pru p/du 2.01 genes (A and B) were on G3, Pru p/du 2.02 on G7,Pru p/du 2.03 on G8 and Pru p/du 2.04 on G1. There were differences in the intron and exon structure in these Pru p/du 2 genes and in their amino acid composition. Three Pru p/du 3 genes (3.01–3.03) containing an intron and a mini exon of 10 nt were mapped in a cluster on G6. Two Pru p/du 4 genes (Pru p/du 4.01 and 4.02) were located on G1 and G7, respectively. The Pru p/du 1 cluster on G1 aligned to the Mal d 1 clusters on LG16; Pru p/du 2.01A and B on G3 to Mal d 2.01A and B on LG9; the Pru p/du 3 cluster on G6 to Mal d 3.01 on LG12; Pru p/du 4.01 on G1 to Mal d 4.03 on LG2; and Pru p/du 4.02 on G7 to Mal d 4.02 on LG2. Conclusion A total of 18 putative peach/almond allergen genes have

  16. Genomic characterization of putative allergen genes in peach/almond and their synteny with apple

    Directory of Open Access Journals (Sweden)

    Weg Eric

    2008-11-01

    Full Text Available Abstract Background Fruits from several species of the Rosaceae family are reported to cause allergic reactions in certain populations. The allergens identified belong to mainly four protein families: pathogenesis related 10 proteins, thaumatin-like proteins, lipid transfer proteins and profilins. These families of putative allergen genes in apple (Mal d 1 to 4 have been mapped on linkage maps and subsequent genetic study on allelic diversity and hypoallergenic traits has been carried out recently. In peach (Prunus persica, these allergen gene families are denoted as Pru p 1 to 4 and for almond (Prunus dulcisPru du 1 to 4. Genetic analysis using current molecular tools may be helpful to establish the cause of allergenicity differences observed among different peach cultivars. This study was to characterize putative peach allergen genes for their genomic sequences and linkage map positions, and to compare them with previously characterized homologous genes in apple (Malus domestica. Results Eight Pru p/du 1 genes were identified, four of which were new. All the Pru p/du 1 genes were mapped in a single bin on the top of linkage group 1 (G1. Five Pru p/du 2 genes were mapped on four different linkage groups, two very similar Pru p/du 2.01 genes (A and B were on G3, Pru p/du 2.02 on G7,Pru p/du 2.03 on G8 and Pru p/du 2.04 on G1. There were differences in the intron and exon structure in these Pru p/du 2 genes and in their amino acid composition. Three Pru p/du 3 genes (3.01–3.03 containing an intron and a mini exon of 10 nt were mapped in a cluster on G6. Two Pru p/du 4 genes (Pru p/du 4.01 and 4.02 were located on G1 and G7, respectively. The Pru p/du 1 cluster on G1 aligned to the Mal d 1 clusters on LG16; Pru p/du 2.01A and B on G3 to Mal d 2.01A and B on LG9; the Pru p/du 3 cluster on G6 to Mal d 3.01 on LG12; Pru p/du 4.01 on G1 to Mal d 4.03 on LG2; and Pru p/du 4.02 on G7 to Mal d 4.02 on LG2. Conclusion A total of 18 putative peach

  17. Southeast Asia Report

    National Research Council Canada - National Science Library

    1987-01-01

    Partial Contents: Southeast Asia, Exchange Dealer, Budget Review, Declared Nonactive, Candidacy, Finance Minister, Economic Policy, Exchange Rate, Farm, Defense Ministers, Labor Party,Local Car Manufacturer...

  18. Sustainable transport studies in Asia

    CERN Document Server

    Zhang, Junyi

    2013-01-01

    This book aims to provide a good understanding of and perspective on sustainable transport in Asia by focusing on economic, environmental, and social sustainability. It is widely acknowledged that the current situation and trends in transport are not always sustainable in Asia, due in part to the fast-growing economy and the astounding speed of urbanization as well as least-mature governance. As essential research material, the book provides strong support for policy makers and planners by comprehensively covering three groups of strategies, characterized by the words “avoid” (e.g., urban form design and control of car ownership), “shift” (e.g., establishing comprehensive transportation systems and increasing public transportation systems for both intracity and intercity travel), and “improve” (e.g., redesign of paratransit system, low-emission vehicles, intelligent transportation systems, and eco-life). These are elaborated in the book alongside consideration of the uncertainty of policy effects ...

  19. Detection and characterization of interleukin-6 gene variants in Canis familiaris: association studies with periodontal disease.

    Science.gov (United States)

    Morinha, Francisco; Albuquerque, Carlos; Requicha, João; Dias, Isabel; Leitão, José; Gut, Ivo; Guedes-Pinto, Henrique; Viegas, Carlos; Bastos, Estela

    2011-10-10

    Periodontal disease (PD) is the most common inflammatory disease of the oral cavity of domestic carnivores. In Human Medicine molecular genetics research showed that several genes play a role in the predisposition and progression of this complex disease, primarily through the regulation of inflammatory mediators, but the exactly mechanisms are poorly understood. This study aims to contribute to the characterization of the genetic basis of PD in the dog, a classically accepted model in Periodontology. We searched for genetic variations in the interleukin-6 (IL6) gene, in order to verify its association with PD in a case-control study including 25 dogs in the PD case group and 45 dogs in the control group. We indentified and characterized three new genetic variations in IL6 gene. No statistically significant differences were detected between the control and PD cases groups. Our results do not support an evidence for a major role contribution of these variants in the susceptibility to PD in the analyzed population. Nevertheless, the sequence variant I/5_g.105G>A leads to an amino acid change (arginine to glutamine) and was predicted to be possibly damaging to the IL6 protein. A larger cohort and functional studies would be of extreme importance in a near future to understand the possible role of IL6 variants in this disease. Copyright © 2011 Elsevier B.V. All rights reserved.

  20. Are South East Asia Countries Capital Markets Characterized by Nonlinear Structures? An Investigation from Indonesia, Philippine and Singapore Capital Market Indices

    Directory of Open Access Journals (Sweden)

    Minarnita Yanti Verawati Bakara

    2014-11-01

    Full Text Available This research paper tries to detect the nonlinear structure in the South East Asia Countries Capital Markets. The capital markets of three South East Asia Countries are chosen: Indonesia, Philippine, and Singapore. Daily return data of Capital Markets composite indices are observed: Straits Times Index (STI of Singapore Exchange from January 04, 1985 to December 31, 2007, Pilipino Stock Exchange Index (PSEi of Philippines Stock Exchange from March 1, 1990 to December 31, 2007 and Jakarta Composite Index (JCI of Indonesia Stock Exchange from January 05, 1988 to December 31, 2007.Should nonlinearity be found, the outcomes of each observation are compared to analyze the implications of each country in global, regional and local position of their competition in the continuously changing world of interdependency environment. The implications of nonlinearity finding in the three ASEAN countries capital markets to the current issues of AFAS on Financial Services, Harmonization among ASEAN countries capital markets in the ASEAN region and ASEAN integration and liberalization on Financial Services are analyzed.BDS statistic and R/S Analysis as our tools for nonlinearity testing are applied. Nonlinearity evidences in Jakarta Composite Index, Pilipino Stock Exchange Index and Straits Times Index are found.

  1. Saponin determination, expression analysis and functional characterization of saponin biosynthetic genes in Chenopodium quinoa leaves.

    Science.gov (United States)

    Fiallos-Jurado, Jennifer; Pollier, Jacob; Moses, Tessa; Arendt, Philipp; Barriga-Medina, Noelia; Morillo, Eduardo; Arahana, Venancio; de Lourdes Torres, Maria; Goossens, Alain; Leon-Reyes, Antonio

    2016-09-01

    Quinoa (Chenopodium quinoa Willd.) is a highly nutritious pseudocereal with an outstanding protein, vitamin, mineral and nutraceutical content. The leaves, flowers and seed coat of quinoa contain triterpenoid saponins, which impart bitterness to the grain and make them unpalatable without postharvest removal of the saponins. In this study, we quantified saponin content in quinoa leaves from Ecuadorian sweet and bitter genotypes and assessed the expression of saponin biosynthetic genes in leaf samples elicited with methyl jasmonate. We found saponin accumulation in leaves after MeJA treatment in both ecotypes tested. As no reference genes were available to perform qPCR in quinoa, we mined publicly available RNA-Seq data for orthologs of 22 genes known to be stably expressed in Arabidopsis thaliana using geNorm, NormFinder and BestKeeper algorithms. The quinoa ortholog of At2g28390 (Monensin Sensitivity 1, MON1) was stably expressed and chosen as a suitable reference gene for qPCR analysis. Candidate saponin biosynthesis genes were screened in the quinoa RNA-Seq data and subsequent functional characterization in yeast led to the identification of CqbAS1, CqCYP716A78 and CqCYP716A79. These genes were found to be induced by MeJA, suggesting this phytohormone might also modulate saponin biosynthesis in quinoa leaves. Knowledge of the saponin biosynthesis and its regulation in quinoa may aid the further development of sweet cultivars that do not require postharvest processing. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  2. Functional Characterization of 4´OMT and 7OMT Genes in BIA Biosynthesis

    Directory of Open Access Journals (Sweden)

    Tugba eGurkok

    2016-02-01

    Full Text Available Alkaloids are diverse group of secondary metabolites generally found in plants. Opium poppy (Papaver somniferum L., the only commercial source of morphinan alkaloids, has been used as a medicinal plant since ancient times. It produces benzylisoquinoline alkaloids (BIA including the narcotic analgesic morphine, the muscle relaxant papaverine, and the anti-cancer agent noscapine. Though BIAs play crucial roles in many biological mechanisms their steps in biosynthesis and the responsible genes remain to be revealed. In this study, expressions of 3-hydroxy-N-methylcoclaurine 4´-O-methyltransferase (4´OMT and reticuline 7-O-methyltransferase (7OMT genes were subjected tomanipulation to functionally characterize their roles in BIA biosynthesis. Measurements of alkaloid accumulation were performed in leaf, stem and capsule tissues accordingly. Suppression of 4´OMT expression caused reduction in the total alkaloid content in stem tissue whereas total alkaloid content was significantly induced in the capsule. Silencing of the 7OMT gene also caused repression in total alkaloid content in the stem. On the other hand, over-expression of 4´OMT and 7OMT resulted in higher morphine accumulation in the stem but suppressed amount in the capsule. Moreover, differential expression in several BIA synthesis genes (CNMT, TYDC, 6OMT, SAT, COR, 4´OMT and 7OMT were observed upon manipulation of 4´OMT and 7OMT expression. Upon silencing and overexpression applications, tissue specific effects of these genes were identified. Manipulation of 4´OMT and 7OMT genes caused differentiated accumulation of BIAs including morphine and noscapine in capsule and stem tissues.

  3. Characterization and Expression of the Lucina pectinata Oxygen and Sulfide Binding Hemoglobin Genes

    Science.gov (United States)

    López-Garriga, Juan; Cadilla, Carmen L.

    2016-01-01

    The clam Lucina pectinata lives in sulfide-rich muds and houses intracellular symbiotic bacteria that need to be supplied with hydrogen sulfide and oxygen. This clam possesses three hemoglobins: hemoglobin I (HbI), a sulfide-reactive protein, and hemoglobin II (HbII) and III (HbIII), which are oxygen-reactive. We characterized the complete gene sequence and promoter regions for the oxygen reactive hemoglobins and the partial structure and promoters of the HbI gene from Lucina pectinata. We show that HbI has two mRNA variants, where the 5’end had either a sequence of 96 bp (long variant) or 37 bp (short variant). The gene structure of the oxygen reactive Hbs is defined by having 4-exons/3-introns with conservation of intron location at B12.2 and G7.0 and the presence of pre-coding introns, while the partial gene structure of HbI has the same intron conservation but appears to have a 5-exon/ 4-intron structure. A search for putative transcription factor binding sites (TFBSs) was done with the promoters for HbII, HbIII, HbI short and HbI long. The HbII, HbIII and HbI long promoters showed similar predicted TFBSs. We also characterized MITE-like elements in the HbI and HbII gene promoters and intronic regions that are similar to sequences found in other mollusk genomes. The gene expression levels of the clam Hbs, from sulfide-rich and sulfide-poor environments showed a significant decrease of expression in the symbiont-containing tissue for those clams in a sulfide-poor environment, suggesting that the sulfide concentration may be involved in the regulation of these proteins. Gene expression evaluation of the two HbI mRNA variants indicated that the longer variant is expressed at higher levels than the shorter variant in both environments. PMID:26824233

  4. Bioinformatics, interaction network analysis, and neural networks to characterize gene expression of radicular cyst and periapical granuloma.

    Science.gov (United States)

    Poswar, Fabiano de Oliveira; Farias, Lucyana Conceição; Fraga, Carlos Alberto de Carvalho; Bambirra, Wilson; Brito-Júnior, Manoel; Sousa-Neto, Manoel Damião; Santos, Sérgio Henrique Souza; de Paula, Alfredo Maurício Batista; D'Angelo, Marcos Flávio Silveira Vasconcelos; Guimarães, André Luiz Sena

    2015-06-01

    Bioinformatics has emerged as an important tool to analyze the large amount of data generated by research in different diseases. In this study, gene expression for radicular cysts (RCs) and periapical granulomas (PGs) was characterized based on a leader gene approach. A validated bioinformatics algorithm was applied to identify leader genes for RCs and PGs. Genes related to RCs and PGs were first identified in PubMed, GenBank, GeneAtlas, and GeneCards databases. The Web-available STRING software (The European Molecular Biology Laboratory [EMBL], Heidelberg, Baden-Württemberg, Germany) was used in order to build the interaction map among the identified genes by a significance score named weighted number of links. Based on the weighted number of links, genes were clustered using k-means. The genes in the highest cluster were considered leader genes. Multilayer perceptron neural network analysis was used as a complementary supplement for gene classification. For RCs, the suggested leader genes were TP53 and EP300, whereas PGs were associated with IL2RG, CCL2, CCL4, CCL5, CCR1, CCR3, and CCR5 genes. Our data revealed different gene expression for RCs and PGs, suggesting that not only the inflammatory nature but also other biological processes might differentiate RCs and PGs. Copyright © 2015 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.

  5. Characterization of Putative cis-Regulatory Elements in Genes Preferentially Expressed in Arabidopsis Male Meiocytes

    Directory of Open Access Journals (Sweden)

    Junhua Li

    2014-01-01

    Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.

  6. Sequence analysis and molecular characterization of Wnt4 gene in metacestodes of Taenia solium.

    Science.gov (United States)

    Hou, Junling; Luo, Xuenong; Wang, Shuai; Yin, Cai; Zhang, Shaohua; Zhu, Xueliang; Dou, Yongxi; Cai, Xuepeng

    2014-04-01

    Wnt proteins are a family of secreted glycoproteins that are evolutionarily conserved and considered to be involved in extensive developmental processes in metazoan organisms. The characterization of wnt genes may improve understanding the parasite's development. In the present study, a wnt4 gene encoding 491amino acids was amplified from cDNA of metacestodes of Taenia solium using reverse transcription PCR (RT-PCR). Bioinformatics tools were used for sequence analysis. The conserved domain of the wnt gene family was predicted. The expression profile of Wnt4 was investigated using real-time PCR. Wnt4 expression was found to be dramatically increased in scolex evaginated cysticerci when compared to invaginated cysticerci. In situ hybridization showed that wnt4 gene was distributed in the posterior end of the worm along the primary body axis in evaginated cysticerci. These findings indicated that wnt4 may take part in the process of cysticerci evagination and play a role in scolex/bladder development of cysticerci of T. solium.

  7. Gene Expression Music Algorithm-Based Characterization of the Ewing Sarcoma Stem Cell Signature

    Directory of Open Access Journals (Sweden)

    Martin Sebastian Staege

    2016-01-01

    Full Text Available Gene Expression Music Algorithm (GEMusicA is a method for the transformation of DNA microarray data into melodies that can be used for the characterization of differentially expressed genes. Using this method we compared gene expression profiles from endothelial cells (EC, hematopoietic stem cells, neuronal stem cells, embryonic stem cells (ESC, and mesenchymal stem cells (MSC and defined a set of genes that can discriminate between the different stem cell types. We analyzed the behavior of public microarray data sets from Ewing sarcoma (“Ewing family tumors,” EFT cell lines and biopsies in GEMusicA after prefiltering DNA microarray data for the probe sets from the stem cell signature. Our results demonstrate that individual Ewing sarcoma cell lines have a high similarity to ESC or EC. Ewing sarcoma cell lines with inhibited Ewing sarcoma breakpoint region 1-Friend leukemia virus integration 1 (EWSR1-FLI1 oncogene retained the similarity to ESC and EC. However, correlation coefficients between GEMusicA-processed expression data between EFT and ESC decreased whereas correlation coefficients between EFT and EC as well as between EFT and MSC increased after knockdown of EWSR1-FLI1. Our data support the concept of EFT being derived from cells with features of embryonic and endothelial cells.

  8. Reliable and rapid characterization of functional FCN2 gene variants reveals diverse geographical patterns

    Directory of Open Access Journals (Sweden)

    Ojurongbe Olusola

    2012-05-01

    Full Text Available Abstract Background Ficolin-2 coded by FCN2 gene is a soluble serum protein and an innate immune recognition element of the complement system. FCN2 gene polymorphisms reveal distinct geographical patterns and are documented to alter serum ficolin levels and modulate disease susceptibility. Methods We employed a real-time PCR based on Fluorescence Resonance Energy Transfer (FRET method to genotype four functional SNPs including -986 G > A (#rs3124952, -602 G > A (#rs3124953, -4A > G (#rs17514136 and +6424 G > T (#rs7851696 in the ficolin-2 (FCN2 gene. We characterized the FCN2 variants in individuals representing Brazilian (n = 176, Nigerian (n = 180, Vietnamese (n = 172 and European Caucasian ethnicity (n = 165. Results We observed that the genotype distribution of three functional SNP variants (−986 G > A, -602 G > A and -4A > G differ significantly between the populations investigated (p p  Conclusions The observed distribution of the FCN2 functional SNP variants may likely contribute to altered serum ficolin levels and this may depend on the different disease settings in world populations. To conclude, the use of FRET based real-time PCR especially for FCN2 gene will benefit a larger scientific community who extensively depend on rapid, reliable method for FCN2 genotyping.

  9. Complement C3 gene: Expression characterization and innate immune response in razor clam Sinonovacula constricta.

    Science.gov (United States)

    Peng, Maoxiao; Niu, Donghong; Wang, Fei; Chen, Zhiyi; Li, Jiale

    2016-08-01

    Complement component 3 (C3) is central to the complement system, playing an important role in immune defense, immune regulation and immune pathology. Several C3 genes have been characterized in invertebrates but very few in shellfish. The C3 gene was identified from the razor clam Sinonovacula constricta, referred to here as Sc-C3. It was found to be highly homologous with the C3 gene of Ruditapes decussatus. All eight model motifs of the C3 gene were found to be included in the thiolester bond and the C345C region. Sc-C3 was widely expressed in all healthy tissues with expression being highest in hemolymph. A significant difference in expression was revealed at the umbo larvae development stage. The expression of Sc-C3 was highly regulated in the hemolymph and liver, with a distinct response pattern being noted after a challenge with Micrococcus lysodeikticus and Vibrio parahemolyticus. It is therefore suggested that a complicated and unique response pathway may be present in S. constricta. Further, serum of S. constricta containing Sc-C3 was extracted. This was activated by LPS or bacterium for verification for function. The more obvious immune function of Sc-C3 was described as an effective membrane rupture in hemocyte cells of rabbit, V. parahemolyticus and Vibrio anguillarum. Thus, Sc-C3 plays an essential role in the immune defense of S. constricta. Copyright © 2016 Elsevier Ltd. All rights reserved.

  10. Molecular cloning and characterization of arginine kinase gene of Toxocara canis.

    Science.gov (United States)

    Sahu, Shivani; Samanta, S; Harish, D R; Sudhakar, N R; Raina, O K; Shantaveer, S B; Madhu, D N; Kumar, Ashok

    2015-06-01

    Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcription was done with oligo dT primers to obtain complementary DNA (cDNA). Polymerase chain reaction (PCR) was carried out using cDNA as template with specific primers which amplified a product of 1,202 bp. The amplicon was cloned into pDrive cloning vector and clone was confirmed by colony PCR and restriction endonuclease analysis. Sequence analysis of the gene showed 99.8 and 77.9 % homology with the published AK gene of T. canis (EF015466.1) and Ascaris suum respectively. Structural analysis shown that the mature AK protein consist of 400 amino acids with a molecular wt of 45360.73 Da. Further expression studies are required for producing the recombinant protein for its evaluation in the diagnosis of T. canis infection in humans as well as in adult dogs.

  11. ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES

    Directory of Open Access Journals (Sweden)

    Dominika Ďurechová

    2013-02-01

    Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.

  12. IDENTIFICATION AND CHARACTERIZATION OF THE SUCROSE SYNTHASE 2 GENE (Sus2 IN DURUM WHEAT

    Directory of Open Access Journals (Sweden)

    Mariateresa eVolpicella

    2016-03-01

    Full Text Available Sucrose transport is the central system for the allocation of carbon resources in vascular plants. Sucrose synthase, which reversibly catalyzes sucrose synthesis and cleavage, represents a key enzyme in the control of the flow of carbon into starch biosynthesis. In the present study the genomic identification and characterization of the Sus2-2A and Sus2-2B genes coding for sucrose synthase in durum wheat (cultivars Ciccio and Svevo is reported. The genes were analyzed for their expression in different tissues and at different seed maturation stages, in four tetraploid wheat genotypes (Svevo, Ciccio, Primadur and 5-BIL42. The activity of the encoded proteins was evaluated by specific activity assays on endosperm extracts and their structure established by modelling approaches. The combined results of SUS2 expression and activity levels were then considered in the light of their possible involvement in starch yield.

  13. Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella

    NARCIS (Netherlands)

    Garcia-Fernandez, A.; Fortini, D.; Veldman, K.T.; Mevius, D.J.; Carattoli, A.

    2009-01-01

    The aim of this study was to identify and characterize plasmids carrying qnrS1, qnrB2 and qnrB19 genes identified in Salmonella strains from The Netherlands. The identification of plasmids may help to follow the dissemination of these resistance genes in different countries and environments.

  14. Mobile banking in Asia

    OpenAIRE

    Anne Ho

    2010-01-01

    Technology has transformed the banking industry with the introduction of mobile banking services that offer unprecedented convenience and accessibility to customers. This Asia Focus report describes the various approaches to mobile banking in Asia, and examines how particular countries have addressed regulatory issues.

  15. Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.

    Science.gov (United States)

    Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo

    2017-10-01

    PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.

  16. Isolation and Characterization of D-Myo-Inositol-3-Phosphate Synthase Gene Family Members in Soybean

    OpenAIRE

    Good, Laura Lee

    2001-01-01

    The objective of this research was to isolate genes encoding isoforms of the enzyme D-myo-inositol 3-phosphate synthase (MIPS, E.C. 5.5.1.4) from soybean and to characterize their expression, especially with respect to their involvement in phytic acid biosynthesis. A MIPS-homologous cDNA, designated GmMIPS1, was isolated via PCR using total RNA from developing seeds. Southern blot analysis and examination of MIPS-homologous soybean EST sequences suggested that GmMIPS1 is part of a multigene...

  17. Asia Pacific energy derivatives

    International Nuclear Information System (INIS)

    Fusaro, P.C.

    1997-09-01

    Asia Pacific Energy Derivatives, from FT Energy, is the first report of its kind to examine the growth of energy derivatives within Asia Pacific and their increasing importance within this region. It provides a comprehensive overview of the subject, including analysis of: deregulation as a market driver; the impact of privatisation; the future for energy risk management tools; the unique characteristics of the Asia Pacific energy market; the role of futures exchanges in Asia; existing indexes and their performance; the differences between the Asia Pacific markets and their more mature counterparts in London and New York; non-oil derivatives, project finance and cross commodity arbitrage; the thriving Pacific Rim Over the Counter (OTC) markets. (author)

  18. Identification and Characterization of TALE Homeobox Genes in the Endangered Fern Vandenboschia speciosa.

    Science.gov (United States)

    Ruiz-Estévez, Mercedes; Bakkali, Mohammed; Martín-Blázquez, Rubén; Garrido-Ramos, Manuel A

    2017-10-17

    identification and characterization of TALE homeobox genes in V. speciosa , and gives novel insights about the role of these genes in fern development.

  19. Characterization of Pm59, a novel powdery mildew resistance gene in Afghanistan wheat landrace PI 181356.

    Science.gov (United States)

    Tan, Chengcheng; Li, Genqiao; Cowger, Christina; Carver, Brett F; Xu, Xiangyang

    2018-05-01

    A new powdery mildew resistance gene, designated Pm59, was identified in Afghanistan wheat landrace PI 181356, and mapped in the terminal region of the long arm of chromosome 7A. Powdery mildew, caused by Blumeria graminis f. sp. tritici (Bgt), is an important foliar disease of wheat worldwide. In the Great Plains of the USA, Bgt isolates virulent to widely used powdery mildew resistance genes, such as Pm3a, were previously identified. The objectives of this study were to characterize the powdery mildew resistance gene in Afghanistan landrace PI 181356, which exhibited high resistance to Bgt isolates collected in southern Great Plains, and identify molecular markers for marker-assisted selection. An F 2 population and F 2:3 lines derived from a cross between PI 181356 and OK1059060-126135-3 were used in this study. Genetic analysis indicated that PI 181356 carries a single dominant gene, designated Pm59, in the terminal region of the long arm of chromosome 7A. Pm59 was mapped to an interval between sequence tag site (STS) markers Xmag1759 and Xmag1714 with genetic distances of 0.4 cM distal to Xmag1759 and 5.7 cM proximal to Xmag1714. Physical mapping suggested that Pm59 is in the distal bin 7AL 0.99-1.00. Pm59 is a novel powdery mildew resistance gene, and confers resistance to Bgt isolates collected from the Great Plains and the state of Montana. Therefore, Pm59 can be used to breed powdery mildew-resistant cultivars in these regions. Xmag1759 is ideal for marker-assisted selection of Pm59 in wheat breeding.

  20. Molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer myostatin gene

    Directory of Open Access Journals (Sweden)

    Smith-Keune Carolyn

    2008-02-01

    Full Text Available Abstract Background Myostatin (MSTN is a member of the transforming growth factor-β superfamily that negatively regulates growth of skeletal muscle tissue. The gene encoding for the MSTN peptide is a consolidate candidate for the enhancement of productivity in terrestrial livestock. This gene potentially represents an important target for growth improvement of cultured finfish. Results Here we report molecular characterization, tissue expression and sequence variability of the barramundi (Lates calcarifer MSTN-1 gene. The barramundi MSTN-1 was encoded by three exons 379, 371 and 381 bp in length and translated into a 376-amino acid peptide. Intron 1 and 2 were 412 and 819 bp in length and presented typical GT...AG splicing sites. The upstream region contained cis-regulatory elements such as TATA-box and E-boxes. A first assessment of sequence variability suggested that higher mutation rates are found in the 5' flanking region with several SNP's present in this species. A putative micro RNA target site has also been observed in the 3'UTR (untranslated region and is highly conserved across teleost fish. The deduced amino acid sequence was conserved across vertebrates and exhibited characteristic conserved putative functional residues including a cleavage motif of proteolysis (RXXR, nine cysteines and two glycosilation sites. A qualitative analysis of the barramundi MSTN-1 expression pattern revealed that, in adult fish, transcripts are differentially expressed in various tissues other than skeletal muscles including gill, heart, kidney, intestine, liver, spleen, eye, gonad and brain. Conclusion Our findings provide valuable insights such as sequence variation and genomic information which will aid the further investigation of the barramundi MSTN-1 gene in association with growth. The finding for the first time in finfish MSTN of a miRNA target site in the 3'UTR provides an opportunity for the identification of regulatory mutations on the

  1. Molecular characterization and expression profiling of BMP 3 gene in broiler and layer chicken.

    Science.gov (United States)

    Divya, Devara; Bhattacharya, Tarun Kumar; Gnana Prakash, Manthani; Chatterjee, R N; Shukla, Renu; Guru Vishnu, Pothana Boyina; Vinoth, Amirthalingam; Dushyanth, Kotha

    2018-04-10

    A study was carried out to characterize and explore the expression profile of BMP 3 gene in control broiler and control layer chicken. The total open reading frame of BMP 3 (1389 bp) was cloned and sequenced. The control broiler and control layer chicken showed variation at nucleotide and amino acid level with reference gene (Gallus gallus, NCBI Acc. No. NM_001034819). When compared to reference gene, the control broiler showed four nucleotide differences (c.192A>G, c.519C>T, 903G>A and 960C>G), while, control layer showed variation at c.33G>C, 192A>G, 858G>A, 904G>A, 960C>G and 1257C>T making six differences in total. However, between control broiler and control layer lines, nucleotide differences was observed at c.33G>C, 519T>C, 858G>A, 903A>G, 904G>A and 1257C>T. The change at amino acid level between reference and control broiler was p.D320N and with control layer chicken, it was p.D302N and p.D320N. On the other hand, a single amino acid difference (p.D302N) was observed between the control broiler and control layer chicken lines. The phylogenetic study displayed a close relationship between broiler and layer lines and reference gene and also with other avian species resulting in a cluster formation. These cluster in turn displayed a distant link with the mammalian species. The expression profile of BMP 3 gene exhibited a variation at different stages of embryonic development and also at post embryonic period among the lines with control layer showing higher expression than that of broiler chicken. The protein was also detected in bone marrow tissue of broiler and layer lines by western blotting. It is concluded that the BMP 3 gene sequence differed at nucleotide and amino acid level among the lines and the gene expressed differentially at different periods of embryonic development and also at post hatch period.

  2. Asia-MIP: Multi Model-data Synthesis of Terrestrial Carbon Cycles in Asia

    Science.gov (United States)

    Ichii, K.; Kondo, M.; Ito, A.; Kang, M.; Sasai, T.; SATO, H.; Ueyama, M.; Kobayashi, H.; Saigusa, N.; Kim, J.

    2013-12-01

    Asia, which is characterized by monsoon climate and intense human activities, is one of the prominent understudied regions in terms of terrestrial carbon budgets and mechanisms of carbon exchange. To better understand terrestrial carbon cycle in Asia, we initiated multi-model and data intercomparison project in Asia (Asia-MIP). We analyzed outputs from multiple approaches: satellite-based observations (AVHRR and MODIS) and related products, empirically upscaled estimations (Support Vector Regression) using eddy-covariance observation network in Asia (AsiaFlux, CarboEastAsia, FLUXNET), ~10 terrestrial biosphere models (e.g. BEAMS, Biome-BGC, LPJ, SEIB-DGVM, TRIFFID, VISIT models), and atmospheric inversion analysis (e.g. TransCom models). We focused on the two difference temporal coverage: long-term (30 years; 1982-2011) and decadal (10 years; 2001-2010; data intensive period) scales. The regions of covering Siberia, Far East Asia, East Asia, Southeast Asia and South Asia (60-80E, 10S-80N), was analyzed in this study for assessing the magnitudes, interannual variability, and key driving factors of carbon cycles. We will report the progress of synthesis effort to quantify terrestrial carbon budget in Asia. First, we analyzed the recent trends in Gross Primary Productivities (GPP) using satellite-based observation (AVHRR) and multiple terrestrial biosphere models. We found both model outputs and satellite-based observation consistently show an increasing trend in GPP in most of the regions in Asia. Mechanisms of the GPP increase were analyzed using models, and changes in temperature and precipitation play dominant roles in GPP increase in boreal and temperate regions, whereas changes in atmospheric CO2 and precipitation are important in tropical regions. However, their relative contributions were different. Second, in the decadal analysis (2001-2010), we found that the negative GPP and carbon uptake anomalies in 2003 summer in Far East Asia is one of the largest

  3. Neurology in Asia.

    Science.gov (United States)

    Tan, Chong-Tin

    2015-02-10

    Asia is important as it accounts for more than half of the world population. The majority of Asian countries fall into the middle income category. As for cultural traditions, Asia is highly varied, with many languages spoken. The pattern of neurologic diseases in Asia is largely similar to the West, with some disease features being specific to Asia. Whereas Asia constitutes 60% of the world's population, it contains only 20% of the world's neurologists. This disparity is particularly evident in South and South East Asia. As for neurologic care, it is highly variable depending on whether it is an urban or rural setting, the level of economic development, and the system of health care financing. To help remedy the shortage of neurologists, most counties with larger populations have established training programs in neurology. These programs are diverse, with many areas of concern. There are regional organizations serving as a vehicle for networking in neurology and various subspecialties, as well as an official journal (Neurology Asia). The Asian Epilepsy Academy, with its emphasis on workshops in various locations, EEG certification examination, and fellowships, may provide a template of effective regional networking for improving neurology care in the region. © 2015 American Academy of Neurology.

  4. Cloning and Functional Characterization of the Maize (Zea mays L.) Carotenoid Epsilon Hydroxylase Gene

    Science.gov (United States)

    Sheng, Yanmin; Wang, Yingdian; Capell, Teresa; Shi, Lianxuan; Ni, Xiuzhen; Sandmann, Gerhard; Christou, Paul; Zhu, Changfu

    2015-01-01

    The assignment of functions to genes in the carotenoid biosynthesis pathway is necessary to understand how the pathway is regulated and to obtain the basic information required for metabolic engineering. Few carotenoid ε-hydroxylases have been functionally characterized in plants although this would provide insight into the hydroxylation steps in the pathway. We therefore isolated mRNA from the endosperm of maize (Zea mays L., inbred line B73) and cloned a full-length cDNA encoding CYP97C19, a putative heme-containing carotenoid ε hydroxylase and member of the cytochrome P450 family. The corresponding CYP97C19 genomic locus on chromosome 1 was found to comprise a single-copy gene with nine introns. We expressed CYP97C19 cDNA under the control of the constitutive CaMV 35S promoter in the Arabidopsis thaliana lut1 knockout mutant, which lacks a functional CYP97C1 (LUT1) gene. The analysis of carotenoid levels and composition showed that lutein accumulated to high levels in the rosette leaves of the transgenic lines but not in the untransformed lut1 mutants. These results allowed the unambiguous functional annotation of maize CYP97C19 as an enzyme with strong zeinoxanthin ε-ring hydroxylation activity. PMID:26030746

  5. Molecular Characterization and Expression Profiles of Polygalacturonase Genes in Apolygus lucorum (Hemiptera: Miridae.

    Directory of Open Access Journals (Sweden)

    Lili Zhang

    Full Text Available Polygalacturonase (PG is an enzyme in the salivary glands of piercing-sucking mirid bugs (Hemiptera: Miridae that plays a key role in plant feeding and injury. By constructing a full-length cDNA library, we cloned and characterized 14 PG genes from the salivary glands of Apolygus lucorum, a pestiferous mirid bug in cotton, fruit trees and other crops in China. BLAST search analysis showed that the amino acid sequences deduced from transcripts of the PG genes were closely related to PGs from other mirid bugs. Phylogenetic analysis showed that the PGs of mirid bugs had six main branches, PG1-PG6 (Genbank accession numbers: KF881899~KF881912. We investigated the mRNA expression patterns of the A. lucorum PG genes using real-time PCR. All 14 PGs were expressed significantly higher in the salivary glands than in other tissues (head, thorax, abdomen, leg and wing. For eggs and nymphs, the expression levels of these PGs were much higher in the 5th instar stage than in the egg, and 1st and 3rd instar stages. The PG expression levels in 1-day-old adults were very low, and increased in 5, 20 and 30-day-old adults. Additionally, PG expression levels were generally similar between males and females. The possible physiological functions of PGs in A. lucorum were discussed.

  6. Cloning and characterization of the human integrin β6 gene promoter.

    Directory of Open Access Journals (Sweden)

    Mingyan Xu

    Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.

  7. Characterization of hydrocortisone bioconversion and 16S RNA gene in Synechococcus nidulans cultures.

    Science.gov (United States)

    Rasoul-Amini, S; Ghasemi, Y; Morowvat, M H; Ghoshoon, M B; Raee, M J; Mosavi-Azam, S B; Montazeri-Najafabady, N; Nouri, F; Parvizi, R; Negintaji, N; Khoubani, S

    2010-01-01

    A unicellular cyanobacterium, Synechococcus nidulans (Pringsheim) Komárek, was isolated from paddy-fields and applied in the biotransformation experiment of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The obtained products were chromatographically purified followed by their characterization using spectroscopic methods. 11beta,17beta-dihydroxyandrost-4-en-3-one (2), 11beta-hydroxyandrost-4-en-3,17-dione (3), and androst-4-ene-3,17-dione (4) were the main bioproducts in the hydrocortisone bioconversion. The observed bioreaction characteristics were the side chain degradation of the substrate to prepare compounds (2) and (3) following the 11beta-dehydroxylation for accumulation of the compound (4). Time course study showed the accumulation of the product (2) from the second day of the fermentation and compounds (3) and (4) from the third day. All the metabolites reached their maximum concentration in seven days. Cyanobacterial 16S rRNA gene was also amplified by PCR. Sequences were amplified using the universal prokaryotic primers which amplify a approximately 400-bp region of the 16S rRNA gene. PCR products were sequenced to confirm their authenticity as 16S rRNA gene of cyanobacteria. The result of PCR blasted with other sequenced cyanobacteria in NCBI showed 99% identity to the 16S small subunit rRNA of seven Synechococcus species.

  8. Characterization of Antimicrobial Resistance Patterns and Detection of Virulence Genes in Campylobacter Isolates in Italy

    Science.gov (United States)

    Di Giannatale, Elisabetta; Di Serafino, Gabriella; Zilli, Katiuscia; Alessiani, Alessandra; Sacchini, Lorena; Garofolo, Giuliano; Aprea, Giuseppe; Marotta, Francesca

    2014-01-01

    Campylobacter has developed resistance to several antimicrobial agents over the years, including macrolides, quinolones and fluoroquinolones, becoming a significant public health hazard. A total of 145 strains derived from raw milk, chicken faeces, chicken carcasses, cattle faeces and human faeces collected from various Italian regions, were screened for antimicrobial susceptibility, molecular characterization (SmaI pulsed-field gel electrophoresis) and detection of virulence genes (sequencing and DNA microarray analysis). The prevalence of C. jejuni and C. coli was 62.75% and 37.24% respectively. Antimicrobial susceptibility revealed a high level of resistance for ciprofloxacin (62.76%), tetracycline (55.86%) and nalidixic acid (55.17%). Genotyping of Campylobacter isolates using PFGE revealed a total of 86 unique SmaI patterns. Virulence gene profiles were determined using a new microbial diagnostic microarray composed of 70-mer oligonucleotide probes targeting genes implicated in Campylobacter pathogenicity. Correspondence between PFGE and microarray clusters was observed. Comparisons of PFGE and virulence profiles reflected the high genetic diversity of the strains examined, leading us to speculate different degrees of pathogenicity inside Campylobacter populations. PMID:24556669

  9. Isolation and characterization of a copalyl diphosphate synthase gene promoter from Salvia miltiorrhiza

    Directory of Open Access Journals (Sweden)

    Piotr Szymczyk

    2016-09-01

    Full Text Available The promoter, 5' UTR, and 34-nt 5' fragments of protein encoding region of the Salvia miltiorrhiza copalyl diphosphate synthase gene were cloned and characterized. No tandem repeats, miRNA binding sites, or CpNpG islands were observed in the promoter, 5' UTR, or protein encoding fragments. The entire isolated promoter and 5' UTR is 2235 bp long and contains repetitions of many cis-active elements, recognized by homologous transcription factors, found in Arabidopsis thaliana and other plant species. A pyrimidine-rich fragment with only 6 non-pyrimidine bases was localized in the 33-nt stretch from nt 2185 to 2217 in the 5' UTR. The observed cis-active sequences are potential binding sites for trans-factors that could regulate spatio-temporal CPS gene expression in response to biotic and abiotic stress conditions. Obtained results are initially verified by in silico and co-expression studies based on A. thaliana microarray data. The quantitative RT-PCR analysis confirmed that the entire 2269-bp copalyl diphosphate synthase gene fragment has the promoter activity. Quantitative RT-PCR analysis was used to study changes in CPS promoter activity occurring in response to the application of four selected biotic and abiotic regulatory factors; auxin, gibberellin, salicylic acid, and high-salt concentration.

  10. Functional characterization of Pol III U6 promoters for gene knockdown and knockout in Plutella xylostella.

    Science.gov (United States)

    Huang, Yuping; Wang, Yajun; Zeng, Baosheng; Liu, Zhaoxia; Xu, Xuejiao; Meng, Qian; Huang, Yongping; Yang, Guang; Vasseur, Liette; Gurr, Geoff M; You, Minsheng

    2017-10-01

    RNA polymerase type III (Pol-III) promoters such as U6 are commonly used to express small RNAs, including short hairpin RNAs (shRNAs) and single guide RNAs (sgRNAs). Functional U6 promoters are widely used in CRISPR systems, and their characterization can facilitate genome editing of non-model organisms. In the present study, six U6 small nuclear RNA (snRNA) promoters containing two conserved elements of a proximal sequence element (PSEA) and a TATA box, were identified and characterized in the diamondback moth (Plutella xylostella) genome. Relative efficiency of the U6 promoters to express shRNA induced EGFP knockdown was tested in a P. xylostella cell line, revealing that the PxU6:3 promoter had the strongest expression effect. Further work with the PxU6:3 promoter showed its efficacy in EGFP knockout using CRISPR/Cas9 system in the cells. The expression plasmids with versatile Pxabd-A gene specific sgRNA driven by the PxU6:3 promoter, combined with Cas9 mRNA, could induce mutagenesis at specific genomic loci in vivo. The phenotypes induced by sgRNA expression plasmids were similar to those done in vitro transcription sgRNAs. A plasmid with two tandem arranged PxU6:3:sgRNA expression cassettes targeting Pxabd-A loci was generated, which caused a 28,856 bp fragment deletion, suggesting that the multi-sgRNA expression plasmid can be used for multi-targeting. Our work indicates that U6 snRNA promoters can be used for functional studies of genes with the approach of reverse genetics in P. xylostella. These essential promoters also provide valuable potential for CRISPR-derived gene drive as a tactic for population control in this globally significant pest. Copyright © 2017 Elsevier Ltd. All rights reserved.

  11. Zika virus in Asia

    Directory of Open Access Journals (Sweden)

    Veasna Duong

    2017-01-01

    Full Text Available Zika virus (ZIKV is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored.

  12. Zika virus in Asia.

    Science.gov (United States)

    Duong, Veasna; Dussart, Philippe; Buchy, Philippe

    2017-01-01

    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.

  13. The nuclear Asia

    International Nuclear Information System (INIS)

    Cordonnier, I.; Tertrais, B.

    2001-01-01

    Since the demolition of the Berlin wall, Asia has become the theater of nuclear rivalry, with as main actors: india, Pakistan, China and South Korea. This book analyzes the geo-political situation in this region of the world and asks some important questions about the new strategic map of Asia: what is the impact of the development of nuclear activities on the security of Asia? Will the deployment of anti-missile defenses lead to a new weapons rush? Is there a nuclear warfare risk? (J.S.)

  14. Molecular characterization of the llama FGF5 gene and identification of putative loss of function mutations.

    Science.gov (United States)

    Daverio, M S; Vidal-Rioja, L; Frank, E N; Di Rocco, F

    2017-12-01

    Llama, the most numerous domestic camelid in Argentina, has good fiber-production ability. Although a few genes related to other productive traits have been characterized, the molecular genetic basis of fiber growth control in camelids is still poorly understood. Fibroblast growth factor 5 (FGF5) is a secreted signaling protein that controls hair growth in humans and other mammals. Mutations in the FGF5 gene have been associated with long-hair phenotypes in several species. Here, we sequenced the llama FGF5 gene, which consists of three exons encoding 813 bp. cDNA analysis from hair follicles revealed the expression of two FGF5 alternative spliced transcripts, in one of which exon 2 is absent. DNA variation analysis showed four polymorphisms in the coding region: a synonymous SNP (c.210A>G), a single base deletion (c.348delA), a 12-bp insertion (c.351_352insCATATAACATAG) and a non-sense mutation (c.499C>T). The deletion was always found together with the insertion forming a haplotype and producing a putative truncated protein of 123 amino acids. The c.499C>T mutation also leads to a premature stop codon at position 168. In both cases, critical functional domains of FGF5, including one heparin binding site, are lost. All animals analyzed were homozygous for one of the deleterious mutations or compound heterozygous for both (i.e. c.348delA, c.351_352insCATATAACATAG/c.499T). Sequencing of guanaco samples showed that the FGF5 gene encodes a full-length 270-amino acid protein. These results suggest that FGF5 is likely functional in short-haired wild species and non-functional in the domestic fiber-producing species, the llama. © 2017 Stichting International Foundation for Animal Genetics.

  15. New insights into the apoptotic process in mollusks: characterization of caspase genes in Mytilus galloprovincialis.

    Directory of Open Access Journals (Sweden)

    Alejandro Romero

    2011-02-01

    Full Text Available Apoptosis is an essential biological process in the development and maintenance of immune system homeostasis. Caspase proteins constitute the core of the apoptotic machinery and can be categorized as either initiators or effectors of apoptosis. Although the genes encoding caspase proteins have been described in vertebrates and in almost all invertebrate phyla, there are few reports describing the initiator and executioner caspases or the modulation of their expression by different stimuli in different apoptotic pathways in bivalves. In the present work, we characterized two initiator and four executioner caspases in the mussel Mytilus galloprovincialis. Both initiators and executioners showed structural features that make them different from other caspase proteins already described. Evaluation of the genes' tissue expression patterns revealed extremely high expression levels within the gland and gills, where the apoptotic process is highly active due to the clearance of damaged cells. Hemocytes also showed high expression values, probably due to of the role of apoptosis in the defense against pathogens. To understand the mechanisms of caspase gene regulation, hemocytes were treated with UV-light, environmental pollutants and pathogen-associated molecular patterns (PAMPs and apoptosis was evaluated by microscopy, flow cytometry and qPCR techniques. Our results suggest that the apoptotic process could be tightly regulated in bivalve mollusks by overexpression/suppression of caspase genes; additionally, there is evidence of caspase-specific responses to pathogens and pollutants. The apoptotic process in mollusks has a similar complexity to that of vertebrates, but presents unique features that may be related to recurrent exposure to environmental changes, pollutants and pathogens imposed by their sedentary nature.

  16. Characterization of gene expression associated with drought avoidance and tolerance traits in a perennial grass species.

    Directory of Open Access Journals (Sweden)

    Peng Zhou

    Full Text Available To understand molecular mechanisms of perennial grass adaptation to drought stress, genes associated with drought avoidance or tolerance traits were identified and their expression patterns were characterized in C4 hybrid bermudagrass [Cynodon dactylon (L. Pers.×C. transvaalensis Burtt Davy, cv. Tifway] and common bermudagrass (C. dactylon, cv. C299. Plants of drought-tolerant 'Tifway' and drought-sensitive 'C299' were exposed to drought for 5 d (mild stress and 10 d (severe stress by withholding irrigation in a growth chamber. 'Tifway' maintained significantly lower electrolyte leakage and higher relative water content than 'C299' at both 5 and 10 d of drought stress. Four cDNA libraries via suppression subtractive hybridization analysis were constructed and identified 277 drought-responsive genes in the two genotypes at 5 and 10 d of drought stress, which were mainly classified into the functional categories of stress defense, metabolism, osmoregulation, membrane system, signal and regulator, structural protein, protein synthesis and degradation, and energy metabolism. Quantitative-PCR analysis confirmed the expression of 36 drought up-regulated genes that were more highly expressed in drought-tolerant 'Tifway' than drought-sensitive 'C299', including those for drought avoidance traits, such as cuticle wax formation (CER1 and sterol desaturase, for drought tolerance traits, such as dehydration-protective proteins (dehydrins, HVA-22-like protein and oxidative stress defense (superoxide dismutase, dehydroascorbate reductase, 2-Cys peroxiredoxins, and for stress signaling (EREBP-4 like protein and WRKY transcription factor. The results suggest that the expression of genes for stress signaling, cuticle wax accumulation, antioxidant defense, and dehydration-protective protein accumulation could be critically important for warm-season perennial grass adaptation to long-term drought stress.

  17. Cloning and characterization of nitrate reductase gene in Ulva prolifera (Ulvophyceae, Chlorophyta).

    Science.gov (United States)

    Guo, Yang; Wang, Hao Zhe; Wu, Chun Hui; Fu, Hui Hui; Jiang, Peng

    2017-10-01

    Ulva spp. dominates green tides around the world, which are occurring at an accelerated rate. The competitive nitrogen assimilation efficiency in Ulva is suggested to result in ecological success against other seaweeds. However, molecular characterization of genes involved in nitrogen assimilation has not been conducted. Here, we describe the identification of the nitrate reductase (NR) gene from a green seaweed Ulva prolifera, an alga which is responsible for the world's largest green tide in the Yellow Sea. Using rapid amplification of cDNA ends and genome walking, the NR gene from U. prolifera (UpNR) was cloned, which consisted of six introns and seven exons encoding 863 amino acids. According to sequence alignment, the NR in U. prolifera was shown to possess all five essential domains and 21 key invariant residues in plant NRs. The GC content of third codon position of UpNR (82.75%) was as high as those of green microalgae, and the intron number supported a potential loss issue from green microalga to land plant. Real-time quantitative PCR results showed that UpNR transcript level was induced by nitrate and repressed by ammonium, which could not be removed by addition of extra nitrate, indicating that U. prolifera preferred ammonium to nitrate. Urea would not repress NR transcription by itself, while it weakened the induction effect of nitrate, implying it possibly inhibited nitrate uptake rather than nitrate reduction. These results suggest the use of UpNR as a gene-sensor to probe the N assimilation process in green tides caused by Ulva. © 2017 Phycological Society of America.

  18. Molecular cloning and biological characterization of the human excision repair gene ERCC-3

    International Nuclear Information System (INIS)

    Weeda, G.; van Ham, R.C.; Masurel, R.; Westerveld, A.; Odijk, H.; de Wit, J.; Bootsma, D.; van der Eb, A.J.; Hoeijmakers, J.H.

    1990-01-01

    In this report we present the cloning, partial characterization, and preliminary studies of the biological activity of a human gene, designated ERCC-3, involved in early steps of the nucleotide excision repair pathway. The gene was cloned after genomic DNA transfection of human (HeLa) chromosomal DNA together with dominant marker pSV3gptH to the UV-sensitive, incision-defective Chinese hamster ovary (CHO) mutant 27-1. This mutant belongs to complementation group 3 of repair-deficient rodent mutants. After selection of UV-resistant primary and secondary 27-1 transformants, human sequences associated with the induced UV resistance were rescued in cosmids from the DNA of a secondary transformant by using a linked dominant marker copy and human repetitive DNA as probes. From coinheritance analysis of the ERCC-3 region in independent transformants, we deduce that the gene has a size of 35 to 45 kilobases, of which one essential segment has so far been refractory to cloning. Conserved unique human sequences hybridizing to a 3.0-kilobase mRNA were used to isolate apparently full-length cDNA clones. Upon transfection to 27-1 cells, the ERCC-3 cDNA, inserted in a mammalian expression vector, induced specific and (virtually) complete correction of the UV sensitivity and unscheduled DNA synthesis of mutants of complementation group 3 with very high efficiency. Mutant 27-1 is, unlike other mutants of complementation group 3, also very sensitive toward small alkylating agents. This unique property of the mutant is not corrected by introduction of the ERCC-3 cDNA, indicating that it may be caused by an independent second mutation in another repair function. By hybridization to DNA of a human x rodent hybrid cell panel, the ERCC-3 gene was assigned to chromosome 2, in agreement with data based on cell fusion

  19. Molecular characterization of the Babesia caballi rap-1 gene and epidemiological survey in horses in Israel.

    Science.gov (United States)

    Rapoport, Adi; Aharonson-Raz, Karin; Berlin, Dalia; Tal, Saar; Gottlieb, Yuval; Klement, Eyal; Steinman, Amir

    2014-04-01

    Equine piroplasmosis imposes great concerns for the equine industry regarding international horse movement, and therefore requires reliable diagnostic tools. Recent studies from South Africa and Jordan, including a preliminary study in Israel, reported extremely low seroprevalence to Babesia caballi (B. caballi) (0-1%) using the acceptable rhoptry-associated protein-1 (RAP-1) cELISA. In accordance with the study from South Africa demonstrating a significant heterogeneity in the rap-1 gene sequence of South African B. caballi isolates, the objectives of this study were to phylogenetically characterize the rap-1 gene of the Israeli isolates and determine the prevalence of B. caballi in horses in Israel. Out of 273 horses tested using the RAP-1 cELISA, only one was sero-positive, while 9.3% were positive on PCR performed on the rap-1 gene. Phylogenetic analysis of the rap-1 gene grouped the Israeli isolates in a cluster together with the South African strains (99% nt identity), but in a separate cluster from the American/Caribbean strains (81-82% nt identity). These findings support the existence of heterogeneity in the RAP-1 amino-acid sequences of the Israeli and South African isolates as compared to that used in the cELISA commercial kit and raise doubts as to the ability of this assay to serve as a sole regulatory test for international horse movement. Risk factor analysis found management and age to significantly associate with prevalence of B. caballi, as higher prevalence was noted in horses held out on pasture and a negative association was recorded with age. In addition, B. caballi was not detected in horses in the steppe-arid and extreme-arid climatic regions as compared to the wetter regions. Findings of this study emphasize the need to combine several detection methods to ameliorate the control and spread of the disease. Copyright © 2014 Elsevier B.V. All rights reserved.

  20. Characterizing genes with distinct methylation patterns in the context of protein-protein interaction network: application to human brain tissues.

    Science.gov (United States)

    Li, Yongsheng; Xu, Juan; Chen, Hong; Zhao, Zheng; Li, Shengli; Bai, Jing; Wu, Aiwei; Jiang, Chunjie; Wang, Yuan; Su, Bin; Li, Xia

    2013-01-01

    DNA methylation is an essential epigenetic mechanism involved in transcriptional control. However, how genes with different methylation patterns are assembled in the protein-protein interaction network (PPIN) remains a mystery. In the present study, we systematically dissected the characterization of genes with different methylation patterns in the PPIN. A negative association was detected between the methylation levels in the brain tissues and topological centralities. By focusing on two classes of genes with considerably different methylation levels in the brain tissues, namely the low methylated genes (LMGs) and high methylated genes (HMGs), we found that their organizing principles in the PPIN are distinct. The LMGs tend to be the center of the PPIN, and attacking them causes a more deleterious effect on the network integrity. Furthermore, the LMGs express their functions in a modular pattern and substantial differences in functions are observed between the two types of genes. The LMGs are enriched in the basic biological functions, such as binding activity and regulation of transcription. More importantly, cancer genes, especially recessive cancer genes, essential genes, and aging-related genes were all found more often in the LMGs. Additionally, our analysis presented that the intra-classes communications are enhanced, but inter-classes communications are repressed. Finally, a functional complementation was revealed between methylation and miRNA regulation in the human genome. We have elucidated the assembling principles of genes with different methylation levels in the context of the PPIN, providing key insights into the complex epigenetic regulation mechanisms.

  1. Averting Crisis in Asia?

    Science.gov (United States)

    Cho, Lee-Jay

    1986-01-01

    Discusses issues related to population growth in Asia, considering various programs and their successes. Indicates that China has had the greatest recent success in reducing population growth (with its one-child family policy). (JN)

  2. Colloquium on Central Asia

    International Nuclear Information System (INIS)

    2005-01-01

    This colloquium on Azerbaijan was organized by the direction of international relations of the French Senate and the French center of foreign trade (CFCE). This document gathers the interventions of the participants and the debates with the audience following these interventions. The topics treated concern: - the present day political-economical situation of Central Asia countries (problem of borders, relations with Russia and China); - the economies of Central Asia countries: short term problems and medium-term perspectives; - the relations with the European Union (political, economical, trade and investments, perspectives); - the European energy stakes of Caspian sea (oil and gas reserves, development of hydrocarbon resources, exploitation and transport constraints, stakes for Europe and France); - TotalFinaElf company in Central Asia (Kazakhstan, Azerbaijan, enclavement problem); - the economical impacts of the TRACECA pathway (Transport Corridor Europe Caucasus Asia). (J.S.)

  3. Manufacturing Enterprise in Asia

    International Development Research Centre (IDRC) Digital Library (Canada)

    2017-12-13

    Dec 13, 2017 ... 53 Designing Financial Systems in East Asia and Japan ..... 5.3 Weights for the industrial production index (%) ..... The demand for manufactured goods for this low level of consumption per capita also tends to be very low.

  4. Gene, protein, and network of male sterility in rice

    OpenAIRE

    Wang, Kun; Peng, Xiaojue; Ji, Yanxiao; Yang, Pingfang; Zhu, Yingguo; Li, Shaoqing

    2013-01-01

    Rice is one of the most important model crop plants whose heterosis has been well-exploited in commercial hybrid seed production via a variety of types of male-sterile lines. Hybrid rice cultivation area is steadily expanding around the world, especially in Southern Asia. Characterization of genes and proteins related to male sterility aims to understand how and why the male sterility occurs, and which proteins are the key players for microspores abortion. Recently, a series of genes and prot...

  5. Expression and characterization of UL16 gene from duck enteritis virus

    Directory of Open Access Journals (Sweden)

    Wang Mingshu

    2011-08-01

    Full Text Available Abstract Background Previous studies have indicated that the UL16 protein and its homologs from herpesvirus were conserved and played similar roles in viral DNA packaging, virion assembly, budding, and egress. However, there was no report on the UL16 gene product of duck enteritis virus (DEV. In this study, we analyzed the amino acid sequence of UL16 using bioinformatics tools and expressed in Escherichia coli Rosetta (DE3 induced by isopropy1-β-D-thiogalactopyranoside (IPTG. The recombinant protein was produced, purified using a Ni-NTA column and used to generate the polyclonal antibody against UL16. The intracellular distribution of the DEV UL16 product was carried out using indirect immunofluorescence assay. Results In our study, UL16 gene of DEV was composed of 1089 nucleotides, which encoded 362 amino acids. Multiple sequence alignment suggested that the UL16 gene was highly conserved in herpesvirus family. The UL16 gene was cloned into a pET prokaryotic expression vector and transformed into Escherichia coli Rossetta (DE3 induced by IPTG. A 60kDa fusion protein band corresponding to the predicted size was produced on the SDS-PAGE, purified using a Ni-NTA column. Anti-UL16 polyclonal sera was prepared by immunizing rabbits, and reacted with a band in the IPTG induced cell lysates with an apparent molecular mass of 60 kDa. In vivo expression of the UL16 protein in DEV infected duck embryo fibroblast cells (DEFs was localized mostly around perinuclear cytoplasmic area and in cytosol using indirect immunofluorescence assay. Conclusions The UL16 gene of DEV was successfully cloned, expressed and detected in DEV infected DEFs for the first time. The UL16 protein localized mostly around perinuclear cytoplasmic area and in cytosol in DEV infected DEFs. DEV UL16 shared high similarity with UL16 family members, indicating that DEV UL16 many has similar function with its homologs. All these results may provide some insight for further research about

  6. Molecular Characterization of the Skate Peripherin/rds Gene: Relationship to Its Orthologues and Paralogues

    Science.gov (United States)

    Li, Chibo; Ding, Xi-Qin; O’Brien, John; Al-Ubaidi, Muayyad R.

    2010-01-01

    PURPOSE A great deal of information about functionally significant domains of a protein may be obtained by comparison of primary sequences of gene homologues over a broad phylogenetic base. This study was designed to identify evolutionarily conserved domains of the photoreceptor disc membrane protein peripherin/rds by analysis of the homologue in a primitive vertebrate, the skate. METHODS A skate retinal cDNA library was screened using a mouse peripherin/rds clone. The 5′ and 3′ untranslated regions of the skate peripherin/rds (srds) cDNA were isolated by the rapid amplification of cDNA ends (RACE) approach. The gene structure was characterized by PCR amplification and sequencing of genomic fragments. Northern and Western blot analyses were used to identify srds transcript and protein, respectively. RESULTS A new homologue of peripherin/rds was identified from the skate retinal cDNA library. SRDS is a glycoprotein with a predicted molecular mass of 40.2 kDa. The srds gene consists of two exons and one small intron and transcribes into a single 6-kb message. Phylogenetic analysis places SRDS at the base of peripherin/rds family and near the division of that group and the branch leading to rds-like and rom-1 genes. SRDS protein is 54.5% identical with peripherin/rds across species. Identity is significantly higher (73%) in the intradiscal domains. Sequence comparison revealed the conservation of all residues that have been shown, on mutation, to associate with retinitis pigmentosa and showed conservation of most residues associated with macular dystrophies. Comparison with ROM-1 and other rds-like proteins revealed the presence of a highly conserved domain in the large intradiscal loop. CONCLUSIONS Srds represents the skate orthologue of mammalian peripherin/rds genes. Conservation of most of the residues associated with human retinal diseases indicates that these residues serve important functional roles. The high degree of conservation of a short stretch within

  7. Isolation and characterization of major histocompatibility complex class II B genes in cranes.

    Science.gov (United States)

    Kohyama, Tetsuo I; Akiyama, Takuya; Nishida, Chizuko; Takami, Kazutoshi; Onuma, Manabu; Momose, Kunikazu; Masuda, Ryuichi

    2015-11-01

    In this study, we isolated and characterized the major histocompatibility complex (MHC) class II B genes in cranes. Genomic sequences spanning exons 1 to 4 were amplified and determined in 13 crane species and three other species closely related to cranes. In all, 55 unique sequences were identified, and at least two polymorphic MHC class II B loci were found in most species. An analysis of sequence polymorphisms showed the signature of positive selection and recombination. A phylogenetic reconstruction based on exon 2 sequences indicated that trans-species polymorphism has persisted for at least 10 million years, whereas phylogenetic analyses of the sequences flanking exon 2 revealed a pattern of concerted evolution. These results suggest that both balancing selection and recombination play important roles in the crane MHC evolution.

  8. Synthesis and characterization of PEG-conjugated quaternized chitosan and its application as a gene vector.

    Science.gov (United States)

    Zhang, Xi; Yao, Juan; Zhang, Lihong; Fang, Jianguo; Bian, Fengling

    2014-03-15

    Poly(ethylene glycol)-conjugated N-(2-hydroxy) propyl-3-trimethyl ammonium chitosan chloride (PHTAC) derivatives were prepared by incorporating PEG molecules onto quaternized chitosan backbone. The copolymers were characterized by FTIR, (1)H NMR and XRD. Agarose gel retardation assay indicated that PHTAC had good plasmid DNA (pDNA) binding capability and the particle sizes of PHTAC/pDNA complexes determined by DLS were about 200 nm. Cytotoxicity assays in HeLa and 293T cells showed that PHTAC had low cytotoxicity. In vitro luciferase assay showed that PHTAC with PEGylation degree of 9% (PHTAC-1) had good transfection efficiency about 5.3-fold higher than quaternized chitosan, which was comparable with PEI (25 kDa). These results suggest that PHTAC-1 is a promising candidate as an efficient nonviral gene vector. Copyright © 2013 Elsevier Ltd. All rights reserved.

  9. Genetic and biochemical characterization of the thymidine kinase gene from herpesvirus of turkeys

    International Nuclear Information System (INIS)

    Martin, S.L.; Aparisio, D.I.; Bandyopadhyay, P.K.

    1989-01-01

    The thymidine kinase gene encoded by herpesvirus of turkeys has been identified and characterized. A viral mutant (ATR 0 ) resistant to 1-β-D-arabinofuranosylthymine was isolated. This mutant was also resistant to 1-(2-fluoro-2-deoxy-β-D-arabinofuronosyl)-5-methyluracil and was unable to incorporate [ 125 I]deoxycytidine into DNA. The mutant phenotype was rescued by a cloned region of the turkey herpesvirus genome whose DNA sequence was found to contain an open reading frame similar to that for known thymidine kinases from other viruses. When expressed in Escherichia coli, this open reading frame complemented a thymidine kinase-deficient strain and resulted in thymidine kinase activity in extracts assayed in vitro

  10. Isolation and characterization of an ubiquitin extension protein gene (JcUEP) promoter from Jatropha curcas.

    Science.gov (United States)

    Tao, Yan-Bin; He, Liang-Liang; Niu, Long-Jian; Xu, Zeng-Fu

    2015-04-01

    The JcUEP promoter is active constitutively in the bio-fuel plant Jatropha curcas , and is an alternative to the widely used CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha. Well-characterized promoters are required for transgenic breeding of Jatropha curcas, a biofuel feedstock with great potential for production of bio-diesel and bio-jet fuel. In this study, an ubiquitin extension protein gene from Jatropha, designated JcUEP, was identified to be ubiquitously expressed. Thus, we isolated a 1.2 kb fragment of the 5' flanking region of JcUEP and evaluated its activity as a constitutive promoter in Arabidopsis and Jatropha using the β-glucuronidase (GUS) reporter gene. As expected, histochemical GUS assay showed that the JcUEP promoter was active in all Arabidopsis and Jatropha tissues tested. We also compared the activity of the JcUEP promoter with that of the cauliflower mosaic virus 35S (CaMV35S) promoter, a well-characterized constitutive promoter conferring strong transgene expression in dicot species, in various tissues of Jatropha. In a fluorometric GUS assay, the two promoters showed similar activities in stems, mature leaves and female flowers; while the CaMV35S promoter was more effective than the JcUEP promoter in other tissues, especially young leaves and inflorescences. In addition, the JcUEP promoter retained its activity under stress conditions in low temperature, high salt, dehydration and exogenous ABA treatments. These results suggest that the plant-derived JcUEP promoter could be an alternative to the CaMV35S promoter for driving constitutive overexpression of transgenes in Jatropha and other plants.

  11. Characterization of a novel xylanase gene from rumen content of Hu sheep.

    Science.gov (United States)

    Wang, Qian; Luo, Yang; He, Bo; Jiang, Lin-Shu; Liu, Jian-Xin; Wang, Jia-Kun

    2015-12-01

    A novel xylanase gene, xyn-lxy, was cloned from a metagenomic fosmid library, which was previously constructed from the rumen contents of Hu sheep and was functionally characterized in Escherichia coli. The open reading frame was composed of 1923 bp and encoded for 640 amino acids, including a catalytic domain of glycosyl hydrolase family 10 and carbohydrate-binding module 9. The gene showed 97 % identity with uncultured bacterium Contig1552 but low similarity with xylanases from known cellulolytic-degrading microorganisms in the rumen. The recombinant XYN-LXY showed a specific activity of 664.7 U mg(-1). The optimal temperature and pH of the enzyme were 50 °C and 6.0, respectively. Specifically, XYN-LXY was exclusively activated by Mn(2+) among all of the cations and reducing agents tested in this study. An enzymatic hydrolysis assay revealed that XYN-LXY degraded birchwood xylan into xylooligosaccharide with a low degree of polymerization. After incubation for 4 h, the concentration of the dominant product, xylobiose, was 2.297 ± 0.175 mg ml(-1) (74.07 % of total product) followed by xylose with a concentration of 0.656 ± 0.010 mg ml(-1) (21.14 % of total product). The XYN-LXY exhibited deep degradation effects on the xylan substrate, which were rarely observed with endo-xylanase, making it a promising candidate for industrial application, especially in biofuel production.

  12. iHAP – integrated haplotype analysis pipeline for characterizing the haplotype structure of genes

    Directory of Open Access Journals (Sweden)

    Lim Yun Ping

    2006-12-01

    Full Text Available Abstract Background The advent of genotype data from large-scale efforts that catalog the genetic variants of different populations have given rise to new avenues for multifactorial disease association studies. Recent work shows that genotype data from the International HapMap Project have a high degree of transferability to the wider population. This implies that the design of genotyping studies on local populations may be facilitated through inferences drawn from information contained in HapMap populations. Results To facilitate analysis of HapMap data for characterizing the haplotype structure of genes or any chromosomal regions, we have developed an integrated web-based resource, iHAP. In addition to incorporating genotype and haplotype data from the International HapMap Project and gene information from the UCSC Genome Browser Database, iHAP also provides capabilities for inferring haplotype blocks and selecting tag SNPs that are representative of haplotype patterns. These include block partitioning algorithms, block definitions, tag SNP definitions, as well as SNPs to be "force included" as tags. Based on the parameters defined at the input stage, iHAP performs on-the-fly analysis and displays the result graphically as a webpage. To facilitate analysis, intermediate and final result files can be downloaded. Conclusion The iHAP resource, available at http://ihap.bii.a-star.edu.sg, provides a convenient yet flexible approach for the user community to analyze HapMap data and identify candidate targets for genotyping studies.

  13. Characterization of Hydrocortisone Biometabolites and 18S rRNA Gene in Chlamydomonas reinhardtii Cultures

    Directory of Open Access Journals (Sweden)

    Seyed Bagher Mosavi-Azam

    2008-10-01

    Full Text Available A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1. This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25ºC for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17b-Dihydroxyandrost-4-en-3-one (2, 11b-hydroxyandrost-4-en-3,17-dione (3, 11b,17a,20b,21-tetrahydroxypregn-4-en-3-one (4 and prednisolone (5 were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  14. Molecular cloning and functional characterization of a mouse gene upregulated by lipopolysaccharide treatment reveals alternative splicing

    Energy Technology Data Exchange (ETDEWEB)

    Du, Kejun; Chen, Yaoming; Dai, Zongming; Bi, Yuan; Cai, Tongjian [Department of Occupational and Environmental Health, Fourth Military Medical University, Xi' an 710032, Shaanxi Province (China); Hou, Lichao [Department of Anesthesiology, Xijing Hospital, Fourth Military Medical University, Xi' an 710032, Shaanxi Province (China); Chai, Yubo; Song, Qinghe; Chen, Sumin [Department of Biochemistry and Molecular Biology, Fourth Military Medical University, Xi' an 710032, Shaanxi Province (China); Luo, Wenjing, E-mail: luowenj@fmmu.edu.cn [Department of Occupational and Environmental Health, Fourth Military Medical University, Xi' an 710032, Shaanxi Province (China); Chen, Jingyuan, E-mail: jy_chen@fmmu.edu.cn [Department of Occupational and Environmental Health, Fourth Military Medical University, Xi' an 710032, Shaanxi Province (China)

    2010-01-01

    Treatment of mouse cells with lipopolysaccharide (LPS) potently initiates an inflammatory response, but the underlying mechanisms are unclear. We therefore sought to characterize cDNA sequences of a new mouse LPS-responsive gene, and to evaluate the effects of MLrg. Full-length cDNAs were obtained from LPS-treated NIH3T3 cells. We report that the MLrg gene produces two alternative splice products (GenBank Accession Nos. (DQ316984) and (DQ320011)), respectively, encoding MLrgW and MLrgS polypeptides. Both proteins contain zinc finger and leucine zipper domains and are thus potential regulators of transcription. Expression of MLrgW and MLrgS were robustly upregulated following LPS treatment, and the proteins were localized predominantly in the nuclear membrane and cytoplasm. In stable transfectants over-expressing MLrgW the proportion of cells in G1 phase was significantly reduced, while in cells over-expressing MLrgS the proportion of cells in G2 was significantly increased; both proteins are thus potential regulators of cell cycle progression. Upregulation of MLrgW and MLrgS may be an important component of the LPS inflammatory pathway and of the host response to infection with GNB.

  15. Characterization of three chalcone synthase-like genes from apple (Malus x domestica Borkh.).

    Science.gov (United States)

    Yahyaa, Mosaab; Ali, Samah; Davidovich-Rikanati, Rachel; Ibdah, Muhammad; Shachtier, Alona; Eyal, Yoram; Lewinsohn, Efraim; Ibdah, Mwafaq

    2017-08-01

    Apple (Malus x domestica Brokh.) is a widely cultivated deciduous tree species of significant economic importance. Apple leaves accumulate high levels of flavonoids and dihydrochalcones, and their formation is dependent on enzymes of the chalcone synthase family. Three CHS genes were cloned from apple leaves and expressed in Escherichia coli. The encoded recombinant enzymes were purified and functionally characterized. In-vitro activity assays indicated that MdCHS1, MdCHS2 and MdCHS3 code for proteins exhibiting polyketide synthase activity that accepted either p-dihydrocoumaroyl-CoA, p-coumaroyl-CoA, or cinnamoyl-CoA as starter CoA substrates in the presence of malonyl-CoA, leading to production of phloretin, naringenin chalcone, and pinocembrin chalcone. MdCHS3 coded a chalcone-dihydrochalcone synthase enzyme with narrower substrate specificity than the previous ones. The apparent Km values of MdCHS3 for p-dihydrocoumaryl-CoA and p-coumaryl-CoA were both 5.0 μM. Expression analyses of MdCHS genes varied according to tissue type. MdCHS1, MdCHS2 and MdCHS3 expression levels were associated with the levels of phloretin accumulate in the respective tissues. Copyright © 2017 Elsevier Ltd. All rights reserved.

  16. Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

    Directory of Open Access Journals (Sweden)

    Li Zhao

    2014-03-01

    Full Text Available A gene vector consisting of nanodiamond, polyglycerol, and basic polypeptide (ND-PG-BPP has been designed, synthesized, and characterized. The ND-PG-BPP was synthesized by PG functionalization of ND through ring-opening polymerization of glycidol on the ND surface, multistep organic transformations (–OH → –OTs (tosylate → –N3 in the PG layer, and click conjugation of the basic polypeptides (Arg8, Lys8 or His8 terminated with propargyl glycine. The ND-PG-BPP exhibited good dispersibility in water (>1.0 mg/mL and positive zeta potential ranging from +14.2 mV to +44.1 mV at neutral pH in Milli-Q water. It was confirmed by gel retardation assay that ND-PG-Arg8 and ND-PG-Lys8 with higher zeta potential hybridized with plasmid DNA (pDNA through electrostatic attraction, making them promising as nonviral vectors for gene delivery.

  17. Characterizing bacterial gene expression in nitrogen cycle metabolism with RT-qPCR.

    Science.gov (United States)

    Graham, James E; Wantland, Nicholas B; Campbell, Mark; Klotz, Martin G

    2011-01-01

    Recent advances in DNA sequencing have greatly accelerated our ability to obtain the raw information needed to recognize both known and potential novel modular microbial genomic capacity for nitrogen metabolism. With PCR-based approaches to quantifying microbial mRNA expression now mainstream in most laboratories, researchers can now more efficiently propose and test hypotheses on the contributions of individual microbes to the biological accessibility of nitrogen upon which all other life depends. We review known microbial roles in these key nitrogen transformations, and describe the necessary steps in carrying out relevant gene expression studies. An example experimental design is then provided characterizing Nitrosococcus oceani mRNA expression in cultures responding to ammonia. The approach described, that of assessing microbial genome inventory and testing putative modular gene expression by mRNA quantification, is likely to remain an important tool in understanding individual microbial contributions within microbial community activities that maintain the Earth's nitrogen balance. Copyright © 2011 Elsevier Inc. All rights reserved.

  18. Polyglycerol-functionalized nanodiamond as a platform for gene delivery: Derivatization, characterization, and hybridization with DNA

    Science.gov (United States)

    Zhao, Li; Nakae, Yuki; Qin, Hongmei; Ito, Tadamasa; Kimura, Takahide; Kojima, Hideto; Chan, Lawrence

    2014-01-01

    Summary A gene vector consisting of nanodiamond, polyglycerol, and basic polypeptide (ND-PG-BPP) has been designed, synthesized, and characterized. The ND-PG-BPP was synthesized by PG functionalization of ND through ring-opening polymerization of glycidol on the ND surface, multistep organic transformations (–OH → –OTs (tosylate) → –N3) in the PG layer, and click conjugation of the basic polypeptides (Arg8, Lys8 or His8) terminated with propargyl glycine. The ND-PG-BPP exhibited good dispersibility in water (>1.0 mg/mL) and positive zeta potential ranging from +14.2 mV to +44.1 mV at neutral pH in Milli-Q water. It was confirmed by gel retardation assay that ND-PG-Arg8 and ND-PG-Lys8 with higher zeta potential hybridized with plasmid DNA (pDNA) through electrostatic attraction, making them promising as nonviral vectors for gene delivery. PMID:24778723

  19. Characterization of calpastatin gene in fish: its potential role in muscle growth and fillet quality.

    Science.gov (United States)

    Salem, Mohamed; Yao, Jianbo; Rexroad, Caird E; Kenney, P Brett; Semmens, Kenneth; Killefer, John; Nath, Joginder

    2005-08-01

    Calpastatin (CAST), the specific inhibitor of the calpain proteases, plays a role in muscle growth and meat quality. In rainbow trout (RBT), we identified cDNAs coding for two CAST isoforms, a long (CAST-L) and a short isoform (CAST-S), apparently derived from two different genes. Zebrafish and pufferfish CAST cDNA and genomic sequences were retrieved from GenBank and their exon/intron structures were characterized. Fish CASTs are novel in that they have fewer repetitive inhibitory domains as compared to their mammalian counterparts (one or two vs. four). The expressions of CAST mRNAs were measured in three RBT strains with different growth rates and fillet firmness that were fed either high energy or control diets. CAST-L and S expressions were significantly lower (pfillet. Strain or diet did not affect level of calpain mRNAs. However, the decrease in the CAST/calpain ratio at the mRNA level did not lead to a corresponding change in the calpain catalytic activity. Further investigation should reveal a potential use of the CAST gene as a tool to monitor fish muscle growth and fillet firmness.

  20. Isolation, expression and characterization of rbcL gene from Ulva prolifera J. Agardh (Ulvophyceae, Chlorophyta)

    Science.gov (United States)

    Shao, Zhanru; Li, Wei; Guo, Hui; Duan, Delin

    2015-12-01

    Ulva prolifera is a typical green alga in subtidal areas and can grow tremendously fast. A highly efficient Rubisco enzyme which is encoded by UpRbcL gene may contribute to the rapid growth. In this study, the full-length UpRbcL open reading frame (ORF) was identified, which encoded a protein of 474 amino acids. Phylogenetic analysis of UpRbcL sequences revealed that Chlorophyta had a closer genetic relationship with higher plants than with Rhodophyta and Phaeophyta. The two distinct residues (aa11 and aa91) were presumed to be unique for Rubisco catalytic activity. The predicted three-dimensional structure showed that one α/β-barrel existed in the C-terminal region, and the sites for Mg2+ coordination and CO2 fixation were also located in this region. Gene expression profile indicated that UpRbcL was expressed at a higher level under light exposure than in darkness. When the culture temperature reached 35°C, the expression level of UpRbcL was 2.5-fold lower than at 15°C, and the carboxylase activity exhibited 13.8-fold decrease. UpRbcL was heterologously expressed in E. coli and was purified by Ni2+ affinity chromatography. The physiological and biochemical characterization of recombinant Rubisco will be explored in the future.

  1. Characterization of microbial community and the alkylscccinate synthase genes in petroleum reservoir fluids of China

    Energy Technology Data Exchange (ETDEWEB)

    Zhou, Lei; Mu, Bo-Zhong [University of Science and Technology (China)], email: bzmu@ecust.edu.cn; Gu, Ji-Dong [The University of Hong Kong (China)], email: jdgu@hkucc.hku.hk

    2011-07-01

    Petroleum reservoirs represent a special ecosystem consisting of specific temperature, pressure, salt concentration, oil, gas, water, microorganisms and, enzymes among others. This paper presents the characterization of microbial community and the alkyl succinate synthase genes in petroleum reservoir fluids in China. A few samples were analyzed and the physical and chemical characteristics are given in a tabular form. A flow chart shows the methods and procedures for microbial activities. Six petroleum reservoirs were studied using an archaeal 16S rRNA gene-based approach to establish the presence of archaea and the results are given. The correlation of archaeal and bacterial communities with reservoir conditions and diversity of the arachaeal community in water-flooding petroleum reservoirs at different temperatures is also shown. From the study, it can be summarized that, among methane producers, CO2-reducing methanogens are mostly found in oil reservoir ecosystems and as more assA sequences are revealed, more comprehensive molecular probes can be designed to track the activity of anaerobic alkane-degrading organisms in the environment.

  2. Characterization of hydrocortisone biometabolites and 18S rRNA gene in Chlamydomonas reinhardtii cultures.

    Science.gov (United States)

    Ghasemi, Younes; Rasoul-Amini, Sara; Morowvat, Mohammad Hossein; Raee, Mohammad Javad; Ghoshoon, Mohammad Bagher; Nouri, Fatemeh; Negintaji, Narges; Parvizi, Rezvan; Mosavi-Azam, Seyed Bagher

    2008-10-31

    A unicellular microalga, Chlamydomonas reinhardtii, was isolated from rice paddy-field soil and water samples and used in the biotransformation of hydrocortisone (1). This strain has not been previously tested for steroid bioconversion. Fermentation was carried out in BG-11 medium supplemented with 0.05% substrate at 25 degrees C for 14 days of incubation. The products obtained were chromatographically purified and characterized using spectroscopic methods. 11b,17 beta-Dihydroxyandrost-4-en-3-one (2), 11 beta-hydroxyandrost-4-en-3,17-dione (3), 11 beta,17 alpha,20 beta,21-tetrahydroxypregn-4-en-3-one (4) and prednisolone (5) were the main products of the bioconversion. The observed bioreaction features were the side chain degradation of the substrate to give compounds 2 and 3 and the 20-ketone reduction and 1,2-dehydrogenation affording compounds 4 and 5, respectively. A time course study showed the accumulation of product 2 from the second day of the fermentation and of compounds 3, 4 and 5 from the third day. All the metabolites reached their maximum concentration in seven days. Microalgal 18S rRNA gene was also amplified by PCR. PCR products were sequenced to confirm their authenticity as 18S rRNA gene of microalgae. The result of PCR blasted with other sequenced microalgae in NCBI showed 100% homology to the 18S small subunit rRNA of two Chlamydomonas reinhardtii spp.

  3. Characterization and expression profile of CaNAC2 pepper gene

    Directory of Open Access Journals (Sweden)

    Wei-Li eGuo

    2015-09-01

    Full Text Available The plant-specific NAC (NAM, ATAF, and CUC transcription factors have diverse role in development and stress regulation. A new transcript encoding NAC protein, homologous to nam-like protein 4 from Petunia was identified from an ABA-regulated subtractive cDNA library of Capsicum annuum seedling. Here, this homolog (named CaNAC2 from Capsicum annuum was characterized and investigated its role in abiotic stress tolerance. Our results indicated that a plant-specific and conserved NAC domain was located in the N-terminus domain of CaNAC2 which was predicted to encode a polypeptide of 410 amino acids. Phylogenetic analysis showed that CaNAC2 belonged to the NAC2 subgroup of the orthologous group 4d. The protein CaNAC2 was subcellularly localized in the nucleus and it had transcriptional activity in yeast cell. CaNAC2 was expressed mainly in seed and root. The transcription expression of CaNAC2 was strongly induced by cold, salt and ABA treatment and inhibited by osmotic stress and SA treatment. Silence of CaNAC2 in virus-induced gene silenced pepper seedlings resulted in the increased susceptibility to cold stress and delayed the salt-induced leaf chlorophyll degradation. These results indicated that this novel CaNAC2 gene might be involved in pepper response to abiotic stress tolerance.

  4. Prokaryotic Expression, Purification and Characterization of a Novel Rice Seed Lipoxygenase Gene OsLOX1

    Directory of Open Access Journals (Sweden)

    Ren Wang

    2008-06-01

    Full Text Available Lipoxygenase (LOX, EC1.13.11.12 is a key enzyme during the degradation of lipids in animals and even plants, and also the first key enzyme responsible for the biosynthesis of jasmonate. To purify and characterize the OsLOX1 gene from rice seeds, the entire coding region of the OsLOX1 gene was inserted into an expression vector pET30a(+ and transformed into Escherichia coli BL21 (DE3. Expression of the fusion protein was successfully induced by isopropyl-β-D- thiogalactopyranoside (IPTG and the purified recombinant protein was obtained by His·Bind® Kits. Further assay showed that the purified recombinant protein exhibited the LOX activity. The optimum pH was 4.8 (acetate buffer and the optimum temperature was 30°C for the above enzyme. Thus, the recombinant might confer an available usage for the synthesis of jasmonate in vitro, and also provides a possibility for elucidating the inter-relationship between the primary structure of the plant seed lipoxygenase protein and its physiological functions.

  5. Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization

    Directory of Open Access Journals (Sweden)

    Saliou Niassy

    2013-01-01

    Full Text Available Virulence is the primary factor used for selection of entomopathogenic fungi (EPF for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates.

  6. Molecular and functional characterization of a human ATM gene analogue at Arabidopsis thaliana

    International Nuclear Information System (INIS)

    Garcia, V.

    2001-12-01

    The human ATM gene, whose inactivation is responsible for the human disease ataxia telangiectasia is conserved throughout the Eukaryotes and plays an important role in the cellular responses to DNA damage, in particular to DNA double-strand breaks (DSBs). Here we describe the identification of an Arabidopsis thaliana homologue of ATM (AtATM), and the molecular and cytological characterization of plants, hereafter called atm, carrying a disrupting T-DNA insertion in this gene. AtATM covers a 32 kb region on chromosome 3. The AtATM transcript has a complex structure, is 12 kb long and formed by 79 exons. The transcriptional level of AtATM is very low in all the tissues tested, and does not vary after exposure to ionizing radiations (IR). In atm plants, the protein is not detected suggesting the mutants are null. The atm mutants are partially sterile. Aberrant segregation of chromosomes during meiosis I on both male and female sides account for this sterility. However, meiotic recombination frequency is normal. Mutant plants are also hypersensitive to gamma rays and methyl methane sulfonate, but not to UV-B, pointing to a specific defect of atm mutants in the response to DNA DSBs. In plants, ionizing radiations induce a strong, rapid and transient transcriptional activation of genes involved in the cellular response to or the repair of DSBs. This transcriptional regulation of AtRAD51, AtPARP1, atGR1 and AtL1G4 is lost in the atm mutants . The absence of AtRAD51 induction associated with ionizing radiation sensitivity suggest that AtAtm play an important function in DSB repair by homologous recombination. In addition we show that homologous intra-chromosomal recombination frequency is elevated in the mutant comparing to wild-type, with or without gamma irradiation. These results show the implication of AtAtm in the genomic stability. (author)

  7. Molecular Characterization of Two Fatty Acyl-CoA Reductase Genes From Phenacoccus solenopsis (Hemiptera: Pseudococcidae).

    Science.gov (United States)

    Li, Xiaolong; Zheng, Tianxiang; Zheng, Xiaowen; Han, Na; Chen, Xuexin; Zhang, Dayu

    2016-01-01

    Fatty acyl-CoA reductases (FARs) are key enzymes involved in fatty alcohol synthesis. Here, we cloned and characterized full-length cDNAs of two FAR genes from the cotton mealybug, Phenacoccus solenopsis. The results showed PsFAR I and PsFAR II cDNAs were 1,584 bp and 1,515 bp in length respectively. Both PsFAR I and PsFAR II were predicted to be located in the endoplasmic reticulum by Euk-mPLoc 2.0 approach. Both of them had a Rossmann folding region and a FAR_C region. Two conservative motifs were discovered in Rossmann folding region by sequence alignment including a NADPH combining motif, TGXXGG, and an active site motif, YXXXK. A phylogenetic tree made using MEGA 6.06 indicated that PsFAR I and PsFAR II were placed in two different branches. Gene expression analysis performed at different developmental stages showed that the expression of PsFar I is significantly higher than that of PsFar II in first and second instar nymphs and in male adults. Spirotetramat treatment at 125 mg/liter significantly increased the expression of PsFar I in third instar nymphs, but there was no effect in the expression of PsFar II Our results indicated these two FAR genes showed different expression patterns during insect development and after pesticide treatment, suggesting they play different roles in insect development and detoxification against pesticides. © The Authors 2016. Published by Oxford University Press on behalf of Entomological Society of America.

  8. Characterization of a novel gene encoding ankyrin repeat domain from Cotesia vestalis polydnavirus (CvBV)

    International Nuclear Information System (INIS)

    Shi Min; Chen Yafeng; Huang Fang; Liu Pengcheng; Zhou Xueping; Chen Xuexin

    2008-01-01

    Cotesia vestalis (Haliday) is an endoparasitoid of Plutella xylostella (L.) larvae and injects a polydnavirus (CvBV) into its host during oviposition. In this report we describe the characterization of a gene (CvBV805) and its products. CvBV805 is located on the segment S8 of CvBV genome; it has a size of 909 bp and encodes a predicted protein of 125 amino acids. This protein contains an ankyrin repeat domain with a high degree of similarity with IκB-like genes. Gene transcripts were detected in extracts of the host as early as 2 h post-parasitization (p.p.) and continued to be detected through 24 h. Tissue-specific expression patterns showed that CvBV805 might be involved in early host immunosuppression. CvBV805 was detected in parasitized hosts at 12 h p.p. and in rBac-eGFP-CvBV805-infected Tn-5B1-4 cells at 72 h.p.i. by using western blots analysis. The size of the protein expressed in the host hemocytes and infected Tn-5B1-4 cells was 17 kDa and 56 kDa (including eGFP), respectively, which nearly corresponded with the predicted molecular weight (14.31 kDa) of CvBV805, suggesting that the protein did not undergo extensive post-translational modification. The protein was confirmed to be present within the nuclear region in hemocytes of the parasitized P. xylostella larvae at 48 h p.p. using confocal laser scanning microscopy

  9. Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.

    Directory of Open Access Journals (Sweden)

    Juergen H Nett

    Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.

  10. Characterization of the chicken inward rectifier K+ channel IRK1/Kir2.1 gene

    Directory of Open Access Journals (Sweden)

    Locke Emily

    2004-11-01

    Full Text Available Abstract Background Inward rectifier potassium channels (IRK contribute to the normal function of skeletal and cardiac muscle cells. The chick inward rectifier K+ channel cIRK1/Kir2.1 is expressed in skeletal muscle, heart, brain, but not in liver; a distribution similar but not identical to that of mouse Kir2.1. We set out to explore regulatory domains of the cIRK1 promoter that enhance or inhibit expression of the gene in different cell types. Results We cloned and characterized the 5'-flanking region of cIRK1. cIRK1 contains two exons with splice sites in the 5'-untranslated region, a structure similar to mouse and human orthologs. cIRK1 has multiple transcription initiation sites, a feature also seen in mouse. However, while the chicken and mouse promoter regions share many regulatory motifs, cIRK1 possesses a GC-richer promoter and a putative TATA box, which appears to positively regulate gene expression. We report here the identification of several candidate cell/tissue specific cIRK1 regulatory domains by comparing promoter activities in expressing (Qm7 and non-expressing (DF1 cells using in vitro transcription assays. Conclusion While multiple transcription initiation sites and the combinatorial function of several domains in activating cIRK1 expression are similar to those seen in mKir2.1, the cIRK1 promoter differs by the presence of a putative TATA box. In addition, several domains that regulate the gene's expression differentially in muscle (Qm7 and fibroblast cells (DF1 were identified. These results provide fundamental data to analyze cIRK1 transcriptional mechanisms. The control elements identified here may provide clues to the tissue-specific expression of this K+ channel.

  11. Seroprevalence and S7 gene characterization of bluetongue virus in the West of Iran

    Directory of Open Access Journals (Sweden)

    Mohammad Khezri

    Full Text Available Aim: The objective of this study was conducted to determine the seroprevalence and S7 gene characterization of BTV of sheep in the West of Iran, during 2007-2008. Materials and Methods: A total 372 sheep blood samples were collected from known seropositive regions in the West of Iran. Anti-BTV antibodies were detected in the serum samples by group specific, c-ELISA. Extractions of the dsRNA from whole blood samples were carried out. The One-step RT-PCR kit was used for the detection of S7 BTV gene in the blood samples. PCR products of the first amplification (RT-PCR were used; template in the nested PCR. Products were separated by 1.2% Agarose gel electrophoresis. Nested PCR products of S7 segment from positive samples and the reference strain; BTV1 (RSA vvvv/01 were prepared for sequencing. All sequences were subjected to multiple sequence alignments and phylogenetic analysis. Results: The results showed widespread presence of the anti-BTV antibodies in the province's sheep population, where 46.77% of the tested sera were positive on ELISA. Bluetongue viruses were diagnosed in some animals by RT-PCR and nested PCR, by targeting S7 segment. This genome segment was sequenced and analyzed in four samples as a conserved gene in BTV serogroup. This group was very similar to the West BTV strains from US, Africa and Europe. This clustered was categorized with BTV4 from Turkey. Conclusion: Increases in epidemic disease may constitute a serious problem for Iran's rural economy in future, and the situation is likely to worsen in the next few years as the proportion of unvaccinated livestock increases. [Vet World 2012; 5(9.000: 549-555

  12. Characterization of the canine desmin (DES) gene and evaluation as a candidate gene for dilated cardiomyopathy in the Dobermann.

    Science.gov (United States)

    Stabej, Polona; Imholz, Sandra; Versteeg, Serge A; Zijlstra, Carla; Stokhof, Arnold A; Domanjko-Petric, Aleksandra; Leegwater, Peter A J; van Oost, Bernard A

    2004-10-13

    Canine-dilated cardiomyopathy (DCM) in dogs is a disease of the myocardium associated with dilatation and impaired contraction of the ventricles and is suspected to have a genetic cause. A missense mutation in the desmin gene (DES) causes DCM in a human family. Human DCM closely resembles the canine disease. In the present study, we evaluated whether DES gene mutations are responsible for DCM in Dobermann dogs. We have isolated bacterial artificial chromosome clones (BACs) containing the canine DES gene and determined the chromosomal location by fluorescence in situ hybridization (FISH). Using data deposited in the NCBI trace archive and GenBank, the canine DES gene DNA sequence was assembled and seven single nucleotide polymorphisms (SNPs) were identified. From the canine DES gene BAC clones, a polymorphic microsatellite marker was isolated. The microsatellite marker and four informative desmin SNPs were typed in a Dobermann family with frequent DCM occurrence, but the disease phenotype did not associate with a desmin haplotype. We concluded that mutations in the DES gene do not play a role in Dobermann DCM. Availability of the microsatellite marker, SNPs and DNA sequence reported in this study enable fast evaluation of the DES gene as a DCM candidate gene in other dog breeds with DCM occurrence.

  13. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    OpenAIRE

    Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B

    2010-01-01

    Abstract Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multip...

  14. Structural and functional characterization of the exonuclease I (sbcB) gene and gene product from Escherichia coli and a Markov chain analysis of DNA sequences

    International Nuclear Information System (INIS)

    Phillips, G.J.

    1987-01-01

    The nucleotide sequence for the structural gene for exonuclease I (sbcB) from Escherichia coli was determined. Two putative promotes for this gene were identified and were predicted to have weak transcription initiation activity. In addition, the sbcB coding region contains many non-optimal codons. These observations are consistent with the suggestions that sbcB is a poorly expressed gene. Several mutant exonuclease I genes were cloned onto pBR322 plasmids. These genes represented both sbcB and xonA mutation. One of the xonA mutation (xonA6) was associated with a 1.2-kb insertion of an IS-30 related mobile genetic element in the 3'-region of the gene. Two of the mutations (xonA2 and xonA6) encode unstable polypeptides. Determination of exonucleolytic activity on single-stranded DNA from cell extracts containing each of the cloned mutant genes revealed no correlation between residual exonucleolytic activity and the pheno-types of sbcB and xonA mutants. A proposal that the exonuclease I protein contains an additional activity besides its ability to degrade single-stranded DNA is presented. Characterization of E. coli strains which overproduce exonuclease I showed increased sensitivity to UV irradiation

  15. Characterizing the pathotype structure of barley powdery mildew and effectiveness of resistance genes to this pathogen in Kazakhstan.

    Science.gov (United States)

    Rsaliyev, Aralbek; Pahratdinova, Zhazira; Rsaliyev, Shynbolat

    2017-11-14

    Powdery mildew of barley is a wind-borne and obligate biotrophic pathogen, which ranks among the most widespread barley pathogens worldwide. However, purposeful research towards studying the structure of the barley powdery mildew populations, of their virulence and of effectiveness of certain resistance genes against the infection was not conducted in Kazakhstan till present time. This paper is the first to describe characteristics of the pathotype structure of Blumeria graminis f.sp. hordei (Bgh) population and effectiveness of resistance genes in two regions of barley cultivation in the republic. One hundred and seven isolates of Bgh were obtained from seven populations occurring on cultivated barley at two geographically locations in Kazakhstan during 2015 and 2016. Their virulence frequency was determined on 17 differential lines Pallas. All isolates were virulent on the resistance gene Mla8 and avirulent for the resistance genes Mla9, Mla1 + MlaAl2, Mla6 + Mla14, Mla13 + MlRu3, Mla7 + MlNo3, Mla10 + MlDu2, Mla13 + MlRu3 and Mlo-5. The frequencies of isolates overcoming the genes Mla3, Mla22, Mlat Mlg + MlCP and Mla12 + MlEm2 were 0.0-33.33%, and frequencies of isolates overcoming the genes Mlra, Mlk, MlLa and Mlh ranged from 10.0 to 78.6%. Based on reactions of differential lines possessing the genes Mla22, Mlra, Mlk, Mlat, MlLa and Mlh, pathotypes were identified. In total, 23 pathotypes with virulence complexity ranging from 1 to 6 were identified. During both years in all populations of South Kazakhstan and Zhambyl regions pathotypes 24 and 64 mainly prevailed. Obtained data suggest that low similarity of populations Bgh in Kazakhstan to European, African, Australian and South-East Asian populations. The present study provides a foundation for future studies on the pathogenic variability within of Bgh populations in Kazakhstan and addresses the knowledge gap on the virulence structure of Bgh in Central Asia. Complete effectiveness of the

  16. Isolation and Characterization of Vaccine Candidate Genes Including CSP and MSP1 in Plasmodium yoelii.

    Science.gov (United States)

    Kim, Seon-Hee; Bae, Young-An; Seoh, Ju-Young; Yang, Hyun-Jong

    2017-06-01

    Malaria is an infectious disease affecting humans, which is transmitted by the bite of Anopheles mosquitoes harboring sporozoites of parasitic protozoans belonging to the genus Plasmodium . Despite past achievements to control the protozoan disease, malaria still remains a significant health threat up to now. In this study, we cloned and characterized the full-unit Plasmodium yoelii genes encoding merozoite surface protein 1 (MSP1), circumsporozoite protein (CSP), and Duffy-binding protein (DBP), each of which can be applied for investigations to obtain potent protective vaccines in the rodent malaria model, due to their specific expression patterns during the parasite life cycle. Recombinant fragments corresponding to the middle and C-terminal regions of PyMSP1 and PyCSP, respectively, displayed strong reactivity against P. yoelii -infected mice sera. Specific native antigens invoking strong humoral immune response during the primary and secondary infections of P. yoelii were also abundantly detected in experimental ICR mice. The low or negligible parasitemia observed in the secondary infected mice was likely to result from the neutralizing action of the protective antibodies. Identification of these antigenic proteins might provide the necessary information and means to characterize additional vaccine candidate antigens, selected solely on their ability to produce the protective antibodies.

  17. Molecular Characterization of Ferulate 5-Hydroxylase Gene from Kenaf (Hibiscus cannabinus L.

    Directory of Open Access Journals (Sweden)

    Jonggeun Kim

    2013-01-01

    Full Text Available The purpose of this study is to clone and characterize the expression pattern of a F5H gene encoding ferulate 5-hydroxylase in the phenylpropanoid pathway from kenaf (Hibiscus cannabinus L.. Kenaf is a fast-growing dicotyledonous plant valued for its biomass. F5H, a cytochrome P450-dependent monooxygenase (CYP84, is a key enzyme for syringyl lignin biosynthesis. The full length of the F5H ortholog was cloned and characterized. The full-length F5H ortholog consists of a 1,557-bp open reading frame (ORF encoding 518 amino acids (GenBank Accession number JX524278. The deduced amino acid sequence showed that kenaf F5H had the highest similarity (78% with that of Populus trichocarpa. Transcriptional analysis of F5H ortholog was conducted using quantitative real-time PCR during the developmental stages of various tissues and in response to various abiotic stresses. The highest transcript level of the F5H ortholog was observed in immature flower tissues and in early stage (6 week-old of stem tissues, with a certain level of expression in all tissues tested. The highest transcript level of F5H ortholog was observed at the late time points after treatments with NaCl (48 h, wounding (24 h, cold (24 h, abscisic acid (24 h, and methyl jasmonate (24 h.

  18. A Combination of CRISPR/Cas9 and Standardized RNAi as a Versatile Platform for the Characterization of Gene Function

    Directory of Open Access Journals (Sweden)

    Sebastian Wissel

    2016-08-01

    Full Text Available Traditional loss-of-function studies in Drosophila suffer from a number of shortcomings, including off-target effects in the case of RNA interference (RNAi or the stochastic nature of mosaic clonal analysis. Here, we describe minimal in vivo GFP interference (miGFPi as a versatile strategy to characterize gene function and to conduct highly stringent, cell type-specific loss-of-function experiments in Drosophila. miGFPi combines CRISPR/Cas9-mediated tagging of genes at their endogenous locus with an immunotag and an exogenous 21 nucleotide RNAi effector sequence with the use of a single reagent, highly validated RNAi line targeting this sequence. We demonstrate the utility and time effectiveness of this method by characterizing the function of the Polymerase I (Pol I-associated transcription factor Tif-1a, and the previously uncharacterized gene MESR4, in the Drosophila female germline stem cell lineage. In addition, we show that miGFPi serves as a powerful technique to functionally characterize individual isoforms of a gene. We exemplify this aspect of miGFPi by studying isoform-specific loss-of-function phenotypes of the longitudinals lacking (lola gene in neural stem cells. Altogether, the miGFPi strategy constitutes a generalized loss-of-function approach that is amenable to the study of the function of all genes in the genome in a stringent and highly time effective manner.

  19. The molecular epidemiology of HIV in Asia.

    Science.gov (United States)

    Weniger, B G; Takebe, Y; Ou, C Y; Yamazaki, S

    1994-01-01

    The human immunodeficiency virus (HIV) was introduced readily into Asia and has quickly spread between Asian states through both parenteral and sexual modes of transmission. Only 1 year after Thailand's epidemic wave among intravenous drug users (IDUs) in 1988, the virus spread to the adjacent Myanmar and Malaysia, and another year later IDUs were infected in parts of India and China bordering Myanmar. Several methods can be used to quantify the genetic diversity, divergence, or variation within or between subtypes, genotypes, or isolates. Consensus sequences, representing the most common nucleotide in the genome, are often generated for comparison. 8 subtypes A through F, H, and O have been described for HIV-1 based on the genetic similarities and differences in the env gene or viral envelope. Subtype A and D have been found primarily in central and western Africa. Subtype B is predominant in Europe, the Western hemisphere, Japan, and Australia. Subtype C has been found mostly in southern Africa, the Central African Republic, and India. Subtype E was first identified in Thailand and recently in the Central African Republic. Subtype F has been found in Romania and is a rare variant in Brazil. Isolates from Gabon and the Russian Federation were designated subtype H. An "outlier" subtype O containing 2 human and 2 chimpanzee isolates has been identified in Cameroon and Gabon. Sequencing of the relatively conserved gag gene of geographically diverse HIV-1 isolates yielded a classification with 7 subtypes A-D and F-H. Other topics discussed include genome characterization, comparison with foreign isolates, segregation by mode of transmission, and biologic properties of HIV-1 variants in Thailand; regional diversity of HIV-1 subtypes and substantial spread of HIV-2 in India; as well as HIV transmission and infections in Japan, Australia, Cambodia, China, Taiwan, Philippines, Malaysia, Myanmar, and in states created out of the former Soviet Union.

  20. Characterizing the Vertical Profile of Aerosol Particle Extinction and Linear Depolarization over Southeast Asia and the Maritime Continent: The 2007-2009 View from CALIOP

    Science.gov (United States)

    Campbell, James R.; Reid, Jeffrey S.; Westphal, Douglas L.; Zhang, Jianglong; Tackett, Jason L.; Chew, Boon Ning; Welton, Ellsworth J.; Shimizu, Atsushi; Sugimoto, Nobuo; Aoki, Kazuma; hide

    2012-01-01

    Vertical profiles of 0.532 µm aerosol particle extinction coefficient and linear volume depolarization ratio are described for Southeast Asia and the Maritime Continent. Quality-screened and cloud-cleared Version 3.01 Level 2 NASA Cloud Aerosol Lidar with Orthogonal Polarization (CALIOP) 5-km Aerosol Profile datasets are analyzed from 2007 to 2009. Numerical simulations from the U.S. Naval Aerosol Analysis and Predictive System (NAAPS), featuring two-dimensional variational assimilation of NASA Moderate Resolution Imaging Spectroradiometer and Multi-angle Imaging Spectro- Radiometer quality-assured datasets, combined with regional ground-based lidar measurements, are considered for assessing CALIOP retrieval performance, identifying bias, and evaluating regional representativeness. CALIOP retrievals of aerosol particle extinction coefficient and aerosol optical depth (AOD) are high over land and low over open waters relative to NAAPS (0.412/0.312 over land for all data points inclusive, 0.310/0.235 when the per bin average is used and each is treated as single data points; 0.102/0.151 and 0.086/0.124, respectively, over ocean). Regional means, however, are very similar (0.180/0.193 for all data points and 0.155/0.159 when averaged per normalized bin), as the two factors offset one another. The land/ocean offset is investigated, and discrepancies attributed to interpretation of particle composition and a-priori assignment of the extinction-to-backscatter ratio ("lidar ratio") necessary for retrieving the extinction coefficient from CALIOP signals. Over land, NAAPS indicates more dust present than CALIOP algorithms are identifying, indicating a likely assignment of a higher lidar ratio representative of more absorptive particles. NAAPS resolvesmore smoke overwater than identified with CALIOP, indicating likely usage of a lidar ratio characteristic of less absorptive particles to be applied that biases low AOD there. Over open waters except within the Bay of Bengal

  1. Cloning and characterization of the iron uptake gene iutA from avian Escherichia coli

    Directory of Open Access Journals (Sweden)

    Dorismey Vieira Tokano

    2008-06-01

    Full Text Available The aim of this work was to isolate, clone and characterize the iron uptake gene iutA from avian pathogenic E. coli (APEC. The iutA gene was isolated from the strain APEC 9, serotype O2:H9, which was cloned in the expression vector pET101/D-TOPO. The gene of 2.2 Kb was sequenced (AY602767, which showed high similarity to the iutA gene from three plasmids, two from APEC, pAPEC-02-ColV (AY545598.4 and pTJ100 (AY553855.1, and one from a human invasive E. coli strain, the pColV K30. The recombinant protein IutA was over expressed in E. coli BL21(DE-3 and was solubilized with urea and purified by Ni-NTA column. This method produced a relatively high yield of r-IutA of approximately 74kDa, which was used to produce the antibody anti-IutA. This anti-IutA reacted with the protein r-IutA and native IutA of APEC 9, as demonstrated by Western blot, showing that the r-IutA conserved epitopes and its antigenicity was preserved. The anti-IutA IgY was able to inhibit the IutA biological activity, inhibiting the sensitivity to cloacin DF13 of APEC9. However, it did not inhibit the growth of APEC9 in M9 and did not protect the chickens inoculated with the APEC, suggesting that the APEC possessed another iron acquisition mechanism distinct of aerobactin.A proteína de membrane externa IutA (iron uptake transport é o receptor para aerobactina férrica, um fator de virulência encontrado mais frequentemente entre as amostras de E. coli pathogênicas para aves (APEC do que entre os isolados fecais de aves saudáveis. O gene iutA da amostra APEC 9, sorotipo O2:H9, foi amplificado e clonado no vetor pET101/D-TOPO. O gene iutA 2.2 Kb foi sequenciado (AY602767 e mostrou alta similaridade para gene iutA de três plasmidios, dois da APEC, pAPEC-02-ColV (AY545598.4 e pTJ100 (AY553855.1, e um da amostra E. coli invasiva humana, pColV K30. A proteína IutA recombinante (r-IutA foi produzida em Escherichia coli BL21(DE-3, solubilizada com uréia e purificada em coluna de n

  2. Cloning, Characterization and Analysis of cat and ben Genes from the Phenol Degrading Halophilic Bacterium Halomonas organivorans

    Science.gov (United States)

    Moreno, Maria de Lourdes; Sánchez-Porro, Cristina; Piubeli, Francine; Frias, Luciana; García, María Teresa; Mellado, Encarnación

    2011-01-01

    Background Extensive use of phenolic compounds in industry has resulted in the generation of saline wastewaters that produce significant environmental contamination; however, little information is available on the degradation of phenolic compounds in saline conditions. Halomonas organivorans G-16.1 (CECT 5995T) is a moderately halophilic bacterium that we isolated in a previous work from saline environments of South Spain by enrichment for growth in different pollutants, including phenolic compounds. PCR amplification with degenerate primers revealed the presence of genes encoding ring-cleaving enzymes of the β-ketoadipate pathway for aromatic catabolism in H. organivorans. Findings The gene cluster catRBCA, involved in catechol degradation, was isolated from H. organivorans. The genes catA, catB, catC and the divergently transcribed catR code for catechol 1,2-dioxygenase (1,2-CTD), cis,cis-muconate cycloisomerase, muconolactone delta-isomerase and a LysR-type transcriptional regulator, respectively. The benzoate catabolic genes (benA and benB) are located flanking the cat genes. The expression of cat and ben genes by phenol and benzoic acid was shown by RT-PCR analysis. The induction of catA gene by phenol and benzoic acid was also probed by the measurement of 1,2-CTD activity in H. organivorans growth in presence of these inducers. 16S rRNA and catA gene-based phylogenies were established among different degrading bacteria showing no phylogenetic correlation between both genes. Conclusions/Significance In this work, we isolated and determined the sequence of a gene cluster from a moderately halophilic bacterium encoding ortho-pathway genes involved in the catabolic metabolism of phenol and analyzed the gene organization, constituting the first report characterizing catabolic genes involved in the degradation of phenol in moderate halophiles, providing an ideal model system to investigate the potential use of this group of extremophiles in the decontamination of

  3. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia

    Directory of Open Access Journals (Sweden)

    Berhanu Ayalew

    2010-08-01

    Full Text Available Abstract Background Newcastle disease (ND, caused by Newcastle disease virus (NDV, is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia, Ch/2000 (China, local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  4. Molecular characterization of partial fusion gene and C-terminus extension length of haemagglutinin-neuraminidase gene of recently isolated Newcastle disease virus isolates in Malaysia.

    Science.gov (United States)

    Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair

    2010-08-08

    Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.

  5. Functional characterization of a Penicillium chrysogenum mutanase gene induced upon co-cultivation with Bacillus subtilis

    NARCIS (Netherlands)

    Bajaj, I.; Veiga, T.; Van Dissel, D.; Pronk, J.T.; Daran, J.M.

    2014-01-01

    Background Microbial gene expression is strongly influenced by environmental growth conditions. Comparison of gene expression under different conditions is frequently used for functional analysis and to unravel regulatory networks, however, gene expression responses to co-cultivation with other

  6. Genome-wide identification and characterization of microRNA genes and their targets in flax (Linum usitatissimum): Characterization of flax miRNA genes.

    Science.gov (United States)

    Barvkar, Vitthal T; Pardeshi, Varsha C; Kale, Sandip M; Qiu, Shuqing; Rollins, Meaghen; Datla, Raju; Gupta, Vidya S; Kadoo, Narendra Y

    2013-04-01

    MicroRNAs (miRNAs) are small (20-24 nucleotide long) endogenous regulatory RNAs that play important roles in plant growth and development. They regulate gene expression at the post-transcriptional level by translational repression or target degradation and gene silencing. In this study, we identified 116 conserved miRNAs belonging to 23 families from the flax (Linum usitatissimum L.) genome using a computational approach. The precursor miRNAs varied in length; while most of the mature miRNAs were 21 nucleotide long, intergenic and showed conserved signatures of RNA polymerase II transcripts in their upstream regions. Promoter region analysis of the flax miRNA genes indicated prevalence of MYB transcription factor binding sites. Four miRNA gene clusters containing members of three phylogenetic groups were identified. Further, 142 target genes were predicted for these miRNAs and most of these represent transcriptional regulators. The miRNA encoding genes were expressed in diverse tissues as determined by digital expression analysis as well as real-time PCR. The expression of fourteen miRNAs and nine target genes was independently validated using the quantitative reverse transcription PCR (qRT-PCR). This study suggests that a large number of conserved plant miRNAs are also found in flax and these may play important roles in growth and development of flax.

  7. Characterization of the global profile of genes expressed in cervical epithelium by Serial Analysis of Gene Expression (SAGE

    Directory of Open Access Journals (Sweden)

    Piña-Sanchez Patricia

    2005-09-01

    Full Text Available Abstract Background Serial Analysis of Gene Expression (SAGE is a new technique that allows a detailed and profound quantitative and qualitative knowledge of gene expression profile, without previous knowledge of sequence of analyzed genes. We carried out a modification of SAGE methodology (microSAGE, useful for the analysis of limited quantities of tissue samples, on normal human cervical tissue obtained from a donor without histopathological lesions. Cervical epithelium is constituted mainly by cervical keratinocytes which are the targets of human papilloma virus (HPV, where persistent HPV infection of cervical epithelium is associated with an increase risk for developing cervical carcinomas (CC. Results We report here a transcriptome analysis of cervical tissue by SAGE, derived from 30,418 sequenced tags that provide a wealth of information about the gene products involved in normal cervical epithelium physiology, as well as genes not previously found in uterine cervix tissue involved in the process of epidermal differentiation. Conclusion This first comprehensive and profound analysis of uterine cervix transcriptome, should be useful for the identification of genes involved in normal cervix uterine function, and candidate genes associated with cervical carcinoma.

  8. Asia electricity study

    International Nuclear Information System (INIS)

    Priddle, R.

    1997-01-01

    Electricity demand in Asia has grown and continues to grow rapidly. Over 40 per cent of the world's growth in electricity output up to 2010 is expected to come from China and East and South Asia. The need to build the additional production capacity to meet demand is the driving force behind the major structural and institutional changes that are presently transforming the electricity sectors throughout the region. The Asia Electricity Study looks in detail at the current and future role of the electricity sectors in Indonesia, the Philippines and Thailand. It analyses existing and planned electricity policies in areas such as financing regulation, environment and end-use efficiency. To build the region's power infrastructure will require large investments, well beyond what governments or multilateral lending institutions can provide. Consequently, mobilizing private sector participation in the process is vital. Independent Power Producers (IPPs) are being allowed to enter what has, until recently, been a government-dominated field. State-owned utilities are being corporatized and/or privatized to improve their competitiveness. Developing the regulatory environment to match the changes taking place is a key challenge. The significant expansion of generation capacity in Asia will have implications well beyond the region. Changes in energy trade volumes and patterns, caused by the need to obtain fuel for power stations, will have an impact on the energy security of Asia and the world as a whole Similarly, fuel and technology choices will have important consequences for both the regional and global environment. (author)

  9. Demyelinating diseases in Asia.

    Science.gov (United States)

    Ochi, Hirofumi; Fujihara, Kazuo

    2016-06-01

    The present review aims to discuss the recent advances in inflammatory demyelinating diseases of the central nervous system in Asia. Prevalence of multiple sclerosis (MS) in Asia is lower than that in Western countries, although it has been increasing recently. Meanwhile, there seems to be no major difference in neuromyelitis optica (NMO) prevalence in various regions or ethnicities. Thus, the ratios of NMO/NMO spectrum disorder (NMOSD) to MS are higher in Asia as compared with Western countries, indicating that the differential diagnosis between NMO/NMOSD and MS is a major challenge in Asia. Although the detection of aquaporin-4 (AQP4)-antibody is critical in distinguishing NMO/NMOSD from MS, some patients with NMO/NMOSD phenotype are seronegative for AQP4-antibody, and a fraction of those patients possess autoantibody against myelin oligodendrocyte glycoprotein. The clinical profile of Asian MS seems to be essentially similar to that in Western MS after careful exclusion of NMO/NMOSD, although some unique genetic and/or environmental factors may modify the disease in Asians. MS prevalence has been low but is increasing in Asia. In contrast, NMO/NMOSD prevalence seems relatively constant in the world. Asian MS is not fundamentally different from Western MS, but some genetic and/or environmental differences may cause some features unique to Asian patients.

  10. Comparative mapping of powdery mildew resistance gene Pm21 and functional characterization of resistance-related genes in wheat.

    Science.gov (United States)

    He, Huagang; Zhu, Shanying; Jiang, Zhengning; Ji, Yaoyong; Wang, Feng; Zhao, Renhui; Bie, Tongde

    2016-04-01

    The powdery mildew resistance gene Pm21 was physically and comparatively mapped by newly developed markers. Seven candidate genes were verified to be required for Pm21 -mediated resistance to wheat powdery mildew. Pm21, a gene derived from wheat wild relative Dasypyrum villosum, has been transferred into common wheat and widely utilized in wheat resistance breeding for powdery mildew. Previously, Pm21 has been located to the bin FL0.45-0.58 of 6VS by using deletion stocks. However, its fine mapping is still a hard work. In the present study, 30 gene-derived 6VS-specific markers were obtained based on the collinearity among genomes of Brachypodium distachyon, Oryza and Triticeae, and then physically and comparatively mapped in the bin FL0.45-0.58 and its nearby chromosome region. According to the maps, the bin FL0.45-0.58 carrying Pm21 was closely flanked by the markers 6VS-03 and 6VS-23, which further narrowed the orthologous regions to 1.06 Mb in Brachypodium and 1.38 Mb in rice, respectively. Among the conserved genes shared by Brachypodium and rice, four serine/threonine protein kinase genes (DvMPK1, DvMLPK, DvUPK and DvPSYR1), one protein phosphatase gene (DvPP2C) and two transcription factor genes (DvGATA and DvWHY) were confirmed to be required for Pm21-mediated resistance to wheat powdery mildew by barley stripe mosaic virus-induced gene silencing (BSMV-VIGS) and transcriptional pattern analyses. In summary, this study gives new insights into the genetic basis of the Pm21 locus and the disease resistance pathways mediated by Pm21.

  11. Phenylpropanoids accumulation in eggplant fruit: characterization of biosynthetic genes and regulation by a MYB transcription factor

    Directory of Open Access Journals (Sweden)

    Teresa eDocimo

    2016-01-01

    Full Text Available Phenylpropanoids are major secondary metabolites in eggplant (Solanum melongena fruits. Chlorogenic acid (CGA accounts for 70 to 90% of total phenolics in flesh tissues, while anthocyanins are mainly present in the fruit skin. As a contribution to the understanding of the peculiar accumulation of these health-promoting metabolites in eggplant, we report on metabolite abundance, regulation of CGA and anthocyanin biosynthesis, and characterization of candidate CGA biosynthetic genes in S. melongena.Higher contents of CGA, Delphinidin 3-rutinoside and rutin were found in eggplant fruits compared to other tissues, associated to an elevated transcript abundance of structural genes such as PAL, HQT, DFR and ANS, suggesting that active in situ biosynthesis contributes to anthocyanin and CGA accumulation in fruit tissues. Putative orthologs of the two CGA biosynthetic genes PAL and HQT, as well as a variant of a MYB1 transcription factor showing identity with group 6 MYBs, were isolated from an Occidental S. melongena traditional variety and demonstrated to differ from published sequences from Asiatic varieties.In silico analysis of the isolated SmPAL1, SmHQT1, SmANS, and SmMyb1 promoters revealed the presence of several Myb regulatory elements for the biosynthetic genes and unique elements for the TF, suggesting its involvement in other physiological roles beside phenylpropanoid biosynthesis regulation.Transient overexpression in Nicotiana benthamiana leaves of SmMyb1 and of a C-terminal SmMyb1 truncated form (SmMyb1Δ9 resulted in anthocyanin accumulation only of SmMyb1 agro-infiltrated leaves. A yeast two-hybrid assay confirmed the interaction of both SmMyb1 and SmMyb1Δ9 with an anthocyanin-related potato bHLH1 TF. Interestingly, a doubled amount of CGA was detected in both SmMyb1 and SmMyb1Δ9 agro-infiltrated leaves, thus suggesting that the N-terminal region of SmMyb1 is sufficient to activate its synthesis. These data suggest that a deletion of

  12. Morphological characterization and gene expression profiling during bud development in a tropical perennial, Litchi chinensis Sonn.

    Directory of Open Access Journals (Sweden)

    Huifeng Zhang

    2016-10-01

    Full Text Available Tropical evergreen perennials undergo recurrent flush growth, and their terminal buds alternate between growth and dormancy. In sharp contrast to intensive studies on bud development in temperate deciduous trees, there is little information about bud development regulation in tropical trees. In this study, litchi (Litchi chinensis Sonn. was used as a model tropical perennial for morphological characterization and transcriptomic analysis of bud development. Litchi buds are naked with apical meristem embraced by rudimentary leaves, which are brown at dormant stage (Stage I. They swell and turn greenish as buds break (Stage II, and as growth accelerates, the rudimentary leaves elongate and open exposing the inner leaf primodia. With the outgrowth of the needle-like leaflets, bud growth reaches a maximum (Stage III. When leaflets expand, bud growth cease with the abortion of the rudimentary leaves at upper positions (Stage IV. Then buds turn brown and reenter dormant status. Budbreak occurs again when new leaves become hard green. Buds at four stages (Stage I to IV were collected for respiration measurements and in-depth RNA sequencing. Respiration rate was lowest at Stage I and highest at Stage II, decreasing towards growth cessation. RNA sequencing obtained over 5 Gb data from each of the bud samples and de novo assembly generated a total of 59999 unigenes, 40119 of which were annotated. Pair-wise comparison of gene expression between stages, gene profiling across stages, GO/KEGG enrichment analysis, and the expression patterns of 17 major genes highlighted by principal component (PC analysis displayed significant changes in stress resistance, hormone signal pathways, circadian rhythm, photosynthesis, cell division, carbohydrate metabolism, programmed cell death during bud development, which might be under epigenetic control involving chromatin methylation. The qPCR results of 8 selected unigenes with high PC scores agreed with the RPKM values

  13. Gene expression classification of colon cancer into molecular subtypes: characterization, validation, and prognostic value.

    Directory of Open Access Journals (Sweden)

    Laetitia Marisa

    Full Text Available Colon cancer (CC pathological staging fails to accurately predict recurrence, and to date, no gene expression signature has proven reliable for prognosis stratification in clinical practice, perhaps because CC is a heterogeneous disease. The aim of this study was to establish a comprehensive molecular classification of CC based on mRNA expression profile analyses.Fresh-frozen primary tumor samples from a large multicenter cohort of 750 patients with stage I to IV CC who underwent surgery between 1987 and 2007 in seven centers were characterized for common DNA alterations, including BRAF, KRAS, and TP53 mutations, CpG island methylator phenotype, mismatch repair status, and chromosomal instability status, and were screened with whole genome and transcriptome arrays. 566 samples fulfilled RNA quality requirements. Unsupervised consensus hierarchical clustering applied to gene expression data from a discovery subset of 443 CC samples identified six molecular subtypes. These subtypes were associated with distinct clinicopathological characteristics, molecular alterations, specific enrichments of supervised gene expression signatures (stem cell phenotype-like, normal-like, serrated CC phenotype-like, and deregulated signaling pathways. Based on their main biological characteristics, we distinguished a deficient mismatch repair subtype, a KRAS mutant subtype, a cancer stem cell subtype, and three chromosomal instability subtypes, including one associated with down-regulated immune pathways, one with up-regulation of the Wnt pathway, and one displaying a normal-like gene expression profile. The classification was validated in the remaining 123 samples plus an independent set of 1,058 CC samples, including eight public datasets. Furthermore, prognosis was analyzed in the subset of stage II-III CC samples. The subtypes C4 and C6, but not the subtypes C1, C2, C3, and C5, were independently associated with shorter relapse-free survival, even after

  14. Genetic characterization and fine mapping of S25, a hybrid male sterility gene, on rice chromosome 12.

    Science.gov (United States)

    Kubo, Takahiko; Yoshimura, Atsushi; Kurata, Nori

    2018-02-10

    Hybrid male sterility genes are important factors in creating postzygotic reproductive isolation barriers in plants. One such gene, S25, is known to cause severe transmission ratio distortion in inter-subspecific progeny of cultivated rice Oryza sativa ssp. indica and japonica. To further characterize the S25 gene, we fine-mapped and genetically characterized the S25 gene using near-isogenic lines with reciprocal genetic backgrounds. We mapped the S25 locus within the 0.67-1.02 Mb region on rice chromosome 12. Further genetic analyses revealed that S25 substantially reduced male fertility in the japonica background, but not in the indica background. In first-generation hybrid progeny, S25 had a milder effect than it had in the japonica background. These results suggest that the expression of S25 is epistatically regulated by at least one partially dominant gene present in the indica genome. This finding supports our previous studies showing that hybrid male sterility due to pollen killer genes results from epistatic interaction with other genes that are hidden in the genetic background.

  15. Identification, characterization and metagenome analysis of oocyte-specific genes organized in clusters in the mouse genome

    Directory of Open Access Journals (Sweden)

    Vaiman Daniel

    2005-05-01

    Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological

  16. Insight into Gene Polymorphisms Involved in Toll-Like Receptor/Interferon Signalling Pathways for Systemic Lupus Erythematosus in South East Asia

    Directory of Open Access Journals (Sweden)

    Hwa Chia Chai

    2014-01-01

    Full Text Available Polymorphisms in genes involved in toll-like receptor/interferon signalling pathways have been reported previously to be associated with SLE in many populations. This study aimed to investigate the role of seven single nucleotide polymorphisms within TNFAIP3, STAT4, and IRF5, which are involved in upstream and downstream pathways of type I interferon production, in SLE in the South East Asian populations. Genotyping of 360 Malaysian SLE patients and 430 normal healthy individuals revealed that minor alleles of STAT4 rs7574865 and rs10168266 were associated with elevated risk of SLE in the Chinese and Malay patients, respectively (P=0.028, odds ratio (OR=1.42; P=0.035, OR=1.80, respectively. Polymorphisms in TNFAIP3 and IRF5 did not show significant associations with SLE in any of the ethnicities. Combined analysis of the Malays, Chinese, and Indians for each SNP indicated that STAT4 rs10168266 was significantly associated with the Malaysian SLE as a whole (P=0.014; OR=1.435. The meta-analysis of STAT4 rs10168266, which combined the data of other studies and this study, further confirmed its importance as the risk factor for SLE by having pooled OR of 1.559 and P value of <0.001.

  17. Insight into Gene Polymorphisms Involved in Toll-Like Receptor/Interferon Signalling Pathways for Systemic Lupus Erythematosus in South East Asia

    Science.gov (United States)

    Chua, Kek Heng; Lim, Soo Kun; Phipps, Maude Elvira

    2014-01-01

    Polymorphisms in genes involved in toll-like receptor/interferon signalling pathways have been reported previously to be associated with SLE in many populations. This study aimed to investigate the role of seven single nucleotide polymorphisms within TNFAIP3, STAT4, and IRF5, which are involved in upstream and downstream pathways of type I interferon production, in SLE in the South East Asian populations. Genotyping of 360 Malaysian SLE patients and 430 normal healthy individuals revealed that minor alleles of STAT4 rs7574865 and rs10168266 were associated with elevated risk of SLE in the Chinese and Malay patients, respectively (P = 0.028, odds ratio (OR) = 1.42; P = 0.035, OR = 1.80, respectively). Polymorphisms in TNFAIP3 and IRF5 did not show significant associations with SLE in any of the ethnicities. Combined analysis of the Malays, Chinese, and Indians for each SNP indicated that STAT4 rs10168266 was significantly associated with the Malaysian SLE as a whole (P = 0.014; OR = 1.435). The meta-analysis of STAT4 rs10168266, which combined the data of other studies and this study, further confirmed its importance as the risk factor for SLE by having pooled OR of 1.559 and P value of <0.001. PMID:24741605

  18. Kedrostis Medik. in Asia

    Directory of Open Access Journals (Sweden)

    W.J.J.O. De Wilde

    2013-04-01

    Full Text Available DE WILDE, W.J.J.O.  & DUYFJES, BRIGITTA E.E. 2004. Kedrostis Medik. in Asia. Reinwardtia 12(2:129 – 133. — Kedrostis (Cucurbitaceae occurs in Africa and Madagascar and comprises 4 (5 species in Asia. Of these 2 species are found in India and Sri Lanka and 2 (3 species in western Malesia. One Malesian species is for the first time included in Kedrostis here, Kedrostis bennettii (Miq. W.J. de Wilde & Duyfjes, and one species is described as new here, Kedrostis hirta W.J. de Wilde & Duyfjes. One more Malesian species is insufficiently known to be formally described.  Keywords: Kedrostis, Cucurbitaceae, SE Asia, taxonomy

  19. Pleistocene Palaeoart of Asia

    Directory of Open Access Journals (Sweden)

    Robert G. Bednarik

    2013-06-01

    Full Text Available This comprehensive overview considers the currently known Pleistocene palaeoart of Asia on a common basis, which suggests that the available data are entirely inadequate to form any cohesive synthesis about this corpus. In comparison to the attention lavished on the corresponding record available from Eurasia’s small western appendage, Europe, it is evident that Pleistocene palaeoart from the rest of the world has been severely neglected. Southern Asia, in particular, holds great promise for the study of early cognitive development of hominins, and yet this potential has remained almost entirely unexplored. Asia is suggested to be the key continent in any global synthesis of ‘art’ origins, emphasising the need for a comprehensive pan-continental research program. This is not just to counter-balance the incredible imbalance in favour of Europe, but to examine the topic of Middle Pleistocene palaeoart development effectively.

  20. Nuclear power in Asia

    International Nuclear Information System (INIS)

    2007-01-01

    The Australian Uranium Association reports that Asia is the only region in the world where electricity generating capacity and specifically nuclear power is growing significantly. In East and South Asia, there are over 109 nuclear power reactors in operation, 18 under construction and plans to build about a further 100. The greatest growth in nuclear generation is expected in China, Japan, South Korea and India. As a member of the SE Asian community, Australia cannot afford to ignore the existence and growth of nuclear power generation on its door step, even if it has not, up to now, needed to utilise this power source

  1. Zika virus in Asia

    OpenAIRE

    Veasna Duong; Philippe Dussart; Philippe Buchy

    2017-01-01

    Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of...

  2. Isolation and characterization of an auxin-inducible glutathione S-transferase gene of Arabidopsis thaliana

    NARCIS (Netherlands)

    Kop, D.A.M. van der; Schuyer, M.; Scheres, B.J.G.; Zaal, B.J. van der; Hooykaas, P.J.J.

    1996-01-01

    Genes homologous to the auxin-inducible Nt103 glutathione S-transferase (GST) gene of tobacco, were isolated from a genomic library of Arabidopsis thaliana. We isolated a λ clone containing an auxin-inducible gene, At103-1a, and part of a constitutively expressed gene, At103-1b. The coding regions

  3. Characterization, expression profiles, intercellular distribution and association analysis of porcine PNAS-4 gene with production traits

    NARCIS (Netherlands)

    Mo, D.L.; Zhu, Z.M.; Pas, te M.F.W.; Li, X.Y.; Yang, S.L.; Wang, H.; Wang, H.L.; Li, K.

    2008-01-01

    Background - In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and

  4. Linkage mapping of putative regulator genes of barley grain development characterized by expression profiling

    Directory of Open Access Journals (Sweden)

    Wobus Ulrich

    2009-01-01

    Full Text Available Abstract Background Barley (Hordeum vulgare L. seed development is a highly regulated process with fine-tuned interaction of various tissues controlling distinct physiological events during prestorage, storage and dessication phase. As potential regulators involved within this process we studied 172 transcription factors and 204 kinases for their expression behaviour and anchored a subset of them to the barley linkage map to promote marker-assisted studies on barley grains. Results By a hierachical clustering of the expression profiles of 376 potential regulatory genes expressed in 37 different tissues, we found 50 regulators preferentially expressed in one of the three grain tissue fractions pericarp, endosperm and embryo during seed development. In addition, 27 regulators found to be expressed during both seed development and germination and 32 additional regulators are characteristically expressed in multiple tissues undergoing cell differentiation events during barley plant ontogeny. Another 96 regulators were, beside in the developing seed, ubiquitously expressed among all tissues of germinating seedlings as well as in reproductive tissues. SNP-marker development for those regulators resulted in anchoring 61 markers on the genetic linkage map of barley and the chromosomal assignment of another 12 loci by using wheat-barley addition lines. The SNP frequency ranged from 0.5 to 1.0 SNP/kb in the parents of the various mapping populations and was 2.3 SNP/kb over all eight lines tested. Exploration of macrosynteny to rice revealed that the chromosomal orders of the mapped putative regulatory factors were predominantly conserved during evolution. Conclusion We identified expression patterns of major transcription factors and signaling related genes expressed during barley ontogeny and further assigned possible functions based on likely orthologs functionally well characterized in model plant species. The combined linkage map and reference

  5. Cloning and characterization of a heme oxygenase-2 gene from alfalfa (Medicago sativa L.).

    Science.gov (United States)

    Fu, Guang-Qing; Jin, Qi-Jiang; Lin, Yu-Ting; Feng, Jian-Fei; Nie, Li; Shen, Wen-Biao; Zheng, Tian-Qing

    2011-11-01

    Heme oxygenase (HO, EC 1.14.99.3) catalyzes the oxidation of heme and performs vital roles in plant development and stress responses. Two HO isozymes exist in plants. Between these, HO-1 is an oxidative stress-response protein, and HO-2 usually exhibited constitutive expression. Although alfalfa HO-1 gene (MsHO1) has been investigated previously, HO2 is still poorly understood. In this study, we report the cloning and characterization of HO2 gene, MsHO2, from alfalfa (Medica sativa L.). The full-length cDNA of MsHO2 contains an ORF of 870 bp and encodes for 290 amino acid residues with a predicted molecular mass of 33.3 kDa. Similar to MsHO1, MsHO2 also appears to have an N-terminal transit peptide sequence for chloroplast import. Many conserved residues in plant HO were also conserved in MsHO2. However, unlike HO-1, the conserved histidine (His) required for heme-iron binding and HO activity was replaced by tyrosine (Tyr) in MsHO2. Further biochemical activity analysis of purified mature MsHO2 showed no HO activity, suggesting that MsHO2 may not be a true HO in nature. Semi-quantitative RT-PCR confirmed its maximum expression in the germinating seeds. Importantly, the expression levels of MsHO2 were up-regulated under sodium nitroprusside (SNP) and H(2)O(2) (especially) treatment, respectively.

  6. Functional characterization of carboxylesterase gene mutations involved in Aphis gossypii resistance to organophosphate insecticides.

    Science.gov (United States)

    Gong, Y-H; Ai, G-M; Li, M; Shi, X-Y; Diao, Q-Y; Gao, X-W

    2017-12-01

    Carboxylesterases (CarEs) play an important role in detoxifying insecticides in insects. Over-expression and structural modification of CarEs have been implicated in the development of organophosphate (OP) insecticide resistance in insects. A previous study identified four nonsynonymous mutations (resulting in four amino acid residue substitutions) in the open reading frame of the carboxylesterase gene of resistant cotton aphids compared to the omethoate susceptible strain, which has possibly influenced the development of resistance to omethoate (a systemic OP insecticide). The current study further characterized the function of these mutations, both alone and in combination, in the hydrolysis of OP insecticides. The metabolism results suggest that the combination of four mutations, mainly existing in the laboratory-selected OP-resistant cotton aphid population, increased the OP hydrolase activity (approximately twofold) at the cost of detectable carboxylesterase activity. The functional studies of single or multiple mutations suggest the positive effect of H104R, A128V and T333P on the acquisition of OP hydrolase activity, especially the combination of H104R with A128V or T333P. K484R substitution decreased both the OP hydrolase activity and the CarE activity, indicating that this mutation primarily drives the negative effect on the acquisition of OP hydrolase activity amongst these four mutations in the resistant strain. The modelling and docking results are basically consistent with the metabolic results, which strongly suggest that the structural gene modification is the molecular basis for the OP resistance in this laboratory-selected cotton aphid strain. © 2017 The Royal Entomological Society.

  7. Functional and crystallographic characterization of Salmonella typhimurium Cu,Zn superoxide dismutase coded by the sodCI virulence gene

    NARCIS (Netherlands)

    Pesce, A; Battistoni, A; Stroppolo, ME; Polizio, F; Nardini, M; Kroll, JS; Langford, PR; O'Neill, P; Sette, M; Desideri, A; Bolognesi, M

    2000-01-01

    The functional and three-dimensional structural features of Cu,Zn superoxide dismutase coded by the Salmonella typhimurium sodCI gene, have been characterized. Measurements of the catalytic rate indicate that this enzyme is the most efficient superoxide dismutase analyzed so far, a feature that may

  8. Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization

    CSIR Research Space (South Africa)

    Gcebe, N

    2017-04-01

    Full Text Available Journal of Systematic and Evolutionary Microbiology: DOI 10.1099/ijsem.0.001678 Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization Gcebe N Rutten V Gey...

  9. Characterization and transcriptional analysis of two gene clusters for type IV secretion machinery in Wolbachia of Armadillidium vulgare

    DEFF Research Database (Denmark)

    Félix, Christine; Pichon, Samuel; Braquart-Varnier, Christine

    2008-01-01

    Wolbachia are maternally inherited alpha-proteobacteria that induce feminization of genetic males in most terrestrial crustacean isopods. Two clusters of vir genes for a type IV secretion machinery have been identified at two separate loci and characterized for the first time in a feminizing Wolb...

  10. Mapping and characterization of wheat stem rust resistance genes SrTm5 and Sr60 from Triticum monococcum

    Science.gov (United States)

    The emergence and spread of new virulent races of the wheat stem rust pathogen (Puccinia graminis f. sp. tritici; Pgt), including the TTKSK (Ug99) race group, is a serious threat to global wheat production. In this study, we mapped and characterized two stem rust resistance genes from diploid wheat ...

  11. Characterization of GmENOD40, a gene showing novel patterns of cell-specific expression during soybean nodule development.

    NARCIS (Netherlands)

    Yang, W.C.; Katinakis, P.; Hendriks, P.; Smolders, A.; Vries, de F.; Spee, J.; Kammen, van A.; Bisseling, T.; Franssen, H.

    1993-01-01

    In this paper, the soybean 'early nodulin' clone pGmENOD40 is characterized. The GmENOD40 encoded protein does not contain methionine and does not show homology to proteins identified so far. In situ hybridizations showed that this gene has a complex expression pattern during development of

  12. CHARACTERIZATION OF 0.58 kb DNA STILBENE SYNTHASE ENCODING GENE FRAGMENT FROM MELINJO PLANT (Gnetum gnemon

    Directory of Open Access Journals (Sweden)

    Tri Joko Raharjo

    2011-12-01

    Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene

  13. Identification and characterization of a novel fumarase gene by metagenome expression cloning from marine microorganisms

    Directory of Open Access Journals (Sweden)

    Tang Xian-Lai

    2010-11-01

    Full Text Available Abstract Background Fumarase catalyzes the reversible hydration of fumarate to L-malate and is a key enzyme in the tricarboxylic acid (TCA cycle and in amino acid metabolism. Fumarase is also used for the industrial production of L-malate from the substrate fumarate. Thermostable and high-activity fumarases from organisms that inhabit extreme environments may have great potential in industry, biotechnology, and basic research. The marine environment is highly complex and considered one of the main reservoirs of microbial diversity on the planet. However, most of the microorganisms are inaccessible in nature and are not easily cultivated in the laboratory. Metagenomic approaches provide a powerful tool to isolate and identify enzymes with novel biocatalytic activities for various biotechnological applications. Results A plasmid metagenomic library was constructed from uncultivated marine microorganisms within marine water samples. Through sequence-based screening of the DNA library, a gene encoding a novel fumarase (named FumF was isolated. Amino acid sequence analysis revealed that the FumF protein shared the greatest homology with Class II fumarate hydratases from Bacteroides sp. 2_1_33B and Parabacteroides distasonis ATCC 8503 (26% identical and 43% similar. The putative fumarase gene was subcloned into pETBlue-2 vector and expressed in E. coli BL21(DE3pLysS. The recombinant protein was purified to homogeneity. Functional characterization by high performance liquid chromatography confirmed that the recombinant FumF protein catalyzed the hydration of fumarate to form L-malate. The maximum activity for FumF protein occurred at pH 8.5 and 55°C in 5 mM Mg2+. The enzyme showed higher affinity and catalytic efficiency under optimal reaction conditions: Km= 0.48 mM, Vmax = 827 μM/min/mg, and kcat/Km = 1900 mM/s. Conclusions We isolated a novel fumarase gene, fumF, from a sequence-based screen of a plasmid metagenomic library from uncultivated

  14. Characterization of Aeromonas hydrophila wound pathotypes by comparative genomic and functional analyses of virulence genes.

    Science.gov (United States)

    Grim, Christopher J; Kozlova, Elena V; Sha, Jian; Fitts, Eric C; van Lier, Christina J; Kirtley, Michelle L; Joseph, Sandeep J; Read, Timothy D; Burd, Eileen M; Tall, Ben D; Joseph, Sam W; Horneman, Amy J; Chopra, Ashok K; Shak, Joshua R

    2013-04-23

    Aeromonas hydrophila has increasingly been implicated as a virulent and antibiotic-resistant etiologic agent in various human diseases. In a previously published case report, we described a subject with a polymicrobial wound infection that included a persistent and aggressive strain of A. hydrophila (E1), as well as a more antibiotic-resistant strain of A. hydrophila (E2). To better understand the differences between pathogenic and environmental strains of A. hydrophila, we conducted comparative genomic and functional analyses of virulence-associated genes of these two wound isolates (E1 and E2), the environmental type strain A. hydrophila ATCC 7966(T), and four other isolates belonging to A. aquariorum, A. veronii, A. salmonicida, and A. caviae. Full-genome sequencing of strains E1 and E2 revealed extensive differences between the two and strain ATCC 7966(T). The more persistent wound infection strain, E1, harbored coding sequences for a cytotoxic enterotoxin (Act), a type 3 secretion system (T3SS), flagella, hemolysins, and a homolog of exotoxin A found in Pseudomonas aeruginosa. Corresponding phenotypic analyses with A. hydrophila ATCC 7966(T) and SSU as reference strains demonstrated the functionality of these virulence genes, with strain E1 displaying enhanced swimming and swarming motility, lateral flagella on electron microscopy, the presence of T3SS effector AexU, and enhanced lethality in a mouse model of Aeromonas infection. By combining sequence-based analysis and functional assays, we characterized an A. hydrophila pathotype, exemplified by strain E1, that exhibited increased virulence in a mouse model of infection, likely because of encapsulation, enhanced motility, toxin secretion, and cellular toxicity. Aeromonas hydrophila is a common aquatic bacterium that has increasingly been implicated in serious human infections. While many determinants of virulence have been identified in Aeromonas, rapid identification of pathogenic versus nonpathogenic

  15. Characterization, expression patterns and functional analysis of the MAPK and MAPKK genes in watermelon (Citrullus lanatus).

    Science.gov (United States)

    Song, Qiuming; Li, Dayong; Dai, Yi; Liu, Shixia; Huang, Lei; Hong, Yongbo; Zhang, Huijuan; Song, Fengming

    2015-12-23

    Mitogen-activated protein kinase (MAPK) cascades, which consist of three functionally associated protein kinases, namely MEKKs, MKKs and MPKs, are universal signaling modules in all eukaryotes and have been shown to play critical roles in many physiological and biochemical processes in plants. However, little or nothing is known about the MPK and MKK families in watermelon. In the present study, we performed a systematic characterization of the ClMPK and ClMKK families including the identification and nomenclature, chromosomal localization, phylogenetic relationships, ClMPK-ClMKK interactions, expression patterns in different tissues and in response to abiotic and biotic stress and transient expression-based functional analysis for their roles in disease resistance. Genome-wide survey identified fifteen ClMPK and six ClMKK genes in watermelon genome and phylogenetic analysis revealed that both of the ClMPK and ClMKK families can be classified into four distinct groups. Yeast two-hybrid assays demonstrated significant interactions between members of the ClMPK and ClMKK families, defining putative ClMKK2-1/ClMKK6-ClMPK4-1/ClMPK4-2/ClMPK13 and ClMKK5-ClMPK6 cascades. Most of the members in the ClMPK and ClMKK families showed differential expression patterns in different tissues and in response to abiotic (e.g. drought, salt, cold and heat treatments) and biotic (e.g. infection of Fusarium oxysporum f. sp. niveum) stresses. Transient expression of ClMPK1, ClMPK4-2 and ClMPK7 in Nicotiana benthamiana resulted in enhanced resistance to Botrytis cinerea and upregulated expression of defense genes while transient expression of ClMPK6 and ClMKK2-2 led to increased susceptibility to B. cinerea. Furthermore, transient expression of ClMPK7 also led to hypersensitive response (HR)-like cell death and significant accumulation of H2O2 in N. benthamiana. We identified fifteen ClMPK and six ClMKK genes from watermelon and analyzed their phylogenetic relationships, expression

  16. In-silico identification and characterization of organic and inorganic chemical stress responding genes in yeast (Saccharomyces cerevisiae).

    Science.gov (United States)

    Barozai, Muhammad Younas Khan; Bashir, Farrukh; Muzaffar, Shafia; Afzal, Saba; Behlil, Farida; Khan, Muzaffar

    2014-10-15

    To study the life processes of all eukaryotes, yeast (Saccharomyces cerevisiae) is a significant model organism. It is also one of the best models to study the responses of genes at transcriptional level. In a living organism, gene expression is changed by chemical stresses. The genes that give response to chemical stresses will provide good source for the strategies in engineering and formulating mechanisms which are chemical stress resistant in the eukaryotic organisms. The data available through microarray under the chemical stresses like lithium chloride, lactic acid, weak organic acids and tomatidine were studied by using computational tools. Out of 9335 yeast genes, 388 chemical stress responding genes were identified and characterized under different chemical stresses. Some of these are: Enolases 1 and 2, heat shock protein-82, Yeast Elongation Factor 3, Beta Glucanase Protein, Histone H2A1 and Histone H2A2 Proteins, Benign Prostatic Hyperplasia, ras GTPase activating protein, Establishes Silent Chromatin protein, Mei5 Protein, Nondisjunction Protein and Specific Mitogen Activated Protein Kinase. Characterization of these genes was also made on the basis of their molecular functions, biological processes and cellular components. Copyright © 2014 Elsevier B.V. All rights reserved.

  17. Molecular Characterization and Functional Analysis of Three Pathogenesis-Related Cytochrome P450 Genes from Bursaphelenchus xylophilus (Tylenchida: Aphelenchoidoidea

    Directory of Open Access Journals (Sweden)

    Xiao-Lu Xu

    2015-03-01

    Full Text Available Bursaphelenchus xylophilus, the causal agent of pine wilt disease, causes huge economic losses in pine forests. The high expression of cytochrome P450 genes in B. xylophilus during infection in P. thunbergii indicated that these genes had a certain relationship with the pathogenic process of B. xylophilus. Thus, we attempted to identify the molecular characterization and functions of cytochrome P450 genes in B. xylophilus. In this study, full-length cDNA of three cytochrome P450 genes, BxCYP33C9, BxCYP33C4 and BxCYP33D3 were first cloned from B. xylophilus using 3' and 5' RACE PCR amplification. Sequence analysis showed that all of them contained a highly-conserved cytochrome P450 domain. The characteristics of the three putative proteins were analyzed with bioinformatic methods. RNA interference (RNAi was used to assess the functions of BxCYP33C9, BxCYP33C4 and BxCYP33D3. The results revealed that these cytochrome P450 genes were likely to be associated with the vitality, dispersal ability, reproduction, pathogenicity and pesticide metabolism of B. xylophilus. This discovery confirmed the molecular characterization and functions of three cytochrome P450 genes from B. xylophilus and provided fundamental information in elucidating the molecular interaction mechanism between B. xylophilus and its host plant.

  18. Functional characterization of diverse ring-hydroxylating oxygenases and induction of complex aromatic catabolic gene clusters in Sphingobium sp. PNB

    Directory of Open Access Journals (Sweden)

    Pratick Khara

    2014-01-01

    Full Text Available Sphingobium sp. PNB, like other sphingomonads, has multiple ring-hydroxylating oxygenase (RHO genes. Three different fosmid clones have been sequenced to identify the putative genes responsible for the degradation of various aromatics in this bacterial strain. Comparison of the map of the catabolic genes with that of different sphingomonads revealed a similar arrangement of gene clusters that harbors seven sets of RHO terminal components and a sole set of electron transport (ET proteins. The presence of distinctly conserved amino acid residues in ferredoxin and in silico molecular docking analyses of ferredoxin with the well characterized terminal oxygenase components indicated the structural uniqueness of the ET component in sphingomonads. The predicted substrate specificities, derived from the phylogenetic relationship of each of the RHOs, were examined based on transformation of putative substrates and their structural homologs by the recombinant strains expressing each of the oxygenases and the sole set of available ET proteins. The RHO AhdA1bA2b was functionally characterized for the first time and was found to be capable of transforming ethylbenzene, propylbenzene, cumene, p-cymene and biphenyl, in addition to a number of polycyclic aromatic hydrocarbons. Overexpression of aromatic catabolic genes in strain PNB, revealed by real-time PCR analyses, is a way forward to understand the complex regulation of degradative genes in sphingomonads.

  19. Occurrence of antibiotic resistance and characterization of resistant genes and integrons in Enterobacteriaceae isolated from integrated fish farms south China

    Science.gov (United States)

    Su, Hao-Chang; Ying, Guang-Guo; Tao, Ran; Zhang, Rui-Quan; Fogarty, Lisa R.; Kolpin, Dana W.

    2011-01-01

    Antibiotics are still widely applied in animal husbandry to prevent diseases and used as feed additives to promote animal growth. This could result in antibiotic resistance to bacteria and antibiotic residues in animals. In this paper, Enterobacteriaceae isolated from four integrated fish farms in Zhongshan, South China were tested for antibiotic resistance, tetracycline resistance genes, sulfonamide resistance genes, and class 1 integrons. The Kirby-Bauer disk diffusion method and polymerase chain reaction (PCR) assays were carried out to test antibiotic susceptibility and resistance genes, respectively. Relatively high antibiotic resistance frequencies were found, especially for ampicillin (80%), tetracycline (52%), and trimethoprim (50%). Out of 203 Enterobacteriaceae isolates, 98.5% were resistant to one or more antibiotics tested. Multiple antibiotic resistance (MAR) was found highest in animal manures with a MAR index of 0.56. Tetracycline resistance genes (tet(A), tet(C)) and sulfonamide resistance genes (sul2) were detected in more than 50% of the isolates. The intI1 gene was found in 170 isolates (83.7%). Both classic and non-classic class 1 integrons were found. Four genes, aadA5, aadA22, dfr2, and dfrA17, were detected. To our knowledge, this is the first report for molecular characterization of antibiotic resistance genes in Enterobacteriaceae isolated from integrated fish farms in China and the first time that gene cassette array dfrA17-aadA5 has been detected in such fish farms. Results of this study indicated that fish farms may be a reservoir of highly diverse and abundant antibiotic resistant genes and gene cassettes. Integrons may play a key role in multiple antibiotic resistances posing potential health risks to the general public and aquaculture.

  20. Characterization of the Transcriptome and Gene Expression of Brain Tissue in Sevenband Grouper (Hyporthodus septemfasciatus in Response to NNV Infection

    Directory of Open Access Journals (Sweden)

    Jong-Oh Kim

    2017-01-01

    Full Text Available Grouper is one of the favorite sea food resources in Southeast Asia. However, the outbreaks of the viral nervous necrosis (VNN disease due to nervous necrosis virus (NNV infection have caused mass mortality of grouper larvae. Many aqua-farms have suffered substantial financial loss due to the occurrence of VNN. To better understand the infection mechanism of NNV, we performed the transcriptome analysis of sevenband grouper brain tissue, the main target of NNV infection. After artificial NNV challenge, transcriptome of brain tissues of sevenband grouper was subjected to next generation sequencing (NGS using an Illumina Hi-seq 2500 system. Both mRNAs from pooled samples of mock and NNV-infected sevenband grouper brains were sequenced. Clean reads of mock and NNV-infected samples were de novo assembled and obtained 104,348 unigenes. In addition, 628 differentially expressed genes (DEGs in response to NNV infection were identified. This result could provide critical information not only for the identification of genes involved in NNV infection, but for the understanding of the response of sevenband groupers to NNV infection.

  1. Characterization of the linkage disequilibrium structure and identification of tagging-SNPs in five DNA repair genes

    International Nuclear Information System (INIS)

    Allen-Brady, Kristina; Camp, Nicola J

    2005-01-01

    Characterization of the linkage disequilibrium (LD) structure of candidate genes is the basis for an effective association study of complex diseases such as cancer. In this study, we report the LD and haplotype architecture and tagging-single nucleotide polymorphisms (tSNPs) for five DNA repair genes: ATM, MRE11A, XRCC4, NBS1 and RAD50. The genes ATM, MRE11A, and XRCC4 were characterized using a panel of 94 unrelated female subjects (47 breast cancer cases, 47 controls) obtained from high-risk breast cancer families. A similar LD structure and tSNP analysis was performed for NBS1 and RAD50, using publicly available genotyping data. We studied a total of 61 SNPs at an average marker density of 10 kb. Using a matrix decomposition algorithm, based on principal component analysis, we captured >90% of the intragenetic variation for each gene. Our results revealed that three of the five genes did not conform to a haplotype block structure (MRE11A, RAD50 and XRCC4). Instead, the data fit a more flexible LD group paradigm, where SNPs in high LD are not required to be contiguous. Traditional haplotype blocks assume recombination is the only dynamic at work. For ATM, MRE11A and XRCC4 we repeated the analysis in cases and controls separately to determine whether LD structure was consistent across breast cancer cases and controls. No substantial difference in LD structures was found. This study suggests that appropriate SNP selection for an association study involving candidate genes should allow for both mutation and recombination, which shape the population-level genomic structure. Furthermore, LD structure characterization in either breast cancer cases or controls appears to be sufficient for future cancer studies utilizing these genes

  2. Performance Theory: Southeast Asia.

    Science.gov (United States)

    Kirby, Michael, Ed.

    1979-01-01

    Focusing on the contemporary theatre in Southeast Asia, this journal issue sheds light on the intercultural relationships that exist between that part of the world and the Western world. In addition to a transcript of a Balinese "topeng" (storytelling) performance, the journal contains eight articles that provide information on the…

  3. Nuclear power in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Hagen, Ronald E.

    1998-08-01

    Contains Executive Summary and Chapters on: Nuclear Energy in the Asian context; Types of nuclear power reactors used in Asia; A survey of nuclear power by country; The economics of nuclear power; Fuels, fuel cycles and reprocessing; Environmental issues and waste disposal; The weapons issues and nuclear power; Conclusions. (Author)

  4. Literacy in South Asia.

    Science.gov (United States)

    Srivastava, R. N.

    1983-01-01

    A study of the various facets and dimensions of literacy programs in South Asia indicates that literacy is viewed as a means of human resource development geared toward meaningful participation of all sectors in society, with individual programs varying according to the magnitude of illiteracy, national goals, linguistic setting, and regional…

  5. Molecular cloning, expression and characterization of a serine proteinase inhibitor gene from Entamoeba histolytica.

    Science.gov (United States)

    Riahi, Yael; Siman-Tov, Rama; Ankri, Serge

    2004-02-01

    Serine proteinase inhibitors (serpins) are irreversible suicide inhibitors of proteinases that regulate a wide range of biological processes, including pathogen evasion of the host defence system. We report the cloning and characterization of a gene encoding a serpin from the protozoan parasite Entamoeba histolytica (Ehserp) that may function in this manner. The protein encoded by Ehserp contains 371 amino acids with a predicted mass of 42.6 kDa. Antibodies to a 42 kDa recombinant Ehserp react specifically with two bands of 42 and 49 kDa in trophozoite extracts. Ehserp has a cytoplasmic localization and is secreted by trophozoites incubated in the presence of mammalian cells, but not by resting trophozoites. A panel of mammalian serine proteinases was screened, but none of them was inhibited by the recombinant Ehserp. In contrast, the 49 kDa Ehserp present in the secretion product (SP) of activated macrophages interacted with human neutrophil cathepsin G to form a complex resistant to sodium dodecyl sulphate. We discuss the nature of the 42 and 49 kDa Ehserp and the possible roles that Ehserp may play in the survival of the parasite inside the host.

  6. Transferrin-facilitated lipofection gene delivery strategy: characterization of the transfection complexes and intracellular trafficking.

    Science.gov (United States)

    Joshee, Nirmal; Bastola, Dhundy R; Cheng, Pi-Wan

    2002-11-01

    We previously showed that mixing transferrin with a cationic liposome prior to the addition of DNA, greatly enhanced the lipofection efficiency. Here, we report characterization of the transfection complexes in formulations prepared with transferrin, lipofectin, and DNA (pCMVlacZ) in various formulations. DNA in all the formulations that contain lipofectin was resistant to DNase I treatment. Transfection experiments performed in Panc 1 cells showed that the standard formulation, which was prepared by adding DNA to a mixture of transferrin and lipofectin, yielded highest transfection efficiency. There was no apparent difference in zeta potential among these formulations, but the most efficient formulation contained complexes with a mean diameter of three to four times that of liposome and the complexes in other gene delivery formulations. Transmission electron microscopic examination of the standard transfection complexes formulated using gold-labeled transferrin showed extended circular DNA decorated with transferrin as compared to extensively condensed DNA found in lipofectin-DNA complexes and heterogeneous structures in other formulations. By confocal microscopy, DNA and transferrin were found to colocalize at the perinuclear space and in the nucleus, suggesting cotransportation intracellularly, including nuclear transport. We propose that transferrin enhances the transfection efficiency of the standard lipofection formulation by preventing DNA condensation, and facilitating endocytosis and nuclear targeting.

  7. Functional characterization of the Drosophila MRP (mitochondrial RNA processing) RNA gene.

    Science.gov (United States)

    Schneider, Mary D; Bains, Anupinder K; Rajendra, T K; Dominski, Zbigniew; Matera, A Gregory; Simmonds, Andrew J

    2010-11-01

    MRP RNA is a noncoding RNA component of RNase mitochondrial RNA processing (MRP), a multi-protein eukaryotic endoribonuclease reported to function in multiple cellular processes, including ribosomal RNA processing, mitochondrial DNA replication, and cell cycle regulation. A recent study predicted a potential Drosophila ortholog of MRP RNA (CR33682) by computer-based genome analysis. We have confirmed the expression of this gene and characterized the phenotype associated with this locus. Flies with mutations that specifically affect MRP RNA show defects in growth and development that begin in the early larval period and end in larval death during the second instar stage. We present several lines of evidence demonstrating a role for Drosophila MRP RNA in rRNA processing. The nuclear fraction of Drosophila MRP RNA localizes to the nucleolus. Further, a mutant strain shows defects in rRNA processing that include a defect in 5.8S rRNA processing, typical of MRP RNA mutants in other species, as well as defects in early stages of rRNA processing.

  8. Molecular Characterization of LRB7 Gene and a Water Channel Protein TIP2 in Chorispora bungeana

    Directory of Open Access Journals (Sweden)

    Ming Li

    2016-01-01

    Full Text Available Background. Water channel proteins, also called aquaporins, are integral membrane proteins from major intrinsic protein (MIP family and involved in several pathways including not only water transport but also cell signaling, reproduction, and photosynthesis. The full cDNA and protein sequences of aquaporin in Chorispora bungeana Fisch. & C.A. Mey (C. bungeana are still unknown. Results. In this study, PCR and rapid amplification of cDNA ends approaches were used to clone the full cDNA of LRB7 (GenBank accession number: EU636988 of C. bungeana. Sequence analysis indicated that it was 1235 bp, which had two introns and encoded a protein of 250 amino acids. Structure analysis revealed that the protein had two conserved NPA motifs, one of which is MIP signature sequence (SGxHxNPAVT, six membrane helix regions, and additional membrane-embedded domains. Phylogenetic analysis suggested that the protein was from TIP2 subgroup. Surprisingly, semiquantitative RT-PCR experiment and western blot analysis showed that LRB7 and TIP2 were only detectable in roots, unlike Arabidopsis and Raphanus. Connecting with our previous studies, LRB7 was supported to associate with chilling-tolerance in C. bungeana. Conclusion. This is the first time to characterize the full sequences of LRB7 gene and water channel protein in C. bungeana. Our findings contribute to understanding the water transports in plants under low temperatures.

  9. Novel glucose dehydrogenase from Mucor prainii: Purification, characterization, molecular cloning and gene expression in Aspergillus sojae.

    Science.gov (United States)

    Satake, Ryoko; Ichiyanagi, Atsushi; Ichikawa, Keiichi; Hirokawa, Kozo; Araki, Yasuko; Yoshimura, Taro; Gomi, Keiko

    2015-11-01

    Glucose dehydrogenase (GDH) is of interest for its potential applications in the field of glucose sensors. To improve the performance of glucose sensors, GDH is required to have strict substrate specificity. A novel flavin adenine dinucleotide (FAD)-dependent GDH was isolated from Mucor prainii NISL0103 and its enzymatic properties were characterized. This FAD-dependent GDH (MpGDH) exhibited high specificity toward glucose. High specificity for glucose was also observed even in the presence of saccharides such as maltose, galactose and xylose. The molecular masses of the glycoforms of GDH ranged from 90 to 130 kDa. After deglycosylation, a single 80 kDa band was observed. The gene encoding MpGDH was cloned and expressed in Aspergillus sojae. The apparent kcat and Km values of recombinant enzyme for glucose were found to be 749.7 s(-1) and 28.3 mM, respectively. The results indicated that the characteristics of MpGDH were suitable for assaying blood glucose levels. Copyright © 2015 The Society for Biotechnology, Japan. Published by Elsevier B.V. All rights reserved.

  10. Isolation and characterization of Agouti: a diabetes/obesity related gene

    Energy Technology Data Exchange (ETDEWEB)

    Woychik, Richard P. (Knoxville, TN)

    2000-06-27

    The present invention relates to the cloning and expression of the Agouti gene and analogous genes in transformed, transfected and transgenic mice. The present invention provides an animal model for the study of diabetes, obesity and tumors for the testing of potential therapeutic agents. The present invention provides oligonucleotide probes for the detection of the Agouti gene and mutations in the gene. The present invention also relates to the isolation and recombinant production of the Agouti gene product, production of antibodies to the Agouti gene product and their use as diagnostic and therapeutic agents.

  11. Isolation and characterization of Agouti: a diabetes/obesity related gene

    Energy Technology Data Exchange (ETDEWEB)

    Woychik, Richard P. (Knoxville, TN)

    1998-01-01

    The present invention relates to the cloning and expression of the Agouti gene and analogous genes in transformed, transfected and transgenic mice. The present invention provides an animal model for the study of diabetes, obesity and tumors for the testing of potential therapeutic agents. The present invention provides oligonucleotide probes for the detection of the Agouti gene and mutations in the gene. The present invention also relates to the isolation and recombinant production of the Agouti gene product, production of antibodies to the Agouti gene product and their use as diagnostic and therapeutic agents.

  12. Systemic virus-induced gene silencing allows functional characterization of maize genes during biotrophic interaction with Ustilago maydis.

    Science.gov (United States)

    van der Linde, Karina; Kastner, Christine; Kumlehn, Jochen; Kahmann, Regine; Doehlemann, Gunther

    2011-01-01

    Infection of maize (Zea mays) plants with the corn smut fungus Ustilago maydis leads to the formation of large tumors on the stem, leaves and inflorescences. In this biotrophic interaction, plant defense responses are actively suppressed by the pathogen, and previous transcriptome analyses of infected maize plants showed massive and stage-specific changes in host gene expression during disease progression. To identify maize genes that are functionally involved in the interaction with U. maydis, we adapted a virus-induced gene silencing (VIGS) system based on the brome mosaic virus (BMV) for maize. Conditions were established that allowed successful U. maydis infection of BMV-preinfected maize plants. This set-up enabled quantification of VIGS and its impact on U. maydis infection using a quantitative real-time PCR (qRT-PCR)-based readout. In proof-of-principle experiments, an U. maydis-induced terpene synthase was shown to negatively regulate disease development while a protein involved in cell death inhibition was required for full virulence of U. maydis. The results suggest that this system is a versatile tool for the rapid identification of maize genes that determine compatibility with U. maydis. © (2010) Max Planck Society. Journal compilation © New Phytologist Trust (2010).

  13. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, J.; Nevrtalová, E.; Kováčová, V.; Hudzieczek, V.; Čegan, R.; Vyskot, B.; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196 ISSN 0176-1617 R&D Projects: GA ČR GBP501/12/G090 Institutional support: RVO:61389030 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: EB - Genetics ; Molecular Biology Impact factor: 2.557, year: 2014

  14. Characterization of differentially expressed genes involved in pathways associated with gastric cancer.

    Directory of Open Access Journals (Sweden)

    Hao Li

    Full Text Available To explore the patterns of gene expression in gastric cancer, a total of 26 paired gastric cancer and noncancerous tissues from patients were enrolled for gene expression microarray analyses. Limma methods were applied to analyze the data, and genes were considered to be significantly differentially expressed if the False Discovery Rate (FDR value was 2. Subsequently, Gene Ontology (GO categories were used to analyze the main functions of the differentially expressed genes. According to the Kyoto Encyclopedia of Genes and Genomes (KEGG database, we found pathways significantly associated with the differential genes. Gene-Act network and co-expression network were built respectively based on the relationships among the genes, proteins and compounds in the database. 2371 mRNAs and 350 lncRNAs considered as significantly differentially expressed genes were selected for the further analysis. The GO categories, pathway analyses and the Gene-Act network showed a consistent result that up-regulated genes were responsible for tumorigenesis, migration, angiogenesis and microenvironment formation, while down-regulated genes were involved in metabolism. These results of this study provide some novel findings on coding RNAs, lncRNAs, pathways and the co-expression network in gastric cancer which will be useful to guide further investigation and target therapy for this disease.

  15. Evolutionary characterization and transcript profiling of β-tubulin genes in flax (Linum usitatissimum L.) during plant development.

    Science.gov (United States)

    Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura

    2017-12-08

    Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.

  16. Rapid characterization of disease-causing mutations in the low density lipoprotein receptor (LDL-R) gene by overexpression in COS cells

    DEFF Research Database (Denmark)

    Jensen, T G; Andresen, B S; Jensen, H K

    1996-01-01

    To characterize disease-causing mutations in the low density lipoprotein receptor (LDL-R) gene, COS cells are transfected with the mutant gene in an EBV-based expression vector and characterized by flow cytometry. Using antibodies against the LDL-receptor the amount of receptor protein on the cel...

  17. Characterization of potent odorants in male giant water bug (Lethocerus indicus Lep. and Serv.), an important edible insect of Southeast Asia.

    Science.gov (United States)

    Kiatbenjakul, Patthamawadi; Intarapichet, Kanok-Orn; Cadwallader, Keith R

    2015-02-01

    Potent odorants in frozen fresh (FFB) and salted boiled (SBB) male giant water bugs (Lethocerus indicus), or 'Maengdana' in Thai, were characterized by application of direct solvent extraction/solvent-assisted flavour evaporation (SAFE), gas chromatography-mass spectrometry (GC-MS), gas chromatography-olfactometry (GC-O), aroma extract dilution analysis (AEDA) and stable isotope dilution assays (SIDA). Twenty and 27 potent odorants were detected in FFB and SBB, respectively. Most odorants were lipid-derived compounds, including the two most abundant volatile components (E)-2-hexenyl acetate and (E)-2-hexenyl butanoate, which contributed banana-like odours. 2-Acetyl-1-pyrroline and 2-acetyl-2-thiazoline, responsible for popcorn-like odours, were detected in SBB only. An aroma reconstitution model of SBB was constructed in an oil-in-water emulsion matrix using 12 selected potent odorants based on the results of AEDA, accurate compound quantification and the calculated odour-activity values (OAV). Omission studies were carried out to verify the significance of esters, particularly (E)-2-hexenyl acetate was determined to be an important character-impact odorant in male giant water bug aroma. Copyright © 2014 Elsevier Ltd. All rights reserved.

  18. In silico characterization of 1,2-diacylglycerol cholinephosphotransferase and lysophospha-tidylcholine acyltransferase genes in Glycine max L. Merrill.

    Science.gov (United States)

    Sousa, C S; Barros, B A; Barh, D; Ghosh, P; Azevedo, V; Barros, E G; Moreira, M A

    2016-08-26

    The enzymes 1,2-diacylglycerol cholinephosphotrans-ferase (CPT) and lysophosphatidylcholine acyltransferase (LPCAT) are important in lipid metabolism in soybean seeds. Thus, understand-ing the genes that encode these enzymes may enable their modification and aid the improvement of soybean oil quality. In soybean, the genes encoding these enzymes have not been completely described; there-fore, this study aimed to identify, characterize, and analyze the in silico expression of these genes in soybean. We identified two gene models encoding CPT and two gene models encoding LPCAT, one of which presented an alternative transcript. The sequences were positioned on the physical map of soybean and the promoter regions were analyzed. Cis-elements responsible for seed-specific expression and responses to biotic and abiotic stresses were identified. Virtual expression analysis of the gene models for CPT and LPCAT indicated that these genes are expressed under different stress conditions, in somatic embryos during differentiation, in immature seeds, root tissues, and calli. Putative ami-no acid sequences revealed the presence of transmembrane domains, and analysis of the cellular localization of these enzymes revealed they are located in the endoplasmic reticulum.

  19. Molecular characterization of a genetic variant of the steroid hormone-binding globulin gene in heterozygous subjects

    Energy Technology Data Exchange (ETDEWEB)

    Hardy, D.O.; Catterall, J.F. [Population Council, New York, NY (United States); Carino, C. [Instituto National de la Nutricion, Mexico City, MX (United States)] [and others

    1995-04-01

    Steroid hormone-binding globulin in human serum displays different isoelectric focusing (IEF) patterns among individuals, suggesting genetic variation in the gene for this extracellular steroid carrier protein. Analysis of allele frequencies and family studies suggested the existence of two codominant alleles of the gene. Subsequent determination of the molecular basis of a variant of the gene was carried out using DNA from homozygous individuals from a single Belgian family. It was of interest to characterize other variant individuals to determine whether all variants identified by IEF phenotyping were caused by the same mutation or whether other mutations occurred in the gene in different populations. Previous studies identified Mexican subjects who were heterozygous for the variant IEF phenotype. Denaturing gradient gel electrophoresis was used to localize the mutation in these subjects and to purify the variant allele for DNA sequence analysis. The results show that the mutation in this population is identical to that identified in the Belgian family, and no other mutations were detected in the gene. These data represent the first analysis of steroid hormone-binding globulin gene variation in heterozygous subjects and further support the conclusion of biallelism of the gene worldwide. 11 refs., 2 figs., 1 tab.

  20. Cloning and Characterization of upp, a Gene Encoding Uracil Phosphoribosyltransferase from Lactococcus lactis

    DEFF Research Database (Denmark)

    Martinussen, Jan; Hammer, Karin

    1994-01-01

    Uracil phosphoribosyltransferase catalyzes the key reaction in the salvage of uracil in many microorganisms. The gene encoding uracil phosphoribosyltransferase (upp) was cloned from Lactococcus lactis subsp. cremoris MG1363 by complementation of an Escherichia coli mutant. The gene was sequenced...

  1. Characterization and detection of a widely distributed gene cluster that predicts anaerobic choline utilization by human gut bacteria.

    Science.gov (United States)

    Martínez-del Campo, Ana; Bodea, Smaranda; Hamer, Hilary A; Marks, Jonathan A; Haiser, Henry J; Turnbaugh, Peter J; Balskus, Emily P

    2015-04-14

    Elucidation of the molecular mechanisms underlying the human gut microbiota's effects on health and disease has been complicated by difficulties in linking metabolic functions associated with the gut community as a whole to individual microorganisms and activities. Anaerobic microbial choline metabolism, a disease-associated metabolic pathway, exemplifies this challenge, as the specific human gut microorganisms responsible for this transformation have not yet been clearly identified. In this study, we established the link between a bacterial gene cluster, the choline utilization (cut) cluster, and anaerobic choline metabolism in human gut isolates by combining transcriptional, biochemical, bioinformatic, and cultivation-based approaches. Quantitative reverse transcription-PCR analysis and in vitro biochemical characterization of two cut gene products linked the entire cluster to growth on choline and supported a model for this pathway. Analyses of sequenced bacterial genomes revealed that the cut cluster is present in many human gut bacteria, is predictive of choline utilization in sequenced isolates, and is widely but discontinuously distributed across multiple bacterial phyla. Given that bacterial phylogeny is a poor marker for choline utilization, we were prompted to develop a degenerate PCR-based method for detecting the key functional gene choline TMA-lyase (cutC) in genomic and metagenomic DNA. Using this tool, we found that new choline-metabolizing gut isolates universally possessed cutC. We also demonstrated that this gene is widespread in stool metagenomic data sets. Overall, this work represents a crucial step toward understanding anaerobic choline metabolism in the human gut microbiota and underscores the importance of examining this microbial community from a function-oriented perspective. Anaerobic choline utilization is a bacterial metabolic activity that occurs in the human gut and is linked to multiple diseases. While bacterial genes responsible for

  2. Elucidation of primary metabolic pathways in Aspergillus species: Orphaned research in characterizing orphan genes

    DEFF Research Database (Denmark)

    Andersen, Mikael Rørdam

    2014-01-01

    metabolites and extracellular enzymes. In this review, all annotated genes from four Aspergillus species have been examined. In this process, it becomes evident that 80-96% of the genes (depending on the species) are still without verified function. A significant proportion of the genes with verified......, applications of this from the Aspergillus genes will be examined, and it is proposed that, where feasible, this should be a standard part of functional annotation of fungal genomes....

  3. Characterization of upstream sequences of the LIM2 gene that bind developmentally regulated and lens-specific proteins

    Institute of Scientific and Technical Information of China (English)

    HSU Heng; Robert L. CHURCH

    2004-01-01

    During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.

  4. Peritoneal Dialysis in Asia.

    Science.gov (United States)

    Kwong, Vickie Wai-Ki; Li, Philip Kam-Tao

    2015-12-01

    There is a growing demand of dialysis in Asia for end-stage renal failure patients. Diabetes mellitus is the leading cause of end-stage renal failure in many countries in Asia. The growth of peritoneal dialysis (PD) in Asia is significant and seeing a good trend. With the enhanced practices of PD, the quality of care in PD in Asia is also improved. Overall, PD and hemodialysis (HD) are comparable in clinical outcome. There is a global trend in the reduction of peritonitis rates and Asian countries also witness such improvement. The socio-economic benefits of PD for end-stage renal failure patients in both urban and rural areas in the developed and developing regions of Asia are an important consideration. This can help to reduce the financial burden of renal failure in addressing the growing demand of patients on dialysis. Initiatives should be considered to further drive down the cost of PD in Asia. Growing demand for dialysis by an increasing number of end-stage renal failure patients requires the use of a cost-effective quality dialysis modality. PD is found to be comparable to HD in outcome and quality. In most countries in Asia, PD should be more cost-effective than HD. A 'PD-first' or a 'PD as first considered therapy' policy can be an overall strategy in many countries in Asia in managing renal failure patients, taking the examples of Hong Kong and Thailand. (1) PD is cheaper than HD and provides a better quality of life worldwide, but its prevalence is significantly lower than that of HD in all countries, with the exception of Hong Kong. Allowing reimbursement of PD but not HD has permitted to increase the use of PD over HD in many Asian countries like Hong Kong, Vietnam, Taiwan, Thailand, as well as in New Zealand and Australia over the last years. In the Western world, however, HD is still promoted, and the proportion of patients treated with PD decreases. Japan remains an exception in Asia where PD penetration is very low. Lack of adequate education of

  5. Characterization of the Aspergillus niger prtT, a unique regulator of extracellular protease encoding genes

    NARCIS (Netherlands)

    Punt, P.J.; Schuren, F.H.J.; Lehmbeck, J.; Christensen, T.; Hjort, C.; Hondel, C.A.M.J.J. van den

    2008-01-01

    Expression of several Aspergillus niger genes encoding major secreted, but not vacuolar, protease genes including the major acid protease gene pepA, was shown to be affected in the previously isolated A. niger protease mutant, AB1.13 [Mattern, I.E., van Noort, J.M., van den Berg, P., Archer, D.A.,

  6. Cloning, sequence analysis, and characterization of the genes involved in isoprimeverose metabolism in Lactobacillus pentosus

    NARCIS (Netherlands)

    Chaillou, S.; Lokman, B.C.; Leer, R.J.; Posthuma, C.; Postma, P.W.; Pouwels, P.H.

    1998-01-01

    Two genes, xylP and xylQ, from the xylose regulon of Lactobacillus pentosus were cloned and sequenced. Together with the repressor gene of the regulon, xylR, the xylPQ genes form an operon which is inducible by xylose and which is transcribed from a promoter located 145 bp upstream of xylP. A

  7. Cloning and characterization of a mouse gene with homology to the human von Hippel-Lindau disease tumor suppressor gene: implications for the potential organization of the human von Hippel-Lindau disease gene.

    Science.gov (United States)

    Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N

    1995-02-15

    The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.

  8. CHARACTERIZATION OF THE ALKANE-INDUCIBLE CYTOCHROME P450 (P450ALK) GENE FROM THE YEAST CANDIDA TROPICALIS: IDENTIFICATION OF A NEW P450 FAMILY

    Science.gov (United States)

    The P450alk gene, which is inducible by the assimilation of alkane in Candida tropicalis, was sequenced and characterized. Structural features described in promoter and terminator regions of Saccharomyces yeast genes are present in the P450alk gene and some particular structures ...

  9. Characterization of Bombyx mori nucleopolyhedrovirus orf68 gene that encodes a novel structural protein of budded virus.

    Science.gov (United States)

    Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung

    2002-05-25

    All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).

  10. Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization.

    Science.gov (United States)

    Gcebe, Nomakorinte; Rutten, Victor; Pittius, Nicolaas Gey van; Naicker, Brendon; Michel, Anita

    2017-04-01

    Non-tuberculous mycobacteria (NTM) are ubiquitous in the environment, and an increasing number of NTM species have been isolated and characterized from both humans and animals, highlighting the zoonotic potential of these bacteria. Host exposure to NTM may impact on cross-reactive immune responsiveness, which may affect diagnosis of bovine tuberculosis and may also play a role in the variability of the efficacy of Mycobacterium bovis BCG vaccination against tuberculosis. In this study we characterized 10 NTM isolates originating from water, soil, nasal swabs of cattle and African buffalo as well as bovine tissue samples. These isolates were previously identified during an NTM survey and were all found, using 16S rRNA gene sequence analysis to be closely related to Mycobacterium moriokaense. A polyphasic approach that included phenotypic characterization, antibiotic susceptibility profiling, mycolic acid profiling and phylogenetic analysis of four gene loci, 16S rRNA, hsp65, sodA and rpoB, was employed to characterize these isolates. Sequence data analysis of the four gene loci revealed that these isolates belong to a unique species of the genus Mycobacterium. This evidence was further supported by several differences in phenotypic characteristics between the isolates and the closely related species. We propose the name Mycobacterium malmesburyense sp. nov. for this novel species. The type strain is WCM 7299T (=ATCC BAA-2759T=CIP 110822T).

  11. Characterization of the HMA7 gene and transcriptomic analysis of candidate genes for copper tolerance in two Silene vulgaris ecotypes

    Czech Academy of Sciences Publication Activity Database

    Baloun, Jiří; Nevrtalová, Eva; Kováčová, Viera; Hudzieczek, Vojtěch; Čegan, Radim; Vyskot, Boris; Hobza, Roman

    2014-01-01

    Roč. 171, č. 13 (2014), s. 1188-1196 ISSN 0176-1617 R&D Projects: GA ČR(CZ) GBP501/12/G090; GA MŠk LO1204 Institutional support: RVO:68081707 Keywords : Copper * Genes coding ROS-eliminating and Cu-transporting proteins * RNA-Seq database Subject RIV: BO - Biophysics Impact factor: 2.557, year: 2014

  12. Functional, genetic and bioinformatic characterization of a calcium/calmodulin kinase gene in Sporothrix schenckii

    Directory of Open Access Journals (Sweden)

    Rodriguez-del Valle Nuri

    2007-11-01

    Full Text Available Abstract Background Sporothrix schenckii is a pathogenic, dimorphic fungus, the etiological agent of sporotrichosis, a subcutaneous lymphatic mycosis. Dimorphism in S. schenckii responds to second messengers such as cAMP and calcium, suggesting the possible involvement of a calcium/calmodulin kinase in its regulation. In this study we describe a novel calcium/calmodulin-dependent protein kinase gene in S. schenckii, sscmk1, and the effects of inhibitors of calmodulin and calcium/calmodulin kinases on the yeast to mycelium transition and the yeast cell cycle. Results Using the PCR homology approach a new member of the calcium/calmodulin kinase family, SSCMK1, was identified in this fungus. The cDNA sequence of sscmk1 revealed an open reading frame of 1,221 nucleotides encoding a 407 amino acid protein with a predicted molecular weight of 45.6 kDa. The genomic sequence of sscmk1 revealed the same ORF interrupted by five introns. Bioinformatic analyses of SSCMK1 showed that this protein had the distinctive features that characterize a calcium/calmodulin protein kinase: a serine/threonine protein kinase domain and a calmodulin-binding domain. When compared to homologues from seven species of filamentous fungi, SSCMK1 showed substantial similarities, except for a large and highly variable region that encompasses positions 330 – 380 of the multiple sequence alignment. Inhibition studies using calmodulin inhibitor W-7, and calcium/calmodulin kinase inhibitors, KN-62 and lavendustin C, were found to inhibit budding by cells induced to re-enter the yeast cell cycle and to favor the yeast to mycelium transition. Conclusion This study constitutes the first evidence of the presence of a calcium/calmodulin kinase-encoding gene in S. schenckii and its possible involvement as an effector of dimorphism in this fungus. These results suggest that a calcium/calmodulin dependent signaling pathway could be involved in the regulation of dimorphism in this fungus

  13. Characterization of FLOWERING LOCUS T1 (FT1 gene in Brachypodium and wheat.

    Directory of Open Access Journals (Sweden)

    Bo Lv

    Full Text Available The phase transition from vegetative to reproductive growth is a critical event in the life cycle of flowering plants. FLOWERING LOCUS T (FT plays a central role in the regulation of this transition by integrating signals from multiple flowering pathways in the leaves and transmitting them to the shoot apical meristem. In this study, we characterized FT homologs in the temperate grasses Brachypodium distachyon and polyploid wheat using transgenic and mutant approaches. Downregulation of FT1 by RNAi was associated with a significant downregulation of the FT-like genes FT2 and FT4 in Brachypodium and FT2 and FT5 in wheat. In a transgenic wheat line carrying a highly-expressed FT1 allele, FT2 and FT3 were upregulated under both long and short days. Overexpression of FT1 caused extremely early flowering during shoot regeneration in both Brachypodium and hexaploid wheat, and resulted in insufficient vegetative tissue to support the production of viable seeds. Downregulation of FT1 transcripts by RNA interference (RNAi resulted in non-flowering Brachypodium plants and late flowering plants (2-4 weeks delay in wheat. A similar delay in heading time was observed in tetraploid wheat plants carrying mutations for both FT-A1 and FT-B1. Plants homozygous only for mutations in FT-B1 flowered later than plants homozygous only for mutations in FT-A1, which corresponded with higher transcript levels of FT-B1 relative to FT-A1 in the early stages of development. Taken together, our data indicate that FT1 plays a critical role in the regulation of flowering in Brachypodium and wheat, and that this role is associated with the simultaneous regulation of other FT-like genes. The differential effects of mutations in FT-A1 and FT-B1 on wheat heading time suggest that different allelic combinations of FT1 homoeologs could be used to adjust wheat heading time to improve adaptation to changing environments.

  14. Molecular characterization, sequence analysis and tissue expression of a porcine gene – MOSPD2

    Directory of Open Access Journals (Sweden)

    Yang Jie

    2017-01-01

    Full Text Available The full-length cDNA sequence of a porcine gene, MOSPD2, was amplified using the rapid amplification of cDNA ends method based on a pig expressed sequence tag sequence which was highly homologous to the coding sequence of the human MOSPD2 gene. Sequence prediction analysis revealed that the open reading frame of this gene encodes a protein of 491 amino acids that has high homology with the motile sperm domain-containing protein 2 (MOSPD2 of five species: horse (89%, human (90%, chimpanzee (89%, rhesus monkey (89% and mouse (85%; thus, it could be defined as a porcine MOSPD2 gene. This novel porcine gene was assigned GeneID: 100153601. This gene is structured in 15 exons and 14 introns as revealed by computer-assisted analysis. The phylogenetic analysis revealed that the porcine MOSPD2 gene has a closer genetic relationship with the MOSPD2 gene of horse. Tissue expression analysis indicated that the porcine MOSPD2 gene is generally and differentially expressed in the spleen, muscle, skin, kidney, lung, liver, fat and heart. Our experiment is the first to establish the primary foundation for further research on the porcine MOSPD2 gene.

  15. Characterization of PRLR and PPARGC1A genes in buffalo (Bubalus bubalis

    Directory of Open Access Journals (Sweden)

    Ruheena Javed

    2011-01-01

    Full Text Available More than 40 million households in India depend at least partially on livestock production. Buffaloes are one of the major milk producers in India. The prolactin receptor (PRLR gene and peroxisome proliferators activated receptor-γ coactivator 1-alpha (PPARGC1A gene are reportedly associated with milk protein and milk fat yields in Bos taurus. In this study, we sequenced the PRLR and PPARGC1A genes in the water buffalo Bubalus bubalis. The PRLR and PPARGC1A genes coded for 581 and 819 amino acids, respectively. The B. bubalis PRLR gene differed from the corresponding Bos taurus at 21 positions and four differences with an additional arginine at position 620 in the PPARGC1A gene were found in the amino acid sequence. All of the changes were confirmed by cDNA sequencing. Twelve buffalo-specific single nucleotide polymorphisms (SNPs were identified in both genes, with five of them being non-synonymous.

  16. Transcriptome-based identification and characterization of genes commonly responding to five different insecticides in the diamondback moth, Plutella xylostella.

    Science.gov (United States)

    Gao, Yue; Kim, Kyungmun; Kwon, Deok Ho; Jeong, In Hong; Clark, J Marshall; Lee, Si Hyeock

    2018-01-01

    When the 3rd instar larvae of the diamondback moth (DBM), Plutella xylostella, were pretreated with sublethal doses (LC 10 ) and then subsequently exposed to lethal doses (LC 50 ) of chlorantraniliprole, cypermethrin, dinotefuran, indoxacarb and spinosad via leaf dipping, their tolerance to insecticides was significantly enhanced. To identify genes that commonly respond to the treatment of different insecticides and are responsible for the tolerance enhancement, transcriptomic profiles of larvae treated with sublethal doses of the five insecticides were compared with that of untreated control. A total of 117,181 transcripts with a mean length of 662bp were generated by de novo assembly, of which 35,329 transcripts were annotated. Among them, 125, 143, 182, 215 and 149 transcripts were determined to be up-regulated whereas 67, 45, 60, 60 and 38 genes were down-regulated following treatments with chlorantraniliprole, cypermethrin, dinotefuran, indoxacarb and spinosad, respectively. Gene ontology (GO) analysis of differentially expressed genes (DEGs) revealed little differences in their GO profiles between treatments with different insecticides except for spinosad. Finally, the DEGs commonly responding to all insecticides were selected for further characterization, and some of their over-transcription levels were confirmed by quantitative PCR. The most notable examples of commonly responding over-transcribed genes were two cytochrome P450 genes (Cyp301a1 and Cyp9e2) and nine cuticular protein genes. In contrast, several genes composing the mitochondrial energy generation system were significantly down-regulated in all treated larvae. Considering the distinct structure and mode of action of the five insecticides tested, the differentially expressed genes identified in this study appear to be involved in general chemical defense at the initial stage of intoxication. Their possible roles in the tolerance/resistance development were discussed. Copyright © 2017 Elsevier

  17. Cloning, characterization and analysis of cat and ben genes from the phenol degrading halophilic bacterium Halomonas organivorans.

    Directory of Open Access Journals (Sweden)

    Maria de Lourdes Moreno

    Full Text Available BACKGROUND: Extensive use of phenolic compounds in industry has resulted in the generation of saline wastewaters that produce significant environmental contamination; however, little information is available on the degradation of phenolic compounds in saline conditions. Halomonas organivorans G-16.1 (CECT 5995(T is a moderately halophilic bacterium that we isolated in a previous work from saline environments of South Spain by enrichment for growth in different pollutants, including phenolic compounds. PCR amplification with degenerate primers revealed the presence of genes encoding ring-cleaving enzymes of the β-ketoadipate pathway for aromatic catabolism in H. organivorans. FINDINGS: The gene cluster catRBCA, involved in catechol degradation, was isolated from H. organivorans. The genes catA, catB, catC and the divergently transcribed catR code for catechol 1,2-dioxygenase (1,2-CTD, cis,cis-muconate cycloisomerase, muconolactone delta-isomerase and a LysR-type transcriptional regulator, respectively. The benzoate catabolic genes (benA and benB are located flanking the cat genes. The expression of cat and ben genes by phenol and benzoic acid was shown by RT-PCR analysis. The induction of catA gene by phenol and benzoic acid was also probed by the measurement of 1,2-CTD activity in H. organivorans growth in presence of these inducers. 16S rRNA and catA gene-based phylogenies were established among different degrading bacteria showing no phylogenetic correlation between both genes. CONCLUSIONS/SIGNIFICANCE: In this work, we isolated and determined the sequence of a gene cluster from a moderately halophilic bacterium encoding ortho-pathway genes involved in the catabolic metabolism of phenol and analyzed the gene organization, constituting the first report characterizing catabolic genes involved in the degradation of phenol in moderate halophiles, providing an ideal model system to investigate the potential use of this group of extremophiles in

  18. Asia's nuclear future

    International Nuclear Information System (INIS)

    Overholt, W.H.

    1977-01-01

    The book is a collection of seven papers by five specialists--two political scientists; a sociologist; and two specialists in the interaction between science and international affairs. They share a disregard for conventional boundaries between disciplines and for the emphasis on method over substance which have tended to fragment knowledge into ever-smaller and smaller fragments. The papers are: The Next Phase in Nuclear Proliferation Research, L.A. Dunn and W.H. Overholt; China as a Nuclear Power, J. D. Pollack; Nuclear Arms and Japan, Herbert Passin; Nuclear Proliferation in Eastern Asia, W. H. Overholt; India's Nuclear Program: Decisions, Intent, and Policy, 1950 to 1976, Onkar Marwah; India, Pakistan, Iran--A Nuclear Proliferation Chain, L. A. Dunn; and A U.S. Nuclear Posture for Asia, W. H. Overholt

  19. Identification and characterization of an autolysin-encoding gene of Streptococcus mutans.

    Science.gov (United States)

    Shibata, Yukie; Kawada, Miki; Nakano, Yoshio; Toyoshima, Kuniaki; Yamashita, Yoshihisa

    2005-06-01

    We identified a gene (atlA) encoding autolytic activity from Streptococcus mutans Xc. The AtlA protein predicted to be encoded by atlA is composed of 979 amino acids with a molecular weight of 107,279 and has a conserved beta-1,4-N-acetylmuramidase (lysozyme) domain in the C-terminal portion. Sodium dodecyl sulfate extracts of strain Xc showed two major bacteriolytic bands with molecular masses of 107 and 79 kDa, both of which were absent from a mutant with inactivated atlA. Western blot analysis revealed that the 79-kDa band was derived from the 107-kDa peptide by cleavage of its N-terminal portion. The inactivation of atlA resulted in a marked decrease in autolysis and the formation of very long chains of cells compared to the case for the parent strain. Although both the parent and mutant strains formed biofilms in the presence of sucrose, the biofilms formed by the mutant had a sponge-like architecture with large gaps and contained 30% less biomass than those formed by the parent strain. Furthermore, strain Xc formed glucose-dependent, loose biofilms in the absence of sucrose, but the mutant lost this ability. These results suggest that AtlA may play an important role in biofilm formation by S. mutans. The antibody produced against the C-terminal peptide containing the beta-1,4-N-acetylmuramidase domain drastically inhibited the autolytic activity of strain Xc. This inhibition was specific among the oral streptococci to S. mutans. These results indicate that the catalytic domain of AtlA is located at the C terminus, suggesting that further characterization of this domain may provide a means to control cariogenic dental plaque formation.

  20. Cloning, characterization and expression of a novel laccase gene Pclac2 from Phytophthora capsici

    Directory of Open Access Journals (Sweden)

    Bao Zhen Feng

    2014-01-01

    Full Text Available Laccases are blue copper oxidases (E.C. 1.10.3.2 that catalyze the one-electron oxidation of phenolics, aromatic amines, and other electron-rich substrates with the concomitant reduction of O2 to H2O. A novel laccase gene pclac2 and its corresponding full-length cDNA were cloned and characterized from Phytophthora capsici for the first time. The 1683 bp full-length cDNA of pclac2 encoded a mature laccase protein containing 560 amino acids preceded by a signal peptide of 23 amino acids. The deduced protein sequence of PCLAC2 showed high similarity with other known fungal laccases and contained four copper-binding conserved domains of typical laccase protein. In order to achieve a high level secretion and full activity expression of PCLAC2, expression vector pPIC9K with the Pichia pastoris expression system was used. The recombinant PCLAC2 protein was purified and showed on SDS-PAGE as a single band with an apparent molecular weight ca. 68 kDa. The high activity of purified PCLAC2, 84 U/mL, at the seventh day induced with methanol, was observed with 2,2'-azino-di-(3-ethylbenzothialozin-6-sulfonic acid (ABTS as substrate. The optimum pH and temperature for ABTS were 4.0 and 30 ºC, respectively . The reported data add a new piece to the knowledge about P. Capsici laccase multigene family and shed light on potential function about biotechnological and industrial applications of the individual laccase isoforms in oomycetes.

  1. Cloning and Characterization of an Endoglucanase Gene from sp. Korean Native Goat 40

    Directory of Open Access Journals (Sweden)

    Sung Chan Kim

    2016-01-01

    Full Text Available A gene from Actinomyces sp. Korean native goat (KNG 40 that encodes an endo-β-1,4-glucanase, EG1, was cloned and expressed in Escherichia coli (E. coli DH5α. Recombinant plasmid DNA from a positive clone with a 3.2 kb insert hydrolyzing carboxyl methyl-cellulose (CMC was designated as pDS3. The entire nucleotide sequence was determined, and an open-reading frame (ORF was deduced. The ORF encodes a polypeptide of 684 amino acids. The recombinant EG1 produced in E. coli DH5α harboring pDS3 was purified in one step using affinity chromatography on crystalline cellulose and characterized. Sodium dodecyl sulfate-polyacrylamide gel electrophoresis/zymogram analysis of the purified enzyme revealed two protein bands of 57.1 and 54.1 kDa. The amino terminal sequences of these two bands matched those of the deduced ones, starting from residue 166 and 208, respectively. Putative signal sequences, a Shine–Dalgarno-type ribosomal binding site, and promoter sequences related to the consensus sequences were deduced. EG1 has a typical tripartite structure of cellulase, a catalytic domain, a serine-rich linker region, and a cellulose-binding domain. The optimal temperature for the activity of the purified enzyme was 55°C, but it retained over 90% of maximum activity in a broad temperature range (40°C to 60°C. The optimal pH for the enzyme activity was 6.0. Kinetic parameters, Km and Vmax of rEG1 were 0.39% CMC and 143 U/mg, respectively.

  2. Southeast Asia Report

    Science.gov (United States)

    1984-12-14

    apparently to save ammunition, according to the BPP report . The attacks came after a battalion of Burmese troops had arrived at the border areas to...Manuel Pangilinan says. 17 It will be divided into five " strategic business units" (or SBU’s): commercial banking, which will include Hibernia and...065082 JPRS-SEA-84-173 14 December 1 984 Southeast Asia Report Reproduced From Best Available Copy 20000107 100 IIXTIC QUALITY INSPECTED 9

  3. Southern comfort in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Gray, F.

    1997-08-01

    The role of entrepreneurs in the recent success of the electric power industry in Asia is discussed. A willingness to run economic risks and skilled negotiation are identified as key factors for success in the competitive and rapidly changing market. The pioneering work of build, operate, transfer (BOT) power projects have also contributed to economic growth, as has the sale of Asian utilities to large power corporations from USA. (UK)

  4. The denuclearization of Asia

    International Nuclear Information System (INIS)

    Pyo, Mun Tae

    1987-12-01

    This book is comprised of 4 parts, which are antinuclear peace movement in Asia, the pacific of anger including A man's action moves the world and what happens in the pacific, what the cause of nuclearization is, including many reports about background and structure of nuclearization, How to fulfill the denuclearization through report such as denuclearization and demilitarization in the Philippines by Alexander Magner and Message from Longgaraf. The last reports Declaration of peace for the great pacific in the future.

  5. Growth & Governance in Asia

    Science.gov (United States)

    2004-01-01

    Project Discussion Paper no.14/2001. Institute for East Asian Studies, Gerhard Mercator Univesitat Duisburg, 2001(b); Mohamad Abu Bakar , “Islam...Dieter Evers, ed., Modernisation in Southeast Asia. Kuala Lumpur: Oxford, 1973; Muhammad Yusoff Hashim, The Malay Sultanate of Malacca. Kuala Lumpur...from the peasantry (educated in the Malay vernacular of SITC or Sultan Idris Training College) and strongly influenced by the left wing of the

  6. Expansion of the known Klebsiella pneumoniae species gene pool by characterization of novel alien DNA islands integrated into tmRNA gene sites.

    Science.gov (United States)

    Zhang, Jie; van Aartsen, Jon Jurriaan; Jiang, Xiaofei; Shao, Yucheng; Tai, Cui; He, Xinyi; Tan, Zhilei; Deng, Zixin; Jia, Shiru; Rajakumar, Kumar; Ou, Hong-Yu

    2011-02-01

    Klebsiella pneumoniae is an important bacterial pathogen of man that is commonly associated with opportunistic and hospital-associated infections. Increasing levels of multiple-antibiotic resistance associated with this species pose a major emerging clinical problem. This organism also occurs naturally in other diverse environments, including the soil. Consistent with its varied lifestyle and membership of the Enterobacteriaceae family, K. pneumoniae genomes exhibit highly plastic architecture comprising a core genome backbone interspersed with numerous and varied alien genomic islands. In this study the size of the presently known K. pneumoniae pan-genome gene pool was estimated through analysis of complete sequences of three chromosomes and 31 plasmids belonging to K. pneumoniae strains. In addition, using a PCR-based strategy the genomic content of eight tRNA/tmRNA gene sites that serve as DNA insertion hotspots were investigated in 28 diverse environmental and clinical strains of K. pneumoniae. Sequencing and characterization of five newly identified horizontally-acquired tmRNA-associated islands further expanded the archived K. pneumoniae gene pool to a total of 7648 unique gene members. Large-scale investigation of the content of tRNA/tmRNA hotspots will be useful to identify and/or survey accessory sequences dispersed amongst hundreds to thousands of members of many key bacterial species. Copyright © 2010 Elsevier B.V. All rights reserved.

  7. Isolation and characterization of NBS-LRR- resistance gene candidates in turmeric (Curcuma longa cv. surama).

    Science.gov (United States)

    Joshi, R K; Mohanty, S; Subudhi, E; Nayak, S

    2010-09-08

    Turmeric (Curcuma longa), an important asexually reproducing spice crop of the family Zingiberaceae is highly susceptible to bacterial and fungal pathogens. The identification of resistance gene analogs holds great promise for development of resistant turmeric cultivars. Degenerate primers designed based on known resistance genes (R-genes) were used in combinations to elucidate resistance gene analogs from Curcuma longa cultivar surama. The three primers resulted in amplicons with expected sizes of 450-600 bp. The nucleotide sequence of these amplicons was obtained through sequencing; their predicted amino acid sequences compared to each other and to the amino acid sequences of known R-genes revealed significant sequence similarity. The finding of conserved domains, viz., kinase-1a, kinase-2 and hydrophobic motif, provided evidence that the sequences belong to the NBS-LRR class gene family. The presence of tryptophan as the last residue of kinase-2 motif further qualified them to be in the non-TIR-NBS-LRR subfamily of resistance genes. A cluster analysis based on the neighbor-joining method was carried out using Curcuma NBS analogs together with several resistance gene analogs and known R-genes, which classified them into two distinct subclasses, corresponding to clades N3 and N4 of non-TIR-NBS sequences described in plants. The NBS analogs that we isolated can be used as guidelines to eventually isolate numerous R-genes in turmeric.

  8. Asia Gas Study

    International Nuclear Information System (INIS)

    1996-01-01

    The Asia region has experienced a period of dynamic growth, both of economies and energy demand. The next fifteen years are likely to see further rapid economic growth in Asia. To fuel this growth energy consumption will also increase rapidly. Of all forms of energy, natural gas demand is likely to grow the fastest. The gas sector will face rapid and dramatic change, creating challenges for the governments of the region. Infrastructure, both for export and domestic consumption of gas, will need to expand significantly. Regional trade in natural gas could triple by 2010. Trade will continue to be dominated by liquefied natural gas (LNG) but pipeline exports will also grow rapidly. Investment needs will be large, putting pressure on governments to look for alternative funding mechanisms. As Asian gas transmission and distribution networks expand and become more interconnected, consumer choice becomes possible. How to encourage and regulate competition will become a vital policy question. As gas consumption increases both in absolute terms, and in terms of its share of energy consumption within particular sectors of the economy (for example, as a fuel for power generation), governments will need to give higher priority to policies dealing with gas security. This study examines the current and possible future role of natural gas in Asia. In particular, it examines in detail the relevant energy policies of six of the key gas producing and consuming economies in the region: Brunei-Darussalam, Chinese Taipei, Indonesia, the Republic of Korea, Malaysia and Thailand. (author). 17 figs., 14 tabs., 7 appends

  9. Allergic conjunctivitis in Asia.

    Science.gov (United States)

    Thong, Bernard Yu-Hor

    2017-04-01

    Allergic conjunctivitis (AC), which may be acute or chronic, is associated with rhinitis in 30%-70% of affected individuals, hence the term allergic rhinoconjunctivitis (AR/C). Seasonal and perennial AC is generally milder than the more chronic and persistent atopic and vernal keratoconjunctivitis. Natural allergens like house dust mites (HDM), temperate and subtropical grass and tree pollen are important triggers that drive allergic inflammation in AC in the Asia-Pacific region. Climate change, environmental tobacco smoke, pollutants derived from fuel combustion, Asian dust storms originating from central/north Asia and phthalates may also exacerbate AR/C. The Allergies in Asia Pacific study and International Study of Asthma and Allergies in Childhood provide epidemiological data on regional differences in AR/C within the region. AC significantly impacts the quality of life of both children and adults, and these can be measured by validated quality of life questionnaires on AR/C. Management guidelines for AC involve a stepped approach depending on the severity of disease, similar to that for allergic rhinitis and asthma. Topical calcineurin inhibitors are effective in certain types of persistent AC, and sublingual immunotherapy is emerging as an effective treatment option in AR/C to grass pollen and HDM. Translational research predominantly from Japan and Korea involving animal models are important for the potential development of targeted pharmacotherapies for AC.

  10. Genome-wide evolutionary characterization and expression analyses of major latex protein (MLP) family genes in Vitis vinifera.

    Science.gov (United States)

    Zhang, Ningbo; Li, Ruimin; Shen, Wei; Jiao, Shuzhen; Zhang, Junxiang; Xu, Weirong

    2018-04-27

    The major latex protein/ripening-related protein (MLP/RRP) subfamily is known to be involved in a wide range of biological processes of plant development and various stress responses. However, the biological function of MLP/RRP proteins is still far from being clear and identification of them may provide important clues for understanding their roles. Here, we report a genome-wide evolutionary characterization and gene expression analysis of the MLP family in European Vitis species. A total of 14 members, was found in the grape genome, all of which are located on chromosome 1, where are predominantly arranged in tandem clusters. We have noticed, most surprisingly, promoter-sharing by several non-identical but highly similar gene members to a greater extent than expected by chance. Synteny analysis between the grape and Arabidopsis thaliana genomes suggested that 3 grape MLP genes arose before the divergence of the two species. Phylogenetic analysis provided further insights into the evolutionary relationship between the genes, as well as their putative functions, and tissue-specific expression analysis suggested distinct biological roles for different members. Our expression data suggested a couple of candidate genes involved in abiotic stresses and phytohormone responses. The present work provides new insight into the evolution and regulation of Vitis MLP genes, which represent targets for future studies and inclusion in tolerance-related molecular breeding programs.

  11. Characterization of the duodenase-1 gene and its associations with resistance to Streptococuus agalactiae in hybrid tilapia (Oreochromis spp.).

    Science.gov (United States)

    Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua

    2015-08-01

    Tilapia is a group of cultured teleost fishes whose production is threatened by some diseases. Identification of DNA markers associated with disease resistance in candidate genes may facilitate to accelerate the selection of disease resistance. The gene encoding a duodenase, which can trigger immune response, has not been studied in fish. We characterized the cDNA of duodenase-1 gene of hybrid tilapia. Its ORF is 759 bp, encoding a serine protease of 252 amino acids. This gene consisted of five exons and four introns. Its expression was detected in all 10 tissues examined, and it was highly expressed in the intestine and kidney. After a challenge with the bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the intestine, liver and spleen. We identified seven SNPs in the gene and found that four of them were significantly associated with the resistance to S. agalactiae (P tilapia. The SNP markers in the duodenase-1 gene associated with resistance to the bacterial pathogen, may facilitate the selection of tilapia resistant to the bacterial disease. Copyright © 2015 Elsevier Ltd. All rights reserved.

  12. [Cloning and characterization of genes differentially expressed in human dental pulp cells and gingival fibroblasts].

    Science.gov (United States)

    Wang, Zhong-dong; Wu, Ji-nan; Zhou, Lin; Ling, Jun-qi; Guo, Xi-min; Xiao, Ming-zhen; Zhu, Feng; Pu, Qin; Chai, Yu-bo; Zhao, Zhong-liang

    2007-02-01

    To study the biological properties of human dental pulp cells (HDPC) by cloning and analysis of genes differentially expressed in HDPC in comparison with human gingival fibroblasts (HGF). HDPC and HGF were cultured and identified by immunocytochemistry. HPDC and HGF subtractive cDNA library was established by PCR-based modified subtractive hybridization, genes differentially expressed by HPDC were cloned, sequenced and compared to find homogeneous sequence in GenBank by BLAST. Cloning and sequencing analysis indicate 12 genes differentially expressed were obtained, in which two were unknown genes. Among the 10 known genes, 4 were related to signal transduction, 2 were related to trans-membrane transportation (both cell membrane and nuclear membrane), and 2 were related to RNA splicing mechanisms. The biological properties of HPDC are determined by the differential expression of some genes and the growth and differentiation of HPDC are associated to the dynamic protein synthesis and secretion activities of the cell.

  13. Gene

    Data.gov (United States)

    U.S. Department of Health & Human Services — Gene integrates information from a wide range of species. A record may include nomenclature, Reference Sequences (RefSeqs), maps, pathways, variations, phenotypes,...

  14. Purification and characterization of the d-xylose isomerase gene from Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Ho, N W.Y.; Rosenfeld, S; Stevis, P; Tsao, G T

    1983-11-01

    A DNA fragment containing both the Escherichia coli D-xylose isomerase (D-xylose ketol-isomerase, EC 5.3.1.5) gene and the D-xylulokinase (ATP: D-xylulose 5-phosphotransferase, EC 2.7.1.17) gene has been cloned on an E. coli plasmid. The D-xylose isomerase gene was separated from the D-xylulokinase gene by the construction of a new deletion plasmid, pLX7. The D-xylose isomerase gene cloned on pLX7 was found still to be an intact gene. The precise location of the D-xylose isomerase gene on the plasmid pLX7 was further determined by the construction of two more plasmids, pLX8 and pLX9. This is believed to be the first D-xylose isomerase gene that has been isolated and extensively purified from any organism. D-Xylose isomerase, the enzyme product of the D-xylose isomerase gene, is responsible for the conversion of D-xylose to D-xylulose, as well as D-glucose to D-fructose. It is widely believed that yeast cannot ferment D-xylose to ethanol primarily because of the lack of D-xylose isomerase in yeast. D-Xylose isomerase (also known as D-glucose isomerase) is also used for the commercial production of high-fructose syrups. The purification of the D-xylose isomerase gene may lead to the following industrial applications: (1) cloning and expression of the gene in yeast to make the latter organism capable of directly fermenting D-xylose to ethanol, and (2) cloning of the gene on a high-copy-number plasmid in a proper host to overproduce the enzyme, which should have a profound impact on the high-fructose syrup technology. 14 references.

  15. Characterization of the serine acetyltransferase gene family of Vitis vinifera uncovers differences in regulation of OAS synthesis in woody plants

    OpenAIRE

    Tavares, Sílvia; Wirtz, Markus; Beier, Marcel P.; Bogs, Jochen; Hell, Rüdiger; Amâncio, Sara

    2015-01-01

    In higher plants cysteine biosynthesis is catalyzed by O-acetylserine(thiol)lyase (OASTL) and represents the last step of the assimilatory sulfate reduction pathway. It is mainly regulated by provision of O-acetylserine (OAS), the nitrogen/carbon containing backbone for fixation of reduced sulfur. OAS is synthesized by Serine acetyltransferase (SERAT), which reversibly interacts with OASTL in the cysteine synthase complex (CSC). In this study we identify and characterize the SERAT gene family...

  16. Characterization of a Canine Tetranucleotide Microsatellite Marker Located in the First Intron of the Tumor Necrosis Factor Alpha Gene

    OpenAIRE

    WATANABE, Masashi; TANAKA, Kazuaki; TAKIZAWA, Tatsuya; SEGAWA, Kazuhito; NEO, Sakurako; TSUCHIYA, Ryo; MURATA, Michiko; MURAKAMI, Masaru; HISASUE, Masaharu

    2013-01-01

    ABSTRACT A polymorphic tetranucleotide (GAAT)n microsatellite in the first intron of the canine tumor necrosis factor alpha (TNFA) gene was characterized in this study; 139 dogs were analyzed: 22 Beagles, 26 Chihuahuas, 20 Miniature Dachshunds, 24 Miniature Poodles, 22 Pembroke Welsh Corgis and 25 Shiba Inus. We detected the presence of the 4 alleles (GAAT)5, (GAAT)6, (GAAT)7 and (GAAT)8, including 9 of the 10 expected genotypes. The expected heterozygosity (He) and the polymorphic informatio...

  17. Genome-wide identification and characterization of WRKY gene family in peanut

    Directory of Open Access Journals (Sweden)

    Hui eSong

    2016-04-01

    Full Text Available WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA and jasmonic acid (JA treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  18. Genome-Wide Identification and Characterization of WRKY Gene Family in Peanut.

    Science.gov (United States)

    Song, Hui; Wang, Pengfei; Lin, Jer-Young; Zhao, Chuanzhi; Bi, Yuping; Wang, Xingjun

    2016-01-01

    WRKY, an important transcription factor family, is widely distributed in the plant kingdom. Many reports focused on analysis of phylogenetic relationship and biological function of WRKY protein at the whole genome level in different plant species. However, little is known about WRKY proteins in the genome of Arachis species and their response to salicylic acid (SA) and jasmonic acid (JA) treatment. In this study, we identified 77 and 75 WRKY proteins from the two wild ancestral diploid genomes of cultivated tetraploid peanut, Arachis duranensis and Arachis ipaënsis, using bioinformatics approaches. Most peanut WRKY coding genes were located on A. duranensis chromosome A6 and A. ipaënsis chromosome B3, while the least number of WRKY genes was found in chromosome 9. The WRKY orthologous gene pairs in A. duranensis and A. ipaënsis chromosomes were highly syntenic. Our analysis indicated that segmental duplication events played a major role in AdWRKY and AiWRKY genes, and strong purifying selection was observed in gene duplication pairs. Furthermore, we translate the knowledge gained from the genome-wide analysis result of wild ancestral peanut to cultivated peanut to reveal that gene activities of specific cultivated peanut WRKY gene were changed due to SA and JA treatment. Peanut WRKY7, 8 and 13 genes were down-regulated, whereas WRKY1 and 12 genes were up-regulated with SA and JA treatment. These results could provide valuable information for peanut improvement.

  19. Identification and characterization of the human type II collagen gene (COL2A1).

    OpenAIRE

    Cheah, Kathryn; Stoker, N.G.; Griffin, J.R.; Grosveld, Frank; Solomon, E.

    1985-01-01

    textabstractThe gene contained in the human cosmid clone CosHcol1, previously designated an alpha 1(I) collagen-like gene, has now been identified. CosHcol1 hybridizes strongly to a single 5.9-kilobase mRNA species present only in tissue in which type II collagen is expressed. DNA sequence analysis shows that this clone is highly homologous to the chicken alpha 1(II) collagen gene. These data together suggest that CosHcol1 contains the human alpha 1(II) collagen gene COL2A1. The clone appears...

  20. Molecular characterization of genes encoding leucoanthocyanidin reductase involved in proanthocyanidin biosynthesis in apple

    Directory of Open Access Journals (Sweden)

    Yuepeng eHan

    2015-04-01

    Full Text Available Proanthocyanidins (PAs are the major component of phenolics in apple, but mechanisms involved in PA biosynthesis remain unclear. Here, the relationship between the PA biosynthesis and the expression of genes encoding leucoanthocyanidin reductase (LAR and anthocyanidin reductase (ANR was investigated in fruit skin of one apple cultivar and three crabapples. Transcript levels of LAR1 and ANR2 genes were significantly correlated with the contents of catechin and epicatechin, respectively, which suggests their active roles in PA synthesis. Surprisingly, transcript levels for both LAR1 and LAR2 genes were almost undetectable in two crabapples that accumulated both flavan-3-ols and PAs. This contradicts the previous finding that LAR1 gene is a strong candidate regulating the accumulation of metabolites such as epicatechin and PAs in apple. Ectopic expression of apple MdLAR1 gene in tobacco suppresses expression of the late genes in anthocyanin biosynthetic pathway, resulting in loss of anthocyanin in flowers. Interestingly, a decrease in PA biosynthesis was also observed in flowers of transgenic tobacco plants overexpressing the MdLAR1 gene, which could be attributed to decreased expression of both the NtANR1 and NtANR2 genes. Our study not only confirms the in vivo function of apple LAR1 gene, but it is also helpful for understanding the mechanism of PA biosynthesis.

  1. Characterization and phylogenetic analysis of lectin gene cDNA isolated from sea cucumber ( Apostichopus japonicus) body wall

    Science.gov (United States)

    Xue, Zhuang; Li, Hui; Liu, Yang; Zhou, Wei; Sun, Jing; Wang, Xiuli

    2017-12-01

    As a `living fossil' of species origin and `rich treasure' of food and nutrition development, sea cucumber has received a lot of attentions from researchers. The cDNA library construction and EST sequencing of blood had been conducted previously in our lab. The bioinformatic analysis provided a gene fragment which is highly homologous with the genes of lectin family, named AjL ( Apostichopus japonicus lectin). To characterize and determine the phylogeny of AjL genes in early evolution, we isolated a full-length cDNA of lectin gene from the body wall of A. japonicus. The open reading frame of this gene contained 489 bp and encoded a 163 amino acids secretory protein being homologous to lectins of mammals and aquatic organisms. The deduced protein included a lectin-like domain. SDS-PAGE analysis showed that AjL migrated as a specific band (about 36.09 kDa under reducing), and agglutinated against rabbit red blood cells. AjL was similar to chain A of CEL-IV in space structure. We predicted that AjL may play the same role of CEL-IV. Our results suggested that more than one lectin gene functioned in sea cucumber and most of other species, which was fused by uncertain sequences during the evolution and encoded different proteins with diverse functions. Our findings provided the insights into the function and characteristics of lectin genes invertebrates. The results will also be helpful for the identification and structural, functional, and evolutionary analyses of lectin genes.

  2. Molecular characterization of tocopherol biosynthetic genes in sweetpotato that respond to stress and activate the tocopherol production in tobacco.

    Science.gov (United States)

    Ji, Chang Yoon; Kim, Yun-Hee; Kim, Ho Soo; Ke, Qingbo; Kim, Gun-Woo; Park, Sung-Chul; Lee, Haeng-Soon; Jeong, Jae Cheol; Kwak, Sang-Soo

    2016-09-01

    Tocopherol (vitamin E) is a chloroplast lipid that is presumed to be involved in the plant response to oxidative stress. In this study, we isolated and characterized five tocopherol biosynthetic genes from sweetpotato (Ipomoea batatas [L.] Lam) plants, including genes encoding 4-hydroxyphenylpyruvate dioxygenase (IbHPPD), homogentisate phytyltransferase (IbHPT), 2-methyl-6-phytylbenzoquinol methyltransferase (IbMPBQ MT), tocopherol cyclase (IbTC) and γ-tocopherol methyltransferase (IbTMT). Fluorescence microscope analysis indicated that four proteins localized into the chloroplast, whereas IbHPPD observed in the nuclear. Quantitative RT-PCR analysis revealed that the expression patterns of the five tocopherol biosynthetic genes varied in different plant tissues and under different stress conditions. All five genes were highly expressed in leaf tissues, whereas IbHPPD and IbHPT were highly expressed in the thick roots. The expression patterns of these five genes significantly differed in response to PEG, NaCl and H2O2-mediated oxidative stress. IbHPPD was strongly induced following PEG and H2O2 treatment and IbHPT was strongly induced following PEG treatment, whereas IbMPBQ MT and IbTC were highly expressed following NaCl treatment. Upon infection of the bacterial pathogen Pectobacterium chrysanthemi, the expression of IbHPPD increased sharply in sweetpotato leaves, whereas the expression of the other genes was reduced or unchanged. Additionally, transient expression of the five tocopherol biosynthetic genes in tobacco (Nicotiana bentamiana) leaves resulted in increased transcript levels of the transgenes expressions and tocopherol production. Therefore, our results suggested that the five tocopherol biosynthetic genes of sweetpotato play roles in the stress defense response as transcriptional regulators of the tocopherol production. Copyright © 2016 Elsevier Masson SAS. All rights reserved.

  3. Characterization of a Nonclassical Class I MHC Gene in a Reptile, the Galápagos Marine Iguana (Amblyrhynchus cristatus)

    Science.gov (United States)

    Glaberman, Scott; Du Pasquier, Louis; Caccone, Adalgisa

    2008-01-01

    Squamates are a diverse order of vertebrates, representing more than 7,000 species. Yet, descriptions of full-length major histocompatibility complex (MHC) genes in this group are nearly absent from the literature, while the number of MHC studies continues to rise in other vertebrate taxa. The lack of basic information about MHC organization in squamates inhibits investigation into the relationship between MHC polymorphism and disease, and leaves a large taxonomic gap in our understanding of amniote MHC evolution. Here, we use both cDNA and genomic sequence data to characterize a class I MHC gene (Amcr-UA) from the Galápagos marine iguana, a member of the squamate subfamily Iguaninae. Amcr-UA appears to be functional since it is expressed in the blood and contains many of the conserved peptide-binding residues that are found in classical class I genes of other vertebrates. In addition, comparison of Amcr-UA to homologous sequences from other iguanine species shows that the antigen-binding portion of this gene is under purifying selection, rather than balancing selection, and therefore may have a conserved function. A striking feature of Amcr-UA is that both the cDNA and genomic sequences lack the transmembrane and cytoplasmic domains that are necessary to anchor the class I receptor molecule into the cell membrane, suggesting that the product of this gene is secreted and consequently not involved in classical class I antigen-presentation. The truncated and conserved character of Amcr-UA lead us to define it as a nonclassical gene that is related to the few available squamate class I sequences. However, phylogenetic analysis placed Amcr-UA in a basal position relative to other published classical MHC genes from squamates, suggesting that this gene diverged near the beginning of squamate diversification. PMID:18682845

  4. Use of homologous and heterologous gene expression profiling tools to characterize transcription dynamics during apple fruit maturation and ripening

    Directory of Open Access Journals (Sweden)

    Sansavini Silviero

    2010-10-01

    Full Text Available Abstract Background Fruit development, maturation and ripening consists of a complex series of biochemical and physiological changes that in climacteric fruits, including apple and tomato, are coordinated by the gaseous hormone ethylene. These changes lead to final fruit quality and understanding of the functional machinery underlying these processes is of both biological and practical importance. To date many reports have been made on the analysis of gene expression in apple. In this study we focused our investigation on the role of ethylene during apple maturation, specifically comparing transcriptomics of normal ripening with changes resulting from application of the hormone receptor competitor 1-Methylcyclopropene. Results To gain insight into the molecular process regulating ripening in apple, and to compare to tomato (model species for ripening studies, we utilized both homologous and heterologous (tomato microarray to profile transcriptome dynamics of genes involved in fruit development and ripening, emphasizing those which are ethylene regulated. The use of both types of microarrays facilitated transcriptome comparison between apple and tomato (for the later using data previously published and available at the TED: tomato expression database and highlighted genes conserved during ripening of both species, which in turn represent a foundation for further comparative genomic studies. The cross-species analysis had the secondary aim of examining the efficiency of heterologous (specifically tomato microarray hybridization for candidate gene identification as related to the ripening process. The resulting transcriptomics data revealed coordinated gene expression during fruit ripening of a subset of ripening-related and ethylene responsive genes, further facilitating the analysis of ethylene response during fruit maturation and ripening. Conclusion Our combined strategy based on microarray hybridization enabled transcriptome characterization

  5. Use of homologous and heterologous gene expression profiling tools to characterize transcription dynamics during apple fruit maturation and ripening.

    Science.gov (United States)

    Costa, Fabrizio; Alba, Rob; Schouten, Henk; Soglio, Valeria; Gianfranceschi, Luca; Serra, Sara; Musacchi, Stefano; Sansavini, Silviero; Costa, Guglielmo; Fei, Zhangjun; Giovannoni, James

    2010-10-25

    Fruit development, maturation and ripening consists of a complex series of biochemical and physiological changes that in climacteric fruits, including apple and tomato, are coordinated by the gaseous hormone ethylene. These changes lead to final fruit quality and understanding of the functional machinery underlying these processes is of both biological and practical importance. To date many reports have been made on the analysis of gene expression in apple. In this study we focused our investigation on the role of ethylene during apple maturation, specifically comparing transcriptomics of normal ripening with changes resulting from application of the hormone receptor competitor 1-methylcyclopropene. To gain insight into the molecular process regulating ripening in apple, and to compare to tomato (model species for ripening studies), we utilized both homologous and heterologous (tomato) microarray to profile transcriptome dynamics of genes involved in fruit development and ripening, emphasizing those which are ethylene regulated.The use of both types of microarrays facilitated transcriptome comparison between apple and tomato (for the later using data previously published and available at the TED: tomato expression database) and highlighted genes conserved during ripening of both species, which in turn represent a foundation for further comparative genomic studies. The cross-species analysis had the secondary aim of examining the efficiency of heterologous (specifically tomato) microarray hybridization for candidate gene identification as related to the ripening process. The resulting transcriptomics data revealed coordinated gene expression during fruit ripening of a subset of ripening-related and ethylene responsive genes, further facilitating the analysis of ethylene response during fruit maturation and ripening. Our combined strategy based on microarray hybridization enabled transcriptome characterization during normal climacteric apple ripening, as well as

  6. Characterization of a nonclassical class I MHC gene in a reptile, the Galápagos marine iguana (Amblyrhynchus cristatus.

    Directory of Open Access Journals (Sweden)

    Scott Glaberman

    Full Text Available Squamates are a diverse order of vertebrates, representing more than 7,000 species. Yet, descriptions of full-length major histocompatibility complex (MHC genes in this group are nearly absent from the literature, while the number of MHC studies continues to rise in other vertebrate taxa. The lack of basic information about MHC organization in squamates inhibits investigation into the relationship between MHC polymorphism and disease, and leaves a large taxonomic gap in our understanding of amniote MHC evolution. Here, we use both cDNA and genomic sequence data to characterize a class I MHC gene (Amcr-UA from the Galápagos marine iguana, a member of the squamate subfamily Iguaninae. Amcr-UA appears to be functional since it is expressed in the blood and contains many of the conserved peptide-binding residues that are found in classical class I genes of other vertebrates. In addition, comparison of Amcr-UA to homologous sequences from other iguanine species shows that the antigen-binding portion of this gene is under purifying selection, rather than balancing selection, and therefore may have a conserved function. A striking feature of Amcr-UA is that both the cDNA and genomic sequences lack the transmembrane and cytoplasmic domains that are necessary to anchor the class I receptor molecule into the cell membrane, suggesting that the product of this gene is secreted and consequently not involved in classical class I antigen-presentation. The truncated and conserved character of Amcr-UA lead us to define it as a nonclassical gene that is related to the few available squamate class I sequences. However, phylogenetic analysis placed Amcr-UA in a basal position relative to other published classical MHC genes from squamates, suggesting that this gene diverged near the beginning of squamate diversification.

  7. Enterobacteriaceae resistant to third-generation cephalosporins and quinolones in fresh culinary herbs imported from Southeast Asia.

    Science.gov (United States)

    Veldman, Kees; Kant, Arie; Dierikx, Cindy; van Essen-Zandbergen, Alieda; Wit, Ben; Mevius, Dik

    2014-05-02

    Since multidrug resistant bacteria are frequently reported from Southeast Asia, our study focused on the occurrence of ESBL-producing Enterobacteriaceae in fresh imported herbs from Thailand, Vietnam and Malaysia. Samples were collected from fresh culinary herbs imported from Southeast Asia in which ESBL-suspected isolates were obtained by selective culturing. Analysis included identification by MALDI-TOF mass spectrometry, susceptibility testing, XbaI-PFGE, microarray, PCR and sequencing of specific ESBL genes, PCR based replicon typing (PBRT) of plasmids and Southern blot hybridization. In addition, the quinolone resistance genotype was characterized by screening for plasmid mediated quinolone resistance (PMQR) genes and mutations in the quinolone resistance determining region (QRDR) of gyrA and parC. The study encompassed fifty samples of ten batches of culinary herbs (5 samples per batch) comprising nine different herb variants. The herbs originated from Thailand (Water morning glory, Acacia and Betel leaf), Vietnam (Parsley, Asian pennywort, Houttuynia leaf and Mint) and Malaysia (Holy basil and Parsley). By selective culturing 21 cefotaxime resistant Enterobacteriaceae were retrieved. Array analysis revealed 18 isolates with ESBL genes and one isolate with solely non-ESBL beta-lactamase genes. Mutations in the ampC promoter region were determined in two isolates with PCR and sequencing. The isolates were identified as Klebsiella pneumoniae (n=9), Escherichia coli (n=6), Enterobacter cloacae complex (n=5) and Enterobacter spp. (n=1). All isolates tested were multidrug resistant. Variants of CTX-M enzymes were predominantly found followed by SHV enzymes. PMQR genes (including aac(6')-1b-cr, qnrB and qnrS) were also frequently detected. In almost all cases ESBL and quinolone resistance genes were located on the same plasmid. Imported fresh culinary herbs from Southeast Asia are a potential source for contamination of food with multidrug resistant bacteria

  8. Characterization of the omlA gene from different serotypes of Actinobacillus pleuropneumoniae: a new insight into an old approach

    Directory of Open Access Journals (Sweden)

    Ciro César Rossi

    2013-01-01

    Full Text Available The OmlA protein is a virulence factor of Actinobacillus pleuropneumoniae, an important pathogen in pigs. The polymorphisms present in the omlA gene sequence of 15 reference serotypes of A. pleuropneumoniae and non-serotypable isolates were assessed to determine the possible evolutionary relationship among them and to validate the importance of this gene as a molecular marker for the characterization of this bacterium. Divergence among the 15 serotypes of A. pleuropneumoniae probably resulted initially from two major evolutionary events that led to subsequent differentiation into nine groups. This differentiation makes it possible to characterize most of the serotypes by using bionformatics, thereby avoiding problems with immunological cross-reactivity. A conserved α-helix common to all the serotypes was most likely involved in connecting the protein to the outer membrane and acting as a signal peptide. A previously unknown gene duplication was also identified and could contribute to the genetic variability that makes it difficult to serotype some isolates. Our data support the importance of the omlA gene in the biology of A. pleuropneumoniae and provide a new area of research into the OmlA protein.

  9. In silico and in situ characterization of the zebrafish (Danio rerio gnrh3 (sGnRH gene

    Directory of Open Access Journals (Sweden)

    Husebye Harald

    2002-08-01

    Full Text Available Abstract Background Gonadotropin releasing hormone (GnRH is responsible for stimulation of gonadotropic hormone (GtH in the hypothalamus-pituitary-gonadal axis (HPG. The regulatory mechanisms responsible for brain specificity make the promoter attractive for in silico analysis and reporter gene studies in zebrafish (Danio rerio. Results We have characterized a zebrafish [Trp7, Leu8] or salmon (s GnRH variant, gnrh3. The gene includes a 1.6 Kb upstream regulatory region and displays the conserved structure of 4 exons and 3 introns, as seen in other species. An in silico defined enhancer at -976 in the zebrafish promoter, containing adjacent binding sites for Oct-1, CREB and Sp1, was predicted in 2 mammalian and 5 teleost GnRH promoters. Reporter gene studies confirmed the importance of this enhancer for cell specific expression in zebrafish. Interestingly the promoter of human GnRH-I, known as mammalian GnRH (mGnRH, was shown capable of driving cell specific reporter gene expression in transgenic zebrafish. Conclusions The characterized zebrafish Gnrh3 decapeptide exhibits complete homology to the Atlantic salmon (Salmo salar GnRH-III variant. In silico analysis of mammalian and teleost GnRH promoters revealed a conserved enhancer possessing binding sites for Oct-1, CREB and Sp1. Transgenic and transient reporter gene expression in zebrafish larvae, confirmed the importance of the in silico defined zebrafish enhancer at -976. The capability of the human GnRH-I promoter of directing cell specific reporter gene expression in zebrafish supports orthology between GnRH-I and GnRH-III.

  10. A compendium and functional characterization of mammalian genes involved in adaptation to Arctic or Antarctic environments.

    Science.gov (United States)

    Yudin, Nikolay S; Larkin, Denis M; Ignatieva, Elena V

    2017-12-28

    Many mammals are well adapted to surviving in extremely cold environments. These species have likely accumulated genetic changes that help them efficiently cope with low temperatures. It is not known whether the same genes related to cold adaptation in one species would be under selection in another species. The aims of this study therefore were: to create a compendium of mammalian genes related to adaptations to a low temperature environment; to identify genes related to cold tolerance that have been subjected to independent positive selection in several species; to determine promising candidate genes/pathways/organs for further empirical research on cold adaptation in mammals. After a search for publications containing keywords: "whole genome", "transcriptome or exome sequencing data", and "genome-wide genotyping array data" authors looked for information related to genetic signatures ascribable to positive selection in Arctic or Antarctic mammalian species. Publications related to Human, Arctic fox, Yakut horse, Mammoth, Polar bear, and Minke whale were chosen. The compendium of genes that potentially underwent positive selection in >1 of these six species consisted of 416 genes. Twelve of them showed traces of positive selection in three species. Gene ontology term enrichment analysis of 416 genes from the compendium has revealed 13 terms relevant to the scope of this study. We found that enriched terms were relevant to three major groups: terms associated with collagen proteins and the extracellular matrix; terms associated with the anatomy and physiology of cilium; terms associated with docking. We further revealed that genes from compendium were over-represented in the lists of genes expressed in the lung and liver. A compendium combining mammalian genes involved in adaptation to cold environment was designed, based on the intersection of positively selected genes from six Arctic and Antarctic species. The compendium contained 416 genes that have been

  11. Characterization of chemically induced liver injuries using gene co-expression modules.

    Directory of Open Access Journals (Sweden)

    Gregory J Tawa

    Full Text Available Liver injuries due to ingestion or exposure to chemicals and industrial toxicants pose a serious health risk that may be hard to assess due to a lack of non-invasive diagnostic tests. Mapping chemical injuries to organ-specific damage and clinical outcomes via biomarkers or biomarker panels will provide the foundation for highly specific and robust diagnostic tests. Here, we have used DrugMatrix, a toxicogenomics database containing organ-specific gene expression data matched to dose-dependent chemical exposures and adverse clinical pathology assessments in Sprague Dawley rats, to identify groups of co-expressed genes (modules specific to injury endpoints in the liver. We identified 78 such gene co-expression modules associated with 25 diverse injury endpoints categorized from clinical pathology, organ weight changes, and histopathology. Using gene expression data associated with an injury condition, we showed that these modules exhibited different patterns of activation characteristic of each injury. We further showed that specific module genes mapped to 1 known biochemical pathways associated with liver injuries and 2 clinically used diagnostic tests for liver fibrosis. As such, the gene modules have characteristics of both generalized and specific toxic response pathways. Using these results, we proposed three gene signature sets characteristic of liver fibrosis, steatosis, and general liver injury based on genes from the co-expression modules. Out of all 92 identified genes, 18 (20% genes have well-documented relationships with liver disease, whereas the rest are novel and have not previously been associated with liver disease. In conclusion, identifying gene co-expression modules associated with chemically induced liver injuries aids in generating testable hypotheses and has the potential to identify putative biomarkers of adverse health effects.

  12. Genomic Survey, Characterization, and Expression Profile Analysis of the SBP Genes in Pineapple (Ananas comosus L.).

    Science.gov (United States)

    Ali, Hina; Liu, Yanhui; Azam, Syed Muhammad; Rahman, Zia Ur; Priyadarshani, S V G N; Li, Weimin; Huang, Xinyu; Hu, Bingyan; Xiong, Junjie; Ali, Umair; Qin, Yuan

    2017-01-01

    Gene expression is regulated by transcription factors, which play many significant developmental processes. SQUAMOSA promoter-binding proteins (SBP) perform a variety of regulatory functions in leaf, flower, and fruit development, plant architecture, and sporogenesis. 16 SBP genes were identified in pineapple and were divided into four groups on basis of phylogenetic analysis. Five paralogs in pineapple for SBP genes were identified with Ka/Ks ratio varied from 0.20 for AcSBP14 and AcSBP15 to 0.36 for AcSBP6 and AcSBP16 , respectively. 16 SBP genes were located on 12 chromosomes out of 25 pineapple chromosomes with highly conserved protein sequence structures. The isoionic points of SBP ranged from 6.05 to 9.57, while molecular weight varied from 22.7 to 121.9 kD. Expression profiles of SBP genes revealed that AcSBP7 and AcSBP15 (leaf), AcSBP13 , AcSBP12 , AcSBP8 , AcSBP16 , AcSBP9 , and AcSBP11 (sepal), AcSBP6 , AcSBP4 , and AcSBP10 (stamen), AcSBP14 , AcSBP1 , and AcSBP5 (fruit) while the rest of genes showed low expression in studied tissues. Four genes, that is, AcSBP11 , AcSBP6 , AcSBP4 , and AcSBP12 , were highly expressed at 4°C, while AcSBP16 were upregulated at 45°C. RNA-Seq was validated through qRT-PCR for some genes. Salt stress-induced expression of two genes, that is, AcSBP7 and AcSBP14 , while in drought stress, AcSBP12 and AcSBP15 were highly expressed. Our study lays a foundation for further gene function and expression studies of SBP genes in pineapple.

  13. Characterization of the rec-1 gene of Haemophilus influenzae and behavior of the gene in Escherichia coli

    Energy Technology Data Exchange (ETDEWEB)

    Setlow, J.K.; Spikes, D.; Griffin, K.

    1988-09-01

    The rec-1 gene of Haemophilus influenzae was cloned into a shuttle vector that replicates in Escherichia coli as well as in H. influenzae. The plasmid, called pRec1, complemented the defects of a rec-1 mutant in repair of UV damage, transformation, and ability of prophage to be induced by UV radiation. Although UV resistance and recombination were caused by pRec1 in E. coli recA mutants, UV induction of lambda and UV mutagenesis were not. We suggest that the ability of the H. influenzae Rec-1 protein to cause cleavage of repressors but not the recombinase function differs from that of the E. coli RecA protein.

  14. Characterization of the rec-1 gene of Haemophilus influenzae and behavior of the gene in Escherichia coli

    International Nuclear Information System (INIS)

    Setlow, J.K.; Spikes, D.; Griffin, K.

    1988-01-01

    The rec-1 gene of Haemophilus influenzae was cloned into a shuttle vector that replicates in Escherichia coli as well as in H. influenzae. The plasmid, called pRec1, complemented the defects of a rec-1 mutant in repair of UV damage, transformation, and ability of prophage to be induced by UV radiation. Although UV resistance and recombination were caused by pRec1 in E. coli recA mutants, UV induction of lambda and UV mutagenesis were not. We suggest that the ability of the H. influenzae Rec-1 protein to cause cleavage of repressors but not the recombinase function differs from that of the E. coli RecA protein

  15. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human.

    Science.gov (United States)

    Wu, Shuyu; Dalsgaard, Anders; Hammerum, Anette M; Porsbo, Lone J; Jensen, Lars B

    2010-07-30

    Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3) in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans) were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc) groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%), while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively). Multireplicons were found associated with all three sul genes. Sul genes were distributed widely in E. coli isolated

  16. Prevalence and characterization of plasmids carrying sulfonamide resistance genes among Escherichia coli from pigs, pig carcasses and human

    Directory of Open Access Journals (Sweden)

    Hammerum Anette M

    2010-07-01

    Full Text Available Abstract Background Sulfonamide resistance is very common in Escherichia coli. The aim of this study was to characterize plasmids carrying sulfonamide resistance genes (sul1, sul2 and sul3 in E. coli isolated from pigs and humans with a specific objective to assess the genetic diversity of plasmids involved in the mobility of sul genes. Methods A total of 501 E. coli isolates from pig feces, pig carcasses and human stools were tested for their susceptibility to selected antimicrobial. Multiplex PCR was conducted to detect the presence of three sul genes among the sulfonamide-resistant E. coli isolates. Fifty-seven sulfonamide-resistant E. coli were selected based on presence of sul resistance genes and subjected to conjugation and/or transformation experiments. S1 nuclease digestion followed by pulsed-field gel electrophoresis was used to visualize and determine the size of plasmids. Plasmids carrying sul genes were characterized by PCR-based replicon typing to allow a comparison of the types of sul genes, the reservoir and plasmid present. Results A total of 109/501 isolates exhibited sulfonamide resistance. The relative prevalences of sul genes from the three reservoirs (pigs, pig carcasses and humans were 65%, 45% and 12% for sul2, sul1, and sul3, respectively. Transfer of resistance through conjugation was observed in 42/57 isolates. Resistances to streptomycin, ampicillin and trimethoprim were co-transferred in most strains. Class 1 integrons were present in 80% of sul1-carrying plasmids and 100% of sul3-carrying plasmids, but only in 5% of sul2-carrying plasmids. The sul plasmids ranged from 33 to 160-kb in size and belonged to nine different incompatibility (Inc groups: FII, FIB, I1, FIA, B/O, FIC, N, HI1 and X1. IncFII was the dominant type in sul2-carrying plasmids (52%, while IncI1 was the most common type in sul1 and sul3-carrying plasmids (33% and 45%, respectively. Multireplicons were found associated with all three sul genes

  17. Characterization and Sequencing of MT-Cox1 Gene in Khorasan ...

    African Journals Online (AJOL)

    The aim of this study was to investigate the nucleotide sequence of COX1 gene in mitochondrial genome of Khorasan native chicken and detect the possible mutations in the genome. For this purpose, after sampling and extracting DNA from the whole blood samples, the COX1 gene was amplified using specific primers and ...

  18. Characterization of Conserved and Non-conserved Imprinted Genes in Swine

    Science.gov (United States)

    In order to increase our understanding of the role of imprinted genes in swine reproduction we used two complementary approaches, analysis of imprinting by pyrosequencing, and expression profiling of parthenogenetic fetuses, to carry out a comprehensive analysis of this gene family in swine. Using A...

  19. The evolutionary history of bears is characterized by gene flow across species

    Science.gov (United States)

    Kumar, Vikas; Lammers, Fritjof; Bidon, Tobias; Pfenninger, Markus; Kolter, Lydia; Nilsson, Maria A.; Janke, Axel

    2017-01-01

    Bears are iconic mammals with a complex evolutionary history. Natural bear hybrids and studies of few nuclear genes indicate that gene flow among bears may be more common than expected and not limited to polar and brown bears. Here we present a genome analysis of the bear family with representatives of all living species. Phylogenomic analyses of 869 mega base pairs divided into 18,621 genome fragments yielded a well-resolved coalescent species tree despite signals for extensive gene flow across species. However, genome analyses using different statistical methods show that gene flow is not limited to closely related species pairs. Strong ancestral gene flow between the Asiatic black bear and the ancestor to polar, brown and American black bear explains uncertainties in reconstructing the bear phylogeny. Gene flow across the bear clade may be mediated by intermediate species such as the geographically wide-spread brown bears leading to large amounts of phylogenetic conflict. Genome-scale analyses lead to a more complete understanding of complex evolutionary processes. Evidence for extensive inter-specific gene flow, found also in other animal species, necessitates shifting the attention from speciation processes achieving genome-wide reproductive isolation to the selective processes that maintain species divergence in the face of gene flow. PMID:28422140

  20. Genome-wide evolutionary characterization and expression analyses of WRKY family genes in Brachypodium distachyon.

    Science.gov (United States)

    Wen, Feng; Zhu, Hong; Li, Peng; Jiang, Min; Mao, Wenqing; Ong, Chermaine; Chu, Zhaoqing

    2014-06-01

    Members of plant WRKY gene family are ancient transcription factors that function in plant growth and development and respond to biotic and abiotic stresses. In our present study, we have investigated WRKY family genes in Brachypodium distachyon, a new model plant of family Poaceae. We identified a total of 86 WRKY genes from B. distachyon and explored their chromosomal distribution and evolution, domain alignment, promoter cis-elements, and expression profiles. Combining the analysis of phylogenetic tree of BdWRKY genes and the result of expression profiling, results showed that most of clustered gene pairs had higher similarities in the WRKY domain, suggesting that they might be functionally redundant. Neighbour-joining analysis of 301 WRKY domains from Oryza sativa, Arabidopsis thaliana, and B. distachyon suggested that BdWRKY domains are evolutionarily more closely related to O. sativa WRKY domains than those of A. thaliana. Moreover, tissue-specific expression profile of BdWRKY genes and their responses to phytohormones and several biotic or abiotic stresses were analysed by quantitative real-time PCR. The results showed that the expression of BdWRKY genes was rapidly regulated by stresses and phytohormones, and there was a strong correlation between promoter cis-elements and the phytohormones-induced BdWRKY gene expression. © The Author 2014. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.

  1. The evolutionary history of bears is characterized by gene flow across species.

    Science.gov (United States)

    Kumar, Vikas; Lammers, Fritjof; Bidon, Tobias; Pfenninger, Markus; Kolter, Lydia; Nilsson, Maria A; Janke, Axel

    2017-04-19

    Bears are iconic mammals with a complex evolutionary history. Natural bear hybrids and studies of few nuclear genes indicate that gene flow among bears may be more common than expected and not limited to polar and brown bears. Here we present a genome analysis of the bear family with representatives of all living species. Phylogenomic analyses of 869 mega base pairs divided into 18,621 genome fragments yielded a well-resolved coalescent species tree despite signals for extensive gene flow across species. However, genome analyses using different statistical methods show that gene flow is not limited to closely related species pairs. Strong ancestral gene flow between the Asiatic black bear and the ancestor to polar, brown and American black bear explains uncertainties in reconstructing the bear phylogeny. Gene flow across the bear clade may be mediated by intermediate species such as the geographically wide-spread brown bears leading to large amounts of phylogenetic conflict. Genome-scale analyses lead to a more complete understanding of complex evolutionary processes. Evidence for extensive inter-specific gene flow, found also in other animal species, necessitates shifting the attention from speciation processes achieving genome-wide reproductive isolation to the selective processes that maintain species divergence in the face of gene flow.

  2. Identification and characterization of the human type II collagen gene (COL2A1).

    NARCIS (Netherlands)

    K.S.E. Cheah (Kathryn); N.G. Stoker; J.R. Griffin; F.G. Grosveld (Frank); E. Solomon

    1985-01-01

    textabstractThe gene contained in the human cosmid clone CosHcol1, previously designated an alpha 1(I) collagen-like gene, has now been identified. CosHcol1 hybridizes strongly to a single 5.9-kilobase mRNA species present only in tissue in which type II collagen is expressed. DNA sequence analysis

  3. Isolation and characterization of the genomic region from Drosophila kuntzei containing the Adh and Adhr genes

    NARCIS (Netherlands)

    Oppentocht, JE; van Delden, W; van de Zande, L

    The nucleotide sequences of the Adh and Adhr genes of Drosophila kuntzei were derived from combined overlapping sequences of clones isolated from a genomic library and from cloned PCR and inverse-PCR fragments. Only a proximal promoter was detected upstream of the Adh gene, indicating that D.

  4. Cloning, Characterization, Controlled Overexpression, and Inactivation of the Major Tributyrin Esterase Gene of Lactococcus lactis

    NARCIS (Netherlands)

    Fernández, Leonides; Beerthuyzen, Marke M.; Brown, Julie; Siezen, Roland J.; Coolbear, Tim; Holland, Ross; Kuipers, Oscar P.

    2000-01-01

    The gene encoding the major intracellular tributyrin esterase of Lactococcus lactis was cloned using degenerate DNA probes based on 19 known N-terminal amino acid residues of the purified enzyme. The gene, named estA, was sequenced and found to encode a protein of 258 amino acid residues. The

  5. Characterization and functional analysis of Calmodulin and Calmodulin-like genes in Fragaria vesca

    Directory of Open Access Journals (Sweden)

    Kai Zhang

    2016-12-01

    Full Text Available Calcium is a universal messenger that is involved in the modulation of diverse developmental and adaptive processes in response to various stimuli. Calmodulin (CaM and calmodulin-like (CML proteins are major calcium sensors in all eukaryotes, and they have been extensively investigated for many years in plants and animals. However, little is known about CaMs and CMLs in woodland strawberry (Fragaria vesca. In this study, we performed a genome-wide analysis of the strawberry genome and identified 4 CaM and 36 CML genes. Bioinformatics analyses, including gene structure, phylogenetic tree, synteny and three-dimensional model assessments, revealed the conservation and divergence of FvCaMs and FvCMLs, thus providing insight regarding their functions. In addition, the transcript abundance of four FvCaM genes and the four most related FvCML genes were examined in different tissues and in response to multiple stress and hormone treatments. Moreover, we investigated the subcellular localization of several FvCaMs and FvCMLs, revealing their potential interactions based on the localizations and potential functions. Furthermore, overexpression of five FvCaM and FvCML genes could not induce a hypersensitive response, but four of the five genes could increase resistance to Agrobacterium tumefaciens in Nicotiana benthamiana leaves. This study provides evidence for the biological roles of FvCaM and CML genes, and the results lay the foundation for future functional studies of these genes.

  6. Characterization of the psoRPM1 gene for resistance to root-knot ...

    African Journals Online (AJOL)

    Several root-knot nematode (Meloidogyne spp.) resistance genes have been discovered in different stone fruit crops. However, none of them has yet been cloned and they were only located on the chromosomes. In this study, a candidate root-knot nematode resistance gene (designated as psoRPM1) was isolated from the ...

  7. Map-based Cloning and Characterization of a Brown Planthopper Resistance Gene BPH26 from Oryza sativa L. ssp. indica Cultivar ADR52

    OpenAIRE

    Tamura, Yasumori; Hattori, Makoto; Yoshioka, Hirofumi; Yoshioka, Miki; Takahashi, Akira; Wu, Jianzhong; Sentoku, Naoki; Yasui, Hideshi

    2014-01-01

    The brown planthopper (BPH) is the most serious insect pest of rice in Asia. The indica rice cultivar ADR52 carries two BPH resistance genes, BPH26 (BROWN PLANTHOPPER RESISTANCE 26) and BPH25. Map-based cloning of BPH26 revealed that BPH26 encodes a coiled-coil-nucleotide-binding-site?leucine-rich repeat (CC?NBS?LRR) protein. BPH26 mediated sucking inhibition in the phloem sieve element. BPH26 was identical to BPH2 on the basis of DNA sequence analysis and feeding ability of the BPH2-virulent...

  8. Identification and characterization of a novel gene differentially expressed in zebrafish cross-subfamily cloned embryos

    Directory of Open Access Journals (Sweden)

    Wang Ya-Ping

    2008-03-01

    Full Text Available Abstract Background Cross-species nuclear transfer has been shown to be a potent approach to retain the genetic viability of a certain species near extinction. However, most embryos produced by cross-species nuclear transfer were compromised because that they were unable to develop to later stages. Gene expression analysis of cross-species cloned embryos will yield new insights into the regulatory mechanisms involved in cross-species nuclear transfer and embryonic development. Results A novel gene, K31, was identified as an up-regulated gene in fish cross-subfamily cloned embryos using SSH approach and RACE method. K31 complete cDNA sequence is 1106 base pairs (bp in length, with a 342 bp open reading frame (ORF encoding a putative protein of 113 amino acids (aa. Comparative analysis revealed no homologous known gene in zebrafish and other species database. K31 protein contains a putative transmembrane helix and five putative phosphorylation sites but without a signal peptide. Expression pattern analysis by real time RT-PCR and whole-mount in situ hybridization (WISH shows that it has the characteristics of constitutively expressed gene. Sub-cellular localization assay shows that K31 protein can not penetrate the nuclei. Interestingly, over-expression of K31 gene can cause lethality in the epithelioma papulosum cyprinid (EPC cells in cell culture, which gave hint to the inefficient reprogramming events occurred in cloned embryos. Conclusion Taken together, our findings indicated that K31 gene is a novel gene differentially expressed in fish cross-subfamily cloned embryos and over-expression of K31 gene can cause lethality of cultured fish cells. To our knowledge, this is the first report on the determination of novel genes involved in nucleo-cytoplasmic interaction of fish cross-subfamily cloned embryos.

  9. Molecular cloning and functional characterization of the anthocyanidin reductase gene from Vitis bellula.

    Science.gov (United States)

    Zhu, Yue; Peng, Qing-Zhong; Li, Ke-Gang; Xie, De-Yu

    2014-08-01

    Anthocyanidin reductase (ANR) is an NADPH-/NADH-dependent enzyme that transfers two hydrides to anthocyanidins to produce three types of isomeric flavan-3-ols. This reductase forms the ANR pathway toward the biosynthesis of proanthocyanidins (PAs, which are also called condensed tannins). Here, we report cloning and functional characterization of an ANR (called VbANR) homolog from the leaves of Vitis bellula, a newly developed grape crop in southern China. The open reading frame (ORF) of VbANR is 1,017 bp in length and encodes 339 amino acids. A phylogenetic analysis and an alignment using 17 sequences revealed that VbANR is approximately 99.9 % identical to the ANR homolog from Vitis vinifera. The VbANR ORF is fused to the Trx gene containing a His-tag in the pET32a(+) vector to obtain a pET32a(+)-VbANR construct for expressing the recombinant VbANR. In vitro enzyme assays show that VbANR converts cyanidin, delphinidin, and pelargonidin to their corresponding flavan-3-ols. Enzymatic products include 2S,3R-trans- and 2R,3R-cis-flavan-3-ols isomers, such as (-)-catechin and (-)-epicatechin. In addition, the third compound that is observed from the enzymatic products is most likely a 2S,3S-cis-flavan-3-ol. To analyze the kinetics and optimize pH and temperature values, a UV spectrometry method was developed to quantify the concentrations of total enzymatic products. The optimum pH and temperature values are 4.0 and 40 °C, respectively. The K m , K cat, V max, and K cat/K m values for pelargonidin and delphinidin were similar. In comparison, VbANR exhibits a slightly lower affinity to cyanidin. VbANR uses both NADPH and NADH but prefers to employ NADPH. GFP fusion and confocal microscopy analyses revealed the cytosolic localization of VbANR. The overexpression of VbANR in ban mutants reconstructed the biosynthetic pathway of PAs in the seed coat. These data demonstrate that VbANR forms the ANR pathway, leading to the formation of three types of isomeric flavan-3-ols

  10. Cloning and functional characterization of the DA2 receptor gene in Chinese mitten crab (Eriocheir sinensis)

    Science.gov (United States)

    Xu, Min-jie; Zhang, Cong; Yang, Zhigang

    2018-01-01

    Dopamine (DA) plays a modulatory role in numerous physiological processes such as light adaptation and food intake, and exerts these functions through DA receptors (DARs). This study presents, for the first time, isolation and characterization of the dopamine receptor 2(DA2 receptor) cDNA from the intestinal tissue of Eriocheir sinensis, an economically important freshwater aquaculture species in China. The DA2 receptor cDNA sequence, which was obtained by rapid amplification of cDNA ends, is 2369bp long, encode peptide of 589 amino acid, and is highly homologous to related sequences in crustaceans. Analysis of the deduced amino acid sequence and the structure of the DA2 indicated that this receptor is a member of the family of G protein-coupled receptors (GPCRs), as it contains seven transmembrane domains and other common signatures of GPCRs. RT-PCR showed that the expression of the DA2 receptor gene was distributed in various tissues, and high expression levels were observed in the cranial ganglia and the thoracic ganglia. Further study of the effect of photoperiod on DA2 expression showed that constant darkness induced a significant increase in DA2 expression in the cranial ganglia. Finally, analysis of DA2 receptor expression under different feeding statuses showed that there was significantly greater expression in the hepatopancreas and intestines after feeding than before feeding, but there were no differences in expression between the before feeding and during feeding periods in either tissue. Our results indicate that the DA2 receptor structurally belongs to the family of G protein-coupled receptors, and that the cranial ganglia are the main tissues in which the DA2 receptor participates in light adaptation during dark hours. In addition, the DA2 receptor in E. sinensis may be involved in the physiological regulation of the hepatopancreas and digestive tract after the ingestion of food. This study provides a foundation for further exploration of the light

  11. Characterization of vitellogenin gene expression in round goby (Neogobius melanostomus) using a quantitative polymerase chain reaction assay.

    Science.gov (United States)

    Bowley, Lucas A; Alam, Farhana; Marentette, Julie R; Balshine, Sigal; Wilson, Joanna Y

    2010-12-01

    A growing concern over endocrine disruption in aquatic species has prompted the development of molecular assays to monitor environmental impacts. This study describes the development of quantitative polymerase chain reaction (qPCR) assays to characterize the expression of two vitellogenin (Vtg) genes in the invasive round goby (Neogobius melanostomus). Fragments from the 18SrRNA (housekeeping gene), Vtg II, and Vtg III genes were cloned and sequenced. The qPCR assays were developed to detect hepatic Vtg expression in goby. The assays detected induction of both Vtg genes in nonreproductive males following a two-week laboratory exposure to 17β-estradiol (≥1 mg/kg i.p. injection). The assays were applied to goby from Hamilton Harbour, Lake Ontario (Canada), including those from sites where feminization and intersex of goby has been documented. Both Vtg genes had significantly higher expression in females compared to males. Male reproductive goby adopt either parental or sneaker tactics; Vtg II expression was higher in sneaker than in parental males but parental and nonreproductive males did not differ from each other. The Vtg III expression was significantly higher in sneaker males followed by parental males and nonreproductive males, respectively. The Vtg II and III expression in nonreproductive males was elevated in the contaminated site with documented intersex. This assay provides an important tool for the use of an invasive species in monitoring endocrine disruption in the Great Lakes region. Copyright © 2010 SETAC.

  12. Leveraging Comparative Genomics to Identify and Functionally Characterize Genes Associated with Sperm Phenotypes in Python bivittatus (Burmese Python

    Directory of Open Access Journals (Sweden)

    Kristopher J. L. Irizarry

    2016-01-01

    Full Text Available Comparative genomics approaches provide a means of leveraging functional genomics information from a highly annotated model organism’s genome (such as the mouse genome in order to make physiological inferences about the role of genes and proteins in a less characterized organism’s genome (such as the Burmese python. We employed a comparative genomics approach to produce the functional annotation of Python bivittatus genes encoding proteins associated with sperm phenotypes. We identify 129 gene-phenotype relationships in the python which are implicated in 10 specific sperm phenotypes. Results obtained through our systematic analysis identified subsets of python genes exhibiting associations with gene ontology annotation terms. Functional annotation data was represented in a semantic scatter plot. Together, these newly annotated Python bivittatus genome resources provide a high resolution framework from which the biology relating to reptile spermatogenesis, fertility, and reproduction can be further investigated. Applications of our research include (1 production of genetic diagnostics for assessing fertility in domestic and wild reptiles; (2 enhanced assisted reproduction technology for endangered and captive reptiles; and (3 novel molecular targets for biotechnology-based approaches aimed at reducing fertility and reproduction of invasive reptiles. Additional enhancements to reptile genomic resources will further enhance their value.

  13. Growth arrest specific gene 2 in tilapia (Oreochromis niloticus): molecular characterization and functional analysis under low-temperature stress.

    Science.gov (United States)

    Yang, ChangGeng; Wu, Fan; Lu, Xing; Jiang, Ming; Liu, Wei; Yu, Lijuan; Tian, Juan; Wen, Hua

    2017-07-17

    Growth arrest specific 2 (gas2) gene is a component of the microfilament system that plays a major role in the cell cycle, regulation of microfilaments, and cell morphology during apoptotic processes. However, little information is available on fish gas2. In this study, the tilapia (Oreochromis niloticus) gas2 gene was cloned and characterized for the first time. The open reading frame was 1020 bp, encoding 340 amino acids; the 5'-untranslated region (UTR) was 140 bp and the 3'-UTR was 70 bp, with a poly (A) tail. The highest promoter activity occurred in the regulatory region (-3000 to -2400 bp). The Gas2-GFP fusion protein was distributed within the cytoplasm. Quantitative reverse transcription-polymerase chain reaction and western blot analyses revealed that gas2 gene expression levels in the liver, muscle, and brain were clearly affected by low temperature stress. The results of gas2 RNAi showed decreased expression of the gas2 and P53 genes. These results suggest that the tilapia gas2 gene may be involved in low temperature stress-induced apoptosis.

  14. Characterization of D-myo-inositol 3-phosphate synthase gene expression in two soybean low phytate mutants

    International Nuclear Information System (INIS)

    Yuan Fengjie; Dong Dekun; Li Baiquan; Yu Xiaomin; Fu Xujun; Zhu Danhua; Zhu Shenlong; Yang Qinghua

    2013-01-01

    1D-myo-inositol 3-phosphate synthase (MIPS) gene plays a significant role in phytic acid biosynthesis. In this study, we used two low phytic acid mutants Gm-lpa-TW-1, Gm-lpa-ZC-2 and their respective wild type parents Taiwan75 and Zhechun No.3 to analyze the expression pattern and characterization of MIPS1 gene. The results showed that there was a common expression pattern of MIPS1 in soybean developing seeds. Expression was weak as detected by RT-PCR in initial stage, increased in the following stages, and the peak expression was appeared in 22 day after flowering (DAF). The expression of MIPS1 gene of non-seed tissues in mutant Gm-lpa-TW-1 and its wildtype Taiwan75 was very weak. In the developing seeds, the MIPS1 expression by qRT-PCR revealed a significant reduction in 22 DAF in mutant Gm-lpa-TW-1 as compared with the wildtype. Similarly, the expression of MIPS1 gene in non-seed tissue of Zhenchun No.3 and Gm-lpa-ZC-2 was very weak. However, stronger expression in developing seeds of the mutant Gm-lpa-ZC-2 than Zhechun No.3 was found. We concluded that the MIPS1 gene expression in the developing seed exhibited an up-regulation pattern in mutant Gm-lpa-ZC-2, but a down-regulation pattern in the mutant Gm-lpa-TW-1. (authors)

  15. Genetic and evolutionary characterization of RABVs from China using the phosphoprotein gene.

    Science.gov (United States)

    Wang, Lihua; Wu, Hui; Tao, Xiaoyan; Li, Hao; Rayner, Simon; Liang, Guodong; Tang, Qing

    2013-01-07

    While the function of the phosphoprotein (P) gene of the rabies virus (RABV) has been well studied in laboratory adapted RABVs, the genetic diversity and evolution characteristics of the P gene of street RABVs remain unclear. The objective of the present study was to investigate the mutation and evolution of P genes in Chinese street RABVs. The P gene of 77 RABVs from brain samples of dogs and wild animals collected in eight Chinese provinces through 2003 to 2008 were sequenced. The open reading frame (ORF) of the P genes was 894 nucleotides (nt) in length, with 85-99% (80-89%) amino acid (nucleotide) identity compared with the laboratory RABVs and vaccine strains. Phylogenetic analysis based on the P gene revealed that Chinese RABVs strains could be divided into two distinct clades, and several RABV variants were found to co circulating in the same province. Two conserved (CD1, 2) and two variable (VD1, 2) domains were identified by comparing the deduced primary sequences of the encoded P proteins. Two sequence motifs, one believed to confer binding to the cytoplasmic dynein light chain LC8 and a lysine-rich sequence were conserved throughout the Chinese RABVs. In contrast, the isolates exhibited lower conservation of one phosphate acceptor and one internal translation initiation site identified in the P protein of the rabies challenge virus standard (CVS) strain. Bayesian coalescent analysis showed that the P gene in Chinese RABVs have a substitution rate (3.305x10(-4) substitutions per site per year) and evolution history (592 years ago) similar to values for the glycoprotein (G) and nucleoprotein (N) reported previously. Several substitutions were found in the P gene of Chinese RABVs strains compared to the laboratory adapted and vaccine strains, whether these variations could affect the biological characteristics of Chinese RABVs need to be further investigated. The substitution rate and evolution history of P gene is similar to G and N gene, combine the

  16. Molecular Cloning and Sequencing of AlkalophilicCellulosimicrobium cellulans CKMX1 Xylanase Gene Isolated from Mushroom Compost and Characterization of the Gene Product

    Directory of Open Access Journals (Sweden)

    Abhishek Walia

    2015-12-01

    Full Text Available ABSTRACT A xylanolytic bacterium was isolated from mushroom compost by using enrichment technique. Results from the metabolic fingerprinting, whole-cell fatty acids methyl ester analysis and 16S rDNA sequencing suggested the bacterium to be Cellulosimicrobium cellulans CKMX1. Due to the xylanolytic activity of this bacterium, isolation and characterization of the xylanase gene were attempted. A distinct fragment of about 1671 bp was successfully amplified using PCR and cloned into Escherichia coli DH5α. A BLAST search confirmed that the DNA sequence from the amplified fragment was endo-1, 4-beta-xylanase, which was a member of glycoside hydrolase family 11. It showed 98% homology withCellulosimicrobium sp. xylanase gene (Accession no. FJ859907.1 reported from the gut of Eisenia fetida in Korea. In silicophysico-chemical characterization of amino acid sequence of xylanase showed an open reading frame encoding a 556 amino acid sequence with a molecular weight of 58 kDa and theoretical isolectric point (pI of 4.46 was computed using Expasy's ProtParam server. Secondary and homology based 3D structure of xylanase was analysed using SOPMA and Swiss-Prot software.

  17. Sphingolipid base modifying enzymes in sunflower (Helianthus annuus): cloning and characterization of a C4-hydroxylase gene and a new paralogous Δ8-desaturase gene.

    Science.gov (United States)

    Moreno-Pérez, Antonio J; Martínez-Force, Enrique; Garcés, Rafael; Salas, Joaquín J

    2011-05-15

    Sphingolipids are components of plant cell membranes that participate in the regulation of important physiological processes. Unlike their animal counterparts, plant sphingolipids are characterized by high levels of base C4-hydroxylation. Moreover, desaturation at the Δ8 position predominates over the Δ4 desaturation typically found in animal sphingolipids. These modifications are due to the action of C4-hydroxylases and Δ8-long chain base desaturases, and they are important for complex sphingolipids finally becoming functional. The long chain bases of sunflower sphingolipids have high levels of hydroxylated and unsaturated moieties. Here, a C4-long chain base hydroxylase was functionally characterized in sunflower plant, an enzyme that could complement the sur2Δ mutation when heterologously expressed in this yeast mutant deficient in hydroxylation. This hydroxylase was ubiquitously expressed in sunflower, with the highest levels found in the developing cotyledons. In addition, we identified a new Δ8-long base chain desaturase gene that displays strong homology to a previously reported desaturase gene. This desaturase was also expressed in yeast and was able to change the long chain base composition of the transformed host. We studied the expression of this desaturase and compared it with that of the other isoform described in sunflower. The desaturase form studied in this paper displayed higher expression levels in developing seeds. Copyright © 2010 Elsevier GmbH. All rights reserved.

  18. Characterization of porcine cytokine inducible SH2-containing protein gene and its association with piglet diarrhea traits

    Directory of Open Access Journals (Sweden)

    Buyue Niu

    2017-12-01

    Full Text Available Objective The cytokine inducible SH2-containing protein (CISH, which might play a role in porcine intestine immune responses, was one of the promising candidate genes for piglet anti-disease traits. An experiment was conducted to characterize the porcine CISH (pCISH gene and to evaluate its genetic effects on pig anti-disease breeding. Methods Both reverse transcription polymerase chain reaction (RT-PCR and PCR were performed to obtain the sequence of pCISH gene. A pEGFP-C1-CISH vector was constructed and transfected into PK-15 cells to analysis the distribution of pCISH. The sequences of individuals were compared with each other to find the polymorphisms in pCISH gene. The association analysis was performed in Min pigs and Landrace pigs to evaluate the genetic effects on piglet diarrhea traits. Results In the present research, the coding sequence and genomic sequence of pCISH gene was obtained. Porcine CISH was mainly localized in cytoplasm. TaqI and HaeIII PCR restriction fragment length polymorphism (RFLP assays were established to detect single nucleotide polymorphisms (SNPs; A-1575G in promoter region and A2497C in Intron1, respectively. Association studies indicated that SNP A-1575G was significantly associated with diarrhea index of Min piglets (p<0.05 and SNP A2497C was significantly associated with the diarrhea trait of both Min pig and Landrace piglets (p<0.05. Conclusion This study suggested that the pCISH gene might be a novel candidate gene for pig anti-disease traits, and further studies are needed to confirm the results of this preliminary research.

  19. Characterization of porcine cytokine inducible SH2-containing protein gene and its association with piglet diarrhea traits.

    Science.gov (United States)

    Niu, Buyue; Guo, Dongchun; Liu, Zhiran; Han, Xiaofei; Wang, Xibiao

    2017-12-01

    The cytokine inducible SH2-containing protein (CISH), which might play a role in porcine intestine immune responses, was one of the promising candidate genes for piglet anti-disease traits. An experiment was conducted to characterize the porcine CISH (pCISH) gene and to evaluate its genetic effects on pig anti-disease breeding. Both reverse transcription polymerase chain reaction (RT-PCR) and PCR were performed to obtain the sequence of pCISH gene. A pEGFP-C1-CISH vector was constructed and transfected into PK-15 cells to analysis the distribution of pCISH. The sequences of individuals were compared with each other to find the polymorphisms in pCISH gene. The association analysis was performed in Min pigs and Landrace pigs to evaluate the genetic effects on piglet diarrhea traits. In the present research, the coding sequence and genomic sequence of pCISH gene was obtained. Porcine CISH was mainly localized in cytoplasm. TaqI and HaeIII PCR restriction fragment length polymorphism (RFLP) assays were established to detect single nucleotide polymorphisms (SNPs); A-1575G in promoter region and A2497C in Intron1, respectively. Association studies indicated that SNP A-1575G was significantly associated with diarrhea index of Min piglets (p<0.05) and SNP A2497C was significantly associated with the diarrhea trait of both Min pig and Landrace piglets (p<0.05). This study suggested that the pCISH gene might be a novel candidate gene for pig anti-disease traits, and further studies are needed to confirm the results of this preliminary research.

  20. Molecular characterization of a human G20P[28] rotavirus a strain with multiple genes related to bat rotaviruses.

    Science.gov (United States)

    Esona, Mathew D; Roy, Sunando; Rungsrisuriyachai, Kunchala; Gautam, Rashi; Hermelijn, Sandra; Rey-Benito, Gloria; Bowen, Michael D

    2018-01-01

    Group A rotaviruses are the major cause of severe gastroenteritis in the young of mammals and birds. This report describes characterization of an unusual G20P[28] rotavirus strain detected in a 24month old child from Suriname. Genomic sequence analyses revealed that the genotype constellation of the Suriname strain RVA/Human-wt/SUR/2014735512/2013/G20P[28] was G20-P[28]-I13-R13-C13-M12-A23-N13-T15-E20-H15. Genes VP1, VP2, VP3, NSP1, NSP2, NSP3, NSP4 and NSP5 were recently assigned novel genotypes by the Rotavirus Classification Working Group (RCWG). Three of the 11 gene segments (VP7, VP4, VP6) were similar to cognate gene sequences of bat-like human rotavirus strain Ecu534 from Ecuador and the VP7, NSP3 and NSP5 gene segments of strain RVA/Human-wt/SUR/2014735512/2013/G20P[28] were found to be closely related to gene sequences of bat rotavirus strain 3081/BRA detected in Brazil. Although distantly related, the VP1 gene of the study strain and bat strain BatLi09 detected in Cameroon in 2014 are monophyletic. The NSP1 gene was found to be most closely related to human strain QUI-35-F5 from Brazil. These findings suggest that strain RVA/Human-wt/SUR/2014735512/2013/G20P[28] represents a zoonotic infection from a bat host. Published by Elsevier B.V.

  1. Molecular characterization of 5S ribosomal RNA genes and transcripts in the protozoan parasite Leishmania major.

    Science.gov (United States)

    Moreno-Campos, Rodrigo; Florencio-Martínez, Luis E; Nepomuceno-Mejía, Tomás; Rojas-Sánchez, Saúl; Vélez-Ramírez, Daniel E; Padilla-Mejía, Norma E; Figueroa-Angulo, Elisa; Manning-Cela, Rebeca; Martínez-Calvillo, Santiago

    2016-12-01

    Eukaryotic 5S rRNA, synthesized by RNA polymerase III (Pol III), is an essential component of the large ribosomal subunit. Most organisms contain hundreds of 5S rRNA genes organized into tandem arrays. However, the genome of the protozoan parasite Leishmania major contains only 11 copies of the 5S rRNA gene, which are interspersed and associated with other Pol III-transcribed genes. Here we report that, in general, the number and order of the 5S rRNA genes is conserved between different species of Leishmania. While in most organisms 5S rRNA genes are normally associated with the nucleolus, combined fluorescent in situ hybridization and indirect immunofluorescence experiments showed that 5S rRNA genes are mainly located at the nuclear periphery in L. major. Similarly, the tandemly repeated 5S rRNA genes in Trypanosoma cruzi are dispersed throughout the nucleus. In contrast, 5S rRNA transcripts in L. major were localized within the nucleolus, and scattered throughout the cytoplasm, where mature ribosomes are located. Unlike other rRNA species, stable antisense RNA complementary to 5S rRNA is not detected in L. major.

  2. Characterization of regulatory pathways in Xylella fastidiosa: genes and phenotypes controlled by algU.

    Science.gov (United States)

    Shi, Xiang Yang; Dumenyo, C Korsi; Hernandez-Martinez, Rufina; Azad, Hamid; Cooksey, Donald A

    2007-11-01

    Many virulence genes in plant bacterial pathogens are coordinately regulated by "global" regulatory genes. Conducting DNA microarray analysis of bacterial mutants of such genes, compared with the wild type, can help to refine the list of genes that may contribute to virulence in bacterial pathogens. The regulatory gene algU, with roles in stress response and regulation of the biosynthesis of the exopolysaccharide alginate in Pseudomonas aeruginosa and many other bacteria, has been extensively studied. The role of algU in Xylella fastidiosa, the cause of Pierce's disease of grapevines, was analyzed by mutation and whole-genome microarray analysis to define its involvement in aggregation, biofilm formation, and virulence. In this study, an algU::nptII mutant had reduced cell-cell aggregation, attachment, and biofilm formation and lower virulence in grapevines. Microarray analysis showed that 42 genes had significantly lower expression in the algU::nptII mutant than in the wild type. Among these are several genes that could contribute to cell aggregation and biofilm formation, as well as other physiological processes such as virulence, competition, and survival.

  3. Characterization and expression of the cytochrome P450 gene family in diamondback moth, Plutella xylostella (L.).

    Science.gov (United States)

    Yu, Liying; Tang, Weiqi; He, Weiyi; Ma, Xiaoli; Vasseur, Liette; Baxter, Simon W; Yang, Guang; Huang, Shiguo; Song, Fengqin; You, Minsheng

    2015-03-10

    Cytochrome P450 monooxygenases are present in almost all organisms and can play vital roles in hormone regulation, metabolism of xenobiotics and in biosynthesis or inactivation of endogenous compounds. In the present study, a genome-wide approach was used to identify and analyze the P450 gene family of diamondback moth, Plutella xylostella, a destructive worldwide pest of cruciferous crops. We identified 85 putative cytochrome P450 genes from the P. xylostella genome, including 84 functional genes and 1 pseudogene. These genes were classified into 26 families and 52 subfamilies. A phylogenetic tree constructed with three additional insect species shows extensive gene expansions of P. xylostella P450 genes from clans 3 and 4. Gene expression of cytochrome P450s was quantified across multiple developmental stages (egg, larva, pupa and adult) and tissues (head and midgut) using P. xylostella strains susceptible or resistant to insecticides chlorpyrifos and fiprinol. Expression of the lepidopteran specific CYP367s predominantly occurred in head tissue suggesting a role in either olfaction or detoxification. CYP340s with abundant transposable elements and relatively high expression in the midgut probably contribute to the detoxification of insecticides or plant toxins in P. xylostella. This study will facilitate future functional studies of the P. xylostella P450s in detoxification.

  4. Elucidation of primary metabolic pathways in Aspergillus species: orphaned research in characterizing orphan genes.

    Science.gov (United States)

    Andersen, Mikael Rørdam

    2014-11-01

    Primary metabolism affects all phenotypical traits of filamentous fungi. Particular examples include reacting to extracellular stimuli, producing precursor molecules required for cell division and morphological changes as well as providing monomer building blocks for production of secondary metabolites and extracellular enzymes. In this review, all annotated genes from four Aspergillus species have been examined. In this process, it becomes evident that 80-96% of the genes (depending on the species) are still without verified function. A significant proportion of the genes with verified metabolic functions are assigned to secondary or extracellular metabolism, leaving only 2-4% of the annotated genes within primary metabolism. It is clear that primary metabolism has not received the same attention in the post-genomic area as many other research areas--despite its role at the very centre of cellular function. However, several methods can be employed to use the metabolic networks in tandem with comparative genomics to accelerate functional assignment of genes in primary metabolism. In particular, gaps in metabolic pathways can be used to assign functions to orphan genes. In this review, applications of this from the Aspergillus genes will be examined, and it is proposed that, where feasible, this should be a standard part of functional annotation of fungal genomes. © The Author 2014. Published by Oxford University Press.

  5. Cloning and Characterization of the Polyether Salinomycin Biosynthesis Gene Cluster of Streptomyces albus XM211

    Science.gov (United States)

    Jiang, Chunyan; Wang, Hougen; Kang, Qianjin; Liu, Jing

    2012-01-01

    Salinomycin is widely used in animal husbandry as a food additive due to its antibacterial and anticoccidial activities. However, its biosynthesis had only been studied by feeding experiments with isotope-labeled precursors. A strategy with degenerate primers based on the polyether-specific epoxidase sequences was successfully developed to clone the salinomycin gene cluster. Using this strategy, a putative epoxidase gene, slnC, was cloned from the salinomycin producer Streptomyces albus XM211. The targeted replacement of slnC and subsequent trans-complementation proved its involvement in salinomycin biosynthesis. A 127-kb DNA region containing slnC was sequenced, including genes for polyketide assembly and release, oxidative cyclization, modification, export, and regulation. In order to gain insight into the salinomycin biosynthesis mechanism, 13 gene replacements and deletions were conducted. Including slnC, 7 genes were identified as essential for salinomycin biosynthesis and putatively responsible for polyketide chain release, oxidative cyclization, modification, and regulation. Moreover, 6 genes were found to be relevant to salinomycin biosynthesis and possibly involved in precursor supply, removal of aberrant extender units, and regulation. Sequence analysis and a series of gene replacements suggest a proposed pathway for the biosynthesis of salinomycin. The information presented here expands the understanding of polyether biosynthesis mechanisms and paves the way for targeted engineering of salinomycin activity and productivity. PMID:22156425

  6. Genome-wide characterization of the SiDof gene family in foxtail millet (Setaria italica).

    Science.gov (United States)

    Zhang, Li; Liu, Baoling; Zheng, Gewen; Zhang, Aiying; Li, Runzhi

    2017-01-01

    Dof (DNA binding with one finger) proteins, which constitute a class of transcription factors found exclusively in plants, are involved in numerous physiological and biochemical reactions affecting growth and development. A genome-wide analysis of SiDof genes was performed in this study. Thirty five SiDof genes were identified and those genes were unevenly distributed across nine chromosomes in the Seteria italica genome. Protein lengths, molecular weights, and theoretical isoelectric points of SiDofs all vary greatly. Gene structure analysis demonstrated that most SiDof genes lack introns. Phylogenetic analysis of SiDof proteins and Dof proteins from Arabidopsis thaliana, rice, sorghum, and Setaria viridis revealed six major groups. Analysis of RNA-Seq data indicated that SiDof gene expression levels varied across roots, stems, leaves, and spike. In addition, expression profiling of SiDof genes in response to stress suggested that SiDof 7 and SiDof 15 are involved in drought stress signalling. Overall, this study could provide novel information on SiDofs for further investigation in foxtail millet. Copyright © 2016 Elsevier Ireland Ltd. All rights reserved.

  7. Cloning and characterization of the 5'-flanking region of the Ehox gene

    International Nuclear Information System (INIS)

    Lee, Woon Kyu; Kim, Yong-Man; Malik, Nasir; Ma Chang; Westphal, Heiner

    2006-01-01

    The paired-like homeobox-containing gene Ehox plays a role in embryonic stem cell differentiation and is highly expressed in the developing placenta and thymus. To understand the mechanisms of regulation of Ehox gene expression, the 5'-flanking region of the Ehox gene was isolated from a mouse BAC library. 5'-RACE analysis revealed a single transcriptional start site 130 nucleotides upstream of the translation initiation codon. Transient transfection with a luciferase reporter gene under the control of serially deleted 5'-flanking sequences revealed that the nt -84 to -68 region contained a positive cis-acting element for efficient expression of the Ehox gene. Mutational analysis of this region and oligonucleotide competition in the electrophoretic mobility shift assay revealed the presence of a CCAAT box, which is a target for transcription nuclear factor Y (NFY). NFY is essential for positive gene regulation. No tissue-specific enhancer was identified in the 1.9-kb 5'-flanking region of the Ehox gene. Ehox is expressed during the early stages of embryo development, specifically in Brain at 9.5 dpc, as well as during the late stages of embryo development. These results suggest that NFY is an essential regulatory factor for Ehox transcriptional activity, which is important for the post-implantation stage of the developing embryo

  8. Labor migration in Asia.

    Science.gov (United States)

    Martin, P L

    1991-01-01

    "A recent conference sponsored by the United Nations Center for Regional Development (UNCRD) in Nagoya, Japan examined the growing importance of labor migration for four major Asian labor importers (Japan, Hong Kong, Malaysia, and Singapore) and five major labor exporters (Bangladesh, Korea, Pakistan, Philippines, and Thailand).... The conference concluded that international labor migration would increase within Asia because the tight labor markets and rising wages which have stimulated Japanese investment in other Asian nations, for example, have not been sufficient to eliminate migration push and pull forces...." excerpt

  9. Underground laboratories in Asia

    International Nuclear Information System (INIS)

    Lin, Shin Ted; Yue, Qian

    2015-01-01

    Deep underground laboratories in Asia have been making huge progress recently because underground sites provide unique opportunities to explore the rare-event phenomena for the study of dark matter searches, neutrino physics and nuclear astrophysics as well as the multi-disciplinary researches based on the low radioactive environments. The status and perspectives of Kamioda underground observatories in Japan, the existing Y2L and the planned CUP in Korea, India-based Neutrino Observatory (INO) in India and China JinPing Underground Laboratory (CJPL) in China will be surveyed

  10. Underground laboratories in Asia

    Energy Technology Data Exchange (ETDEWEB)

    Lin, Shin Ted, E-mail: linst@mails.phys.sinica.edu.tw [College of Physical Science and Technology, Sichuan University, Chengdu 610064 China (China); Yue, Qian, E-mail: yueq@mail.tsinghua.edu.cn [Key Laboratory of Particle and Radiation Imaging (Ministry of Education) and Department of Engineering Physics, Tsinghua University, Beijing 100084 China (China)

    2015-08-17

    Deep underground laboratories in Asia have been making huge progress recently because underground sites provide unique opportunities to explore the rare-event phenomena for the study of dark matter searches, neutrino physics and nuclear astrophysics as well as the multi-disciplinary researches based on the low radioactive environments. The status and perspectives of Kamioda underground observatories in Japan, the existing Y2L and the planned CUP in Korea, India-based Neutrino Observatory (INO) in India and China JinPing Underground Laboratory (CJPL) in China will be surveyed.

  11. Teaching Modern Southeast Asia

    Directory of Open Access Journals (Sweden)

    Thomas Williamson

    2009-04-01

    Full Text Available Teaching about Southeast Asia to undergraduates at an American liberal arts college presents several challenges. At my institution, it is the only course on the region in the curriculum; thus no preparation, and no follow-up. I have therefore struggled with the approach that I should take–pulled between a wish for students to gain an empirical understanding of Southeast Asian life, and a desire to have them learn the concepts and theories of critical inquiry. Obviously I am still learning how to successfully accomplish such an ambitious undertaking.

  12. Characterization, expression profiles, intracellular distribution and association analysis of porcine PNAS-4 gene with production traits

    Directory of Open Access Journals (Sweden)

    Wang Heng

    2008-06-01

    Full Text Available Abstract Background In a previous screen to identify differentially expressed genes associated with embryonic development, the porcine PNAS-4 gene had been found. Considering differentially expressed genes in early stages of muscle development are potential candidate genes to improve meat quality and production efficiency, we determined how porcine PNAS-4 gene regulates meat production. Therefore, this gene has been sequenced, expression analyzed and associated with meat production traits. Results We cloned the full-length cDNA of porcine PNAS-4 gene encoding a protein of 194 amino acids which was expressed in the Golgi complex. This gene was mapped to chromosome 10, q11–16, in a region of conserved synteny with human chromosome 1 where the human homologous gene was localized. Real-time PCR revealed that PNAS-4 mRNA was widely expressed with highest expression levels in skeletal muscle followed by lymph, liver and other tissues, and showed a down-regulated expression pattern during prenatal development while a up-regulated expression pattern after weaning. Association analysis revealed that allele C of SNP A1813C was prevalent in Chinese indigenous breeds whereas A was dominant allele in Landrace and Large White, and the pigs with homozygous CC had a higher fat content than those of the pigs with other genotypes (P Conclusion Porcine PNAS-4 protein tagged with green fluorescent protein accumulated in the Golgi complex, and its mRNA showed a widespread expression across many tissues and organs in pigs. It may be an important factor affecting the meat production efficiency, because its down-regulated expression pattern during early embryogenesis suggests involvement in increase of muscle fiber number. In addition, the SNP A1813C associated with fat traits might be a genetic marker for molecular-assisted selection in animal breeding.

  13. Molecular cloning and characterization of the recA gene of Pseudomonas aeruginosa PAO

    Energy Technology Data Exchange (ETDEWEB)

    Kokjohn, T.A.; Miller, R.V.

    1985-08-01

    The recA gene of Pseudomonas aeruginosa PAO has been isolated and introduced into Escherichia coli K-12. Resistance to killing by UV irradiation was restored in several RecA-E. coli K-12 hosts by the P. aeruginosa gene, as was resistance to methyl methanesulfonate. Recombination proficiency was also restored, as measured by HfrH-mediated conjugation and by the ability to propagate Fec-phage lambda derivatives. The cloned P. aeruginosa recA gene restored both spontaneous and mitomycin C-stimulated induction of lambda prophage in lysogens of a recA strain of E. coli K-12.

  14. Cloning, characterization, and expression of the dapE gene of Escherichia coli.

    OpenAIRE

    Bouvier, J; Richaud, C; Higgins, W; Bögler, O; Stragier, P

    1992-01-01

    The dapE gene of Escherichia coli encodes N-succinyl-L-diaminopimelic acid desuccinylase, an enzyme that catalyzes the synthesis of LL-diaminopimelic acid, one of the last steps in the diaminopimelic acid-lysine pathway. The dapE gene region was previously purified from a lambda bacteriophage transducing the neighboring purC gene (J. Parker, J. Bacteriol. 157:712-717, 1984). Various subcloning steps led to the identification of a 2.3-kb fragment that complemented several dapE mutants and allo...

  15. Isolation and characterization of PEP3, a gene required for vacuolar biogenesis in Saccharomyces cerevisiae.

    OpenAIRE

    Preston, R A; Manolson, M F; Becherer, K; Weidenhammer, E; Kirkpatrick, D; Wright, R; Jones, E W

    1991-01-01

    The Saccharomyces cerevisiae PEP3 gene was cloned from a wild-type genomic library by complementation of the carboxypeptidase Y deficiency in a pep3-12 strain. Subclone complementation results localized the PEP3 gene to a 3.8-kb DNA fragment. The DNA sequence of the fragment was determined; a 2,754-bp open reading frame predicts that the PEP3 gene product is a hydrophilic, 107-kDa protein that has no significant similarity to any known protein. The PEP3 predicted protein has a zinc finger (CX...

  16. Evolutionary Relationship and Structural Characterization of the EPF/EPFL Gene Family

    OpenAIRE

    Takata, Naoki; Yokota, Kiyonobu; Ohki, Shinya; Mori, Masashi; Taniguchi, Toru; Kurita, Manabu

    2013-01-01

    EPF1-EPF2 and EPFL9/Stomagen act antagonistically in regulating leaf stomatal density. The aim of this study was to elucidate the evolutionary functional divergence of EPF/EPFL family genes. Phylogenetic analyses showed that AtEPFL9/Stomagen-like genes are conserved only in vascular plants and are closely related to AtEPF1/EPF2-like genes. Modeling showed that EPF/EPFL peptides share a common 3D structure that is constituted of a scaffold and loop. Molecular dynamics simulation suggested that...

  17. Characterization of resistance to tetracyclines and aminoglycosides of sheep mastitis pathogens: study of the effect of gene content on resistance.

    Science.gov (United States)

    Lollai, S A; Ziccheddu, M; Duprè, I; Piras, D

    2016-10-01

    Mastitis causes economic losses and antimicrobials are frequently used for mastitis treatment. Antimicrobial resistance surveys are still rare in the ovine field and characterization of strains is important in order to acquire information about resistance and for optimization of therapy. Bacterial pathogens recovered in milk samples from mastitis-affected ewes were characterized for resistance to tetracyclines and aminoglycosides, members of which are frequently used antimicrobials in small ruminants. A total of 185 strains of staphylococci, streptococci, and enterococci, common mastitis pathogens, were tested for minimal inhibitory concentration (MIC) to tetracycline, doxycycline, minocycline, gentamicin, kanamycin, streptomycin, and for resistance genes by PCR. Effects of different tet genes arrangements on MICs were also investigated. Staphylococci expressed the lowest MIC for tetracycline and tet(K) was the most common gene recovered; tet(M) and tet(O) were also found. Gene content was shown to influence the tetracycline MIC values. Enterococci and streptococci showed higher MICs to tetracyclines and nonsusceptible strains always harboured at least one ribosomal protection gene (MIC above 8 μg ml(-1) ). Streptococci often harboured two or more tet determinants. As regards the resistance to aminoglycosides, staphylococci showed the lowest gentamicin and kanamycin median MIC along with streptomycin high level resistant (HLR) strains (MIC >1024 μg ml(-1) ) all harbouring str gene. The resistance determinant aac(6')-Ie-aph(2″)-Ia was present in few strains. Streptococci were basically nonsusceptible to aminoglycosides but neither HLR isolates nor resistance genes were detected. Enterococci revealed the highest MICs for gentamicin; two str harbouring isolates were shown to be HLR to streptomycin. Evidence was obtained for the circulation of antimicrobial-resistant strains and genes in sheep dairy farming. Tetracycline MIC of 64 μg ml(-1) and high

  18. Vector for IS element entrapment and functional characterization based on turning on expression of distal promoterless genes.

    Science.gov (United States)

    Szeverényi, I; Hodel, A; Arber, W; Olasz, F

    1996-09-26

    We constructed and characterized a novel trap vector for rapid isolation of insertion sequences. The strategy used for the isolation of IS elements is based on the ability of many IS elements to turn on the expression of otherwise silent genes distal to some sites of insertion. The simple transposition of an IS element can sometimes cause the constitutive expression of promoterless antibiotic resistance genes resulting in selectable phenotypes. The trap vector pAW1326 is based on a pBR322 replicon, it carries ampicillin and streptomycin resistance genes, and also silenced genes that confer chloramphenicol and kanamycin resistance once activated. The trap vector pAW1326 proved to be efficient and 85 percent of all isolated mutations were insertions. The majority of IS elements resident in the studied Escherichia coli strains tested became trapped, namely IS2, IS3, IS5, IS150, IS186 and Tn1000. We also encountered an insertion sequence, called IS10L/R-2, which is a hybrid of the two IS variants IS10L and IS10R. IS10L/R-2 is absent from most E. coli strains, but it is detectable in some strains such as JM109 which had been submitted to Tn10 mutagenesis. The distribution of the insertion sequences within the trap region was not random. Rather, the integration of chromosomal mobile genetic elements into the offered target sequence occurred in element-specific clusters. This is explained both by the target specificity and by the specific requirements for the activation of gene transcription by the DNA rearrangement. The employed trap vector pAW1326 proved to be useful for the isolation of mobile genetic elements, for a demonstration of their transposition activity as well as for the further characterization of some of the functional parameters of transposition.

  19. Characterization and functional analysis of seven flagellin genes in Rhizobium leguminosarum bv. viciae. Characterization of R. leguminosarum flagellins

    Directory of Open Access Journals (Sweden)

    Tambalo Dinah D

    2010-08-01

    Full Text Available Abstract Background Rhizobium leguminosarum bv. viciae establishes symbiotic nitrogen fixing partnerships with plant species belonging to the Tribe Vicieae, which includes the genera Vicia, Lathyrus, Pisum and Lens. Motility and chemotaxis are important in the ecology of R. leguminosarum to provide a competitive advantage during the early steps of nodulation, but the mechanisms of motility and flagellar assembly remain poorly studied. This paper addresses the role of the seven flagellin genes in producing a functional flagellum. Results R. leguminosarum strains 3841 and VF39SM have seven flagellin genes (flaA, flaB, flaC, flaD, flaE, flaH, and flaG, which are transcribed separately. The predicted flagellins of 3841 are highly similar or identical to the corresponding flagellins in VF39SM. flaA, flaB, flaC, and flaD are in tandem array and are located in the main flagellar gene cluster. flaH and flaG are located outside of the flagellar/motility region while flaE is plasmid-borne. Five flagellin subunits (FlaA, FlaB, FlaC, FlaE, and FlaG are highly similar to each other, whereas FlaD and FlaH are more distantly related. All flagellins exhibit conserved amino acid residues at the N- and C-terminal ends and are variable in the central regions. Strain 3841 has 1-3 plain subpolar flagella while strain VF39SM exhibits 4-7 plain peritrichous flagella. Three flagellins (FlaA/B/C and five flagellins (FlaA/B/C/E/G were detected by mass spectrometry in the flagellar filaments of strains 3841 and VF39SM, respectively. Mutation of flaA resulted in non-motile VF39SM and extremely reduced motility in 3841. Individual mutations of flaB and flaC resulted in shorter flagellar filaments and consequently reduced swimming and swarming motility for both strains. Mutant VF39SM strains carrying individual mutations in flaD, flaE, flaH, and flaG were not significantly affected in motility and filament morphology. The flagellar filament and the motility of 3841 strains

  20. Characterization of shark complement factor I gene(s): genomic analysis of a novel shark-specific sequence.

    Science.gov (United States)

    Shin, Dong-Ho; Webb, Barbara M; Nakao, Miki; Smith, Sylvia L

    2009-07-01

    Complement factor I is a crucial regulator of mammalian complement activity. Very little is known of complement regulators in non-mammalian species. We isolated and sequenced four highly similar complement factor I cDNAs from the liver of the nurse shark (Ginglymostoma cirratum), designated as GcIf-1, GcIf-2, GcIf-3 and GcIf-4 (previously referred to as nsFI-a, -b, -c and -d) which encode 689, 673, 673 and 657 amino acid residues, respectively. They share 95% (shark-specific sequence between the leader peptide (LP) and the factor I membrane attack complex (FIMAC) domain. The cDNA sequences differ only in the size and composition of the shark-specific region (SSR). Sequence analysis of each SSR has identified within the region two novel short sequences (SS1 and SS2) and three repeat sequences (RS1-3). Genomic analysis has revealed the existence of three introns between the leader peptide and the FIMAC domain, tentatively designated intron 1, intron 2, and intron 3 which span 4067, 2293 and 2082bp, respectively. Southern blot analysis suggests the presence of a single gene copy for each cDNA type. Phylogenetic analysis suggests that complement factor I of cartilaginous fish diverged prior to the emergence of mammals. All four GcIf cDNA species are expressed in four different tissues and the liver is the main tissue in which expression level of all four is high. This suggests that the expression of GcIf isotypes is tissue-dependent.