Sultan, Serageldeen; Charoenvisal, Nataya; Lan, Nguyen Thi; Yamaguchi, Ryoji; Maeda, Ken; Kai, Kazushige
2009-01-01
Background Although the presence of Asia 2 group of canine distemper virus (CDV) was known by the sequencing and phylogenetic analysis of hemagglutinin (H) gene, the fusion (F) protein gene sequence of Asia 2 group had not been identified. So, the sequence analysis of F gene was carried out to elucidate the genotypic varaitons among Asian isolates. Results The phylogenetic analysis of F and H gene sequences from fourteen CDV isolates obtained from diseased dogs in Japan and Thailand indicated that the F genes had a new initiation codon and extra 27 nucleotides upstream of the usual open reading frame (ORF) and the F proteins had extra 9 amino acids at the N-terminal position only in Asia 2 isolates. On the contrary, the Asia 1 isolates had three extra putative N-glycosylation sites (two sites in the signal peptide region and one site in the F1 region) except for two strains of Th12 and Ac96I (two sites in signal peptide region) adding to four putative N-glycosylation sites that were conserved among all Asian isolates and Onderstepoort strain. In addition to this difference in N-glycosylation sites, the signal peptide region had a great diversity between Asia 1 and Asia 2 isolates. Also, characteristic amino acids were detected for some strains. Conclusion Asia 2 isolates were distinguished from other CDV lineages by the extra 27 nucleotide sequence. The signal peptide region of F gene gives a remarkable differentiation between Asia 1 and Asia 2 isolates. Strains Th12 and Ac96I were differentiated from other Asia 1 strains by the F protein glycosylation sites. PMID:19807927
Evolutionary Analysis of Structural Protein Gene VP1 of Foot-and-Mouth Disease Virus Serotype Asia 1
Zhang, Qingxun; Liu, Xinsheng; Fang, Yuzhen; Pan, Li; Lv, Jianliang; Zhang, Zhongwang; Zhou, Peng; Ding, Yaozhong; Chen, Haotai; Shao, Junjun; Zhao, Furong; Lin, Tong; Chang, Huiyun; Zhang, Jie; Wang, Yonglu; Zhang, Yongguang
2015-01-01
Foot-and-mouth disease virus (FMDV) serotype Asia 1 was mostly endemic in Asia and then was responsible for economically important viral disease of cloven-hoofed animals, but the study on its selection and evolutionary process is comparatively rare. In this study, we characterized 377 isolates from Asia collected up until 2012, including four vaccine strains. Maximum likelihood analysis suggested that the strains circulating in Asia were classified into 8 different groups (groups I–VIII) or were unclassified (viruses collected before 2000). On the basis of divergence time analyses, we infer that the TMRCA of Asia 1 virus existed approximately 86.29 years ago. The result suggested that the virus had a high mutation rate (5.745 × 10−3 substitutions/site/year) in comparison to the other serotypes of FMDV VP1 gene. Furthermore, the structural protein VP1 was under lower selection pressure and the positive selection occurred at many sites, and four codons (positions 141, 146, 151, and 169) were located in known critical antigenic residues. The remaining sites were not located in known functional regions and were moderately conserved, and the reason for supporting all sites under positive selection remains to be elucidated because the power of these analyses was largely unknown. PMID:25793223
Yang, Ying; Zhang, Tong; Zhang, Xu-Xiang; Liang, Da-Wei; Zhang, Ming; Gao, Da-Wen; Zhu, He-Guang; Huang, Qing-Guo; Fang, Herbert H P
2012-09-01
The emerging antibiotic resistance genes in the aquatic environment have aroused public concern. As β-lactam is the most widely used group of antibiotics, β-lactam resistance genes were selected to investigate their distribution and diversity in the activated sludge from 15 geographically different sewage treatment plants (STPs) of China, Singapore, USA, and Canada. Specific PCR and quantitative real-time PCR (q-PCR) were used to investigate the occurrence and abundance of nine β-lactam resistance genes. Five genes (OXA-1, OXA-2, OXA-10, ampC, and TEM-1) were detected in most of the sludge collected, while three genes (mecA, CTX-M-1, and SME) were not found in any sludge sample. The total abundances of the six detected β-lactam resistance genes in the 15 STPs varied from 5.34 × 10(1) copies/ng DNA (ampC) to 5.49 × 10(4) copies/ng DNA (OXA-1). Overall, OXA-1 had the highest total concentration, followed by IMP and OXA-10. Noticeably, the abundances of TEM-1 in Chinese STPs were generally higher than those in the STPs of other countries, while the abundances of OXA-2 and IMP in the STPs of North America were much greater than those of East Asia. A total of 78 clones carrying β-lactam resistance genes were randomly selected from six clone libraries for phylogenetic diversity analysis; the similarity of these cloned genes to known β-lactam resistance genes with sequence identities ranged from 96% to 100%. Furthermore, OXA-1, ampC, and IMP were found to be more diverse than the other β-lactam resistance genes.
2010-01-01
Background Oysters are morphologically plastic and hence difficult subjects for taxonomic and evolutionary studies. It is long been suspected, based on the extraordinary species diversity observed, that Asia Pacific is the epicenter of oyster speciation. To understand the species diversity and its evolutionary history, we collected five Crassostrea species from Asia and sequenced their complete mitochondrial (mt) genomes in addition to two newly released Asian oysters (C. iredalei and Saccostrea mordax) for a comprehensive analysis. Results The six Asian Crassostrea mt genomes ranged from 18,226 to 22,446 bp in size, and all coded for 39 genes (12 proteins, 2 rRNAs and 25 tRNAs) on the same strand. Their genomes contained a split of the rrnL gene and duplication of trnM, trnK and trnQ genes. They shared the same gene order that differed from an Atlantic sister species by as many as nine tRNA changes (6 transpositions and 3 duplications) and even differed significantly from S. mordax in protein-coding genes. Phylogenetic analysis indicates that the six Asian Crassostrea species emerged between 3 and 43 Myr ago, while the Atlantic species evolved 83 Myr ago. Conclusions The complete conservation of gene order in the six Asian Crassostrea species over 43 Myr is highly unusual given the remarkable rate of rearrangements in their sister species and other bivalves. It provides strong evidence for the recent speciation of the six Crassostrea species in Asia. It further indicates that changes in mt gene order may not be strictly a function of time but subject to other constraints that are presently not well understood. PMID:21189147
Le Hello, Simon; Bortolaia, Valeria; Pulsrikarn, Chaiwat; Nielsen, Eva Møller; Pornruangmong, Srirat; Chaichana, Phattharaporn; Svendsen, Christina Aaby; Weill, François-Xavier; Aarestrup, Frank M.
2012-01-01
Salmonella enterica serovar Stanley (S. Stanley) is a common serovar in Southeast Asia and was the second most common serovar implicated in human salmonellosis in Thailand in the years 2002 to 2007. In contrast, this serovar is relatively uncommon in Europe. The objective of this study was to characterize a collection of S. Stanley strains isolated from Thai (n = 62), Danish (n = 39), and French (n = 24) patients to gain a broader understanding of the genetic diversity, population dynamics, and susceptibility to antimicrobials. All isolates were characterized by pulsed-field gel electrophoresis and antimicrobial susceptibility testing. The molecular mechanisms of resistance to extended-spectrum cephalosporins and plasmid-mediated resistance to quinolones were characterized by PCR and sequencing. Plasmid profiling, replicon typing, and microarray analysis were used to characterize the genetic mechanisms of antimicrobial resistance in 10 extended-spectrum cephalosporinase-producing isolates. Considerable genetic diversity was observed among the isolates characterized with 91 unique XbaI pulsed-field gel electrophoresis (PFGE) patterns, including 17 distinct clusters consisting of two to seven indistinguishable isolates. We found some of the S. Stanley isolates isolated from patients in Europe were acquired during travel to Southeast Asia, including Thailand. The presence of multiple plasmid lineages carrying the extended-spectrum cephalosporinase-encoding blaCMY-2 gene in S. Stanley isolates from the central part of Thailand was confirmed. Our results emphasize that Thai authorities, as well as authorities in other countries lacking prudent use of antimicrobials, should improve the ongoing efforts to regulate antimicrobial use in agriculture and in clinical settings to limit the spread of multidrug-resistant Salmonella isolates and plasmids among humans and pigs in Thailand and abroad. PMID:22205822
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-01-01
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino a...
The promise of discovering population-specific disease-associated genes in South Asia.
Nakatsuka, Nathan; Moorjani, Priya; Rai, Niraj; Sarkar, Biswanath; Tandon, Arti; Patterson, Nick; Bhavani, Gandham SriLakshmi; Girisha, Katta Mohan; Mustak, Mohammed S; Srinivasan, Sudha; Kaushik, Amit; Vahab, Saadi Abdul; Jagadeesh, Sujatha M; Satyamoorthy, Kapaettu; Singh, Lalji; Reich, David; Thangaraj, Kumarasamy
2017-09-01
The more than 1.5 billion people who live in South Asia are correctly viewed not as a single large population but as many small endogamous groups. We assembled genome-wide data from over 2,800 individuals from over 260 distinct South Asian groups. We identified 81 unique groups, 14 of which had estimated census sizes of more than 1 million, that descend from founder events more extreme than those in Ashkenazi Jews and Finns, both of which have high rates of recessive disease due to founder events. We identified multiple examples of recessive diseases in South Asia that are the result of such founder events. This study highlights an underappreciated opportunity for decreasing disease burden among South Asians through discovery of and testing for recessive disease-associated genes.
Characterization of Dust Properties at the Source Region During ACE-Asia
Tsay, Si-Chee; Lau, William (Technical Monitor)
2001-01-01
ACE (Aerosol Characterization Experiment)-Asia is designed to study the compelling variability in spatial and temporal scale of both pollution-derived and naturally-occurring aerosols, which often exist in high concentrations over eastern Asia and along the rim of the western Pacific. The phase-I of ACE-Asia was conducted from March-May 2001 in the vicinity of the Gobi desert, east coast of China, Yellow Sea, Korea, and Japan, along the pathway of Kosa (severe events that blanket East Asia with yellow desert dust, peaked in the Spring season). Asian dust typically originates in desert areas far from polluted urban regions. During transport, dust layers can interact with anthropogenic sulfate and soot aerosols from heavily polluted urban areas. Added to the complex effects of clouds and natural marine aerosols, dust particles reaching the marine environment can have drastically different properties than those from the source. Thus, understanding the unique temporal and spatial variations of Asian dust is of special importance in regional-to-global climate issues such as radiative forcing, the hydrological cycle, and primary biological productivity in the mid-Pacific Ocean. During ACE-Asia we have measured continuously aerosol optical/radiative properties, column precipitable water amount, and surface reflectivity over homogeneous areas from surface. The inclusion of flux measurements permits the determination of dust aerosol radiative flux in addition to measurements of loading and optical thickness. At the time of the Terra/MODIS overpass, these ground-based observations can provide valuable data to compare with MODIS retrievals over land. Preliminary results will be presented and discussed their implications in regional climatic effects.
[Construction and characterization of an epitope-mutated Asia 1 type foot-and-mouth disease virus].
Zhang, Yan; Hu, Yonghao; Yang, Fan; Yang, Bo; Wang, Songhao; Zhu, Zixiang; Zheng, Haixue
2015-01-01
To generate an epitope-mutated foot-and-mouth disease virus (FMDV) as a marker vaccine, the infectious clone pAsia 1-FMDV containing the complete genomic cDNA of Asia 1 type FMDV was used as backbone, the residues at positions 27 and 31 in the 3D gene were mutated (H27Y and N31R). The resulting plasmid pAsia 1-FMDV-3DM encoding a mutated epitope was transfected into BHK-21 cells and the recombinant virus rAsia 1-3DM was rescued. The recombinant virus showed similar biological characteristics comparable with the parental virus. In serological neutralization test the antisera against recombine virus have a good reactivity with parental virus. The antisera against the mutant virus were shown to be reactive with the mutated epitope but not the wild-type one. The results indicated that the two virus strains could be distinguished by western blotting using synthetic peptides. This epitope-mutated FMDV strain will be evaluated as a potential marker vaccine against FMDV infections.
Sun, Meng; Lu, Ming-Xing; Tang, Xiao-Tian; Du, Yu-Zhou
2014-12-12
The pink stem borer, Sesamia inferens (Walker), is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs) encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Meng Sun
2014-12-01
Full Text Available The pink stem borer, Sesamia inferens (Walker, is a major pest of rice and is endemic in China and other parts of Asia. Small heat shock proteins (sHSPs encompass a diverse, widespread class of stress proteins that have not been characterized in S. inferens. In the present study, we isolated and characterized three S. inferens genes that encode members of the α-crystallin/sHSP family, namely, Sihsp21.4, Sihsp20.6, and Sihsp19.6. The three cDNAs encoded proteins of 187, 183 and 174 amino acids with calculated molecular weights of 21.4, 20.6 and 19.6 kDa, respectively. The deduced amino acid sequences of the three genes showed strong similarity to sHSPs identified in other lepidopteran insects. Sihsp21.4 contained an intron, but Sihsp20.6 and Sihsp19.6 lacked introns. Real-time quantitative PCR analyses revealed that Sihsp21.4 was most strongly expressed in S. inferens heads; Whereas expression of Sihsp20.6 and Sihsp19.6 was highest in eggs. The three S. inferens sHSP genes were up-regulated during low temperature stress. In summary, our results show that S. inferens sHSP genes have distinct regulatory roles in the physiology of S. inferens.
Directory of Open Access Journals (Sweden)
Nuntra Suwantarat
2016-05-01
Full Text Available Abstract Background Multidrug-resistant Gram-negative bacteria (MDRGN, including extended-spectrum β-lactamases (ESBLs and multidrug-resistant glucose-nonfermenting Gram-negative bacilli (nonfermenters, have emerged and spread throughout Southeast Asia. Methods We reviewed and summarized current critical knowledge on the epidemiology and molecular characterization of MDRGN in Southeast Asia by PubMed searches for publications prior to 10 March 2016 with the term related to “MDRGN definition” combined with specific Southeast Asian country names (Thailand, Singapore, Malaysia, Vietnam, Indonesia, Philippines, Laos, Cambodia, Myanmar, Brunei. Results There were a total of 175 publications from the following countries: Thailand (77, Singapore (35, Malaysia (32, Vietnam (23, Indonesia (6, Philippines (1, Laos (1, and Brunei (1. We did not find any publications on MDRGN from Myanmar and Cambodia. We did not include publications related to Shigella spp., Salmonella spp., and Vibrio spp. and non-human related studies in our review. English language articles and abstracts were included for analysis. After the abstracts were reviewed, data on MDRGN in Southeast Asia from 54 publications were further reviewed and included in this study. Conclusions MDRGNs are a major contributor of antimicrobial-resistant bacteria in Southeast Asia. The high prevalence of ESBLs has been a major problem since 2005 and is possibly related to the development of carbapenem resistant organisms in this region due to the overuse of carbapenem therapy. Carbapenem–resistant Acinetobacter baumannii is the most common pathogen associated with nosocomial infections in this region followed by carbapenem-resistant Pseudomonas aeruginosa. Although Southeast Asia is not an endemic area for carbapenem-resistant Enterobacteriaceae (CRE, recently, the rate of CRE detection has been increasing. Limited infection control measures, lack of antimicrobial control, such as the presence of
DEFF Research Database (Denmark)
Jamal, Syed Muhammad; Ferrari, Giancarlo; Ahmed, Safia
2011-01-01
Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. The FMD virus serotypes O, A and Asia-1 are responsible for the outbreaks in these countries. Diverse strains of FMDV, even within the same serotype, co-circulate. Characterization of the viruses in circulation can facilitate...... appropriate vaccine selection and tracing of outbreaks.The present study characterized foot-and-mouth disease serotype Asia-1 viruses circulating in Pakistan and Afghanistan during the period 1998–2009. Phylogenetic analysis of FMDV type Asia-1 revealed that three different genetic Groups of serotype Asia-1...... of the A-Iran05AFG-07 sub-lineage. The Asia-1 FMDVs currently circulating in Pakistan and Afghanistan are not efficiently neutralized by antisera raised against the Asia-1/Shamir vaccine strain. Thus, new Asia-1 vaccine strains may be required to block the spread of the current Asia-1 viruses....
Jiang, Likun; You, Weiwei; Zhang, Xiaojun; Xu, Jian; Jiang, Yanliang; Wang, Kai; Zhao, Zixia; Chen, Baohua; Zhao, Yunfeng; Mahboob, Shahid; Al-Ghanim, Khalid A; Ke, Caihuan; Xu, Peng
2016-02-01
The small abalone (Haliotis diversicolor) is one of the most important aquaculture species in East Asia. To facilitate gene cloning and characterization, genome analysis, and genetic breeding of it, we constructed a large-insert bacterial artificial chromosome (BAC) library, which is an important genetic tool for advanced genetics and genomics research. The small abalone BAC library includes 92,610 clones with an average insert size of 120 Kb, equivalent to approximately 7.6× of the small abalone genome. We set up three-dimensional pools and super pools of 18,432 BAC clones for target gene screening using PCR method. To assess the approach, we screened 12 target genes in these 18,432 BAC clones and identified 16 positive BAC clones. Eight positive BAC clones were then sequenced and assembled with the next generation sequencing platform. The assembled contigs representing these 8 BAC clones spanned 928 Kb of the small abalone genome, providing the first batch of genome sequences for genome evaluation and characterization. The average GC content of small abalone genome was estimated as 40.33%. A total of 21 protein-coding genes, including 7 target genes, were annotated into the 8 BACs, which proved the feasibility of PCR screening approach with three-dimensional pools in small abalone BAC library. One hundred fifty microsatellite loci were also identified from the sequences for marker development in the future. The BAC library and clone pools provided valuable resources and tools for genetic breeding and conservation of H. diversicolor.
Lau, William K. M. (Technical Monitor); Tsay, Si-Chee; Hsu, N. Christina; Herman, Jay R.; Ji, Q. Jack
2002-01-01
Many recent field experiments are designed to study the compelling variability in spatial and temporal scale of both pollution-derived and naturally occurring aerosols, which often exist in high concentration over particular pathways around the globe. For example, the ACE-Asia (Aerosol Characterization Experiment-Asia) was conducted from March-May 2001 in the vicinity of the Taklimakan and Gobi deserts, East Coast of China, Yellow Sea, Korea, and Japan, along the pathway of Kosa (severe events that blanket East Asia with yellow desert dust, peaked in the Spring season). The PRIDE (Puerto RIco Dust Experiment, July 2000) was designed to measure the properties of Saharan dust transported across the Atlantic Ocean to the Caribbean. Dust particles typically originate in desert areas far from polluted urban regions. During transport, dust layers can interact with anthropogenic sulfate and soot aerosols from heavily polluted urban areas. Added to the complex effects of clouds and natural marine aerosols, dust particles reaching the marine environment can have drastically different properties than those from the source. Thus, understanding the unique temporal and spatial variations of dust aerosols is of special importance in regional-to-global climate issues such as radiative forcing, the hydrological cycle, and primary biological productivity in the ocean. During ACE-Asia and PRIDE we had measured aerosol physical/optical/radiative properties, column precipitable water amount, and surface reflectivity over homogeneous areas from ground-based remote sensing. The inclusion of flux measurements permits the determination of aerosol radiative flux in addition to measurements of loading and optical depth. At the time of the Terra/MODIS, SeaWiFS, TOMS and other satellite overpasses, these ground-based observations can provide valuable data to compare with satellite retrievals over land. We will present the results and discuss their implications in regional climatic effects.
Asia-MIP: Multi Model-data Synthesis of Terrestrial Carbon Cycles in Asia
Ichii, K.; Kondo, M.; Ito, A.; Kang, M.; Sasai, T.; SATO, H.; Ueyama, M.; Kobayashi, H.; Saigusa, N.; Kim, J.
2013-12-01
Asia, which is characterized by monsoon climate and intense human activities, is one of the prominent understudied regions in terms of terrestrial carbon budgets and mechanisms of carbon exchange. To better understand terrestrial carbon cycle in Asia, we initiated multi-model and data intercomparison project in Asia (Asia-MIP). We analyzed outputs from multiple approaches: satellite-based observations (AVHRR and MODIS) and related products, empirically upscaled estimations (Support Vector Regression) using eddy-covariance observation network in Asia (AsiaFlux, CarboEastAsia, FLUXNET), ~10 terrestrial biosphere models (e.g. BEAMS, Biome-BGC, LPJ, SEIB-DGVM, TRIFFID, VISIT models), and atmospheric inversion analysis (e.g. TransCom models). We focused on the two difference temporal coverage: long-term (30 years; 1982-2011) and decadal (10 years; 2001-2010; data intensive period) scales. The regions of covering Siberia, Far East Asia, East Asia, Southeast Asia and South Asia (60-80E, 10S-80N), was analyzed in this study for assessing the magnitudes, interannual variability, and key driving factors of carbon cycles. We will report the progress of synthesis effort to quantify terrestrial carbon budget in Asia. First, we analyzed the recent trends in Gross Primary Productivities (GPP) using satellite-based observation (AVHRR) and multiple terrestrial biosphere models. We found both model outputs and satellite-based observation consistently show an increasing trend in GPP in most of the regions in Asia. Mechanisms of the GPP increase were analyzed using models, and changes in temperature and precipitation play dominant roles in GPP increase in boreal and temperate regions, whereas changes in atmospheric CO2 and precipitation are important in tropical regions. However, their relative contributions were different. Second, in the decadal analysis (2001-2010), we found that the negative GPP and carbon uptake anomalies in 2003 summer in Far East Asia is one of the largest
Jamal, Syed M; Ferrari, Giancarlo; Ahmed, Safia; Normann, Preben; Belsham, Graham J
2011-12-01
Foot-and-mouth disease (FMD) is endemic in Pakistan and Afghanistan. The FMD virus serotypes O, A and Asia-1 are responsible for the outbreaks in these countries. Diverse strains of FMDV, even within the same serotype, co-circulate. Characterization of the viruses in circulation can facilitate appropriate vaccine selection and tracing of outbreaks. The present study characterized foot-and-mouth disease serotype Asia-1 viruses circulating in Pakistan and Afghanistan during the period 1998-2009. Phylogenetic analysis of FMDV type Asia-1 revealed that three different genetic Groups of serotype Asia-1 have circulated in Pakistan during this time. These are Group-II, -VI and, recently, a novel Group (designated here as Group-VII). This new Group has not been detected in neighbouring Afghanistan during the study period but viruses from Groups I and -II are in circulation there. Using near complete genome sequences, from FMD viruses of serotypes Asia-1 and A that are currently circulating in Pakistan, we have identified an interserotypic recombinant virus, which has the VP2-VP3-VP1-2A coding sequences derived from a Group-VII Asia-1 virus and the remainder of the genome from a serotype A virus of the A-Iran05(AFG-07) sub-lineage. The Asia-1 FMDVs currently circulating in Pakistan and Afghanistan are not efficiently neutralized by antisera raised against the Asia-1/Shamir vaccine strain. Thus, new Asia-1 vaccine strains may be required to block the spread of the current Asia-1 viruses. Copyright © 2011 Elsevier B.V. All rights reserved.
Loboda, Tatiana V.; Giglio, Louis; Boschetti, Luigi; Justice, Christopher O.
2012-06-01
Central Asian dry lands are grass- and desert shrub-dominated ecosystems stretching across Northern Eurasia. This region supports a population of more than 100 million which continues to grow at an average rate of 1.5% annually. Dry steppes are the primary grain and cattle growing zone within Central Asia. Degradation of this ecosystem through burning and overgrazing directly impacts economic growth and food supply in the region. Fire is a recurrent disturbance agent in dry lands contributing to soil erosion and air pollution. Here we provide an overview of inter-annual and seasonal fire dynamics in Central Asia obtained from remotely sensed data. We evaluate the accuracy of the Moderate Resolution Imaging Spectroradiometer (MODIS) global fire products within Central Asian dry lands and use these products to characterize fire occurrence between 2001 and 2009. The results show that on average ˜15 million ha of land burns annually across Central Asia with the majority of the area burned in August and September in grasslands. Fire is used as a common crop residue management practice across the region. Nearly 89% of all burning occurs in Kazakhstan, where 5% and 3% of croplands and grasslands, respectively, are burned annually.
Iron storage disease in Asia-Pacific populations: the importance of non-HFE mutations.
McDonald, Cameron J; Wallace, Daniel F; Crawford, Darrell H G; Subramaniam, V Nathan
2013-07-01
Hereditary hemochromatosis (HH) is a widely recognized and well-studied condition in European populations. This is largely due to the high prevalence of the C282Y mutation of HFE. Although less common than in Europe, HH cases have been reported in the Asia-Pacific region because of mutations in both HFE and non-HFE genes. Mutations in all of the currently known genes implicated in non-HFE HH (hemojuvelin, hepcidin, transferrin receptor 2, and ferroportin) have been reported in patients from the Asia-Pacific region. This review discusses the molecular basis of HH and the genes and mutations known to cause non-HFE HH with particular reference to the Asia-Pacific region. Challenges in the genetic diagnosis of non-HFE HH are also discussed and how new technologies such as next generation sequencing may be informative in the future. © 2013 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.
Characterization of the MLO gene family in Rosaceae and gene expression analysis in Malus domestica.
Pessina, Stefano; Pavan, Stefano; Catalano, Domenico; Gallotta, Alessandra; Visser, Richard G F; Bai, Yuling; Malnoy, Mickael; Schouten, Henk J
2014-07-22
Powdery mildew (PM) is a major fungal disease of thousands of plant species, including many cultivated Rosaceae. PM pathogenesis is associated with up-regulation of MLO genes during early stages of infection, causing down-regulation of plant defense pathways. Specific members of the MLO gene family act as PM-susceptibility genes, as their loss-of-function mutations grant durable and broad-spectrum resistance. We carried out a genome-wide characterization of the MLO gene family in apple, peach and strawberry, and we isolated apricot MLO homologs through a PCR-approach. Evolutionary relationships between MLO homologs were studied and syntenic blocks constructed. Homologs that are candidates for being PM susceptibility genes were inferred by phylogenetic relationships with functionally characterized MLO genes and, in apple, by monitoring their expression following inoculation with the PM causal pathogen Podosphaera leucotricha. Genomic tools available for Rosaceae were exploited in order to characterize the MLO gene family. Candidate MLO susceptibility genes were identified. In follow-up studies it can be investigated whether silencing or a loss-of-function mutations in one or more of these candidate genes leads to PM resistance.
Gene, protein, and network of male sterility in rice
Wang, Kun; Peng, Xiaojue; Ji, Yanxiao; Yang, Pingfang; Zhu, Yingguo; Li, Shaoqing
2013-01-01
Rice is one of the most important model crop plants whose heterosis has been well-exploited in commercial hybrid seed production via a variety of types of male-sterile lines. Hybrid rice cultivation area is steadily expanding around the world, especially in Southern Asia. Characterization of genes and proteins related to male sterility aims to understand how and why the male sterility occurs, and which proteins are the key players for microspores abortion. Recently, a series of genes and prot...
Veldman, Kees; Kant, Arie; Dierikx, Cindy; van Essen-Zandbergen, Alieda; Wit, Ben; Mevius, Dik
2014-05-02
Since multidrug resistant bacteria are frequently reported from Southeast Asia, our study focused on the occurrence of ESBL-producing Enterobacteriaceae in fresh imported herbs from Thailand, Vietnam and Malaysia. Samples were collected from fresh culinary herbs imported from Southeast Asia in which ESBL-suspected isolates were obtained by selective culturing. Analysis included identification by MALDI-TOF mass spectrometry, susceptibility testing, XbaI-PFGE, microarray, PCR and sequencing of specific ESBL genes, PCR based replicon typing (PBRT) of plasmids and Southern blot hybridization. In addition, the quinolone resistance genotype was characterized by screening for plasmid mediated quinolone resistance (PMQR) genes and mutations in the quinolone resistance determining region (QRDR) of gyrA and parC. The study encompassed fifty samples of ten batches of culinary herbs (5 samples per batch) comprising nine different herb variants. The herbs originated from Thailand (Water morning glory, Acacia and Betel leaf), Vietnam (Parsley, Asian pennywort, Houttuynia leaf and Mint) and Malaysia (Holy basil and Parsley). By selective culturing 21 cefotaxime resistant Enterobacteriaceae were retrieved. Array analysis revealed 18 isolates with ESBL genes and one isolate with solely non-ESBL beta-lactamase genes. Mutations in the ampC promoter region were determined in two isolates with PCR and sequencing. The isolates were identified as Klebsiella pneumoniae (n=9), Escherichia coli (n=6), Enterobacter cloacae complex (n=5) and Enterobacter spp. (n=1). All isolates tested were multidrug resistant. Variants of CTX-M enzymes were predominantly found followed by SHV enzymes. PMQR genes (including aac(6')-1b-cr, qnrB and qnrS) were also frequently detected. In almost all cases ESBL and quinolone resistance genes were located on the same plasmid. Imported fresh culinary herbs from Southeast Asia are a potential source for contamination of food with multidrug resistant bacteria
Integrated spatiotemporal characterization of dust sources and outbreaks in Central and East Asia
Darmenova, Kremena T.
The potential of atmospheric dust aerosols to modify the Earth's environment and climate has been recognized for some time. However, predicting the diverse impact of dust has several significant challenges. One is to quantify the complex spatial and temporal variability of dust burden in the atmosphere. Another is to quantify the fraction of dust originating from human-made sources. This thesis focuses on the spatiotemporal characterization of sources and dust outbreaks in Central and East Asia by integrating ground-based data, satellite multisensor observations, and modeling. A new regional dust modeling system capable of operating over a span of scales was developed. The modeling system consists of a dust module DuMo, which incorporates several dust emission schemes of different complexity, and the PSU/NCAR mesoscale model MM5, which offers a variety of physical parameterizations and flexible nesting capability. The modeling system was used to perform for the first time a comprehensive study of the timing, duration, and intensity of individual dust events in Central and East Asia. Determining the uncertainties caused by the choice of model physics, especially the boundary layer parameterization, and the dust production scheme was the focus of our study. Implications to assessments of the anthropogenic dust fraction in these regions were also addressed. Focusing on Spring 2001, an analysis of routine surface meteorological observations and satellite multi-sensor data was carried out in conjunction with modeling to determine the extent to which integrated data set can be used to characterize the spatiotemporal distribution of dust plumes at a range of temporal scales, addressing the active dust sources in China and Mongolia, mid-range transport and trans-Pacific, long-range transport of dust outbreaks on a case-by-case basis. This work demonstrates that adequate and consistent characterization of individual dust events is central to establishing a reliable
Directory of Open Access Journals (Sweden)
Raghavendra Sumanth Pudupakam
2017-03-01
Full Text Available Aim: Sequence analysis and phylogenetic studies based on non-structural protein-3 (NS3 gene are important in understanding the evolution and epidemiology of bluetongue virus (BTV. This study was aimed at characterizing the NS3 gene sequence of Indian BTV serotype-2 (BTV2 to elucidate its genetic relationship to global BTV isolates. Materials and Methods: The NS3 gene of BTV2 was amplified from infected BHK-21 cell cultures, cloned and subjected to sequence analysis. The generated NS3 gene sequence was compared with the corresponding sequences of different BTV serotypes across the world, and a phylogenetic relationship was established. Results: The NS3 gene of BTV2 showed moderate levels of variability in comparison to different BTV serotypes, with nucleotide sequence identities ranging from 81% to 98%. The region showed high sequence homology of 93-99% at amino acid level with various BTV serotypes. The PPXY/PTAP late domain motifs, glycosylation sites, hydrophobic domains, and the amino acid residues critical for virus-host interactions were conserved in NS3 protein. Phylogenetic analysis revealed that BTV isolates segregate into four topotypes and that the Indian BTV2 in subclade IA is closely related to Asian and Australian origin strains. Conclusion: Analysis of the NS3 gene indicated that Indian BTV2 isolate is closely related to strains from Asia and Australia, suggesting a common origin of infection. Although the pattern of evolution of BTV2 isolate is different from other global isolates, the deduced amino acid sequence of NS3 protein demonstrated high molecular stability.
Pudupakam, Raghavendra Sumanth; Raghunath, Shobana; Pudupakam, Meghanath; Daggupati, Sreenivasulu
2017-03-01
Sequence analysis and phylogenetic studies based on non-structural protein-3 (NS3) gene are important in understanding the evolution and epidemiology of bluetongue virus (BTV). This study was aimed at characterizing the NS3 gene sequence of Indian BTV serotype-2 (BTV2) to elucidate its genetic relationship to global BTV isolates. The NS3 gene of BTV2 was amplified from infected BHK-21 cell cultures, cloned and subjected to sequence analysis. The generated NS3 gene sequence was compared with the corresponding sequences of different BTV serotypes across the world, and a phylogenetic relationship was established. The NS3 gene of BTV2 showed moderate levels of variability in comparison to different BTV serotypes, with nucleotide sequence identities ranging from 81% to 98%. The region showed high sequence homology of 93-99% at amino acid level with various BTV serotypes. The PPXY/PTAP late domain motifs, glycosylation sites, hydrophobic domains, and the amino acid residues critical for virus-host interactions were conserved in NS3 protein. Phylogenetic analysis revealed that BTV isolates segregate into four topotypes and that the Indian BTV2 in subclade IA is closely related to Asian and Australian origin strains. Analysis of the NS3 gene indicated that Indian BTV2 isolate is closely related to strains from Asia and Australia, suggesting a common origin of infection. Although the pattern of evolution of BTV2 isolate is different from other global isolates, the deduced amino acid sequence of NS3 protein demonstrated high molecular stability.
Bhalla, Devender; Tchalla, Achille Edem; Marin, Benoît; Ngoungou, Edgard Brice; Tan, Chong Tin; Preux, Pierre-Marie
2014-09-01
Is epilepsy truly an "African ailment"? We aimed to determine this, since international health agencies often refer to epilepsy as an African disease and the scientific literature has spoken the same tone. Various published materials, mainly reports, articles, were used to gather Asian and African evidence on various aspects of epilepsy and many of its risk and associated factors. Our results suggest that in no way can epilepsy be considered as an African ailment and such characterization is most likely based on popular beliefs rather than scientific evidence. In comparison to Africa, Asia has a 5.0% greater burden from all diseases, and is 17.0% more affected from neuropsychiatric disorders (that include epilepsy). Given that more countries in Asia are transitioning, there may be large demographic and lifestyle changes in the near future. However these changes are nowhere close to those expected in Africa. Moreover, 23 million Asians have epilepsy in comparison to 3.3 million Africans and 1.2 million sub-Saharan Africans. In comparison to Africa, Asia has more untreated patients, 55.0% more additional epilepsy cases every year, because of its larger population, with greater treatment cost and possibly higher premature mortality. Of several associated factors discussed herein, many have more importance for Asia than Africa. The current state of epilepsy in Asia is far less than ideal and there is an urgent need to recognize and accept the importance of epilepsy in Asia. In no way can epilepsy be considered as an African ailment. This is most likely based on popular beliefs rather than scientific evidence. A PowerPoint slide summarizing this article is available for download in the Supporting Information section here. Wiley Periodicals, Inc. © 2014 International League Against Epilepsy.
Directory of Open Access Journals (Sweden)
Wang Lirong
2016-03-01
Full Text Available Braya humilis (Brassicaceae is a widely distributed plant in arid and semi-arid regions of northern Asia. This plant is well adapted to extremely arid conditions and is a promising candidate species to discover novel drought tolerance strategies. However, not much information about the mechanism(s mediating drought resistance in this species is currently available. Therefore, the present study aimed to characterize the physiological traits and expression patterns of a polyethylene glycol (PEG-responsive gene in B. humilis responding to different levels of osmotic stress induced by PEG-6000. Several important physiological parameters were examined, including the levels of relative water content, soluble protein, malondialdehyde, and antioxidant enzyme activity. A tolerance threshold between 20 and 30% PEG-6000 was identified for B. humilis. The water status and oxidative damage below this threshold were maintained at a relatively constant level during the 12 h of treatment. However, once the threshold was exceeded, the water status and oxidative damage were obviously affected after treatment for 4 h. The soluble protein results suggest that B. humilis maintains a vigorous resistance to osmotic stress and that it may play a greater role in osmotic regulation at late stages of stress. Moreover, superoxide dismutase and catalase may be important at preventing oxidative damage in plants at early stages of stress, while peroxidase may be more involved in some biological processes that resist osmotic stress at the late stage, especially in severely damaged plants. Furthermore, a PEG-responsive gene, BhCIPK12, was identified by differential display reverse transcription-polymerase chain reaction (PCR, cloned, and characterized by quantitative real-time PCR. We hypothesized that this gene may play an important role in mediating osmotic stress or drought resistance in plants. Altogether, these results provide valuable insights into the mechanism
Governing Rapid Growth in Asia: State-led Development in Historical Perspective
T-W. Ngo (Tak-Wing)
2009-01-01
textabstractRapid growth in Asia has often been explained in terms of effective policies pursued by a “developmental state”. In particular, countries in East Asia are said to be characterized by the presence of a strong state with technocratic capacity and social embeddedness. This inaugural address
Characterization and phylogenetic analysis of α-gliadin gene ...
Indian Academy of Sciences (India)
Home; Journals; Journal of Genetics; Volume 93; Issue 3 ... Research Article Volume 93 Issue 3 December 2014 pp 725-731 ... Although the unique properties of wheat -gliadin gene family are well characterized, little is known about the evolution and genomic divergence of -gliadin gene family within the Triticeae.
Characterization of Genes for Beef Marbling Based on Applying Gene Coexpression Network
Directory of Open Access Journals (Sweden)
Dajeong Lim
2014-01-01
Full Text Available Marbling is an important trait in characterization beef quality and a major factor for determining the price of beef in the Korean beef market. In particular, marbling is a complex trait and needs a system-level approach for identifying candidate genes related to the trait. To find the candidate gene associated with marbling, we used a weighted gene coexpression network analysis from the expression value of bovine genes. Hub genes were identified; they were topologically centered with large degree and BC values in the global network. We performed gene expression analysis to detect candidate genes in M. longissimus with divergent marbling phenotype (marbling scores 2 to 7 using qRT-PCR. The results demonstrate that transmembrane protein 60 (TMEM60 and dihydropyrimidine dehydrogenase (DPYD are associated with increasing marbling fat. We suggest that the network-based approach in livestock may be an important method for analyzing the complex effects of candidate genes associated with complex traits like marbling or tenderness.
Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression.
1996-10-01
AD GRANT NUMBER DAMDI7-94-J-4041 TITLE: Cloning and Characterizing Genes Involved in Monoterpene Induced Mammary Tumor Regression PRINCIPAL...October 1996 Annual (1 Sep 95 - 31 Aug 96) 4. TITLE AND SUBTITLE 5. FUNDING NUMBERS Cloning and Characterizing Genes Involved in Monoterpene Induced... Monoterpene -induced/repressed genes were identified in regressing rat mammary carcinomas treated with dietary limonene using a newly developed method
Isolation and characterization of LHY homolog gene expressed in ...
African Journals Online (AJOL)
STORAGESEVER
2008-05-02
May 2, 2008 ... responsible in negative feedback loop reaction of central oscillator in plant circadian clock system. The level of gene expression was found to be high four hours after dawn in flowering shoots and flower. This paper reported the isolation and characterization of the gene. Key words: LHY gene, circadian ...
Characterizing Aerosols over Southeast Asia using the AERONET Data Synergy Tool
Giles, David M.; Holben, Brent N.; Eck, Thomas F.; Slutsker, Ilya; Slutsker, Ilya; Welton, Ellsworth, J.; Chin, Mian; Kucsera, Thomas; Schmaltz, Jeffery E.; Diehl, Thomas;
2007-01-01
Biomass burning, urban pollution and dust aerosols have significant impacts on the radiative forcing of the atmosphere over Asia. In order to better quanti@ these aerosol characteristics, the Aerosol Robotic Network (AERONET) has established over 200 sites worldwide with an emphasis in recent years on the Asian continent - specifically Southeast Asia. A total of approximately 15 AERONET sun photometer instruments have been deployed to China, India, Pakistan, Thailand, and Vietnam. Sun photometer spectral aerosol optical depth measurements as well as microphysical and optical aerosol retrievals over Southeast Asia will be analyzed and discussed with supporting ground-based instrument, satellite, and model data sets, which are freely available via the AERONET Data Synergy tool at the AERONET web site (http://aeronet.gsfc.nasa.gov). This web-based data tool provides access to groundbased (AERONET and MPLNET), satellite (MODIS, SeaWiFS, TOMS, and OMI) and model (GOCART and back trajectory analyses) databases via one web portal. Future development of the AERONET Data Synergy Tool will include the expansion of current data sets as well as the implementation of other Earth Science data sets pertinent to advancing aerosol research.
Disease gene characterization through large-scale co-expression analysis.
Directory of Open Access Journals (Sweden)
Allen Day
2009-12-01
Full Text Available In the post genome era, a major goal of biology is the identification of specific roles for individual genes. We report a new genomic tool for gene characterization, the UCLA Gene Expression Tool (UGET.Celsius, the largest co-normalized microarray dataset of Affymetrix based gene expression, was used to calculate the correlation between all possible gene pairs on all platforms, and generate stored indexes in a web searchable format. The size of Celsius makes UGET a powerful gene characterization tool. Using a small seed list of known cartilage-selective genes, UGET extended the list of known genes by identifying 32 new highly cartilage-selective genes. Of these, 7 of 10 tested were validated by qPCR including the novel cartilage-specific genes SDK2 and FLJ41170. In addition, we retrospectively tested UGET and other gene expression based prioritization tools to identify disease-causing genes within known linkage intervals. We first demonstrated this utility with UGET using genetically heterogeneous disorders such as Joubert syndrome, microcephaly, neuropsychiatric disorders and type 2 limb girdle muscular dystrophy (LGMD2 and then compared UGET to other gene expression based prioritization programs which use small but discrete and well annotated datasets. Finally, we observed a significantly higher gene correlation shared between genes in disease networks associated with similar complex or Mendelian disorders.UGET is an invaluable resource for a geneticist that permits the rapid inclusion of expression criteria from one to hundreds of genes in genomic intervals linked to disease. By using thousands of arrays UGET annotates and prioritizes genes better than other tools especially with rare tissue disorders or complex multi-tissue biological processes. This information can be critical in prioritization of candidate genes for sequence analysis.
Directory of Open Access Journals (Sweden)
Kenji Fukunaga
2015-12-01
Full Text Available We investigated genetic variation of a rice HEADING DATE 1(HD1 homolog in foxtail millet. First, we searched for a rice HD1 homolog in a foxtail millet genome sequence and designed primers to amplify the entire coding sequence of the gene. We compared full HD1 gene sequences of 11 accessions (including Yugu 1, a Chinese cultivar used for genome sequencing from various regions in Europe and Asia, found a nucleotide substitution at a putative splice site of intron 1, and designated the accessions with the nucleotide substitution as carrying a splicing variant. We verified by RT-PCR that this single nucleotide substitution causes aberrant splicing of intron 1. We investigated the geographical distribution of the splicing variant in 480 accessions of foxtail millet from various regions of Europe and Asia and part of Africa by dCAPS and found that the splicing variant is broadly distributed in Europe and Asia. Differences of heading times between accessions with wild type allele of the HD1 gene and those with the splicing variant allele were unclear. We also investigated variation in 13 accessions of ssp. viridis, the wild ancestor, and the results suggested that the wild type is predominant in the wild ancestor.
Isolation and characterization of an isoamylase gene from rye
Directory of Open Access Journals (Sweden)
Ke Zheng
2013-12-01
Full Text Available Genomic DNA and cDNA sequences of an isoamylase gene were isolated and characterized from the rye genome. The full-lengths of the rye isoamylase gene are 7351 bp for genomic DNA and 2364 bp for cDNA. There are 18 exons and 17 introns in the genomic sequence, which shares a similar organization with homologous genes from Aegilops tauschii, maize, rice and Arabidopsis. Exon regions of rye and other plant isoamylase genes are more conserved than the introns. High sequence similarity (> 95% was observed in mature proteins of isoamylase genes originating from rye, Ae. tauschii, wheat and barley. The transcript profile revealed that rye isoamylase is mainly expressed in the seed endosperm with a maximum level at the middle developmental stage (15 DPA. A phylogenetic tree based on the deduced aa sequences of mature proteins from rye and other plant isoamylases indicated that rye isoamylase is more closely related to Ae. tauschii wDBE1 and wheat iso1. This is the first report on identification and characterization of the isoamylase gene from rye, making it possible to explore the roles of this enzyme for amylopectin development in rye and triticale.
Isolation and characterization of resistant gene analogs in cassava ...
African Journals Online (AJOL)
These candidate sequences mapped to the draft cassava genome with high sequence similarity to predicted NBS-LRR genes. These novel sequences may serve as a stepping stone for further characterization and experimental validation of predicted R genes in the draft cassava genome, ultimately leading to the ...
Brodzik, M. J.; Armstrong, R. L.; Khalsa, S. J. S.; Painter, T. H.; Racoviteanu, A.; Rittger, K.
2014-12-01
Ice melt from mountain glaciers can represent a significant contribution to freshwater hydrological budgets, along with seasonal snow melt, rainfall and groundwater. In the rivers of High Asia, understanding the proportion of glacier ice melt is critical for water resource management of irrigation and planning for hydropower generation and human consumption. Current climate conditions are producing heterogeneous glacier responses across the Hindu Kush-Karakoram-Himalayan ranges. However, it is not yet clear how contrasting glacier patterns affect regional water resources. For example, in the Upper Indus basin, estimates of glacial contribution to runoff are often not distinguished from seasonal snow contribution, and vary widely, from as little as 15% to as much as 55%. While many studies are based on reasonable concepts, most are based on assumptions uninformed by actual snow or ice cover measurements. While straightforward temperature index models have been used to estimate glacier runoff in some Himalayan basins, application of these models in larger Himalayan basins is limited by difficulties in estimating key model parameters, particularly air temperature. Estimating glacial area from the MODIS Permanent Snow and Ice Extent (MODICE) product for the years 2000-2013, with recently released Shuttle Radar Topography Mission (SRTMGL3) elevation data, we use a simple ablation gradient approach to calculate an upper limit on the contribution of clean glacier ice melt to streamflow data. We present model results for the five major rivers with glaciated headwaters in High Asia: the Bramaputra, Ganges, Indus, Amu Darya and Syr Darya. Using GRDC historical discharge records, we characterize the annual contribution from glacier ice melt. We use MODICE interannual trends in each basin to estimate glacier ice melt uncertainties. Our results are being used in the USAID project, Contribution to High Asia Runoff from Ice and Snow (CHARIS), to inform regional-scale planning for
Bioinformatic prediction and functional characterization of human KIAA0100 gene
Directory of Open Access Journals (Sweden)
He Cui
2017-02-01
Full Text Available Our previous study demonstrated that human KIAA0100 gene was a novel acute monocytic leukemia-associated antigen (MLAA gene. But the functional characterization of human KIAA0100 gene has remained unknown to date. Here, firstly, bioinformatic prediction of human KIAA0100 gene was carried out using online softwares; Secondly, Human KIAA0100 gene expression was downregulated by the clustered regularly interspaced short palindromic repeats (CRISPR/CRISPR-associated (Cas 9 system in U937 cells. Cell proliferation and apoptosis were next evaluated in KIAA0100-knockdown U937 cells. The bioinformatic prediction showed that human KIAA0100 gene was located on 17q11.2, and human KIAA0100 protein was located in the secretory pathway. Besides, human KIAA0100 protein contained a signalpeptide, a transmembrane region, three types of secondary structures (alpha helix, extended strand, and random coil , and four domains from mitochondrial protein 27 (FMP27. The observation on functional characterization of human KIAA0100 gene revealed that its downregulation inhibited cell proliferation, and promoted cell apoptosis in U937 cells. To summarize, these results suggest human KIAA0100 gene possibly comes within mitochondrial genome; moreover, it is a novel anti-apoptotic factor related to carcinogenesis or progression in acute monocytic leukemia, and may be a potential target for immunotherapy against acute monocytic leukemia.
Preparation and characterization of magnetic gene vectors for targeting gene delivery
Energy Technology Data Exchange (ETDEWEB)
Zheng, S.W.; Liu, G. [College of Chemistry, Chemical Engineering and Materials Science and Key Laboratory of Organic Synthesis of Jiangsu Province, Soochow University, SIP, Suzhou 215123 (China); Hong, R.Y., E-mail: rhong@suda.edu.cn [College of Chemistry, Chemical Engineering and Materials Science and Key Laboratory of Organic Synthesis of Jiangsu Province, Soochow University, SIP, Suzhou 215123 (China); State Key Laboratory of Multi-phase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100080 (China); Li, H.Z. [State Key Laboratory of Multi-phase Complex Systems, Institute of Process Engineering, Chinese Academy of Sciences, Beijing 100080 (China); Li, Y.G., E-mail: ilguoliang@sohu.com [Department of radiology, the First Affiliated Hospital of Soochow University, Suzhou 215007 (China); Wei, D.G., E-mail: dougwei@deas.harvard.edu [Center for Nanoscale Systems, School of Engineering and Applied Science, Harvard University, 11 Oxford Street, Cambridge, MA 02139 (United States)
2012-10-15
Highlights: Black-Right-Pointing-Pointer PEI is ideal candidate polymer for the design of gene delivery systems. Black-Right-Pointing-Pointer PEI-CMD-MNPs exhibited a typical superparamagnetic behavior. Black-Right-Pointing-Pointer PEI-CMD-MNPs were well stable over the entire range of pH and NaCl concentration. Black-Right-Pointing-Pointer DNA-PEI-CMD-MNPs transfected cells by a magnet have higher transfection efficiency and gene expression efficiency. - Abstract: The PEI-CMD-MNPs were successfully prepared by the surface modification of magnetic Fe{sub 3}O{sub 4} nanoparticles with carboxymethyl dextran (CMD) and polyethyleneimine (PEI). The PEI-CMD-MNPs polyplexes exhibited a typical superparamagnetic behavior and were well stable over the entire range of pH and NaCl concentration. These PEI-CMD-MNPs were used as magnetic gene vectors for targeting gene delivery. The prepared MNPs at different surface modification stages were characterized using Fourier transform infrared (FT-IR), thermogravimetric analysis (TGA), field emissions canning electron microscopy (FE-SEM), powder X-ray diffraction (XRD) and dynamic laser light scattering (DLS) analysis. The magnetic properties were studied by vibrating sample magnetometer (VSM). To evaluate the performance of the magnetic nanoparticles as gene transfer vector, the PEI-CMD-MNPs were used to delivery green fluorescent protein (GFP) gene into BHK21 cells. The expression of GFP gene was detected by fluorescence microscope. DNA-PEI-CMD-MNPs polyplexes absorbed by the cells were also monitored by Magnetic resonance imaging (MRI). The transfection efficiency and gene expression efficiency of that transfected with a magnet were much higher than that of standard transfection.
Characterization of MORE AXILLARY GROWTH genes in Populus.
Directory of Open Access Journals (Sweden)
Olaf Czarnecki
Full Text Available Strigolactones are a new class of plant hormones that play a key role in regulating shoot branching. Studies of branching mutants in Arabidopsis, pea, rice and petunia have identified several key genes involved in strigolactone biosynthesis or signaling pathway. In the model plant Arabidopsis, MORE AXILLARY GROWTH1 (MAX1, MAX2, MAX3 and MAX4 are four founding members of strigolactone pathway genes. However, little is known about the strigolactone pathway genes in the woody perennial plants.Here we report the identification of MAX homologues in the woody model plant Populus trichocarpa. We identified the sequence homologues for each MAX protein in P. trichocarpa. Gene expression analysis revealed that Populus MAX paralogous genes are differentially expressed across various tissues and organs. Furthermore, we showed that Populus MAX genes could complement or partially complement the shoot branching phenotypes of the corresponding Arabidopsis max mutants.This study provides genetic evidence that strigolactone pathway genes are likely conserved in the woody perennial plants and lays a foundation for further characterization of strigolactone pathway and its functions in the woody perennial plants.
International Nuclear Information System (INIS)
Miller, Mark A.; Knobelspiesse, Kirk; Frouin, Robert; Bartholomew, Mary Jane; Reynolds, R. Michael; Pietras, Christophe; Fargion, Giulietta; Quinn, Patricia; Thieuleux, Francois
2005-01-01
Marine sunphotometer measurements collected aboard the R/V Ronald H. Brown during the Aerosol Characterization Experiment - Asia (ACE-Asia) are used to evaluate the ability of complementary instrumentation to obtain the best possible estimates of aerosol optical thickness and Angstrom exponent from ships at sea. A wide range of aerosol conditions, including clean maritime conditions and highly polluted coastal environments, were encountered during the ACE-Asia cruise. The results of this study suggest that shipboard hand-held sunphotometers and fast-rotating shadow-band radiometers (FRSRs) yield similar measurements and uncertainties if proper measurement protocols are used and if the instruments are properly calibrated. The automated FRSR has significantly better temporal resolution (2 min) than the hand-held sunphotometers when standard measurement protocols are used, so it more faithfully represents the variability of the local aerosol structure in polluted regions. Conversely, results suggest that the hand-held sunphotometers may perform better in clean, maritime air masses for unknown reasons. Results also show that the statistical distribution of the Angstrom exponent measurements is different when the distributions from hand-held sunphotometers are compared with those from the FRSR and that the differences may arise from a combination of factors
COGNATE: comparative gene annotation characterizer.
Wilbrandt, Jeanne; Misof, Bernhard; Niehuis, Oliver
2017-07-17
The comparison of gene and genome structures across species has the potential to reveal major trends of genome evolution. However, such a comparative approach is currently hampered by a lack of standardization (e.g., Elliott TA, Gregory TR, Philos Trans Royal Soc B: Biol Sci 370:20140331, 2015). For example, testing the hypothesis that the total amount of coding sequences is a reliable measure of potential proteome diversity (Wang M, Kurland CG, Caetano-Anollés G, PNAS 108:11954, 2011) requires the application of standardized definitions of coding sequence and genes to create both comparable and comprehensive data sets and corresponding summary statistics. However, such standard definitions either do not exist or are not consistently applied. These circumstances call for a standard at the descriptive level using a minimum of parameters as well as an undeviating use of standardized terms, and for software that infers the required data under these strict definitions. The acquisition of a comprehensive, descriptive, and standardized set of parameters and summary statistics for genome publications and further analyses can thus greatly benefit from the availability of an easy to use standard tool. We developed a new open-source command-line tool, COGNATE (Comparative Gene Annotation Characterizer), which uses a given genome assembly and its annotation of protein-coding genes for a detailed description of the respective gene and genome structure parameters. Additionally, we revised the standard definitions of gene and genome structures and provide the definitions used by COGNATE as a working draft suggestion for further reference. Complete parameter lists and summary statistics are inferred using this set of definitions to allow down-stream analyses and to provide an overview of the genome and gene repertoire characteristics. COGNATE is written in Perl and freely available at the ZFMK homepage ( https://www.zfmk.de/en/COGNATE ) and on github ( https
Integrative characterization of germ cell-specific genes from mouse spermatocyte UniGene library
Directory of Open Access Journals (Sweden)
Eddy Edward M
2007-07-01
Full Text Available Abstract Background The primary regulator of spermatogenesis, a highly ordered and tightly regulated developmental process, is an intrinsic genetic program involving male germ cell-specific genes. Results We analyzed the mouse spermatocyte UniGene library containing 2155 gene-oriented transcript clusters. We predict that 11% of these genes are testis-specific and systematically identified 24 authentic genes specifically and abundantly expressed in the testis via in silico and in vitro approaches. Northern blot analysis disclosed various transcript characteristics, such as expression level, size and the presence of isoform. Expression analysis revealed developmentally regulated and stage-specific expression patterns in all of the genes. We further analyzed the genes at the protein and cellular levels. Transfection assays performed using GC-2 cells provided information on the cellular characteristics of the gene products. In addition, antibodies were generated against proteins encoded by some of the genes to facilitate their identification and characterization in spermatogenic cells and sperm. Our data suggest that a number of the gene products are implicated in transcriptional regulation, nuclear integrity, sperm structure and motility, and fertilization. In particular, we found for the first time that Mm.333010, predicted to contain a trypsin-like serine protease domain, is a sperm acrosomal protein. Conclusion We identify 24 authentic genes with spermatogenic cell-specific expression, and provide comprehensive information about the genes. Our findings establish a new basis for future investigation into molecular mechanisms underlying male reproduction.
Characterization of rabies virus from a human case in Nepal.
Pant, G R; Horton, D L; Dahal, M; Rai, J N; Ide, S; Leech, S; Marston, D A; McElhinney, L M; Fooks, A R
2011-04-01
Rabies is endemic throughout most of Asia, with the majority of human cases transmitted by domestic dogs (Canis familiaris). Here, we report a case of rabies in a 12-year-old girl in the Lalitpur district of Nepal that might have been prevented by better public awareness and timely post-exposure prophylaxis. Molecular characterization of the virus showed 100% identity over a partial nucleoprotein gene sequence to previous isolates from Nepal belonging to the 'arctic-like' lineage of rabies virus. Sequence analysis of both partial nucleoprotein and glycoprotein genes showed differences in consensus sequence after passage in vitro but not after passage in vivo.
Sustainable transport studies in Asia
Zhang, Junyi
2013-01-01
This book aims to provide a good understanding of and perspective on sustainable transport in Asia by focusing on economic, environmental, and social sustainability. It is widely acknowledged that the current situation and trends in transport are not always sustainable in Asia, due in part to the fast-growing economy and the astounding speed of urbanization as well as least-mature governance. As essential research material, the book provides strong support for policy makers and planners by comprehensively covering three groups of strategies, characterized by the words “avoid” (e.g., urban form design and control of car ownership), “shift” (e.g., establishing comprehensive transportation systems and increasing public transportation systems for both intracity and intercity travel), and “improve” (e.g., redesign of paratransit system, low-emission vehicles, intelligent transportation systems, and eco-life). These are elaborated in the book alongside consideration of the uncertainty of policy effects ...
Characterizing the anthropogenic signature in the LCLU dynamics in the Central Asia region
Tatarskii, V.; Sokolik, I. N.; de Beurs, K.; Shiklomanov, A. I.
2017-12-01
Humans have been changing the LCLU dynamics over time through the world. In the Central Asia region, these changes have been especially pronounced due to the political and economic transformation. We present a detailed analysis, focusing on identifying and quantifying the anthropogenic signature in the water and land use across the region. We have characterized the anthropogenic dust emission by combining the modeling and observations. The model is a fully coupled model called WRF-Chem-DuMo that takes explicitly into account the vegetation treatment in modeling the dust emission. We have reconstructed the anthropogenic dust sources in the region, such as the retreat of the Aral Sea, changes in agricultural fields, etc. In addition, we characterize the anthropogenic water use dynamics, including the changes in the water use for the agricultural production. Furthermore, we perform an analysis to identify the anthropogenic signature in the NDVI pattern. The NDVI were analyzed in conjunction with the meteorological fields that were simulated at the high special resolution using the WRF model. Meteorological fields of precipitation and temperature were used for the correlation analysis to separate the natural vs. anthropogenic changes. In this manner, we were able to identify the regions that have been affected by human activities. We will present the quantitative assessment of the anthropogenic changes. The diverse consequences for the economy of the region, as well as, the environment will be addressed.
Casein genes of Bos taurus. II. Isolation and characterization of the β-casein gene
International Nuclear Information System (INIS)
Gorodetskii, S.I.; Tkach, T.M.; Kapelinskaya, T.V.
1988-01-01
The expression of the casein genes in the cells of the mammary gland is regulated by peptide and steroid hormones. In order to study the controlling mechanisms we have isolated and characterized the β-casein gene. The gene is 8.6 kb long and exceeds by a factor of 7.8 the length of the corresponding mRNA which is encoded by nine exons. The genomic clones incorporate in addition 8.5 kb and 4.5 kb of the 5'- and 3'-flanking regions. We have determined the sequence of the 5- and 3-terminals of the gene and have performed a comparative analysis of the corresponding regions of the rat β-casein gene. Furthermore we have identified the conversed sequences identical or homologous to the potential sections of binding to the nuclear factor CTF/NF-1 by glucocorticoid and progesterone receptors. The regulatory region of the bovine casein gene contains two variants of the TATA signal, flanking the duplication section in the promoter region
Lu, Kai; Wang, Ying; Chen, Xia; Zhang, Zhichao; Li, Yue; Li, Wenru; Zhou, Qiang
2017-12-01
The widespread and extensive application of insecticides have promoted the development of resistance in the brown planthopper Nilaparvata lugens (Stål), one of the most important rice pests in Asia. To better understand the underlying molecular mechanisms of metabolic resistance to insecticides, a chlorpyrifos-resistant (CR) strain of N. lugens was selected and its possible resistance mechanism was investigated. Synergistic tests using carboxylesterases (CarEs) inhibitor triphenyl phosphate (TPP) decreased the resistance of N. lugens to chlorpyrifos, and CarE activities could be induced by low concentrations of chlorpyrifos. Subsequently, a gene putatively encoding CarE, namely NlCarE, predominant in the midgut and ovary was isolated and characterized. The expression levels of NlCarE were detected and compared between the CR and a susceptible (SS) strain of N. lugens. Consistent with the increased CarE activity, this gene was overexpressed in the CR strain compared to the SS strain. The transcript levels of NlCarE were up-regulated by chlorpyrifos exposure, showing dose- and time-dependent expression patterns. Furthermore, RNA interference (RNAi)-mediated knockdown of NlCarE followed by insecticide application significantly increased the susceptibility of N. lugens to chlorpyrifos. These results demonstrate that NlCarE plays an important role in chlorpyrifos detoxification and its overexpression may be involved in chlorpyrifos resistance in N. lugens. Copyright © 2017 Elsevier Inc. All rights reserved.
New epidemiology of Staphylococcus aureus infection in Asia.
Chen, C-J; Huang, Y-C
2014-07-01
Not only is Asia the most populous region in the world, but inappropriate therapy, including self-medication with over-the-counter antimicrobial agents, is a common response to infectious diseases. The high antibiotic selective pressure among the overcrowded inhabitants creates an environment that is suitable for the rapid development and efficient spread of numerous multidrug-resistant pathogens. Indeed, Asia is among the regions with the highest prevalence rates of healthcare-associated methicillin-resistant Staphylococcus aureus (HA-MRSA) and community-associated methicillin-resistant S. aureus (CA-MRSA) in the world. Most hospitals in Asia are endemic for multidrug-resistant methicillin-resistant S. aureus (MRSA), with an estimated proportion from 28% (in Hong Kong and Indonesia) to >70% (in Korea) among all clinical S. aureus isolates in the early 2010s. Isolates with reduced susceptibility or a high level of resistance to glycopeptides have also been increasingly identified in the past few years. In contrast, the proportion of MRSA among community-associated S. aureus infections in Asian countries varies markedly, from 35%. Two pandemic HA-MRSA clones, namely multilocus sequence type (ST) 239 and ST5, are disseminated internationally in Asia, whereas the molecular epidemiology of CA-MRSA in Asia is characterized by clonal heterogeneity, similar to that in Europe. In this review, the epidemiology of S. aureus in both healthcare facilities and communities in Asia is addressed, with an emphasis on the prevalence, clonal structure and antibiotic resistant profiles of the MRSA strains. The novel MRSA strains from livestock animals have been considered to constitute a public health threat in western countries. The emerging livestock-associated MRSA strains in Asia are also included in this review. © 2014 The Authors Clinical Microbiology and Infection © 2014 European Society of Clinical Microbiology and Infectious Diseases.
Ullah, A; Jamal, S M; Romey, A; Gorna, K; Kakar, M A; Abbas, F; Ahmad, J; Zientara, S; Bakkali Kassimi, L
2017-10-01
This study reports characterization of foot-and-mouth disease virus (FMDV) in samples collected from Balochistan, Pakistan. FMDV was detected by pan-FMDV real-time RT-PCR in 31 samples (epithelial and oral swabs) collected in 2011 from clinical suspect cases. Of these, 29 samples were serotyped by serotype-specific real-time RT-PCR assays and were confirmed by sequencing the VP1 coding region. Sixteen samples were found positive for serotype A and eight for serotype Asia-1, whereas five samples were found positive for both serotypes A and Asia-1. Two serotype A positive samples were found positive for two different strains of serotype A FMDV each. Phylogenetic analyses of serotype A FMDVs showed circulation of at least three different sublineages within the A-Iran05 lineage. These included two earlier reported sublineages, A-Iran05 HER -10 and A-Iran05 FAR -11 , and a new sublineage, designated here as A-Iran05 BAL -11 . This shows that viruses belonging to the A-Iran05 lineage are continuously evolving in the region. Viruses belonging to the A-Iran05 FAR -11 sublineage showed close identity with the viruses circulating in 2009 in Pakistan and Afghanistan. However, viruses belonging to the A-Iran05 HER -10 detected in Balochistan, Pakistan, showed close identity with the viruses circulating in Kyrgyzstan, Iran and Kazakhstan in 2011 and 2012, showing that viruses responsible for outbreak in these countries have a common origin. Serotype Asia-1 FMDVs reported in this study all belonged to the earlier reported Group-VII (Sindh-08), which is currently a dominant strain in the West Eurasian region. Detection of two different serotypes of FMDV or/and two different strains of the same serotype in one animal/sample shows complexity in occurrence of FMD in the region. © 2016 Blackwell Verlag GmbH.
Dengue in the Americas and Southeast Asia: do they differ?
Halstead, Scott B
2006-12-01
The populations of Southeast Asia (SE Asia) and tropical America are similar, and all four dengue viruses of Asian origin are endemic in both regions. Yet, during comparable 5-year periods, SE Asia experienced 1.16 million cases of dengue hemorrhagic fever (DHF), principally in children, whereas in the Americas there were 2.8 million dengue fever (DF) cases, principally in adults, and only 65,000 DHF cases. This review aims to explain these regional differences. In SE Asia, World War II amplified Aedes aegypti populations and the spread of dengue viruses. In the Americas, efforts to eradicate A. aegypti in the 1940s and 1950s contained dengue epidemics mainly to the Caribbean Basin. Cuba escaped infections with the American genotype dengue-2 and an Asian dengue-3 endemic in the 1960s and 1970s. Successive infections with dengue-1 and an Asian genotype dengue-2 resulted in the 1981 DHF epidemic. When this dengue-2 virus was introduced in other Caribbean countries, it encountered populations highly immune to the American genotype dengue-2. During the 1980s and 1990s, rapidly expanding populations of A. aegypti in Brazil permitted successive epidemics of dengue-1, -2, and -3. These exposures, however, resulted mainly in DF, with surprisingly few cases of DHF. The absence of high rates of severe dengue disease in Brazil, as elsewhere in the Americas, may be partly explained by the widespread prevalence of human dengue resistance genes. Understanding the nature and distribution of these genes holds promise for containing severe dengue. Future research on dengue infections should emphasize population-based designs.
Dengue in the Americas and Southeast Asia: do they differ?
Directory of Open Access Journals (Sweden)
Scott B. Halstead
2006-12-01
Full Text Available The populations of Southeast Asia (SE Asia and tropical America are similar, and all four dengue viruses of Asian origin are endemic in both regions. Yet, during comparable 5-year periods, SE Asia experienced 1.16 million cases of dengue hemorrhagic fever (DHF, principally in children, whereas in the Americas there were 2.8 million dengue fever (DF cases, principally in adults, and only 65 000 DHF cases. This review aims to explain these regional differences. In SE Asia, World War II amplified Aedes aegypti populations and the spread of dengue viruses. In the Americas, efforts to eradicate A. aegypti in the 1940s and 1950s contained dengue epidemics mainly to the Caribbean Basin. Cuba escaped infections with the American genotype dengue-2 and an Asian dengue-3 endemic in the 1960s and 1970s. Successive infections with dengue-1 and an Asian genotype dengue-2 resulted in the 1981 DHF epidemic. When this dengue-2 virus was introduced in other Caribbean countries, it encountered populations highly immune to the American genotype dengue-2. During the 1980s and 1990s, rapidly expanding populations of A. aegypti in Brazil permitted successive epidemics of dengue-1, -2, and -3. These exposures, however, resulted mainly in DF, with surprisingly few cases of DHF. The absence of high rates of severe dengue disease in Brazil, as elsewhere in the Americas, may be partly explained by the widespread prevalence of human dengue resistance genes. Understanding the nature and distribution of these genes holds promise for containing severe dengue. Future research on dengue infections should emphasize population-based designs.
Gene cloning and characterization of NADH oxidase from ...
African Journals Online (AJOL)
The genome search of Thermococcus kodakarensis revealed three open reading frames, Tk0304, Tk1299 and Tk1392 annotated as nicotinamide adenine dinucleotide (NADH) oxidases. This study deals with cloning, and characterization of Tk0304. The gene, composed of 1320 nucleotides, encodes a protein of 439 ...
Linda S. Adair; David L. Andrews; John Cairney; Edward A. Funkhouser; Ronald J. Newton; Earl F. Aldon
1992-01-01
New techniques in molecular biology can be used to characterize genes whose expression is induced by drought stress. These techniques can be used to understand responses of range plants to environmental stresses at the biochemical and molecular level. For example, they can be used to characterize genes that respond to drought stress conditions in the native shrub
Measuring Pre-Service Teachers' Asia Literacy and Their Preparedness to Teach Asia
Grainger, Peter; Christie, Michael
2016-01-01
Asia literacy is a growing concern of the Federal Government in relation to the development of an Asia literate workforce. Despite 30 years of funded initiatives, the thought of teaching about Asia is a daunting one for pre-service teachers. This is due to the lack of Asia foci in university pre-service courses and complicated by the definition of…
Directory of Open Access Journals (Sweden)
Shuanghui Yin
Full Text Available Foot-and-mouth disease (FMD, caused by FMD virus (FMDV, is a highly contagious viral disease affecting cloven-hoofed animals. Camelids have a unique immunoglobulin profile, with the smallest functional heavy-chain antibodies (sdAb or VHH naturally devoid of light chains with antigen-binding capacity. We screened and characterized five sdAbs against FMDV by immunized library from C. bactrianus with Asia 1 virus-like particles (VLPs. Three of five recombinant sdAbs were stably expressed in E.coli, remained highly soluble, and were serotype-specific for VP1 protein of FMDV Asia 1 by ELISA. These failed to completely neutralize the Asia 1 virus. According to the KD value of binding affinity to three sdAbs, which ranged from 0.44 to 0.71 nm by SPR, sdAb-C6 was selected and conjugated with Zn/CdSe quantum dots (QDs to form a QDs-C6 probe, which was used to trace and image the subcellular location of FMDV in BHK-21 cells. The results show that FMD virions were observed from 3 h.p.i., and most of virions were distributed on one side of the nucleus in the cytoplasm. We demonstrate the utility of sdAbs as functionalized QDs are powerful tools for FMDV research.
Kumar, Kamal; Srivastava, Vikas; Purayannur, Savithri; Kaladhar, V Chandra; Cheruvu, Purnima Jaiswal; Verma, Praveen Kumar
2016-06-01
The WRKY genes have been identified as important transcriptional modulators predominantly during the environmental stresses, but they also play critical role at various stages of plant life cycle. We report the identification of WRKY domain (WD)-encoding genes from galegoid clade legumes chickpea (Cicer arietinum L.) and barrel medic (Medicago truncatula). In total, 78 and 98 WD-encoding genes were found in chickpea and barrel medic, respectively. Comparative analysis suggests the presence of both conserved and unique WRKYs, and expansion of WRKY family in M. truncatula primarily by tandem duplication. Exclusively found in galegoid legumes, CaWRKY16 and its orthologues encode for a novel protein having a transmembrane and partial Exo70 domains flanking a group-III WD. Genomic region of galegoids, having CaWRKY16, is more dynamic when compared with millettioids. In onion cells, fused CaWRKY16-EYFP showed punctate fluorescent signals in cytoplasm. The chickpea WRKY group-III genes were further characterized for their transcript level modulation during pathogenic stress and treatments of abscisic acid, jasmonic acid, and salicylic acid (SA) by real-time PCR. Differential regulation of genes was observed during Ascochyta rabiei infection and SA treatment. Characterization of A. rabiei and SA inducible gene CaWRKY50 showed that it localizes to plant nucleus, binds to W-box, and have a C-terminal transactivation domain. Overexpression of CaWRKY50 in tobacco plants resulted in early flowering and senescence. The in-depth comparative account presented here for two legume WRKY genes will be of great utility in hastening functional characterization of crop legume WRKYs and will also help in characterization of Exo70Js. © The Author 2016. Published by Oxford University Press on behalf of Kazusa DNA Research Institute.
Characterization and phylogenetic analysis of α-gliadin gene ...
Indian Academy of Sciences (India)
Supplementary data: Characterization and phylogenetic analysis of α-gliadin gene sequences reveals significant genomic divergence in Triticeae species. Guang-Rong Li, Tao Lang, En-Nian Yang, Cheng Liu ... The MITE insertion at the 3 UTR is boxed. Figure 2. The secondary structure of MITE insertion in HM452949.
Molecular characterization of the porcine surfactant, pulmonary-associated protein C gene
DEFF Research Database (Denmark)
Cirera, S.; Nygård, A.B.; Jensen, H.E.
2006-01-01
The surfactant, pulmonary-associated protein C (SFTPC) is a peptide secreted by the alveolar type II pneumocytes of the lung. We have characterized the porcine SFTPC gene at genomic, transcriptional, and protein levels. The porcine SFTPC is a single-copy gene on pig chromosome 14. Two transcripts...
Tan, Chong-Tin
2015-02-10
Asia is important as it accounts for more than half of the world population. The majority of Asian countries fall into the middle income category. As for cultural traditions, Asia is highly varied, with many languages spoken. The pattern of neurologic diseases in Asia is largely similar to the West, with some disease features being specific to Asia. Whereas Asia constitutes 60% of the world's population, it contains only 20% of the world's neurologists. This disparity is particularly evident in South and South East Asia. As for neurologic care, it is highly variable depending on whether it is an urban or rural setting, the level of economic development, and the system of health care financing. To help remedy the shortage of neurologists, most counties with larger populations have established training programs in neurology. These programs are diverse, with many areas of concern. There are regional organizations serving as a vehicle for networking in neurology and various subspecialties, as well as an official journal (Neurology Asia). The Asian Epilepsy Academy, with its emphasis on workshops in various locations, EEG certification examination, and fellowships, may provide a template of effective regional networking for improving neurology care in the region. © 2015 American Academy of Neurology.
Multiple Sclerosis Epidemiology in East Asia, South East Asia and South Asia: A Systematic Review.
Eskandarieh, Sharareh; Heydarpour, Pouria; Minagar, Alireza; Pourmand, Shadi; Sahraian, Mohammad Ali
2016-01-01
Multiple sclerosis (MS) is one of the most common chronic immune-mediated diseases of the human central nervous system and an important cause of non-traumatic neurologic disability among young population in several countries. Recent reports from East Asia, South East Asia and South Asia have proposed a low to moderate prevalence of MS in these countries. A literature review search was carried out in December 2014 in Medline, Embase, Scopus and Cochrane library to recover original population-based studies on MS epidemiology in East Asia, South East Asia and South Asia countries published between January 1, 1950 and December 30, 2014. We intended search strategies using the key words: multiple sclerosis, prevalence, incidence and epidemiology. Based on our inclusion criteria, 68 epidemiologic studies were included in this systematic review. The most extensively used diagnostic criteria in the studies were McDonald's criteria. Most studies were performed in a multi-center hospital setting. The female to male ratio varied and ranged from 0.7 in India to 9.0 in China. The mean age at disease onset ranged from the lowest age of 25.3 in Iran to the highest age of 46.4 in China. MS prevalence ranged from 0.77 in 100,000 populations in Hong Kong (1999) to 85.80 in 100,000 in Iran (2013). Advances in MS registries around the globe allow nationwide population-based studies and will allow worldly comparisons between the prevalence and incidence in different regions that are provided to monitor estimation. © 2016 S. Karger AG, Basel.
Emerging new poleroviruses and tospoviruses affecting vegetables in Asia and breeding for resistance
Relevante, C.; Cheewachaiwit, S.; Chuapong, J.; Stratongjun, M.; Salutan, V.E.; Peters, D.; Balatero, C.H.; Hoop, de, S.J.
2012-01-01
The diseases caused by aphid-borne poleroviruses (genus Polerovirus, family Luteoviridae) and thrips-borne tospoviruses (genus Tospovirus, family Bunyaviridae) are emerging threats to the production of economically important vegetable and fruit crops in tropical and sub-tropical Asia. To date, at least 13 different polerovirus species have been characterized. In Asia, the reported poleroviruses include Cucurbit aphid-borne yellows virus (CABYV), Melon aphid-borne yellows virus (MABYV) and Sua...
"(East) Asia" as a Platform for Debate: Grouping and Bioethics.
Sleeboom-Faulkner, Margaret
This article examines the use of the notions of "Asian" and "East Asian" in definitions of bioethics. Using examples from East Asia, I argue that the verbal Asianization of bioethics is based on the notion of "Asia" as a family metaphor and serves as a platform of bioethical debate, networking, and political change. I maintain that the use of "Asia" and "East Asia" to shape bioethics is not so much a sign of inward-looking regionalism, but an attempt to build bridges among Asian countries, while putting up a common stance against what educated elites interpret as undesirable global trends of Westernization through bioethics. Using the notions of "grouping" and "segmentary systems" to show the performative nature of characterizations of (East) Asian bioethics, allowing users to mark regional identity, share meanings, take political positions, and network. Deploying Peter Haas's notion of "epistemic communities," I argue that academic and political elites translate "home" issues into "Asia speak," while at the same time, introducing and giving shape to "new" bioethical issues. Although the "Asianisms" and group-marking activities of Asian networks of bioethics are ideological, thereby engaging in the politics of in/exclusion, they succeed in putting politically sensitive topics on the agenda.
Genetic diversity of Diaphorina citri and its endosymbionts across east and south-east Asia.
Wang, Yanjing; Xu, Changbao; Tian, Mingyi; Deng, Xiaoling; Cen, Yijing; He, Yurong
2017-10-01
Diaphorina citri is the vector of 'Candidatus Liberibacter asiaticus', the most widespread pathogen associated huanglongbing, the most serious disease of citrus. To enhance our understanding of the distribution and origin of the psyllid, we investigated the genetic diversity and population structures of 24 populations in Asia and one from Florida based on the mtCOI gene. Simultaneously, genetic diversity and population structures of the primary endosymbiont (P-endosymbiont) 'Candidatus Carsonella ruddii' and secondary endosymbiont (S-endosymbiont) 'Candidatus Profftella armatura' of D. citri were determined with the housekeeping genes. AMOVA analysis indicated that populations of D. citri and its endosymbionts in east and south-east Asia were genetically distinct from populations in Pakistan and Florida. Furthermore, P-endosymbiont populations displayed a strong geographical structure across east and south-east Asia, while low genetic diversity indicated the absence of genetic structure among the populations of D. citri and its S-endosymbiont across these regions. The 'Ca. C. ruddii' is more diverse and structured than the D. citri and the 'Ca. P. armatura' across east and south-east Asia. Multiple introductions of the psyllid have occurred in China. Management application for controlling the pest is proposed based on the genetic information of D. citri and its endosymbionts. © 2017 Society of Chemical Industry. © 2017 Society of Chemical Industry.
Gene, protein and network of male sterility in rice
Directory of Open Access Journals (Sweden)
Wang eKun
2013-04-01
Full Text Available Rice is one of the most important model crop plants whose heterosis has been well exploited in commercial hybrid seed production via a variety of types of male sterile lines. Hybrid rice cultivation area is steadily expanding around the world, especially in Southern Asia. Characterization of genes and proteins related to male sterility aims to understand how and why the male sterility occurs, and which proteins are the key players for microspores abortion. Recently, a series of genes and proteins related to cytoplasmic male sterility, photoperiod sensitive male sterility, self-incompatibility and other types of microspores deterioration have been characterized through genetics or proteomics. Especially the latter, offers us a powerful and high throughput approach to discern the novel proteins involving in male-sterile pathways which may help us to breed artificial male-sterile system. This represents an alternative tool to meet the critical challenge of further development of hybrid rice. In this paper, we reviewed the recent developments in our understanding of male sterility in rice hybrid production across gene, protein and integrated network levels, and also, present a perspective on the engineering of male sterile lines for hybrid rice production.
Human serum amyloid genes--molecular characterization
International Nuclear Information System (INIS)
Sack, G.H.; Lease, J.J.
1986-01-01
Three clones containing human genes for serum amyloid A protein (SAA) have been isolated and characterized. Each of two clones, GSAA 1 and 2 (of 12.8 and 15.9 kilobases, respectively), contains two exons, accouting for amino acids 12-58 and 58-103 of mature SAA; the extreme 5' termini and 5' untranslated regions have not yet been defined but are anticipated to be close based on studies of murine SAA genes. Initial amino acid sequence comparisons show 78/89 identical residues. At 4 of the 11 discrepant residues, the amino acid specified by the codon is the same as the corresponding residue in murine SAA. Identification of regions containing coding regions has permitted use of selected subclones for blot hybridization studies of larger human SAA chromosomal gene organization. The third clone, GSAA 3 also contains SAA coding information by DNA sequence analysis but has a different organization which has not yet been fully described. We have reported the isolation of clones of human DNA hybridizing with pRS48 - a plasmid containing a complementary DNA (cDNA) clone for murine serum amyloid A (SAA; 1, 2). We now present more detailed data confirming the identity and defining some of the organizational features of these clones
Hepatocellular carcinoma in Asia: Prevention strategy and planning.
Ashtari, Sara; Pourhoseingholi, Mohamad Amin; Sharifian, Afsaneh; Zali, Mohamad Reza
2015-06-28
To review all of epidemiological and etiological aspects of hepatocellular carcinoma (HCC) and examined the prevention of this disease in Asia. We conducted a systematic review according to the PRISMA guidelines. We were chosen articles that published previously, from PubMed (MEDLINE), the Cochrane database and Scopus. The key words used in this research were as follows: HCC in Asia and the way of prevention of this disease, with no language limitations. We selected those papers published before 2014 that we considered to be most important and appropriate. All relevant articles were accessed in full text and all relevant materials was evaluated and reviewed. More than 70% of all new cases of liver cancer were diagnosed in Asia, a region that 75% of all those chronically infected with hepatitis B virus (HBV) in the world. Chronic HBV infection is the main cause of HCC in Asia, where the virus is endemic and vertical transmission is common. Japan, Saudi Arabia, Egypt and Pakistan are exception because of high prevalence of HCV infection in these regions. The prevalence of this cancer is high in Eastern and South-Eastern Asia, But Middle Eastern countries are characterized as moderate prevalence rate of HCC region and Central Asia and some part of Middle Eastern countries are known as low prevalence rate of HCC. In addition of HBV and HCV the other factors such as aflatoxin, alcohol, obesity, diabetes and non-alcoholic fatty liver disease (NAFLD) might be responsible for a low prevalence of HCC in Asian countries. Currently available HCC therapies, chemotherapy, surgical are inefficient, mainly due to usually late diagnosis and high recurrence rates after surgical resection, and usually end with treatment failure. Liver transplantation also remains as a difficult strategy in patients with HCC. Thus prevention of HCC by treating and prevention HBV and HCV infection, the major causative agents of HCC, and the other risk factors such as aflatoxin, alcohol, obesity
Erb, Maribeth; Ong, Chin Ee
2017-01-01
This paper introduces a special issue on Theme Parks in Asia with reflections on how the various theoretical ideas on theming and theme parks that are found in the social science literature can help us to understand the proliferation of theming and theme parks in contemporary Asia. How does theming
Sánchez, E; Perrone, T; Recchimuzzi, G; Cardozo, I; Biteau, N; Aso, P M; Mijares, A; Baltz, T; Berthier, D; Balzano-Nogueira, L; Gonzatti, M I
2015-10-15
Livestock trypanosomoses, caused by three species of the Trypanozoon subgenus, Trypanosoma brucei brucei, T. evansi and T. equiperdum is widely distributed throughout the world and constitutes an important limitation for the production of animal protein. T. evansi and T. equiperdum are morphologically indistinguishable parasites that evolved from a common ancestor but acquired important biological differences, including host range, mode of transmission, distribution, clinical symptoms and pathogenicity. At a molecular level, T. evansi is characterized by the complete loss of the maxicircles of the kinetoplastic DNA, while T. equiperdum has retained maxicircle fragments similar to those present in T. brucei. T. evansi causes the disease known as Surra, Derrengadera or "mal de cadeiras", while T. equiperdum is the etiological agent of dourine or "mal du coit", characterized by venereal transmission and white patches in the genitalia. Nine Venezuelan Trypanosoma spp. isolates, from horse, donkey or capybara were genotyped and classified using microsatellite analyses and maxicircle genes. The variables from the microsatellite data and the Procyclin PE repeats matrices were combined using the Hill-Smith method and compared to a group of T. evansi, T. equiperdum and T. brucei reference strains from South America, Asia and Africa using Coinertia analysis. Four maxicircle genes (cytb, cox1, a6 and nd8) were amplified by PCRfrom TeAp-N/D1 and TeGu-N/D1, the two Venezuelan isolates that grouped with the T. equiperdum STIB841/OVI strain. These maxicircle sequences were analyzed by nucleotide BLAST and aligned toorthologous genes from the Trypanozoon subgenus by MUSCLE tools. Phylogenetic trees were constructed using Maximum Parsimony (MP) and Maximum Likelihood (ML) with the MEGA5.1® software. We characterized microsatellite markers and Procyclin PE repeats of nine Venezuelan Trypanosoma spp. isolates with various degrees of virulence in a mouse model, and compared them to a
Asia Pacific energy derivatives
International Nuclear Information System (INIS)
Fusaro, P.C.
1997-09-01
Asia Pacific Energy Derivatives, from FT Energy, is the first report of its kind to examine the growth of energy derivatives within Asia Pacific and their increasing importance within this region. It provides a comprehensive overview of the subject, including analysis of: deregulation as a market driver; the impact of privatisation; the future for energy risk management tools; the unique characteristics of the Asia Pacific energy market; the role of futures exchanges in Asia; existing indexes and their performance; the differences between the Asia Pacific markets and their more mature counterparts in London and New York; non-oil derivatives, project finance and cross commodity arbitrage; the thriving Pacific Rim Over the Counter (OTC) markets. (author)
The Himalayas: barrier and conduit for gene flow.
Gayden, Tenzin; Perez, Annabel; Persad, Patrice J; Bukhari, Areej; Chennakrishnaiah, Shilpa; Simms, Tanya; Maloney, Trisha; Rodriguez, Kristina; Herrera, Rene J
2013-06-01
The Himalayan mountain range is strategically located at the crossroads of the major cultural centers in Asia, the Middle East and Europe. Although previous Y-chromosome studies indicate that the Himalayas served as a natural barrier for gene flow from the south to the Tibetan plateau, this region is believed to have played an important role as a corridor for human migrations between East and West Eurasia along the ancient Silk Road. To evaluate the effects of the Himalayan mountain range in shaping the maternal lineages of populations residing on either side of the cordillera, we analyzed mitochondrial DNA variation in 344 samples from three Nepalese collections (Newar, Kathmandu and Tamang) and a general population of Tibet. Our results revealed a predominantly East Asian-specific component in Tibet and Tamang, whereas Newar and Kathmandu are both characterized by a combination of East and South Central Asian lineages. Interestingly, Newar and Kathmandu harbor several deep-rooted Indian lineages, including M2, R5, and U2, whose coalescent times from this study (U2, >40 kya) and previous reports (M2 and R5, >50 kya) suggest that Nepal was inhabited during the initial peopling of South Central Asia. Comparisons with our previous Y-chromosome data indicate sex-biased migrations in Tamang and a founder effect and/or genetic drift in Tamang and Newar. Altogether, our results confirm that while the Himalayas acted as a geographic barrier for human movement from the Indian subcontinent to the Tibetan highland, it also served as a conduit for gene flow between Central and East Asia. Copyright © 2013 Wiley Periodicals, Inc.
National Aeronautics and Space Administration — The ASIAS effort builds on demonstrations that an open exchange of information contributes to improved aviation safety. ASIAS is a comprehensive effort, covering the...
Progress of ambient air pollution and cardiovascular disease research in Asia.
Su, Ta-Chen; Chen, Szu-Ying; Chan, Chang-Chuan
2011-01-01
Asian countries are with deteriorating air quality accompanying the rapid economic and social development of the past decades, and the potential health impacts of air pollution have been noticed by researchers in the region. We reviewed the scientific literature on air pollution and cardiovascular diseases (CVD) published by Asian researchers in English since the 1980s to determine whether the findings in Europe and North America can be extrapolated to Asia. Epidemiological studies show that short-term particulate matter pollution is a strong predictor for CVD morbidity and mortality and suggestive on cerebrovascular morbidity and mortality in newly developed countries in Asia. Multicountry epidemiological studies are needed to fully appreciate the extent of air pollution on CVD in Asia, especially less developed Asian countries. New cohort studies should be initiated to improve our understanding of particulate matter's toxicological pathways, long-term exposure effects, and gene-environment interaction on CVD among the Asian population. Copyright © 2011 Elsevier Inc. All rights reserved.
Characterization of an ancient lepidopteran lateral gene transfer.
Directory of Open Access Journals (Sweden)
David Wheeler
Full Text Available Bacteria to eukaryote lateral gene transfers (LGT are an important potential source of material for the evolution of novel genetic traits. The explosion in the number of newly sequenced genomes provides opportunities to identify and characterize examples of these lateral gene transfer events, and to assess their role in the evolution of new genes. In this paper, we describe an ancient lepidopteran LGT of a glycosyl hydrolase family 31 gene (GH31 from an Enterococcus bacteria. PCR amplification between the LGT and a flanking insect gene confirmed that the GH31 was integrated into the Bombyx mori genome and was not a result of an assembly error. Database searches in combination with degenerate PCR on a panel of 7 lepidopteran families confirmed that the GH31 LGT event occurred deep within the Order approximately 65-145 million years ago. The most basal species in which the LGT was found is Plutella xylostella (superfamily: Yponomeutoidea. Array data from Bombyx mori shows that GH31 is expressed, and low dN/dS ratios indicates the LGT coding sequence is under strong stabilizing selection. These findings provide further support for the proposition that bacterial LGTs are relatively common in insects and likely to be an underappreciated source of adaptive genetic material.
Application of DNA barcodes in wildlife conservation in Tropical East Asia.
Wilson, John-James; Sing, Kong-Wah; Lee, Ping-Shin; Wee, Alison K S
2016-10-01
Over the past 50 years, Tropical East Asia has lost more biodiversity than any tropical region. Tropical East Asia is a megadiverse region with an acute taxonomic impediment. DNA barcodes are short standardized DNA sequences used for taxonomic purposes and have the potential to lessen the challenges of biodiversity inventory and assessments in regions where they are most needed. We reviewed DNA barcoding efforts in Tropical East Asia relative to other tropical regions. We suggest DNA barcodes (or metabarcodes from next-generation sequencers) may be especially useful for characterizing and connecting species-level biodiversity units in inventories encompassing taxa lacking formal description (particularly arthropods) and in large-scale, minimal-impact approaches to vertebrate monitoring and population assessments through secondary sources of DNA (invertebrate derived DNA and environmental DNA). We suggest interest and capacity for DNA barcoding are slowly growing in Tropical East Asia, particularly among the younger generation of researchers who can connect with the barcoding analogy and understand the need for new approaches to the conservation challenges being faced. © 2016 Society for Conservation Biology.
Characterization of transformation related genes in oral cancer cells.
Chang, D D; Park, N H; Denny, C T; Nelson, S F; Pe, M
1998-04-16
A cDNA representational difference analysis (cDNA-RDA) and an arrayed filter technique were used to characterize transformation-related genes in oral cancer. From an initial comparison of normal oral epithelial cells and a human papilloma virus (HPV)-immortalized oral epithelial cell line, we obtained 384 differentially expressed gene fragments and arrayed them on a filter. Two hundred and twelve redundant clones were identified by three rounds of back hybridization. Sequence analysis of the remaining clones revealed 99 unique clones corresponding to 69 genes. The expression of these transformation related gene fragments in three nontumorigenic HPV-immortalized oral epithelial cell lines and three oral cancer cell lines were simultaneously monitored using a cDNA array hybridization. Although there was a considerable cell line-to-cell line variability in the expression of these clones, a reliable prediction of their expression could be made from the cDNA array hybridization. Our study demonstrates the utility of combining cDNA-RDA and arrayed filters in high-throughput gene expression difference analysis. The differentially expressed genes identified in this study should be informative in studying oral epithelial cell carcinogenesis.
Adapting to Climate Change in Peri-Urban Southeast Asia | CRDI ...
International Development Research Centre (IDRC) Digital Library (Canada)
The rapid growth of peri-urban areas in Southeast Asia is characterized by a lack of basic services, unplanned built environments, and relatively weak governments. Residents of these areas are particularly vulnerable to extreme climate events, such as hurricanes, drought, flooding, and desertification. This research will ...
Kitamoto, N; Yoshino-Yasuda, S; Ohmiya, K; Tsukagoshi, N
2001-01-01
A second pectin lyase gene, designated pel2, was isolated from a shoyu koji mold Aspergillus oryzae KBN616 and characterized. The structural gene comprised 1306 bp with three introns. The ORF encoded 375 amino acids with a signal peptide of 19 amino acids. The deduced amino acid sequence showed high similarity to those of A. oryzae Pel1, Aspergillus niger pectin lyases and Glomerella cingulata Pn1A. The pel2 gene was overexpressed under the control of the promoter of the A. oryzae TEF1 gene for purification and enzymatic characterization of its gene product. The gene product exhibited two molecular masses of 48 and 44 kDa due to different degrees of glycosylation. Both proteins had the same pH optimum of 6.0 and temperature optimum of 50 degrees C.
Yang, Wei; Chen, Huapu; Cui, Xuefan; Zhang, Kewei; Jiang, Dongneng; Deng, Siping; Zhu, Chunhua; Li, Guangli
2017-09-01
Spotted scat (Scatophagus argus) is an economically important farmed fish, particularly in East and Southeast Asia. Because there has been little research on reproductive development and regulation in this species, the lack of a mature artificial reproduction technology remains a barrier for the sustainable development of the aquaculture industry. More genetic and genomic background knowledge is urgently needed for an in-depth understanding of the molecular mechanism of reproductive process and identification of functional genes related to sexual differentiation, gonad maturation and gametogenesis. For these reasons, we performed transcriptomic analysis on spotted scat using a multiple tissue sample mixing strategy. The Illumina RNA sequencing generated 118 510 486 raw reads. After trimming, de novo assembly was performed and yielded 99 888 unigenes with an average length of 905.75 bp. A total of 45 015 unigenes were successfully annotated to the Nr, Swiss-Prot, KOG and KEGG databases. Additionally, 23 783 and 27 183 annotated unigenes were assigned to 56 Gene Ontology (GO) functional groups and 228 KEGG pathways, respectively. Subsequently, 2 474 transcripts associated with reproduction were selected using GO term and KEGG pathway assignments, and a number of reproduction-related genes involved in sex differentiation, gonad development and gametogenesis were identified. Furthermore, 22 279 simple sequence repeat (SSR) loci were discovered and characterized. The comprehensive transcript dataset described here greatly increases the genetic information available for spotted scat and contributes valuable sequence resources for functional gene mining and analysis. Candidate transcripts involved in reproduction would make good starting points for future studies on reproductive mechanisms, and the putative sex differentiation-related genes will be helpful for sex-determining gene identification and sex-specific marker isolation. Lastly, the SSRs can serve as marker
Lawton, Jennifer
2012-03-29
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Directory of Open Access Journals (Sweden)
Lawton Jennifer
2012-03-01
Full Text Available Abstract Background The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required. Results The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages. Conclusions In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub
Lawton, Jennifer; Brugat, Thibaut; Yan, Yam Xue; Reid, Adam James; Bö hme, Ulrike; Otto, Thomas Dan; Pain, Arnab; Jackson, Andrew; Berriman, Matthew; Cunningham, Deirdre; Preiser, Peter; Langhorne, Jean
2012-01-01
Background: The pir genes comprise the largest multi-gene family in Plasmodium, with members found in P. vivax, P. knowlesi and the rodent malaria species. Despite comprising up to 5% of the genome, little is known about the functions of the proteins encoded by pir genes. P. chabaudi causes chronic infection in mice, which may be due to antigenic variation. In this model, pir genes are called cirs and may be involved in this mechanism, allowing evasion of host immune responses. In order to fully understand the role(s) of CIR proteins during P. chabaudi infection, a detailed characterization of the cir gene family was required.Results: The cir repertoire was annotated and a detailed bioinformatic characterization of the encoded CIR proteins was performed. Two major sub-families were identified, which have been named A and B. Members of each sub-family displayed different amino acid motifs, and were thus predicted to have undergone functional divergence. In addition, the expression of the entire cir repertoire was analyzed via RNA sequencing and microarray. Up to 40% of the cir gene repertoire was expressed in the parasite population during infection, and dominant cir transcripts could be identified. In addition, some differences were observed in the pattern of expression between the cir subgroups at the peak of P. chabaudi infection. Finally, specific cir genes were expressed at different time points during asexual blood stages.Conclusions: In conclusion, the large number of cir genes and their expression throughout the intraerythrocytic cycle of development indicates that CIR proteins are likely to be important for parasite survival. In particular, the detection of dominant cir transcripts at the peak of P. chabaudi infection supports the idea that CIR proteins are expressed, and could perform important functions in the biology of this parasite. Further application of the methodologies described here may allow the elucidation of CIR sub-family A and B protein
Zhao, Jian-Jun; Yan, Xi-Jun; Chai, Xiu-Li; Martella, Vito; Luo, Guo-Liang; Zhang, Hai-Ling; Gao, Han; Liu, Ying-Xue; Bai, Xue; Zhang, Lei; Chen, Tao; Xu, Lei; Zhao, Chun-Fei; Wang, Feng-Xue; Shao, Xi-Qun; Wu, Wei; Cheng, Shi-Peng
2010-01-06
Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. Genetic/antigenic heterogeneity has been observed among the various CDV strains, notably in the haemagglutinin (H) gene, that appears as a good target to gather epidemiological information. Based on sequence analysis of the H gene, wild-type CDV strains cluster into distinct geographic lineages (genotypes), irrespective of the species of isolation. The sequence of the H gene of 28 CDV strains detected from both vaccinated and non-vaccinated breeding foxes, raccoon dogs and minks from different geographical areas of China during the years 2004-2008 was determined. All the CDV strains but two (strains HL and HLJ2) were characterized as Asia-1 genotype and were highly similar to each other (96.2-99.7% at the amino acid [aa] level) and to other Asia-1 strains (96.1-99.5% aa) previously detected in China. The CDV strains HL and HLJ2 were both collected from foxes in Heilongjiang province in 2005. Strain HL resembled CDVs of the Arctic genotype (GR88-like) and displayed high aa identity (98.0%) to the Chinese canine strain Liu. By converse, strain HLJ2 was barely related to CDVs of the Asia-2 genotype (88.7-90.3% aa identity), and could represent a novel CDV genotype, tentatively proposed as Asia-3. These results suggest that at least three different CDV genotypes, distantly related (81.8-91.6% aa identity) to the vaccine strains, Onderstepoort-like (America-1 genotype), are currently circulating in breeding foxes, raccoon dogs and minks in China, and that the genotype Asia-1 is predominant. Whether the diversity between wild-type CDVs and the vaccine strains may affect, to some extent, the efficacy of the vaccines deserves further investigations.
Central Asia in Asia: Charting growing trans-regional linkages
Directory of Open Access Journals (Sweden)
Nicola P. Contessi
2016-01-01
Full Text Available As the so-called ‘Asian Century’ unfolds, Central Asian countries are increasingly directing their foreign relations eastward. Meanwhile, Asian states are equally turning to Central Asia in their search for energy resources and new markets. This dual dynamic is giving rise to closer and deeper ties in three key areas. As far as infrastructures are concerned, various Asian powers have adopted Silk Road policies that see Central Asia as a fundamental transit route for their long-haul connectivity projects. In the field of trade, Central Asia's exchanges with other Asian countries have been growing steadily since the 1990s, in some cases even coming to rival, in comparative terms, exchanges with the West. Lastly, in terms of multilateralism, Central Asia is increasingly enmeshed in a web of overlapping institutions with a strong Asian identity, coexisting with the region's Western institutional references. The article then problematizes this emerging pattern by sketching out some of the possible ramifications that could stem from the sustainment and consolidation of these trends for the international order and the global balance of power.
Gene therapy for cartilage and bone tissue engineering
Hu, Yu-Chen
2014-01-01
"Gene Therapy for Cartilage and Bone Tissue Engineering" outlines the tissue engineering and possible applications of gene therapy in the field of biomedical engineering as well as basic principles of gene therapy, vectors and gene delivery, specifically for cartilage and bone engineering. It is intended for tissue engineers, cell therapists, regenerative medicine scientists and engineers, gene therapist and virologists. Dr. Yu-Chen Hu is a Distinguished Professor at the Department of Chemical Engineering, National Tsing Hua University and has received the Outstanding Research Award (National Science Council), Asia Research Award (Society of Chemical Engineers, Japan) and Professor Tsai-Teh Lai Award (Taiwan Institute of Chemical Engineers). He is also a fellow of the American Institute for Medical and Biological Engineering (AIMBE) and a member of the Tissue Engineering International & Regenerative Medicine Society (TERMIS)-Asia Pacific Council.
International Nuclear Information System (INIS)
Cordonnier, I.; Tertrais, B.
2001-01-01
Since the demolition of the Berlin wall, Asia has become the theater of nuclear rivalry, with as main actors: india, Pakistan, China and South Korea. This book analyzes the geo-political situation in this region of the world and asks some important questions about the new strategic map of Asia: what is the impact of the development of nuclear activities on the security of Asia? Will the deployment of anti-missile defenses lead to a new weapons rush? Is there a nuclear warfare risk? (J.S.)
Genome-wide survey and characterization of the WRKY gene family in Populus trichocarpa.
He, Hongsheng; Dong, Qing; Shao, Yuanhua; Jiang, Haiyang; Zhu, Suwen; Cheng, Beijiu; Xiang, Yan
2012-07-01
WRKY transcription factors participate in diverse physiological and developmental processes in plants. They have highly conserved WRKYGQK amino acid sequences in their N-termini, followed by the novel zinc-finger-like motifs, Cys₂His₂ or Cys₂HisCys. To date, numerous WRKY genes have been identified and characterized in a number of herbaceous species. Survey and characterization of WRKY genes in a ligneous species would facilitate a better understanding of the evolutionary processes and functions of this gene family. In this study, 104 poplar WRKY genes (PtWRKY) were identified in the latest poplar genome sequence. According to their structural features, the predicted members were divided into the previously defined groups I-III, as described in rice. In addition, chromosomal localization of the genes demonstrated that there might be WRKY gene hot spots in 2.3 Mb regions on chromosome 14. Furthermore, approximately 83% (86 out of 104) WRKY genes participated in gene duplication events, including 69% (29 out of 42) gene pairs which exhibited segmental duplication. Using semi-quantitative RT-PCR, the expression patterns of subgroup III genes were investigated under different stresses [cold, drought, salinity and salicylic acid (SA)]. The data revealed that these genes presented different expression levels in response to various stress conditions. Expression analysis exhibited PtWRKY76 gene induced markedly in 0.1 mM SA or 25% PEG-6000 treatment. The results presented here provide a fundamental clue for cloning specific function genes in further studies and applications. This study identified 104 poplar WRKY genes and demonstrated WRKY gene hot spots on chromosome 14. Furthermore, semi-quantitative RT-PCR showed variable stress responses in subgroup III.
Capelli, Cristian; Wilson, James F.; Richards, Martin; Stumpf, Michael P. H.; Gratrix, Fiona; Oppenheimer, Stephen; Underhill, Peter; Pascali, Vincenzo L.; Ko, Tsang-Ming; Goldstein, David B.
2001-01-01
Modern humans reached Southeast Asia and Oceania in one of the first dispersals out of Africa. The resulting temporal overlap of modern and archaic humans-and the apparent morphological continuity between them-has led to claims of gene flow between Homo sapiens and H. erectus. Much more recently, an agricultural technology from mainland Asia spread into the region, possibly in association with Austronesian languages. Using detailed genealogical study of Y chromosome variation, we show that th...
Tsay, S. -C.; Ji, Q.; Chu, A.; Hsu, C.; Holben, B.; Campbell, J.; Welton, E. J.; Shu, P. K.
2002-01-01
Many recent field experiments are designed to study the compelling variability in spatial and temporal scale of both pollution-derived and naturally occurring aerosols, which often exist in high concentrations over eastern/southeastern Asia and along the rim of the western Pacific. For example, the ACE-Asia was conducted from March-May 2001 in the vicinity of the Taklimakan and Gobi deserts, East Coast of China, Yellow Sea, Korea, and Japan, along the pathway of Kosa (severe events that blanket East Asia with yellow desert dust, peaked in the Spring season). Asian dust typically originates in desert areas far from polluted urban regions. During transport, dust layers can interact with anthropogenic sulfate and soot aerosols from heavily polluted urban areas. Added to the complex effects of clouds and natural marine aerosols, dust particles reaching the marine environment can have drastically different properties than those from the source. Thus, understanding the unique temporal and spatial variations of Asian aerosols is of special importance in regional-to-global climate issues such as radiative forcing, the hydrological cycle, and primary biological productivity in the mid-Pacific Ocean. During ACE-Asia we have measured continuously aerosol physical/optical/radiative properties, column precipitable water amount, and surface reflectivity over homogeneous areas from surface. The inclusion of flux measurements permits the determination of aerosol radiative flux in addition to measurements of loading and optical depth. At the time of the Terra/MODIS, SeaWiFS, TOMS and other satellite overpasses, these ground-based observations can provide valuable data to compare with satellite retrievals over land. Preliminary results will be presented and discussed their implications in regional climatic effects.
Molecular characterization of capsid protein gene of potato virus X ...
African Journals Online (AJOL)
Molecular characterization of capsid protein gene of potato virus X from Pakistan. Arshad Jamal, Idrees Ahmad Nasir, Bushra Tabassum, Muhammad Tariq, Abdul Munim Farooq, Zahida Qamar, Mohsin Ahmad Khan, Nadeem Ahmad, Muhammad Shafiq, Muhammad Saleem Haider, M. Arshad Javed, Tayyab Husnain ...
Directory of Open Access Journals (Sweden)
Aron Pirade
2014-04-01
menempati urutan tertinggi. Wilayah Asia Selatan dan Asia Timur-Selatan (juga disebut Asia Tenggara adalah wilayah dengan prevalensi Gonore dan Klamidia terbesar. Prevalensi Gonore di tahun 1995 dan 1999 yaitu 29.11 dan 27.2 juta penduduk wilayah Asia Selatan dan Asia Tenggara. Klamidia, di tahun 1995 dan tahun 1999 yaitu 40.48 dan 42.89 juta penduduk wilayah Asia Selatan dan Asia Tenggara. Di Indonesia sendiri, pada 11 area penelitian menunjukkan bahwa prevalensi Gonore dalam wilayah Indonesia menunjukkan rata-rata prosentasenya 20%-40% dari keseluruhan STI pada wanita beresiko tinggi terkena STI. Sedangkan infeksi oleh Klamidia prosentasenya 15%- 45% dari keseluruhan STI pada wanita beresiko tinggi terkena penyakit kelamin. Prosentase Gonore dan Klamidia di Kota Manado rata-rata 15-30%. Tingginya prevalensi infeksi Gonore dan Klamidia di Asia Tenggara, ternyata diikuti juga dengan tingginya perkembangan infeksi Gonore dan Klamidia di Indonesia dan Kota Manado.
Stohl , A.; Forster , C.; Huntrieser , H.; Mannstein , H.; Mcmillan , W. W.; Petzold , A.; Schlager , H.; Weinzierl , B.
2006-01-01
An air pollution plume from Southern and Eastern Asia, including regions in India and China, was predicted by the FLEXPART particle dispersion model to arrive in the upper troposphere over Europe on 24–25 March 2006. According to the model, the plume was exported from Southeast Asia only six days earlier, transported into the upper troposphere by a warm conveyor belt, and travelled to Europe in a fast zonal flow. This is confirmed by the retrievals of carbon monoxide (CO) from AIRS sate...
Integrasi Ekonomi Asia: Solusi Asia Menghadapi Krisis Global 2008
Directory of Open Access Journals (Sweden)
Adrian Hidayat
2008-09-01
Full Text Available No economies throughout the region managed to escape from the "global economic crisis in 2008" that was initiated in the United States. This is a logical consequence of the global economy that has been rolling along. The world economy is increasingly becoming more integrated and interdependent with one another. Exposure stems from the economic crisis in the prolonged United States subprime mortgage financial crisis, and eventually dragged the European economy, and also Asia. The Asian region was only affected, but even if only the impact of course, was enough to overwhelm the Asian region since the crisis has a major impact on a country's foreign exchange reserves. Therefore, after the G-20 summit held in Washington on November 15, 2008, the three major Asian countries, namely China, Japan and South Korea held a summit in Fukuoka Japanese initiative, which was attended by the three heads of government. This summit was to bring fresh air for the Asian region, because in addition to having a positive impact on Asian stocks, it also provides a new self confidence that Asia has formed an alliance that would at least fortify themselves (region with the resulting stimulus policy. This initiative to find a solution is eventually expanded, and was welcomed by ASEAN countries, known as ASEAN Plus Three. Since in Asia there is already the East Asia Summit (East Asia Summit, the negotiations and the name of the group changed into the 6 partner countries of ASEAN. These six countries are Japan, China, South Korea, Australia, New Zealand, and India.
A novel binary T-vector with the GFP reporter gene for promoter characterization.
Directory of Open Access Journals (Sweden)
Shu-Ye Jiang
Full Text Available Several strategies have been developed to clone PCR fragments into desired vectors. However, most of commercially available T-vectors are not binary vectors and cannot be directly used for Agrobacterium-mediated plant genetic transformation. In this study, a novel binary T-vector was constructed by integrating two AhdI restriction sites into the backbone vector pCAMBIA 1300. The T-vector also contains a GFP reporter gene and thus, can be used to analyze promoter activity by monitoring the reporter gene. On the other hand, identification and characterization of various promoters not only benefit the functional annotation of their genes but also provide alternative candidates to be used to drive interesting genes for plant genetic improvement by transgenesis. More than 1,000 putative pollen-specific rice genes have been identified in a genome-wide level. Among them, 67 highly expressed genes were further characterized. One of the pollen-specific genes LOC_Os10g35930 was further surveyed in its expression patterns with more details by quantitative real-time reverse-transcription PCR (qRT-PCR analysis. Finally, its promoter activity was further investigated by analyzing transgenic rice plants carrying the promoter::GFP cassette, which was constructed from the newly developed T-vector. The reporter GFP gene expression in these transgenic plants showed that the promoter was active only in mature but not in germinated pollens.
International Nuclear Information System (INIS)
Yamaguchi, N.
2001-01-01
An overview of the Asia-Pacific (AP) lubricating oils market, its special characteristics, and its role in the global economy are presented. In the 'boom and bust' years of 1997-1999, the Asia-Pacific market was even bigger then the US market. For the short-term, the scenario is surplus capacity and poor margins, but in the long term there is enormous potential for growth. How fuel demand and quality is related to engine type is discussed. The three basic grades of baseoils are described, and the Asia-Pacific lube demand and the Asia-Pacific lube oil supply are discussed. There are 15 diagrams giving data on: (i) finished lubes in world markets as a percentage of total; (ii) how lube demand follows GDP per capita in Asia; (iii) AP baseoil capacity relationships; (iv) AP baseoil disposition by end use; (v) AP changing shares of baseoil demand; (vi) AP finished lube demand by subregion; (vii) AP finished lube demand growth, indexed; (viii) AP baseoil capacity by region; Singapore baseoil vs. Dubai crude prices, 1992-99; (ix) Singapore baseoil vs. crude prices, 1992-99; (x) AP baseoil deficit moved to surplus; (xi) AP baseoil production; (xii) East Asia net percentage change in lube sales, 1997-1999. (xiii) Southeast Asia net percentage change in lube sales, 1997-1999; (xiv) South East Asia and Australia net percentage change in lube sales, 1997-1999 and (xv) Asia-Pacific major lube marketers
Vasijas conectadas: Asia Occidental y Asia Oriental en la Geopolítica de China
Yitzhak Shichor
2016-01-01
Las regiones de Asia Oriental y Asia Occidental (Oriente Medio) son normalmente tratadas en la literatura académica como dos asuntos separados y distintos dentro de la política exterior china. Los estudios acerca de la política de China en Asia Oriental apenas si mencionan Oriente Medio, mientras que los estudios de Oriente Medio apenas mencionan Asia Occidental. Pero de hecho ambas regiones no sólo están interconectadas en la visión geopolítica de Chin...
Epidemiology of Leptospira Transmitted by Rodents in Southeast Asia
Mielcarek, Mathilde; Tatard, Caroline; Chaval, Yannick; Suputtamongkol, Yupin; Buchy, Philippe; Jittapalapong, Sathaporn; Herbreteau, Vincent; Morand, Serge
2014-01-01
Background Leptospirosis is the most common bacterial zoonoses and has been identified as an important emerging global public health problem in Southeast Asia. Rodents are important reservoirs for human leptospirosis, but epidemiological data is lacking. Methodology/Principal Findings We sampled rodents living in different habitats from seven localities distributed across Southeast Asia (Thailand, Lao PDR and Cambodia), between 2009 to 2010. Human isolates were also obtained from localities close to where rodents were sampled. The prevalence of Leptospira infection was assessed by real-time PCR using DNA extracted from rodent kidneys, targeting the lipL32 gene. Sequencing rrs and secY genes, and Multi Locus Variable-number Tandem Repeat (VNTR) analyses were performed on DNA extracted from rat kidneys for Leptospira isolates molecular typing. Four species were detected in rodents, L. borgpetersenii (56% of positive samples), L. interrogans (36%), L. kirschneri (3%) and L. weilli (2%), which were identical to human isolates. Mean prevalence in rodents was approximately 7%, and largely varied across localities and habitats, but not between rodent species. The two most abundant Leptospira species displayed different habitat requirements: L. interrogans was linked to humid habitats (rice fields and forests) while L. borgpetersenii was abundant in both humid and dry habitats (non-floodable lands). Conclusion/Significance L. interrogans and L. borgpetersenii species are widely distributed amongst rodent populations, and strain typing confirmed rodents as reservoirs for human leptospirosis. Differences in habitat requirements for L. interrogans and L. borgpetersenii supported differential transmission modes. In Southeast Asia, human infection risk is not only restricted to activities taking place in wetlands and rice fields as is commonly accepted, but should also include tasks such as forestry work, as well as the hunting and preparation of rodents for consumption, which
Characterization of differentially expressed genes using high-dimensional co-expression networks
DEFF Research Database (Denmark)
Coelho Goncalves de Abreu, Gabriel; Labouriau, Rodrigo S.
2010-01-01
We present a technique to characterize differentially expressed genes in terms of their position in a high-dimensional co-expression network. The set-up of Gaussian graphical models is used to construct representations of the co-expression network in such a way that redundancy and the propagation...... that allow to make effective inference in problems with high degree of complexity (e.g. several thousands of genes) and small number of observations (e.g. 10-100) as typically occurs in high throughput gene expression studies. Taking advantage of the internal structure of decomposable graphical models, we...... construct a compact representation of the co-expression network that allows to identify the regions with high concentration of differentially expressed genes. It is argued that differentially expressed genes located in highly interconnected regions of the co-expression network are less informative than...
Characterization of Gene Candidates for Vacuolar Sodium Transport from Hordeum Vulgare
Scheu, Arne Hagen August
2017-05-01
Soil salinity is a major abiotic stress for land plants, and multiple mechanisms of salt tolerance have evolved. Tissue tolerance is one of these mechanisms, which involves the sequestration of sodium into the vacuole to retain low cytosolic sodium concentrations. This enables the plant to maintain cellular functions, and ultimately maintain growth and yield. However, the molecular components involved in tissue tolerance remain elusive. Several candidate genes for vacuolar sodium sequestration have recently been identified by proteome analysis of vacuolar membranes purified from the salt-tolerant cereal Hordeum vulgare (barley). In this study, I aimed to characterize these candidates in more detail. I successfully cloned coding sequences for the majority of candidate genes with primers designed based on the barley reference genome sequence. During the course of this study a newer genome sequence with improved annotations was published, to which I also compared my observations. To study the candidate genes, I used the heterologous expression system Saccharomyces cerevisiae (yeast). I used several salt sensitive yeast strains (deficient in intrinsic sodium transporters) to test whether the candidate genes would affect their salt tolerance by mediating the sequestration of sodium into the yeast vacuole. I observed a reduction in growth upon expression for several of the gene candidate under salt-stress conditions. However, confocal microscopy suggests that most gene products are subject to degradation, and did not localize to the vacuolar membrane (tonoplast). Therefore, growth effects cannot be linked to protein function without further evidence. Various potential causes are discussed, including inaccuracies in the genome resource used as reference for primer design and issues inherent to the model system. Finally, I make suggestions on how to proceed to further characterize the candidate genes and hopefully identify novel sodium transporters from barley.
International Nuclear Information System (INIS)
Stafford, D.W.
1983-01-01
Our project was to isolate and characterize the enzyme β-glucosidase and to clone and characterize the β-glucosidase gene; our goal is to clone and characterize each of the cellulase genes from Trichoderma. The induction of the Trichoderma reesei cellulase complex by cellulose and by the soluble inducer, sophorose, has been demonstrated. Although the induction of the cellulase complex has previously been well documented, the induction of β-glucosidase had been questioned. 49 refs., 6 figs., 2 tabs
Genomic Characterization of Phenylalanine Ammonia Lyase Gene in Buckwheat.
Directory of Open Access Journals (Sweden)
Karthikeyan Thiyagarajan
Full Text Available Phenylalanine Ammonia Lyase (PAL gene which plays a key role in bio-synthesis of medicinally important compounds, Rutin/quercetin was sequence characterized for its efficient genomics application. These compounds possessing anti-diabetic and anti-cancer properties and are predominantly produced by Fagopyrum spp. In the present study, PAL gene was sequenced from three Fagopyrum spp. (F. tataricum, F. esculentum and F. dibotrys and showed the presence of three SNPs and four insertion/deletions at intra and inter specific level. Among them, the potential SNP (position 949th bp G>C with Parsimony Informative Site was selected and successfully utilised to individuate the zygosity/allelic variation of 16 F. tataricum varieties. Insertion mutations were identified in coding region, which resulted the change of a stretch of 39 amino acids on the putative protein. Our Study revealed that autogamous species (F. tataricum has lower frequency of observed SNPs as compared to allogamous species (F. dibotrys and F. esculentum. The identified SNPs in F. tataricum didn't result to amino acid change, while in other two species it caused both conservative and non-conservative variations. Consistent pattern of SNPs across the species revealed their phylogenetic importance. We found two groups of F. tataricum and one of them was closely related with F. dibotrys. Sequence characterization information of PAL gene reported in present investigation can be utilized in genetic improvement of buckwheat in reference to its medicinal value.
Identification and characterization of amelogenin genes in monotremes, reptiles, and amphibians
Toyosawa, Satoru; O’hUigin, Colm; Figueroa, Felipe; Tichy, Herbert; Klein, Jan
1998-01-01
Two features make the tooth an excellent model in the study of evolutionary innovations: the relative simplicity of its structure and the fact that the major tooth-forming genes have been identified in eutherian mammals. To understand the nature of the innovation at the molecular level, it is necessary to identify the homologs of tooth-forming genes in other vertebrates. As a first step toward this goal, homologs of the eutherian amelogenin gene have been cloned and characterized in selected species of monotremes (platypus and echidna), reptiles (caiman), and amphibians (African clawed toad). Comparisons of the homologs reveal that the amelogenin gene evolves quickly in the repeat region, in which numerous insertions and deletions have obliterated any similarity among the genes, and slowly in other regions. The gene organization, the distribution of hydrophobic and hydrophilic segments in the encoded protein, and several other features have been conserved throughout the evolution of the tetrapod amelogenin gene. Clones corresponding to one locus only were found in caiman, whereas the clawed toad possesses at least two amelogenin-encoding loci. PMID:9789040
Ethnic Related Selection for an ADH Class I Variant within East Asia
Li, Hui; Gu, Sheng; Cai, Xiaoyun; Speed, William C.; Pakstis, Andrew J.; Golub, Efim I.; Kidd, Judith R.; Kidd, Kenneth K.
2008-01-01
Background The alcohol dehydrogenases (ADH) are widely studied enzymes and the evolution of the mammalian gene cluster encoding these enzymes is also well studied. Previous studies have shown that the ADH1B*47His allele at one of the seven genes in humans is associated with a decrease in the risk of alcoholism and the core molecular region with this allele has been selected for in some East Asian populations. As the frequency of ADH1B*47His is highest in East Asia, and very low in most of the...
A genome-wide characterization of microRNA genes in maize.
Directory of Open Access Journals (Sweden)
Lifang Zhang
2009-11-01
Full Text Available MicroRNAs (miRNAs are small, non-coding RNAs that play essential roles in plant growth, development, and stress response. We conducted a genome-wide survey of maize miRNA genes, characterizing their structure, expression, and evolution. Computational approaches based on homology and secondary structure modeling identified 150 high-confidence genes within 26 miRNA families. For 25 families, expression was verified by deep-sequencing of small RNA libraries that were prepared from an assortment of maize tissues. PCR-RACE amplification of 68 miRNA transcript precursors, representing 18 families conserved across several plant species, showed that splice variation and the use of alternative transcriptional start and stop sites is common within this class of genes. Comparison of sequence variation data from diverse maize inbred lines versus teosinte accessions suggest that the mature miRNAs are under strong purifying selection while the flanking sequences evolve equivalently to other genes. Since maize is derived from an ancient tetraploid, the effect of whole-genome duplication on miRNA evolution was examined. We found that, like protein-coding genes, duplicated miRNA genes underwent extensive gene-loss, with approximately 35% of ancestral sites retained as duplicate homoeologous miRNA genes. This number is higher than that observed with protein-coding genes. A search for putative miRNA targets indicated bias towards genes in regulatory and metabolic pathways. As maize is one of the principal models for plant growth and development, this study will serve as a foundation for future research into the functional roles of miRNA genes.
Energy in Asia. An Outline of Some Strategic Energy Issues in Asia
International Nuclear Information System (INIS)
Kiesow, Ingolf
2003-01-01
The Asian countries are expected to generate 45% of the world energy consumption and Japan is the absolutely greatest consumer in Asia, but China is the country that will be most important as a new consumer on the world energy markets. China, like India and later possibly even Japan try to change to natural gas as a source of energy as much as possible. This is causing a competition about the resources that can be reached by pipelines for gas, which in practice means those in Russia and Central Asia. Russia is trying to control the gas in Central Asia. The competition is also increasing about oil. China is becoming heavily dependent on Muslim countries in the Middle East and Central Asia. This also leads to an effort to increase the safety along the sea lanes, which may collide with the interests of other countries. Territorial conflicts with gas and oil as underlying elements exist in Asia. USA is a player on the energy market, who is using military means as well, but it is possible that in the short perspective, the American acting may not seriously disturb European interests. In the long term perspective, however, the American activity can cause potential conflicts between USA and the Muslim world, that also affects the relations between Europe and its Muslim neighbours. China and other Asian countries may choose a more pro-islamic line of policy in order to gain advantages in the competition about oil and gas. Europe (and Sweden) ought not to wait until the countries of Asia have finalised their negotiations with Russia and Central Asia about access to resources of natural gas but instead form a clear strategy for negotiations built on its own present demand and act accordingly
Energy in Asia. An Outline of Some Strategic Energy Issues in Asia
Energy Technology Data Exchange (ETDEWEB)
Kiesow, Ingolf
2003-01-01
The Asian countries are expected to generate 45% of the world energy consumption and Japan is the absolutely greatest consumer in Asia, but China is the country that will be most important as a new consumer on the world energy markets. China, like India and later possibly even Japan try to change to natural gas as a source of energy as much as possible. This is causing a competition about the resources that can be reached by pipelines for gas, which in practice means those in Russia and Central Asia. Russia is trying to control the gas in Central Asia. The competition is also increasing about oil. China is becoming heavily dependent on Muslim countries in the Middle East and Central Asia. This also leads to an effort to increase the safety along the sea lanes, which may collide with the interests of other countries. Territorial conflicts with gas and oil as underlying elements exist in Asia. USA is a player on the energy market, who is using military means as well, but it is possible that in the short perspective, the American acting may not seriously disturb European interests. In the long term perspective, however, the American activity can cause potential conflicts between USA and the Muslim world, that also affects the relations between Europe and its Muslim neighbours. China and other Asian countries may choose a more pro-lslamic line of policy in order to gain advantages in the competition about oil and gas. Europe (and Sweden) ought not to wait until the countries of Asia have finalised their negotiations with Russia and Central Asia about access to resources of natural gas but instead form a clear strategy for negotiations built on its own present demand and act accordingly.
Dynamics of Diabetes and Obesity: An Alarming Situation in the Developing Countries in Asia.
Chakraborty, Chiranjib; Das, Srijit
2016-01-01
The incidence of diabetes in developing countries in Asia has increased over the last few years. The economic development is radically changing the lifestyle of the younger generation who prefer to embrace the western lifestyle of eating high calorie fast food with minimal physical exercise. Previously, the rate of diabetes was very low but it is increasing at an alarming rate in the developing countries in Asia. Admittedly, there is paucity of literature on the prevalence of patients with type-1 diabetes in Asian developing countries due to lower field surveys and lack of quantitative data. Few contributing factors such as body mass index (BMI) and its relation with obesity and diabetes, energy dense diet, excessive caloric intake, sedentary behaviors, lifestyle and family history, gene and genomewide association of diabetes, genes and gene polymorphisms are being discussed especially with regard to the Asian population. Dynamics of the diabetes and obesity was depicted for the population of Asian developing countries with special emphasis on China and India. Diabetes has become widespread among the low-income communities. Hence, it is necessary to develop appropriate healthcare policies in order to mitigate this rampant epidemic before it is too late.
Identification and characterization of an autolysin gene, atlg, from Streptococcus sobrinus.
Yamada, Arisa; Tamura, Haruki; Kato, Hirohisa
2009-02-01
AtlA is a major cell-lytic enzyme called autolysin in Streptococcus mutans. In this study, we identified the atlg gene-encoding autolysin (Atlg), consisting of 863 residues from Streptococcus sobrinus 6715DP, and confirmed lytic activity of recombinant Atlg by zymography of S. sobrinus cells. An atlA-inactivated mutant was constructed in S. mutans Xc, and the atlg gene product was characterized by plasmid complementation. Microscopic analysis, saliva-induced aggregation assay and autolysis assay of static cultures in air revealed that the atlg gene product partially complemented the role of AtlA. Furthermore, the capability of biofilm formation of the atlA-deficient mutant cultivated in air was restored by plasmid comprising the atlg gene. These findings suggest that Atlg may be involved in cell separation and biofilm formation in S. sobrinus.
Chaichan, P; Mercier, A; Galal, L; Mahittikorn, A; Ariey, F; Morand, S; Boumédiène, F; Udonsom, R; Hamidovic, A; Murat, J B; Sukthana, Y; Dardé, M L
2017-09-01
Defining the pattern of genetic diversity of Toxoplasma gondii is important to understand its worldwide distribution. During the last decades, a large number of studies have been published on Toxoplasma genotypes circulating in Europe, in North and South America. Two continents are still largely unexplored, Africa and, to a less extent, Asia. In this last continent, an increasing number of publications reported genotypes circulating in diverse provinces of China, but very few data are available for other Asian countries. After a systematic database search, 47 papers related to T. gondii genotypes in Asia were analyzed. Genetic characterization of DNA was performed by microsatellite markers, or more usually by a multiplex PCR using 11 PCR-RFLP markers, allowing data comparison to draw a first global picture of the population structure of this parasite throughout Asia. Overall, 390 isolates or DNA extracts were completely typed by PCR-RFLP and/or microsatellite marker methods, revealing 36 different PCR-RFLP or equivalent microsatellite genotypes: 15 genotypes identified by a ToxoDB number and 21 atypical or unique genotypes. The most common genotype found in Asia is the genotype ToxoDB#9 (Chinese 1). The clonal types I, II and II variant, and III were also commonly found in Asia. The geographical distribution of these genotypes across Asia may reflect either a continuum with Europe for the western part of Asia (presence of Type II), or the circulation of strains through animal migration or human activities between Africa and the Southwestern part of Asia (Africa 1 genotype in Turkey or ToxoDB#20 both I Sri-Lanka and in Ethiopia or Egypt). Although there are some indications of a genetic population structure in Southeast Asian countries different from the rest of Asia, more studies in this tropical part of Asia will be necessary for a region which represent as well as Africa one of the missing links of the T. gondii genetic diversity. Copyright © 2017 Elsevier B
Cloning, characterization and targeting of the mouse HEXA gene
Energy Technology Data Exchange (ETDEWEB)
Wakamatsu, N.; Trasler, J.M.; Gravel, R.A. [McGill Univ., Quebec (Canada)] [and others
1994-09-01
The HEXA gene, encoding the {alpha} subunit of {beta}-hexosaminidase A, is essential for the metabolism of ganglioside G{sub M2}, and defects in this gene cause Tay-Sachs disease in humans. To elucidate the role of the gene in the nervous system of the mouse and to establish a mouse model of Tay-Sachs disease, we have cloned and characterized the HEXA gene and targeted a disruption of the gene in mouse ES cells. The mouse HEXA gene spans {approximately}26 kb and consists of 14 exons, similar to the human gene. A heterogeneous transcription initiation site was identified 21-42 bp 5{prime} of the initiator ATG, with two of the sites fitting the consensus CTCA (A = start) as seen for some weak initiator systems. Promoter analysis showed that the first 150 bp 5{prime} of the ATG contained 85% of promoter activity observed in constructs containing up to 1050 bp of 5{prime} sequence. The active region contained a sequence matching that of the adenovirus major late promoter upstream element factor. A survey of mouse tissues showed that the highest mRNA levels were in (max to min): testis (5.5 x brain cortex), adrenal, epididymis, heart, brain, lung, kidney, and liver (0.3 x brain cortex). A 12 kb BstI/SalI fragment containing nine exons was disrupted with the insertion of the bacterial neo{sup r} gene in exon 11 and was targeted into 129/Sv ES cells by homologous recombination. Nine of 153 G418 resistant clones were correctly targeted as confirmed by Southern blotting. The heterozygous ES cells were microinjected into mouse blastocysts and implanted into pseudo-pregnant mice. Nine male chimeric mice, showing that 40-95% chimerism for the 129/Sv agouti coat color marker, are being bred in an effort to generate germline transmission of the disrupted HEXA gene.
Molecular characterization of barley 3H semi-dwarf genes.
Directory of Open Access Journals (Sweden)
Haobing Li
Full Text Available The barley chromosome 3H accommodates many semi-dwarfing genes. To characterize these genes, the two-rowed semi-dwarf Chinese barley landrace 'TX9425' was crossed with the Australian barley variety 'Franklin' to generate a doubled haploid (DH population, and major QTLs controlling plant height have been identified in our previous study. The major QTL derived from 'TX9425' was targeted to investigate the allelism of the semi-dwarf gene uzu in barley. Twelve sets of near-isogenic lines and a large NILF2 fine mapping population segregating only for the dwarfing gene from 'TX9425' were developed. The semi-dwarfing gene in 'TX9425' was located within a 2.8 cM region close to the centromere on chromosome 3H by fine mapping. Molecular cloning and sequence analyses showed that the 'TX9425'-derived allele contained a single nucleotide substitution from A to G at position 2612 of the HvBRI1 gene. This was apparently the same mutation as that reported in six-rowed uzu barley. Markers co-segregating with the QTL were developed from the sequence of the HvBRI1 gene and were validated in the 'TX9425'/'Franklin' DH population. The other major dwarfing QTL derived from the Franklin variety was distally located on chromosome 3HL and co-segregated with the sdw1 diagnostic marker hv20ox2. A third dwarfing gene, expressed only in winter-sown trials, was identified and located on chromosome 3HS. The effects and interactions of these dwarfing genes under different growing conditions are discussed. These results improve our understanding of the genetic mechanisms controlling semi-dwarf stature in barley and provide diagnostic markers for the selection of semi-dwarfness in barley breeding programs.
Molecular cloning and characterization of arginine kinase gene of Toxocara canis
Sahu, Shivani; Samanta, S.; Harish, D. R.; Sudhakar, N. R.; Raina, O. K.; Shantaveer, S. B.; Madhu, D. N.; Kumar, Ashok
2013-01-01
Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcripti...
Bartonella species in small mammals and their potential vectors in Asia
Directory of Open Access Journals (Sweden)
Tawisa Jiyipong
2014-10-01
Full Text Available In this article, authors review the current knowledge of Bartonella infection in small mammals including rodents, insectivores, bats and exotic small mammal pets and their vectors in Asia. Species of Bartonella are Gram-negative intracellular bacteria that infect erythrocytes of various mammalian and non-mammalian animals and mainly transmitted by blood sucking arthropod vectors. The genus Bartonella includes several species of important human diseases with severe clinical signs. Several new Bartonella species were isolated from rodents and other small mammals, and from human patients in Asia. Bartonella species are identified using standard polymerase chain reaction amplification and a sequencing targeting two housekeeping genes (gltA and rpoB and the internal transcribed spacer fragment. Authors also discuss the implications in term of potential emerging zoonotic diseases.
Radon-222 in boundary layer and free tropospheric continental outflow events at three ACE-Asia sites
Zahorowski, Wlodek; Chambers, Scott; Wang, Tao; Kang, Chang-Hee; Uno, Itsushi; Poon, Steven; Oh, Sung-Nam; Werczynski, Sylvester; Kim, Jiyoung; Henderson-Sellers, Ann
2011-01-01
A 1-year record of hourly atmospheric radon-222 concentration observations at three ACE-Asia network sites—Hok Tsui (Hong Kong), Gosan (Jeju Island) and Mauna Loa Observatory (Hawaii)—is presented and discussed. The observations include the spring 2001 ACE-Asia intensive operation period. Site locations were chosen for the experimental characterization of both boundary layer (Hok Tsui, Gosan) and free tropospheric (Mauna Loa) continental outflow to the Pacific. A significant seasonal variabil...
Mahapatra, Mana; Upadhyaya, Sasmita; Aviso, Sharie; Babu, Aravindh; Hutchings, Geoff; Parida, Satya
2017-12-18
Foot-and-mouth disease (FMD) is endemic in Southeast Asia (SEA) and East Asia with circulation of multiple serotypes and multiple genotypes within each serotype of the virus. Although countries like Japan and South Korea in the Far East were free of FMD, in 2010 FMD serotype O (O/Mya-98) outbreaks were recorded and since then South Korea has experienced several FMD outbreaks despite regular vaccination. In this study a total of 85 serotype O FMD viruses (FMDV) isolated from 2007 to 2012 from SEA, East Asia and Far East were characterized by virus neutralisation tests using antisera to four existing (O/HKN/6/83, O/IND/R2/75, O/SKR/2010 and O/PanAsia-2) and one putative (O/MYA/2009) vaccine strains, and by full capsid sequencing. Serological studies revealed broad cross-reactivity with the vaccine strains; O/PanAsia-2 exhibited a good match with 95.3%, O/HKN/6/83 with 91.8%, O/IND/R2/75 with 80%, and the putative strain O/MYA/2009 with 89.4% isolates employed in this study. Similarly O/PanAsia-2 and O/IND/R2/75 vaccines showed a good match with all eight viruses belonging to O-Ind-2001d sublineage whereas the vaccines of O/Mya-98 lineage, O/MYA/2009 and O/SKR/2010 exhibited the lowest match indicating their unsuitability to protect infections from O-Ind-2001d viruses. A Bayesian analysis of the capsid sequence data indicated these circulating viruses (n = 85) to be of either SEA or Middle East-South Asian (ME-SA) topotype. The ME-SA topotype viruses were mainly detected in Lao PDR, Vietnam, Myanmar and Thailand reflecting the trade links with the Indian subcontinent, and also within the SEA countries. Implications of these results in the context of FMD control in SEA and East Asian countries are discussed. Copyright © 2017 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Genome-wide identification and characterization of the bHLH gene family in tomato.
Sun, Hua; Fan, Hua-Jie; Ling, Hong-Qing
2015-01-22
The basic helix-loop-helix (bHLH) proteins are a large superfamily of transcription factors, and play a central role in a wide range of metabolic, physiological, and developmental processes in higher organisms. Tomato is an important vegetable crop, and its genome sequence has been published recently. However, the bHLH gene family of tomato has not been systematically identified and characterized yet. In this study, we identified 159 bHLH protein-encoding genes (SlbHLH) in tomato genome and analyzed their structures. Although bHLH domains were conserved among the bHLH proteins between tomato and Arabidopsis, the intron sequences and distribution of tomato bHLH genes were extremely different compared with Arabidopsis. The gene duplication analysis showed that 58.5% and 6.3% of SlbHLH genes belonged to low-stringency and high-stringency duplication, respectively, indicating that the SlbHLH genes are mainly generated via short low-stringency region duplication in tomato. Subsequently, we classified the SlbHLH genes into 21 subfamilies by phylogenetic tree analysis, and predicted their possible functions by comparison with their homologous genes of Arabidopsis. Moreover, the expression profile analysis of SlbHLH genes from 10 different tissues showed that 21 SlbHLH genes exhibited tissue-specific expression. Further, we identified that 11 SlbHLH genes were associated with fruit development and ripening (eight of them associated with young fruit development and three with fruit ripening). The evolutionary analysis revealed that 92% SlbHLH genes might be evolved from ancestor(s) originated from early land plant, and 8% from algae. In this work, we systematically identified SlbHLHs by analyzing the tomato genome sequence using a set of bioinformatics approaches, and characterized their chromosomal distribution, gene structures, duplication, phylogenetic relationship and expression profiles, as well predicted their possible biological functions via comparative analysis
Characterization of the ovine ribosomal protein SA gene and its pseudogenes
Directory of Open Access Journals (Sweden)
Van Zeveren Alex
2010-03-01
Full Text Available Abstract Background The ribosomal protein SA (RPSA, previously named 37-kDa laminin receptor precursor/67-kDa laminin receptor (LRP/LR is a multifunctional protein that plays a role in a number of pathological processes, such as cancer and prion diseases. In all investigated species, RPSA is a member of a multicopy gene family consisting of one full length functional gene and several pseudogenes. Therefore, for studies on RPSA related pathways/pathologies, it is important to characterize the whole family and to address the possible function of the other RPSA family members. The present work aims at deciphering the RPSA family in sheep. Results In addition to the full length functional ovine RPSA gene, 11 other members of this multicopy gene family, all processed pseudogenes, were identified. Comparison between the RPSA transcript and these pseudogenes shows a large variety in sequence identities ranging from 99% to 74%. Only one of the 11 pseudogenes, i.e. RPSAP7, shares the same open reading frame (ORF of 295 amino acids with the RPSA gene, differing in only one amino acid. All members of the RPSA family were annotated by comparative mapping and fluorescence in situ hybridization (FISH localization. Transcription was investigated in the cerebrum, cerebellum, spleen, muscle, lymph node, duodenum and blood, and transcripts were detected for 6 of the 11 pseudogenes in some of these tissues. Conclusions In the present work we have characterized the ovine RPSA family. Our results have revealed the existence of 11 ovine RPSA pseudogenes and provide new data on their structure and sequence. Such information will facilitate molecular studies of the functional RPSA gene taking into account the existence of these pseudogenes in the design of experiments. It remains to be investigated if the transcribed members are functional as regulatory non-coding RNA or as functional proteins.
Ruethers, T; Raith, M; Sharp, M F; Koeberl, M; Stephen, J N; Nugraha, R; Le, T T K; Quirce, S; Nguyen, H X M; Kamath, S D; Mehr, S S; Campbell, D E; Bridges, C R; Taki, A C; Swoboda, I; Lopata, A L
2018-04-01
Fish is a well-recognized cause of food allergy and anaphylaxis. The evolutionary and taxonomic diversity of the various consumed fish species pose a challenge in the identification and characterization of the major fish allergens critical for reliable diagnostics. Globally, fish is a rising cause of food allergy complicated by a large under-investigated variety of species as well as increasing global tourism and trade. This is the first comprehensive study on allergen profiles of heat-processed fish from Vietnam. The aim of this study was to identify the major heat-stable allergens from frequently exported Asia-Pacific freshwater and marine fish and to characterize the major allergen parvalbumin (PV) from one of the most consumed and exported fish species from Asia, the Indian mackerel (Rastrelliger kanagurta). Heated protein extracts from 33 fish species were separated by gel electrophoresis. PV isoforms were identified by immunoblotting utilizing 3 different PV-specific monoclonal and polyclonal antibodies and further characterized by mass spectrometry. IgE reactivity was investigated using sera from 21 patients with confirmed fish allergy. Heat-stable IgE-reactive PVs, with up to 5 isoforms per species, were identified in all 33 analysed fish species. In the Indian mackerel, 7 PV isoforms were identified by 2D-gel electrophoresis combined with mass spectrometric analyses. The amino acid sequence deduced from cDNA of the most expressed isoform showed a high identity (>90%) to PVs from 2 other mackerel species. Different PVs were identified as the major heat-stable allergens in all 33 analysed freshwater and marine fish species from Vietnam, many of which are exported world-wide and 21 species that have never been investigated before. The Indian mackerel PV represents a novel fish allergen, now officially registered as Ras k 1. Improved diagnostics for fish allergy against Asia-Pacific species should be developed with focus on PV. © 2017 John Wiley & Sons Ltd.
The molecular epidemiology of HIV in Asia.
Weniger, B G; Takebe, Y; Ou, C Y; Yamazaki, S
1994-01-01
The human immunodeficiency virus (HIV) was introduced readily into Asia and has quickly spread between Asian states through both parenteral and sexual modes of transmission. Only 1 year after Thailand's epidemic wave among intravenous drug users (IDUs) in 1988, the virus spread to the adjacent Myanmar and Malaysia, and another year later IDUs were infected in parts of India and China bordering Myanmar. Several methods can be used to quantify the genetic diversity, divergence, or variation within or between subtypes, genotypes, or isolates. Consensus sequences, representing the most common nucleotide in the genome, are often generated for comparison. 8 subtypes A through F, H, and O have been described for HIV-1 based on the genetic similarities and differences in the env gene or viral envelope. Subtype A and D have been found primarily in central and western Africa. Subtype B is predominant in Europe, the Western hemisphere, Japan, and Australia. Subtype C has been found mostly in southern Africa, the Central African Republic, and India. Subtype E was first identified in Thailand and recently in the Central African Republic. Subtype F has been found in Romania and is a rare variant in Brazil. Isolates from Gabon and the Russian Federation were designated subtype H. An "outlier" subtype O containing 2 human and 2 chimpanzee isolates has been identified in Cameroon and Gabon. Sequencing of the relatively conserved gag gene of geographically diverse HIV-1 isolates yielded a classification with 7 subtypes A-D and F-H. Other topics discussed include genome characterization, comparison with foreign isolates, segregation by mode of transmission, and biologic properties of HIV-1 variants in Thailand; regional diversity of HIV-1 subtypes and substantial spread of HIV-2 in India; as well as HIV transmission and infections in Japan, Australia, Cambodia, China, Taiwan, Philippines, Malaysia, Myanmar, and in states created out of the former Soviet Union.
Identification and characterization of nuclear genes involved in photosynthesis in Populus
2014-01-01
Background The gap between the real and potential photosynthetic rate under field conditions suggests that photosynthesis could potentially be improved. Nuclear genes provide possible targets for improving photosynthetic efficiency. Hence, genome-wide identification and characterization of the nuclear genes affecting photosynthetic traits in woody plants would provide key insights on genetic regulation of photosynthesis and identify candidate processes for improvement of photosynthesis. Results Using microarray and bulked segregant analysis strategies, we identified differentially expressed nuclear genes for photosynthesis traits in a segregating population of poplar. We identified 515 differentially expressed genes in this population (FC ≥ 2 or FC ≤ 0.5, P photosynthesis by the nuclear genome mainly involves transport, metabolism and response to stimulus functions. Conclusions This study provides new genome-scale strategies for the discovery of potential candidate genes affecting photosynthesis in Populus, and for identification of the functions of genes involved in regulation of photosynthesis. This work also suggests that improving photosynthetic efficiency under field conditions will require the consideration of multiple factors, such as stress responses. PMID:24673936
Directory of Open Access Journals (Sweden)
Jonathan W.K. Liew
2017-07-01
Full Text Available Quantitative reverse transcription PCR (qRT-PCR has been an integral part of characterizing the immunity of Anopheles mosquitoes towards Plasmodium invasion. Two anti-Plasmodium factors of Anopheles, thioester-containing protein 1 (TEP1 and nitric oxide synthase (NOS, play a role in the refractoriness of Anopheles towards Plasmodium infection and are generally expressed during infection. However, these are less studied in Anopheles dirus, a dominant malaria vector in Southeast Asia. Furthermore, most studies used a single reference gene for normalization during gene expression analysis without proper validation. This may lead to erroneous quantification of expression levels. Therefore, the present study characterized and investigated the expression profiles of TEP1 and NOS of Anopheles dirus during P. berghei infection. Prior to that, the elongation factor 1-alpha (EF1, actin 1 (Act and ribosomal protein S7 (S7 genes were validated for their suitability as a set of reference genes. TEP1 and NOS expressions in An. dirus were found to be significantly induced after P. berghei infection.
Sumatera Air Asia Training Center (Arsitektur Metafora)
Susanto, William
2015-01-01
Sumatera Air Asia Training Center as Air Asia training facility’s construction have a propose to train the Air Asia air craft crew who will be the employee of the Air Asia Airlines.Beside the main function;training facility for the Air Asia Crew; the other airline’s crew can be train by a cooperation with Air Asia.The aircraft crew that can be train in this facility is pilot initial, pilot type-rating, pilot recurrent, ATPL, Flight attendant initial and recurrent..This facility ha...
Identification and Characterization of Genes That Interact with Lin-12 in Caenorhabditis Elegans
Tax, F. E.; Thomas, J. H.; Ferguson, E. L.; Horvitz, H. R.
1997-01-01
We identified and characterized 14 extragenic mutations that suppressed the dominant egg-laying defect of certain lin-12 gain-of-function mutations. These suppressors defined seven genes: sup-17, lag-2, sel-4, sel-5, sel-6, sel-7 and sel-8. Mutations in six of the genes are recessive suppressors, whereas the two mutations that define the seventh gene, lag-2, are semi-dominant suppressors. These suppressor mutations were able to suppress other lin-12 gain-of-function mutations. The suppressor ...
The cloning and characterization of a poplar stomatal density gene
Shaneka S. Lawson; Paula M. Pijut; Charles H. Michler
2014-01-01
EPIDERMAL PATTERNING FACTOR1 (EPF1) is a well characterized negative regulator of cell division in Arabidopsis thaliana (AtEPF1) where the primary region of localization is the leaf. However, little data have been reported on the role of EPF1 in other plant species. In this study, the EPF1 gene from ...
International Nuclear Information System (INIS)
2005-01-01
This colloquium on Azerbaijan was organized by the direction of international relations of the French Senate and the French center of foreign trade (CFCE). This document gathers the interventions of the participants and the debates with the audience following these interventions. The topics treated concern: - the present day political-economical situation of Central Asia countries (problem of borders, relations with Russia and China); - the economies of Central Asia countries: short term problems and medium-term perspectives; - the relations with the European Union (political, economical, trade and investments, perspectives); - the European energy stakes of Caspian sea (oil and gas reserves, development of hydrocarbon resources, exploitation and transport constraints, stakes for Europe and France); - TotalFinaElf company in Central Asia (Kazakhstan, Azerbaijan, enclavement problem); - the economical impacts of the TRACECA pathway (Transport Corridor Europe Caucasus Asia). (J.S.)
International Nuclear Information System (INIS)
2011-09-01
The improvement of quality traits in food and industrial crops is an important breeding objective for both developed and developing countries in order to add value to the crop and thereby increasing farmers' income. It has been well established that the application of mutagens can be a very important approach for manipulating many crop characteristics including quality. While mutation induction using nuclear techniques such as gamma irradiation is a power tool in generating new genotypes with favourable alleles for improving crop quality in plant breeding, a more thorough understanding of gene expression, gene interactions, and physical location will improve ability to manipulate and control genes, and directly lead to crop improvement. Physical mapping technologies, molecular markers and molecular cytogenetic techniques are tools available with the potential to enhance the ability to tag genes and gene complexes to facilitate the selection of desirable genotypes in breeding programmes, including those based on mutation breeding. This Coordinated Research Project (CRP) on 'Physical Mapping Technologies for the Identification and Characterization of Mutated Genes Contributing to Crop Quality' was conducted under the overall IAEA project objective of 'Identification, Characterization and Transfer of Mutated Genes'. The specific objectives of the CRP were to assist Member States in accelerating crop breeding programmes through the application of physical mapping and complementary genomic approaches, and the characterization and utilization of induced mutants for improvement of crop quality. The IAEA-TECDOC describes the success obtained in the application of molecular cytology, molecular markers, physical mapping and mutation technologies since the inception of the CRP in 2003. The CRP also resulted in two book chapters, 35 peer reviewed papers, 25 conference proceedings, one PhD thesis, and 22 published abstracts. In addition, thirteen sequences were submitted to the
Directory of Open Access Journals (Sweden)
Veasna Duong
2017-01-01
Full Text Available Zika virus (ZIKV is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored.
Clone and characterization of photolyase-gene from soybean
International Nuclear Information System (INIS)
Najrana, T.; Hirouchi, T.; Yamamoto, K.
2003-01-01
Full text: Cyclobutane pyrimidine dimer (CPD) and pyrimidine [6-4] pyrimidone photoproduct (6-4pp) are the major products of UV-radiation. Both CPD and 6-4pp posses lethal as well as mutagenic property. Excision repair and photoreactivation are involved as major pathways in repairing those photoproducts. To repair those products plant uses photoreactivation as a major pathway. In photoreactivation process photolyase (enzyme encoded by PHR-gene) catalyzes the splitting of the dimer into a monomer under blue light. Photolyase is specific for damage CPD or 6-4pp. The CPD and 6-4pp photolyases are responsible for repairing CPD and 6-4pp lesions respectively. Several investigators reported that removal of CPD lesion is necessary for survival in higher plants in the early development. Thus one should realize the importance of clone and characterization of CPD-photolyase gene from plants especially from those are lying in the list of foods such as wheat, corn, soybean etc. cDNA library (pSPORT-P) of soybean was amplified using the primers that designated as common for CPD-photolyase gene for plants. These primers gave the desire size of PCR product. Desirable PCR product inserted into TA-cloning vector and sequenced. Amino acid sequence revealed considerable homology with CPD-photolyases of rice, arabidopsis thaliana. Then using dilution-PCR amplification method (Hirouchi et al., MGG in press) I have identified the true clone from cDNA library of soybean that containing the full length of CPD-photolyase gene. Full length of cloned gene is about 1698 bps long and exist start and stop codon. Amino acid sequence of the cloned gene shows more than 70% homology with rice, arabidopsis thaliana. Cloned gene enables to complement the E. coli ( phr-uvrA-recA-) system that is completely defective in photoreactivation. The size of CPD-photolyase of soybean is about 56 KDa as identified by 12% SDS PAGE
Characteristics of gastric cancer in Asia.
Rahman, Rubayat; Asombang, Akwi W; Ibdah, Jamal A
2014-04-28
Gastric cancer (GC) is the fourth most common cancer in the world with more than 70% of cases occur in the developing world. More than 50% of cases occur in Eastern Asia. GC is the second leading cause of cancer death in both sexes worldwide. In Asia, GC is the third most common cancer after breast and lung and is the second most common cause of cancer death after lung cancer. Although the incidence and mortality rates are slowly declining in many countries of Asia, GC still remains a significant public health problem. The incidence and mortality varies according to the geographic area in Asia. These variations are closely related to the prevalence of GC risk factors; especially Helicobacter pylori (H. pylori) and its molecular virulent characteristics. The gradual and consistent improvements in socioeconomic conditions in Asia have lowered the H. pylori seroprevalence rates leading to a reduction in the GC incidence. However, GC remains a significant public health and an economic burden in Asia. There has been no recent systemic review of GC incidence, mortality, and H. pylori molecular epidemiology in Asia. The aim of this report is to review the GC incidence, mortality, and linkage to H. pylori in Asia.
Breurec, Sebastien; Guillard, Bertrand; Hem, Sopheak; Brisse, Sylvain; Dieye, Fatou Bintou; Huerre, Michel; Oung, Chakravuth; Raymond, Josette; Tan, Tek Sreng; Thiberge, Jean-Michel; Vong, Sirenda; Monchy, Didier; Linz, Bodo
2011-01-01
The human population history in Southeast Asia was shaped by numerous migrations and population expansions. Their reconstruction based on archaeological, linguistic or human genetic data is often hampered by the limited number of informative polymorphisms in classical human genetic markers, such as the hypervariable regions of the mitochondrial DNA. Here, we analyse housekeeping gene sequences of the human stomach bacterium Helicobacter pylori from various countries in Southeast Asia and we provide evidence that H. pylori accompanied at least three ancient human migrations into this area: i) a migration from India introducing hpEurope bacteria into Thailand, Cambodia and Malaysia; ii) a migration of the ancestors of Austro-Asiatic speaking people into Vietnam and Cambodia carrying hspEAsia bacteria; and iii) a migration of the ancestors of the Thai people from Southern China into Thailand carrying H. pylori of population hpAsia2. Moreover, the H. pylori sequences reflect iv) the migrations of Chinese to Thailand and Malaysia within the last 200 years spreading hspEasia strains, and v) migrations of Indians to Malaysia within the last 200 years distributing both hpAsia2 and hpEurope bacteria. The distribution of the bacterial populations seems to strongly influence the incidence of gastric cancer as countries with predominantly hspEAsia isolates exhibit a high incidence of gastric cancer while the incidence is low in countries with a high proportion of hpAsia2 or hpEurope strains. In the future, the host range expansion of hpEurope strains among Asian populations, combined with human motility, may have a significant impact on gastric cancer incidence in Asia.
International Nuclear Information System (INIS)
Priddle, R.
1997-01-01
Electricity demand in Asia has grown and continues to grow rapidly. Over 40 per cent of the world's growth in electricity output up to 2010 is expected to come from China and East and South Asia. The need to build the additional production capacity to meet demand is the driving force behind the major structural and institutional changes that are presently transforming the electricity sectors throughout the region. The Asia Electricity Study looks in detail at the current and future role of the electricity sectors in Indonesia, the Philippines and Thailand. It analyses existing and planned electricity policies in areas such as financing regulation, environment and end-use efficiency. To build the region's power infrastructure will require large investments, well beyond what governments or multilateral lending institutions can provide. Consequently, mobilizing private sector participation in the process is vital. Independent Power Producers (IPPs) are being allowed to enter what has, until recently, been a government-dominated field. State-owned utilities are being corporatized and/or privatized to improve their competitiveness. Developing the regulatory environment to match the changes taking place is a key challenge. The significant expansion of generation capacity in Asia will have implications well beyond the region. Changes in energy trade volumes and patterns, caused by the need to obtain fuel for power stations, will have an impact on the energy security of Asia and the world as a whole Similarly, fuel and technology choices will have important consequences for both the regional and global environment. (author)
International tuberculosis research collaborations within Asia.
Molton, James S; Singh, Shweta; Chen, Ling Jun; Paton, Nicholas I
2017-09-07
Asia bears more than half the global tuberculosis (TB) burden. Economic development in the region has increased available funding for biomedical research and opportunity for collaboration. We explored the extent of international tuberculosis research collaborations between institutions within Asia. We conducted a Pubmed search for all articles with tuberculosis in the title published during a 12 month period with at least one author affiliation listed in Asia, then identified international collaborations from institution websites and internet searches. We identified 99 international collaborations involving an institution within Asia, of which only 8 (8.1%) were collaborations between Asian institutions. The remainder were with institutions outside of Asia. The paucity of intra-Asian international research collaboration represents a lost opportunity to optimise regional research funding, capacity building and the development of an Asia-relevant TB research agenda.
Anne Ho
2010-01-01
Technology has transformed the banking industry with the introduction of mobile banking services that offer unprecedented convenience and accessibility to customers. This Asia Focus report describes the various approaches to mobile banking in Asia, and examines how particular countries have addressed regulatory issues.
Characteristics of Fine Particulate Carbonaceous Aerosol at Two Remote Sites in Central Asia
Central Asia is a relatively understudied region of the world in terms of characterizing ambient particulate matter (PM) and quantifying source impacts of PM at receptor locations, although it is speculated to have an important role as a source region for long-range transport of ...
Ancient inland human dispersals from Myanmar into interior East Asia since the Late Pleistocene.
Li, Yu-Chun; Wang, Hua-Wei; Tian, Jiao-Yang; Liu, Li-Na; Yang, Li-Qin; Zhu, Chun-Ling; Wu, Shi-Fang; Kong, Qing-Peng; Zhang, Ya-Ping
2015-03-26
Given the existence of plenty of river valleys connecting Southeast and East Asia, it is possible that some inland route(s) might have been adopted by the initial settlers to migrate into the interior of East Asia. Here we analyzed mitochondrial DNA (mtDNA) HVS variants of 845 newly collected individuals from 14 Myanmar populations and 5,907 published individuals from 115 populations from Myanmar and its surroundings. Enrichment of basal lineages with the highest genetic diversity in Myanmar suggests that Myanmar was likely one of the differentiation centers of the early modern humans. Intriguingly, some haplogroups were shared merely between Myanmar and southwestern China, hinting certain genetic connection between both regions. Further analyses revealed that such connection was in fact attributed to both recent gene flow and certain ancient dispersals from Myanmar to southwestern China during 25-10 kya, suggesting that, besides the coastal route, the early modern humans also adopted an inland dispersal route to populate the interior of East Asia.
Oil and the geopolitics of Central Asia: A "new 'great game'"?
Al-Sati, Saud M.
The nineteenth century rivalry between the Russian Empire and Great Britain over Central Asia, known as the "great game," was triggered by the quest for power and dominance. This study revisits Sir Halford Mackinder's thesis, which viewed the "heartland," consisting of Russia and Central Asia, as being crucial for international politics. It also discusses the influence of Mackinder's ideas on twentieth century geopolitical thinking. The study also examines the common assumption that the new "great game" in Central Asia is evolving around the exploitation of energy resources, and analyzes the consequences of this new factor for the geopolitical significance of the region. The landlocked nature of the Central Asian countries makes it necessary for them to rely on their neighbors for the export of oil and gas to international markets. Thus, the political and economic interests of Russia, Iran, and Turkey motivate them to compete with each other for export routes through their territories. This study also shows that the estimates of Central Asian proven oil reserves are characterized by considerable ambiguity. Estimates vary from seven to twenty-two billion barrels. Despite the fact that these proven oil reserves are limited compared to those of other regions, such as the Middle East, continued exploration is compatible with the Western strategy of energy resource diversification. Another primary aim of American involvement is to prevent the reintegration of Central Asia into the Russian federation and to block Chinese influence in Central Asia. This study reveals that realities in today's Central Asia are different from those of the nineteenth century. Central Asia now consists of independent countries; the competing powers have changed, with the exception of Russia; and oil has emerged as a new factor. However, the perpetual quest for power and dominance that marked the historical "great game" is still at work in the last decade of the twentieth century. Finally, the
Characterization of Gene Candidates for Vacuolar Sodium Transport from Hordeum Vulgare
Scheu, Arne Hagen August
2017-01-01
Various potential causes are discussed, including inaccuracies in the genome resource used as reference for primer design and issues inherent to the model system. Finally, I make suggestions on how to proceed to further characterize the candidate genes and hopefully identify novel sodium transporters from barley.
Directory of Open Access Journals (Sweden)
Vanessa Soufflet-Freslon
Full Text Available Carrot is a vegetable cultivated worldwide for the consumption of its root. Historical data indicate that root colour has been differentially selected over time and according to geographical areas. Root pigmentation depends on the relative proportion of different carotenoids for the white, yellow, orange and red types but only internally for the purple one. The genetic control for root carotenoid content might be partially associated with carotenoid biosynthetic genes. Carotenoid isomerase (CRTISO has emerged as a regulatory step in the carotenoid biosynthesis pathway and could be a good candidate to show how a metabolic pathway gene reflects a species genetic history.In this study, the nucleotide polymorphism and the linkage disequilibrium among the complete CRTISO sequence, and the deviation from neutral expectation were analysed by considering population subdivision revealed with 17 microsatellite markers. A sample of 39 accessions, which represented different geographical origins and root colours, was used. Cultivated carrot was divided into two genetic groups: one from Middle East and Asia (Eastern group, and another one mainly from Europe (Western group. The Western and Eastern genetic groups were suggested to be differentially affected by selection: a signature of balancing selection was detected within the first group whereas the second one showed no selection. A focus on orange-rooted carrots revealed that cultivars cultivated in Asia were mainly assigned to the Western group but showed CRTISO haplotypes common to Eastern carrots.The carotenoid pathway CRTISO gene data proved to be complementary to neutral markers in order to bring critical insight in the cultivated carrot history. We confirmed the occurrence of two migration events since domestication. Our results showed a European background in material from Japan and Central Asia. While confirming the introduction of European carrots in Japanese resources, the history of Central Asia
Characterization of carotenoid hydroxylase gene promoter in Haematococcus pluvialis.
Meng, C X; Wei, W; Su, Z- L; Qin, S
2006-10-01
Astaxanthin, a high-value ketocarotenoid is mainly used in fish aquaculture. It also has potential in human health due to its higher antioxidant capacity than beta-carotene and vitamin E. The unicellular green alga Haematococcus pluvialis is known to accumulate astaxanthin in response to environmental stresses, such as high light intensity and salt stress. Carotenoid hydroxylase plays a key role in astaxanthin biosynthesis in H. pluvialis. In this paper, we report the characterization of a promoter-like region (-378 to -22 bp) of carotenoid hydroxylase gene by cloning, sequence analysis and functional verification of its 919 bp 5'-flanking region in H. pluvialis. The 5'-flanking region was characterized using micro-particle bombardment method and transient expression of LacZ reporter gene. Results of sequence analysis showed that the 5'-flanking region might have putative cis-acting elements, such as ABA (abscisic acid)-responsive element (ABRE), C-repeat/dehydration responsive element (C-repeat/DRE), ethylene-responsive element (ERE), heat-shock element (HSE), wound-responsive element (WUN-motif), gibberellin-responsive element (P-box), MYB-binding site (MBS) etc., except for typical TATA and CCAAT boxes. Results of 5' deletions construct and beta-galactosidase assays revealed that a highest promoter-like region might exist from -378 to -22 bp and some negative regulatory elements might lie in the region from -919 to -378 bp. Results of site-directed mutagenesis of a putative C-repeat/DRE and an ABRE-like motif in the promoter-like region (-378 to -22 bp) indicated that the putative C-repeat/DRE and ABRE-like motif might be important for expression of carotenoid hydroxylase gene.
Gene expression characterizes different nutritional strategies among three mixotrophic protists.
Liu, Zhenfeng; Campbell, Victoria; Heidelberg, Karla B; Caron, David A
2016-07-01
Mixotrophic protists, i.e. protists that can carry out both phototrophy and heterotrophy, are a group of organisms with a wide range of nutritional strategies. The ecological and biogeochemical importance of these species has recently been recognized. In this study, we investigated and compared the gene expression of three mixotrophic protists, Prymnesium parvum, Dinobyron sp. and Ochromonas sp. under light and dark conditions in the presence of prey using RNA-Seq. Gene expression of the obligately phototrophic P. parvum and Dinobryon sp. changed significantly between light and dark treatments, while that of primarily heterotrophic Ochromonas sp. was largely unchanged. Gene expression of P. parvum and Dinobryon sp. shared many similarities, especially in the expression patterns of genes related to reproduction. However, key genes involved in central carbon metabolism and phagotrophy had different expression patterns between these two species, suggesting differences in prey consumption and heterotrophic nutrition in the dark. Transcriptomic data also offered clues to other physiological traits of these organisms such as preference of nitrogen sources and photo-oxidative stress. These results provide potential target genes for further exploration of the mechanisms of mixotrophic physiology and demonstrate the potential usefulness of molecular approaches in characterizing the nutritional modes of mixotrophic protists. © FEMS 2016. All rights reserved. For permissions, please e-mail: journals.permissions@oup.com.
Triticale powdery mildew: population characterization and wheat gene efficiency.
Bouguennec, Annaig; Trottet, Maxime; du Cheyron, Philippe; Lonnet, Philippe
2014-01-01
Powdery mildew has emerged on triticale in the early 2000s in many locations, probably due to a host range expansion of the wheat formae speciales, Blumeria graminis f.sp. tritici. Many triticale cultivars are highly susceptible to powdery mildew, mainly in seedling stage, revealing a probably narrow genetic basis for powdery mildew resistance genes (Pm). Moreover, as Blumeria graminis is an obligate biotrophic fungus, it is very time consuming and difficult to maintain powdery mildew isolates for a non-specialized laboratory and populations can evolve. In order to identify wheat Pm genes efficient against natural populations of powdery mildew, wheat differential hosts and triticale seedlings were inoculated below susceptible triticale crop naturally contaminated by mildew, in several locations and several years. Symptoms on seedlings were measured after approximately two weeks of incubation in favorable fungus growth conditions. According to these data, we classified the Pm genes presents in our wheat differential hosts set in 3 classes: Pm already overcame by triticale powdery mildew, Pm having variable effects and Pm still efficient against triticale mildew. Data on triticale seedlings allowed us to identify some few triticale cultivars resistant to Blumeria graminis in seedling stage. We will try to identify Pm genes present in those cultivars next year by testing them with the characterized isolates of powdery mildew from Gent University. Nevertheless, interspecific crossing of wheat, resistant to powdery mildew in seedling stage, and rye have been initiated to introduce potentially interesting genes for resistance in triticale.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Petrov, Petar; Syrjänen, Riikka; Smith, Jacqueline; Gutowska, Maria Weronika; Uchida, Tatsuya; Vainio, Olli; Burt, David W
2015-01-01
"Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Malyarchuk, Boris; Derenko, Miroslava; Mikhailova, Ekaterina; Denisova, Galina
2014-02-01
Phylogenetic and statistical analyses of DNA sequences of two genes, cytochrome oxidase subunit 1 (cox 1) of the mitochondrial DNA and 18S subunit of the nuclear ribosomal RNA (18S rRNA), was used to characterize Neoechinorhynchus species from fishes collected in different localities of North-East Asia. It has been found that four species can be clearly recognized using molecular markers-Neoechinorhynchus tumidus, Neoechinorhynchus beringianus, Neoechinorhynchus simansularis and Neoechinorhynchus salmonis. 18S sequences ascribed to Neoechinorhynchus crassus specimens from North-East Asia were identical to those of N. tumidus, but differed substantially from North American N. crassus. We renamed North-East Asian N. crassus specimens to N. sp., although the possibility that they represent a subspecies of N. tumidus cannot be excluded, taking into account a relatively small distance between cox 1 sequences of North-East Asian specimens of N. crassus and N. tumidus. Maximum likelihood, maximum parsimony and Bayesian inference analyses were performed for phylogeny reconstruction. All the phylogenetic trees showed that North-East Asian species of Neoechinorhynchus analyzed in this study represent independent clades, with the only exception of N. tumidus and N. sp. for 18S data. Phylogenetic analysis has shown that the majority of species sampled (N. tumidus+N. sp., N. simansularis and N. beringianus) are probably very closely related, while N. salmonis occupies separate position in the trees, possibly indicating a North American origin of this species. © 2013.
Directory of Open Access Journals (Sweden)
Walker Angela M
2009-04-01
Full Text Available Abstract Background The Pregnancy-associated glycoproteins (PAGs belong to a large family of aspartic peptidases expressed exclusively in the placenta of species in the Artiodactyla order. In cattle, the PAG gene family is comprised of at least 22 transcribed genes, as well as some variants. Phylogenetic analyses have shown that the PAG family segregates into 'ancient' and 'modern' groupings. Along with sequence differences between family members, there are clear distinctions in their spatio-temporal distribution and in their relative level of expression. In this report, 1 we performed an in silico analysis of the bovine genome to further characterize the PAG gene family, 2 we scrutinized proximal promoter sequences of the PAG genes to evaluate the evolution pressures operating on them and to identify putative regulatory regions, 3 we determined relative transcript abundance of selected PAGs during pregnancy and, 4 we performed preliminary characterization of the putative regulatory elements for one of the candidate PAGs, bovine (bo PAG-2. Results From our analysis of the bovine genome, we identified 18 distinct PAG genes and 14 pseudogenes. We observed that the first 500 base pairs upstream of the translational start site contained multiple regions that are conserved among all boPAGs. However, a preponderance of conserved regions, that harbor recognition sites for putative transcriptional factors (TFs, were found to be unique to the modern boPAG grouping, but not the ancient boPAGs. We gathered evidence by means of Q-PCR and screening of EST databases to show that boPAG-2 is the most abundant of all boPAG transcripts. Finally, we provided preliminary evidence for the role of ETS- and DDVL-related TFs in the regulation of the boPAG-2 gene. Conclusion PAGs represent a relatively large gene family in the bovine genome. The proximal promoter regions of these genes display differences in putative TF binding sites, likely contributing to observed
Mao, J.; Wang, T.; Ludington, S.; Qiu, Z.; Li, Z.
2017-12-01
East Asia is one of the most complex regions in the world. Its margin was divided into 4 parts: Northeast Asia, North China, South China and Southeast Asia. During the Phanerozoic, continental plates of East Asia have interacted successively with a) the Paleo Tethyan Ocean, b) the Tethyan and Paleo Pacific Oceans and c) the Pacific and Indian. In the Early Mesozoic, the Indosinian orogeny is characterized by the convergence and extension within multiple continental plates, whereas the Late Mesozoic Yanshanian orogeny is characterized by both convergence and compression due to oceanic subduction and by widespread extension. We propose this combination as "East Asia Continental Margin type." Except in Northeast Asia, where Jurassic and Cretaeous accretionary complexes are common, most magmatic rocks are the result of reworking of ancient margins of small continental plates; and oceanic island arc basalts and continental margin arc andesites are largely absent. Because South China is adjacent to the western margin of the Pacific Plate, some effects of its westward subduction must be unavoidable, but juvenile arc-related crust has not been identified. The East Asian Continental Margin is characterized by magmatic rocks that are the result of post-convergent tectonics, which differs markedly from the active continental margins of both South and North America. In summary, the chief characteristics of the East Asian Continental Margin are: 1) In Mesozoic, the periphery of multiple blocks experienced magmatism caused by lithospheric delamination and thinning in response to extension punctuated by shorter periods of convergence. 2) The main mechanism of magma generation was the partial melting of crustal rocks, due to underplating by upwelling mafic magma associated with the collapse of orogenic belts and both extension and compression between small continental blocks. 3) During orogeny, mostly high Sr/Y arc-related granitoids formed, whereas during post-orogenic times, A
Characterization of human septic sera induced gene expression modulation in human myocytes
Hussein, Shaimaa; Michael, Paul; Brabant, Danielle; Omri, Abdelwahab; Narain, Ravin; Passi, Kalpdrum; Ramana, Chilakamarti V.; Parrillo, Joseph E.; Kumar, Anand; Parissenti, Amadeo; Kumar, Aseem
2009-01-01
To gain a better understanding of the gene expression changes that occurs during sepsis, we have performed a cDNA microarray study utilizing a tissue culture model that mimics human sepsis. This study utilized an in vitro model of cultured human fetal cardiac myocytes treated with 10% sera from septic patients or 10% sera from healthy volunteers. A 1700 cDNA expression microarray was used to compare the transcription profile from human cardiac myocytes treated with septic sera vs normal sera. Septic sera treatment of myocytes resulted in the down-regulation of 178 genes and the up-regulation of 4 genes. Our data indicate that septic sera induced cell cycle, metabolic, transcription factor and apoptotic gene expression changes in human myocytes. Identification and characterization of gene expression changes that occur during sepsis may lead to the development of novel therapeutics and diagnostics. PMID:19684886
Metspalu, Mait; Romero, Irene Gallego; Yunusbayev, Bayazit; Chaubey, Gyaneshwer; Mallick, Chandana Basu; Hudjashov, Georgi; Nelis, Mari; Mägi, Reedik; Metspalu, Ene; Remm, Maido; Pitchappan, Ramasamy; Singh, Lalji; Thangaraj, Kumarasamy; Villems, Richard; Kivisild, Toomas
2011-12-09
South Asia harbors one of the highest levels genetic diversity in Eurasia, which could be interpreted as a result of its long-term large effective population size and of admixture during its complex demographic history. In contrast to Pakistani populations, populations of Indian origin have been underrepresented in previous genomic scans of positive selection and population structure. Here we report data for more than 600,000 SNP markers genotyped in 142 samples from 30 ethnic groups in India. Combining our results with other available genome-wide data, we show that Indian populations are characterized by two major ancestry components, one of which is spread at comparable frequency and haplotype diversity in populations of South and West Asia and the Caucasus. The second component is more restricted to South Asia and accounts for more than 50% of the ancestry in Indian populations. Haplotype diversity associated with these South Asian ancestry components is significantly higher than that of the components dominating the West Eurasian ancestry palette. Modeling of the observed haplotype diversities suggests that both Indian ancestry components are older than the purported Indo-Aryan invasion 3,500 YBP. Consistent with the results of pairwise genetic distances among world regions, Indians share more ancestry signals with West than with East Eurasians. However, compared to Pakistani populations, a higher proportion of their genes show regionally specific signals of high haplotype homozygosity. Among such candidates of positive selection in India are MSTN and DOK5, both of which have potential implications in lipid metabolism and the etiology of type 2 diabetes. Copyright © 2011 The American Society of Human Genetics. Published by Elsevier Inc. All rights reserved.
Wen, Bo; Xu, Shuhua; Wang, Yi; Lu, Yan; Wei, Lanhai; Wang, Chuanchao; Li, Shilin; Huang, Xingqiu; Jin, Li; Li, Hui
2011-01-01
Molecular anthropological studies of the populations in and around East Asia have resulted in the discovery that most of the Y-chromosome lineages of East Asians came from Southeast Asia. However, very few Southeast Asian populations had been investigated, and therefore, little was known about the purported migrations from Southeast Asia into East Asia and their roles in shaping the genetic structure of East Asian populations. Here, we present the Y-chromosome data from 1,652 individuals belonging to 47 Mon-Khmer (MK) and Hmong-Mien (HM) speaking populations that are distributed primarily across Southeast Asia and extend into East Asia. Haplogroup O3a3b-M7, which appears mainly in MK and HM, indicates a strong tie between the two groups. The short tandem repeat network of O3a3b-M7 displayed a hierarchical expansion structure (annual ring shape), with MK haplotypes being located at the original point, and the HM and the Tibeto-Burman haplotypes distributed further away from core of the network. Moreover, the East Asian dominant haplogroup O3a3c1-M117 shows a network structure similar to that of O3a3b-M7. These patterns indicate an early unidirectional diffusion from Southeast Asia into East Asia, which might have resulted from the genetic drift of East Asian ancestors carrying these two haplogroups through many small bottle-necks formed by the complicated landscape between Southeast Asia and East Asia. The ages of O3a3b-M7 and O3a3c1-M117 were estimated to be approximately 19 thousand years, followed by the emergence of the ancestors of HM lineages out of MK and the unidirectional northward migrations into East Asia. PMID:21904623
Distinct genomic architecture of Plasmodium falciparum populations from South Asia.
Kumar, Shiva; Mudeppa, Devaraja G; Sharma, Ambika; Mascarenhas, Anjali; Dash, Rashmi; Pereira, Ligia; Shaik, Riaz Basha; Maki, Jennifer N; White, John; Zuo, Wenyun; Tuljapurkar, Shripad; Duraisingh, Manoj T; Gomes, Edwin; Chery, Laura; Rathod, Pradipsinh K
Previous whole genome comparisons of Plasmodium falciparum populations have not included collections from the Indian subcontinent, even though two million Indians contract malaria and about 50,000 die from the disease every year. Stratification of global parasites has revealed spatial relatedness of parasite genotypes on different continents. Here, genomic analysis was further improved to obtain country-level resolution by removing var genes and intergenic regions from distance calculations. P. falciparum genomes from India were found to be most closely related to each other. Their nearest neighbors were from Bangladesh and Myanmar, followed by Thailand. Samples from the rest of Southeast Asia, Africa and South America were increasingly more distant, demonstrating a high-resolution genomic-geographic continuum. Such genome stratification approaches will help monitor variations of malaria parasites within South Asia and future changes in parasite populations that may arise from in-country and cross-border migrations. Copyright © 2016 The Author(s). Published by Elsevier B.V. All rights reserved.
Duong, Veasna; Dussart, Philippe; Buchy, Philippe
2017-01-01
Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of Zika cases in Asia are explored. Copyright © 2016 The Author(s). Published by Elsevier Ltd.. All rights reserved.
Directory of Open Access Journals (Sweden)
W.J.J.O. De Wilde
2013-04-01
Full Text Available DE WILDE, W.J.J.O. & DUYFJES, BRIGITTA E.E. 2004. Kedrostis Medik. in Asia. Reinwardtia 12(2:129 – 133. — Kedrostis (Cucurbitaceae occurs in Africa and Madagascar and comprises 4 (5 species in Asia. Of these 2 species are found in India and Sri Lanka and 2 (3 species in western Malesia. One Malesian species is for the first time included in Kedrostis here, Kedrostis bennettii (Miq. W.J. de Wilde & Duyfjes, and one species is described as new here, Kedrostis hirta W.J. de Wilde & Duyfjes. One more Malesian species is insufficiently known to be formally described. Keywords: Kedrostis, Cucurbitaceae, SE Asia, taxonomy
Characterization of hey bHLH genes in teleost fish.
Winkler, Christoph; Elmasri, Harun; Klamt, Barbara; Volff, Jean-Nicolas; Gessler, Manfred
2003-11-01
Hairy-related basic helix-loop-helix (bHLH) transcription factors are targets of Delta-Notch signaling and represent essential components for a number of cell fate decisions during vertebrate embryogenesis. Hey genes encode a subfamily of hairy-related proteins that have been implicated in processes like somitogenesis, blood vessel and heart development. We have identified and characterized hey genes in three teleost fish lineages using degenerate PCR and database searches. Phylogenetic analysis of Hey proteins suggests a complex pattern of evolution with high divergence of hey2 in Takifugu rubripes (Fugu, Japanese pufferfish) and possibly loss in the related Tetraodon nigroviridis (the freshwater pufferfish). In addition, duplication of hey1 in both pufferfishes, Fugu and Tetraodon, was observed. Conversely, zebrafish (Danio rerio) has the same complement of three hey genes as known from mammals. All three hey genes show much more restricted gene expression profiles in zebrafish when compared to mouse. Importantly, while all three murine Hey genes are expressed in overlapping patterns in the presomitic mesoderm (PSM) and somites, in zebrafish only hey1 shows PSM and somite expression in a highly dynamic fashion. Therefore, while overlapping expression might account for redundancy of hey function in higher vertebrates, this is unlikely to be the case in zebrafish. In deltaD (dlD) deficient after-eight zebrafish mutants, the dynamic expression of hey1 in the PSM is impaired and completely lost in newly formed somitomeres. Overexpression of dlD on the other hand results in the ectopic expression of hey1 in the axial mesoderm. Hence, hey1 represents a target of Delta-Notch signaling dynamically expressed during somite formation in zebrafish.
Demyelinating diseases in Asia.
Ochi, Hirofumi; Fujihara, Kazuo
2016-06-01
The present review aims to discuss the recent advances in inflammatory demyelinating diseases of the central nervous system in Asia. Prevalence of multiple sclerosis (MS) in Asia is lower than that in Western countries, although it has been increasing recently. Meanwhile, there seems to be no major difference in neuromyelitis optica (NMO) prevalence in various regions or ethnicities. Thus, the ratios of NMO/NMO spectrum disorder (NMOSD) to MS are higher in Asia as compared with Western countries, indicating that the differential diagnosis between NMO/NMOSD and MS is a major challenge in Asia. Although the detection of aquaporin-4 (AQP4)-antibody is critical in distinguishing NMO/NMOSD from MS, some patients with NMO/NMOSD phenotype are seronegative for AQP4-antibody, and a fraction of those patients possess autoantibody against myelin oligodendrocyte glycoprotein. The clinical profile of Asian MS seems to be essentially similar to that in Western MS after careful exclusion of NMO/NMOSD, although some unique genetic and/or environmental factors may modify the disease in Asians. MS prevalence has been low but is increasing in Asia. In contrast, NMO/NMOSD prevalence seems relatively constant in the world. Asian MS is not fundamentally different from Western MS, but some genetic and/or environmental differences may cause some features unique to Asian patients.
China's Economic Engagement with Southeast Asia
DEFF Research Database (Denmark)
Kokko, Ari
2014-01-01
Review of: China’s Economic Engagement with Southeast Asia: Indonesia / by John Lee. Trends in Southeast Asia. Singapore: Institute of Southeast Asian Studies, 2013. Pp. 40. Paperback: $9.90/S$12.90. PDF available: http://www.iseas.edu.sg/documents/publication/Trends_2013-3.pdf......Review of: China’s Economic Engagement with Southeast Asia: Indonesia / by John Lee. Trends in Southeast Asia. Singapore: Institute of Southeast Asian Studies, 2013. Pp. 40. Paperback: $9.90/S$12.90. PDF available: http://www.iseas.edu.sg/documents/publication/Trends_2013-3.pdf...
Towards a sustainable Asia. Environment and climate change
Energy Technology Data Exchange (ETDEWEB)
NONE
2011-07-01
This series of books are the output of the research project called ''Sustainable Development in Asia (SDA)'', which was initiated by the Association of Academies of Sciences in Asia (AASA). They are comprised of one synthesis report, which entitled ''Towards a Sustainable Asia: Green Transition and Innovation'', and four thematic reports on natural resources, energy, the environment and climate change, and culture from particular perspectives of agriculture. They aim to: (1) investigate common sustainability issues faced by all Asian countries, including population increase, poverty alleviation, pollution control, ecological restoration, as well as regional problems, such as water shortage in West and Central Asia, energy security in Northeast Asia, development model and transformation in East Asia; (2) analyze and summarize of best practices towards sustainable development in Asia; (3) bring forward suggestions and policy options for promoting green transition, system innovation and sustainable development of Asia. With best practice guidelines for a sustainable Asia, this series of reports, for the first time systematically address the common challenges and regional problems in regard to Asia's natural resources use, pollution reduction and climate protection, sustainable energy development, and innovations for environment-friendly and culture-compatible agriculture. They will provide handy and useful information to researchers, government policy makers and the general public who have concerns about Asia's sustainable development. AASA is a scientific and technological organization in Asia, established in 2000, comprising of 26 member academies all over Asia. Its vision is to provide a forum for the discussion of all issues relevant to science and technology development and its application on national level within Asia. (orig.)
Kwong, Vickie Wai-Ki; Li, Philip Kam-Tao
2015-12-01
There is a growing demand of dialysis in Asia for end-stage renal failure patients. Diabetes mellitus is the leading cause of end-stage renal failure in many countries in Asia. The growth of peritoneal dialysis (PD) in Asia is significant and seeing a good trend. With the enhanced practices of PD, the quality of care in PD in Asia is also improved. Overall, PD and hemodialysis (HD) are comparable in clinical outcome. There is a global trend in the reduction of peritonitis rates and Asian countries also witness such improvement. The socio-economic benefits of PD for end-stage renal failure patients in both urban and rural areas in the developed and developing regions of Asia are an important consideration. This can help to reduce the financial burden of renal failure in addressing the growing demand of patients on dialysis. Initiatives should be considered to further drive down the cost of PD in Asia. Growing demand for dialysis by an increasing number of end-stage renal failure patients requires the use of a cost-effective quality dialysis modality. PD is found to be comparable to HD in outcome and quality. In most countries in Asia, PD should be more cost-effective than HD. A 'PD-first' or a 'PD as first considered therapy' policy can be an overall strategy in many countries in Asia in managing renal failure patients, taking the examples of Hong Kong and Thailand. (1) PD is cheaper than HD and provides a better quality of life worldwide, but its prevalence is significantly lower than that of HD in all countries, with the exception of Hong Kong. Allowing reimbursement of PD but not HD has permitted to increase the use of PD over HD in many Asian countries like Hong Kong, Vietnam, Taiwan, Thailand, as well as in New Zealand and Australia over the last years. In the Western world, however, HD is still promoted, and the proportion of patients treated with PD decreases. Japan remains an exception in Asia where PD penetration is very low. Lack of adequate education of
Isolation and characterization of CXC receptor genes in a range of elasmobranchs.
Goostrey, Anna; Jones, Gareth; Secombes, Christopher J
2005-01-01
The CXC group of chemokines exert their cellular effects via the CXCR group of G-protein coupled receptors. Six CXCR genes have been identified in humans (CXCR1-6), and homologues to some of these have been isolated from a range of vertebrate species. Here we isolate and characterize CXCR genes from a range of elasmobranch species. One CXCR1/2 gene fragment isolated from Scyliorhinus caniculus (lesser spotted catshark), and two CXCR1/2 copies from each of the elasmobranchs, Cetorhinus maximus (basking shark), Carcharodon carcharias (great white shark), and Raja naevus (cuckoo ray), exhibit high similarity to both CXCR1 and CXCR2. The two copies evident in the cuckoo ray and lamniform sharks provide strong evidence of CXCR1/2 lineage specific duplication in rays and sharks. A CXCR fragment isolated from Lamna ditropis (salmon shark) shows high similarity to a range of CXCR4 genes and strong clustering with CXCR4 gene homologues was apparent during phylogenetic reconstruction.
In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression.
Carlin, Sean; Pugachev, Andrei; Sun, Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C Clifton; Humm, John L
2009-10-01
To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer (18)F-fluoromisonidazole ((18)F-FMISO). Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe (124)I-2'-fluoro-2'-deoxy-1-beta-d-arabinofuranosyl-5-iodouracil ((124)I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between (124)I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe (18)F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with (124)I-FIAU (3 h before sacrifice) and (18)F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between (18)F-FMISO and (124)I-FIAU on a pixel-by-pixel basis was performed. Correlation coefficients between (124)I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between (18)F-FMISO and (124)I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of this model for the
In vivo characterization of a reporter gene system for imaging hypoxia-induced gene expression
International Nuclear Information System (INIS)
Carlin, Sean; Pugachev, Andrei; Sun Xiaorong; Burke, Sean; Claus, Filip; O'Donoghue, Joseph; Ling, C. Clifton; Humm, John L.
2009-01-01
Purpose: To characterize a tumor model containing a hypoxia-inducible reporter gene and to demonstrate utility by comparison of reporter gene expression to the uptake and distribution of the hypoxia tracer 18 F-fluoromisonidazole ( 18 F-FMISO). Methods: Three tumors derived from the rat prostate cancer cell line R3327-AT were grown in each of two rats as follows: (1) parental R3327-AT, (2) positive control R3327-AT/PC in which the HSV1-tkeGFP fusion reporter gene was expressed constitutively, (3) R3327-AT/HRE in which the reporter gene was placed under the control of a hypoxia-inducible factor-responsive promoter sequence (HRE). Animals were coadministered a hypoxia-specific marker (pimonidazole) and the reporter gene probe 124 I-2'-fluoro-2'-deoxy-1-β-D-arabinofuranosyl-5-iodouracil ( 124 I-FIAU) 3 h prior to sacrifice. Statistical analysis of the spatial association between 124 I-FIAU uptake and pimonidazole fluorescent staining intensity was then performed on a pixel-by-pixel basis. Utility of this system was demonstrated by assessment of reporter gene expression versus the exogenous hypoxia probe 18 F-FMISO. Two rats, each bearing a single R3327-AT/HRE tumor, were injected with 124 I-FIAU (3 h before sacrifice) and 18 F-FMISO (2 h before sacrifice). Statistical analysis of the spatial association between 18 F-FMISO and 124 I-FIAU on a pixel-by-pixel basis was performed. Results: Correlation coefficients between 124 I-FIAU uptake and pimonidazole staining intensity were: 0.11 in R3327-AT tumors, -0.66 in R3327-AT/PC and 0.76 in R3327-AT/HRE, confirming that only in the R3327-AT/HRE tumor was HSV1-tkeGFP gene expression associated with hypoxia. Correlation coefficients between 18 F-FMISO and 124 I-FIAU uptakes in R3327-AT/HRE tumors were r=0.56, demonstrating good spatial correspondence between the two tracers. Conclusions: We have confirmed hypoxia-specific expression of the HSV1-tkeGFP fusion gene in the R3327-AT/HRE tumor model and demonstrated the utility of
Hu, Jian; Zhang, Jun L; Nardi, Francesco; Zhang, Run J
2008-11-01
The melon fly, Bactrocera cucurbitae Coquillett, is a species of fruit flies of significant agricultural interest. Of supposed Indian origin, the melon fly is now widely distributed throughout South East Asia up to China, while it has been recently eradicated from Japan. The population structure of seven geographic populations from coastal China, as well as samples from other regions of South East Asia and Japan, including lab colonies, have been studied using a 782 bp fragment of mitochondrial cytochrome oxidase I (COI) gene sequence. The observed genetic diversity was exceedingly low, considering the geographic scale of the sampling, and one single haplotype was found to be predominant from Sri Lanka to China. We confirm that Bactrocera cucurbitae exists in South East Asia as a single phyletic lineage, that Chinese populations are genetically uniform, and that no apparent genetic differentiation exists between these and three available Japanese melon fly sequences.
Characterization of the avian Trojan gene family reveals contrasting evolutionary constraints.
Directory of Open Access Journals (Sweden)
Petar Petrov
Full Text Available "Trojan" is a leukocyte-specific, cell surface protein originally identified in the chicken. Its molecular function has been hypothesized to be related to anti-apoptosis and the proliferation of immune cells. The Trojan gene has been localized onto the Z sex chromosome. The adjacent two genes also show significant homology to Trojan, suggesting the existence of a novel gene/protein family. Here, we characterize this Trojan family, identify homologues in other species and predict evolutionary constraints on these genes. The two Trojan-related proteins in chicken were predicted as a receptor-type tyrosine phosphatase and a transmembrane protein, bearing a cytoplasmic immuno-receptor tyrosine-based activation motif. We identified the Trojan gene family in ten other bird species and found related genes in three reptiles and a fish species. The phylogenetic analysis of the homologues revealed a gradual diversification among the family members. Evolutionary analyzes of the avian genes predicted that the extracellular regions of the proteins have been subjected to positive selection. Such selection was possibly a response to evolving interacting partners or to pathogen challenges. We also observed an almost complete lack of intracellular positively selected sites, suggesting a conserved signaling mechanism of the molecules. Therefore, the contrasting patterns of selection likely correlate with the interaction and signaling potential of the molecules.
Liang, Kai-Chiang; Tseng, Joseph T; Tsai, Shaw-Jenq; Sun, H Sunny
2015-08-01
Repetitive elements constitute more than 50% of the human genome. Recent studies implied that the complexity of living organisms is not just a direct outcome of a number of coding sequences; the repetitive elements, which do not encode proteins, may also play a significant role. Though scattered studies showed that repetitive elements in the regulatory regions of a gene control gene expression, no systematic survey has been done to report the characterization and distribution of various types of these repetitive elements in the human genome. Sequences from 5' and 3' untranslated regions and upstream and downstream of a gene were downloaded from the Ensembl database. The repetitive elements in the neighboring of each gene were identified and classified using cross-matching implemented in the RepeatMasker. The annotation and distribution of distinct classes of repetitive elements associated with individual gene were collected to characterize genes in association with different types of repetitive elements using systems biology program. We identified a total of 1,068,400 repetitive elements which belong to 37-class families and 1235 subclasses that are associated with 33,761 genes and 57,365 transcripts. In addition, we found that the tandem repeats preferentially locate proximal to the transcription start site (TSS) of genes and the major function of these genes are involved in developmental processes. On the other hand, interspersed repetitive elements showed a tendency to be accumulated at distal region from the TSS and the function of interspersed repeat-containing genes took part in the catabolic/metabolic processes. Results from the distribution analysis were collected and used to construct a gene-based repetitive element database (GBRED; http://www.binfo.ncku.edu.tw/GBRED/index.html). A user-friendly web interface was designed to provide the information of repetitive elements associated with any particular gene(s). This is the first study focusing on the gene
Isolation and characterization of the human parathyroid hormone-like peptide gene
International Nuclear Information System (INIS)
Mangin, M.; Ikeda, K.; Dreyer, B.E.; Broadus, A.E.
1989-01-01
A parathyroid hormone-like peptide (PTH-LP) has recently been identified in human tumors associated with the syndrome of humoral hypercalcemia of malignancy. The peptide appears to be encoded by a single-copy gene that gives rise to multiple mRNAs that are heterogeneous at both their 5' and their 3' ends. Alternative RNA splicing is responsible for the 3' heterogeneity and results in mRNAs encoding three different peptides, each with a unique C terminus. The authors have isolated and characterized the human PTHLP gene. The gene is a complex transcriptional unit spanning more than 12 kilobases of DNA and containing six exons. Two 5' exons encode distinct 5' untranslated regions and are separated by a putative promoter element, indicating that the gene either has two promoters or is alternatively spliced from a single promoter upstream of the first exon. The middle portion of the PTHLP gene, comprising exons 2-4, has an organizational pattern of introns and exons identical to that of the parathyroid hormone gene, consistent with a common ancestral origin of these two genes. Exon 4 of the PTHLP gene encodes the region common to all three peptides and the C terminus of the shortest peptide, and exons 5 and 6 encode the unique C termini of the other two peptides. Northern analysis of mRNAs from four human tumors of different histological types reveals the preferential use of 3' splicing patterns of individual tumors
The USA and proliferation in Northeast Asia
International Nuclear Information System (INIS)
Weeks, S.B.
1995-01-01
United States policy on proliferation in Northeast Asia poses a test of balance between general US global non-proliferation goals and specific US regional security goals for Northeast Asia. US policy on proliferation in Northeast Asia further poses a test of priorities for US bilateral relations with the key Northeast Asian states, as non-proliferation and regional security goals must be weighed against other (e.g., economic, human rights) declared US policy goals. The result is a US policy equation for Northeast Asia proliferation that is considerably more complex in execution than might be expected from the simple statement of the US goal to avoid nuclear proliferation in Northeast Asia. The question of security assurances - both negative and positive - may be closely related to US policies to avoid proliferation in Northeast Asia
Directory of Open Access Journals (Sweden)
Hashim Nor Haslina
2016-01-01
Full Text Available Southeast Asia countries were developing countries, with the rapid development for a better living condition leads to longer life expectancy, which increased total population. It may result in increased the demand of pharmaceutical in domestic use and or in hospital. Although most wastewater treatment plants (WWTPs met the local authority’s regulatory requirement, there are still many pharmaceutical compound incompletely removed and discharge to the water stream and enter the environment. Recently many studies and researches have published on the occurrence and source as well as the fate of pharmaceuticals all over the world including Asia. As part of Asia region, Southeast Asia countries (Malaysia, Philippines, Singapore, Thailand, Vietnam, Brunei, Cambodia, and Lao PDR seem has lack of research knowledge and information regarding this emerging pollutant issues compared to developed Asia country as China, Korea and Hong Kong. In this paper, it will review recent studies occurrences (surface and wastewater on most common pharmaceuticals with several recommendations to overcome and thus summarise the actual situation in Southeast Asia.
Molecular characterization of the CRa gene conferring clubroot resistance in Brassica rapa.
Ueno, Hiroki; Matsumoto, Etsuo; Aruga, Daisuke; Kitagawa, Satoshi; Matsumura, Hideo; Hayashida, Nobuaki
2012-12-01
Clubroot disease is one of the major diseases affecting Brassicaceae crops, and a number of these crops grown commercially, such as Chinese cabbage (Brassica rapa L. ssp. pekinensis), are known to be highly susceptible to clubroot disease. To provide protection from this disease, plant breeders have introduced genes for resistance to clubroot from the European turnip into susceptible lines. The CRa gene confers specific resistance to the clubroot pathogen Plasmodiophora brassicae isolate M85. Fine mapping of the CRa locus using synteny to the Arabidopsis thaliana genome and partial genome sequences of B. rapa revealed a candidate gene encoding a TIR-NBS-LRR protein. Several structural differences in this candidate gene were found between susceptible and resistant lines, and CRa expression was observed only in the resistant line. Four mutant lines lacking clubroot resistance were obtained by the UV irradiation of pollen from a resistant line, and all of these mutant lines carried independent mutations in the candidate TIR-NBS-LRR gene. This genetic and molecular evidence strongly suggests that the identified gene is CRa. This is the first report on the molecular characterization of a clubroot Resistance gene in Brassicaceae and of the disease resistance gene in B. rapa.
Kubo, Takahiko; Yoshimura, Atsushi; Kurata, Nori
2018-02-10
Hybrid male sterility genes are important factors in creating postzygotic reproductive isolation barriers in plants. One such gene, S25, is known to cause severe transmission ratio distortion in inter-subspecific progeny of cultivated rice Oryza sativa ssp. indica and japonica. To further characterize the S25 gene, we fine-mapped and genetically characterized the S25 gene using near-isogenic lines with reciprocal genetic backgrounds. We mapped the S25 locus within the 0.67-1.02 Mb region on rice chromosome 12. Further genetic analyses revealed that S25 substantially reduced male fertility in the japonica background, but not in the indica background. In first-generation hybrid progeny, S25 had a milder effect than it had in the japonica background. These results suggest that the expression of S25 is epistatically regulated by at least one partially dominant gene present in the indica genome. This finding supports our previous studies showing that hybrid male sterility due to pollen killer genes results from epistatic interaction with other genes that are hidden in the genetic background.
Diabetic Retinopathy in the Asia-Pacific.
Chua, Jacqueline; Lim, Claire Xin Ying; Wong, Tien Yin; Sabanayagam, Charumathi
2018-01-01
Diabetic retinopathy (DR), the most common complication of diabetes mellitus, is the leading cause of new cases of blindness in middle-aged and elderly in the Asia-Pacific. It has been estimated that 51% of all those with blindness due to DR globally (n = 424,400) and 56% of those with visual impairment due to DR (2.1 million) come from the Asia-Pacific. Prevalence of DR among those with diabetes ranged from 10% in India to 43% in Indonesia within the Asia-Pacific. Awareness of DR among persons with diabetes ranged from 28% to 84%. Most common modifiable risk factors for DR in the Asia-Pacific were hyperglycemia, blood pressure, dyslipidemia, and obesity. Implementation of systematic screening programs for DR and advancement in telemedicine screening methods have increased patient coverage and cost-effectiveness, though there are still numerous factors impeding screening uptake in the low-middle income regions of the Asia-Pacific. Management and treatment of DR in the Asia-Pacific is mainly limited to traditional laser retinopexy, but it is suboptimal despite new clinical approaches such as use of intravitreal anti.vascular endothelial growth factor and steroids due to limited resources. Further research and data are required to structure a more cost-effective public healthcare program and more awareness-building initiatives to increase the effectiveness of DR screening programs. Copyright 2017 Asia-Pacific Academy of Ophthalmology.
Nuclear nonproliferation strategy in Asia
International Nuclear Information System (INIS)
Jenkins, F.W.
1989-07-01
The most immediate danger of a further spread of nuclear weapons in Asia is in South Asia, where both India and Pakistan have developed the means of producing nuclear explosive materials. In East Asia, North Korea appears to be in the early stages of a weapon-related nuclear program, and before the end of the century South Korea or Taiwan could revive their past efforts to move closer to a nuclear weapons capability. Over the longer run, Japan could conceivably decide to abandon its present strong opposition to the acquisition of nuclear Weapons. At present, the United States has largely separate approaches to the nuclear weapon proliferation problems in South Asia and in East Asia. This paper argues that these separate approaches should be strengthened and integrated into a broader regional nonproliferation strategy. This regional strategy would have three major strands: inducing India and Pakistan to agree not to produce nuclear weapons or test nuclear explosive devices for a specific period; bolstering the existing nonproliferation regime, principally by maintaining nonproliferation incentives and involving China more in the nonproliferation regime; and encouraging regional cooperation in peaceful uses of nuclear energy
CORRUPTION AND FOREIGN DIRECT INVESTMENT IN EAST ASIA AND SOUTH ASIA: AN ECONOMETRIC STUDY
Directory of Open Access Journals (Sweden)
Rahim M. Quazi
2014-04-01
Full Text Available Many recent FDI studies have focused on the effects of corruption on FDI inflows. Theoretically, corruption can act as either a grabbing hand by raising uncertainty and transaction costs, which should impede FDI, or a helping hand by “greasing” the wheels of commerce in the presence of weak regulatory framework, which should facilitate FDI. This study analyzes the impact of corruption on FDI inflows in East Asia and South Asia – two regions that have recently received huge FDI inflows. Using GLS methodology with 1995-2011 panel data, this study finds that the impact of corruption on FDI is significantly negative and robust, which validates the “grabbing hand” hypothesis. It is also found that, even after accounting for the economic fundamentals, East Asia seems to enjoy a locational advantage in attracting FDI vis-à-vis South Asia. These results further our knowledge of the FDI dynamics, which policymakers should find helpful in devising pro-FDI strategies.
Taiwan Y-chromosomal DNA variation and its relationship with Island Southeast Asia
2014-01-01
Background Much of the data resolution of the haploid non-recombining Y chromosome (NRY) haplogroup O in East Asia are still rudimentary and could be an explanatory factor for current debates on the settlement history of Island Southeast Asia (ISEA). Here, 81 slowly evolving markers (mostly SNPs) and 17 Y-chromosomal short tandem repeats were used to achieve higher level molecular resolution. Our aim is to investigate if the distribution of NRY DNA variation in Taiwan and ISEA is consistent with a single pre-Neolithic expansion scenario from Southeast China to all ISEA, or if it better fits an expansion model from Taiwan (the OOT model), or whether a more complex history of settlement and dispersals throughout ISEA should be envisioned. Results We examined DNA samples from 1658 individuals from Vietnam, Thailand, Fujian, Taiwan (Han, plain tribes and 14 indigenous groups), the Philippines and Indonesia. While haplogroups O1a*-M119, O1a1*-P203, O1a2-M50 and O3a2-P201 follow a decreasing cline from Taiwan towards Western Indonesia, O2a1-M95/M88, O3a*-M324, O3a1c-IMS-JST002611 and O3a2c1a-M133 decline northward from Western Indonesia towards Taiwan. Compared to the Taiwan plain tribe minority groups the Taiwanese Austronesian speaking groups show little genetic paternal contribution from Han. They are also characterized by low Y-chromosome diversity, thus testifying for fast drift in these populations. However, in contrast to data provided from other regions of the genome, Y-chromosome gene diversity in Taiwan mountain tribes significantly increases from North to South. Conclusion The geographic distribution and the diversity accumulated in the O1a*-M119, O1a1*-P203, O1a2-M50 and O3a2-P201 haplogroups on one hand, and in the O2a1-M95/M88, O3a*-M324, O3a1c-IMS-JST002611 and O3a2c1a-M133 haplogroups on the other, support a pincer model of dispersals and gene flow from the mainland to the islands which likely started during the late upper Paleolithic, 18,000 to 15
Sediment dynamics in a large shallow lake characterized by seasonal flood pulse in Southeast Asia.
Siev, Sokly; Yang, Heejun; Sok, Ty; Uk, Sovannara; Song, Layheang; Kodikara, Dilini; Oeurng, Chantha; Hul, Seingheng; Yoshimura, Chihiro
2018-08-01
Most of studies on sediment dynamics in stable shallow lakes focused on the resuspension process as it is the dominant process. However, understanding of sediment dynamics in a shallow lake influenced by flood pulse is unclear. We tested a hypothesis that floodplain vegetation plays as a significant role in lessening the intensity of resuspension process in a shallow lake characterized by the flood pulse system. Therefore, this study aimed to investigate sediment dynamics in this type of shallow lake. The target was Tonle Sap Lake (TSL), which is a large shallow lake influenced by a flood pulse system of Mekong River located in Southeast Asia. An extensive and seasonal sampling survey was conducted to measure total suspended solid (TSS) concentrations, sedimentation and resuspension rates in TSL and its 4 floodplain areas. The study revealed that sedimentation process was dominant (TSS ranged: 3-126mgL -1 ) in the high water period (September-December) while resuspension process was dominant (TSS ranged: 4-652mgL -1 ) only in the low water period (March-June). In addition, floodplain vegetation reduced the resuspension of sediment (up to 26.3%) in water. The implication of the study showed that resuspension is a seasonally dominant process in shallow lake influenced by the flood pulse system at least for the case of TSL. Copyright © 2018 Elsevier B.V. All rights reserved.
Isolation and characterization of the human CDX1 gene: A candidate gene for diastrophic dysplasia
Energy Technology Data Exchange (ETDEWEB)
Bonner, C.; Loftus, S.; Wasmuth, J.J. [Univ. of California, Irvine, CA (United States)
1994-09-01
Diastrophic dysplasia is an autosomal recessive disorder characterized by short stature, dislocation of the joints, spinal deformities and malformation of the hands and feet. Multipoint linkage analysis places the diastrophic dysplasia (DTD) locus in 5q31-5q34. Linkage disequilibrium mapping places the DTD locus near CSFIR in the direction of PDGFRB (which is tandem to CSFIR). This same study tentatively placed PDGFRB and DTD proximal to CSFIR. Our results, as well as recently reported work from other laboratories, suggest that PDGFRB (and possibly DTD) is distal rather than proximal to CSFIR. We have constructed a cosmid contig covering approximately 200 kb of the region containing CSFIR. Several exons have been {open_quotes}trapped{close_quotes} from these cosmids using exon amplification. One of these exons was trapped from a cosmid isolated from a walk from PDGFRB, approximately 80 kb from CSFIR. This exon was sequenced and was determined to be 89% identical to the nucleotide sequence of exon two of the murine CDX1 gene (100% amino acid identity). The exon was used to isolate the human CDX gene. Sequence analysis of the human CDX1 gene indicates a very high degree of homology to the murine gene. CDX1 is a caudal type homeobox gene expressed during gastrulation. In the mouse, expression during gastrulation begins in the primitive streak and subsequently localizes to the ectodermal and mesodermal cells of the primitive streak, neural tube, somites, and limb buds. Later in gastrulation, CDX1 expression becomes most prominent in the mesoderm of the forelimbs, and, to a lesser extent, the hindlimbs. CDX1 is an intriguing candidate gene for diastrophic dysplasia. We are currently screening DNA from affected individuals and hope to shortly determine whether CDX1 is involved in this disorder.
Directory of Open Access Journals (Sweden)
Chen Xin
2012-10-01
Full Text Available Abstract Background The identification of genes that predict in vitro cellular chemosensitivity of cancer cells is of great importance. Chemosensitivity related genes (CRGs have been widely utilized to guide clinical and cancer chemotherapy decisions. In addition, CRGs potentially share functional characteristics and network features in protein interaction networks (PPIN. Methods In this study, we proposed a method to identify CRGs based on Gene Ontology (GO and PPIN. Firstly, we documented 150 pairs of drug-CCRG (curated chemosensitivity related gene from 492 published papers. Secondly, we characterized CCRGs from the perspective of GO and PPIN. Thirdly, we prioritized CRGs based on CCRGs’ GO and network characteristics. Lastly, we evaluated the performance of the proposed method. Results We found that CCRG enriched GO terms were most often related to chemosensitivity and exhibited higher similarity scores compared to randomly selected genes. Moreover, CCRGs played key roles in maintaining the connectivity and controlling the information flow of PPINs. We then prioritized CRGs using CCRG enriched GO terms and CCRG network characteristics in order to obtain a database of predicted drug-CRGs that included 53 CRGs, 32 of which have been reported to affect susceptibility to drugs. Our proposed method identifies a greater number of drug-CCRGs, and drug-CCRGs are much more significantly enriched in predicted drug-CRGs, compared to a method based on the correlation of gene expression and drug activity. The mean area under ROC curve (AUC for our method is 65.2%, whereas that for the traditional method is 55.2%. Conclusions Our method not only identifies CRGs with expression patterns strongly correlated with drug activity, but also identifies CRGs in which expression is weakly correlated with drug activity. This study provides the framework for the identification of signatures that predict in vitro cellular chemosensitivity and offers a valuable
2009-01-01
Background Penicillium chrysogenum converts isopenicillin N (IPN) into hydrophobic penicillins by means of the peroxisomal IPN acyltransferase (IAT), which is encoded by the penDE gene. In silico analysis of the P. chrysogenum genome revealed the presence of a gene, Pc13g09140, initially described as paralogue of the IAT-encoding penDE gene. We have termed this gene ial because it encodes a protein with high similarity to IAT (IAL for IAT-Like). We have conducted an investigation to characterize the ial gene and to determine the role of the IAL protein in the penicillin biosynthetic pathway. Results The IAL contains motifs characteristic of the IAT such as the processing site, but lacks the peroxisomal targeting sequence ARL. Null ial mutants and overexpressing strains indicated that IAL lacks acyltransferase (penicillin biosynthetic) and amidohydrolase (6-APA forming) activities in vivo. When the canonical ARL motif (leading to peroxisomal targeting) was added to the C-terminus of the IAL protein (IALARL) by site-directed mutagenesis, no penicillin biosynthetic activity was detected. Since the IAT is only active after an accurate self-processing of the preprotein into α and β subunits, self-processing of the IAL was tested in Escherichia coli. Overexpression experiments and SDS-PAGE analysis revealed that IAL is also self-processed in two subunits, but despite the correct processing, the enzyme remained inactive in vitro. Conclusion No activity related to the penicillin biosynthesis was detected for the IAL. Sequence comparison among the P. chrysogenum IAL, the A. nidulans IAL homologue and the IAT, revealed that the lack of enzyme activity seems to be due to an alteration of the essential Ser309 in the thioesterase active site. Homologues of the ial gene have been found in many other ascomycetes, including non-penicillin producers. Our data suggest that like in A. nidulans, the ial and penDE genes might have been formed from a single ancestral gene that became
International Nuclear Information System (INIS)
Johnson, C.J.
1997-02-01
Coal exports from the US to Asia are declining over time as a result of (1) increased competition from coal suppliers within the Asia-Pacific region, (2) changing steel making technologies, (3) decreased emphasis on security of coal supplies, and (4) deregulation of the energy industry--particularly electric utilities. There are no major changes on the horizon that are likely to alter the role of the US as a modest coal supplier to the Asia-Pacific region. The downward trend in US coal exports to Asia is expected to continue over the 1997--2010 period. But economic and policy changes underway in Asia are likely to result in periodic coal shortages, lasting a few months to a year, and short term increased export opportunities for US coal. US coal exports to Asia are projected to fluctuate within the following ranges over the 2000--2010 period: 10--17 million tons in total exports, 6--12 million tons in thermal coal exports, and 4--9 million tons in coking coal exports. The most important role for US coal, from the perspective of Asian coal importing countries, is to ensure a major alternative source of coal supplies that can be turned to in the event of unforeseen disruptions in coal supplies from the Asia-Pacific region or South Africa. However, the willingness of consumers to pay a premium to ensure US export capacity is declining, with increased emphasis on obtaining the lowest cost coal supplies
Yang, Yan; Zhou, Yuan; Chi, Yingjun; Fan, Baofang; Chen, Zhixiang
2017-12-19
WRKY proteins are a superfamily of plant transcription factors with important roles in plants. WRKY proteins have been extensively analyzed in plant species including Arabidopsis and rice. Here we report characterization of soybean WRKY gene family and their functional analysis in resistance to soybean cyst nematode (SCN), the most important soybean pathogen. Through search of the soybean genome, we identified 174 genes encoding WRKY proteins that can be classified into seven groups as established in other plants. WRKY variants including a WRKY-related protein unique to legumes have also been identified. Expression analysis reveals both diverse expression patterns in different soybean tissues and preferential expression of specific WRKY groups in certain tissues. Furthermore, a large number of soybean WRKY genes were responsive to salicylic acid. To identify soybean WRKY genes that promote soybean resistance to SCN, we first screened soybean WRKY genes for enhancing SCN resistance when over-expressed in transgenic soybean hairy roots. To confirm the results, we transformed five WRKY genes into a SCN-susceptible soybean cultivar and generated transgenic soybean lines. Transgenic soybean lines overexpressing three WRKY transgenes displayed increased resistance to SCN. Thus, WRKY genes could be explored to develop new soybean cultivars with enhanced resistance to SCN.
Nguyen, Doan C.; Uyeki, Timothy M.; Jadhao, Samadhan; Maines, Taronna; Shaw, Michael; Matsuoka, Yumiko; Smith, Catherine; Rowe, Thomas; Lu, Xiuhua; Hall, Henrietta; Xu, Xiyan; Balish, Amanda; Klimov, Alexander; Tumpey, Terrence M.; Swayne, David E.; Huynh, Lien P. T.; Nghiem, Ha K.; Nguyen, Hanh H. T.; Hoang, Long T.; Cox, Nancy J.; Katz, Jacqueline M.
2005-01-01
Since 1997, outbreaks of highly pathogenic (HP) H5N1 and circulation of H9N2 viruses among domestic poultry in Asia have posed a threat to public health. To better understand the extent of transmission of avian influenza viruses (AIV) to humans in Asia, we conducted a cross-sectional virologic study in live bird markets (LBM) in Hanoi, Vietnam, in October 2001. Specimens from 189 birds and 18 environmental samples were collected at 10 LBM. Four influenza A viruses of the H4N6 (n = 1), H5N2 (n = 1), and H9N3 (n = 2) subtypes were isolated from healthy ducks for an isolation frequency of over 30% from this species. Two H5N1 viruses were isolated from healthy geese. The hemagglutinin (HA) genes of these H5N1 viruses possessed multiple basic amino acid motifs at the cleavage site, were HP for experimentally infected chickens, and were thus characterized as HP AIV. These HA genes shared high amino acid identities with genes of other H5N1 viruses isolated in Asia during this period, but they were genetically distinct from those of H5N1 viruses isolated from poultry and humans in Vietnam during the early 2004 outbreaks. These viruses were not highly virulent for experimentally infected ducks, mice, or ferrets. These results establish that HP H5N1 viruses with properties similar to viruses isolated in Hong Kong and mainland China circulated in Vietnam as early as 2001, suggest a common source for H5N1 viruses circulating in these Asian countries, and provide a framework to better understand the recent widespread emergence of HP H5N1 viruses in Asia. PMID:15767421
Central Asia's raging waters the prospects of water conflict in Central Asia
Hartman, William B.
2007-01-01
This thesis examines the prospects of conflict caused by water scarcity in Central Asia. The thesis analyzes the three most recent political eras of Central Asia, Tsarist Russia, the Soviet Union and independence, utilizing indicators of water tensions including: water quality, water quantity, the management of water for multiple uses, the political divisions and geopolitical setting, state institutions and national water ethos. Although water is not likely to be the sole cause of a majo...
Malaria successes and challenges in Asia.
Bhatia, Rajesh; Rastogi, Rakesh Mani; Ortega, Leonard
2013-12-01
Asia ranks second to Africa in terms of malaria burden. In 19 countries of Asia, malaria is endemic and 2.31 billion people or 62% of the total population in these countries are at risk of malaria. In 2010, WHO estimated around 34.8 million cases and 45,600 deaths due to malaria in Asia. In 2011, 2.7 million cases and > 2000 deaths were reported. India, Indonesia, Myanmar and Pakistan are responsible for >85% of the reported cases (confirmed) and deaths in Asia. In last 10 yr, due to availability of donor's fund specially from Global fund, significant progress has been made by the countries in Asia in scaling-up malaria control interventions which were instrumental in reducing malaria morbidity and mortality significantly. There is a large heterogeneity in malaria epidemiology in Asia. As a result, the success in malaria control/elimination is also diverse. As compared to the data of the year 2000, out of 19 malaria endemic countries, 12 countries were able to reduce malaria incidence (microscopically confirmed cases only) by 75%. Two countries, namely Bangladesh and Malaysia are projected to reach 75% reduction by 2015 while India is projected to reach 50-75% only by 2015. The trend could not be assessed in four countries, namely Indonesia, Myanmar, Pakistan and Timor-Leste due to insufficient consistent data. Numerous key challenges need to be addressed to sustain the gains and eliminate malaria in most parts of Asia. Some of these are to control the spread of resistance in Plasmodium falciparum to artemisinin, control of outdoor transmission, control of vivax malaria and ensuring universal coverage of key interventions. Asia has the potential to influence the malaria epidemiology all over the world as well as to support the global efforts in controlling and eliminating malaria through production of quality-assured ACTs, RDTs and long-lasting insecticidal nets.
DEFF Research Database (Denmark)
Jensen, T G; Andresen, B S; Jensen, H K
1996-01-01
To characterize disease-causing mutations in the low density lipoprotein receptor (LDL-R) gene, COS cells are transfected with the mutant gene in an EBV-based expression vector and characterized by flow cytometry. Using antibodies against the LDL-receptor the amount of receptor protein on the cel...
Establishing bioinformatics research in the Asia Pacific
Ranganathan, Shoba; Tammi, Martti; Gribskov, Michael; Tan, Tin Wee
2006-01-01
Abstract In 1998, the Asia Pacific Bioinformatics Network (APBioNet), Asia's oldest bioinformatics organisation was set up to champion the advancement of bioinformatics in the Asia Pacific. By 2002, APBioNet was able to gain sufficient critical mass to initiate the first International Conference on Bioinformatics (InCoB) bringing together scientists working in the field of bioinformatics in the region. This year, the InCoB2006 Conference was organized as the 5th annual conference of the Asia-...
Japanese strategic thought toward asia
Rozman, Gilbert; Ferguson, Joseph
2007-01-01
Japanese leaders and often the media too have substituted symbols for strategy in dealing with Asia. This comprehensive review of four periods over twenty years exposes the strategic gap in viewing individually and collectively China, Taiwan, the Korean peninsula, Russia, Central Asia, and regionalism.
China, Southeast Asia, and the United States
Directory of Open Access Journals (Sweden)
Lowell Dittmer
2016-04-01
Full Text Available Southeast Asia has historically been a meeting point between East Asia and South Asia before Western colonialism opened the region to the West and to the winds of global modernization. Since Japan’s coercive decolonization during the Second World War, the dominant outside influences have come from the United States and from the People’s Republic of China. The post-Cold War era began with a withdrawal of both China’s and US power projection from Southeast Asia, facilitating the configuration of a triangular ménage à trios, with ASEAN expanding to include all of Southeast Asia and introducing a number of extended forums intended to socialize the rest of East Asia into the ASEAN way. The “rise of China” occurred within this friendly context, though beginning around 2010 its strategic implications began to appear more problematic with the mounting dispute over the issue of the South China Sea.
Purcell, M.K.; Laing, K.J.; Woodson, J.C.; Thorgaard, G.H.; Hansen, J.D.
2009-01-01
The genes encoding the type I and type II interferons (IFNs) have previously been identified in rainbow trout and their proteins partially characterized. These previous studies reported a single type II IFN (rtIFN-??) and three rainbow trout type I IFN genes that are classified into either group I (rtIFN1, rtIFN2) or group II (rtIFN3). In this present study, we report the identification of a novel IFN-?? gene (rtIFN-??2) and a novel type I group II IFN (rtIFN4) in homozygous rainbow trout and predict that additional IFN genes or pseudogenes exist in the rainbow trout genome. Additionally, we provide evidence that short and long forms of rtIFN1 are actively and differentially transcribed in homozygous trout, and likely arose due to alternate splicing of the first exon. Quantitative reverse transcriptase PCR (qRT-PCR) assays were developed to systematically profile all of the rainbow trout IFN transcripts, with high specificity at an individual gene level, in na??ve fish and after stimulation with virus or viral-related molecules. Cloned PCR products were used to ensure the specificity of the qRT-PCR assays and as absolute standards to assess transcript abundance of each gene. All IFN genes were modulated in response to Infectious hematopoietic necrosis virus (IHNV), a DNA vaccine based on the IHNV glycoprotein, and poly I:C. The most inducible of the type I IFN genes, by all stimuli tested, were rtIFN3 and the short transcript form of rtIFN1. Gene expression of rtIFN-??1 and rtIFN-??2 was highly up-regulated by IHNV infection and DNA vaccination but rtIFN-??2 was induced to a greater magnitude. The specificity of the qRT-PCR assays reported here will be useful for future studies aimed at identifying which cells produce IFNs at early time points after infection. ?? 2008 Elsevier Ltd.
International Nuclear Information System (INIS)
Allen-Brady, Kristina; Camp, Nicola J
2005-01-01
Characterization of the linkage disequilibrium (LD) structure of candidate genes is the basis for an effective association study of complex diseases such as cancer. In this study, we report the LD and haplotype architecture and tagging-single nucleotide polymorphisms (tSNPs) for five DNA repair genes: ATM, MRE11A, XRCC4, NBS1 and RAD50. The genes ATM, MRE11A, and XRCC4 were characterized using a panel of 94 unrelated female subjects (47 breast cancer cases, 47 controls) obtained from high-risk breast cancer families. A similar LD structure and tSNP analysis was performed for NBS1 and RAD50, using publicly available genotyping data. We studied a total of 61 SNPs at an average marker density of 10 kb. Using a matrix decomposition algorithm, based on principal component analysis, we captured >90% of the intragenetic variation for each gene. Our results revealed that three of the five genes did not conform to a haplotype block structure (MRE11A, RAD50 and XRCC4). Instead, the data fit a more flexible LD group paradigm, where SNPs in high LD are not required to be contiguous. Traditional haplotype blocks assume recombination is the only dynamic at work. For ATM, MRE11A and XRCC4 we repeated the analysis in cases and controls separately to determine whether LD structure was consistent across breast cancer cases and controls. No substantial difference in LD structures was found. This study suggests that appropriate SNP selection for an association study involving candidate genes should allow for both mutation and recombination, which shape the population-level genomic structure. Furthermore, LD structure characterization in either breast cancer cases or controls appears to be sufficient for future cancer studies utilizing these genes
Molecular cloning and characterization of genes required for nucleotide excision repair in yeast
International Nuclear Information System (INIS)
Friedberg, E.C.
1987-01-01
Nucleotide excision repair in the yeast S. cerevisiae is a complex process which involves a large number of genes. At least five of these genes (RAD1, RAD2, RAD3, RAD4 and RAD10) are absolutely required for this process and mutations in any of these genes result in no detectable excision repair in vivo. In order to understand the function of these genes in DNA repair, the authors isolated a number of them by screening a yeast genomic library for recombinant plasmids which complement the phentoype of sensitivity to ultraviolet (UV) radiation imparted to mutant strains. A plasmid containing the RAD4 gene was isolated by an alternative strategy which will be discussed. The cloned genes have been extensively characterized. It has been determined that the RAD3 gene is essential for the viability of haploid yeast cells in the absence of DNA damage. The RAD2 gene is inducible by treatment of cells with a variety of DNA-damaging agents, including UV radiation and ionizing radiation. The RAD10 gene shares considerable amino acid sequence homology with a cloned gene involved in nucleotide excision repair in human cells. Yeast is a particularly versatile organism for studying gene function by molecular and genetic approaches and emphasis is placed on many of the techniques used in the present studies
Southeast Asia and U.S. Security
National Research Council Canada - National Science Library
Byers, Michael; Clark, Jr., R. W; Sporn, James
1996-01-01
The Southeast Asia region consists of the following countries Brunei, Burma Cambodia Indonesia Laos, Malaysia Philippines, Singapore Thailand and Vietnam For the purpose of this paper, Southeast Asia...
Financial Shenanigans : Evidence from Developing Countries In East Asia and South Asia
Leong, Siew Yean
2014-01-01
This study investigates the reported cases involved in financial shenanigans which subject to the enforcement actions by the authorities of selected developing countries in East Asia and South Asia between 2010 and 2012. The scope of this study includes the attempts used and causes of the financial shenanigans. This study finds that the most common attempt used by the sample companies is overstating the revenue and follows by manipulation of expenses and discretionary accounting. Revenue and ...
Molecular characterization of ferulate 5-hydroxylase gene from kenaf (Hibiscus cannabinus L.)
The purpose of this research was to clone and characterize the expression pattern of a kenaf (Hibiscus cannabinus L.) F5H gene that encodes ferulate 5-hydroxylase in the phenylpropanoid pathway. Kenaf is well known as a fast growing dicotyledonous plant, which makes it a valuable biomass plant. The ...
From Jollibee to BeeBee: "lifestyle" and chronic illness in Southeast Asia.
Manderson, Lenore; Naemiratch, Bhensri
2010-07-01
Throughout Southeast Asia, the number of people living with chronic conditions and degenerative disease has increased proportionately and absolutely. Public health interventions and effective medical treatment and surgeries have increased life expectancy. Concurrently, social and economic conditions have led to the rapid escalation of lifelong illnesses, characterized as "lifestyle" conditions. Drawing on ethnographic and survey research conducted in Southeast Asia, the authors illustrate the multiple factors contributing to people's health. Changes in food production; the organization, nature, and conditions of work; living conditions; and other factors affecting contemporary living increase vulnerability to noncommunicable diseases. These factors are largely beyond the control of most people. Efforts to reduce chronic illnesses predominantly focus on individual interventions, overlooking the lack of individual capacity to address the structural and institutional factors that compromise people's health.
Eltahir, E. A. B.
2017-12-01
I will review recent work from my group on the impact of climate change on the intensity and frequency of heat waves in Asia. Our studies covered Southwest Asia, South Asia, East China, and the Maritime continent. In any of these regions, the risk associated with climate change impact reflects intensity of natural hazard and level of human vulnerability. Previous work has shown that the wet-bulb temperature is a useful variable to consider in describing the natural hazard from heat waves since it can be easily compared to the natural threshold that defines the upper limit on human survivability. Based on an ensemble of high resolution climate change simulations, we project extremes of wet-bulb temperature conditions in each of these four regions of Asia. We consider the business-as-usual scenario of future greenhouse gas emissions, as well as a moderate mitigation scenario. The results from these regions will be compared and lessons learned summarized.
NASA's East and Southeast Asia Initiatives: BASE-ASIA and EAST-AIRE
Tsay, S.; Maring, H.
2005-01-01
Airborne dust from northern China influences air quality and regional climate in Asia during springtime. However, with the economic growth in China, increased emission of particulate air pollutants from industrial and vehicular sources will not only impact the earth's radiation balance, but also adversely affect human health year round. In addition, both of dust and aerosol pollutants can be transported swiftly across the Pacific affecting North America within a few days. Asian dust and pollutant aerosols can be detected by their colored appearance using current Earth observing satellites (e.g., MODIS, SeaWiFS, TOMS, etc.) and by sunphotometers deployed on the surface of the earth. Biomass burning has been a regular practice for land clearing and conversion in many countries, especially those in Africa, South America, and Southeast Asia. However, the climatology of Southeast Asia is very different than that of Africa and South America, such that large-scale biomass burning causes smoke to interact extensively with clouds during the peak-burning season of March to April. Globally significant sources of greenhouse gases (eg., CO2, CH4), chemically active gases (e.g., NO, CO, HC, CH3Br), and atmospheric aerosols are produced by biomass burning. These gases influence the Earth-atmosphere system, impacting both global climate and tropospheric chemistry. Some aerosols can serve as cloud condensation nuclei, which play a role in determining cloud lifetime and precipitation, altering the earth's radiation and water budgets. Biomass burning also affects the biogeochemical cycling of nitrogen and carbon compounds; the hydrological cycle; land surface reflectivity and emissivity; and ecosystem biodiversity and stability. Two NASA initiatives, EAST-AIRE (East Asian Study of Tropospheric Aerosols: an International Regional Experiment) and BASE-ASIA (Biomass-burning Aerosols in South East-Asia: Smoke Impact Assessment) will be presented. The objectives of these initiatives is to
Directory of Open Access Journals (Sweden)
Berhanu Ayalew
2010-08-01
Full Text Available Abstract Background Newcastle disease (ND, caused by Newcastle disease virus (NDV, is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. Results The coding region of eleven NDV isolates fusion (F gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia, Ch/2000 (China, local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. Conclusions The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.
Berhanu, Ayalew; Ideris, Aini; Omar, Abdul R; Bejo, Mohd Hair
2010-08-08
Newcastle disease (ND), caused by Newcastle disease virus (NDV), is a highly contagious disease of birds and has been one of the major causes of economic losses in the poultry industry. Despite routine vaccination programs, sporadic cases have occasionally occurred in the country and remain a constant threat to commercial poultry. Hence, the present study was aimed to characterize NDV isolates obtained from clinical cases in various locations of Malaysia between 2004 and 2007 based on sequence and phylogenetic analysis of partial F gene and C-terminus extension length of HN gene. The coding region of eleven NDV isolates fusion (F) gene and carboxyl terminal region of haemagglutinin-neuraminidase (HN) gene including extensions were amplified by reverse transcriptase PCR and directly sequenced. All the isolates have shown to have non-synonymous to synonymous base substitution rate ranging between 0.081 - 0.264 demonstrating presence of negative selection. Analysis based on F gene showed the characterized isolates possess three different types of protease cleavage site motifs; namely 112RRQKRF117, 112RRRKRF117 and 112GRQGRL117 and appear to show maximum identities with isolates in the region such as cockatoo/14698/90 (Indonesia), Ch/2000 (China), local isolate AF2240 indicating the high similarity of isolates circulating in the South East Asian countries. Meanwhile, one of the isolates resembles commonly used lentogenic vaccine strains. On further characterization of the HN gene, Malaysian isolates had C-terminus extensions of 0, 6 and 11 amino acids. Analysis of the phylogenetic tree revealed that the existence of three genetic groups; namely, genotype II, VII and VIII. The study concluded that the occurrence of three types of NDV genotypes and presence of varied carboxyl terminus extension lengths among Malaysian isolates incriminated for sporadic cases.
Egervärn, M; Roos, S; Lindmark, H
2009-11-01
The study aimed to identify the resistance genes mediating atypical minimum inhibitory concentrations (MICs) for tetracycline, erythromycin, clindamycin and chloramphenicol within two sets of representative strains of the species Lactobacillus reuteri and Lactobacillus plantarum and to characterize identified genes by means of gene location and sequencing of flanking regions. A tet(W) gene was found in 24 of the 28 Lact. reuteri strains with atypical MIC for tetracycline, whereas four of the six strains with atypical MIC for erythromycin were positive for erm(B) and one strain each was positive for erm(C) and erm(T). The two Lact. plantarum strains with atypical MIC for tetracycline harboured a plasmid-encoded tet(M) gene. The majority of the tet(W)-positive Lact. reuteri strains and all erm-positive Lact. reuteri strains carried the genes on plasmids, as determined by Southern blot and a real-time PCR method developed in this study. Most of the antibiotic-resistant strains of Lact. reuteri and Lact. plantarum harboured known plasmid-encoded resistance genes. Examples of putative transfer machineries adjacent to both plasmid- and chromosome-located resistance genes were also demonstrated. These data provide some of the knowledge required for assessing the possible risk of using Lact. reuteri and Lact. plantarum strains carrying antibiotic resistance genes as starter cultures and probiotics.
Cloning and Characterization of Genes that Inhibit TRAIL-Induced Apoptosis of Breast Cancer Cells
National Research Council Canada - National Science Library
Shu, Hong-Bing
2003-01-01
...). However, some cancer cells are resistant to TRAIL-induced apoptosis (3, 4, 6-13). The purpose of this proposed study is to clone and characterize such inhibitory genes of TRAIL-induced apoptosis...
Directory of Open Access Journals (Sweden)
Muhammad Naveed
2014-09-01
Full Text Available In the present study, samples of rhizosphere and root nodules were collected from different areas of Pakistan to isolate plant growth promoting rhizobacteria. Identification of bacterial isolates was made by 16S rRNA gene sequence analysis and taxonomical confirmation on EzTaxon Server. The identified bacterial strains were belonged to 5 genera i.e. Ensifer, Bacillus, Pseudomona, Leclercia and Rhizobium. Phylogenetic analysis inferred from 16S rRNA gene sequences showed the evolutionary relationship of bacterial strains with the respective genera. Based on phylogenetic analysis, some candidate novel species were also identified. The bacterial strains were also characterized for morphological, physiological, biochemical tests and glucose dehydrogenase (gdh gene that involved in the phosphate solublization using cofactor pyrroloquinolone quinone (PQQ. Seven rhizoshperic and 3 root nodulating stains are positive for gdh gene. Furthermore, this study confirms a novel association between microbes and their hosts like field grown crops, leguminous and non-leguminous plants. It was concluded that a diverse group of bacterial population exist in the rhizosphere and root nodules that might be useful in evaluating the mechanisms behind plant microbial interactions and strains QAU-63 and QAU-68 have sequence similarity of 97 and 95% which might be declared as novel after further taxonomic characterization.
Hou, F; Ma, J; Liu, X; Wang, Y; Liu, X N; Zhang, F C
2010-01-01
Desert beetle Microdera punctipennis (Coleoptera: Tenebriondae) is a special species in Gurbantonggut Desert in Central Asia. To investigate the possible strategy it employs for cold survival, seasonal changes in supercooling point (SCP), body water content, haemolymph osmolality and antifreeze protein gene (Mpafp) expression were measured over 13 months. Our results show SCPs in M. punctipennis adults changed from -8.0°C in summer to -18.7°C in winter. During winter, adults endured modest water loss; total water decreased from 65.4 percent in summer to 55.9% in winter. Mpafp mRNAs level increased by 13.1 fold from summer to early winter, and haemolymph osmolality increased accordingly from 550 mOsm to 1486 mOsm. Correlation coefficient of Mpafp mRNAs level and SCP indicates that Mpafp mRNA explained 65.3 percent of the variation in SCPs. The correlation between Mpafp mRNA level and total water reflected an indirect influence of antifreeze protein on water content via reducing SCP.
Identification and characterization of NF-YB family genes in tung tree.
Yang, Susu; Wang, Yangdong; Yin, Hengfu; Guo, Haobo; Gao, Ming; Zhu, Huiping; Chen, Yicun
2015-12-01
The NF-YB transcription factor gene family encodes a subunit of the CCAAT box-binding factor (CBF), a highly conserved trimeric activator that strongly binds to the CCAAT box promoter element. Studies on model plants have shown that NF-YB proteins participate in important developmental and physiological processes, but little is known about NF-YB proteins in trees. Here, we identified seven NF-YB transcription factor-encoding genes in Vernicia fordii, an important oilseed tree in China. A phylogenetic analysis separated the genes into two groups; non-LEC1 type (VfNF-YB1, 5, 7, 9, 11, 13) and LEC1-type (VfNF-YB 14). A gene structure analysis showed that VfNF-YB 5 has three introns and the other genes have no introns. The seven VfNF-YB sequences contain highly conserved domains, a disordered region at the N terminus, and two long helix structures at the C terminus. Phylogenetic analyses showed that VfNF-YB family genes are highly homologous to GmNF-YB genes, and many of them are closely related to functionally characterized NF-YBs. In expression analyses of various tissues (root, stem, leaf, and kernel) and the root during pathogen infection, VfNF-YB1, 5, and 11 were dominantly expressed in kernels, and VfNF-YB7 and 9 were expressed only in the root. Different VfNF-YB family genes showed different responses to pathogen infection, suggesting that they play different roles in the pathogen response. Together, these findings represent the first extensive evaluation of the NF-YB family in tung tree and provide a foundation for dissecting the functions of VfNF-YB genes in seed development, stress adaption, fatty acid synthesis, and pathogen response.
JPRS Report: East Asia, Southeast Asia, LPDR Criminal Code, Courts, and Criminal Procedure.
1991-03-05
1941 - 1991 JPRS Repor East Asia Southeast Asia LPDR Criminal Code, Courts, and Criminal Procedure mom m £C QUALITY »ra^r...prostitution, will be impris- oned for three to five years. Article 124. Incest . Anyone who has sexual intercourse with parents, step- parents...This consists of facts which indicate whether there have been actions dangerous to society, the guilt of the per- sons who undertook the
Directory of Open Access Journals (Sweden)
David J. Burks
2016-12-01
Full Text Available The Auxin Response Factor (ARF family of transcription factors is an important regulator of environmental response and symbiotic nodulation in the legume Medicago truncatula. While previous studies have identified members of this family, a recent spurt in gene expression data coupled with genome update and reannotation calls for a reassessment of the prevalence of ARF genes and their interaction networks in M. truncatula. We performed a comprehensive analysis of the M. truncatula genome and transcriptome that entailed search for novel ARF genes and the co-expression networks. Our investigation revealed 8 novel M. truncatula ARF (MtARF genes, of the total 22 identified, and uncovered novel gene co-expression networks as well. Furthermore, the topological clustering and single enrichment analysis of several network models revealed the roles of individual members of the MtARF family in nitrogen regulation, nodule initiation, and post-embryonic development through a specialized protein packaging and secretory pathway. In summary, this study not just shines new light on an important gene family, but also provides a guideline for identification of new members of gene families and their functional characterization through network analyses.
Directory of Open Access Journals (Sweden)
Ming He
Full Text Available The white-backed planthopper, Sogatella furcifera, a notorious rice pest in Asia, employs host plant volatiles as cues for host location. In insects, odor detection is mediated by two types of olfactory receptors: odorant receptors (ORs and ionotropic receptors (IRs. In this study, we identified 63 SfurORs and 14 SfurIRs in S. furcifera based on sequences obtained from the head transcriptome and bioinformatics analysis. The motif-pattern of 130 hemiptera ORs indicated an apparent differentiation in this order. Phylogenetic trees of the ORs and IRs were constructed using neighbor-joining estimates. Most of the ORs had orthologous genes, but a specific OR clade was identified in S. furcifera, which suggests that these ORs may have specific olfactory functions in this species. Our results provide a basis for further investigations of how S. furcifera coordinates its olfactory receptor genes with its plant hosts, thereby providing a foundation for novel pest management approaches based on these genes.
Characterization and Expression of the Lucina pectinata Oxygen and Sulfide Binding Hemoglobin Genes
López-Garriga, Juan; Cadilla, Carmen L.
2016-01-01
The clam Lucina pectinata lives in sulfide-rich muds and houses intracellular symbiotic bacteria that need to be supplied with hydrogen sulfide and oxygen. This clam possesses three hemoglobins: hemoglobin I (HbI), a sulfide-reactive protein, and hemoglobin II (HbII) and III (HbIII), which are oxygen-reactive. We characterized the complete gene sequence and promoter regions for the oxygen reactive hemoglobins and the partial structure and promoters of the HbI gene from Lucina pectinata. We show that HbI has two mRNA variants, where the 5’end had either a sequence of 96 bp (long variant) or 37 bp (short variant). The gene structure of the oxygen reactive Hbs is defined by having 4-exons/3-introns with conservation of intron location at B12.2 and G7.0 and the presence of pre-coding introns, while the partial gene structure of HbI has the same intron conservation but appears to have a 5-exon/ 4-intron structure. A search for putative transcription factor binding sites (TFBSs) was done with the promoters for HbII, HbIII, HbI short and HbI long. The HbII, HbIII and HbI long promoters showed similar predicted TFBSs. We also characterized MITE-like elements in the HbI and HbII gene promoters and intronic regions that are similar to sequences found in other mollusk genomes. The gene expression levels of the clam Hbs, from sulfide-rich and sulfide-poor environments showed a significant decrease of expression in the symbiont-containing tissue for those clams in a sulfide-poor environment, suggesting that the sulfide concentration may be involved in the regulation of these proteins. Gene expression evaluation of the two HbI mRNA variants indicated that the longer variant is expressed at higher levels than the shorter variant in both environments. PMID:26824233
2011 Asia Pacific Few-Body Conference Summary Remarks
International Nuclear Information System (INIS)
Gibson, B. F.
2013-01-01
These remarks represent the author’s personal perspective regarding ideas presented at this fifth Asia Pacific Conference on Few-Body Problems in Physics. They are not intended as a comprehensive summary of what we witnessed during this week of stimulating presentations and intense discussions. However, these remarks do characterize some of the physics we heard and some of the key questions raised. The ideas presented will hopefully outlive the rapporteurs who brought their work and that of others to our attention here in the International Hall of the Sungkyunkwan University in Seoul, Republic of Korea. (author)
International Nuclear Information System (INIS)
Segal, G.
1991-01-01
The fate of northeast Asia is central to the global balance of power. But just as the Cold War took a different course in northeast Asia than it did in its central battleground in Europe, so the post-Cold War world in northeast Asia is taking on a different shape. In Europe, formal arms control was a feature of the political landscape both before and after sweeping changes began altering the face of the continent in 1989. In contrast, northeast Asia saw only informal arms control measures before 1989. But in the post-Cold War world, the opportunity for more formal accords seems to be growing as the changing political environment makes them possible. In the rapidly developing virtuous circle of detente in northeast Asia, the prospects for arms control progress are better than ever, although considerable obstacles remain in the way. One of the unique features of northeast Asia is the convergence of interests of four of the world's most powerful nations - the US, the Soviet Union, Japan, and China. But unlike Europe, where the interests of the Soviet Union and the US have intermingled with those of the diverse members of the European Community (EC) and resulted in far-reaching arms reduction and confidence-building accords, northeast Asia has known only limited regional efforts at reducing tension and enhancing regional security. Nevertheless, unilateral moves and bilateral discussions among the four powers have produced a Sino-Soviet detente, reductions in US and Soviet forces in the Pacific region, the beginning of a Soviet-Japanese dialogue aimed at normalizing relations, and an overall trend toward closer diplomatic and economic relations throughout the region
Nuclear safety cooperation in Southeast Asia. Lessons from Asia's regional networks
International Nuclear Information System (INIS)
Trajano, Julius Cesar I.
2017-01-01
Debate has been ongoing among key stakeholders on whether South-east Asia should use or reject nuclear power. However, there are still significant regional concerns over nuclear safety and security in South-east Asia. As some ASEAN countries plan to pursue nuclear power, they need to create and maintain a pool of local nuclear professionals with actual relevant experience in the nuclear industry. While the IAEA does not influence a country's decision on introducing nuclear power, it supports Member States' efforts to evaluate all options towards making a knowledgeable decision. Nuclear safety is the responsibility of every nation that utilizes nuclear technology. National governments are responsible for regulations that govern how safety at nuclear facilities is maintained, as well as to reduce radiation risks, including emergency response and recovery actions. But nuclear energy has transboundary/ regional implications if nuclear safety in each member state is not strengthened. ASEAN countries share a common goal in achieving high level of public safety and confidence in nuclear and radiation related issues. Can regional cooperation help ASEAN Member-States strengthen nuclear safety? The paper examines the importance of regional cooperation on nuclear energy governance and the role of regional organisations in Asia in strengthening nuclear safety cooperation and emergency preparedness and response in Southeast Asia. (author)
Molecular Characterization of Putative Virulence Determinants in Burkholderia pseudomallei
Directory of Open Access Journals (Sweden)
Suat Moi Puah
2014-01-01
Full Text Available The Gram-negative saprophyte Burkholderia pseudomallei is the causative agent of melioidosis, an infectious disease which is endemic in Southeast Asia and northern Australia. This bacterium possesses many virulence factors which are thought to contribute to its survival and pathogenicity. Using a virulent clinical isolate of B. pseudomallei and an attenuated strain of the same B. pseudomallei isolate, 6 genes BPSL2033, BP1026B_I2784, BP1026B_I2780, BURPS1106A_A0094, BURPS1106A_1131, and BURPS1710A_1419 were identified earlier by PCR-based subtractive hybridization. These genes were extensively characterized at the molecular level, together with an additional gene BPSL3147 that had been identified by other investigators. Through a reverse genetic approach, single-gene knockout mutants were successfully constructed by using site-specific insertion mutagenesis and were confirmed by PCR. BPSL2033::Km and BURPS1710A_1419::Km mutants showed reduced rates of survival inside macrophage RAW 264.7 cells and also low levels of virulence in the nematode infection model. BPSL2033::Km demonstrated weak statistical significance (P=0.049 at 8 hours after infection in macrophage infection study but this was not seen in BURPS1710A_1419::Km. Nevertheless, complemented strains of both genes were able to partially restore the gene defects in both in vitro and in vivo studies, thus suggesting that they individually play a minor role in the virulence of B. pseudomallei.
Cloning and characterization of an epoxide hydrolase-encoding gene from Rhodotorula glutinis
Visser, H.; Vreugdenhil, S.; Bont, de J.A.M.; Verdoes, J.C.
2000-01-01
We cloned and characterized the epoxide hydrolase gene, EPH1, from Rhodotorula glutinis. The EPH1 open reading frame of 1230 bp was interrupted by nine introns and encoded a polypeptide of 409 amino acids with a calculated molecular mass of 46.3 kDa. The amino acid sequence was similar to that of
The Prevalence and Management of Diabetic Nephropathy in Asia
Tomino, Yasuhiko; Gohda, Tomohito
2015-01-01
Background Diabetic nephropathy (DN), especially type 2 diabetes, is now increasing rapidly worldwide, also in Asian countries, and is one of the major long-term vascular complications. The pathogenesis of DN involves both genetic and environmental factors. Around 30-40% of type 2 diabetic patients develop DN despite strict blood glucose and/or blood pressure control. Although it is considered that the genetic background may influence the initiation and progression of DN, the candidate genes are still obscure. Summary To search for genes that are involved in the susceptibility of DN, a candidate gene approach was taken in the beginning before the development of genome-wide association studies. Although a candidate gene approach can detect rare genetic variants, in advance we need known or presumed pathophysiological knowledge of the specific gene. Investigations using spontaneous animal models are important to determine the pathogenesis and treatment of DN patients. There are many spontaneous animal models, such as the NOD and Akita mice for type 1 diabetes and the Ob/Ob, db/db, Tsumura Suzuki Obese Diabetics, and KK-Ay mice for type 2 diabetes. Furthermore, the toxicity of persistent hyperglycemia, the activation of reactive oxygen species, systemic and/or glomerular hypertension, microinflammation, dyslipidemia, and other factors are considered to play important roles. Diabetic patients with normoalbuminuria and normal renal function showed typical histological patterns of DN. The discovery of a specific and reliable diagnostic and prognostic biomarker other than albuminuria is urgently needed and indispensable. Since large clinical trials of oral hypoglycemic drugs in renal failure are lacking, these recommendations will need to be regularly updated after results of larger randomized trials with longer follow-up durations are available. Key Message It is necessary to summarize the basic and clinical features of DN patients in Asia and to use these for the
Characterization of a gene from the EDM1-PSACH region of human chromosome 19p
Energy Technology Data Exchange (ETDEWEB)
Lennon, G.G.; Giorgi, D.; Martin, J.R. [Lawrence Livermore National Lab., CA (United States)] [and others
1994-09-01
Genetic linkage mapping has indicated that both multiple epiphyseal dysplasia (EDM1), a dominantly inherited chondrodysplasia, and pseudoachondroplasia (PSACH), a skeletal disorder associated with dwarfism, map to a 2-3 Mb region of human chromosome 19p. We have isolated a partial cDNA from this region using hybrid selection, and report on progress towards the characterization of the genomic structure and transcription of the corresponding gene. Sequence analysis of the cDNA to date indicates that this gene is likely to be expressed within extracellular matrix tissues. Defects in this gene or neighboring gene family members may therefore lead to EDM1, PSACH, or other connective tissue and skeletal disorders.
Robertsonian translocation 13/14 associated with rRNA genes ...
African Journals Online (AJOL)
Robertsonian translocation 13/14 associated with rRNA genes overexpression and intellectual disability. Alexander A. Dolskiy, Natalya A. Lemskaya, Yulia V. Maksimova, Asia R. Shorina, Irina S. Kolesnikova, Dmitry V. Yudkin ...
Cloning and characterization of the gene encoding IMP dehydrogenase from Arabidopsis thaliana.
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Arabidopsis thaliana (At). The transcription unit of the At gene spans approximately 1900 bp and specifies a protein of 503 amino acids with a calculated relative molecular mass (M(r)) of 54,190. The gene is comprised of a minimum of four introns and five exons with all donor and acceptor splice sequences conforming to previously proposed consensus sequences. The deduced IMPDH amino-acid sequence from At shows a remarkable similarity to other eukaryotic IMPDH sequences, with a 48% identity to human Type II enzyme. Allowing for conservative substitutions, the enzyme is 69% similar to human Type II IMPDH. The putative active-site sequence of At IMPDH conforms to the IMP dehydrogenase/guanosine monophosphate reductase motif and contains an essential active-site cysteine residue.
Barozai, Muhammad Younas Khan; Bashir, Farrukh; Muzaffar, Shafia; Afzal, Saba; Behlil, Farida; Khan, Muzaffar
2014-10-15
To study the life processes of all eukaryotes, yeast (Saccharomyces cerevisiae) is a significant model organism. It is also one of the best models to study the responses of genes at transcriptional level. In a living organism, gene expression is changed by chemical stresses. The genes that give response to chemical stresses will provide good source for the strategies in engineering and formulating mechanisms which are chemical stress resistant in the eukaryotic organisms. The data available through microarray under the chemical stresses like lithium chloride, lactic acid, weak organic acids and tomatidine were studied by using computational tools. Out of 9335 yeast genes, 388 chemical stress responding genes were identified and characterized under different chemical stresses. Some of these are: Enolases 1 and 2, heat shock protein-82, Yeast Elongation Factor 3, Beta Glucanase Protein, Histone H2A1 and Histone H2A2 Proteins, Benign Prostatic Hyperplasia, ras GTPase activating protein, Establishes Silent Chromatin protein, Mei5 Protein, Nondisjunction Protein and Specific Mitogen Activated Protein Kinase. Characterization of these genes was also made on the basis of their molecular functions, biological processes and cellular components. Copyright © 2014 Elsevier B.V. All rights reserved.
Characterization and functional analysis of the Paralichthys olivaceus prdm1 gene promoter.
Li, Peizhen; Wang, Bo; Cao, Dandan; Liu, Yuezhong; Zhang, Quanqi; Wang, Xubo
2017-10-01
PR domain containing protein 1 (Prdm1) is a transcriptional repressor identified in various species and plays multiple important roles in immune response and embryonic development. However, little is known about the transcriptional regulation of the prdm1 gene. This study aims to characterize the promoter of Paralichthys olivaceus prdm1 (Po-prdm1) gene and determine the regulatory mechanism of Po-prdm1 expression. A 2000bp-long 5'-flanking region (translation initiation site designated as +1) of the Po-prdm1 gene was isolated and characterized. The regulatory elements in this fragment were then investigated and many putative transcription factor (TF) binding sites involved in immunity and multiple tissue development were identified. A 5'-deletion analysis was then conducted, and the ability of the deletion mutants to promote luciferase and green fluorescent protein (GFP) expression in a flounder gill cell line was examined. The results revealed that the minimal promoter is located in the region between -446 and -13bp, and the region between -1415 and -13bp enhanced the promoter activity. Site-directed mutation analysis was subsequently performed on the putative regulatory elements sites, and the results indicated that FOXP1, MSX and BCL6 binding sites play negative functional roles in the regulation of the Po-prdm1 expression in FG cells. In vivo analysis demonstrated that a GFP reporter gene containing 1.4kb-long promoter fragment (-1415/-13) was expressed in the head and trunk muscle fibres of transient transgenic zebrafish embryos. Our study provided the basic information for the exploration of Po-prdm1 regulation and expression. Copyright © 2017 Elsevier Inc. All rights reserved.
OHNO Sanae; FUKUDA Shin-ichi
2003-01-01
Since the onset of the Asian crisis, what characterizes the East Asian exchange rates has been a topic of considerable discussion. In the pre-crisis period, the de facto pegs to the U.S. dollar sometimes destabilized the real "effective" exchange rates of these currencies. Several economists have, thus, proposed the desirability of intermediate exchange rate regimes in East Asia that might stabilize their effective exchange rates. The post-crisis experience in East Asia, however, taught us th...
Directory of Open Access Journals (Sweden)
Vaiman Daniel
2005-05-01
Full Text Available Abstract Background Genes specifically expressed in the oocyte play key roles in oogenesis, ovarian folliculogenesis, fertilization and/or early embryonic development. In an attempt to identify novel oocyte-specific genes in the mouse, we have used an in silico subtraction methodology, and we have focused our attention on genes that are organized in genomic clusters. Results In the present work, five clusters have been studied: a cluster of thirteen genes characterized by an F-box domain localized on chromosome 9, a cluster of six genes related to T-cell leukaemia/lymphoma protein 1 (Tcl1 on chromosome 12, a cluster composed of a SPErm-associated glutamate (E-Rich (Speer protein expressed in the oocyte in the vicinity of four unknown genes specifically expressed in the testis on chromosome 14, a cluster composed of the oocyte secreted protein-1 (Oosp-1 gene and two Oosp-related genes on chromosome 19, all three being characterized by a partial N-terminal zona pellucida-like domain, and another small cluster of two genes on chromosome 19 as well, composed of a TWIK-Related spinal cord K+ channel encoding-gene, and an unknown gene predicted in silico to be testis-specific. The specificity of expression was confirmed by RT-PCR and in situ hybridization for eight and five of them, respectively. Finally, we showed by comparing all of the isolated and clustered oocyte-specific genes identified so far in the mouse genome, that the oocyte-specific clusters are significantly closer to telomeres than isolated oocyte-specific genes are. Conclusion We have studied five clusters of genes specifically expressed in female, some of them being also expressed in male germ-cells. Moreover, contrarily to non-clustered oocyte-specific genes, those that are organized in clusters tend to map near chromosome ends, suggesting that this specific near-telomere position of oocyte-clusters in rodents could constitute an evolutionary advantage. Understanding the biological
Lindsay, Richard
2014-01-01
This document explores some of the examples of peatland restoration under different circumstances around the World in order to present an overview of the variety of benefits and inspiring ways in which peatland restoration can be delivered, and so avoid serious and costly consequences for society. Richard Lindsay wrote the Asia and Americas sections of this edited publication.
ISOLATION AND CHARACTERIZATION OF CHITINASE GENE FROM THE UNTRADITIONAL PLANT SPECIES
Directory of Open Access Journals (Sweden)
Dominika Ďurechová
2013-02-01
Full Text Available Round-leaf sundew (Drosera rotundifolia L. from Droseraceae family belongs among a few plant species with strong antifungal potential. It was previously shown that chitinases of carnivorous plant species may play role during the insect prey digestion, when hard chitin skeleton is being decomposed. As many phytopathogenic fungi contain chitin in their cell wall our attention in this work was focused on isolation and in silico characterization of genomic DNA sequence of sundew chitinase gene. Subsequently this gene was fused to strong constitutive CaMV35S promoter and cloned into the plant binary vector pBinPlus and tested in A. tumefaciens LBA 4404 for its stability. Next, when transgenic tobacco plants are obtained, increasing of their antifungal potential will be tested.
Characterization of five partial deletions of the factor VIII gene
International Nuclear Information System (INIS)
Youssoufian, H.; Antonarakis, S.E.; Aronis, S.; Tsiftis, G.; Phillips, D.G.; Kazazian, H.H. Jr.
1987-01-01
Hemophilia A is an X-linked disorder of coagulation caused by a deficiency of factor VIII. By using cloned DNA probes, the authors have characterized the following five different partial deletions of the factor VIII gene from a panel of 83 patients with hemophilia A: (i) a 7-kilobase (kb) deletion that eliminates exon 6; (ii) a 2.5-kb deletion that eliminates 5' sequences of exon 14; (iii) a deletion of at least 7 kb that eliminates exons 24 and 25; (iv) a deletion of at least 16 kb that eliminates exons 23-25; and (v) a 5.5-kb deletion that eliminates exon 22. The first four deletions are associated with severe hemophilia A. By contrast, the last deletion is associated with moderate disease, possibly because of in-frame splicing from adjacent exons. None of those patients with partial gene deletions had circulating inhibitors to factor VIII. One deletion occurred de novo in a germ cell of the maternal grandmother, while a second deletion occurred in a germ cell of the maternal grandfather. These observations demonstrate that de novo deletions of X-linked genes can occur in either male or female gametes
Directory of Open Access Journals (Sweden)
Robert G. Bednarik
2013-06-01
Full Text Available This comprehensive overview considers the currently known Pleistocene palaeoart of Asia on a common basis, which suggests that the available data are entirely inadequate to form any cohesive synthesis about this corpus. In comparison to the attention lavished on the corresponding record available from Eurasia’s small western appendage, Europe, it is evident that Pleistocene palaeoart from the rest of the world has been severely neglected. Southern Asia, in particular, holds great promise for the study of early cognitive development of hominins, and yet this potential has remained almost entirely unexplored. Asia is suggested to be the key continent in any global synthesis of ‘art’ origins, emphasising the need for a comprehensive pan-continental research program. This is not just to counter-balance the incredible imbalance in favour of Europe, but to examine the topic of Middle Pleistocene palaeoart development effectively.
SECURITY THREATS IN CENTRAL ASIA
Directory of Open Access Journals (Sweden)
Çağla Gül Yesevi
2013-07-01
Full Text Available This study will analyze main security threats in Central Asia. It is obvious thatsince the end of Cold War, there have been many security threats in Central Asiaas internal weakness of Central Asian states, terrorism, transnational crime,economic insecurity, environmental issues, drug trafficking, ethnic violence,regional instability. This study will propose thatwith increasing interdependence,states need each other to solve these global security problems. In that sense,regional and sub-regional cooperation between Central Asian states and with otherregional actors has been witnessed. It is clear that the withdrawal of NATO fromAfghanistan will destabilize Central Asia. This study will investigate overallsecurity situation in Central Asia and affects andcontributions of regionalorganizations to Eurasian security
Winterhagen, Patrick; Tiyayon, Pimsiri; Samach, Alon; Hegele, Martin; Wünsche, Jens N
2013-10-01
Longan (Dimocarpus longan Lour.) is a subtropical evergreen fruit tree, mainly cultivated in Asia. Two putative floral integrator genes, D. longan FLOWERING LOCUS T1 and 2 (DlFT1 and DlFT2) were isolated and both translated sequences revealed a high homology to FT sequences from other plants. Moreover, two APETALA1-like (DlAP1-1 and DlAP1-2) sequences from longan were isolated and characterized. Results indicate that the sequences of these genes are highly conserved, suggesting functions in the longan flowering pathway. Ectopic expression of the longan genes in arabidopsis resulted in different flowering time phenotypes of transgenic plants. Expression experiments reveal a different action of the longan FT genes and indicate that DlFT1 is a flowering promoter, while DlFT2 acts as flowering inhibitor. Overexpression of longan AP1 genes in transgenic arabidopsis results in a range of flowering time phenotypes also including early and late flowering individuals. Copyright © 2013 Elsevier Masson SAS. All rights reserved.
Directory of Open Access Journals (Sweden)
Liang Zhu
Full Text Available Most Sphingomonas species synthesize the yellow carotenoid nostoxanthin. However, the carotenoid biosynthetic pathway of these species remains unclear. In this study, we cloned and characterized a carotenoid biosynthesis gene cluster containing four carotenogenic genes (crtG, crtY, crtI and crtB and a β-carotene hydroxylase gene (crtZ located outside the cluster, from the gellan-gum producing bacterium Sphingomonas elodea ATCC 31461. Each of these genes was inactivated, and the biochemical function of each gene was confirmed based on chromatographic and spectroscopic analysis of the intermediates accumulated in the knockout mutants. Moreover, the crtG gene encoding the 2,2'-β-hydroxylase and the crtZ gene encoding the β-carotene hydroxylase, both responsible for hydroxylation of β-carotene, were confirmed by complementation studies using Escherichia coli producing different carotenoids. Expression of crtG in zeaxanthin and β-carotene accumulating E. coli cells resulted in the formation of nostoxanthin and 2,2'-dihydroxy-β-carotene, respectively. Based on these results, a biochemical pathway for synthesis of nostoxanthin in S. elodea ATCC 31461 is proposed.
Zhu, Liang; Wu, Xuechang; Li, Ou; Qian, Chaodong; Gao, Haichun
2012-01-01
Most Sphingomonas species synthesize the yellow carotenoid nostoxanthin. However, the carotenoid biosynthetic pathway of these species remains unclear. In this study, we cloned and characterized a carotenoid biosynthesis gene cluster containing four carotenogenic genes (crtG, crtY, crtI and crtB) and a β-carotene hydroxylase gene (crtZ) located outside the cluster, from the gellan-gum producing bacterium Sphingomonas elodea ATCC 31461. Each of these genes was inactivated, and the biochemical function of each gene was confirmed based on chromatographic and spectroscopic analysis of the intermediates accumulated in the knockout mutants. Moreover, the crtG gene encoding the 2,2'-β-hydroxylase and the crtZ gene encoding the β-carotene hydroxylase, both responsible for hydroxylation of β-carotene, were confirmed by complementation studies using Escherichia coli producing different carotenoids. Expression of crtG in zeaxanthin and β-carotene accumulating E. coli cells resulted in the formation of nostoxanthin and 2,2'-dihydroxy-β-carotene, respectively. Based on these results, a biochemical pathway for synthesis of nostoxanthin in S. elodea ATCC 31461 is proposed.
Oba, Yuichi; Ojika, Makoto; Inouye, Satoshi
2004-03-31
This is the first identification of a long-chain fatty acyl-CoA synthetase in Drosophila by enzymatic characterization. The gene product of CG6178 (CG6178) in Drosophila melanogaster genome, which has a high sequence similarity to firefly luciferase, has been expressed and characterized. CG6178 showed long-chain fatty acyl-CoA synthetic activity in the presence of ATP, CoA and Mg(2+), suggesting a fatty acyl adenylate is an intermediate. Recently, it was revealed that firefly luciferase has two catalytic functions, monooxygenase (luciferase) and AMP-mediated CoA ligase (fatty acyl-CoA synthetase). However, unlike firefly luciferase, CG6178 did not show luminescence activity in the presence of firefly luciferin, ATP, CoA and Mg(2+). The enzymatic properties of CG6178 including substrate specificity, pH dependency and optimal temperature were close to those of firefly luciferase and rat fatty acyl-CoA synthetase. Further, phylogenic analyses strongly suggest that the firefly luciferase gene may have evolved from a fatty acyl-CoA synthetase gene as a common ancestral gene.
International Nuclear Information System (INIS)
Meade, W.; Bailly, H.C.
1991-01-01
This article examines the market for independent power plants in Asia and the financing available for these projects. The topics of the article include making room for non-utility generation; the markets in India, Indonesia, Pakistan, the Philippines, Thailand; third-party ownership, 1989 installed capacity, capacity additions 1989-1990, and the outlook for the market in Asia
South Asia | Page 30 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Read more about Trauma, Development and Peacebuilding : Toward an Integrated Psychological Approach. Language English. Read more about Information Society Innovation Fund Asia. Language English. Read more about Information Society Innovation Fund Asia (ISIF Asia). Language French. Read more about Liens ...
Dust Aerosols at the Source Region During ACE-ASIA: A Surface/Satellite Perspective
Tsay, Si-Chee; Lau, William K. M. (Technical Monitor)
2001-01-01
ACE (Aerosol Characterization Experiment)-Asia is designed to study the compelling variability in spatial and temporal scale of both pollution-derived and naturally occurring aerosols, which often exist in high concentrations over eastern Asia and along the rim of the western Pacific. The phase-I of ACE-Asia was conducted from March-May 2001 in the vicinity of the Gobi desert, East Coast of China, Yellow Sea, Korea, and Japan, along the pathway of Kosa (severe events that blanket East Asia with yellow desert dust, peaked in the Spring season). Asian dust typically originates in desert areas far from polluted urban regions. During transport, dust layers can interact with anthropogenic sulfate and soot aerosols from heavily polluted urban areas. Added to the complex effects of clouds and natural marine aerosols, dust particles reaching the marine environment can have drastically different properties than those from the source. Thus, understanding the unique temporal and spatial variations of Asian dust is of special importance in regional-to-global climate issues such as radiative forcing, the hydrological cycle, and primary biological productivity in the mid-Pacific Ocean. During ACE-Asia we have measured continuously aerosol physical/optical/radiative properties, column precipitable water amount, and surface reflectivity over homogeneous areas from surface. The inclusion of flux measurements permits the determination of dust aerosol radiative flux in addition to measurements of loading and optical thickness. At the time of the Terra/MODIS, SeaWiFS, TOMS and other satellite overpasses, these ground-based observations can provide valuable data to compare with satellite retrievals over land. Preliminary results will be presented and discussed their implications in regional climatic effects.
Tamura, Yasumori; Hattori, Makoto; Yoshioka, Hirofumi; Yoshioka, Miki; Takahashi, Akira; Wu, Jianzhong; Sentoku, Naoki; Yasui, Hideshi
2014-01-01
The brown planthopper (BPH) is the most serious insect pest of rice in Asia. The indica rice cultivar ADR52 carries two BPH resistance genes, BPH26 (BROWN PLANTHOPPER RESISTANCE 26) and BPH25. Map-based cloning of BPH26 revealed that BPH26 encodes a coiled-coil-nucleotide-binding-site?leucine-rich repeat (CC?NBS?LRR) protein. BPH26 mediated sucking inhibition in the phloem sieve element. BPH26 was identical to BPH2 on the basis of DNA sequence analysis and feeding ability of the BPH2-virulent...
Genome-wide identification and characterization of WRKY gene family in Salix suchowensis.
Bi, Changwei; Xu, Yiqing; Ye, Qiaolin; Yin, Tongming; Ye, Ning
2016-01-01
WRKY proteins are the zinc finger transcription factors that were first identified in plants. They can specifically interact with the W-box, which can be found in the promoter region of a large number of plant target genes, to regulate the expressions of downstream target genes. They also participate in diverse physiological and growing processes in plants. Prior to this study, a plenty of WRKY genes have been identified and characterized in herbaceous species, but there is no large-scale study of WRKY genes in willow. With the whole genome sequencing of Salix suchowensis, we have the opportunity to conduct the genome-wide research for willow WRKY gene family. In this study, we identified 85 WRKY genes in the willow genome and renamed them from SsWRKY1 to SsWRKY85 on the basis of their specific distributions on chromosomes. Due to their diverse structural features, the 85 willow WRKY genes could be further classified into three main groups (group I-III), with five subgroups (IIa-IIe) in group II. With the multiple sequence alignment and the manual search, we found three variations of the WRKYGQK heptapeptide: WRKYGRK, WKKYGQK and WRKYGKK, and four variations of the normal zinc finger motif, which might execute some new biological functions. In addition, the SsWRKY genes from the same subgroup share the similar exon-intron structures and conserved motif domains. Further studies of SsWRKY genes revealed that segmental duplication events (SDs) played a more prominent role in the expansion of SsWRKY genes. Distinct expression profiles of SsWRKY genes with RNA sequencing data revealed that diverse expression patterns among five tissues, including tender roots, young leaves, vegetative buds, non-lignified stems and barks. With the analyses of WRKY gene family in willow, it is not only beneficial to complete the functional and annotation information of WRKY genes family in woody plants, but also provide important references to investigate the expansion and evolution of
Characterization of TALE genes expression during the first lineage segregation in mammalian embryos.
Sonnet, Wendy; Rezsöhazy, Rene; Donnay, Isabelle
2012-11-01
Three amino acid loop extension (TALE) homeodomain-containing transcription factors are generally recognized for their role in organogenesis and differentiation during embryogenesis. However, very little is known about the expression and function of Meis, Pbx, and Prep genes during early development. In order to determine whether TALE proteins could contribute to the early cell fate decisions in mammalian development, this study aimed to characterize in a systematic manner the pattern of expression of all Meis, Pbx, and Prep genes from the precompaction to blastocyst stage corresponding to the first step of cell differentiation in mammals. To reveal to what extent TALE genes expression at these early stages is a conserved feature among mammals, this study was performed in parallel in the bovine and mouse models. We demonstrated the transcription and translation of TALE genes, before gastrulation in the two species. At least one member of Meis, Pbx, and Prep subfamilies was found expressed at the RNA and protein levels but different patterns of expression were observed between genes and between species, suggesting specific gene regulations. Taken together, these results suggest a previously unexpected involvement of these factors during the early development in mammals. Copyright © 2012 Wiley Periodicals, Inc.
Characterization of a Crabs Claw Gene in Basal Eudicot Species Epimedium sagittatum (Berberidaceae
Directory of Open Access Journals (Sweden)
Wei Sun
2013-01-01
Full Text Available The Crabs Claw (CRC YABBY gene is required for regulating carpel development in angiosperms and has played an important role in nectary evolution during core eudicot speciation. The function or expression of CRC-like genes has been explored in two basal eudicots, Eschscholzia californica and Aquilegia formosa. To further investigate the function of CRC orthologous genes related to evolution of carpel and nectary development in basal eudicots, a CRC ortholog, EsCRC, was isolated and characterized from Epimedium sagittatum (Sieb. and Zucc. Maxim. A phylogenetic analysis of EsCRC and previously identified CRC-like genes placed EsCRC within the basal eudicot lineage. Gene expression results suggest that EsCRC is involved in the development of sepals and carpels, but not nectaries. Phenotypic complementation of the Arabidopsis mutant crc-1 was achieved by constitutive expression of EsCRC. In addition, over-expression of EsCRC in Arabidopsis and tobacco gave rise to abaxially curled leaves. Transgenic results together with the gene expression analysis suggest that EsCRC may maintain a conserved function in carpel development and also play a novel role related to sepal formation. Absence of EsCRC and ElCRC expression in nectaries further indicates that nectary development in non-core eudicots is unrelated to expression of CRC-like genes.
Characterization of a Crabs Claw Gene in basal eudicot species Epimedium sagittatum (Berberidaceae).
Sun, Wei; Huang, Wenjun; Li, Zhineng; Lv, Haiyan; Huang, Hongwen; Wang, Ying
2013-01-08
The Crabs Claw (CRC) YABBY gene is required for regulating carpel development in angiosperms and has played an important role in nectary evolution during core eudicot speciation. The function or expression of CRC-like genes has been explored in two basal eudicots, Eschscholzia californica and Aquilegia formosa. To further investigate the function of CRC orthologous genes related to evolution of carpel and nectary development in basal eudicots, a CRC ortholog, EsCRC, was isolated and characterized from Epimedium sagittatum (Sieb. and Zucc.) Maxim. A phylogenetic analysis of EsCRC and previously identified CRC-like genes placed EsCRC within the basal eudicot lineage. Gene expression results suggest that EsCRC is involved in the development of sepals and carpels, but not nectaries. Phenotypic complementation of the Arabidopsis mutant crc-1 was achieved by constitutive expression of EsCRC. In addition, over-expression of EsCRC in Arabidopsis and tobacco gave rise to abaxially curled leaves. Transgenic results together with the gene expression analysis suggest that EsCRC may maintain a conserved function in carpel development and also play a novel role related to sepal formation. Absence of EsCRC and ElCRC expression in nectaries further indicates that nectary development in non-core eudicots is unrelated to expression of CRC-like genes.
Yew, Chee-Wei; Lu, Dongsheng; Deng, Lian; Wong, Lai-Ping; Ong, Rick Twee-Hee; Lu, Yan; Wang, Xiaoji; Yunus, Yushimah; Aghakhanian, Farhang; Mokhtar, Siti Shuhada; Hoque, Mohammad Zahirul; Voo, Christopher Lok-Yung; Abdul Rahman, Thuhairah; Bhak, Jong; Phipps, Maude E; Xu, Shuhua; Teo, Yik-Ying; Kumar, Subbiah Vijay; Hoh, Boon-Peng
2018-02-01
Southeast Asia (SEA) is enriched with a complex history of peopling. Malaysia, which is located at the crossroads of SEA, has been recognized as one of the hubs for early human migration. To unravel the genomic complexity of the native inhabitants of Malaysia, we sequenced 12 samples from 3 indigenous populations from Peninsular Malaysia and 4 native populations from North Borneo to a high coverage of 28-37×. We showed that the Negritos from Peninsular Malaysia shared a common ancestor with the East Asians, but exhibited some level of gene flow from South Asia, while the North Borneo populations exhibited closer genetic affinity towards East Asians than the Malays. The analysis of time of divergence suggested that ancestors of Negrito were the earliest settlers in the Malay Peninsula, whom first separated from the Papuans ~ 50-33 thousand years ago (kya), followed by East Asian (~ 40-15 kya), while the divergence time frame between North Borneo and East Asia populations predates the Austronesian expansion period implies a possible pre-Neolithic colonization. Substantial Neanderthal ancestry was confirmed in our genomes, as was observed in other East Asians. However, no significant difference was observed, in terms of the proportion of Denisovan gene flow into these native inhabitants from Malaysia. Judging from the similar amount of introgression in the Southeast Asians and East Asians, our findings suggest that the Denisovan gene flow may have occurred before the divergence of these populations and that the shared similarities are likely an ancestral component.
Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer
Pearson, T.; Giffard, P.; Beckstrom-Sternberg, S.; Auerbach, R.; Hornstra, H.; Tuanyok, A.; Price, E.P.; Glass, M.B.; Leadem, B.; Beckstrom-Sternberg, J. S.; Allan, G.J.; Foster, J.T.; Wagner, D.M.; Okinaka, R.T.; Sim, S.H.; Pearson, O.; Wu, Z.; Chang, J.; Kaul, R.; Hoffmaster, A.R.; Brettin, T.S.; Robison, R.A.; Mayo, M.; Gee, J.E.; Tan, P.; Currie, B.J.; Keim, P.
2009-01-01
Australian origin for B. pseudomallei, characterized by a single introduction event into Southeast Asia during a recent glacial period, and variable levels of lateral gene transfer within populations. These patterns provide insights into mechanisms of genetic diversification in B. pseudomallei and its closest relatives, and provide a framework for integrating the traditionally separate fields of population genetics and phylogenetics for other bacterial species with high levels of lateral gene transfer. ?? 2009 Pearson et al; licensee BioMed Central Ltd.
Phylogeographic reconstruction of a bacterial species with high levels of lateral gene transfer
Directory of Open Access Journals (Sweden)
Kaul Rajinder
2009-11-01
. Conclusion We describe an Australian origin for B. pseudomallei, characterized by a single introduction event into Southeast Asia during a recent glacial period, and variable levels of lateral gene transfer within populations. These patterns provide insights into mechanisms of genetic diversification in B. pseudomallei and its closest relatives, and provide a framework for integrating the traditionally separate fields of population genetics and phylogenetics for other bacterial species with high levels of lateral gene transfer.
Epidemiology of Inflammatory Bowel Diseases in Iran and Asia; A Mini Review
Directory of Open Access Journals (Sweden)
Ali Reza Safarpour
2013-06-01
Full Text Available The prevalence of inflammatory bowel diseases (IBDs is set to stabilize in Western Europe and North America, as opposed to its increasing trend in developing countries in Asia. The epidemiology of IBDs in areas where the incidence and prevalence are relatively low provides an opportunity for researchers to determine the unknown aspects of them. In this review article, the PubMed and MEDLINE databases were searched from 1970 to 2012 and the epidemiological aspects assessed in Iranian articles were compared with identical subjects in other Asian countries. During this period, there were 21 documented articles on IBD epidemiology in Iran and 52 in Asia. According to the present review, CTLA-gene polymorphism and male/female ratio in ulcerative colitis (UC, incidence of extra-intestinal manifestations, extent of intestinal involvement, and family history in both UC and Crohn’s disease (CD seemed to be different between Asia and Iran. In contrast, the incidence of primary sclerosing cholangitis in IBD patients and association between NO2/CARD15 mutation and CD as C3435-T allele and UC were nearly the same. The rate of IBD has increased significantly in Iran, as has that of other Asian countries during the last decade. A thorough, well-designed, population-based, multi-regional epidemiologic study seems mandatory due to the substantial demographic and characteristic variability in IBD patients in our region.
Isolation and Characterization of the Etheostoma tallapoosae (Teleostei: Percidae CENP-A Gene
Directory of Open Access Journals (Sweden)
Leos G. Kral
2011-10-01
Full Text Available Both centromeric alpha-satellite sequences as well as centromeric protein A (CENP-A are highly variable in eukaryotes. CENP-A, a histone H3 variant, is thought to act as the epigenetic “mark” for assembly of centromeric proteins. While most of the histone fold domain (HFD of the CENP-A is fairly well conserved, a portion of this HFD as well as the N-terminal tail show adaptive variation in both plants and animals. Such variation may establish reproductive barriers that may lead to speciation. The family Percidae contains over 200 species most of which are within the subfamily Etheostomatinae. This subfamily represents a species rich radiation of freshwater fishes in North America and these species exhibit both allopatric and sympatric distributions. In order to study the evolution of CENP-A in percid fish species, we have isolated and characterized the CENP-A gene from Etheostoma tallapoosae by PCR based gene walking. As a result of this study we have demonstrated that the Tallapoosa darter CENP-A gene HFD sequences can be isolated from genomic DNA by nested PCR in a manner that does not lead to the amplification of the highly sequence related histone H3 gene. We also demonstrated that PCR based walking can be subsequently used to isolate the rest of the CENP-A gene and adjacent gene sequences. These adjacent gene sequences provide us with a primer binding sites for PCR isolation of the CENP-A gene from other percid species of fishes. An initial comparison of three percid species shows that the N-terminal tail of the percid CENP-A gene shows adaptive evolution.
Groossiord, B.P.; Luesink, E.J.; Vaughan, E.E.; Arnaud, A.; Vos, de W.M.
2003-01-01
A cluster containing five similarly oriented genes involved in the metabolism of galactose via the Leloir pathway in Lactococcus lactis subsp. cremoris MG1363 was cloned and characterized. The order of the genes is galPMKTE, and these genes encode a galactose permease (GalP), an aldose I-epimerase
Characterization of plasmids harbouring qnrS1, qnrB2 and qnrB19 genes in Salmonella
Garcia-Fernandez, A.; Fortini, D.; Veldman, K.T.; Mevius, D.J.; Carattoli, A.
2009-01-01
The aim of this study was to identify and characterize plasmids carrying qnrS1, qnrB2 and qnrB19 genes identified in Salmonella strains from The Netherlands. The identification of plasmids may help to follow the dissemination of these resistance genes in different countries and environments.
National Research Council Canada - National Science Library
1987-01-01
Partial Contents: Southeast Asia, Exchange Dealer, Budget Review, Declared Nonactive, Candidacy, Finance Minister, Economic Policy, Exchange Rate, Farm, Defense Ministers, Labor Party,Local Car Manufacturer...
Molecular cloning and characterization of arginine kinase gene of Toxocara canis.
Sahu, Shivani; Samanta, S; Harish, D R; Sudhakar, N R; Raina, O K; Shantaveer, S B; Madhu, D N; Kumar, Ashok
2015-06-01
Toxocara canis is an important gastrointestinal nematode of dogs and also a causative agent of visceral larva migrans in humans. Arginine kinase (AK) gene is one of the important biomolecule of phosphagen kinase of T. canis which is emerging as an exciting novel diagnostic target in toxocarosis. The present study was carried out to clone and characterize AK gene of T. canis for future utilization as a diagnostic molecule. Total RNA was extracted from intact adult worms and reverse transcription was done with oligo dT primers to obtain complementary DNA (cDNA). Polymerase chain reaction (PCR) was carried out using cDNA as template with specific primers which amplified a product of 1,202 bp. The amplicon was cloned into pDrive cloning vector and clone was confirmed by colony PCR and restriction endonuclease analysis. Sequence analysis of the gene showed 99.8 and 77.9 % homology with the published AK gene of T. canis (EF015466.1) and Ascaris suum respectively. Structural analysis shown that the mature AK protein consist of 400 amino acids with a molecular wt of 45360.73 Da. Further expression studies are required for producing the recombinant protein for its evaluation in the diagnosis of T. canis infection in humans as well as in adult dogs.
Veasna Duong; Philippe Dussart; Philippe Buchy
2017-01-01
Zika virus (ZIKV) is an emerging mosquito-borne virus that was first isolated from a sentinel rhesus monkey in the Zika Forest in Uganda in 1947. In Asia, the virus was isolated in Malaysia from Aedes aegypti mosquitoes in 1966, and the first human infections were reported in 1977 in Central Java, Indonesia. In this review, all reported cases of ZIKV infection in Asia as of September 1, 2016 are summarized and some of the hypotheses that could currently explain the apparently low incidence of...
Directory of Open Access Journals (Sweden)
Sebastian Wissel
2016-08-01
Full Text Available Traditional loss-of-function studies in Drosophila suffer from a number of shortcomings, including off-target effects in the case of RNA interference (RNAi or the stochastic nature of mosaic clonal analysis. Here, we describe minimal in vivo GFP interference (miGFPi as a versatile strategy to characterize gene function and to conduct highly stringent, cell type-specific loss-of-function experiments in Drosophila. miGFPi combines CRISPR/Cas9-mediated tagging of genes at their endogenous locus with an immunotag and an exogenous 21 nucleotide RNAi effector sequence with the use of a single reagent, highly validated RNAi line targeting this sequence. We demonstrate the utility and time effectiveness of this method by characterizing the function of the Polymerase I (Pol I-associated transcription factor Tif-1a, and the previously uncharacterized gene MESR4, in the Drosophila female germline stem cell lineage. In addition, we show that miGFPi serves as a powerful technique to functionally characterize individual isoforms of a gene. We exemplify this aspect of miGFPi by studying isoform-specific loss-of-function phenotypes of the longitudinals lacking (lola gene in neural stem cells. Altogether, the miGFPi strategy constitutes a generalized loss-of-function approach that is amenable to the study of the function of all genes in the genome in a stringent and highly time effective manner.
Representation of Central Asia and Traveling Self in Vambery’s Travels in Central Asia
Directory of Open Access Journals (Sweden)
Ahmad Gholi
2016-03-01
Full Text Available In the course of the nineteenth century Arminius Vambery, an anglophile travel writer, in the guise of a mendicant dervish with a group of Tartar pilgrims departs to secluded and sealed Central Asia. After six months travel in the Khanates of Central Asia, he undertakes a journey to England where he offers his observations to the Royal Geographical Society and publishes his travelogue, Travel in Central Asia. Despite its literary merits and connection with British imperialism, the travelogue has not been scrutinized separately by the scholars of travel writing. To fill the gap, this article by drawing on the theories of post-structuralism: Orientalism and Postcolonialism, endeavors to unveil the political agenda behind the travel writer’s representation of his travelees, destination, and his own traveling self. Additionally, it argues that the travel writer in dialogue with other Western travel writers to deterritorialize his traversed region or justify the prospective presence of Britain in Central Asia, represents his journey destination as the locus of barbarity, a region under the grip of despotic rulers, as well as an area with frozen time, while to exhibit his Eurocentrism, he portrays his traveling subject as the a suffering hero and a benign traveler.
South Asia | Page 99 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
South Asia. Asie du sud. Read more about Nanotechnology in South Asia : Building Capabilities and Governing the Technology in South Asia. Language English. Read more about La nanotechnologie en Asie du Sud : renforcement des capacités et encadrement des technologies. Language French. Read more about La ...
South Asia | Page 115 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Read more about Digital Review of Asia Pacific 2009–2010. Language French. Drawing on research and practical experiences from China, South Asia, and Southeast Asia, this book presents and analyzes novel approaches to collaborative learning and communities of practice. Case studies show how, through joint efforts ...
Far East Asia | Page 189 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Read more about Digital Review of Asia Pacific 2009–2010. Language French. Drawing on research and practical experiences from China, South Asia, and Southeast Asia, this book presents and analyzes novel approaches to collaborative learning and communities of practice. Case studies show how, through joint efforts ...
Far East Asia | Page 107 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Read more about Digital Review of Asia Pacific 2009–2010. Language French. Drawing on research and practical experiences from China, South Asia, and Southeast Asia, this book presents and analyzes novel approaches to collaborative learning and communities of practice. Case studies show how, through joint efforts ...
Directory of Open Access Journals (Sweden)
Finbarr G. Horgan
2017-09-01
Full Text Available This study examines aspects of virulence to resistant rice varieties among planthoppers and leafhoppers. Using a series of resistant varieties, brown planthopper, Nilaparvata lugens, virulence was assessed in seedlings and early-tillering plants at seven research centers in South and East Asia. Virulence of the whitebacked planthopper, Sogatella furcifera, in Taiwan and the Philippines was also assessed. Phylogenetic analysis of the varieties using single-nucleotide polymorphisms (SNPs indicated a clade of highly resistant varieties from South Asia with two further South Asian clades of moderate resistance. Greenhouse bioassays indicated that planthoppers can develop virulence against multiple resistance genes including genes introgressed from wild rice species. Nilaparvata lugens populations from Punjab (India and the Mekong Delta (Vietnam were highly virulent to a range of key resistance donors irrespective of variety origin. Sogatella furcifera populations were less virulent to donors than N. lugens; however, several genes for resistance to S. furcifera are now ineffective in East Asia. A clade of International Rice Research Institute (IRRI-bred varieties and breeding lines, without identified leafhopper-resistance genes, were highly resistant to the green leafhopper, Nephotettix virescens. Routine phenotyping during breeding programs likely maintains high levels of quantitative resistance to leafhoppers. We discuss these results in the light of breeding and deploying resistant rice in Asia.
Minarnita Yanti Verawati Bakara; Bambang Hermanto
2014-01-01
This research paper tries to detect the nonlinear structure in the South East Asia Countries Capital Markets. The capital markets of three South East Asia Countries are chosen: Indonesia, Philippine, and Singapore. Daily return data of Capital Markets composite indices are observed: Straits Times Index (STI) of Singapore Exchange from January 04, 1985 to December 31, 2007, Pilipino Stock Exchange Index (PSEi) of Philippines Stock Exchange from March 1, 1990 to December 31, 2007 and Jakarta Co...
Hurtado, Luis A; Mateos, Mariana; Wang, Chang; Santamaria, Carlos A; Jung, Jongwoo; Khalaji-Pirbalouty, Valiallah; Kim, Won
2018-01-01
The native ranges and invasion histories of many marine species remain elusive due to a dynamic dispersal process via marine vessels. Molecular markers can aid in identification of native ranges and elucidation of the introduction and establishment process. The supralittoral isopod Ligia exotica has a wide tropical and subtropical distribution, frequently found in harbors and ports around the globe. This isopod is hypothesized to have an Old World origin, from where it was unintentionally introduced to other regions via wooden ships and solid ballast. Its native range, however, remains uncertain. Recent molecular studies uncovered the presence of two highly divergent lineages of L. exotica in East Asia, and suggest this region is a source of nonindigenous populations. In this study, we conducted phylogenetic analyses (Maximum Likelihood and Bayesian) of a fragment of the mitochondrial 16S ribosomal (r)DNA gene using a dataset of this isopod that greatly expanded previous representation from Asia and putative nonindigenous populations around the world. For a subset of samples, sequences of 12S rDNA and NaK were also obtained and analyzed together with 16S rDNA. Our results show that L. exotica is comprised of several highly divergent genetic lineages, which probably represent different species. Most of the 16S rDNA genetic diversity (48 haplotypes) was detected in East and Southeast Asia. Only seven haplotypes were observed outside this region (in the Americas, Hawai'i, Africa and India), which were identical or closely related to haplotypes found in East and Southeast Asia. Phylogenetic patterns indicate the L. exotica clade originated and diversified in East and Southeast Asia, and only members of one of the divergent lineages have spread out of this region, recently, suggesting the potential to become invasive is phylogenetically constrained.
Characterization of vNr-13, the first alphaherpesvirus gene of the bcl-2 family
International Nuclear Information System (INIS)
Aouacheria, Abdel; Banyai, Michelle; Rigal, Dominique; Schmidt, Carl J.; Gillet, Germain
2003-01-01
The Bcl-2 family, including antiapoptotic and proapoptotic members, plays key regulating roles in programmed cell death. We report the characterization of a new member of the bcl-2 family, encoded by herpesvirus of turkeys (HVT). The product of this gene shares 80% homology with Nr-13, an apoptosis inhibitor, which is overexpressed in avian cells transformed by the v-src oncogene. This new gene, that we propose to call vnr-13, is the first member of the bcl-2 family to be isolated among α-herpesviruses. Results from cells expressing the HVT-vnr-13 gene product show that the encoded protein inhibits apoptosis and also reduces the rate of cellular proliferation. Contrary to all bcl-2 homologues found in γ-herpesvirus, which are intronless, vnr-13 has the same organization as the cellular nr-13 gene. Hence, the HVT vnr-13 gene may have been acquired from a reverse transcriptase product of an unspliced precursor RNA, or via direct recombination with the host chromosomal DNA
Evolutionary and genetic analysis of the VP2 gene of canine parvovirus.
Li, Gairu; Ji, Senlin; Zhai, Xiaofeng; Zhang, Yuxiang; Liu, Jie; Zhu, Mengyan; Zhou, Jiyong; Su, Shuo
2017-07-17
Canine parvovirus (CPV) type 2 emerged in 1978 in the USA and quickly spread among dog populations all over the world with high morbidity. Although CPV is a DNA virus, its genomic substitution rate is similar to some RNA viruses. Therefore, it is important to trace the evolution of CPV to monitor the appearance of mutations that might affect vaccine effectiveness. Our analysis shows that the VP2 genes of CPV isolated from 1979 to 2016 are divided into six groups: GI, GII, GIII, GIV, GV, and GVI. Amino acid mutation analysis revealed several undiscovered important mutation sites: F267Y, Y324I, and T440A. Of note, the evolutionary rate of the CPV VP2 gene from Asia and Europe decreased. Codon usage analysis showed that the VP2 gene of CPV exhibits high bias with an ENC ranging from 34.93 to 36.7. Furthermore, we demonstrate that natural selection plays a major role compared to mutation pressure driving CPV evolution. There are few studies on the codon usage of CPV. Here, we comprehensively studied the genetic evolution, codon usage pattern, and evolutionary characterization of the VP2 gene of CPV. The novel findings revealing the evolutionary process of CPV will greatly serve future CPV research.
Currency crises: Is Asia different?
Diehl, Markus; Schweickert, Rainer
1998-01-01
International investors' enthusiasm with respect to growth prospects in Southeast Asia has been followed by panic. Both the outstanding economic performance of Southeast Asian economies and their ability to master adjustment challenges had led most observers of these economies to the conclusion that "Asia is different". In comparison with previous currency crises, the macroeconomic fundamentals (GDP growth, inflation, fiscal deficit, external indebtedness, domestic savings, export performance...
The genus Rhaponticum in East Asia
Directory of Open Access Journals (Sweden)
Gorovoy, P.
2010-12-01
Full Text Available The genus Rhaponticum in East Asia has always been a taxon for discussion. Rhaponticum carthamoides from East Siberia comprises three subspecies: carthamoides, chamarensis and orientale. Even though they differ in morphology, they do not have isolated areas. Rhaponticum satzyperovii was recently described and its author pointed out its affinity with Rh. uniflorum. Plant height, stem indumentum, and radical and stem leaf dissection were signaled as the diagnostic characters. Our present study on living and herbarium specimens of Rh. satzyperovii shows that the diagnostic characters are not consistent. The species area was also claimed to be an argument for considering Rh. satzyperovii a distinct species. This area covers the south of the Primorye Province in the Far East of Russia with some locations in the adjacent Jewish Autonomous Region and in China. In our study, the area of Rh. satzyperovii is found to be within the area of Rh. uniflorum and thereafter they turned out to have no disjunction. In East Asia, Rh. uniflorum is characterized by a wide range of morphological variability. We suggest that Rh. satzyperovii should be included within Rh. uniflorum without any taxonomic rank.El género Rhaponticum en el Este de Asia ha sido siempre un taxón discutido. Rhaponticum carthamoides del Este de Siberia incluye tres subespecies: carthamoides, chamarensis y orientale. Aunque difieren en su morfología, sus áreas no están aisladas. Rhaponticum satzyperovii fue descrito recientemente y su autor señaló su afinidad con Rh. uniflorum. Los caracteres diagnósticos fueron la altura de la planta, el indumento del tallo y las divisiones de las hojas basales y caulinares. Nuestro estudio de plantas vivas y muestras de herbario de Rh. satzyperovii muestra que los caracteres diagnósticos no son consistentes. El área de distribución también se argumentó para considerar Rh. satzyperovii una especie diferente. El área cubre el sur de la provincia de
Overexpressed Genes/ESTs and Characterization of Distinct Amplicons on 17823 in Breast Cancer Cells
Directory of Open Access Journals (Sweden)
Ayse E. Erson
2001-01-01
Full Text Available 17823 is a frequent site of gene amplification in breast cancer. Several lines of evidence suggest the presence of multiple amplicons on 17823. To characterize distinct amplicons on 17823 and localize putative oncogenes, we screened genes and expressed sequence tags (ESTs in existing physical and radiation hybrid maps for amplification and overexpression in breast cancer cell lines by semiquantitative duplex PCR, semiquantitative duplex RT-PCR, Southern blot, Northern blot analyses. We identified two distinct amplicons on 17823, one including TBX2 and another proximal region including RPS6KB1 (PS6K and MUL. In addition to these previously reported overexpressed genes, we also identified amplification and overexpression of additional uncharacterized genes and ESTs, some of which suggest potential oncogenic activity. In conclusion, we have further defined two distinct regions of gene amplification and overexpression on 17823 with identification of new potential oncogene candidates. Based on the amplification and overexpression patterns of known and as of yet unrecognized genes on 17823, it is likely that some of these genes mapping to the discrete amplicons function as oncogenes and contribute to tumor progression in breast cancer cells.
Xu, Yan; Zou, Peng; Liu, Yao; Deng, Fengjiao
2010-06-01
Genes specifically expressed in the notochord may be crucial for proper notochord development. Using the digital differential display program offered by the National Center for Biotechnology Information, we identified a novel EST sequence from a zebrafish ovary library (No. XM_701450). The full-length cDNA of this transcript was cloned by performing 3' and 5'-RACE and was further confirmed by PCR and sequencing. The resulting 614 bp gene was found to encode a novel 94 amino acid protein that did not share significant homology with any other known protein. Characterization of the genomic sequence revealed that the gene spanned 4.9 kb and was composed of four exons and three introns. RT-PCR gene expression analysis revealed that our gene of interest was expressed in ovary, kidney, brain, mature oocytes and during the early stages of embryogenesis. During embryonic development, znfr mRNA was found to be expressed in the embryonic shield, chordamesoderm and the vacuolated notochord cells by in situ hybridization. Based on this information, we hypothesize that this novel gene is an important maternal factor required for zebrafish notochord formation during early embryonic development. We have thus named this gene znfr (zebrafish notochord formation related).
Sulaiman, Irshad M; Torres, Patricia; Simpson, Steven; Kerdahi, Khalil; Ortega, Ynes
2013-04-01
We have described the development of a 2-step nested PCR protocol based on the characterization of the 70-kDa heat shock protein (HSP70) gene for rapid detection of the human-pathogenic Cyclospora cayetanensis parasite. We tested and validated these newly designed primer sets by PCR amplification followed by nucleotide sequencing of PCR-amplified HSP70 fragments belonging to 16 human C. cayetanensis isolates from 3 different endemic regions that include Nepal, Mexico, and Peru. No genetic polymorphism was observed among the isolates at the characterized regions of the HSP70 locus. This newly developed HSP70 gene-based nested PCR protocol provides another useful genetic marker for the rapid detection of C. cayetanensis in the future.
Chin, Mian; Ginoux, Paul; Torres, Omar; Zhao, Xue-Peng
2005-01-01
We propose a research project to incorporate a global 3-D model and satellite data into the multi-national Aerosol Characterization Experiment-Asia (ACE-Asia) mission. Our objectives are (1) to understand the physical, chemical, and optical properties of aerosols and the processes that control those properties over the Asian-Pacific region, (2) to investigate the interaction between aerosols and tropospheric chemistry, and (3) to determine the aerosol radiative forcing over the Asia-Pacific region. We will use the Georgia TecWGoddard Global Ozone Chemistry Aerosol Radiation and Transport (GOCART) model to link satellite observations and the ACE-Asia measurements. First, we will use the GOCART model to simulate aerosols and related species, and evaluate the model with satellite and in-situ observations. Second, the model generated aerosol vertical profiles and compositions will be used to validate the satellite products; and the satellite data will be used for during- and post- mission analysis. Third, we will use the model to analyze and interpret both satellite and ACE- Asia field campaign data and investigate the aerosol-chemistry interactions. Finally, we will calculate aerosol radiative forcing over the Asian-Pacific region, and assess the influence of Asian pollution in the global atmosphere. We propose a research project to incorporate a global 3-D model and satellite data into
Molecular cloning and characterization of recA-like gene from Schizosaccharomyces pombe
International Nuclear Information System (INIS)
Lee, J.S.; Kang, J.K.; Yoon, S.M.; Park, Y.; Yang, Y.K.; Kim, S.W.; Park, J.K.; Park, J.G.; Hong, S.H.; Park, S.D.
1996-01-01
We have previously purified and characterized a RecA-like protein from Schizosaccharomyces pombe (S. pombe). In the present study, we have cloned a gene encoding the RecA-like protein. The S. pombe recA-like gene was isolated by immunological screening of the expression library of S. pombe using anti-Escherichia coli (E. coli) RecA antibody as a probe. From 10(6) plaques screened, 6 putative clones were finally isolated. Five of the clones screened contained the same kinds of DNA inserts, as determined by crosshybridization analysis. Among the clones, TC-2 was selected for further studies. The pGEM3Zf(-)Delta 17 vector harboring the 4.3 kb DNA insert of TC-2 clone was capable of producing abeta-gal/RecA-like fusion protein, suggesting that the cloned gene encodes the RecA-like protein of S. pombe. It was also revealed by Southern hybridization analysis that the same DNA sequence as the cloned recA-like gene is located within the S. pombe chromosomal DNA. In addition, the cloned recA-like gene was transcribed into a 3.0 kb RNA transcript, as judged by Northern blot analysis. The level of the RNA transcript of recA-like gene was increased approximately 1.6 to 2.4-fold upon treatment with DNA damaging agents such as ultraviolet (UV)-light, methyl methanesulfonate (MMS), and mitomycin-C (MMC). This data suggests that the cloned S. pombe recA-like gene is slightly inducible to DNAdamage as in E. coli recA gene. These results suggest that an inducible repair mechanism analogous to that of E. coli may exist in fission yeast S. pombe
Avian influenza H5N1 viral and bird migration networks in Asia
Tian, Huaivu; Zhou, Sen; Dong, Lu; Van Boeckel, Thomas P.; Cui, Yujun; Newman, Scott H.; Takekawa, John Y.; Prosser, Diann J.; Xiao, Xiangming; Wu, Yarong; Cazelles, Bernard; Huang, Shanqian; Yang, Ruifu; Grenfell, Bryan T.; Xu, Bing
2015-01-01
The spatial spread of the highly pathogenic avian influenza virus H5N1 and its long-term persistence in Asia have resulted in avian influenza panzootics and enormous economic losses in the poultry sector. However, an understanding of the regional long-distance transmission and seasonal patterns of the virus is still lacking. In this study, we present a phylogeographic approach to reconstruct the viral migration network. We show that within each wild fowl migratory flyway, the timing of H5N1 outbreaks and viral migrations are closely associated, but little viral transmission was observed between the flyways. The bird migration network is shown to better reflect the observed viral gene sequence data than other networks and contributes to seasonal H5N1 epidemics in local regions and its large-scale transmission along flyways. These findings have potentially far-reaching consequences, improving our understanding of how bird migration drives the periodic reemergence of H5N1 in Asia.
Alpha-fetoprotein-targeted reporter gene expression imaging in hepatocellular carcinoma.
Kim, Kwang Il; Chung, Hye Kyung; Park, Ju Hui; Lee, Yong Jin; Kang, Joo Hyun
2016-07-21
Hepatocellular carcinoma (HCC) is one of the most common cancers in Eastern Asia, and its incidence is increasing globally. Numerous experimental models have been developed to better our understanding of the pathogenic mechanism of HCC and to evaluate novel therapeutic approaches. Molecular imaging is a convenient and up-to-date biomedical tool that enables the visualization, characterization and quantification of biologic processes in a living subject. Molecular imaging based on reporter gene expression, in particular, can elucidate tumor-specific events or processes by acquiring images of a reporter gene's expression driven by tumor-specific enhancers/promoters. In this review, we discuss the advantages and disadvantages of various experimental HCC mouse models and we present in vivo images of tumor-specific reporter gene expression driven by an alpha-fetoprotein (AFP) enhancer/promoter system in a mouse model of HCC. The current mouse models of HCC development are established by xenograft, carcinogen induction and genetic engineering, representing the spectrum of tumor-inducing factors and tumor locations. The imaging analysis approach of reporter genes driven by AFP enhancer/promoter is presented for these different HCC mouse models. Such molecular imaging can provide longitudinal information about carcinogenesis and tumor progression. We expect that clinical application of AFP-targeted reporter gene expression imaging systems will be useful for the detection of AFP-expressing HCC tumors and screening of increased/decreased AFP levels due to disease or drug treatment.
Policies, Political-Economy, and Swidden in Southeast Asia.
Fox, Jefferson; Fujita, Yayoi; Ngidang, Dimbab; Peluso, Nancy; Potter, Lesley; Sakuntaladewi, Niken; Sturgeon, Janet; Thomas, David
2009-06-01
For centuries swidden was an important farming practice found across the girth of Southeast Asia. Today, however, these systems are changing and sometimes disappearing at a pace never before experienced. In order to explain the demise or transitioning of swidden we need to understand the rapid and massive changes that have and are occurring in the political and economic environment in which these farmers operate. Swidden farming has always been characterized by change, but since the onset of modern independent nation states, governments and markets in Southeast Asia have transformed the terms of swiddeners' everyday lives to a degree that is significantly different from that ever experienced before. In this paper we identified six factors that have contributed to the demise or transformation of swidden systems, and support these arguments with examples from China (Xishuangbanna), Laos, Thailand, Malaysia, and Indonesia. These trends include classifying swiddeners as ethnic minorities within nation-states, dividing the landscape into forest and permanent agriculture, expansion of forest departments and the rise of conservation, resettlement, privatization and commoditization of land and land-based production, and expansion of market infrastructure and the promotion of industrial agriculture. In addition we note a growing trend toward a transition from rural to urban livelihoods and expanding urban-labor markets.
Ooi, Choon Jin; Makharia, Govind K; Hilmi, Ida; Gibson, Peter R; Fock, Kwong Ming; Ahuja, Vineet; Ling, Khoon Lin; Lim, Wee Chian; Thia, Kelvin T; Wei, Shu-chen; Leung, Wai Keung; Koh, Poh Koon; Gearry, Richard B; Goh, Khean Lee; Ouyang, Qin; Sollano, Jose; Manatsathit, Sathaporn; de Silva, H Janaka; Rerknimitr, Rungsun; Pisespongsa, Pises; Abu Hassan, Muhamad Radzi; Sung, Joseph; Hibi, Toshifumi; Boey, Christopher C M; Moran, Neil; Leong, Rupert W L
2016-01-01
Inflammatory bowel disease (IBD) was previously thought to be rare in Asia, but emerging data indicate rising incidence and prevalence of IBD in the region. The Asia Pacific Working Group on Inflammatory Bowel Disease was established in Cebu, Philippines, at the Asia Pacific Digestive Week conference in 2006 under the auspices of the Asian Pacific Association of Gastroenterology with the goal of developing best management practices, coordinating research, and raising awareness of IBD in the region. The consensus group previously published recommendations for the diagnosis and management of ulcerative colitis with specific relevance to the Asia-Pacific region. The present consensus statements were developed following a similar process to address the epidemiology, diagnosis, and management of Crohn's disease. The goals of these statements are to pool the pertinent literature specifically highlighting relevant data and conditions in the Asia-Pacific region relating to the economy, health systems, background infectious diseases, differential diagnoses, and treatment availability. It does not intend to be all comprehensive and future revisions are likely to be required in this ever-changing field. © 2015 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.
International Nuclear Information System (INIS)
Abelson, P.H.
1996-01-01
This editorial discusses the shifting dominance in the nuclear reactor technology from the USA to new leadership in East Asia. With the expanding economies and electricity demand, Design, construction and operation of a large number of nuclear power plants in east Asia will support nuclear engineers, technologist, manufacturing facilities, and potential weapons experts. In contrast, the cessation of construction of power reactors in the US is leading to deminished nuclear capabilities
Establishing bioinformatics research in the Asia Pacific
Directory of Open Access Journals (Sweden)
Tammi Martti
2006-12-01
Full Text Available Abstract In 1998, the Asia Pacific Bioinformatics Network (APBioNet, Asia's oldest bioinformatics organisation was set up to champion the advancement of bioinformatics in the Asia Pacific. By 2002, APBioNet was able to gain sufficient critical mass to initiate the first International Conference on Bioinformatics (InCoB bringing together scientists working in the field of bioinformatics in the region. This year, the InCoB2006 Conference was organized as the 5th annual conference of the Asia-Pacific Bioinformatics Network, on Dec. 18–20, 2006 in New Delhi, India, following a series of successful events in Bangkok (Thailand, Penang (Malaysia, Auckland (New Zealand and Busan (South Korea. This Introduction provides a brief overview of the peer-reviewed manuscripts accepted for publication in this Supplement. It exemplifies a typical snapshot of the growing research excellence in bioinformatics of the region as we embark on a trajectory of establishing a solid bioinformatics research culture in the Asia Pacific that is able to contribute fully to the global bioinformatics community.
Directory of Open Access Journals (Sweden)
Hong-Shik Oh
2017-03-01
Full Text Available This study was examined to reveal haplotype distribution and phylogenetic relationship using mitochondrial DNA CYTB gene sequences of Reeve’s turtle (Mauremys reevesii of East Asia. CYTB sequences of Reeve’s turtles were divided into 6 haplotypes (Hap01–Hap06. Chinese turtles were found in Hap01, Hap02, Hap04, and Hap05, and Hap01 was the highest frequency of 85.0%. Korean Turtles were found in Hap01, Hap03, Hap04, and Hap05, and Hap03 was the highest frequency of 52.1%. Although there was no haplotype which includes only the CYTB sequence exclusive for Reeve’s turtles of Korea, since no CYTB sequence of China was found in Hap03, it would be possible that Hap03 turtles of Korea are separated from those of China. The haplotypes of Reeve’s turtles of East Asia were monophyletic, which indicated that they had been evolved from a single maternal lineage, but went through local evolution after geographical migration and isolation in East Asia.
Drug problem in southeast and southwest Asia.
Kulsudjarit, Kongpetch
2004-10-01
In 2002, the drug problem in Southeast and Southwest Asia was serious, particularly in the production of opium and heroin in Afghanistan, Myanmar, and Laos, the three largest producers of illicit opium in the world. The increasing illicit manufacture of ATS, particularly methamphetamine, in Southeast Asia, mainly in China and Myanmar, was also a major concern. Some reports indicated that ephedrine, used for illicitly producing methamphetamine in Southeast Asia, is diverted and smuggled out of China and India, whereas caffeine, the adulterant used for producing methamphetamine tablets, is mainly smuggled into Myanmar through its border with Thailand. Seizure data showed a dramatic increase in trafficking in MDMA through Southeast Asia. In terms of the drug epidemic, in 2002, cannabis remained overall the main drug of abuse in all of the countries of Southeast and Southwest Asia. Opiates, mainly opium and heroin, were also the drugs of choice except in Thailand, where opiate abuse declined, but ATS was the main drug of abuse due to its low cost and availability. A significant increase in ATS abuse, amphetamine, methamphetamine, and MDMA among the youth who smoked, sniffed, and inhaled them was reported in Cambodia, China, Indonesia, Laos, Myanmar, the Philippines, and Thailand. Injecting drug use among opiate abusers has been identified as the prime cause of the rapid spread of HIV/AIDS in Southeast and Southwest Asia.
Southeast Asia activity on the rise
International Nuclear Information System (INIS)
Khin, J.A.; Johnston, D.
1992-01-01
This paper reports that the Asia-Pacific region has gained favor in the increasingly competitive global market for drilling funds and technology. The level of activity in the region contrasts to the U.S., where political, fiscal, and geological conditions have caused an industry-wide depression. Consolidation and restructuring of the oil industry have also affected the Asia-Pacific area, but not as adversely as North America. The shifting focus of most U.S. oil companies to the international sector has increased attention on Southeast Asia. The number of production-sharing contracts and exploration licenses in the region has increased to almost 800, covering an area of 7 million sq km
Directory of Open Access Journals (Sweden)
Dian Anggraini Suroto
Full Text Available Phthoxazolin A, an oxazole-containing polyketide, has a broad spectrum of anti-oomycete activity and herbicidal activity. We recently identified phthoxazolin A as a cryptic metabolite of Streptomyces avermitilis that produces the important anthelmintic agent avermectin. Even though genome data of S. avermitilis is publicly available, no plausible biosynthetic gene cluster for phthoxazolin A is apparent in the sequence data. Here, we identified and characterized the phthoxazolin A (ptx biosynthetic gene cluster through genome sequencing, comparative genomic analysis, and gene disruption. Sequence analysis uncovered that the putative ptx biosynthetic genes are laid on an extra genomic region that is not found in the public database, and 8 open reading frames in the extra genomic region could be assigned roles in the biosynthesis of the oxazole ring, triene polyketide and carbamoyl moieties. Disruption of the ptxA gene encoding a discrete acyltransferase resulted in a complete loss of phthoxazolin A production, confirming that the trans-AT type I PKS system is responsible for the phthoxazolin A biosynthesis. Based on the predicted functional domains in the ptx assembly line, we propose the biosynthetic pathway of phthoxazolin A.
DEFF Research Database (Denmark)
Hendriksen, Rene S.; Le Hello, Simon; Bortolaia, Valeria
2012-01-01
Salmonella enterica serovar Stanley (S. Stanley) is a common serovar in Southeast Asia and was the second most common serovar implicated in human salmonellosis in Thailand in the years 2002 to 2007. In contrast, this serovar is relatively uncommon in Europe. The objective of this study was to cha...
Atmospheric transport of ozone between Southern and Eastern Asia.
Chakraborty, T; Beig, G; Dentener, F J; Wild, O
2015-08-01
This study describes the effect of pollution transport between East Asia and South Asia on tropospheric ozone (O3) using model results from the Task Force on Hemispheric Transport of Air Pollution (TF HTAP). Ensemble mean O3 concentrations are evaluated against satellite-data and ground observations of surface O3 at four stations in India. Although modeled surface O3 concentrations are 1020ppb higher than those observed, the relative magnitude of the seasonal cycle of O3 is reproduced well. Using 20% reductions in regional anthropogenic emissions, we quantify the seasonal variations in pollution transport between East Asia and South Asia. While there is only a difference of 0.05 to 0.1ppb in the magnitudes of the regional contributions from one region to the other, O3 from East Asian sources affects the most densely populated parts of South Asia while Southern Asian sources only partly affect the populated parts of East Asia. We show that emission changes over East Asia between 2000 and 2010 had a larger impact on populated parts of South Asia than vice versa. This study will help inform future decisions on emission control policy over these regions. Copyright © 2015 Elsevier B.V. All rights reserved.
The Asia-Pacific Strategic Triangle
DEFF Research Database (Denmark)
Schmidt, Johannes Dragsbæk
2014-01-01
The objective of this paper is to give insight into the debate over the strategic triangle and how it impacts conflict and security in South Asia. First the new geopolitical motives of the United States in the Asia-Pacific are outlined. Then the concept of strategic triangle is elaborated and its...... applicability discussed; third, details about China and India’s relations and responses to the new US policy are being analyzed; the perspective turns to the implications for conflict and security in South Asia with a focus on Afghanistan and Iran where oil and energy security are the main denominators...... of foreign policy calculations and moves in the strategic triangle; and finally, some concluding remarks are offered to explain the recent shifts in interactions between these core players in the emerging world order and whether a new geopolitical architecture is emerging...
Gavazzi, Floriana; Pigna, Gaia; Braglia, Luca; Gianì, Silvia; Breviario, Diego; Morello, Laura
2017-12-08
Microtubules, polymerized from alpha and beta-tubulin monomers, play a fundamental role in plant morphogenesis, determining the cell division plane, the direction of cell expansion and the deposition of cell wall material. During polarized pollen tube elongation, microtubules serve as tracks for vesicular transport and deposition of proteins/lipids at the tip membrane. Such functions are controlled by cortical microtubule arrays. Aim of this study was to first characterize the flax β-tubulin family by sequence and phylogenetic analysis and to investigate differential expression of β-tubulin genes possibly related to fibre elongation and to flower development. We report the cloning and characterization of the complete flax β-tubulin gene family: exon-intron organization, duplicated gene comparison, phylogenetic analysis and expression pattern during stem and hypocotyl elongation and during flower development. Sequence analysis of the fourteen expressed β-tubulin genes revealed that the recent whole genome duplication of the flax genome was followed by massive retention of duplicated tubulin genes. Expression analysis showed that β-tubulin mRNA profiles gradually changed along with phloem fibre development in both the stem and hypocotyl. In flowers, changes in relative tubulin transcript levels took place at anthesis in anthers, but not in carpels. Phylogenetic analysis supports the origin of extant plant β-tubulin genes from four ancestral genes pre-dating angiosperm separation. Expression analysis suggests that particular tubulin subpopulations are more suitable to sustain different microtubule functions such as cell elongation, cell wall thickening or pollen tube growth. Tubulin genes possibly related to different microtubule functions were identified as candidate for more detailed studies.
CORRUPTION AND FOREIGN DIRECT INVESTMENT IN EAST ASIA AND SOUTH ASIA: AN ECONOMETRIC STUDY
Rahim M. Quazi
2014-01-01
Many recent FDI studies have focused on the effects of corruption on FDI inflows. Theoretically, corruption can act as either a grabbing hand by raising uncertainty and transaction costs, which should impede FDI, or a helping hand by “greasing” the wheels of commerce in the presence of weak regulatory framework, which should facilitate FDI. This study analyzes the impact of corruption on FDI inflows in East Asia and South Asia – two regions that have recently received huge FDI inflows. Using ...
Asia Section. Regional Activities Division. Paper.
International Federation of Library Associations, The Hague (Netherlands).
Two papers on library and information activities in developing nations, particularly in India and other Asian countries, were presented at the 1983 International Federation of Library Associations (IFLA) conference. In "IFLA in Asia: A Review of the Work of the Regional Section for Asia," Edward Lim Huck Tee (Malaysia) describes the low…
Characterization of the novel In1059 harbouring VIM gene cassette
Directory of Open Access Journals (Sweden)
Dongguo Wang
2017-05-01
Full Text Available Abstract Background VIM-type enzyme encodes the most widely acquired metallo-β-lactamases in Gram- negative bacteria. To obtain current epidemiological data for integrons from enterobacteriae in hospital, the study characterizes the genetic structure in In1059 by comparison with In846 integrons harbouring VIM gene and other class 1 integrons including In37, In62, In843 and In1021 with the aim of identifying the putative mechanisms involved integron mobilization and infer evolution of relevant integrons. Methods Six of 69 recombinant plasmids from clinical strains were found to be class 1 integrons by digestion with BamHI, drug susceptibility testing, conjugation experiments, PCR amplification, integron cloning and sequencing, genome comparison, and detection of carbapenemase activity. Results The sequences of the six recombinant plasmids encoding In1021, In843, In846, In37, In62, and the novel In1059 integron had approximate lengths of ~4.8-, 4.1-, 5.1-, 5.3-, 5.3- and 6.6- kb, respectively. The genetic structures of these integrons were mapped and characterized, and the carbapenemase activities of their parental strains were assessed. Conclusions Our results suggest that the six variable integron structures and regular variations that exist in the gene cassettes provide a putative mechanism for the integron changes. Our study has also shown that the genetic features in the integrons named above fall within a scheme involving the stepwise and parallel evolution of class 1 integron variation likely under antibiotic selection pressure in clinical settings.
Preston, Jill C; Jorgensen, Stacy A; Jha, Suryatapa G
2014-01-01
Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae), many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1) in the short-lived perennial Petunia hybrida (petunia, Solanaceae). Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS) and Floral Binding Protein 21 (FBP21), but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
Directory of Open Access Journals (Sweden)
Jill C Preston
Full Text Available Flowering time is strictly controlled by a combination of internal and external signals that match seed set with favorable environmental conditions. In the model plant species Arabidopsis thaliana (Brassicaceae, many of the genes underlying development and evolution of flowering have been discovered. However, much remains unknown about how conserved the flowering gene networks are in plants with different growth habits, gene duplication histories, and distributions. Here we functionally characterize three homologs of the flowering gene Suppressor Of Overexpression of Constans 1 (SOC1 in the short-lived perennial Petunia hybrida (petunia, Solanaceae. Similar to A. thaliana soc1 mutants, co-silencing of duplicated petunia SOC1-like genes results in late flowering. This phenotype is most severe when all three SOC1-like genes are silenced. Furthermore, expression levels of the SOC1-like genes Unshaven (UNS and Floral Binding Protein 21 (FBP21, but not FBP28, are positively correlated with developmental age. In contrast to A. thaliana, petunia SOC1-like gene expression did not increase with longer photoperiods, and FBP28 transcripts were actually more abundant under short days. Despite evidence of functional redundancy, differential spatio-temporal expression data suggest that SOC1-like genes might fine-tune petunia flowering in response to photoperiod and developmental stage. This likely resulted from modification of SOC1-like gene regulatory elements following recent duplication, and is a possible mechanism to ensure flowering under both inductive and non-inductive photoperiods.
Genomic characterization of putative allergen genes in peach/almond and their synteny with apple
Chen, Lin; Zhang, Shuiming; Illa, Eudald; Song, Lijuan; Wu, Shandong; Howad, Werner; Arús, Pere; Weg, Eric van de; Chen, Kunsong; Gao, Zhongshan
2008-01-01
Background Fruits from several species of the Rosaceae family are reported to cause allergic reactions in certain populations. The allergens identified belong to mainly four protein families: pathogenesis related 10 proteins, thaumatin-like proteins, lipid transfer proteins and profilins. These families of putative allergen genes in apple (Mal d 1 to 4) have been mapped on linkage maps and subsequent genetic study on allelic diversity and hypoallergenic traits has been carried out recently. In peach (Prunus persica), these allergen gene families are denoted as Pru p 1 to 4 and for almond (Prunus dulcis)Pru du 1 to 4. Genetic analysis using current molecular tools may be helpful to establish the cause of allergenicity differences observed among different peach cultivars. This study was to characterize putative peach allergen genes for their genomic sequences and linkage map positions, and to compare them with previously characterized homologous genes in apple (Malus domestica). Results Eight Pru p/du 1 genes were identified, four of which were new. All the Pru p/du 1 genes were mapped in a single bin on the top of linkage group 1 (G1). Five Pru p/du 2 genes were mapped on four different linkage groups, two very similar Pru p/du 2.01 genes (A and B) were on G3, Pru p/du 2.02 on G7,Pru p/du 2.03 on G8 and Pru p/du 2.04 on G1. There were differences in the intron and exon structure in these Pru p/du 2 genes and in their amino acid composition. Three Pru p/du 3 genes (3.01–3.03) containing an intron and a mini exon of 10 nt were mapped in a cluster on G6. Two Pru p/du 4 genes (Pru p/du 4.01 and 4.02) were located on G1 and G7, respectively. The Pru p/du 1 cluster on G1 aligned to the Mal d 1 clusters on LG16; Pru p/du 2.01A and B on G3 to Mal d 2.01A and B on LG9; the Pru p/du 3 cluster on G6 to Mal d 3.01 on LG12; Pru p/du 4.01 on G1 to Mal d 4.03 on LG2; and Pru p/du 4.02 on G7 to Mal d 4.02 on LG2. Conclusion A total of 18 putative peach/almond allergen genes have
Genomic characterization of putative allergen genes in peach/almond and their synteny with apple
Directory of Open Access Journals (Sweden)
Weg Eric
2008-11-01
Full Text Available Abstract Background Fruits from several species of the Rosaceae family are reported to cause allergic reactions in certain populations. The allergens identified belong to mainly four protein families: pathogenesis related 10 proteins, thaumatin-like proteins, lipid transfer proteins and profilins. These families of putative allergen genes in apple (Mal d 1 to 4 have been mapped on linkage maps and subsequent genetic study on allelic diversity and hypoallergenic traits has been carried out recently. In peach (Prunus persica, these allergen gene families are denoted as Pru p 1 to 4 and for almond (Prunus dulcisPru du 1 to 4. Genetic analysis using current molecular tools may be helpful to establish the cause of allergenicity differences observed among different peach cultivars. This study was to characterize putative peach allergen genes for their genomic sequences and linkage map positions, and to compare them with previously characterized homologous genes in apple (Malus domestica. Results Eight Pru p/du 1 genes were identified, four of which were new. All the Pru p/du 1 genes were mapped in a single bin on the top of linkage group 1 (G1. Five Pru p/du 2 genes were mapped on four different linkage groups, two very similar Pru p/du 2.01 genes (A and B were on G3, Pru p/du 2.02 on G7,Pru p/du 2.03 on G8 and Pru p/du 2.04 on G1. There were differences in the intron and exon structure in these Pru p/du 2 genes and in their amino acid composition. Three Pru p/du 3 genes (3.01–3.03 containing an intron and a mini exon of 10 nt were mapped in a cluster on G6. Two Pru p/du 4 genes (Pru p/du 4.01 and 4.02 were located on G1 and G7, respectively. The Pru p/du 1 cluster on G1 aligned to the Mal d 1 clusters on LG16; Pru p/du 2.01A and B on G3 to Mal d 2.01A and B on LG9; the Pru p/du 3 cluster on G6 to Mal d 3.01 on LG12; Pru p/du 4.01 on G1 to Mal d 4.03 on LG2; and Pru p/du 4.02 on G7 to Mal d 4.02 on LG2. Conclusion A total of 18 putative peach
The nuclear Asia; L'Asie nucleaire
Energy Technology Data Exchange (ETDEWEB)
Cordonnier, I.; Tertrais, B
2001-07-01
Since the demolition of the Berlin wall, Asia has become the theater of nuclear rivalry, with as main actors: india, Pakistan, China and South Korea. This book analyzes the geo-political situation in this region of the world and asks some important questions about the new strategic map of Asia: what is the impact of the development of nuclear activities on the security of Asia? Will the deployment of anti-missile defenses lead to a new weapons rush? Is there a nuclear warfare risk? (J.S.)
Wu, Shun-Fan; Li, Jian; Zhang, Yong; Gao, Cong-Fen
2018-02-09
Transferrins are involved in iron metabolism, immunity, xenobiotics tolerance, and development in eukaryotic organisms including insects. However, little is known about the relationship between transferrins and insecticide toxicology and resistance. Three transferrin family genes, NlTsf1, NlTsf2, and NlTsf3, of the brown planthopper, Nilaparvata lugens (Stål) (Hemiptera: Delphacidae)a major insect pest of rice field in Asia, had been identified and characterized in this study. Quantitative polymerase chain reaction results demonstrated that NlTsf1 was significantly higher than the other two genes in different tissues. All of them were expressed at higher levels in abdomen and head than in antenna, leg, stylet, and thorax. Compared with the control, the expression of three N. lugens transferrin family genes decreased dramatically 24 h after treatment with buprofezin, pymetrozine and imidacloprid. Published by Oxford University Press on behalf of Entomological Society of America 2017. This work is written by (a) US Government employee(s) and is in the public domain in the US.
Chen, Dijun; Kaufmann, Kerstin
2017-01-01
Key transcription factors (TFs) controlling the morphogenesis of flowers and leaves have been identified in the model plant Arabidopsis thaliana. Recent genome-wide approaches based on chromatin immunoprecipitation (ChIP) followed by high-throughput DNA sequencing (ChIP-seq) enable systematic identification of genome-wide TF binding sites (TFBSs) of these regulators. Here, we describe a computational pipeline for analyzing ChIP-seq data to identify TFBSs and to characterize gene regulatory networks (GRNs) with applications to the regulatory studies of flower development. In particular, we provide step-by-step instructions on how to download, analyze, visualize, and integrate genome-wide data in order to construct GRNs for beginners of bioinformatics. The practical guide presented here is ready to apply to other similar ChIP-seq datasets to characterize GRNs of interest.
Hays, Shan M; Swanson, Johanna; Selker, Eric U
2002-01-01
We have identified and characterized the complete complement of genes encoding the core histones of Neurospora crassa. In addition to the previously identified pair of genes that encode histones H3 and H4 (hH3 and hH4-1), we identified a second histone H4 gene (hH4-2), a divergently transcribed pair of genes that encode H2A and H2B (hH2A and hH2B), a homolog of the F/Z family of H2A variants (hH2Az), a homolog of the H3 variant CSE4 from Saccharomyces cerevisiae (hH3v), and a highly diverged ...
Cloning and characterization of the gene for L-amino acid oxidase in hybrid tilapia.
Shen, Yubang; Fu, Gui Hong; Liu, Feng; Yue, Gen Hua
2015-12-01
Tilapia is the common name for a group of cichlid fishes. Identification of DNA markers significantly associated with important traits in candidate genes may speed up genetic improvement. L-Amino acid oxidase (LAO) plays a crucial role in the innate immune defences of animals. Previously, whether LAO variants were associated with economic traits had not been studied in fish. We characterized the cDNA sequence of the LAO gene of hybrid tilapia (Oreochromis spp.). Its ORF was 1536 bp, encoding a flavoenzyme of 511 amino acids. This gene consisted of seven exons and six introns. Its expression was detected in the intestine, blood, kidney, skin, liver. It was highly expressed in the intestine. After a challenge with a bacterial pathogen, Streptococcus agalactiae, its expression was up-regulated significantly in the liver, intestine and spleen (P tilapia. The investigation of relationship between polymorphism of LAO gene and disease resistance and growth in tilapia showed that one SNP was associated significantly with body length. Further experiments on whether SNPs in the LAO gene are associated with growth in tilapia and other populations could be useful in understanding more functions of the LAO gene.
Nuclear energy in Asia and regional co-operation
International Nuclear Information System (INIS)
Ishii, M.
1997-01-01
There is increasing concern in East Asia about regional cooperation in the field of nuclear power. At the APEC conference in Osaka in 1995, APEC (Asia Pacific Economic Cooperation) established an Energy Research Center. The center has started to perform joint research forecasts on energy supply and demand for the region. Japan proposed the inauguration of a Conference on Nuclear Safety in Asia at the Moscow Nuclear Energy Summit in 1996. The first conference was held in Tokyo that year. This year, the conference will be held in Seoul. Japan's Atomic Energy Commission sponsors the International Conference for Nuclear Cooperation in Asia every year. This year marks the eighth conference. The outstanding feature of this year's conference was that so many countries stressed regional cooperation. South Korea proposed the installation of a regional online radiation monitoring system. The Philippines asserted the need for a cooperative mechanism on the lines of ASIATOM. Why is so much concern now being focused on nuclear power cooperation in East Asia? What kind of regional cooperation is necessary, and what kind is possible? What are the unique features of nuclear power cooperation in East Asia? These are the points addressed in this paper. (author)
Directory of Open Access Journals (Sweden)
Saurabh Majumder
2013-10-01
Full Text Available Aim: To characterize one of the major glycoprotein genes viz., glycoprotein C (gC; UL44, unique long region 44 of bovineherpesvirus 1(BoHV1 of Indian origin at genetic and phylogenetic level.Materials and Methods: A bovine herpesvirus 1 isolate viz., (BoHV1/IBR 216 II/ 1976/ India maintained at Division ofVirology, IVRI, Mukteswar was used for the current study. The DNA was extracted using commercial kit and the completeORF of gC gene was amplified, cloned, and sequenced by conventional Sanger sequencing method. The sequence wasgenetically and phylogenetically analysed using various bioinformatic tools. The sequence was submitted in the Genbankwith accession number Kc756965.Results: The complete ORF of gC gene was amplified and sequenced. It showed 100% sequence homology with referencecooper strain of BoHV1 and divergence varied from 0% to 2.7% with other isolates of BoHV1. The isolate under study haddivergence of 9.2%, 13%, 26.6%, and 9.2% with BoHV5 (Bovine herpesvirus 5, CvHV1 (Cervid herpesvirus 1, CpHV1(Caprine herpesvirus 1, and BuHV1 (Bubaline herpesvirus 1, respectively.Conclusion: This is the first genetic characterization of complete open reading frame (ORF of glycoprotein C gene (UL44 ofIndian isolate of BoHV1. The gC gene of BoHV1 is highly conserved among all BoHV1 isolates and it can be used as a targetfor designing diagnostic primers for the specific detection of BoHV1.
Cox, M; Gerritse, G; Dankmeyer, L; Quax, W.J.
2001-01-01
Pseudomonas alcaligenes secretes a lipase with a high pH optimum, which has interesting properties for application in detergents. The expression of the lipase is strongly dependent on the presence of lipids in the growth medium such as soybean oil. The promoter of the gene was characterized and
Institute of Scientific and Technical Information of China (English)
HSU Heng; Robert L. CHURCH
2004-01-01
During lens development, lens epithelial cells differentiate into fiber cells. To date, four major lens fiber cell intrinsic membrane proteins (MIP) ranging in size from 70 kD to 19 kD have been characterized. The second most abundant lens fiber cell intrinsic membrane protein is MP19. This protein probably is involved with lens cell communication and relates with cataractogenesis. The aim of this research is to characterize upstream sequences of the MP19 (also called LIM2) gene that bind developmentally regulated and lens-specific proteins. We have used the gel mobility assays and corresponding competition experiments to identify and characterize cis elements within approximately 500 bases of LIM2 upstream sequences. Our studies locate the positions of some cis elements, including a "CA" repeat, a methylation Hha I island, an FnuD II site, an Ap1 and an Ap2 consensus sequences, and identify some specific cis elements which relate to lens-specific transcription of LIM2. Our experiments also preliminarily identify trans factors which bind to specific cis elements of the LIM2 promoter and/or regulate transcription of LIM2. We conclude that developmental regulation and coordination of the MP 19 gene in ocular lens fiber cells is controlled by the presence of specific cis elements that bind regulatory trans factors that affect LIM2 gene expression. DNA methylation is one mechanism of controlling LIM2 gene expression during lens development.
Russian Language in the Central Asia Region
Directory of Open Access Journals (Sweden)
Ksenia Petrovna Borishpolets
2014-01-01
Full Text Available He article is devoted to the role of the Russian language in Central Asia and its development perspectives in the context of the Eurasian integration processes. Russian language has a long historical tradition in Central Asia and hasn't lost its importance even at the background of two waves of "derussification" that took place after 1991. Notwithstanding the decrease of the status, it keeps substantial public significance. During last two decades only in Turkmenistan we are witnessing the decrease in spreading of the Russian language among title population of the Central Asia region. Its positions as an active communication channel is secured not only by the social tradition, but also by the competitiveness of the Russian language education, advantages of the bilingual business, requirements of the labor migrants, HR interests and by some other pragmatic thoughts, which role within the context of Eurasian economic integration will increase. Despite the difficulties, it is too early to speak about the decrease of the Russian language in the Central Asia region. It is more likely that the institutes itself that maintain it and promoting it are at the low ebb. New scales and forms of practical work that is interested not only for Russia, but also Central Asia countries are required. Pressure on the resources of the Russian language increases the possibility of ethnic conflicts and strengthens the positions of political radicalism in Central Asia region.
Prevalence of food allergies in South Asia.
Arakali, Schweta R; Green, Todd D; Dinakar, Chitra
2017-01-01
To evaluate the published medical literature on the prevalence and types of food allergies in South Asia. A PubMed search was performed using the keywords India and food allergy, Asia and food allergy, and South Asia and food allergy for any period. Articles cited in selected studies were reviewed for their appropriateness of inclusion into this review. Publications were included that were original research and fit the topic of food allergy and South Asia. South Asia is defined as region inclusive of India, Pakistan, Bangladesh, and Sri Lanka. A total of 169 articles were initially identified, and 47 were reviewed in detail for inclusion in this review. The primary focus was placed on 10 studies that consisted of case reports of newly reported or documented food allergy, survey studies that investigated food allergy prevalence in specific demographics, and prospective and cross-sectional studies with case controls, all of which investigated food allergy prevalence by allergy testing in a selected population. The medical literature on the prevalence and types of food allergy in South Asia indicates that there is a variety of unusual and unique allergens and an overall low incidence of food allergy. There is also an association of increased food allergy prevalence in individuals who live in metropolitan regions or who migrate to communities that have adopted westernization. Copyright © 2016 American College of Allergy, Asthma & Immunology. Published by Elsevier Inc. All rights reserved.
Sources and trends of environmental mercury emissions in Asia.
Wong, Coby S C; Duzgoren-Aydin, Nurdan S; Aydin, Adnan; Wong, Ming H
2006-09-15
This paper focuses on environmental mercury emissions in Asia and elaborates its probable trend in the future and associated implications given the anticipated socioeconomic outlook and other macro-environmental factors. Among the various regions, Asia has become the largest contributor of anthropogenic atmospheric Hg, responsible for over half of the global emission. In the next few decades, a significant increase in anthropogenic Hg emissions in Asia is likely owing to rapid economic and industrial development, unless drastic measures are taken. In particular, the dominance of Asia in some Hg-emitting industries, such as coal combustion, steel production and gold mining, provokes a serious environmental concern over their potential contributions of incidental Hg in the region. Moreover, the increasing prevalence of electrical and electronic manufacturing industry as a user and a contributor of Hg in Asia is also worrying. Specifically, disposal of obsolete electrical and electronic wastes represents a phenomenon increasingly encountered in Asia. In addition to escalating anthropogenic Hg emissions in Asia, associated environmental and health implications may also exacerbate in the region for the probable effects of a unique combination of climatic (e.g. subtropical climate), environmental (e.g. acid rain) and socioeconomic factors (e.g. high population density). Hence, much effort is still needed to understand the role of Asia in global Hg cycle and associated environmental and health effects in the region.
Sources and trends of environmental mercury emissions in Asia
International Nuclear Information System (INIS)
Wong, Coby S.C.; Duzgoren-Aydin, Nurdan S.; Aydin, Adnan; Wong, Ming H.
2006-01-01
This paper focuses on environmental mercury emissions in Asia and elaborates its probable trend in the future and associated implications given the anticipated socioeconomic outlook and other macro-environmental factors. Among the various regions, Asia has become the largest contributor of anthropogenic atmospheric Hg, responsible for over half of the global emission. In the next few decades, a significant increase in anthropogenic Hg emissions in Asia is likely owing to rapid economic and industrial development, unless drastic measures are taken. In particular, the dominance of Asia in some Hg-emitting industries, such as coal combustion, steel production and gold mining, provokes a serious environmental concern over their potential contributions of incidental Hg in the region. Moreover, the increasing prevalence of electrical and electronic manufacturing industry as a user and a contributor of Hg in Asia is also worrying. Specifically, disposal of obsolete electrical and electronic wastes represents a phenomenon increasingly encountered in Asia. In addition to escalating anthropogenic Hg emissions in Asia, associated environmental and health implications may also exacerbate in the region for the probable effects of a unique combination of climatic (e.g. subtropical climate), environmental (e.g. acid rain) and socioeconomic factors (e.g. high population density). Hence, much effort is still needed to understand the role of Asia in global Hg cycle and associated environmental and health effects in the region
International Nuclear Information System (INIS)
Overholt, W.H.
1977-01-01
The book is a collection of seven papers by five specialists--two political scientists; a sociologist; and two specialists in the interaction between science and international affairs. They share a disregard for conventional boundaries between disciplines and for the emphasis on method over substance which have tended to fragment knowledge into ever-smaller and smaller fragments. The papers are: The Next Phase in Nuclear Proliferation Research, L.A. Dunn and W.H. Overholt; China as a Nuclear Power, J. D. Pollack; Nuclear Arms and Japan, Herbert Passin; Nuclear Proliferation in Eastern Asia, W. H. Overholt; India's Nuclear Program: Decisions, Intent, and Policy, 1950 to 1976, Onkar Marwah; India, Pakistan, Iran--A Nuclear Proliferation Chain, L. A. Dunn; and A U.S. Nuclear Posture for Asia, W. H. Overholt
Nuclear policies in Northeast Asia
International Nuclear Information System (INIS)
Mack, A.
1995-01-01
In Northeast Asia, states have tried to enhance their security through unilateral means rather than cooperative ones. In this area, there is no regional multilateral security dialogue of significance. In the nuclear age, security is not something to be built for oneself irrespective of others. Security is something to be built together with one's opponents. The arms build-up in Northeast Asia is very substantial. Defence budgets are growing almost as fast as are the national economies. Still, there is no arms race, i.e. no interacting patterns of arms acquisitions and force deployments. There is a real risk, however, that the arms build-up might spill over into an arms race. Hence the case for cooperative policies - for confidence-building measures and arms control in particular - to prevent this from happening. The end of the Cold War has brought about profound changes in the international political and economic environment. There is a noticeable tendency towards political reconciliation and cooperation among states and an increasing interdependence and globalization. On the other hand, one cannot miss some worrisome phenomena, including the resurgence of nationalism, the multiplication of ethnic conflicts and the dangers associated with the proliferation of weapons of mass destruction. This is particularly true of the Northeast Asian region. Although some changes in the regional security outlook are favourable, there are also sources of insecurity and uncertainty in Northeast Asia, not least being the disturbing trend towards a regional arms build-up. In today's Northeast Asia weapons proliferation is a source of growing concern. The major purpose of this volume is to provide a comprehensive analysis of the dimensions of the various nuclear problems and their interrelationships in Northeast Asia. A second purpose is to explore practical approaches to regional non-proliferation, to see how they may be strengthened and made mutually supportive of the global non
1991-09-01
Perhaps 1 million people in Asia are HIV positive (1% of the world's total). Even many more people are at risk since Asia has 50% of the world's population. Sexual transmission is the main mode of transmission. Yet people in Asia do not want to deal with sexual behavior. Thus high level political commitment is needed such has been done in Thailand which has set up a national AIDS committee. An AIDS expert predicts that by 1995 the number of HIV positive individuals in Asia will surpass the number of HIV positive individuals in all the developed countries. India, Myanmar, and Thailand where prostitution and intravenous (IV) drug use abounds (the Golden Triangle) suffer from the worst AIDS epidemics in the region. International sex tourism contributes greatly to both the heterosexual and homosexual spread of AIDS. In fact, the national AIDS committee in Thailand has begun a campaign to stop sex tourism, but as of September 1991, it had no effect. Further some sex businesses have attempted to stop the spread of AIDS. For example, 2 brothels in central Thailand have implemented a condom only policy for their clients. High rates of sexually transmitted diseases among prostitutes facilitate HIV transmission. This highlights the need for Asian countries to promote condom use. Not all of the Asian countries screen 100% of their blood and blood products. In fact, in India, commercial blood banks do not always screen donated blood since screening eats into their profits. Further unsterile needles are often used in medical facilities such as in India and Viet Nam. Hong Kong sells inexpensive sterile needles over the counter which may account for its low HIV positive rate among drug users. Despite the many problems in Asia which facilitate HIV transmission, tragedy can be averted if governments act at once.
The future for distributed power in Asia
International Nuclear Information System (INIS)
Kanwarpal, Vishvjeet
2000-01-01
The substantial potential market opportunities for on-site tailor-made cogeneration units in Asia generally is discussed. The article also looks at India, Australia, Japan and Indonesia in particular. The article is presented under the sub-headings of (i) Asian power and IPP developments; (ii) captive capacity and rationale; (iii) Asian captive capacity; (iv) captive power plants; (v) key drivers of CPPs in Asia; (vi) cogeneration plants; (vii) cogeneration application industries; (viii) biomass power for Asia (ix) key hurdles in cogeneration development; (x) future potential of cogeneration and (xi) country snapshots
Informing Drought Preparedness and Response with the South Asia Land Data Assimilation System
Zaitchik, B. F.; Ghatak, D.; Matin, M. A.; Qamer, F. M.; Adhikary, B.; Bajracharya, B.; Nelson, J.; Pulla, S. T.; Ellenburg, W. L.
2017-12-01
Decision-relevant drought monitoring in South Asia is a challenge from both a scientific and an institutional perspective. Scientifically, climatic diversity, inconsistent in situ monitoring, complex hydrology, and incomplete knowledge of atmospheric processes mean that monitoring and prediction are fraught with uncertainty. Institutionally, drought monitoring efforts need to align with the information needs and decision-making processes of relevant agencies at national and subnational levels. Here we present first results from an emerging operational drought monitoring and forecast system developed and supported by the NASA SERVIR Hindu-Kush Himalaya hub. The system has been designed in consultation with end users from multiple sectors in South Asian countries to maximize decision-relevant information content in the monitoring and forecast products. Monitoring of meteorological, agricultural, and hydrological drought is accomplished using the South Asia Land Data Assimilation System, a platform that supports multiple land surface models and meteorological forcing datasets to characterize uncertainty, and subseasonal to seasonal hydrological forecasts are produced by driving South Asia LDAS with downscaled meteorological fields drawn from an ensemble of global dynamically-based forecast systems. Results are disseminated to end users through a Tethys online visualization platform and custom communications that provide user oriented, easily accessible, timely, and decision-relevant scientific information.
Characterization of ORF89 - A latency-related gene of white spot syndrome virus
International Nuclear Information System (INIS)
Hossain, M.S.; Khadijah, Siti; Kwang, Jimmy
2004-01-01
Open reading frame 89 (ORF89) is one of the three genes that are believed to be involved in the latent infection of white spot syndrome virus (WSSV). Here, we report the structure and functional characterization of ORF89. cDNA sequencing, 5' RLM-RACE, and 3' RLM-RACE showed that ORF89 gene is transcribed into an unspliced mRNA of 4436 nucleotides, which is predicted to encode a protein of 1437 amino acids. ORF89 expressed an approximately 165-kDa protein in Sf9 cells that localized in the nucleus. Amino acids 678-683 were found to be essential for nuclear localization. Cotransfection assays demonstrated that ORF89 protein repressed its own promoter as well as those of a protein kinase and the thymidine-thymidylate kinase genes of WSSV. SYBR Green real-time PCR indicated that the repression occurred at the transcriptional level
[The population and economic problems of South Asia].
Gu, J
1983-07-29
South Asia, which includes Central South Asia, Southeast Asia, and Southwest Asia, had a comparatively higher population growth rate during the 30-year postwar period because of the overall backward economy and strong religious tradition. From the viewpoint of economics, the high population growth in South Asia has slowed down economic growth, increased the foreign trade imblance, and worsened poverty. Secondly, the rapid population growth has overburdened the area's educational system. The illiteracy rate has been going up continuously because of inadequate funds available for education. Thirdly, young labor is lacking in skills, training, and work experience, and related productivity has declined. Consequently, profits, the investment capability, and wages are also declining. The problems of the oversupply of labor, unemployment, and poverty have also become increasingly serious. In addition, the rapid population growth has intensified the pressure on the food supply and worsened the average nutrition of the general public. In recent years, countries in South Asia have been trying to deal with various problems caused by the rapid population growth. Measures have been taken to control the population growth, with a redistribution of the population to places outside cities, and export labor to oil-producing nations of the Middle East and Africa in order to solve the problem of the domestic labor surplus and earn more income for the foreign exchange. Countries in South Asia need more time and effort to achieve a balance between the population growth and economic development.
Characteristics of intercontinental transport of tropospheric ozone from Africa to Asia
Han, Han; Liu, Jane; Yuan, Huiling; Zhuang, Bingliang; Zhu, Ye; Wu, Yue; Yan, Yuhan; Ding, Aijun
2018-03-01
In this study, we characterize the transport of ozone from Africa to Asia through the analysis of the simulations of a global chemical transport model, GEOS-Chem, from 1987 to 2006. The receptor region Asia is defined within 5-60° N and 60-145° E, while the source region Africa is within 35° S-15° N and 20° W-55° E and within 15-35° N and 20° W-30° E. The ozone generated in the African troposphere from both natural and anthropogenic sources is tracked through tagged ozone simulation. Combining this with analysis of trajectory simulations using the Hybrid Single-Particle Lagrangian Integrated Trajectory (HYSPLIT) model, we find that the upper branch of the Hadley cell connects with the subtropical westerlies in the Northern Hemisphere (NH) to form a primary transport pathway from Africa to Asia in the middle and upper troposphere throughout the year. The Somali jet that runs from eastern Africa near the equator to the Indian subcontinent in the lower troposphere is the second pathway that appears only in NH summer. The influence of African ozone mainly appears over Asia south of 40° N. The influence shows strong seasonality, varying with latitude, longitude, and altitude. In the Asian upper troposphere, imported African ozone is largest from March to May around 30° N (12-16 ppbv) and lowest during July-October around 10° N ( ˜ 2 ppbv). In the Asian middle and lower troposphere, imported African ozone peaks in NH winter between 20 and 25° N. Over 5-40° N, the mean fractional contribution of imported African ozone to the overall ozone concentrations in Asia is largest during NH winter in the middle troposphere ( ˜ 18 %) and lowest in NH summer throughout the tropospheric column ( ˜ 6 %). This seasonality mainly results from the collective effects of the ozone precursor emissions in Africa and meteorology and chemistry in Africa, in Asia and along the transport pathways. The seasonal swing of the Hadley circulation and subtropical westerlies along the
Cost-effective control of SO2 emissions in Asia
Cofala, J.; Amann, M.; Gyarfas, F.; Schoepp, F.; Boudri, J.C.; Hordijk, L.; Kroeze, C.; Li Junfeng,; Dai Lin, D.; Panwar, T.S.; Gupta, S.
2004-01-01
Despite recent efforts to limit the growth of SO2 emissions in Asia, the negative environmental effects of sulphur emissions are likely to further increase in the future. This paper presents an extension of the RAINS-Asia integrated assessment model for acidification in Asia with an optimisation
Rsaliyev, Aralbek; Pahratdinova, Zhazira; Rsaliyev, Shynbolat
2017-11-14
Powdery mildew of barley is a wind-borne and obligate biotrophic pathogen, which ranks among the most widespread barley pathogens worldwide. However, purposeful research towards studying the structure of the barley powdery mildew populations, of their virulence and of effectiveness of certain resistance genes against the infection was not conducted in Kazakhstan till present time. This paper is the first to describe characteristics of the pathotype structure of Blumeria graminis f.sp. hordei (Bgh) population and effectiveness of resistance genes in two regions of barley cultivation in the republic. One hundred and seven isolates of Bgh were obtained from seven populations occurring on cultivated barley at two geographically locations in Kazakhstan during 2015 and 2016. Their virulence frequency was determined on 17 differential lines Pallas. All isolates were virulent on the resistance gene Mla8 and avirulent for the resistance genes Mla9, Mla1 + MlaAl2, Mla6 + Mla14, Mla13 + MlRu3, Mla7 + MlNo3, Mla10 + MlDu2, Mla13 + MlRu3 and Mlo-5. The frequencies of isolates overcoming the genes Mla3, Mla22, Mlat Mlg + MlCP and Mla12 + MlEm2 were 0.0-33.33%, and frequencies of isolates overcoming the genes Mlra, Mlk, MlLa and Mlh ranged from 10.0 to 78.6%. Based on reactions of differential lines possessing the genes Mla22, Mlra, Mlk, Mlat, MlLa and Mlh, pathotypes were identified. In total, 23 pathotypes with virulence complexity ranging from 1 to 6 were identified. During both years in all populations of South Kazakhstan and Zhambyl regions pathotypes 24 and 64 mainly prevailed. Obtained data suggest that low similarity of populations Bgh in Kazakhstan to European, African, Australian and South-East Asian populations. The present study provides a foundation for future studies on the pathogenic variability within of Bgh populations in Kazakhstan and addresses the knowledge gap on the virulence structure of Bgh in Central Asia. Complete effectiveness of the
Sequence analysis and molecular characterization of Wnt4 gene in metacestodes of Taenia solium.
Hou, Junling; Luo, Xuenong; Wang, Shuai; Yin, Cai; Zhang, Shaohua; Zhu, Xueliang; Dou, Yongxi; Cai, Xuepeng
2014-04-01
Wnt proteins are a family of secreted glycoproteins that are evolutionarily conserved and considered to be involved in extensive developmental processes in metazoan organisms. The characterization of wnt genes may improve understanding the parasite's development. In the present study, a wnt4 gene encoding 491amino acids was amplified from cDNA of metacestodes of Taenia solium using reverse transcription PCR (RT-PCR). Bioinformatics tools were used for sequence analysis. The conserved domain of the wnt gene family was predicted. The expression profile of Wnt4 was investigated using real-time PCR. Wnt4 expression was found to be dramatically increased in scolex evaginated cysticerci when compared to invaginated cysticerci. In situ hybridization showed that wnt4 gene was distributed in the posterior end of the worm along the primary body axis in evaginated cysticerci. These findings indicated that wnt4 may take part in the process of cysticerci evagination and play a role in scolex/bladder development of cysticerci of T. solium.
Transition of maternal and child nutrition in Asia: implications for public health.
Winichagoon, Pattanee
2015-05-01
This article reviews the maternal and child nutrition situation in Asia in transition and its public health implications. Countries in Asia are facing a double burden of malnutrition. Accessibility to high energy, less nutrient-dense foods or processed foods affects current dietary patterns, whereas industrialization is leading to more sedentary lifestyles both in rural and urban areas. Stunting and wasting among young children persist but have declined in severity, whereas overweight and obesity have risen rapidly. Growth faltering in height during the first 2 years of life has affected muscle mass accretion, but rapid weight gain after 2 years of age has led to more fat accretion, imposing risks of childhood obesity and consequent metabolic disorders. The number of women entering pregnancy with low BMI has decreased, but increasing BMI is noticeable. Prepregnancy BMI and gestational weight gain are important determinants of maternal nutrition during pregnancy, the risk of gestational diabetes and postpartum weight retention, as well as obesity and diet-related noncommunicable diseases in later adulthood. Asia in transition is faced with persistent undernutrition and increasing trends of obesity and metabolic disorders among children and women. The first 1000 days from conception is a critical period, but it is also a window of opportunity for preventing double burden of malnutrition in Asian countries characterized by a nutrition transition.
Genetic characterization of an isolate of canine distemper virus from a Tibetan Mastiff in China.
Li, Weike; Li, Tiansong; Liu, Yuxiu; Gao, Yuwei; Yang, Songtao; Feng, Na; Sun, Heting; Wang, Shengle; Wang, Lei; Bu, Zhigao; Xia, Xianzhu
2014-08-01
Canine distemper (CD) is a highly contagious, often fatal, multisystemic, and incurable disease in dogs and other carnivores, which is caused by canine distemper virus (CDV). Although vaccines have been used as the principal means of controlling the disease, CD has been reported in vaccinated animals. The hemoagglutinin (H) protein is one of the most important antigens for inducing protective immunity against CD, and antigenic variation of recent CDV strains may explain vaccination failure. In this study, a new CDV isolate (TM-CC) was obtained from a Tibetan Mastiff that died of distemper, and its genome was characterized. Phylogenetic analysis of the H gene revealed that the CDV-TM-CC strain is unique among 20 other CDV strains and can be classified into the Asia-1 group with the Chinese strains, Hebei and HLJ1-06, and the Japanese strain, CYN07-hV. The H gene of CDV-TM-CC shows low identity (90.4 % nt and 88.9 % aa) with the H gene of the classical Onderstepoort vaccine strain, which may explain the inability of the Tibetan Mastiff to mount a protective immune response. We also performed a comprehensive phylogenetic analysis of the N, P, and F protein sequences, as well as potential N-glycosylation sites and cysteine residues. This analysis shows that an N-glycosylation site at aa 108-110 within the F protein of CDV-TM-CC is specific for the wild-type strains (5804P, A75/17, and 164071) and the Asia-1 group strains, and may be another important factor for the poor immune response. These results provide important information for the design of CD vaccines in the China region and elsewhere.
Goh, Chin Fei; Tay, Karen
2010-01-01
The birth of low-cost carriers (LCC) in recent years, have added a new dimension to the aviation business, especially in Asia. There have been several success stories of these LCCs, compared with conventional full-serviced carriers. Two renowned airlines in Asia, Air Asia and Singapore Airlines have been chosen as our sample companies for the purpose of this research paper. Air Asia will represent the LCC segment, while Singapore Airlines is the proxy for traditional carriers. These two class...
Jin, Liya; Zhang, Xiaojian
2017-04-01
High-resolution and precisely dated speleothem oxygen isotope (δ18O) records from Asia have provided key evidence for past monsoonal changes. It is found that δ18O records of stalagmites from Kesang Cave (42°52'N, 81°45'E, Xinjiang, China) in inland central Asia were very similar to those from Qunf Cave (17°10'N, 54°18'E, southern Oman) in South Asia, shifting from light to heavy throughout the Holocene, which was regarded as a signal that strong Asian summer monsoon (ASM) may have intruded into the Kesang Cave site and/or adjacent areas in inland central Asia to produce heavy rainfall during the high insolation times (e.g. the early Holocene). However, this is in contrast to conclusions based on other Holocene proxy records and modeling simulations, showing a persistent wetting trend in arid central Asia during the Holocene with a dryer condition in the early Holocene and the wettest condition in the late Holocene. With an analysis of model-proxy data comparison, we revealed a possible physical mechanism responsible for the Holocene evolution of moisture/precipitation in Asian summer monsoon (ASM)-dominated regions and that in the inland central Asia. It is revealed that a recurrent circumglobal teleconnection (CGT) pattern in the summertime mid-latitude circulation of the Northern Hemisphere was closely related to the ASM and the climate of inland central Asia, acting as a bridge linking the ASM to insolation, high-latitude forcing (North Atlantic sea surface temperature (SST)), and low-latitude forcing (tropical Ocean SST). Also, the CGT influence speleothem δ18O values in South Asia via its effect on the amount of precipitation. In addition, the moisture source from the Indian Ocean is associated with relatively high δ18O values compared with that from the North Atlantic Ocean, leading to increased precipitation δ18O values. Hence, the CGT has probably been the key factor responsible for the in-phase relationship in speleothem δ18O values (Kesang Cave
Characterization of Sunn hemp begomovirus and its geographical ...
African Journals Online (AJOL)
Thus, it is concluded that the recombinant CP genes related to begomoviruses are evolved from the Indian isolates, causing broad host specificity and molecular diversity among the related begomoviruses across the geographical limits of Southeast Asia. Keywords: Begomovirus, sunn hemp, coat protein, recombination, ...
International Nuclear Information System (INIS)
2007-01-01
The Australian Uranium Association reports that Asia is the only region in the world where electricity generating capacity and specifically nuclear power is growing significantly. In East and South Asia, there are over 109 nuclear power reactors in operation, 18 under construction and plans to build about a further 100. The greatest growth in nuclear generation is expected in China, Japan, South Korea and India. As a member of the SE Asian community, Australia cannot afford to ignore the existence and growth of nuclear power generation on its door step, even if it has not, up to now, needed to utilise this power source
Heart failure as a general pandemic in Asia.
Shimokawa, Hiroaki; Miura, Masanobu; Nochioka, Kotaro; Sakata, Yasuhiko
2015-09-01
Heart failure (HF) is an epidemic in healthcare worldwide, including Asia. It appears that HF will become more serious in the near future, with the epidemiological transition and ageing of the population. However, in contrast to Western countries, information on HF epidemiology is still limited in Asia, particularly in South Asia. In this review, we will briefly summarize available information regarding the current and future burden of HF in Asia, which indicates the importance of both primary prevention of underlying diseases of HF and secondary prevention, including management of ischaemic HF, HF with preserved EF, and HF in the elderly. © 2015 The Authors European Journal of Heart Failure © 2015 European Society of Cardiology.
Evolution of the clinical trial landscape in Asia Pacific
Directory of Open Access Journals (Sweden)
Yathindranath S
2014-07-01
Full Text Available Shourav Yathindranath,1 Amar Kureishi,2 Simranjit Singh,3 Spencer Yeow,3 Grace Geng,4 Karen Wai,1 Audrey Ho,1 Elvira Zenaida Lansang,1 Ken J Lee5 1Feasibility and Site Identification Asia, 2Drug Development Asia, 3Strategic Planning Asia, Quintiles East Asia Private Limited, Singapore; 4People’s Republic of China Site Services, Quintiles, Beijing, People’s Republic of China; 5Asia Site Services, Quintiles East Asia Private Limited, Singapore Introduction: Asia Pacific has and continues to be one of the fastest-growing pharmaceutical markets in the world. This growth has a carry-over effect of driving pharmaceutical research and development investment in the region. Coupled with this, there have been multiple initiatives conducted by governments and other research focused organizations and societies in the region to help support this growth in research. In this report, we discuss the latest developments in pharmaceutical research and development in Asia Pacific and how these various initiatives have made an impact. Methods: An extensive search of the major clinical trial registries, along with the literature and Internet review of the recent developments in clinical trials, was performed comparing two time periods – 2009–2010 and 2011–2012. Results: In overall numbers, the clinical trial industry in Asia Pacific has remained stable when comparing the two time periods, with stable volumes of clinical trial numbers and site numbers. However, on closer inspection, a dynamic change in geography, nature, and therapeutic areas of the trials being conducted is observed. Japan, South Korea, People’s Republic of China, and Taiwan continue to be major clinical trial destinations. Developing countries, such as Indonesia, Vietnam, and Philippines, have seen rising standards of living and medical care; this is starting to impact their contribution to trials. Also, there are an increasing number of local trials in Asia Pacific with a bigger role
United States interests in South Asia
2009-12-11
Gulf of Malacca in the 10 Bhupinder Singh , ―The Indian Ocean and regional Security‖ (Punjab: B.C...Qaida in Afghanistan. Swati Parashar of the South Asian Analysis Group says that, US led anti terrorist operations cannot exclude South Asia...23 Swati Parashar, ―The U.S and South Asia: From Tactical Security Relationship Towards a Strategic Partnership,‖ 2006, http
The US Pivot Towards Asia-Pacific
DEFF Research Database (Denmark)
Ulrich, Philip Christian
An analysis of the US new Asia-Pacific strategy. The brief seeks to set the new strategy in the context of American foreign policy since the end of the Cold War.......An analysis of the US new Asia-Pacific strategy. The brief seeks to set the new strategy in the context of American foreign policy since the end of the Cold War....
MAPA DE LOS CONFLICTOS DE ASIA
Directory of Open Access Journals (Sweden)
Javier Gil Pérez
2011-01-01
Full Text Available El autor muestra los principales focos de conflicto y tensión en una región, Asia-Pacífico, que está llamada a liderar políticamente y económicamente el mundo. Este presente siglo es el siglo de Asia y por ello los conflictos mostrados son el principal obstáculo para que Asia ostente el poder hegemónico en el futuro. La situación de inestabilidad en Pakistán y su vecina Afganistán y la evolución económica de China y su relación con sus vecinos regionales determinará la evolución de esta región estratégica.
The present state of social science research in Asia
Lieten, G.K.
2014-01-01
The first pan-Asia conference ‘Status and Role of Social Science Research in Asia, Emerging Challenges and Policy Issues’ (New Delhi, 13-15 March 2014), with representatives from 24 countries in Asia and some non-Asian countries, was intended to assess the present state of social science research in
Lee, Seo-Jin; Lee, Mu-Yeong; Lin, Liang-Kong; Lin, Y Kirk; Li, Yuchun; Shin, E-Hyun; Han, Sang-Hoon; Min, Mi-Sook; Lee, Hang; Kim, Kyung Seok
2018-04-01
Many peninsulas in the temperate zone played an important role as refugia of various flora and fauna, and the southern Korean Peninsula also served as a refugium for many small mammals in East Asia during the Pleistocene. The Asian lesser white-toothed shrew, Crocidura shantungensis, is a widely distributed species in East Asia, and is an appropriate model organism for exploring the role of the Korean Peninsula as a refugium of small mammals. Here, we investigated phylogenetic relationships and genetic diversity based on the entire sequence of the mitochondrial cytochrome b gene (1140 bp). A Bayesian tree for 98 haplotypes detected in 228 C. shantungensis specimens from East Asia revealed the presence of three major groups with at least 5 subgroups. Most haplotypes were distributed according to their geographic proximity. Pairwise F ST 's and analysis of molecular variance (AMOVA) revealed a high degree of genetic differentiation and variance among regions as well as among populations within region, implying little gene flow among local populations. Genetic evidence from South Korean islands, Jeju-do Island of South Korea, and Taiwan leads us to reject the hypothesis of recent population expansion. We observed unique island-type genetic characteristics consistent with geographic isolation and resultant genetic drift. Phylogeographic inference, together with estimates of genetic differentiation and diversity, suggest that the southern most part the Korean Peninsula, including offshore islands, played an important role as a refugium for C. shantungensis during the Pleistocene. However, the presence of several refugia on the mainland of northeast Asia is also proposed.
Zhao, Yongda; Guo, Lili; Li, Jie; Huang, Xianhui; Fang, Binghu
2018-01-01
Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase ( gyrA and gyrB ) and topoisomerase IV ( parC and parE ). The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%), levofloxacin (20.28%), norfloxacin (22.38%), ciprofloxacin (23.78%), however, high resistance levels were found to nalidixic acid (82.52%) and enrofloxacin (55.94%). In addition, we found 14 antimicrobial resistance genes were present in these isolates, including bla TEM-1 , bla ROB-1 , ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3')-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes ( tetB, tetC, flor, rmtB, sul1 ). The genes tetB , rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G) were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target gene mutations. These data provide novel
Gcebe, Nomakorinte; Rutten, Victor; Pittius, Nicolaas Gey van; Naicker, Brendon; Michel, Anita
2017-04-01
Non-tuberculous mycobacteria (NTM) are ubiquitous in the environment, and an increasing number of NTM species have been isolated and characterized from both humans and animals, highlighting the zoonotic potential of these bacteria. Host exposure to NTM may impact on cross-reactive immune responsiveness, which may affect diagnosis of bovine tuberculosis and may also play a role in the variability of the efficacy of Mycobacterium bovis BCG vaccination against tuberculosis. In this study we characterized 10 NTM isolates originating from water, soil, nasal swabs of cattle and African buffalo as well as bovine tissue samples. These isolates were previously identified during an NTM survey and were all found, using 16S rRNA gene sequence analysis to be closely related to Mycobacterium moriokaense. A polyphasic approach that included phenotypic characterization, antibiotic susceptibility profiling, mycolic acid profiling and phylogenetic analysis of four gene loci, 16S rRNA, hsp65, sodA and rpoB, was employed to characterize these isolates. Sequence data analysis of the four gene loci revealed that these isolates belong to a unique species of the genus Mycobacterium. This evidence was further supported by several differences in phenotypic characteristics between the isolates and the closely related species. We propose the name Mycobacterium malmesburyense sp. nov. for this novel species. The type strain is WCM 7299T (=ATCC BAA-2759T=CIP 110822T).
Chau, Tran Thuy; Campbell, James Ian; Galindo, Claudia M.; van Minh Hoang, Nguyen; Diep, To Song; Nga, Tran Thu Thi; van Vinh Chau, Nguyen; Tuan, Phung Quoc; Page, Anne Laure; Ochiai, R. Leon; Schultsz, Constance; Wain, John; Bhutta, Zulfiqar A.; Parry, Christopher M.; Bhattacharya, Sujit K.; Dutta, Shanta; Agtini, Magdarina; Dong, Baiqing; Honghui, Yang; Anh, Dang Duc; Canh, Do Gia; Naheed, Aliya; Albert, M. John; Phetsouvanh, Rattanaphone; Newton, Paul N.; Basnyat, Buddha; Arjyal, Amit; La, Tran Thi Phi; Rang, Nguyen Ngoc; Phuong, Le Thi; van Be Bay, Phan; von Seidlein, Lorenz; Dougan, Gordon; Clemens, John D.; Vinh, Ha; Hien, Tran Tinh; Chinh, Nguyen Tran; Acosta, Camilo J.; Farrar, Jeremy; Dolecek, Christiane
2007-01-01
This study describes the pattern and extent of drug resistance in 1,774 strains of Salmonella enterica serovar Typhi isolated across Asia between 1993 and 2005 and characterizes the molecular mechanisms underlying the reduced susceptibilities to fluoroquinolones of these strains. For 1,393 serovar
Social Movements in Southeast Asia and Latin America
Iqra Anugrah; Department of Political Science, Northern Illinois University
2014-01-01
"Three recent works provide a timely update on the contemporary landscape of social movements in Southeast Asia and Latin America. These works are also relevant for broader theoretical discussions on social movements and provide a basis for future inter-regional comparative studies." (author's abstract). Review of: 1. Ford, Michele (ed.): Social Activism in Southeast Asia. Series: Routledge Contemporary Southeast Asia. London, New York: Routledge 2013. ISBN 978-0-415-63059-7. 2. Petras, James...
China's Soft Power Diplomacy in Southeast Asia
DEFF Research Database (Denmark)
Schmidt, Johannes Dragsbæk
2008-01-01
The paper analyses the new geo-political and geo-economic strategic relationship between China and Southeast Asia. Is Chinese soft power encroachment into Southeast Asia creating greater stability, does it jeopardize US interests and what is the impact on the regime-types, economic restructuring...
Asia and Europe, knowledge economies in encounter
Marien van den Boom; Dr. Daan Andriessen
2006-01-01
With the rise of the knowledge-based economy in Asia, Western-dominated organizational literature is being exported to Asian countries. There is a huge interest from businesses and universities in China, Korea, Taiwan, Indonesia, Malaysia, Singapore, and other countries in Asia and the Middle-East
Future technology needs for enhancing food availability and nutrition in Asia
International Nuclear Information System (INIS)
Ahloowalia, B.S.
2002-01-01
The increased food production during the past 50 years in Asia has not solved the problem of food availability and its access to large sections of the population. In addition, the nutritional level of the consumed food is highly inadequate to meet the daily requirements of minerals and vitamins. No doubt, the national policies on price support and subsidies for increasing food production and procurement have had a motor influence on access to food. However, the infrastructures for increasing storage capacity, prevent food wastage, and enhance food quality have not kept with the increased food production and its equitable access to the low income groups. The malnutrition of the poor, especially among children and women, remains a challenge to the policy makers and scientists alike. The building of food storage capacity at the village level and adoption of nuclear techniques to store grains under minimal insect and fungal infestation would cut down losses and enhance grain quality. Breeding new varieties of staple food grains (rice, wheat, maize and mallets), vegetables and fruits with enhanced minerals, vitamins and their bio-availability is seen as a complementary approach to food diversification to reduce malnutrition. Conventional breeding assisted by induced mutations, tissue culture, gene insertion and molecular gene modification holds promise to enhance food nutrition. However, the adoption of the appropriate combination of technologies is essential to enhance food availability and nutrition in Asia. Unfortunately, transgenic approach is seen by many as the only option or many times the major solution to enhance food access and its quality. It is often forgotten that a yardstick has many markings, each of which is important to reach the goal. (Author)
Security in the Asia Pacific region
International Nuclear Information System (INIS)
1999-01-01
The Working Group began by discussing the meaning of security in terms of its comprehensive, cooperative and human dimensions. In doing so, the members of the Group focused on major issues which could endanger regional stability and non-proliferation. In order to identify the major problems and sources of tension, it was agreed that the Group would concentrate on two sub-regions, namely, East Asia and South East Asia and then to compare these briefly with South Asia and Latin America, the aim being to identify common security concerns. The discussion was framed in terms of: (i) evaluating the adequacy of the existing institutional framework for security cooperation; (ii) evaluating linkages between economic development and security; and (iii) seeking ways to reduce tension and to increase security in the region. Discussion was focused on the broad subject of security risks and challenges as well as opportunities for effective cooperative security in the Asia Pacific region. Attention was devoted to ways of changing Cold War mentalities, which still hinder the normalization process and the achievement of comprehensive security cooperation among the countries in the region
Maughan, P J; Turner, T B; Coleman, C E; Elzinga, D B; Jellen, E N; Morales, J A; Udall, J A; Fairbanks, D J; Bonifacio, A
2009-07-01
Salt tolerance is an agronomically important trait that affects plant species around the globe. The Salt Overly Sensitive 1 (SOS1) gene encodes a plasma membrane Na+/H+ antiporter that plays an important role in germination and growth of plants in saline environments. Quinoa (Chenopodium quinoa Willd.) is a halophytic, allotetraploid grain crop of the family Amaranthaceae with impressive nutritional content and an increasing worldwide market. Many quinoa varieties have considerable salt tolerance, and research suggests quinoa may utilize novel mechanisms to confer salt tolerance. Here we report the cloning and characterization of two homoeologous SOS1 loci (cqSOS1A and cqSOS1B) from C. quinoa, including full-length cDNA sequences, genomic sequences, relative expression levels, fluorescent in situ hybridization (FISH) analysis, and a phylogenetic analysis of SOS1 genes from 13 plant taxa. The cqSOS1A and cqSOS1B genes each span 23 exons spread over 3477 bp and 3486 bp of coding sequence, respectively. These sequences share a high level of similarity with SOS1 homologs of other species and contain two conserved domains, a Nhap cation-antiporter domain and a cyclic-nucleotide binding domain. Genomic sequence analysis of two BAC clones (98 357 bp and 132 770 bp) containing the homoeologous SOS1 genes suggests possible conservation of synteny across the C. quinoa sub-genomes. This report represents the first molecular characterization of salt-tolerance genes in a halophytic species in the Amaranthaceae as well as the first comparative analysis of coding and non-coding DNA sequences of the two homoeologous genomes of C. quinoa.
Directory of Open Access Journals (Sweden)
Jong-Oh Kim
2017-01-01
Full Text Available Grouper is one of the favorite sea food resources in Southeast Asia. However, the outbreaks of the viral nervous necrosis (VNN disease due to nervous necrosis virus (NNV infection have caused mass mortality of grouper larvae. Many aqua-farms have suffered substantial financial loss due to the occurrence of VNN. To better understand the infection mechanism of NNV, we performed the transcriptome analysis of sevenband grouper brain tissue, the main target of NNV infection. After artificial NNV challenge, transcriptome of brain tissues of sevenband grouper was subjected to next generation sequencing (NGS using an Illumina Hi-seq 2500 system. Both mRNAs from pooled samples of mock and NNV-infected sevenband grouper brains were sequenced. Clean reads of mock and NNV-infected samples were de novo assembled and obtained 104,348 unigenes. In addition, 628 differentially expressed genes (DEGs in response to NNV infection were identified. This result could provide critical information not only for the identification of genes involved in NNV infection, but for the understanding of the response of sevenband groupers to NNV infection.
Directory of Open Access Journals (Sweden)
Marek Ostaszewski
Full Text Available The impact of gene silencing on cellular phenotypes is difficult to establish due to the complexity of interactions in the associated biological processes and pathways. A recent genome-wide RNA knock-down study both identified and phenotypically characterized a set of important genes for the cell cycle in HeLa cells. Here, we combine a molecular interaction network analysis, based on physical and functional protein interactions, in conjunction with evolutionary information, to elucidate the common biological and topological properties of these key genes. Our results show that these genes tend to be conserved with their corresponding protein interactions across several species and are key constituents of the evolutionary conserved molecular interaction network. Moreover, a group of bistable network motifs is found to be conserved within this network, which are likely to influence the network stability and therefore the robustness of cellular functioning. They form a cluster, which displays functional homogeneity and is significantly enriched in genes phenotypically relevant for mitosis. Additional results reveal a relationship between specific cellular processes and the phenotypic outcomes induced by gene silencing. This study introduces new ideas regarding the relationship between genotype and phenotype in the context of the cell cycle. We show that the analysis of molecular interaction networks can result in the identification of genes relevant to cellular processes, which is a promising avenue for future research.
Berka, Randy M.; Rey, Michael W.; Brown, Kimberly M.; Byun, Tony; Klotz, Alan V.
1998-01-01
The phyA gene encoding an extracellular phytase from the thermophilic fungus Thermomyces lanuginosus was cloned and heterologously expressed, and the recombinant gene product was biochemically characterized. The phyA gene encodes a primary translation product (PhyA) of 475 amino acids (aa) which includes a putative signal peptide (23 aa) and propeptide (10 aa). The deduced amino acid sequence of PhyA has limited sequence identity (ca. 47%) with Aspergillus niger phytase. The phyA gene was inserted into an expression vector under transcriptional control of the Fusarium oxysporum trypsin gene promoter and used to transform a Fusarium venenatum recipient strain. The secreted recombinant phytase protein was enzymatically active between pHs 3 and 7.5, with a specific activity of 110 μmol of inorganic phosphate released per min per mg of protein at pH 6 and 37°C. The Thermomyces phytase retained activity at assay temperatures up to 75°C and demonstrated superior catalytic efficiency to any known fungal phytase at 65°C (the temperature optimum). Comparison of this new Thermomyces catalyst with the well-known Aspergillus niger phytase reveals other favorable properties for the enzyme derived from the thermophilic gene donor, including catalytic activity over an expanded pH range. PMID:9797301
Iwanaga, Masashi; Kurihara, Masaaki; Kobayashi, Masahiko; Kang, WonKyung
2002-05-25
All lepidopteran baculovirus genomes sequenced to date encode a homolog of the Bombyx mori nucleopolyhedrovirus (BmNPV) orf68 gene, suggesting that it performs an important role in the virus life cycle. In this article we describe the characterization of BmNPV orf68 gene. Northern and Western analyses demonstrated that orf68 gene was expressed as a late gene and encoded a structural protein of budded virus (BV). Immunohistochemical analysis by confocal microscopy showed that ORF68 protein was localized mainly in the nucleus of infected cells. To examine the function of orf68 gene, we constructed orf68 deletion mutant (BmD68) and characterized it in BmN cells and larvae of B. mori. BV production was delayed in BmD68-infected cells. The larval bioassays also demonstrated that deletion of orf68 did not reduce the infectivity, but mutant virus took 70 h longer to kill the host than wild-type BmNPV. In addition, dot-blot analysis showed viral DNA accumulated more slowly in mutant infected cells. Further examination suggested that BmD68 was less efficient in entry and budding from cells, although it seemed to possess normal attachment ability. These results suggest that ORF68 is a BV-associated protein involved in secondary infection from cell-to-cell. (c) 2002 Elsevier Science (USA).
Dynamics of Corporate Social Responsibility in Asia
DEFF Research Database (Denmark)
Kim, Rebecca Chunghee; Moon, Jeremy
2015-01-01
This article investigates Corporate Social Responsibility (CSR) in Asia through two related themes: research knowledge and ethical norms. ‘CSR in Asia’ research is shown to be growing, particularly in East Asia. Compared with Western CSR literature, it is shown to be dominated by empirical, parti...
Directory of Open Access Journals (Sweden)
Xiao-Lu Xu
2015-03-01
Full Text Available Bursaphelenchus xylophilus, the causal agent of pine wilt disease, causes huge economic losses in pine forests. The high expression of cytochrome P450 genes in B. xylophilus during infection in P. thunbergii indicated that these genes had a certain relationship with the pathogenic process of B. xylophilus. Thus, we attempted to identify the molecular characterization and functions of cytochrome P450 genes in B. xylophilus. In this study, full-length cDNA of three cytochrome P450 genes, BxCYP33C9, BxCYP33C4 and BxCYP33D3 were first cloned from B. xylophilus using 3' and 5' RACE PCR amplification. Sequence analysis showed that all of them contained a highly-conserved cytochrome P450 domain. The characteristics of the three putative proteins were analyzed with bioinformatic methods. RNA interference (RNAi was used to assess the functions of BxCYP33C9, BxCYP33C4 and BxCYP33D3. The results revealed that these cytochrome P450 genes were likely to be associated with the vitality, dispersal ability, reproduction, pathogenicity and pesticide metabolism of B. xylophilus. This discovery confirmed the molecular characterization and functions of three cytochrome P450 genes from B. xylophilus and provided fundamental information in elucidating the molecular interaction mechanism between B. xylophilus and its host plant.
Atmospheric pollutant outflow from southern Asia: a review
Lawrence, M. G.; Lelieveld, J.
2010-11-01
Southern Asia, extending from Pakistan and Afghanistan to Indonesia and Papua New Guinea, is one of the most heavily populated regions of the world. Biofuel and biomass burning play a disproportionately large role in the emissions of most key pollutant gases and aerosols there, in contrast to much of the rest of the Northern Hemisphere, where fossil fuel burning and industrial processes tend to dominate. This results in polluted air masses which are enriched in carbon-containing aerosols, carbon monoxide, and hydrocarbons. The outflow and long-distance transport of these polluted air masses is characterized by three distinct seasonal circulation patterns: the winter monsoon, the summer monsoon, and the monsoon transition periods. During winter, the near-surface flow is mostly northeasterly, and the regional pollution forms a thick haze layer in the lower troposphere which spreads out over millions of square km between southern Asia and the Intertropical Convergence Zone (ITCZ), located several degrees south of the equator over the Indian Ocean during this period. During summer, the heavy monsoon rains effectively remove soluble gases and aerosols. Less soluble species, on the other hand, are lifted to the upper troposphere in deep convective clouds, and are then transported away from the region by strong upper tropospheric winds, particularly towards northern Africa and the Mediterranean in the tropical easterly jet. Part of the pollution can reach the tropical tropopause layer, the gateway to the stratosphere. During the monsoon transition periods, the flow across the Indian Ocean is primarily zonal, and strong pollution plumes originating from both southeastern Asia and from Africa spread across the central Indian Ocean. This paper provides a review of the current state of knowledge based on the many observational and modeling studies over the last decades that have examined the southern Asian atmospheric pollutant outflow and its large scale effects. An outlook
Coal marketing in Asia: Opportunities and challenges
International Nuclear Information System (INIS)
Klingner, D.
1996-01-01
In Asia, coal currently accounts for over 40 percent of the fossil fuel used for commercial energy. This paper briefly surveys the forces that are likely to decide the future role coal will play as a prime source of energy in the vigorous economies of Asia. As Australia is well placed to profit from Asia's growing need for coal, the challenge to Australian coal suppliers is how to maximize its potential contribution. Four-fifths of all new coal fired electrical generating capacity in the world in the next decade will be located in Asia. Three-quarters of Australia's coal exports are to Asian customers and, conversely, 40 percent of Asian imports are from Australia. Australian coal suppliers have established ties and a depth of marketing experience in the region on which to build. However, pricing policies, and the emergence of the private power producers, together with environmental pressures, will present challenges for the future. (author). 1 fig
Cloning and characterization of the human integrin β6 gene promoter.
Directory of Open Access Journals (Sweden)
Mingyan Xu
Full Text Available The integrin β6 (ITGB6 gene, which encodes the limiting subunit of the integrin αvβ6 heterodimer, plays an important role in wound healing and carcinogenesis. The mechanism underlying ITGB6 regulation, including the identification of DNA elements and cognate transcription factors responsible for basic transcription of human ITGB6 gene, remains unknown. This report describes the cloning and characterization of the human ITGB6 promoter. Using 5'-RACE (rapid amplification of cDNA ends analysis, the transcriptional initiation site was identified. Promoter deletion analysis identified and functionally validated a TATA box located in the region -24 to -18 base pairs upstream of the ITGB6 promoter. The regulatory elements for transcription of the ITGB6 gene were predominantly located -289 to -150 from the ITGB6 promoter and contained putative binding sites for transcription factors such as STAT3 and C/EBPα. Using chromatin immunoprecipitation assays, this study has demonstrated, for the first time, that transcription factors STAT3 and C/EBPα are involved in the positive regulation of ITGB6 transcription in oral squamous cell carcinoma cells. These findings have important implications for unraveling the mechanism of abnormal ITGB6 activation in tissue remodeling and tumorigenesis.
Advancing Evaluation Theory and Practice in South Asia ...
International Development Research Centre (IDRC) Digital Library (Canada)
Advancing Evaluation Theory and Practice in South Asia: Community of ... evidence-based policy development, decision-making, and practice in South Asia. ... International Water Resources Association, in close collaboration with IDRC, ...
Hunter-gatherers in southeast Asia: from prehistory to the present.
Higham, Charles
2013-01-01
Anatomically modern hunter-gatherers expanded from Africa into Southeast Asia at least 50,000 years ago, where they probably encountered and interacted with populations of Homo erectus and Homo floresiensis and the recently discovered Denisovans. Simulation studies suggest that these hunter-gatherers may well have followed a coastal route that ultimately led to the settlement of Sahul, while archaeology confirms that they also crossed significant seas and explored well into the interior. They also adapted to marked environmental changes that alternated between relatively cool and dry conditions and warmer, wetter interludes. During the former, the sea fell by up to 120 m below its present level, which opened up a vast low-lying area known as Sundaland. Three principal alignments can be identified: the first involved the occupation of rock shelters in upland regions, the second has identified settlement on broad riverine floodplains, and the last concentrated on the raised beaches formed from about five millennia ago when the sea level was elevated above its present position. This cultural sequence was dislocated about 4 kya when rice and millet farmers infiltrated the lowlands of Southeast Asia ultimately from the Yangtze River valley. It is suggested that this led to two forms of interaction. In the first, the indigenous hunter-gatherers integrated with intrusive Neolithic communities and, while losing their cultural identity, contributed their genes to the present population of Southeast Asia. In the second, hunter-gatherers withdrew to rainforest refugia and, through selective pressures inherent in such an environment, survived as the small-bodied, dark-skinned humans found to this day in the Philippines, Peninsular Malaysia and Thailand, and the Andaman Islands. Beyond the impact of expansive rice farmers in Melanesia and Australia, hunter-gatherers continued to dominate until they encountered European settlement. Copyright © 2013 Wayne State University Press
Alteration of rRNA gene copy number and expression in patients ...
African Journals Online (AJOL)
Irina S. Kolesnikova
2017-09-01
Sep 1, 2017 ... Asia R. Shorina d, Alexander S. Graphodatsky a, Ekaterina M. Galanina b, Dmitry V. Yudkin a,b,* ... rRNA gene copy numbers on affected acrocentric chromosomes in .... estimated using MS Excel software (Microsoft, USA).
Policy trends of strategic environmental assessment in Asia
International Nuclear Information System (INIS)
Victor, Dennis; Agamuthu, P.
2014-01-01
Highlights: • SEA policy trends in Asia indicate a proliferation of SEA legislation. • Primary SEA problem is its limited integration in strategic decision making. • Notable SEA progress is the emerging awareness on the need for SEA. • Main SEA prospects is in international regional cooperation on SEA. • SEA paradigm shift requires linkages of structural and non-structural policy instruments. - Abstract: This paper provides an overview on the policy trends of strategic environmental assessment (SEA) in Asia. SEA is promoted as a system of incorporating environmental considerations into policies, plans and programmes (PPP). SEA has evolved from an alternative of environmental impact assessments (EIA) to a potential environmental policy integration (EPI) tool in national policy planning. Nevertheless, SEA trends in Asia require a re-examination on its role and effectiveness to avoid SEA implementation in Asia mimicking SEA developments in Europe without customizing its application to local conditions in Asia. Policy trends of SEA in Asia indicate that it is currently an important environmental policy consideration for countries in the region with the formulation of SEA legislations in Hong Kong, China, South Korea, Taiwan, Vietnam and Indonesia. Nevertheless, SEA implementation also has been impeded by challenges in realizing practical SEA public participation especially in countries with traditionally high cultural power distance dynamics such as China, Indonesia and Vietnam. Meanwhile, countries such as Japan and Pakistan have voluntarily implemented SEA elements such as public participation without legislative provisions while countries such as Thailand, Philippines, Bangladesh and Sri Lanka are resisting the adoption of SEA. The primary problem of SEA implementation in Asia has been its limited integration in strategic decision making due to the highly political nature of policy planning framed within the cultural context of Asian countries. Notable
Directory of Open Access Journals (Sweden)
Angireddy Rajesh
Full Text Available The cysteine rich prostate and testis expressed (Pate proteins identified till date are thought to resemble the three fingered protein/urokinase-type plasminogen activator receptor proteins. In this study, for the first time, we report the identification, cloning and characterization of rat Pate gene cluster and also determine the expression pattern. The rat Pate genes are clustered on chromosome 8 and their predicted proteins retained the ten cysteine signature characteristic to TFP/Ly-6 protein family. PATE and PATE-F three dimensional protein structure was found to be similar to that of the toxin bucandin. Though Pate gene expression is thought to be prostate and testis specific, we observed that rat Pate genes are also expressed in seminal vesicle and epididymis and in tissues beyond the male reproductive tract. In the developing rats (20-60 day old, expression of Pate genes seem to be androgen dependent in the epididymis and testis. In the adult rat, androgen ablation resulted in down regulation of the majority of Pate genes in the epididymides. PATE and PATE-F proteins were found to be expressed abundantly in the male reproductive tract of rats and on the sperm. Recombinant PATE protein exhibited potent antibacterial activity, whereas PATE-F did not exhibit any antibacterial activity. Pate expression was induced in the epididymides when challenged with LPS. Based on our results, we conclude that rat PATE proteins may contribute to the reproductive and defense functions.
Machado, Vilmar; Serrano, Jose; Galián, Jose
2016-01-01
The fall armyworm (Spodoptera frugiperda, Noctuidae, Lepidoptera) is one of the most important crop pests in the Americas, causing significant damage to maize, rice and sorghum. The mechanisms that determine its defences against pathogens are particularly relevant for the development of management and control strategies. We used an in silico approach to identify and characterize pathogen response genes (repat) present in different tissue libraries of S. fugiperda. The analyses revealed complete cDNA for nine repat genes; of these, repat15 and repat39 were found in libraries from a specific tissue--the midgut of larvae fed with xenobiotic substances. High expression levels of some genes were found in different libraries: 39 hits in repat30 in challenged hemocytes, 16 hits in repat31 in fat body, 10 hits in repat32 in fat body and 10 in challenged hemocytes, and 10 hits in repat38 in midgut of non-treated larvae and midgut of larvae fed with natural and xenobiotic substances. The genes corresponded to two ontology categories, stress response and immune response, and their phylogenetic relationships, nucleotide similarity, number of amino acid residues and molecular weights agree with what has been described for repat genes. It is noteworthy that proteins encoded by the repat genes of S. frugiperda have important defence functions in other tissues beyond midgut and that their functional categories are likely diverse, as they are related to cell envelope structure, energy metabolism, transport and binding.
Gao, J; Naglich, J G; Laidlaw, J; Whaley, J M; Seizinger, B R; Kley, N
1995-02-15
The human von Hippel-Lindau disease (VHL) gene has recently been identified and, based on the nucleotide sequence of a partial cDNA clone, has been predicted to encode a novel protein with as yet unknown functions [F. Latif et al., Science (Washington DC), 260: 1317-1320, 1993]. The length of the encoded protein and the characteristics of the cellular expressed protein are as yet unclear. Here we report the cloning and characterization of a mouse gene (mVHLh1) that is widely expressed in different mouse tissues and shares high homology with the human VHL gene. It predicts a protein 181 residues long (and/or 162 amino acids, considering a potential alternative start codon), which across a core region of approximately 140 residues displays a high degree of sequence identity (98%) to the predicted human VHL protein. High stringency DNA and RNA hybridization experiments and protein expression analyses indicate that this gene is the most highly VHL-related mouse gene, suggesting that it represents the mouse VHL gene homologue rather than a related gene sharing a conserved functional domain. These findings provide new insights into the potential organization of the VHL gene and nature of its encoded protein.
Cloning and functional characterization of the Rvi15 (Vr2) gene for apple scab resistance
Schouten, H.J.; Brinkhuis, J.; Burgh, van der S.; Schaart, J.; Groenwold, R.; Broggini, G.A.L.; Gessler, C.
2014-01-01
Apple scab, caused by Venturia inaequalis, is a serious disease of apple. Previously, the scab resistance Rvi15 (Vr2) from the accession GMAL 2473 was genetically mapped, and three candidate resistance genes were identified. Here, we report the cloning and functional characterization of these three
How Nuclear South Asia is Like Cold War Europe:
DEFF Research Database (Denmark)
Cohen, Michael David
2013-01-01
Conventional wisdom states that the stability-instability paradox does not explain the effect of nuclear proliferation on the conflict propensity of South Asia and that nuclear weapons have had a different and more dangerous impact in South Asia than Cold War Europe. I argue that the paradox...... Europe and South Asia. Pakistani President Pervez Musharraf may have adopted more moderate foreign policy towards India after experiencing fear of imminent nuclear war during the ten month mobilised crisis in 2002 as Nikita Khrushchev did forty years earlier. I argue that the stability-instability...... explains nuclear South Asia, that the similarities between nuclear South Asia and Cold War Europe are strong, and that conventional instability does not cause revisionist challenges in the long run. I develop and probe a psychological causal mechanism that explains the impact of nuclear weapons on Cold War...
Social Movements in Southeast Asia and Latin America
Directory of Open Access Journals (Sweden)
Iqra Anugrah
2014-01-01
Full Text Available Three recent works – Social Activism in Southeast Asia, Social Movements in Latin America: Neoliberalism and Popular Resistance, and Southeast Asia and the Civil Society Gaze: Scoping a Contested Concept in Cambodia and Vietnam – provide a timely update on the contemporary landscape of social movements in Southeast Asia and Latin America. These works are also relevant for broader theoretical discussions on social movements and provide a basis for future inter-regional comparative studies.
Is Long-Term Food Insecurity Inevitable in Asia
Cuesta, Jose
2014-01-01
This article questions two widely accepted claims on long-term food insecurity in Asia, the world's (heterogeneous) region with the largest number of undernourished individuals. The first claim is that food production may not grow as fast as the pace of population growth in Asia, which will reach 5 billion by 2050. The second claim is that an unstoppable emergence of a middle class in Asia will dramatically change the composition of food demand. On the first claim, the region's contribution t...
Genome-wide identification and characterization of the SBP-box gene family in Petunia.
Zhou, Qin; Zhang, Sisi; Chen, Feng; Liu, Baojun; Wu, Lan; Li, Fei; Zhang, Jiaqi; Bao, Manzhu; Liu, Guofeng
2018-03-12
SQUAMOSA PROMOTER BINDING PROTEIN (SBP)-box genes encode a family of plant-specific transcription factors (TFs) that play important roles in many growth and development processes including phase transition, leaf initiation, shoot and inflorescence branching, fruit development and ripening etc. The SBP-box gene family has been identified and characterized in many species, but has not been well studied in Petunia, an important ornamental genus. We identified 21 putative SPL genes of Petunia axillaris and P. inflata from the reference genome of P. axillaris N and P. inflata S6, respectively, which were supported by the transcriptome data. For further confirmation, all the 21 genes were also cloned from P. hybrida line W115 (Mitchel diploid). Phylogenetic analysis based on the highly conserved SBP domains arranged PhSPLs in eight groups, analogous to those from Arabidopsis and tomato. Furthermore, the Petunia SPL genes had similar exon-intron structure and the deduced proteins contained very similar conserved motifs within the same subgroup. Out of 21 PhSPL genes, fourteen were predicted to be potential targets of PhmiR156/157, and the putative miR156/157 response elements (MREs) were located in the coding region of group IV, V, VII and VIII genes, but in the 3'-UTR regions of group VI genes. SPL genes were also identified from another two wild Petunia species, P. integrifolia and P. exserta, based on their transcriptome databases to investigate the origin of PhSPLs. Phylogenetic analysis and multiple alignments of the coding sequences of PhSPLs and their orthologs from wild species indicated that PhSPLs were originated mainly from P. axillaris. qRT-PCR analysis demonstrated differential spatiotemperal expression patterns of PhSPL genes in petunia and many were expressed predominantly in the axillary buds and/or inflorescences. In addition, overexpression of PhSPL9a and PhSPL9b in Arabidopsis suggested that these genes play a conserved role in promoting the vegetative
International Nuclear Information System (INIS)
Leslie, G.B.
1995-01-01
Respiratory disease and mortality due to indoor air pollution are amongst the greatest environmental threats to health in the developing countries of Asia. World-wide, acute respiratory infection is the cause of death of at least 5 million children under the age of 5 every year. The World Bank has claimed that smoke from biomass fuels resulted in an estimated 4 million deaths annually amongst infants and children. Most of these deaths occur in developing countries. Combustion in its various forms must head the list of pollution sources in Asia. Combustion of various fuels for domestic heating, lighting and cooking comprises the major source of internally generated pollutants and combustion in industrial plants, power generation and transportation is the major cause of externally generated pollutants. The products of pyrolysis and combustion include many compounds with well-known adverse health effects. These include gases such as CO, CO 2 , NO x and SO 2 , volatile organic compounds such as polynuclear aromatic hydrocarbons and nitroamines as well as respirable particulates of variable composition. The nature and magnitude of the health risks posed by these materials vary with season, climate, location housing, method of ventilation, culture and socio-economic status. The most important cause of lung cancer in non-smokers in Northern Asia is the domestic combustion of smoky coal. Acute carbon monoxide poisoning is common in many Asian countries. Roads traffic exhaust pollution is worse in the major cities of South East Asia than almost anywhere else in the world and this externally generated air pollution forms the indoor air for the urban poor. Despite all these major problems there has been a tendency for international agencies to focus attention and resources on the more trivial problems of indoor air encountered in the affluent countries of the West. Regulatory agencies in Asia have been too frequently persuaded that their problems of indoor air pollution are
Directory of Open Access Journals (Sweden)
Bissell MJ
2006-03-01
Full Text Available Abstract Background Ensemble attribute profile clustering is a novel, text-based strategy for analyzing a user-defined list of genes and/or proteins. The strategy exploits annotation data present in gene-centered corpora and utilizes ideas from statistical information retrieval to discover and characterize properties shared by subsets of the list. The practical utility of this method is demonstrated by employing it in a retrospective study of two non-overlapping sets of genes defined by a published investigation as markers for normal human breast luminal epithelial cells and myoepithelial cells. Results Each genetic locus was characterized using a finite set of biological properties and represented as a vector of features indicating attributes associated with the locus (a gene attribute profile. In this study, the vector space models for a pre-defined list of genes were constructed from the Gene Ontology (GO terms and the Conserved Domain Database (CDD protein domain terms assigned to the loci by the gene-centered corpus LocusLink. This data set of GO- and CDD-based gene attribute profiles, vectors of binary random variables, was used to estimate multiple finite mixture models and each ensuing model utilized to partition the profiles into clusters. The resultant partitionings were combined using a unanimous voting scheme to produce consensus clusters, sets of profiles that co-occured consistently in the same cluster. Attributes that were important in defining the genes assigned to a consensus cluster were identified. The clusters and their attributes were inspected to ascertain the GO and CDD terms most associated with subsets of genes and in conjunction with external knowledge such as chromosomal location, used to gain functional insights into human breast biology. The 52 luminal epithelial cell markers and 89 myoepithelial cell markers are disjoint sets of genes. Ensemble attribute profile clustering-based analysis indicated that both lists
In silico and in situ characterization of the zebrafish (Danio rerio gnrh3 (sGnRH gene
Directory of Open Access Journals (Sweden)
Husebye Harald
2002-08-01
Full Text Available Abstract Background Gonadotropin releasing hormone (GnRH is responsible for stimulation of gonadotropic hormone (GtH in the hypothalamus-pituitary-gonadal axis (HPG. The regulatory mechanisms responsible for brain specificity make the promoter attractive for in silico analysis and reporter gene studies in zebrafish (Danio rerio. Results We have characterized a zebrafish [Trp7, Leu8] or salmon (s GnRH variant, gnrh3. The gene includes a 1.6 Kb upstream regulatory region and displays the conserved structure of 4 exons and 3 introns, as seen in other species. An in silico defined enhancer at -976 in the zebrafish promoter, containing adjacent binding sites for Oct-1, CREB and Sp1, was predicted in 2 mammalian and 5 teleost GnRH promoters. Reporter gene studies confirmed the importance of this enhancer for cell specific expression in zebrafish. Interestingly the promoter of human GnRH-I, known as mammalian GnRH (mGnRH, was shown capable of driving cell specific reporter gene expression in transgenic zebrafish. Conclusions The characterized zebrafish Gnrh3 decapeptide exhibits complete homology to the Atlantic salmon (Salmo salar GnRH-III variant. In silico analysis of mammalian and teleost GnRH promoters revealed a conserved enhancer possessing binding sites for Oct-1, CREB and Sp1. Transgenic and transient reporter gene expression in zebrafish larvae, confirmed the importance of the in silico defined zebrafish enhancer at -976. The capability of the human GnRH-I promoter of directing cell specific reporter gene expression in zebrafish supports orthology between GnRH-I and GnRH-III.
International Nuclear Information System (INIS)
1996-01-01
The Asia region has experienced a period of dynamic growth, both of economies and energy demand. The next fifteen years are likely to see further rapid economic growth in Asia. To fuel this growth energy consumption will also increase rapidly. Of all forms of energy, natural gas demand is likely to grow the fastest. The gas sector will face rapid and dramatic change, creating challenges for the governments of the region. Infrastructure, both for export and domestic consumption of gas, will need to expand significantly. Regional trade in natural gas could triple by 2010. Trade will continue to be dominated by liquefied natural gas (LNG) but pipeline exports will also grow rapidly. Investment needs will be large, putting pressure on governments to look for alternative funding mechanisms. As Asian gas transmission and distribution networks expand and become more interconnected, consumer choice becomes possible. How to encourage and regulate competition will become a vital policy question. As gas consumption increases both in absolute terms, and in terms of its share of energy consumption within particular sectors of the economy (for example, as a fuel for power generation), governments will need to give higher priority to policies dealing with gas security. This study examines the current and possible future role of natural gas in Asia. In particular, it examines in detail the relevant energy policies of six of the key gas producing and consuming economies in the region: Brunei-Darussalam, Chinese Taipei, Indonesia, the Republic of Korea, Malaysia and Thailand. (author). 17 figs., 14 tabs., 7 appends
Indonesia's Transformation and the Stability of Southeast Asia
National Research Council Canada - National Science Library
Rabasa, Angel
2001-01-01
... and straits, Indonesia is the key to Southeast Asian security. Therefore, Indonesia's choices and its evolution will frame the future of Southeast Asia and influence the balance of power in the broader Asia-Pacific region...
South Asia | Page 192 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Although economic growth has reduced poverty in much of Asia, rural and ... These pressures strain the infrastructure and fray human relations, ultimately hampering development. ... Our regional office for Asia is located in New Delhi, India.
South Asia | Page 191 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Although economic growth has reduced poverty in much of Asia, rural and ... These pressures strain the infrastructure and fray human relations, ultimately hampering development. ... Our regional office for Asia is located in New Delhi, India.
South Asia | Page 195 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Although economic growth has reduced poverty in much of Asia, rural and ... These pressures strain the infrastructure and fray human relations, ultimately hampering development. ... Our regional office for Asia is located in New Delhi, India.
Far East Asia | Page 182 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Although economic growth has reduced poverty in much of Asia, rural and ... These pressures strain the infrastructure and fray human relations, ultimately hampering development. ... Our regional office for Asia is located in New Delhi, India.
Directory of Open Access Journals (Sweden)
Junhua Li
2014-01-01
Full Text Available Meiosis is essential for plant reproduction because it is the process during which homologous chromosome pairing, synapsis, and meiotic recombination occur. The meiotic transcriptome is difficult to investigate because of the size of meiocytes and the confines of anther lobes. The recent development of isolation techniques has enabled the characterization of transcriptional profiles in male meiocytes of Arabidopsis. Gene expression in male meiocytes shows unique features. The direct interaction of transcription factors (TFs with DNA regulatory sequences forms the basis for the specificity of transcriptional regulation. Here, we identified putative cis-regulatory elements (CREs associated with male meiocyte-expressed genes using in silico tools. The upstream regions (1 kb of the top 50 genes preferentially expressed in Arabidopsis meiocytes possessed conserved motifs. These motifs are putative binding sites of TFs, some of which share common functions, such as roles in cell division. In combination with cell-type-specific analysis, our findings could be a substantial aid for the identification and experimental verification of the protein-DNA interactions for the specific TFs that drive gene expression in meiocytes.
Delgado, María J; Tresierra-Ayala, Alvaro; Talbi, Chouhra; Bedmar, Eulogio J
2006-01-01
A modABC gene cluster that encodes an ABC-type, high-affinity molybdate transporter from Bradyrhizobium japonicum has been isolated and characterized. B. japonicum modA and modB mutant strains were unable to grow aerobically or anaerobically with nitrate as nitrogen source or as respiratory substrate, respectively, and lacked nitrate reductase activity. The nitrogen-fixing ability of the mod mutants in symbiotic association with soybean plants grown in a Mo-deficient mineral solution was severely impaired. Addition of molybdate to the bacterial growth medium or to the plant mineral solution fully restored the wild-type phenotype. Because the amount of molybdate required for suppression of the mutant phenotype either under free-living or under symbiotic conditions was dependent on sulphate concentration, it is likely that a sulphate transporter is also involved in Mo uptake in B. japonicum. The promoter region of the modABC genes has been characterized by primer extension. Reverse transcription and expression of a transcriptional fusion, P(modA)-lacZ, was detected only in a B. japonicum modA mutant grown in a medium without molybdate supplementation. These findings indicate that transcription of the B. japonicum modABC genes is repressed by molybdate.
Directory of Open Access Journals (Sweden)
Gong Xia
2012-10-01
Full Text Available Abstract Background Interest in cellulose degrading enzymes has increased in recent years due to the expansion of the cellulosic biofuel industry. The rumen is a highly adapted environment for the degradation of cellulose and a promising source of enzymes for industrial use. To identify cellulase enzymes that may be of such use we have undertaken a functional metagenomic screen to identify cellulase enzymes from the bacterial community in the rumen of a grass-hay fed dairy cow. Results Twenty five clones specifying cellulose activity were identified. Subcloning and sequence analysis of a subset of these hydrolase-positive clones identified 10 endoglucanase genes. Preliminary characterization of the encoded cellulases was carried out using crude extracts of each of the subclones. Zymogram analysis using carboxymethylcellulose as a substrate showed a single positive band for each subclone, confirming that only one functional cellulase gene was present in each. One cellulase gene, designated Cel14b22, was expressed at a high level in Escherichia coli and purified for further characterization. The purified recombinant enzyme showed optimal activity at pH 6.0 and 50°C. It was stable over a broad pH range, from pH 4.0 to 10.0. The activity was significantly enhanced by Mn2+ and dramatically reduced by Fe3+ or Cu2+. The enzyme hydrolyzed a wide range of beta-1,3-, and beta-1,4-linked polysaccharides, with varying activities. Activities toward microcrystalline cellulose and filter paper were relatively high, while the highest activity was toward Oat Gum. Conclusion The present study shows that a functional metagenomic approach can be used to isolate previously uncharacterized cellulases from the rumen environment.
Sentinel Asia step 2 utilization for disaster management in Malaysia
International Nuclear Information System (INIS)
Moslin, S I; Wahap, N A; Han, O W
2014-01-01
With the installation of Wideband InterNetworking engineering test and Demonstration Satellite (WINDS) communication system in the National Space Centre, Banting; officially Malaysia is one of the twelve Sentinel Asia Step2 System Regional Servers in the Asia Pacific region. The system will be dedicated to receive and deliver images of disaster struck areas observed by Asia Pacific earth observation satellites by request of the Sentinel Asia members via WINDS satellite or 'Kizuna'. Sentinel Asia is an initiative of collaboration between space agencies and disaster management agencies, applying remote sensing and web-GIS technologies to assist disaster management in Asia Pacific. When a disaster occurred, participating members will make an Emergency Observation Request (EOR) to the Asian Disaster Reduction Centre (ADRC). Subsequently, the Data Provider Node (DPN) will execute the emergency observation using the participating earth observation satellites. The requested images then will be processed and analysed and later it will be uploaded on the Sentinel Asia website to be utilised for disaster management and mitigation by the requestor and any other international agencies related to the disaster. Although the occurrences of large scale natural disasters are statistically seldom in Malaysia, but we can never be sure with the unpredictable earth climate nowadays. This paper will demonstrate the advantage of using Sentinel Asia Step2 for local disaster management. Case study will be from the recent local disaster occurrences. In addition, this paper also will recommend a local disaster management support system by using the Sentinel Asia Step2 facilities in ANGKASA
Knowledge Production with Asia-Centric Research Methodology
Park, Jae
2017-01-01
Taiwanese cultural critic Kuan-Hsing Chen has elaborated and promoted an "Asia and the rest" worldview for over a decade. His "opus magnum" "Asia as Method" argues for a paradigm shift to observe Asian reality with a de-imperialized, de-colonized, and de-Cold War mentality. The work has produced academic discussions…
Risks of nuclear crisis in Asia
International Nuclear Information System (INIS)
Grand, Camille
2015-01-01
The author first recalls the history of the emergence of a nuclear Asia, its evolution during and after the Cold War. As Asia appears to be a region combining phenomena of proliferation and of arms race, the author outlines the multiple possibilities of emergence of a nuclear crisis in this region: possibility of conflict between Pakistan and India, the unpredictable behaviour of North Korea, a crisis between China and Taiwan or China and Japan that might result in a US commitment. The author then identifies some peculiarities of Asian nuclear challenges: a context of arms race with rather opaque nuclear postures and doctrines of Asian countries, development of antimissile capacities and of autonomous ballistic programmes in different Asian countries, project of development of anti satellite weapons by China. For all that, nuclear deterrence appears not to be surely operative in Asia
Dengue in the Americas and Southeast Asia: do they differ?
Scott B. Halstead
2006-01-01
The populations of Southeast Asia (SE Asia) and tropical America are similar, and all four dengue viruses of Asian origin are endemic in both regions. Yet, during comparable 5-year periods, SE Asia experienced 1.16 million cases of dengue hemorrhagic fever (DHF), principally in children, whereas in the Americas there were 2.8 million dengue fever (DF) cases, principally in adults, and only 65 000 DHF cases. This review aims to explain these regional differences. In SE Asia, World War II ampli...
Directory of Open Access Journals (Sweden)
Yongda Zhao
2018-04-01
Full Text Available Background Haemophilus parasuis is a common porcine respiratory pathogen that causes high rates of morbidity and mortality in farmed swine. We performed a molecular characterization of antimicrobial resistance genes harbored by H. parasuis from pig farms in China. Methods We screened 143 H. parasuis isolates for antimicrobial susceptibility against six fluoroquinolone antibiotics testing by the broth microdilution method, and the presence of 64 antimicrobial resistance genes by PCR amplification and DNA sequence analysis. We determined quinolone resistance determining region mutations of DNA gyrase (gyrA and gyrB and topoisomerase IV (parC and parE. The genetic relatedness among the strains was analyzed by pulsed-field gel electrophoresis. Results Susceptibility test showed that all isolates were low resistance to lomefloxacin (28.67%, levofloxacin (20.28%, norfloxacin (22.38%, ciprofloxacin (23.78%, however, high resistance levels were found to nalidixic acid (82.52% and enrofloxacin (55.94%. In addition, we found 14 antimicrobial resistance genes were present in these isolates, including blaTEM-1, blaROB-1, ermB, ermA, flor, catl, tetB, tetC, rmtB, rmtD, aadA1, aac(3′-llc, sul1, and sul2 genes. Interestingly, one isolate carried five antibiotic resistance genes (tetB, tetC, flor, rmtB, sul1. The genes tetB, rmtB, and flor were the most prevalent resistance genes in H. parasuis in China. Alterations in the gyrA gene (S83F/Y, D87Y/N/H/G were detected in 81% of the strains and parC mutations were often accompanied by a gyrA mutation. Pulsed-field gel electrophoresis typing revealed 51 unique patterns in the isolates carrying high-level antibiotic resistance genes, indicating considerable genetic diversity and suggesting that the genes were spread horizontally. Discussion The current study demonstrated that the high antibiotic resistance of H. parasuis in piglets is a combination of transferable antibiotic resistance genes and multiple target
The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes
Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas
2018-01-01
Abstract The world’s smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development. PMID:29684203
The Most Developmentally Truncated Fishes Show Extensive Hox Gene Loss and Miniaturized Genomes.
Malmstrøm, Martin; Britz, Ralf; Matschiner, Michael; Tørresen, Ole K; Hadiaty, Renny Kurnia; Yaakob, Norsham; Tan, Heok Hui; Jakobsen, Kjetill Sigurd; Salzburger, Walter; Rüber, Lukas
2018-04-01
The world's smallest fishes belong to the genus Paedocypris. These miniature fishes are endemic to an extreme habitat: the peat swamp forests in Southeast Asia, characterized by highly acidic blackwater. This threatened habitat is home to a large array of fishes, including a number of miniaturized but also developmentally truncated species. Especially the genus Paedocypris is characterized by profound, organism-wide developmental truncation, resulting in sexually mature individuals of <8 mm in length with a larval phenotype. Here, we report on evolutionary simplification in the genomes of two species of the dwarf minnow genus Paedocypris using whole-genome sequencing. The two species feature unprecedented Hox gene loss and genome reduction in association with their massive developmental truncation. We also show how other genes involved in the development of musculature, nervous system, and skeleton have been lost in Paedocypris, mirroring its highly progenetic phenotype. Further, our analyses suggest two mechanisms responsible for the genome streamlining in Paedocypris in relation to other Cypriniformes: severe intron shortening and reduced repeat content. As the first report on the genomic sequence of a vertebrate species with organism-wide developmental truncation, the results of our work enhance our understanding of genome evolution and how genotypes are translated to phenotypes. In addition, as a naturally simplified system closely related to zebrafish, Paedocypris provides novel insights into vertebrate development.
The association of polymorphic sites in some genes with type 1 ...
African Journals Online (AJOL)
Ahmed A. El-Kafoury
2014-06-23
Jun 23, 2014 ... low risk countries. ... The type 1 diabetes risk gene loci paced over the genome. ... and 185 bp, lane 2 represents heterozygous GA genotype as G allele PCR products cleaved by Fast Digest® ..... in Europe, America, and Asia.
Cloning and characterization of the ONAC106 gene from Oryza sativa cultivar Kuku Belang
Basri, Khairunnisa; Sukiran, Noor Liyana; Zainal, Zamri
2016-11-01
Plants possess different mechanisms in stress response, where induction of stress-responsive genes provides tolerance to unfavorable conditions. Stress-responsive genes are characterized for functional and regulatory genes that help in overcoming stress by molecular, biochemical and morphological adaptations. NAC transcription factors are one of the regulatory proteins that involved in stress signaling pathway. A putative NAC transcription factor, ONAC016 was identified from drought transcriptomic data. Our data suggested that ONAC106 was induced by drought, but its function in abiotic stress is still unclear. In silico analysis of ONAC106 showed that this gene encodes 334 amino acids, and its protein consists of NAM (No Apical Meristem) domain. The orthologue of ONAC106 was present in several Poaceae family members, suggesting that ONAC106 is unique to monocot plants only. We found that ONAC106 was induced by salt and cold stresses, indicating that this gene involves in abiotic stress response. In addition, we also found that ONAC106 might function in defense response to pathogen invasion. The ABRE (Abscisic Acid Regulatory Element) cis-element was identified in the promoter region of ONAC106, suggesting that it may involve in the abscisic acid (ABA)-dependent signaling pathway. Based on this preliminary result, we hypothesize that ONAC106 may play a role in abiotic stress response by regulating ABA-responsive genes.
Global warming and allergy in Asia Minor.
Bajin, Munir Demir; Cingi, Cemal; Oghan, Fatih; Gurbuz, Melek Kezban
2013-01-01
The earth is warming, and it is warming quickly. Epidemiological studies have demonstrated that global warming is correlated with the frequency of pollen-induced respiratory allergy and allergic diseases. There is a body of evidence suggesting that the prevalence of allergic diseases induced by pollens is increasing in developed countries, a trend that is also evident in the Mediterranean area. Because of its mild winters and sunny days with dry summers, the Mediterranean area is different from the areas of central and northern Europe. Classical examples of allergenic pollen-producing plants of the Mediterranean climate include Parietaria, Olea and Cupressaceae. Asia Minor is a Mediterranean region that connects Asia and Europe, and it includes considerable coastal areas. Gramineae pollens are the major cause of seasonal allergic rhinitis in Asia Minor, affecting 1.3-6.4 % of the population, in accordance with other European regions. This article emphasizes the importance of global climate change and anticipated increases in the prevalence and severity of allergic disease in Asia Minor, mediated through worsening air pollution and altered local and regional pollen production, from an otolaryngologic perspective.
Büsse, Sebastian; von Grumbkow, Philipp; Hummel, Susanne; Shah, Deep Narayan; Tachamo Shah, Ram Devi; Li, Jingke; Zhang, Xueping; Yoshizawa, Kazunori; Wedmann, Sonja; Hörnschemeyer, Thomas
2012-01-01
Unusual biogeographic patterns of closely related groups reflect events in the past, and molecular analyses can help to elucidate these events. While ample research on the origin of disjunct distributions of different organism groups in the Western Paleartic has been conducted, such studies are rare for Eastern Palearctic organisms. In this paper we present a phylogeographic analysis of the disjunct distribution pattern of the extant species of the strongly cool-adapted Epiophlebia dragonflies from Asia. We investigated sequences of the usually more conserved 18 S rDNA and 28 S rDNA genes and the more variable sequences of ITS1, ITS2 and CO2 of all three currently recognised Epiophlebia species and of a sample of other odonatan species. In all genes investigated the degrees of similarity between species of Epiophlebia are very high and resemble those otherwise found between different populations of the same species in Odonata. This indicates that substantial gene transfer between these populations occurred in the comparatively recent past. Our analyses imply a wide distribution of the ancestor of extant Epiophlebia in Southeast Asia during the last ice age, when suitable habitats were more common. During the following warming phase, its range contracted, resulting in the current disjunct distribution. Given the strong sensitivity of these species to climatic parameters, the current trend to increasing global temperatures will further reduce acceptable habitats and seriously threaten the existences of these last representatives of an ancient group of Odonata. PMID:22666462
Functional Characterization of 4´OMT and 7OMT Genes in BIA Biosynthesis
Directory of Open Access Journals (Sweden)
Tugba eGurkok
2016-02-01
Full Text Available Alkaloids are diverse group of secondary metabolites generally found in plants. Opium poppy (Papaver somniferum L., the only commercial source of morphinan alkaloids, has been used as a medicinal plant since ancient times. It produces benzylisoquinoline alkaloids (BIA including the narcotic analgesic morphine, the muscle relaxant papaverine, and the anti-cancer agent noscapine. Though BIAs play crucial roles in many biological mechanisms their steps in biosynthesis and the responsible genes remain to be revealed. In this study, expressions of 3-hydroxy-N-methylcoclaurine 4´-O-methyltransferase (4´OMT and reticuline 7-O-methyltransferase (7OMT genes were subjected tomanipulation to functionally characterize their roles in BIA biosynthesis. Measurements of alkaloid accumulation were performed in leaf, stem and capsule tissues accordingly. Suppression of 4´OMT expression caused reduction in the total alkaloid content in stem tissue whereas total alkaloid content was significantly induced in the capsule. Silencing of the 7OMT gene also caused repression in total alkaloid content in the stem. On the other hand, over-expression of 4´OMT and 7OMT resulted in higher morphine accumulation in the stem but suppressed amount in the capsule. Moreover, differential expression in several BIA synthesis genes (CNMT, TYDC, 6OMT, SAT, COR, 4´OMT and 7OMT were observed upon manipulation of 4´OMT and 7OMT expression. Upon silencing and overexpression applications, tissue specific effects of these genes were identified. Manipulation of 4´OMT and 7OMT genes caused differentiated accumulation of BIAs including morphine and noscapine in capsule and stem tissues.
Far East Asia | Page 88 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
... has shown that, as more and more people go online in Asia, digital privacy is increasingly ... An IDRC-funded project in Asia found that distance education can be as ... education in delivering quality teaching and a good learning experience.
Latin America second only to Asia in petrochemical prospects
International Nuclear Information System (INIS)
Krenek, M.R.
1995-01-01
The opportunity in Asia for petrochemical companies generally is well known among global players in the industry. Conventional wisdom dictates that most companies at least consider investing in Asia, and for good reason, in most cases. The more aggressive, growth-oriented companies, however, already are attempting to discover the ''next Asia,'' if there is such a thing. Latin America has been nominated as one of the less developed regions that might inherit the Asia/Pacific region's enviable position. This nomination, however, was made before the Mexican financial crisis and the burgeoning pressure on the currencies of Brazil and Argentina. In light of current events, can Latin America still be considered the next Asia, and, if so, what opportunities will follow the devaluation of the Mexican peso? An analysis of the economic and political factors affecting the petrochemical industry in Latin America indicates that the region still hold excellent prospects for petrochemical companies
Poswar, Fabiano de Oliveira; Farias, Lucyana Conceição; Fraga, Carlos Alberto de Carvalho; Bambirra, Wilson; Brito-Júnior, Manoel; Sousa-Neto, Manoel Damião; Santos, Sérgio Henrique Souza; de Paula, Alfredo Maurício Batista; D'Angelo, Marcos Flávio Silveira Vasconcelos; Guimarães, André Luiz Sena
2015-06-01
Bioinformatics has emerged as an important tool to analyze the large amount of data generated by research in different diseases. In this study, gene expression for radicular cysts (RCs) and periapical granulomas (PGs) was characterized based on a leader gene approach. A validated bioinformatics algorithm was applied to identify leader genes for RCs and PGs. Genes related to RCs and PGs were first identified in PubMed, GenBank, GeneAtlas, and GeneCards databases. The Web-available STRING software (The European Molecular Biology Laboratory [EMBL], Heidelberg, Baden-Württemberg, Germany) was used in order to build the interaction map among the identified genes by a significance score named weighted number of links. Based on the weighted number of links, genes were clustered using k-means. The genes in the highest cluster were considered leader genes. Multilayer perceptron neural network analysis was used as a complementary supplement for gene classification. For RCs, the suggested leader genes were TP53 and EP300, whereas PGs were associated with IL2RG, CCL2, CCL4, CCL5, CCR1, CCR3, and CCR5 genes. Our data revealed different gene expression for RCs and PGs, suggesting that not only the inflammatory nature but also other biological processes might differentiate RCs and PGs. Copyright © 2015 American Association of Endodontists. Published by Elsevier Inc. All rights reserved.
Pedagogical Approaches and Strategies for Teaching Asia
Chau, Donovan C.
2014-01-01
Asia today is the center of tremendous growth. With the continued rise of China and the influential roles of Japan and South Korea in international affairs, it is no wonder that the 21st century has been dubbed the Asian century. Outside of these influential political actors, one also see the growing political significance of Southeast Asia in…
Gene Expression Music Algorithm-Based Characterization of the Ewing Sarcoma Stem Cell Signature
Directory of Open Access Journals (Sweden)
Martin Sebastian Staege
2016-01-01
Full Text Available Gene Expression Music Algorithm (GEMusicA is a method for the transformation of DNA microarray data into melodies that can be used for the characterization of differentially expressed genes. Using this method we compared gene expression profiles from endothelial cells (EC, hematopoietic stem cells, neuronal stem cells, embryonic stem cells (ESC, and mesenchymal stem cells (MSC and defined a set of genes that can discriminate between the different stem cell types. We analyzed the behavior of public microarray data sets from Ewing sarcoma (“Ewing family tumors,” EFT cell lines and biopsies in GEMusicA after prefiltering DNA microarray data for the probe sets from the stem cell signature. Our results demonstrate that individual Ewing sarcoma cell lines have a high similarity to ESC or EC. Ewing sarcoma cell lines with inhibited Ewing sarcoma breakpoint region 1-Friend leukemia virus integration 1 (EWSR1-FLI1 oncogene retained the similarity to ESC and EC. However, correlation coefficients between GEMusicA-processed expression data between EFT and ESC decreased whereas correlation coefficients between EFT and EC as well as between EFT and MSC increased after knockdown of EWSR1-FLI1. Our data support the concept of EFT being derived from cells with features of embryonic and endothelial cells.
SOUTHEAST ASIA: HISTORY, MODERNITY, AND RELIGIOUS CHANGE
Directory of Open Access Journals (Sweden)
Sumanto Al Qurtuby
2015-11-01
Full Text Available Southeast Asia or Southeastern Asia, with more than six hundred million populations, is home to millions of Buddhists, Muslims, Confucians, Protestants, Catholics, and now Pentecostals, as well as many followers of local religions and spiritual beliefs. Notwithstanding its great historical, political, cultural legacies, however, the region has long been neglected as a site for religious studies in the Western academia. Aiming at filling the gap in Asian and religious studies as well as exploring the richness of Southeast Asian cultures, this article discusses the dynamics, diversity, and complexity of Southeast Asian societies in their response to the region’s richly political, cultural, and religious traditions spanning from pre-modern era to modern one. The article also examines the “integrative revolutions” that shaped and reshaped warfare, state organization and economics of Southeast Asia, particularly in the pre-European colonial era. In addition, the work discusses the wave of Islamization, particularly since the nineteenth century, as well as the upsurge of religious resurgence that shift the nature of religiosity and the formation of religious groupings in the area. The advent of Islam, with some interventions of political regimes, had been an important cause for the decline of Hindu-Buddhist traditions in some areas of Southeast Asia, especially Indonesia, the coming of Pentecostalism has challenged the well-established mainstream Protestantism and Catholicism, especially in Indonesia and the Philippines. Keywords: history, modernity, religious change, Southeast Asia
Ruxrungtham, Kiat; Brown, Tim; Phanuphak, Praphan
HIV (ie, HIV-1) epidemics in Asia show great diversity, both in severity and timing. But epidemics in Asia are far from over and several countries including China, Indonesia, and Vietnam have growing epidemics. Several factors affect the rate and magnitude of growth of HIV prevalence, but two of the most important are the size of the sex worker population and the frequency with which commercial sex occurs. In view of the present state of knowledge, even countries with low prevalence of infection might still have epidemics affecting a small percentage of the population. Once HIV infection has become established, growing needs for care and treatment are unavoidable and even the so-called prevention-successful countries of Thailand and Cambodia are seeing burgeoning care needs. The manifestations of HIV disease in the region are discussed with the aim of identifying key issues in medical management and care of HIV/AIDS. In particular, issues relevant to developing appropriate highly active antiretroviral treatment programmes in the region are discussed. Although access to antiretroviral therapy is increasing globally, making it work effectively while simultaneously expanding prevention programmes to stem the flow of new infections remains a real challenge in Asia. Genuine political interest and commitment are essential foundations for success, demanding advocacy at all levels to drive policy, mobilise sufficient resources, and take effective action.
Allergic conjunctivitis in Asia.
Thong, Bernard Yu-Hor
2017-04-01
Allergic conjunctivitis (AC), which may be acute or chronic, is associated with rhinitis in 30%-70% of affected individuals, hence the term allergic rhinoconjunctivitis (AR/C). Seasonal and perennial AC is generally milder than the more chronic and persistent atopic and vernal keratoconjunctivitis. Natural allergens like house dust mites (HDM), temperate and subtropical grass and tree pollen are important triggers that drive allergic inflammation in AC in the Asia-Pacific region. Climate change, environmental tobacco smoke, pollutants derived from fuel combustion, Asian dust storms originating from central/north Asia and phthalates may also exacerbate AR/C. The Allergies in Asia Pacific study and International Study of Asthma and Allergies in Childhood provide epidemiological data on regional differences in AR/C within the region. AC significantly impacts the quality of life of both children and adults, and these can be measured by validated quality of life questionnaires on AR/C. Management guidelines for AC involve a stepped approach depending on the severity of disease, similar to that for allergic rhinitis and asthma. Topical calcineurin inhibitors are effective in certain types of persistent AC, and sublingual immunotherapy is emerging as an effective treatment option in AR/C to grass pollen and HDM. Translational research predominantly from Japan and Korea involving animal models are important for the potential development of targeted pharmacotherapies for AC.
Directory of Open Access Journals (Sweden)
Pratick Khara
2014-01-01
Full Text Available Sphingobium sp. PNB, like other sphingomonads, has multiple ring-hydroxylating oxygenase (RHO genes. Three different fosmid clones have been sequenced to identify the putative genes responsible for the degradation of various aromatics in this bacterial strain. Comparison of the map of the catabolic genes with that of different sphingomonads revealed a similar arrangement of gene clusters that harbors seven sets of RHO terminal components and a sole set of electron transport (ET proteins. The presence of distinctly conserved amino acid residues in ferredoxin and in silico molecular docking analyses of ferredoxin with the well characterized terminal oxygenase components indicated the structural uniqueness of the ET component in sphingomonads. The predicted substrate specificities, derived from the phylogenetic relationship of each of the RHOs, were examined based on transformation of putative substrates and their structural homologs by the recombinant strains expressing each of the oxygenases and the sole set of available ET proteins. The RHO AhdA1bA2b was functionally characterized for the first time and was found to be capable of transforming ethylbenzene, propylbenzene, cumene, p-cymene and biphenyl, in addition to a number of polycyclic aromatic hydrocarbons. Overexpression of aromatic catabolic genes in strain PNB, revealed by real-time PCR analyses, is a way forward to understand the complex regulation of degradative genes in sphingomonads.
This paper presents the first study describing the isolation, cloning and characterization of a full length gene encoding Bowman-Birk protease inhibitor (RbTI) from rice bean (Vigna umbellata). A full-length protease inhibitor gene with complete open reading frame of 327bp encoding 109 amino acids w...
He, Xiu; He, Zheng-Bo; Zhang, Yu-Juan; Zhou, Yong; Xian, Peng-Jie; Qiao, Liang; Chen, Bin
2016-06-01
Anopheles sinensis is a major malaria vector. Insect odorant-binding proteins (OBPs) may function in the reception of odorants in the olfactory system. The classification and characterization of the An. sinensis OBP genes have not been systematically studied. In this study, 64 putative OBP genes were identified at the whole-genome level of An. sinensis based on the comparison between OBP conserved motifs, PBP_GOBP, and phylogenetic analysis with An. gambiae OBPs. The characterization of An. sinensis OBPs, including the motif's conservation, gene structure, genomic organization and classification, were investigated. A new gene, AsOBP73, belonging to the Plus-C subfamily, was identified with the support of transcript and conservative motifs. These An. sinensis OBP genes were classified into three subfamilies with 37, 15 and 12 genes in the subfamily Classic, Atypical and Plus-C, respectively. The genomic organization of An. sinensis OBPs suggests a clustered distribution across nine different scaffolds. Eight genes (OBP23-28, OBP63-64) might originate from a single gene through a series of historic duplication events at least before divergence of Anopheles, Culex and Aedes. The microsynteny analyses indicate a very high synteny between An. sinensis and An. gambiae OBPs. OBP70 and OBP71 earlier classified under Plus-C in An. gambiae are recognized as belonging to the group Obp59a of the Classic subfamily, and OBP69 earlier classified under Plus-C has been moved to the Atypical subfamily in this study. The study established a basic information frame for further study of the OBP genes in insects as well as in An. sinensis. © 2016 Institute of Zoology, Chinese Academy of Sciences.
A study of the frequency of methylation of gene promoter regions in ...
Indian Academy of Sciences (India)
2013-04-02
Apr 2, 2013 ... colorectal cancer in the Taiwanese population. CHANG-CHIEH WU1 ... hypermethylation of promoter-region CpG islands is an important ... mismatch repair gene MLH1 plays an important role in dele- ..... Asia Pac. J. Clin.
Martínez-del Campo, Ana; Bodea, Smaranda; Hamer, Hilary A; Marks, Jonathan A; Haiser, Henry J; Turnbaugh, Peter J; Balskus, Emily P
2015-04-14
Elucidation of the molecular mechanisms underlying the human gut microbiota's effects on health and disease has been complicated by difficulties in linking metabolic functions associated with the gut community as a whole to individual microorganisms and activities. Anaerobic microbial choline metabolism, a disease-associated metabolic pathway, exemplifies this challenge, as the specific human gut microorganisms responsible for this transformation have not yet been clearly identified. In this study, we established the link between a bacterial gene cluster, the choline utilization (cut) cluster, and anaerobic choline metabolism in human gut isolates by combining transcriptional, biochemical, bioinformatic, and cultivation-based approaches. Quantitative reverse transcription-PCR analysis and in vitro biochemical characterization of two cut gene products linked the entire cluster to growth on choline and supported a model for this pathway. Analyses of sequenced bacterial genomes revealed that the cut cluster is present in many human gut bacteria, is predictive of choline utilization in sequenced isolates, and is widely but discontinuously distributed across multiple bacterial phyla. Given that bacterial phylogeny is a poor marker for choline utilization, we were prompted to develop a degenerate PCR-based method for detecting the key functional gene choline TMA-lyase (cutC) in genomic and metagenomic DNA. Using this tool, we found that new choline-metabolizing gut isolates universally possessed cutC. We also demonstrated that this gene is widespread in stool metagenomic data sets. Overall, this work represents a crucial step toward understanding anaerobic choline metabolism in the human gut microbiota and underscores the importance of examining this microbial community from a function-oriented perspective. Anaerobic choline utilization is a bacterial metabolic activity that occurs in the human gut and is linked to multiple diseases. While bacterial genes responsible for
Radon-222 in boundary layer and free tropospheric continental outflow events at three ACE-Asia sites
International Nuclear Information System (INIS)
Zahorowski, Wlodek; Chambers, Scott; Wang Tao
2005-01-01
A 1-year record of hourly atmospheric radon-222 concentration observations at three ACE-Asia network sites Hok Tsui (Hong Kong), Gosan (Jeju Island) and Mauna Loa Observatory (Hawaii) is presented and discussed. The observations include the spring 2001 ACE-Asia intensive operation period. Site locations were chosen for the experimental characterization of both boundary layer (Hok Tsui, Gosan) and free tropospheric (Mauna Loa) continental outflow to the Pacific. A significant seasonal variability in background radon concentration is quantified at each site with the ratios of winter maximum to summer minimum background of 96, 15 and 3 for Hok Tsui, Gosan and Mauna Loa, respectively. Only during summer were background radon concentrations directly comparable with unperturbed marine values (20 mBq/m 3 ). The variability in radon signal was characterized at each site on diurnal to seasonal timescales. The seasonal variability in fetch regions for air masses experiencing the greatest and smallest terrestrial influence was characterized using 10-day back trajectories of air masses corresponding to radon concentrations higher (lower) than the 90th (10th) percentile value. The trajectory analyses for Hok Tsui and Gosan, as well as a direct analysis of the experimental results, further supports the previously postulated existence of a strong spatial heterogeneity in the radon source strength in East Asia. Back trajectories of free tropospheric air masses reaching Mauna Loa indicated source regions deep within the Asian continent primarily between 20 and 40 deg N. This fetch region is different from that influencing the Hok Tsui and Gosan sites. The radon concentration of air masses reaching Mauna Loa was shown to vary seasonally as well as with latitude of the predominant fetch region. Possible mechanisms of this phenomenon have been identified and include (a) seasonal variation in the radon source, (b) seasonal variation in the strength, frequency and/or efficiency of
Biogeography and evolution of the Carassius auratus-complex in East Asia
Directory of Open Access Journals (Sweden)
Iguchi Kei'ichiro
2010-01-01
Full Text Available Abstract Background Carassius auratus is a primary freshwater fish with bisexual diploid and unisexual gynogenetic triploid lineages. It is distributed widely in Eurasia and is especially common in East Asia. Although several genetic studies have been conducted on C. auratus, they have not provided clear phylogenetic and evolutionary descriptions of this fish, probably due to selection bias in sampling sites and the DNA regions analysed. As the first step in clarifying the evolutionary entity of the world's Carassius fishes, we attempted to clarify the phylogeny of C. auratus populations distributed in East Asia. Results We conducted a detailed analysis of a large dataset of mitochondrial gene sequences [CR, 323 bp, 672 sequences (528 sequenced + 144 downloaded; CR + ND4 + ND5 + cyt b, 4669 bp in total, 53 sequences] obtained from C. auratus in East Asia. Our phylogeographic analysis revealed two superlineages, one distributed mainly among the Japanese main islands and the other in various regions in and around the Eurasian continent, including the Ryukyus and Taiwan. The two superlineages include seven lineages with high regional specificity that are composed of endemic populations indigenous to each region. The divergence time of the seven lineages was estimated to be 0.2 million years ago (Mya by a fossil-based method and 1.0-1.9 Mya by the molecular clock method. The antiquity and endemism of these lineages suggest that they are native to their respective regions, although some seem to have been affected by the artificial introduction of C. auratus belonging to other lineages. Triploids of C. auratus did not form a monophyletic lineage but were clustered mostly with sympatric diploids. Conclusions The results of the present study revealed the existence of two superlineages of C. auratus in East Asia that include seven lineages endemic to each of the seven regions examined. The lack of substantial genetic separation between triploids and
Use of Metarhizium anisopliae Chitinase Genes for Genotyping and Virulence Characterization
Directory of Open Access Journals (Sweden)
Saliou Niassy
2013-01-01
Full Text Available Virulence is the primary factor used for selection of entomopathogenic fungi (EPF for development as biopesticides. To understand the genetic mechanisms underlying differences in virulence of fungal isolates on various arthropod pests, we compared the chitinase genes, chi2 and chi4, of 8 isolates of Metarhizium anisopliae. The clustering of the isolates showed various groups depending on their virulence. However, the analysis of their chitinase DNA sequences chi2 and chi4 did not reveal major divergences. Although their protein translates have been implicated in fungal virulence, the predicted protein structure of chi2 was identical for all isolates. Despite the critical role of chitin digestion in fungal infection, we conclude that chi2 and chi4 genes cannot serve as molecular markers to characterize observed variations in virulence among M. anisopliae isolates as previously suggested. Nevertheless, processes controlling the efficient upregulation of chitinase expression might be responsible for different virulence characteristics. Further studies using comparative “in vitro” chitin digestion techniques would be more appropriate to compare the quality and the quantity of chitinase production between fungal isolates.
Directory of Open Access Journals (Sweden)
Abhishek Walia
2015-12-01
Full Text Available ABSTRACT A xylanolytic bacterium was isolated from mushroom compost by using enrichment technique. Results from the metabolic fingerprinting, whole-cell fatty acids methyl ester analysis and 16S rDNA sequencing suggested the bacterium to be Cellulosimicrobium cellulans CKMX1. Due to the xylanolytic activity of this bacterium, isolation and characterization of the xylanase gene were attempted. A distinct fragment of about 1671 bp was successfully amplified using PCR and cloned into Escherichia coli DH5α. A BLAST search confirmed that the DNA sequence from the amplified fragment was endo-1, 4-beta-xylanase, which was a member of glycoside hydrolase family 11. It showed 98% homology withCellulosimicrobium sp. xylanase gene (Accession no. FJ859907.1 reported from the gut of Eisenia fetida in Korea. In silicophysico-chemical characterization of amino acid sequence of xylanase showed an open reading frame encoding a 556 amino acid sequence with a molecular weight of 58 kDa and theoretical isolectric point (pI of 4.46 was computed using Expasy's ProtParam server. Secondary and homology based 3D structure of xylanase was analysed using SOPMA and Swiss-Prot software.
Impact Assessment of Biomass Burning on Air Quality in Southeast and East Asia During BASE-ASIA
Huang, Kan; Fu, Joshua S.; Hsu, N. Christina; Gao, Yang; Dong, Xinyi; Tsay, Si-Chee; Lam, Yun Fat
2013-01-01
A synergy of numerical simulation, ground-based measurement and satellite observation was applied to evaluate the impact of biomass burning originating from Southeast Asia (SE Asia) within the framework of NASA's 2006 Biomass burning Aerosols in Southeast Asia: Smoke Impact Assessment (BASE-ASIA). Biomass burning emissions in the spring of 2006 peaked in MarcheApril when most intense biomass burning occurred in Myanmar, northern Thailand, Laos, and parts of Vietnam and Cambodia. Model performances were reasonably validated by comparing to both satellite and ground-based observations despite overestimation or underestimation occurring in specific regions due to high uncertainties of biomass burning emission. Chemical tracers of particulate K(+), OC concentrations, and OC/EC ratios showed distinct regional characteristics, suggesting biomass burning and local emission dominated the aerosol chemistry. CMAQ modeled aerosol chemical components were underestimated at most circumstances and the converted AOD values from CMAQ were biased low at about a factor of 2, probably due to the underestimation of biomass emissions. Scenario simulation indicated that the impact of biomass burning to the downwind regions spread over a large area via the Asian spring monsoon, which included Southern China, South China Sea, and Taiwan Strait. Comparison of AERONET aerosol optical properties with simulation at multi-sites clearly demonstrated the biomass burning impact via longrange transport. In the source region, the contribution from biomass burning to AOD was estimated to be over 56%. While in the downwind regions, the contribution was still significant within the range of 26%-62%.
Characterization of class II alpha genes and DLA-D region allelic associations in the dog.
Sarmiento, U M; Storb, R F
1988-10-01
Human major histocompatibility complex (HLA) cDNA probes were used to analyze the restriction fragment length polymorphism (RFLP) of the alpha genes of the DLA-D region in dogs. Genomic DNA from peripheral blood leucocytes of 23 unrelated DLA-D homozygous dogs representing nine DLA-D types (defined by mixed leucocyte reaction) was digested with restriction enzymes (BamHI, EcoRI, Hind III, Pvu II, Taq I, Rsa I, Msp I, Pst I and Bgl II), separated by agarose gel electrophoresis and transferred onto Biotrace membrane. The Southern blots were successively hybridized with radiolabelled HLA cDNA probes corresponding to DQ, DP, DZ and DR alpha genes. Clear evidence was obtained for the canine homologues of DQ and DR alpha genes with simple bi- or tri-allelic polymorphism respectively. Evidence for a single, nonpolymorphic DP alpha gene was also obtained. However, the presence of a DZ alpha gene could not be clearly demonstrated in canine genomic DNA. This report extends our previous RFLP analysis documenting polymorphism of DLA class II beta genes in the same panel of homozygous typing cell dogs, and provides the basis for DLA-D genotyping at a population level. This study also characterizes the RFLP-defined preferential allelic associations across the DLA-D region in nine different homozygous typing cell specificities.
Cho, Lee-Jay
1986-01-01
Discusses issues related to population growth in Asia, considering various programs and their successes. Indicates that China has had the greatest recent success in reducing population growth (with its one-child family policy). (JN)
Impact of the Dominant Large-scale Teleconnections on Winter Temperature Variability over East Asia
Lim, Young-Kwon; Kim, Hae-Dong
2013-01-01
Monthly mean geopotential height for the past 33 DJF seasons archived in Modern Era Retrospective analysis for Research and Applications reanalysis is decomposed into the large-scale teleconnection patterns to explain their impacts on winter temperature variability over East Asia. Following Arctic Oscillation (AO) that explains the largest variance, East Atlantic/West Russia (EA/WR), West Pacific (WP) and El Nino-Southern Oscillation (ENSO) are identified as the first four leading modes that significantly explain East Asian winter temperature variation. While the northern part of East Asia north of 50N is prevailed by AO and EA/WR impacts, temperature in the midlatitudes (30N-50N), which include Mongolia, northeastern China, Shandong area, Korea, and Japan, is influenced by combined effect of the four leading teleconnections. ENSO impact on average over 33 winters is relatively weaker than the impact of the other three teleconnections. WP impact, which has received less attention than ENSO in earlier studies, characterizes winter temperatures over Korea, Japan, and central to southern China region south of 30N mainly by advective process from the Pacific. Upper level wave activity fluxes reveal that, for the AO case, the height and circulation anomalies affecting midlatitude East Asian winter temperature is mainly located at higher latitudes north of East Asia. Distribution of the fluxes also explains that the stationary wave train associated with EA/WR propagates southeastward from the western Russia, affecting the East Asian winter temperature. Investigation on the impact of each teleconnection for the selected years reveals that the most dominant teleconnection over East Asia is not the same at all years, indicating a great deal of interannual variability. Comparison in temperature anomaly distributions between observation and temperature anomaly constructed using the combined effect of four leading teleconnections clearly show a reasonable consistency between
Regulatory Regionalism and Education: The European Union in Central Asia
Jones, Peter
2010-01-01
This paper investigates the purchase which Jayasuriya's regulatory regionalism approach offers for an analysis of the European Union's engagement in Central Asia. The European Union has a clearly articulated strategy through which to pursue what it sees as its interests in Central Asia and the development of a range of EU-Central Asia education…
A Reconceptualisation of "Knowing Asia" in Australian Education
Salter, Peta
2015-01-01
Since 1969, over 60 Australian government and non-government policies, documents, committees, working parties and organisations have explored the need to "know Asia". In schools, this engagement is conceptualised as "Asia literacy" and disseminated in the emerging Australian Curriculum through the cross-curriculum priority…
Zhao, Xia; Yang, Guang
2017-01-01
The persistence of atmospheric circulation anomalies over East Asia shows a winter to winter recurrence (WTWR) phenomenon. Seasonal variations in sea level pressure anomalies and surface wind anomalies display significantly different characteristics between WTWR and non-WTWR years. The WTWR years are characterized by the recurrence of both a strong (weak) anomalous Siberian High and an East Asian winter monsoon over two successive winters without persistence through the intervening summer. However, anomalies during the non-WTWR years have the opposite sign between the current and ensuing winters. The WTWR of circulation anomalies contributes to that of surface air temperature anomalies (SATAs), which is useful information for improving seasonal and interannual climate predictions over East Asia and China. In the positive (negative) WTWR years, SATAs are cooler (warmer) over East Asia in two successive winters, but the signs of the SATAs are opposite in the preceding and subsequent winters during the non-WTWR years.
Lupus Nephritis in Asia: Clinical Features and Management.
Yap, Desmond Y H; Chan, Tak Mao
2015-09-01
outcomes in Asian patients with LN compare favorably with patients from other parts of the world. The prevention and treatment of infective complications remain significant challenges in managing LN in Asia. (1) The prevalence of SLE is lower among Caucasians than other ethnicities. A higher prevalence is observed among Asians and African Americans, while the highest prevalence is found in Caribbean people. The prevalence of LN in Asian SLE patients is much higher than in Caucasians as well. However, the 10-year renal outcome and renal survival rate appear to be better in Asians. (2) Polymorphisms of genes involved in the immune response, such as Fcγ receptor, integrin alpha M, TNF superfamily 4, myotubularin-related protein 3 and many others, might be partly responsible for the differences in prevalence between the different ethnic groups. European ancestry was shown to be associated with a decrease in the risk of LN even after adjustment for genes most associated with renal disease. (3) Access to health care is a key determinant of disease progression, treatment outcome and the management of complications such as infections, particularly in South Asia, and might also explain disparities between clinical outcomes. (4) The efficacy of low-dose CYC combined with corticosteroids for induction treatment of LN was proved in European Caucasian patients. This treatment is also used in Asia, although no formal evaluation of efficacy and safety in comparison with other treatment regimens exists in this population. The efficacy of mycophenolate mofetil (MMF) is similar to that of CYC, and similar between Asians and Caucasians. MMF may be more effective than CYC in inducing response in high-risk populations such as African American or Hispanic patients. MMF might cause less infection-related events in Asians, but its high cost prevents broader usage at present. (5) For maintenance therapy, corticosteroid combined with AZA or MMF is used worldwide, with a broadly similar efficacy of
Prostate cancer trends in Asia.
Akaza, Hideyuki; Onozawa, Mizuki; Hinotsu, Shiro
2017-06-01
Differences in the incidence and mortality rates for prostate cancer between East and West are clearly defined, with higher rates in the West and lower rates in the East. Treatment methods are generally selected in accordance with general practice guidelines, but the current reality in Asia is that there is not sufficient clinical data to set Asia-specific guidelines for treatment. This leads to a situation whereby for the large part guidelines based on scientific evidence accumulated in Western countries are followed, but from time to time cases are encountered when such guidelines may not be considered to be the most appropriate for the case at hand. Although there is a relatively large volume of clinical evidence relating to endocrine therapy in Asia, the treatment choices and effects differ to those in the West. These regional differences are thought to be due to various factors, including not only differences in genetic background, but also distinct differences in the living and healthcare environments. If the differences between East and West in terms of trends in prostate cancer could be examined, with positive aspects being adopted and negative aspects being improved, this could also be expected to be of use in developing a better treatment strategy for prostate cancer. The exchanging of information on a broader, global level will enable improvements in prevention, diagnosis and treatment of prostate cancer. It is in pursuit of this objective that it is important to promote high-quality clinical trials and joint epidemiological studies in Asia and work to accumulate data that are comparable to data available in Western countries.
Lee, Sang-Hyop; Mason, Andrew; Park, Donghyun
2011-01-01
Asia as a whole is experiencing a rapid demographic transition toward older populations, though different countries are at different stages of this region- wide trend. We document Asia's aging population, describe the region's old-age support systems, and highlight the regional socioeconomic implications of the transition for those support systems. Aging populations present two fundamental challenges to Asian policymakers: (1) developing socioeconomic systems that can provide economic securit...
Sensible climates in monsoon Asia.
Ono, H S; Kawamura, T
1991-06-01
This study identifies characteristics of the geographical distribution of sensible climates and their diurnal and annual variations, and presents a classification of bioclimates in monsoon Asia by using Kawamura's discomfort index formula. During the hottest month, tropical areas and areas in central and South China are uncomfortable for humans throughout the day and night, and temperate zones in lowlands are uncomfortable during the daytime. Tropical zones are uncomfortable all year long and temperate zones in lowlands are uncomfortable during summer. Four climatic types were distinguished in monsoon Asia. Climatic type I, hyperthermal throughout the year, occurs in the tropics south of latitude 20 degrees N. Climatic type II, hyperthermal in the hottest month and comfortable in the coldest month, extends over latitudes from 20 degrees to 30 degrees N except in the highlands. Climatic type III, hyperthermal in the hottest month and hypothermal in the coldest month, encompasses temperate zones of East Asia and subtropical arid areas of northwestern India. Climatic type V, comfortable in the hottest month and hypothermal in coldest month, occurs near the southeast coast of the Soviet Union and in the highlands of the Himalayas.
Glaucoma in Asia: regional prevalence variations and future projections.
Chan, Errol Wei'en; Li, Xiang; Tham, Yih-Chung; Liao, Jiemin; Wong, Tien Yin; Aung, Tin; Cheng, Ching-Yu
2016-01-01
To evaluate glaucoma prevalence and disease burden across Asian subregions from 2013 to 2040. We conducted a systematic review and meta-analysis of 23 population-based studies of 1318 primary open angle glaucoma (POAG) cases in 66,800 individuals and 691 primary angle closure glaucoma (PACG) cases in 72,767 individuals in Asia. Regions in Asia were defined based on United Nations' (UN) classification of macro-geographic regions. PubMed, Medline and Web of Science databases were searched for population-based glaucoma prevalence studies using standardised criteria published to 31 December 2013. Pooled glaucoma prevalence for individuals aged 40-80 years was calculated using hierarchical Bayesian approaches. Prevalence differences by geographic subregion, subtype and habitation were examined with random effects meta-regression models. Estimates of individuals with glaucoma from 2013 to 2040 were based on the UN World Population Prospects. In 2013, pooled overall glaucoma prevalence was 3.54% (95% credible interval (CrI) 1.83 to 6.28). POAG (2.34%, 95% CrI 0.96 to 4.55) predominated over PACG (0.73%, 95% CrI 0.18 to 1.96). With age and gender adjustment, PACG prevalence was higher in East than South East Asia (OR 5.55, 95% CrI 1.52 to 14.73), and POAG prevalence was higher in urban than rural populations (OR 2.11, 95% CrI 1.57 to 2.38). From 2013 to 2040, South Central Asia will record the steepest increase in number of glaucoma individuals from 17.06 million to 32.90 million compared with other Asian subregions. In 2040, South-Central Asia is also projected to overtake East Asia for highest overall glaucoma and POAG burden, while PACG burden remains highest in East Asia. Across the Asian subregions, there was greater glaucoma burden in South-Central and East Asia. Sustainable public health strategies to combat glaucoma in Asia are needed. Published by the BMJ Publishing Group Limited. For permission to use (where not already granted under a licence) please go to
Crude oil pricing in Asia and future problems; Asia no gen`yu pricing to kongo no kadai
Energy Technology Data Exchange (ETDEWEB)
Kato, T. [The Institute of Energy Economics, Tokyo (Japan)
1997-01-30
This paper describes pricing factors of crude oil for Asia and future problems. Price of the Middle East crude oil for Asia is determined by linking the spot price of Dubayy crude oil using as a marker. Factors affecting the pricing of marker crude oil include the information dispatching functions for prices of spot market and paper market of marker crude oil, the presence of competitive crude oil, and the correlation between market of oil products and price of crude oil. The paper market of Dubayy crude oil with a small scale of trading provides poor impact and transparency. In Asia, there is no strong competitive crude oil except the Middle East crude oil. There is only a weak price linking between crude oil and products. These are the background that the price of Middle East crude oil stays at the high level and the price adjusting functions are hard to work. The marker crude oil should be changed to another except Dubayy crude oil, and information should be dispatched from purchasers based on the stable standard crude oil. The real paper market should be created, and the force of speaking to oil producing countries should be enhanced by concentrating forces of major oil consuming countries in Asia. It is necessary to find out competitive crude oils. 5 figs., 6 tabs.
Trade in Services and Investment Flows in South Asia
Rajesh Chadha; Geethanjali Nataraj
2008-01-01
Despite being a group of contiguous countries South Asia is one of the least integrated regions in terms of intra-regional investment and trade relations. The share of services in GDP of South Asian countries has increased substantially with South Asia exhibiting a high revealed comparative advantage in commercial services and more particularly in other services including computer and information technology enabled services. Analysis of the FDI inflows in South Asia reveals that the number of...
Atmospheric pollutant outflow from southern Asia: a review
Directory of Open Access Journals (Sweden)
M. G. Lawrence
2010-11-01
Full Text Available Southern Asia, extending from Pakistan and Afghanistan to Indonesia and Papua New Guinea, is one of the most heavily populated regions of the world. Biofuel and biomass burning play a disproportionately large role in the emissions of most key pollutant gases and aerosols there, in contrast to much of the rest of the Northern Hemisphere, where fossil fuel burning and industrial processes tend to dominate. This results in polluted air masses which are enriched in carbon-containing aerosols, carbon monoxide, and hydrocarbons. The outflow and long-distance transport of these polluted air masses is characterized by three distinct seasonal circulation patterns: the winter monsoon, the summer monsoon, and the monsoon transition periods. During winter, the near-surface flow is mostly northeasterly, and the regional pollution forms a thick haze layer in the lower troposphere which spreads out over millions of square km between southern Asia and the Intertropical Convergence Zone (ITCZ, located several degrees south of the equator over the Indian Ocean during this period. During summer, the heavy monsoon rains effectively remove soluble gases and aerosols. Less soluble species, on the other hand, are lifted to the upper troposphere in deep convective clouds, and are then transported away from the region by strong upper tropospheric winds, particularly towards northern Africa and the Mediterranean in the tropical easterly jet. Part of the pollution can reach the tropical tropopause layer, the gateway to the stratosphere. During the monsoon transition periods, the flow across the Indian Ocean is primarily zonal, and strong pollution plumes originating from both southeastern Asia and from Africa spread across the central Indian Ocean. This paper provides a review of the current state of knowledge based on the many observational and modeling studies over the last decades that have examined the southern Asian atmospheric pollutant outflow and its large scale
Information Society Innovation Fund Asia | CRDI - Centre de ...
International Development Research Centre (IDRC) Digital Library (Canada)
Information Society Innovation Fund Asia. IDRC's Pan Asia Networking (PAN) program initiative has about 10 years experience with small grants funding. The small grants modality has allowed PAN to sample the region for research priorities, emerging research issues and players, and has resulted in innovative ...
Using Evaluation for CBNRM Capacity Development (Southeast Asia)
International Development Research Centre (IDRC) Digital Library (Canada)
Using Evaluation for CBNRM Capacity Development (Southeast Asia). Recently, capacity development has regained a central place on the agenda of many donor organizations, including IDRC. The challenge is to measure the results of capacity development initiatives. In Asia, there are a few ongoing efforts to document ...
Far East Asia | Page 108 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Drawing on research and practical experiences from China, South Asia, and Southeast Asia, this book presents and analyzes novel approaches to collaborative learning and communities of practice. Case studies show how, through joint efforts with researchers and other actors, local communities address and learn from ...
Asia-Pacific malaria is singular, pervasive, diverse and invisible.
Baird, J Kevin
2017-06-01
Malaria in the Asia-Pacific region has been targeted for elimination by the year 2030. This article asks the question, "by what means?" in the context of proven technical strategies and tools against key challenges imposed by the distinct character of the Asia-Pacific malaria problem. The misperception of malaria in the Asia-Pacific region as a less serious but otherwise essentially similar problem to African malaria lulls us into rote application of the same tools and strategies. Those now mitigating the harm done by malaria in Africa will not suffice to eliminate malaria in the Asia-Pacific region - these tasks and the problems are fundamentally distinct. This article describes the singular characteristics of Asia-Pacific malaria and the bearing of those upon the technical strategy of malaria elimination. Most of the tools needed for that endeavour do not yet exist and spirited calls for elimination within the next 14years may discourage the patience and investments needed to conceive, optimise and validate them. Copyright © 2016 The Author. Published by Elsevier Ltd.. All rights reserved.
KETERKAITAN DINAMIS PASAR SAHAM INDONESIA DAN ASIA PASIFIK
Directory of Open Access Journals (Sweden)
Haryo Suparmun
2017-03-01
Full Text Available This study aimed to detect and identify short-term dynamic linkages between Indonesian stock market andAsia-Pacific stock markets during the period of January 2nd, 2003 until December 31st, 2009 by using theimpulse response function analysis and forecast error variance decomposition. The period was divided intosub-period of before, during, and after the global financial crisis. The results showed that Indonesian stockmarket responded positively to each shock caused by the Asia-Pacific stock markets. The response becamestronger during crisis sub-period. This condition proved a significant increase of short-term dynamic linkagesbetween Indonesian stock market and other Asia Pacific during the global financial crisis. After crisis sub-period, many Asian-Pacific stock markets’ shocks were responded negatively by Indonesian stock market.Australian, China and Hong Kong stock markets were the top three in share among the countries of the AsiaPacific contributing to influence the Indonesian stock market movements
Characterizing bacterial gene expression in nitrogen cycle metabolism with RT-qPCR.
Graham, James E; Wantland, Nicholas B; Campbell, Mark; Klotz, Martin G
2011-01-01
Recent advances in DNA sequencing have greatly accelerated our ability to obtain the raw information needed to recognize both known and potential novel modular microbial genomic capacity for nitrogen metabolism. With PCR-based approaches to quantifying microbial mRNA expression now mainstream in most laboratories, researchers can now more efficiently propose and test hypotheses on the contributions of individual microbes to the biological accessibility of nitrogen upon which all other life depends. We review known microbial roles in these key nitrogen transformations, and describe the necessary steps in carrying out relevant gene expression studies. An example experimental design is then provided characterizing Nitrosococcus oceani mRNA expression in cultures responding to ammonia. The approach described, that of assessing microbial genome inventory and testing putative modular gene expression by mRNA quantification, is likely to remain an important tool in understanding individual microbial contributions within microbial community activities that maintain the Earth's nitrogen balance. Copyright © 2011 Elsevier Inc. All rights reserved.
Diversity of the Mountain Flora of Central Asia with Emphasis on Alkaloid-Producing Plants
Directory of Open Access Journals (Sweden)
Karimjan Tayjanov
2017-02-01
Full Text Available The mountains of Central Asia with 70 large and small mountain ranges represent species-rich plant biodiversity hotspots. Major mountains include Saur, Tarbagatai, Dzungarian Alatau, Tien Shan, Pamir-Alai and Kopet Dag. Because a range of altitudinal belts exists, the region is characterized by high biological diversity at ecosystem, species and population levels. In addition, the contact between Asian and Mediterranean flora in Central Asia has created unique plant communities. More than 8100 plant species have been recorded for the territory of Central Asia; about 5000–6000 of them grow in the mountains. The aim of this review is to summarize all the available data from 1930 to date on alkaloid-containing plants of the Central Asian mountains. In Saur 301 of a total of 661 species, in Tarbagatai 487 out of 1195, in Dzungarian Alatau 699 out of 1080, in Tien Shan 1177 out of 3251, in Pamir-Alai 1165 out of 3422 and in Kopet Dag 438 out of 1942 species produce alkaloids. The review also tabulates the individual alkaloids which were detected in the plants from the Central Asian mountains. Quite a large number of the mountain plants produce neurotoxic and cytotoxic alkaloids, indicating that a strong chemical defense is needed under the adverse environmental conditions of these mountains with presumably high pressure from herbivores.
Triwijayani, A. U.; Puspita, I. D.; Murwantoko; Ustadi
2018-03-01
Chitinolytic bacteria are a group of bacteria owning enzymes that able to hydrolyze chitin. Previously, we isolated chitinolytic bacteria from shrimp pond sediment in Bantul, Yogyakarta, and obtained five isolates showing high chitinolytic index named as isolate PT1, PT2, PT5, PT6 and PB2. The aims of this study were to identify chitinolytic bacteria isolated from shrimp pond sediment and to characterize the chitinase encoding gene from each isolate. The molecular technique was performed by amplification of 16S rDNA, amplification of chitinase encoding gene and sequence analysis. Two chitinolytic bacteria of PT1 and PT2 were similar to Aeromonas bivalvium strain D15, PT5 to Pseudomonas stutzeri strain BD-2.2.1, PT6 to Serratia marcescens strain FZSF02 and PB2 to Streptomyces misionensis strain OsiRt-1. The comparison of chitinase encoding gene between three isolates with those in Gen Bank shows that PT1 had similar sequences with the chi1 gene in Aeromonas sp. 17m, PT2 with chi1 gene in A. caviae (CB101) and PT6 with chiB gene in S. Marcescens (BJL200).
Expression and characterization of UL16 gene from duck enteritis virus
Directory of Open Access Journals (Sweden)
Wang Mingshu
2011-08-01
Full Text Available Abstract Background Previous studies have indicated that the UL16 protein and its homologs from herpesvirus were conserved and played similar roles in viral DNA packaging, virion assembly, budding, and egress. However, there was no report on the UL16 gene product of duck enteritis virus (DEV. In this study, we analyzed the amino acid sequence of UL16 using bioinformatics tools and expressed in Escherichia coli Rosetta (DE3 induced by isopropy1-β-D-thiogalactopyranoside (IPTG. The recombinant protein was produced, purified using a Ni-NTA column and used to generate the polyclonal antibody against UL16. The intracellular distribution of the DEV UL16 product was carried out using indirect immunofluorescence assay. Results In our study, UL16 gene of DEV was composed of 1089 nucleotides, which encoded 362 amino acids. Multiple sequence alignment suggested that the UL16 gene was highly conserved in herpesvirus family. The UL16 gene was cloned into a pET prokaryotic expression vector and transformed into Escherichia coli Rossetta (DE3 induced by IPTG. A 60kDa fusion protein band corresponding to the predicted size was produced on the SDS-PAGE, purified using a Ni-NTA column. Anti-UL16 polyclonal sera was prepared by immunizing rabbits, and reacted with a band in the IPTG induced cell lysates with an apparent molecular mass of 60 kDa. In vivo expression of the UL16 protein in DEV infected duck embryo fibroblast cells (DEFs was localized mostly around perinuclear cytoplasmic area and in cytosol using indirect immunofluorescence assay. Conclusions The UL16 gene of DEV was successfully cloned, expressed and detected in DEV infected DEFs for the first time. The UL16 protein localized mostly around perinuclear cytoplasmic area and in cytosol in DEV infected DEFs. DEV UL16 shared high similarity with UL16 family members, indicating that DEV UL16 many has similar function with its homologs. All these results may provide some insight for further research about
Asia Pacific Mangrove Information Network (APMIN): A conceptual model
Digital Repository Service at National Institute of Oceanography (India)
Chavan, V.S.; Jagtap, T.G.; Untawale, A.G.
Asia Pacific Mangrove Information Network (APMIN), its structure and scope, is discussed in this paper. Establishment of National Mangrove Information Centers (NMIC) in 20 Asia-Pacific countries, would contribute towards development of databases...
Asia-Pacific Economic Cooperation (APEC) - Center for Global Health
As the leading economic forum in the Asia-Pacific region, APEC facilitates economic growth and prosperity in the Asia-Pacific region through trade and investment liberalization, business facilitation, and economic and technical cooperation.
Foreign direct investments in Southeast Asia
Sjöholm, Fredrik
2013-01-01
Foreign direct investment has been of large importance in economic growth and global economic integration over the last decades. South East Asia has been part of this development with rapidly increasing inflows of FDI. However, there are large variations over time and between countries in the region as regard to the policies towards FDI, and in actual inflows of FDI. This chapter aims at examining the size of FDI in South East Asia and the trends in it. The main determinants of FDI in Southea...
Central Asia | Page 87 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Read more about Nanotechnology in South Asia : Building Capabilities and Governing the Technology in South Asia. Language English. Read more about La nanotechnologie en Asie du Sud : renforcement des capacités et encadrement des technologies. Language French. Read more about La situation de la femme à ...
South Asia | Page 23 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Read more about Nanotechnology in South Asia : Building Capabilities and Governing the Technology in South Asia. Language English. Read more about La nanotechnologie en Asie du Sud : renforcement des capacités et encadrement des technologies. Language French. Read more about Gestion des forêts et des ...
Ruiz-Estévez, Mercedes; Bakkali, Mohammed; Martín-Blázquez, Rubén; Garrido-Ramos, Manuel A
2017-10-17
identification and characterization of TALE homeobox genes in V. speciosa , and gives novel insights about the role of these genes in fern development.
Energy Technology Data Exchange (ETDEWEB)
Hardy, D.O.; Catterall, J.F. [Population Council, New York, NY (United States); Carino, C. [Instituto National de la Nutricion, Mexico City, MX (United States)] [and others
1995-04-01
Steroid hormone-binding globulin in human serum displays different isoelectric focusing (IEF) patterns among individuals, suggesting genetic variation in the gene for this extracellular steroid carrier protein. Analysis of allele frequencies and family studies suggested the existence of two codominant alleles of the gene. Subsequent determination of the molecular basis of a variant of the gene was carried out using DNA from homozygous individuals from a single Belgian family. It was of interest to characterize other variant individuals to determine whether all variants identified by IEF phenotyping were caused by the same mutation or whether other mutations occurred in the gene in different populations. Previous studies identified Mexican subjects who were heterozygous for the variant IEF phenotype. Denaturing gradient gel electrophoresis was used to localize the mutation in these subjects and to purify the variant allele for DNA sequence analysis. The results show that the mutation in this population is identical to that identified in the Belgian family, and no other mutations were detected in the gene. These data represent the first analysis of steroid hormone-binding globulin gene variation in heterozygous subjects and further support the conclusion of biallelism of the gene worldwide. 11 refs., 2 figs., 1 tab.
The economics of greenhouse gas mitigation in developing Asia
Aleluia Reis, Lara; Emmerling, Johannes; Tavoni, Massimo; Raitzer, David
2016-01-01
Developing Asia has the world's fastest greenhouse gas emissions growth. This study uses an economy-energy-climate model to assess the effects of Paris Agreement pledges on Asia, in comparison with business as usual (BAU) and more ambitious scenarios. Results confirm that pledges must be strongly increased in ambition to achieve the Paris Agreement's goal of less than 2 degrees Celsius (2êC) warming. The policy costs of Asia's pledges are found to be less than 1% of gross domestic product (GD...
Causes of early Holocene desertification in arid central Asia
Energy Technology Data Exchange (ETDEWEB)
Jin, Liya [Lanzhou University, Key Laboratory of Western China' s Environmental System, Lanzhou, Gansu (China); University of Kiel, Institute of Geosciences, Kiel (Germany); Chen, Fahu [Lanzhou University, Key Laboratory of Western China' s Environmental System, Lanzhou, Gansu (China); Morrill, Carrie [University of Colorado, Cooperative Institute for Research in Environmental Sciences, Boulder, CO (United States); NOAA' s National Climatic Data Center, Paleoclimatology Branch, Boulder, CO (United States); Otto-Bliesner, Bette L.; Rosenbloom, Nan [National Center for Atmospheric Research, Climate and Global Dynamics Division, Boulder, CO (United States)
2012-04-15
Paleoclimate records of effective moisture (precipitation minus evaporation, or P-E) show a dry (low effective moisture) period in mid-latitude arid/semi-arid central Asia during the early Holocene (11,000-8,000 years ago) relative to the middle and late Holocene, in contrast to evidence for greater-than-present precipitation at the same time in the south and east Asian monsoonal areas. To investigate the spatial differences in climate response over mid-latitude central Asia and monsoonal Asia we conducted a series of simulations with the Community Climate System Model version 3 coupled climate model for the early, middle and late Holocene. The simulations test the climatic impact of all important forcings for the early Holocene, including changes in orbital parameters, the presence of the remnant Laurentide ice sheet and deglacial freshening of the North Atlantic. Model results clearly show the early Holocene patterns indicated by proxy records, including both the decreased effective moisture in arid central Asia, which occurs in the model primarily during the winter months, and the increase in summer monsoon precipitation in south and east Asia. The model results suggest that dry conditions in the early Holocene in central Asia are closely related to decreased water vapor advection due to reduced westerly wind speed and less evaporation upstream from the Mediterranean, Black, and Caspian Seas in boreal winter. As an extra forcing to the early Holocene climate system, the Laurentide ice sheet and meltwater fluxes have a substantial cooling effect over high latitudes, especially just over and downstream of the ice sheets, but contribute only to a small degree to the early Holocene aridity in central Asia. Instead, most of the effective moisture signal can be explained by orbital forcing decreasing the early Holocene latitudinal temperature gradient and wintertime surface temperature. We find little evidence for regional subsidence related to a stronger summer Asian
International Nuclear Information System (INIS)
Phillips, G.J.
1987-01-01
The nucleotide sequence for the structural gene for exonuclease I (sbcB) from Escherichia coli was determined. Two putative promotes for this gene were identified and were predicted to have weak transcription initiation activity. In addition, the sbcB coding region contains many non-optimal codons. These observations are consistent with the suggestions that sbcB is a poorly expressed gene. Several mutant exonuclease I genes were cloned onto pBR322 plasmids. These genes represented both sbcB and xonA mutation. One of the xonA mutation (xonA6) was associated with a 1.2-kb insertion of an IS-30 related mobile genetic element in the 3'-region of the gene. Two of the mutations (xonA2 and xonA6) encode unstable polypeptides. Determination of exonucleolytic activity on single-stranded DNA from cell extracts containing each of the cloned mutant genes revealed no correlation between residual exonucleolytic activity and the pheno-types of sbcB and xonA mutants. A proposal that the exonuclease I protein contains an additional activity besides its ability to degrade single-stranded DNA is presented. Characterization of E. coli strains which overproduce exonuclease I showed increased sensitivity to UV irradiation
Ciguatera fish poisoning in East Asia and southeast Asia.
Chan, Thomas Y K
2015-06-02
In the coastal countries of East Asia and Southeast Asia, ciguatera should be common because of the extensive tropical and subtropical coral reefs along the coasts and in the neighboring seas with ciguatoxic fishes. An extensive search of journal databases, the Internet and the government websites was performed to identify all reports of ciguatera from the regions. Based on the official data and large published case series, the incidence of ciguatera was higher in the coastal cities (Hong Kong, Foshan, Zhongshan) of southern China than in Japan (Okinawa Prefecture). In Singapore, ciguatera appeared to be almost unknown. In other countries, only isolated cases or small case series were reported, but under-reporting was assumed to be common. Ciguatera may cause severe acute illness and prolonged neurological symptoms. Ciguatera represents an important public health issue for endemic regions, with significant socio-economic impact. Coordinated strategies to improve risk assessment, risk management and risk communication are required. The systematic collection of accurate data on the incidence and epidemiology of ciguatera should enable better assessment and management of its risk. Much more work needs to be done to define the size threshold for important coral reef fish species from different regions, above which the risk of ciguatera significantly increases.
Ciguatera Fish Poisoning in East Asia and Southeast Asia
Directory of Open Access Journals (Sweden)
Thomas Y. K. Chan
2015-06-01
Full Text Available In the coastal countries of East Asia and Southeast Asia, ciguatera should be common because of the extensive tropical and subtropical coral reefs along the coasts and in the neighboring seas with ciguatoxic fishes. An extensive search of journal databases, the Internet and the government websites was performed to identify all reports of ciguatera from the regions. Based on the official data and large published case series, the incidence of ciguatera was higher in the coastal cities (Hong Kong, Foshan, Zhongshan of southern China than in Japan (Okinawa Prefecture. In Singapore, ciguatera appeared to be almost unknown. In other countries, only isolated cases or small case series were reported, but under-reporting was assumed to be common. Ciguatera may cause severe acute illness and prolonged neurological symptoms. Ciguatera represents an important public health issue for endemic regions, with significant socio-economic impact. Coordinated strategies to improve risk assessment, risk management and risk communication are required. The systematic collection of accurate data on the incidence and epidemiology of ciguatera should enable better assessment and management of its risk. Much more work needs to be done to define the size threshold for important coral reef fish species from different regions, above which the risk of ciguatera significantly increases.
Ciguatera Fish Poisoning in East Asia and Southeast Asia
Chan, Thomas Y. K.
2015-01-01
In the coastal countries of East Asia and Southeast Asia, ciguatera should be common because of the extensive tropical and subtropical coral reefs along the coasts and in the neighboring seas with ciguatoxic fishes. An extensive search of journal databases, the Internet and the government websites was performed to identify all reports of ciguatera from the regions. Based on the official data and large published case series, the incidence of ciguatera was higher in the coastal cities (Hong Kong, Foshan, Zhongshan) of southern China than in Japan (Okinawa Prefecture). In Singapore, ciguatera appeared to be almost unknown. In other countries, only isolated cases or small case series were reported, but under-reporting was assumed to be common. Ciguatera may cause severe acute illness and prolonged neurological symptoms. Ciguatera represents an important public health issue for endemic regions, with significant socio-economic impact. Coordinated strategies to improve risk assessment, risk management and risk communication are required. The systematic collection of accurate data on the incidence and epidemiology of ciguatera should enable better assessment and management of its risk. Much more work needs to be done to define the size threshold for important coral reef fish species from different regions, above which the risk of ciguatera significantly increases. PMID:26042615
Inland post-glacial dispersal in East Asia revealed by mitochondrial haplogroup M9a'b
Directory of Open Access Journals (Sweden)
Wang Wen-Zhi
2011-01-01
Full Text Available Abstract Background Archaeological studies have revealed a series of cultural changes around the Last Glacial Maximum in East Asia; whether these changes left any signatures in the gene pool of East Asians remains poorly indicated. To achieve deeper insights into the demographic history of modern humans in East Asia around the Last Glacial Maximum, we extensively analyzed mitochondrial DNA haplogroup M9a'b, a specific haplogroup that was suggested to have some potential for tracing the migration around the Last Glacial Maximum in East Eurasia. Results A total of 837 M9a'b mitochondrial DNAs (583 from the literature, while the remaining 254 were newly collected in this study pinpointed from over 28,000 subjects residing across East Eurasia were studied here. Fifty-nine representative samples were further selected for total mitochondrial DNA sequencing so we could better understand the phylogeny within M9a'b. Based on the updated phylogeny, an extensive phylogeographic analysis was carried out to reveal the differentiation of haplogroup M9a'b and to reconstruct the dispersal histories. Conclusions Our results indicated that southern China and/or Southeast Asia likely served as the source of some post-Last Glacial Maximum dispersal(s. The detailed dissection of haplogroup M9a'b revealed the existence of an inland dispersal in mainland East Asia during the post-glacial period. It was this dispersal that expanded not only to western China but also to northeast India and the south Himalaya region. A similar phylogeographic distribution pattern was also observed for haplogroup F1c, thus substantiating our proposition. This inland post-glacial dispersal was in agreement with the spread of the Mesolithic culture originating in South China and northern Vietnam.
Linguistic Phylogenies Support Back-Migration from Beringia to Asia
Sicoli, Mark A.; Holton, Gary
2014-01-01
Recent arguments connecting Na-Dene languages of North America with Yeniseian languages of Siberia have been used to assert proof for the origin of Native Americans in central or western Asia. We apply phylogenetic methods to test support for this hypothesis against an alternative hypothesis that Yeniseian represents a back-migration to Asia from a Beringian ancestral population. We coded a linguistic dataset of typological features and used neighbor-joining network algorithms and Bayesian model comparison based on Bayes factors to test the fit between the data and the linguistic phylogenies modeling two dispersal hypotheses. Our results support that a Dene-Yeniseian connection more likely represents radiation out of Beringia with back-migration into central Asia than a migration from central or western Asia to North America. PMID:24621925
Directory of Open Access Journals (Sweden)
Ciro César Rossi
2013-01-01
Full Text Available The OmlA protein is a virulence factor of Actinobacillus pleuropneumoniae, an important pathogen in pigs. The polymorphisms present in the omlA gene sequence of 15 reference serotypes of A. pleuropneumoniae and non-serotypable isolates were assessed to determine the possible evolutionary relationship among them and to validate the importance of this gene as a molecular marker for the characterization of this bacterium. Divergence among the 15 serotypes of A. pleuropneumoniae probably resulted initially from two major evolutionary events that led to subsequent differentiation into nine groups. This differentiation makes it possible to characterize most of the serotypes by using bionformatics, thereby avoiding problems with immunological cross-reactivity. A conserved α-helix common to all the serotypes was most likely involved in connecting the protein to the outer membrane and acting as a signal peptide. A previously unknown gene duplication was also identified and could contribute to the genetic variability that makes it difficult to serotype some isolates. Our data support the importance of the omlA gene in the biology of A. pleuropneumoniae and provide a new area of research into the OmlA protein.
Borrás, Teresa
2017-01-01
Treatment of diseases with gene therapy is advancing rapidly. The use of gene therapy has expanded from the original concept of re-placing the mutated gene causing the disease to the use of genes to con-trol nonphysiological levels of expression or to modify pathways known to affect the disease. Genes offer numerous advantages over conventional drugs. They have longer duration of action and are more specific. Genes can be delivered to the target site by naked DNA, cells, nonviral, and viral vectors. The enormous progress of the past decade in molecular bi-ology and delivery systems has provided ways for targeting genes to the intended cell/tissue and safe, long-term vectors. The eye is an ideal organ for gene therapy. It is easily accessible and it is an immune-privileged site. Currently, there are clinical trials for diseases affecting practically every tissue of the eye, including those to restore vision in patients with Leber congenital amaurosis. However, the number of eye trials compared with those for systemic diseases is quite low (1.8%). Nevertheless, judg-ing by the vast amount of ongoing preclinical studies, it is expected that such number will increase considerably in the near future. One area of great need for eye gene therapy is glaucoma, where a long-term gene drug would eliminate daily applications and compliance issues. Here, we review the current state of gene therapy for glaucoma and the possibilities for treating the trabecular meshwork to lower intraocular pressure and the retinal ganglion cells to protect them from neurodegeneration. Copyright© 2017 Asia-Pacific Academy of Ophthalmology.
Hepatocellular carcinoma: Implications for Asia-Pacific Oncology Nurses
Directory of Open Access Journals (Sweden)
Deborah A Boyle
2017-01-01
Full Text Available Hepatocellular carcinoma (HCC is a prominent malignancy in the Asia-Pacific region. Despite considerable knowledge about it's scope and nature this malignancy remains incurable. This manuscript reviews the epidemiology of this cancer, its pathogenesis, risk factors, potential prevention, surveillance, treatment, and the oncology nurses' role relative to this malignancy. A literature search from the past decade was performed using the PubMed and CINAHL databases using the search terms “hepatocellular carcinoma,” “Asia,” and “nursing issues”. Themes such as etiology, prevention, treatment, and prognosis were included in this synthesis which has particular relevance to oncology nurses within the Asia-Pacific region.
Proceedings of International Symposium on Energy Co-operation in North East Asia
Energy Technology Data Exchange (ETDEWEB)
NONE
2001-06-01
This proceedings are for the International Symposium on Energy Co-operation in North-East Asia, organized by Korea Energy Economics Institute, Institute of Energy Economics, Japan, and United Nations Economic and Social Commission for Asia and the Pacific, held on June 2001 at Sheraton Walker Hill Hotel in Seoul, Korea. The major themes discussed are following: 1.Energy Profile, Outlook and Perspectives on Regional Co-operation in Northeast Asia 2.Future Challenges in the Energy Sector in Northeast Asia 3.Perspectives of Energy Co-operation in Northeast Asia.
Using technology to deliver quality education in Asia | IDRC ...
International Development Research Centre (IDRC) Digital Library (Canada)
2016-06-08
Jun 8, 2016 ... Using technology to deliver quality education in Asia ... Entrepreneurship has been a major driver of growth and job creation in Southeast Asia. ... to provide access to health services, especially to vulnerable populations.
Far East Asia | Page 69 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Far East Asia. Extrême-Orient. Read more about Startup : Philippine Community eCentres Network. Language English. Read more about Mise sur pied d'un réseau philippin de télécentres communautaires. Language French. Read more about Transnational Migration of Vietnamese Women in Asia. Language English.
A Global Conceptual History of Asia, 1860-1940
DEFF Research Database (Denmark)
Contributors to this volume explore the changing concepts of the social and the economic during a period of fundamental change across Asia. They challenge accepted explanations of how Western knowledge spread through Asia and show how versatile Asian intellectuals were in introducing European...... concepts and in blending them with local traditions....
Far East Asia | Page 110 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Far East Asia. Extrême-Orient. Read more about L'initiative Samdrup Jongkhar, un modèle de développement intégré écologiquement responsable. Language French. Read more about Supporting Biotechnology Regulatory Policy Processes in Southeast Asia. Language English. Read more about Soutien aux processus ...
2nd Asia-Pacific Conference on Complex Systems Design & Management
Fong, Saik; Krob, Daniel; Lui, Pao; Tan, Yang
2016-01-01
This book contains all refereed papers that were accepted to the second edition of the Asia-Pacific conference on « Complex Systems Design & Management Asia» (CSD&M Asia 2016) that took place in Singapore from February 24 to February 26, 2016 (Website: http://www.2016.csdm-asia.net/). These proceedings cover the most recent trends in the emerging field of Complex Systems, both from an academic and a professional perspective. A special focus is put on Smart Nations: Designing and Sustaining. The CSD&M Asia 2016 conference is organized under the guidance of the Singapore division of the Center of Excellence on Systems Architecture, Management, Economy and Strategy (CESAMES) – Legal address: C.E.S.A.M.E.S. Singapore – 16 Raffles Quay – #38-03 Hong Leong Building – Singapore 048581 (website : http://www.cesames.net/en – email: contact@cesames.net).
Manufacturing Enterprise in Asia
International Development Research Centre (IDRC) Digital Library (Canada)
2017-12-13
Dec 13, 2017 ... 53 Designing Financial Systems in East Asia and Japan ..... 5.3 Weights for the industrial production index (%) ..... The demand for manufactured goods for this low level of consumption per capita also tends to be very low.
Liao, Peng; Guo, Li; Wen, Yongjun; Yang, Yangling; Cheng, Shipeng
2015-01-01
In the present study, the genotype of two Canine distemper virus (CDV) strains, namely, ZJJ-SD and ZJJ-LN, were investigated, based on the whole hemagglutinin (HA) gene. The CDV strains were obtained from two foxes in Shandong Province and Liaoning Province in 2011. Phylogenetic analyses were carried out for 260 CDV strains worldwide, and a statistical analysis was performed in the amino acid substitutions at positions 530 and 549 of the HA protein. Phylogenetic analyses revealed that the two strains, ZJJ-SD and ZJJ-LN, belonged to the CDV Asia I lineage. Site 530 of HA protein was found to be relatively conserved within CDV lineages in different host species by combining the genetic sequence data with the published data from 260 CDV strains worldwide. The data analysis showed a bias toward the predicted substitution Y549H for the non-dog strains in Asia I and Europe lineages. The ratio of site 549 genetic drift in the HA gene were significantly different between dogs and non-dogs in the two lineages. The strain ZJJ-SD, from wild canid, has an Y549H substitution. It is one of three Y549H substitution for wild canids in Asia I lineages. Site 530 of HA protein was not immediately relative to CDV genetic drift from dogs to non-dogs. Statistical analysis indicated that non-dog strains have a high probability to contain Y549H than dog strains in Asia I and Europe lineages. Thus, site 549 is considered important in genetic drift from dogs to non-dogs, at least in Asia I and Europe lineages.
The Index of Asia-Pacific Regional Integration Effort
Directory of Open Access Journals (Sweden)
Victor Yifan Ye
2016-06-01
Full Text Available The Asia-Pacific region is not typically seen as one geographic or socio-economic space. Yet, 58 regional economies occupying the space of 28 million square kilometers from Turkey in the West, Russian Federation in the North, French Polynesia in the East and New Zealand in the South belong to the Economic and Social Commission of Asia and the Pacific (ESCAP. This commission provides a forum for member states that "promotes regional cooperation and collective action, assisting countries in building and sustaining shared economic growth and social equity". In 2013, ESCAP's members adopted the Bangkok Declaration to enhance efforts towards deeper regional economic integration. Yet this document neither proposes a concrete modality or modalities of achieving deeper integration, nor provides a sense of distance of individual countries to a "perceived" integrated Asia-Pacific.This paper aims to comprehensively quantify recent integration efforts of economies in the Asia-Pacific region. We provide an "index of integration effort" based on twelve metrics that measure the relative distance of a given economy to the region as an economic entity. Generally, we find that while the region has trended towards becoming integrated in general, both the level of integration and integration effort are inconsistent among Asia-Pacific economies. We discuss potential applications and extensions of the index in developing our perspective of the region's economic and social dynamics.
Molecular characterization of enolase gene from Taenia multiceps.
Li, W H; Qu, Z G; Zhang, N Z; Yue, L; Jia, W Z; Luo, J X; Yin, H; Fu, B Q
2015-10-01
Taenia multiceps is a cestode parasite with its larval stage, known as Coenurus cerebralis, mainly encysts in the central nervous system of sheep and other livestocks. Enolase is a key glycolytic enzyme and represents multifunction in most organisms. In the present study, a 1617bp full-length cDNA encoding enolase was cloned from T. multiceps and designated as TmENO. A putative encoded protein of 433 amino acid residues that exhibited high similarity to helminth parasites. The recombinant TmENO protein (rTmENO) showed the catalytic and plasminogen-binding characteristics after the TmENO was subcloned and expressed in the pET30a(+) vector. The TmENO gene was transcribed during the adult and larval stages and was also identified in both cyst fluid and as a component of the adult worms and the metacestode by western blot analysis. Taken together, our results will facilitate further structural characterization for TmENO and new potential control strategies for T. multiceps. Copyright © 2015 Elsevier Ltd. All rights reserved.
The P450alk gene, which is inducible by the assimilation of alkane in Candida tropicalis, was sequenced and characterized. Structural features described in promoter and terminator regions of Saccharomyces yeast genes are present in the P450alk gene and some particular structures ...
National Research Council Canada - National Science Library
1986-01-01
.... This report from Near East/South Asia, Egypt, Libya, Morocco, Tunisia, Israel, Jordan, Lebanon, Syria, Afghanistan, Bangladesh, and Iran contains articles on Political Science, Economics, Regional...
National Research Council Canada - National Science Library
1986-01-01
.... This report from Near East/South Asia, Egypt, Libya, Tunisia, Israel, Afghanistan, Bangladesh, Iran, Iraq, and Pakistan contains articles on International, Regional, Political and Economic Issues...
A Multicultural Social Studies Series. Book 2. Asia.
Kwok, Irene; Sung, Robert
This text is designed for students continuing in the Chinese Bilingual Pilot Program, ESEA Title VII, at the seventh grade level. The text introduces different cultural aspects and general knowledge of Asia, and is divided into twenty-five lessons, having the following headings: Glimpses of Asia; Monsoon; Malaysia; Borneo; Asian Countries; Caste…
South Asia | Page 9 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Asie du sud. Read more about Building emerging leaders in communications policy in Africa and Asia. Language English. Read more about Transformer les chaînes de valeur en avantages sociaux en Asie du SudEst. Language French. Read more about Turning value chains into social gains in Southeast Asia. Language ...
Sediment Properties along Gradients of Siltation in South-East Asia
DEFF Research Database (Denmark)
Kamp-Nielsen, Lars; Vermaat, J.; Wesseling, I.
2002-01-01
sediment properties, SE Asia, siltation, resuspension, iron, calcium, seagrass, corals, mangroves, mudflats......sediment properties, SE Asia, siltation, resuspension, iron, calcium, seagrass, corals, mangroves, mudflats...
Epidemiology of Gastroesophageal Reflux Disease in Asia: A Systematic Review
2011-01-01
Ethnic and geographical differences are important factors in studying disease frequencies, because they may highlight the environmental or genetic influences in the etiology. We retrieved the studies which have been published regarding the epidemiologic features of gastroesophageal reflux disease (GERD) in Asia, based on the definitions of GERD, study settings, publication years and geographical regions. From the population-based studies, the prevalence of symptom-based GERD in Eastern Asia was found to be 2.5%-4.8% before 2005 and 5.2%-8.5% from 2005 to 2010. In Southeast and Western Asia, it was 6.3%-18.3% after 2005, which was much higher than those in Eastern Asia. There were robust epidemiologic data of endoscopic reflux esophagitis in medical check-up participants. The prevalence of endoscopic reflux esophagitis in Eastern Asia increased from 3.4%-5.0% before 2000, to 4.3%-15.7% after 2005. Although there were only limited studies, the prevalence of extra-esophageal syndromes in Asia was higher in GERD group than in controls. The prevalence of Barrett's esophagus was 0.06%-0.84% in the health check-up participants, whereas it was 0.31%-2.00% in the referral hospital settings. In summary, the prevalence of symptom-based GERD and endoscopic reflux esophagitis has increased in Asian countries. However, the prevalence of Barrett's esophagus in Asia has not changed and also still rare. PMID:21369488
Utilization of atomic energy in Asia and nuclear nonproliferation system
International Nuclear Information System (INIS)
Ishii, Makoto
1995-01-01
The economical growth in East Asia is conspicuous as it was called East Asian Miracle, and also the demand of energy increased rapidly. The end of Cold War created the condition for the further development in this district. Many countries advanced positively the plan of atomic energy utilization, and it can be said that the smooth progress of atomic energy utilization is the key for the continuous growth in this district in view of the restriction of petroleum resources and its price rise in future and the deterioration of global environment. The nuclear nonproliferation treaty (NPT) has accomplished large role, but also its limitation became clear. At present, there is not the local security system in Asia, but in order that the various countries in Asia make the utilization of atomic energy and the security compatible, it is useful to jointly develop safety technology, execute security measures and form the nuclear fuel cycle as Asia. Energy and environmental problems in Asia are reported. Threat is essentially intention and capability, and the regulation only by capability regardless of intention brings about unrealistic result. The limitation of the NPT is discussed. The international relation of interdependence deepends after Cold War, and the security in Asia after Cold War is considered. As the mechanism of forming the nuclear fuel cycle for whole Asia, it is desirable to realize ASIATOM by accumulating the results of possible cooperation. (K.I.)
Impact of Desiccation of Aral Sea on the Regional Climate of Central Asia Using WRF Model
Sharma, Ashish; Huang, Huei-Ping; Zavialov, Peter; Khan, Valentina
2018-01-01
This study explores the impacts of the desiccation of the Aral Sea and large-scale climate change on the regional climate of Central Asia in the post-1960 era. A series of climate downscaling experiments for the 1960's and 2000's decades were performed using the Weather Research and Forecast model at 12-km horizontal resolution. To quantify the impacts of the changing surface boundary condition, a set of simulations with an identical lateral boundary condition but different extents of the Aral Sea were performed. It was found that the desiccation of the Aral Sea leads to more snow (and less rain) as desiccated winter surface is relatively much colder than water surface. In summer, desiccation led to substantial warming over the Aral Sea. These impacts were largely confined to within the area covered by the former Aral Sea and its immediate vicinity, although desiccation of the Sea also led to minor cooling over the greater Central Asia in winter. A contrasting set of simulations with an identical surface boundary condition but different lateral boundary conditions produced more identifiable changes in regional climate over the greater Central Asia which was characterized by a warming trend in both winter and summer. Simulations also showed that while the desiccation of the Aral Sea has significant impacts on the local climate over the Sea, the climate over the greater Central Asia on inter-decadal time scale was more strongly influenced by the continental or global-scale climate change on that time scale.
Validation of Hotspots Detected by Satellites in Sentinel Asia
Kaku, K.; Kushida, K.; Fukuda, M.
2008-12-01
The Sentinel Asia (SA) initiative is a collaboration between space agencies and disaster management agencies, applying remote sensing and Web-GIS technologies to assist disaster management in the Asia- Pacific region. It aims to: "EImprove safety in society by ICT and space technology "EImprove speed and accuracy of disaster preparedness and early warning "EMinimize the number of victims and social/economic losses. SA is a voluntary initiative led by the Asia-Pacific Regional Space Agency Forum (APRSAF) to share disaster information in near-real-time across the Asia-Pacific region. Wildfire is a major and recurring phenomenon that has a serious impact on property and human health, affecting many countries in the Asia region. Compared to other disasters in the area, it does not necessarily cause many immediate fatalities. However, it causes serious impact on property and human health due to smoke. Furthermore, its effects are of great relevance both at a regional and global level, and accordingly bear substantial influence on global warming. Responding to requirements from Asian countries, under Sentinel Asia a dedicated Wildfire Working Group (WG) has been established to apply remote sensing technology to the management of wildfire. Having accurate information on the location and intensity of the fires, and subsequent control of wildfire, are therefore very important and urgent tasks across the region. SA primarily addresses the issue of near-real-time information distribution on wildfires in the region. Concerning hotspot data obtained by satellites, it is essential to validate and improve its accuracy. In the framework of Sentinel Asia Wildfire WG, various approaches to hotspot detection, including MOD14 algorithm for MODIS hotspots, were studied, and their validations were carried out, comparing them with active fires extracted from satellite imagery and ground truth data in Chiengmai, Thailand and in Kalimantan, Indonesia.
Oil refining and product marketing developments in Southeast Asia
International Nuclear Information System (INIS)
Szabo, A.M.
1991-01-01
It is estimated that the high growth rate in oil demand in the Asia-Pacific region (excluding Japan) will slow down slightly but still outperform the rest of the world during 1990-2000. This is expected to be true for southeast Asia as well, or more specifically the Association of Southeast Asian Nations (ASEAN). The region's dependence on oil imports from the Middle East will continue for the foreseeable future. Asia-Pacific crude oil production is expected to grow to 6.8 million bbl/d by 1995 and to 7.3 million bbl/d by 2000, meaning that the region will import nearly 50% of its crude oil requirements at both 1995 and 2000. The participation of ASEAN in the production of indigenous crudes in the Asia-Pacific region will increase from 31% in the mid-1980s to 41% by 2000. The Asia-Pacific imbalance between refinery output or supplies and demand patterns will be accentuated during the decade, providing significant opportunities for investments and/or product trading. The region will require upgrading facilities to generate an additional 3.7 million bbl/d of light products in 1995. In the ASEAN countries, surpluses in refined products are expected for 1995. Environmental concerns are following similar trends in the Asia-Pacific region as in the rest of the world, and the proportion of high aromatics gasolines produced will increase as the proportion of leaded gasoline decreases. 6 tabs
INDIA’S GROWING INFLUENCE IN STABILIZING REGIONAL SECURITY IN SOUTHEAST ASIA
2016-02-16
East Policy’ focusing on engagement with Southeast Asia .2 Following the reforms, Indian economy grew rapidly with an...civilizational neighbors in Southeast Asia and East Asia .”19 Thus, LEP and recognition of India’s economic, political, security and cultural potential by ASEAN...point. 21 During the 10th East Asia Summit, Prime Minister Modi emphasized the importance of South East Asian region and informed that his
National Research Council Canada - National Science Library
1986-01-01
.... This report from Near East/South Asia, Algeria, Sudan, Iraq, Israel, Kuwait, Saudi Arabia, Syria, Afghanistan, Bangladesh, India, Iran, and Pakistan, contains articles on Economics, Political Science...
National Research Council Canada - National Science Library
1986-01-01
.... This report contains articles on the Near East/South Asia, Egypt, Mauritania, Morocco, Tunisia, Israel, Jordan, Kuwait, Oman, Saudi Arabia, United Arab Emirates, Afghanistan, Iran and Pakistan...
National Research Council Canada - National Science Library
1986-01-01
.... This report from the Near East/South Asia, Algeria, Egypt, Tunisia, Israel, Kuwait, Lebanon, Oman, Qatar, Saudi Arabia, Afghanistan and Iran, contains articles on International Affairs, Politics...
2013-01-01
Background Canine distemper virus (CDV) infects a variety of carnivores, including wild and domestic Canidae. In this study, we sequenced and phylogenetic analyses of the hemagglutinin (H) genes from eight canine distemper virus (CDV) isolates obtained from seven raccoon dogs (Nyctereutes procyonoides) and a giant panda (Ailuropoda melanoleuca) in China. Results Phylogenetic analysis of the partial hemagglutinin gene sequences showed close clustering for geographic lineages, clearly distinct from vaccine strains and other wild-type foreign CDV strains, all the CDV strains were characterized as Asia-1 genotype and were highly similar to each other (91.5-99.8% nt and 94.4-99.8% aa). The giant panda and raccoon dogs all were 549Y on the HA protein in this study, irrespective of the host species. Conclusions These findings enhance our knowledge of the genetic characteristics of Chinese CDV isolates, and may facilitate the development of effective strategies for monitoring and controlling CDV for wild canids and non-cainds in China. PMID:23566727
Cloning and characterization of human DNA repair genes
International Nuclear Information System (INIS)
Thompson, L.H.; Brookman, K.W.; Weber, C.A.; Salazar, E.P.; Stewart, S.A.; Carrano, A.V.
1987-01-01
The isolation of two addition human genes that give efficient restoration of the repair defects in other CHO mutant lines is reported. The gene designated ERCC2 (Excision Repair Complementing Chinese hamster) corrects mutant UV5 from complementation group 1. They recently cloned this gene by first constructing a secondary transformant in which the human gene was shown to have become physically linked to the bacterial gpt dominant-marker gene by cotransfer in calcium phosphate precipitates in the primary transfection. Transformants expressing both genes were recovered by selecting for resistance to both UV radiation and mycophenolic acid. Using similar methods, the human gene that corrects CHO mutant EM9 was isolated in cosmids and named XRCC1 (X-ray Repair Complementing Chinese hamster). In this case, transformants were recovered by selecting for resistance to CldUrd, which kills EM9 very efficiently. In both genomic and cosmid transformants, the XRCC1 gene restored resistance to the normal range. DNA repair was studied using the kinetics of strand-break rejoining, which was measured after exposure to 137 Cs γ-rays
Asia-Pacific consensus statements on Crohn's disease. Part 2: Management.
Ooi, Choon Jin; Makharia, Govind K; Hilmi, Ida; Gibson, Peter R; Fock, Kwong Ming; Ahuja, Vineet; Ling, Khoon Lin; Lim, Wee Chian; Thia, Kelvin T; Wei, Shu-chen; Leung, Wai Keung; Koh, Poh Koon; Gearry, Richard B; Goh, Khean Lee; Ouyang, Qin; Sollano, Jose; Manatsathit, Sathaporn; de Silva, H Janaka; Rerknimitr, Rungsun; Pisespongsa, Pises; Abu Hassan, Muhamad Radzi; Sung, Joseph; Hibi, Toshifumi; Boey, Christopher C M; Moran, Neil; Leong, Rupert W L
2016-01-01
The Asia Pacific Working Group on Inflammatory Bowel Disease was established in Cebu, Philippines, at the Asia Pacific Digestive Week conference in 2006 under the auspices of the Asian Pacific Association of Gastroenterology (APAGE) with the goal of developing best management practices, coordinating research and raising awareness of IBD in the region. The consensus group previously published recommendations for the diagnosis and management of ulcerative colitis (UC) with specific relevance to the Asia-Pacific region. The present consensus statements were developed following a similar process to address the epidemiology, diagnosis and management of Crohn's disease (CD). The goals of these statements are to pool the pertinent literature specifically highlighting relevant data and conditions in the Asia-Pacific region relating to the economy, health systems, background infectious diseases, differential diagnoses and treatment availability. It does not intend to be all-comprehensive and future revisions are likely to be required in this ever-changing field. © 2015 Journal of Gastroenterology and Hepatology Foundation and Wiley Publishing Asia Pty Ltd.
Directory of Open Access Journals (Sweden)
Turdimurat M. Tursunmuratov
2017-10-01
Full Text Available The author analyses the European Union’s foreign policy in Central Asia. He indicates the basic tendencies of development of the EU cooperation with the countries of Central Asian region. Further, the author analyzes the implementation of joint projects within the framework adopted by the Partnership Agreements. Based on a critical analysis, the researcher highlights a number of constraints to effective development of relations between the EU and Central Asian states. He carries out a structural analysis of conceptual documents of the European Union for the development of bilateral and multilateral relations with Central Asian countries in the region. Scientific novelty of this work lies in the systematization of stages in the evolution of relations between the European Union and the countries of Central Asia. The author divides the formation of cooperation into four main stages. The first stage of the relations between the EU and the countries of Central Asia includes conceptual framework of the legal regulatory structure of bilateral and multilateral cooperation. The second stage is characterized by the realization of a number of joint projects in the field of transport communications, democratic transformations, regional security and stability. The third stage of the relations is determined by acquiring of special geographical significance of the region of Central Asia resulting from the engagement of the International Security Assistance Force in Afghanistan in 2001. The fourth stage has begun in 2015 with the adoption of the EU Strategy for a New Partnership with Central Asia for 2017-2021. These studies serve as a basis for developing some important proposals and recommendations for the improvement of the effectiveness of cooperation between the parties.
Genetic characterization of Italian field strains of Schmallenberg virus based on N and NSs genes.
Izzo, Francesca; Cosseddu, Gian Mario; Polci, Andrea; Iapaolo, Federica; Pinoni, Chiara; Capobianco Dondona, Andrea; Valleriani, Fabrizia; Monaco, Federica
2016-08-01
Following its first identification in Germany in 2011, the Schmallenberg virus (SBV) has rapidly spread to many other European countries. Despite the wide dissemination, the molecular characterization of the circulating strains is limited to German, Belgian, Dutch, and Swiss viruses. To fill this gap, partial genetic characterization of 15 Italian field strains was performed, based on S segment genes. Samples were collected in 2012 in two different regions where outbreaks occurred during distinct epidemic seasons. The comparative sequence analysis demonstrated a high molecular stability of the circulating viruses; nevertheless, we identified several variants of the N and NSs proteins not described in other SBV isolates circulating in Europe.
Relationships between cancer pattern, country income and geographical region in Asia.
Ng, Chirk Jenn; Teo, Chin Hai; Abdullah, Nurdiana; Tan, Wei Phin; Tan, Hui Meng
2015-09-03
Cancer incidence and mortality varies across region, sex and country's economic status. While most studies focused on global trends, this study aimed to describe and analyse cancer incidence and mortality in Asia, focusing on cancer site, sex, region and income status. Age-standardised incidence and mortality rates of cancer were extracted from the GLOBOCAN 2012 database. Cancer mortality to incidence ratios (MIRs) were calculated to represent cancer survival. The data were analysed based on the four regions in Asia and income. Cancer incidence rate is lower in Asia compared to the West but for MIR, it is the reverse. In Asia, the most common cancers in men are lung, stomach, liver, colorectal and oesophageal cancers while the most common cancers in women are breast, lung, cervical, colorectal and stomach cancers. The MIRs are the highest in lung, liver and stomach cancers and the lowest in colorectal, breast and prostate cancers. Eastern and Western Asia have a higher incidence of cancer compared to South-Eastern and South-Central Asia but this pattern is the reverse for MIR. Cancer incidence rate increases with country income particularly in colorectal and breast cancers but the pattern is the opposite for MIR. This study confirms that there is a wide variation in cancer incidence and mortality across Asia. This study is the first step towards documenting and explaining the changing cancer pattern in Asia in comparison to the rest of the world.
Idiosyncratic Features of the Contemporary Regional Economic Architecture in Asia
Directory of Open Access Journals (Sweden)
Dilip K. Das
2012-06-01
Full Text Available The objective of this article is to examine the characteristic features of contemporary policy-led regionalism in Asia. It identifies the positive and negative features associated with the free trade agreements that have proliferated in Asia during the first decade of the 21st century. There has been a marked transformation in Asia's regional architecture in a short span of a decade-and-a-half. The mode and conduct of multilateral trade has been signifThe objective of this article is to examine the characteristic features of contemporary policy-led regionalism in Asia. It identifies the positive and negative features associated with the free trade agreements that have proliferated in Asia during the first decade of the 21st century. There has been a marked transformation in Asia's regional architecture in a short span of a decade-and-a-half. The mode and conduct of multilateral trade has been significantly transformed during recent years and Asia could not possibly remain immune to this transformation. The importance of regionalism in multilateral trade has increased steadily. In addition, the trade-investment-services nexus has developed and grown increasingly important. As business firms now manufacture parts of their products across the border, bilateral trade agreements (BTAs, regional trade agreements (RTAs and free trade agreements (FTAs of the contemporary period need to take into account the new kind of trade barriers that have been created due to the changing mode of trade. The contemporary regional agreements need to be designed to facilitate the new modes of conducting business and trade. It was understood rather late in Asia that the 'WTO-Plus' FTAs are more functional and result-oriented than their predecessors.
South Asia | Page 72 | IDRC - International Development Research ...
International Development Research Centre (IDRC) Digital Library (Canada)
Asie du sud. Read more about Toward Détente in Media Piracy. Language English. Read more about Recherche d'une détente dans le dossier du piratage des médias. Language French. Read more about ONI-Asia - censure et surveillance numériques. Language French. Read more about OpenNet Initiative - Asia ...
Far East Asia | Page 105 | IDRC - International Development ...
International Development Research Centre (IDRC) Digital Library (Canada)
Far East Asia. Extrême-Orient. Read more about Renforcement des capacités de recherche et de l'élaboration de politiques fondées sur des données probantes en Afghanistan et en Asie centrale. Language French. Read more about Microwork and Virtual Production Networks in Sub-Saharan Africa and Southeast Asia.
International prospects for clean coal technologies (Focus on Asia)
Energy Technology Data Exchange (ETDEWEB)
Gallaspy, D.T. [Southern Energy, Inc., Atlanta, GA (United States)
1997-12-31
The purpose of this paper is to propose Asia as a focus market for commercialization of CCT`s; describe the principles for successful penetration of CCT`s in the international market; and summarize prospects for CCT`s in Asia and other international markets. The paper outlines the following: Southern Company`s clean coal commitment; acquisition of Consolidated Electric Power Asia (CEPA); the prospects for CCT`s internationally; requirements for CCT`s widespread commercialization; CEPA`s application of CCT`s; and gas turbine power plants as a perfect example of a commercialization driver.
Characterization of human cardiac myosin heavy chain genes
International Nuclear Information System (INIS)
Yamauchi-Takihara, K.; Sole, M.J.; Liew, J.; Ing, D.; Liew, C.C.
1989-01-01
The authors have isolated and analyzed the structure of the genes coding for the α and β forms of the human cardiac myosin heavy chain (MYHC). Detailed analysis of four overlapping MYHC genomic clones shows that the α-MYHC and β-MYHC genes constitute a total length of 51 kilobases and are tandemly linked. The β-MYHC-encoding gene, predominantly expressed in the normal human ventricle and also in slow-twitch skeletal muscle, is located 4.5 kilobases upstream of the α-MYHC-encoding gene, which is predominantly expressed in normal human atrium. The authors have determined the nucleotide sequences of the β form of the MYHC gene, which is 100% homologous to the cardiac MYHC cDNA clone (pHMC3). It is unlikely that the divergence of a few nucleotide sequences from the cardiac β-MYHC cDNA clone (pHMC3) reported in a MYHC cDNA clone (PSMHCZ) from skeletal muscle is due to a splicing mechanism. This finding suggests that the same β form of the cardiac MYHC gene is expressed in both ventricular and slow-twitch skeletal muscle. The promoter regions of both α- and β-MYHC genes, as well as the first four coding regions in the respective genes, have also been sequenced. The sequences in the 5'-flanking region of the α- and β-MYHC-encoding genes diverge extensively from one another, suggesting that expression of the α- and β-MYHC genes is independently regulated
Collaborative work between the West and Asia.
Hser, Yih-Ing; Bart, Gavin; Li, Li; Giang, Le Minh
2013-12-01
The "Collaborative Work between the West and Asia" session was chaired by Dr. Yih-Ing Hser and had three speakers. The speakers (and their topics) were: Dr. Gavin Bart (Collaborative Addiction Research in Asian Populations Home and Abroad), Dr. Li Li (Implementing Intervention Research Projects in Asia), and Dr. Le Minh Giang (Building Research Infrastructure for International Collaborative Studies on Substance Use Disorder and HIV: The Case of Hanoi Medical University/Vietnam).
Governance in Southeast Asia: Issues and Options
Gonzalez, Eduardo T.; Mendoza, Magdalena L.
2003-01-01
This paper attempts to analyze governance systems in Southeast Asia and proposes some policy suggestions that can improve governance practices in the region. It also discusses the links between governance and official development assistance and the role of the Japan Bank for International Cooperation. To put the discussion on governance systems in a proper context, the paper discusses the governance and growth nexus in Southeast Asia; describes the operating governance systems in Southeast As...
International trade and specialisation between Europe and Asia
DEFF Research Database (Denmark)
Hansen, Henning Otte
2016-01-01
and organizations. The analyses combine international trade theories with trade statistics and in this way results and conclusions are presented. The analyses show that international trade with fur skin products between Asia and Europe has increased remarkably during the recent decades. Europe accounts for a major......, that there is a major international trade of both fur skin and fur garments between Europe and Asia, and that the international specialisation in this sector is high.......The objective of this paper is to analyze, quantify and explain trade patterns and international specialisation within fur skin and fur garments focusing on Europa and Asia as two major trading partners. Data is provided from international trade statistics, national statistical institutions...
Panel discussion: LNG's future in Asia
International Nuclear Information System (INIS)
Ohashi, Tadahiko
1992-01-01
The panelists convened to: (1) identify and evaluate the role which LNG is likely to play in the changing energy scene; (2) to examine the future supply and demand structure of the LNG trade; (3) to discover the key obstacles to continued growth in LNG trade; and (4) to find solutions to these problems. The panelists identified and outlined growing opportunities for LNG utilization in Asia during the next two decades. They shared the opinion that the structure of the supply and demand balance for LNG in Asia will shift during the next decade, providing considerable room for new projects. The key obstacles to continued growth in LNG trade are the lack of: long-distance transmission networks and an efficient competitive market pricing mechanism for LNG in the Asian region. The major importers in the region are keen on developing a range of new long-term supply alternatives, not simply within the Asia-Pacific region, but also from a wider perspective. These alternatives include: financing the expansion of production from existing facilities, development of new fields, and construction of long-distance pipelines
Integrasi Ekonomi Asia: Solusi Asia Menghadapi Krisis Global 2008
Adrian Hidayat
2008-01-01
No economies throughout the region managed to escape from the "global economic crisis in 2008" that was initiated in the United States. This is a logical consequence of the global economy that has been rolling along. The world economy is increasingly becoming more integrated and interdependent with one another. Exposure stems from the economic crisis in the prolonged United States subprime mortgage financial crisis, and eventually dragged the European economy, and also Asia. The Asian region ...
Morinha, Francisco; Albuquerque, Carlos; Requicha, João; Dias, Isabel; Leitão, José; Gut, Ivo; Guedes-Pinto, Henrique; Viegas, Carlos; Bastos, Estela
2011-10-10
Periodontal disease (PD) is the most common inflammatory disease of the oral cavity of domestic carnivores. In Human Medicine molecular genetics research showed that several genes play a role in the predisposition and progression of this complex disease, primarily through the regulation of inflammatory mediators, but the exactly mechanisms are poorly understood. This study aims to contribute to the characterization of the genetic basis of PD in the dog, a classically accepted model in Periodontology. We searched for genetic variations in the interleukin-6 (IL6) gene, in order to verify its association with PD in a case-control study including 25 dogs in the PD case group and 45 dogs in the control group. We indentified and characterized three new genetic variations in IL6 gene. No statistically significant differences were detected between the control and PD cases groups. Our results do not support an evidence for a major role contribution of these variants in the susceptibility to PD in the analyzed population. Nevertheless, the sequence variant I/5_g.105G>A leads to an amino acid change (arginine to glutamine) and was predicted to be possibly damaging to the IL6 protein. A larger cohort and functional studies would be of extreme importance in a near future to understand the possible role of IL6 variants in this disease. Copyright © 2011 Elsevier B.V. All rights reserved.
Irons, Richard D; Le, Anh; Bao, Liming; Zhu, Xiongzeng; Ryder, John; Wang, Xiao Qin; Ji, Meirong; Chen, Yan; Wu, Xichun; Lin, Guowei
2009-12-01
The clinical, cytogenetic and molecular features of chronic lymphocytic leukemia/small lymphocytic lymphoma (CLL/SLL), a disease previously considered to be rare in Asia, were examined in consecutive series of 70 cases diagnosed by our laboratory over a 30-month period. Clonal abnormalities were observed in 80% of CLL/SLL cases using a combination of conventional cytogenetic and fluorescence in situ hybridization (FISH) analysis. Those involving 14q32/IGH were the most frequent (24 cases), followed by trisomy 12 and 11q abnormalities. IgV(H) gene usage was non-random with over-representation of V(H)4-34, V(H)3-23 and a previously unreported increase in V(H)3-48 gene use. Somatic hypermutation (SHM) of IgV(H) germline sequences was observed in 56.5% of cases with stereotyped patterns of SHM observed in V(H)4-34 heavy chain complimentary-determining (HCDR1) and framework region CFR2 sequences. These findings in a Chinese population suggest subtle geographical differences in IgV(H) gene usage while the remarkably specific pattern of SHM suggest that a relatively limited set of antigens may be involved in the development of this disease worldwide. IgV(H) gene mutation status was a significant predictor of initial survival in CLL/SLL. However, an influence of karyotype on prognosis was not observed.
Cohen, J. B.
2016-12-01
Due to intense and changing levels of emissions as well as highly non-linear chemical processing, the concentrations of aerosols and thus their impacts are not well known. Urban areas consist of the majority of the emissions of these species and their precursors over large periods of time, while wildfires contribute very large spikes, concentrated in space and over a period of weeks to months. Yet due to urban and economic expansion, as well as clouds amd low intensity burning, the spatial and temporal profiles of these species are changing, with both new sources appearing and old sources decreasing. New work incorporates measurements at different spatial andboptical resolutions from MODIS, MISR, and OMI, coupled with new sampling approaches with CALIOP and AERONET to search for, characterize, and spatially and temporally constrain aerosols. An advanced modeling system including aerosol chemistry, physics, optics, and transport, using a multi-modal and both externally mixed and core-shell mixing is used to quantify the magnitudes of these missing sources. Comparisons between the model and additional dozens of ground stations show extreme improvement when these new sources are included. This new approach is shown to identify new source regions of emissions, many of which were previously non-urbanized or were not found to contain any fire hotspots. In addition, the use of new models run under conditions including both missing local sources from regions such as the expanded urban areas in Southeast and East Asia and advanced chemical and aerosol routines, allow for a comprehensive analysis to be performed. The impacts of insitu chemistry, horizontal, and vertical transport of species, both on the Regional and Continental scale are also included. It is shown that for proper identification, especially on intra-annual and inter-annual variations, this approach is a large improvement throughout Asia, ranging from India, to Indonesia, to China and Japan. Results specific
Liu, Xiang; Li, Shangqi; Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A; Xu, Peng
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.
Peng, Wenzhu; Feng, Shuaisheng; Feng, Jianxin; Mahboob, Shahid; Al-Ghanim, Khalid A.
2016-01-01
The ATP-binding cassette (ABC) gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio) are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill) revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp. PMID:27058731
Directory of Open Access Journals (Sweden)
Xiang Liu
Full Text Available The ATP-binding cassette (ABC gene family is considered to be one of the largest gene families in all forms of prokaryotic and eukaryotic life. Although the ABC transporter genes have been annotated in some species, detailed information about the ABC superfamily and the evolutionary characterization of ABC genes in common carp (Cyprinus carpio are still unclear. In this research, we identified 61 ABC transporter genes in the common carp genome. Phylogenetic analysis revealed that they could be classified into seven subfamilies, namely 11 ABCAs, six ABCBs, 19 ABCCs, eight ABCDs, two ABCEs, four ABCFs, and 11 ABCGs. Comparative analysis of the ABC genes in seven vertebrate species including common carp, showed that at least 10 common carp genes were retained from the third round of whole genome duplication, while 12 duplicated ABC genes may have come from the fourth round of whole genome duplication. Gene losses were also observed for 14 ABC genes. Expression profiles of the 61 ABC genes in six common carp tissues (brain, heart, spleen, kidney, intestine, and gill revealed extensive functional divergence among the ABC genes. Different copies of some genes had tissue-specific expression patterns, which may indicate some gene function specialization. This study provides essential genomic resources for future studies in common carp.
Gui, Duan; Jia, Kuntong; Xia, Jia; Yang, Lili; Chen, Jialin; Wu, Yuping; Yi, Meisheng
2013-01-01
The Indo-Pacific humpback dolphin (Sousa chinensis), a marine mammal species inhabited in the waters of Southeast Asia, South Africa and Australia, has attracted much attention because of the dramatic decline in population size in the past decades, which raises the concern of extinction. So far, this species is poorly characterized at molecular level due to little sequence information available in public databases. Recent advances in large-scale RNA sequencing provide an efficient approach to generate abundant sequences for functional genomic analyses in the species with un-sequenced genomes. We performed a de novo assembly of the Indo-Pacific humpback dolphin leucocyte transcriptome by Illumina sequencing. 108,751 high quality sequences from 47,840,388 paired-end reads were generated, and 48,868 and 46,587 unigenes were functionally annotated by BLAST search against the NCBI non-redundant and Swiss-Prot protein databases (E-valueIndo-Pacific humpback dolphin, an endangered species. The de novo transcriptome analysis of the unique transcripts will provide valuable sequence information for discovery of new genes, characterization of gene expression, investigation of various pathways and adaptive evolution, as well as identification of genetic markers.
National Research Council Canada - National Science Library
1986-01-01
.... This report from the Near East/South Asia, Algeria, Egypt, Sudan, Tunisia, Israel, Lebanon, Afghanistan, Bangladesh, Iran and Pakistan, contains articles on Politics, Economics, Regional Affairs and Military Affairs...
Identifying key genes in rheumatoid arthritis by weighted gene co-expression network analysis.
Ma, Chunhui; Lv, Qi; Teng, Songsong; Yu, Yinxian; Niu, Kerun; Yi, Chengqin
2017-08-01
This study aimed to identify rheumatoid arthritis (RA) related genes based on microarray data using the WGCNA (weighted gene co-expression network analysis) method. Two gene expression profile datasets GSE55235 (10 RA samples and 10 healthy controls) and GSE77298 (16 RA samples and seven healthy controls) were downloaded from Gene Expression Omnibus database. Characteristic genes were identified using metaDE package. WGCNA was used to find disease-related networks based on gene expression correlation coefficients, and module significance was defined as the average gene significance of all genes used to assess the correlation between the module and RA status. Genes in the disease-related gene co-expression network were subject to functional annotation and pathway enrichment analysis using Database for Annotation Visualization and Integrated Discovery. Characteristic genes were also mapped to the Connectivity Map to screen small molecules. A total of 599 characteristic genes were identified. For each dataset, characteristic genes in the green, red and turquoise modules were most closely associated with RA, with gene numbers of 54, 43 and 79, respectively. These genes were enriched in totally enriched in 17 Gene Ontology terms, mainly related to immune response (CD97, FYB, CXCL1, IKBKE, CCR1, etc.), inflammatory response (CD97, CXCL1, C3AR1, CCR1, LYZ, etc.) and homeostasis (C3AR1, CCR1, PLN, CCL19, PPT1, etc.). Two small-molecule drugs sanguinarine and papaverine were predicted to have a therapeutic effect against RA. Genes related to immune response, inflammatory response and homeostasis presumably have critical roles in RA pathogenesis. Sanguinarine and papaverine have a potential therapeutic effect against RA. © 2017 Asia Pacific League of Associations for Rheumatology and John Wiley & Sons Australia, Ltd.
Silverman, Andrew M; Qiao, Kangjian; Xu, Peng; Stephanopoulos, Gregory
2016-04-01
Single cell oil (SCO) is an attractive energy source due to scalability, utilization of low-cost renewable feedstocks, and type of product(s) made. Engineering strains capable of producing high lipid titers and yields is crucial to the economic viability of these processes. However, lipid synthesis in cells is a complex phenomenon subject to multiple layers of regulation, making gene target identification a challenging task. In this study, we aimed to identify genes in the oleaginous yeast Yarrowia lipolytica whose overexpression enhances lipid production by this organism. To this end, we examined the effect of the overexpression of a set of 44 native genes on lipid production in Y. lipolytica, including those involved in glycerolipid synthesis, fatty acid synthesis, central carbon metabolism, NADPH generation, regulation, and metabolite transport and characterized each resulting strain's ability to produce lipids growing on both glucose and acetate as a sole carbon source. Our results suggest that a diverse subset of genes was effective at individually influencing lipid production in Y. lipolytica, sometimes in a substrate-dependent manner. The most productive strain on glucose overexpressed the diacylglycerol acyltransferase DGA2 gene, increasing lipid titer, cellular content, and yield by 236, 165, and 246 %, respectively, over our control strain. On acetate, our most productive strain overexpressed the acylglycerol-phosphate acyltransferase SLC1 gene, with a lipid titer, cellular content, and yield increase of 99, 91, and 151 %, respectively, over the control strain. Aside from genes encoding enzymes that directly catalyze the reactions of lipid synthesis, other ways by which lipogenesis was increased in these cells include overexpressing the glycerol-3-phosphate dehydrogenase (GPD1) gene to increase production of glycerol head groups and overexpressing the 6-phosphogluconolactonase (SOL3) gene from the oxidative pentose phosphate pathway to increase NADPH
Molecular characterization of Agrotis segetum nucleopolyhedrovirus from Poland
Jakubowska, A.K.; Oers, van M.M.; Ziemnicka, J.; Lipa, J.J.; Vlak, J.M.
2005-01-01
The turnip moth, Agrotis segetum (Lepidoptera, Noctuidae), is an important pest insect in Europe, Asia, and Africa. We have genetically characterized and classified a nucleopolyhedrovirus isolated from A. segetum larvae in Poland (AgseNPV-P). The restriction pattern of AgseNPV-P was distinct from an
Holding, David R.
2010-11-13
Quality protein maize (QPM) is a high lysine-containing corn that is based on genetic modification of the opaque2 (o2) mutant. In QPM, modifier genes convert the starchy endosperm of o2 to the vitreous phenotype of wild type maize. There are multiple, unlinked o2 modifier loci (Opm) in QPM and their nature and mode of action are unknown. We previously identified seven Opm QTLs and characterized 16 genes that are differentially up-regulated at a significant level in K0326Y QPM, compared to the starchy endosperm mutant W64Ao2. In order to further characterize these Opm QTLs and the genes up-regulated in K0326Y QPM, we created a population of 314 recombinant inbred lines (RILs) from a cross between K0326Y QPM and W64Ao2. The RILs were characterized for three traits associated with endosperm texture: vitreousness, density and hardness. Genetic linkage analysis of the RIL population confirmed three of the previously identified QTLs associated with o2 endosperm modification in K0326Y QPM. Many of the genes up-regulated in K0326Y QPM showed substantially higher levels of expression in vitreous compared with opaque RILs. These included genes associated with the upstream regulation of the ethylene response pathway, and a gene encoding a regulatory subunit of pyrophosphate-dependent fructose-6-phosphate 1-phosphotransferase, an adaptive enzyme of the glycolytic pathway. © 2010 Springer-Verlag.
Stroke in Asia: a global disaster.
Kim, Jong S
2014-10-01
Although stroke is a world-wide problem, the burden of stroke is particularly serious in Asia; its mortality is higher than in Europe or North America. The situation in Asia is dichotomized. Stroke mortality and case fatality has been declining in northern-eastern countries such as Korea, Japan, Taiwan, and urbanized areas of China. This is attributed to both the risk factor control and stroke care improvement. However, declining stroke incidence is rarely observed, which is in part due to rapidly aging population. As a result, there is an increase in the number of stroke survivors who require long-term, costly care. The extremely low birth rate and relatively insecure social health system markedly increases the caregiver burden. The problem in southern Asian countries, such as India, Pakistan, Bangladesh, and Indonesia is more fundamental. With the improving control of infectious diseases, life expectancy is prolonged. However, risk factors such as hypertension, diabetes, obesity and cigarette smoking become prevalent, and are poorly controlled. Stroke neurologists, organized stroke centers, and diagnostic tools are insufficient, which has resulted in high stroke fatality and mortality. Throughout Asia, the most urgent priority should be the primary stroke prevention through promoting a healthy lifestyle, e.g. low salt intake, regular physical exercise, stopping smoking, government sectors should take a stronger initiative to accomplish this. The rapidly aging populations and stroke burden will shrink the economy and destabilize the society, not only in Asia but also globally unless appropriate efforts are promptly initiated, this may result in a global disaster. © 2014 World Stroke Organization.
CSIR Research Space (South Africa)
Gcebe, N
2017-04-01
Full Text Available Journal of Systematic and Evolutionary Microbiology: DOI 10.1099/ijsem.0.001678 Mycobacterium malmesburyense sp. nov., a non-tuberculous species of the genus Mycobacterium revealed by multiple gene sequence characterization Gcebe N Rutten V Gey...
DEFF Research Database (Denmark)
Mogensen, Line; Kinze, Carl Christian; Werge, Thomas
2006-01-01
A large number of mammalian species harbor a tandem repeat in exon III of the gene encoding dopamine receptor D4 (DRD4), a receptor associated with cognitive functions. In this study, a DRD4 gene exon III tandem repeat from the order Cetacea was identified and characterized. Included in our study...
Hematological and Molecular Characterization of Hb J-Buda [α61(E10)Lys → Asn, AAG > AAT].
Panyasai, Sitthichai; Permsripong, Nopphadol; Jaiping, Kanokwan; Khantarag, Pisuttinee; Pornprasert, Sakorn
2016-06-01
Hemoglobin (Hb) J-Buda [α61(E10)Lys → Asn, AAG > AAT] is a very rare α-chain variant found in South-East Asia. We analyzed hematological parameters and provided a rapid molecular analysis method for detection of this hemoglobinopathy in two Thai women who had severe microcytic anemia with Hb and MCV AAG → AAT mutation at codon 61 for Hb J-Buda on one allele of the α1-globin gene. The developed Allele-specific PCR (ASPCR) showed the 455 bp amplified fragment from Hb J-Buda allele. Thus, understanding of hematological characterizations and the developed ASPCR for diagnosis of Hb J-Buda are essential for genetic counseling of this hemoglobinopathy.
Directory of Open Access Journals (Sweden)
Tri Joko Raharjo
2011-12-01
Full Text Available Resveratrol is a potent anticancer agent resulted as the main product of enzymatic reaction between common precursor in plants and Stilbene Synthase enzyme, which is expressed by sts gene. Characterization of internal fragment of Stilbene Synthase (STS encoding gene from melinjo plant (Gnetum gnemon L. has been carried out as part of a larger work to obtain a full length of Stilbene Synthase encoding gene of the plant. RT-PCR (Reverse Transcriptase Polymerase Chain Reaction was performed using two degenerated primers to amplify the gene fragment. Ten published STS conserved amino acid sequences from various plant species from genebank were utilized to construct a pair of GGF2 (5' GTTCCACCTGCGAAGCAGCC 3' and GGR2 (5' CTGGATCGCACATCC TGGTG 3' primers. Both designed primers were predicted to be in the position of 334-354 and 897-916 kb of the gene respectively. Total RNA isolated from melinjo leaves was used as template for the RT-PCR amplification process using two-step technique. A collection of 0.58 DNA fragments was generated from RT-PCR amplification and met the expected results. The obtained DNA fragments were subsequently isolated, refined and sequenced. A nucleotide sequence analysis was accomplished by comparing it to the existed sts genes available in genebank. Homology analysis of the DNA fragments with Arachis hypogaea L00952 sts gene showed high similarity level. Taken together, the results are evidence that the amplified fragment obtained in this study is part of melinjo sts gene
LNG: in Asia, the demand should double by 2010
International Nuclear Information System (INIS)
Anon.
1996-01-01
In a well-documented study, ''Asia Gas Study'', published by the end of the first semester of 1996, the International Energy Agency (IEA) anticipated the doubling of the LNG demand from Asia, because of a more rapid growth of gas industry than for other energy industries. The regional gas trade should even triple by 2010. This study is the first from IEA about Asia and focusses on 6 key-countries: Brunei-Darussalam, Taiwan, Indonesia, the Republic of Korea, Malaysia and Thailand. About 7% of the worldwide natural gas reserves belong to Asia but this self-sufficiency will fall rapidly. This paper summarizes the forecasting and uncertainties of natural gas demand from Japan, South Korea, China and India by the year 2010. LNG producers such as Brunei and Australia but also Papua-New Guinea, Vietnam, Alaska and Middle East are ready to supply the Asian demand. (J.S.)
National Research Council Canada - National Science Library
1986-01-01
.... This report from the Near East/South Asia, Egypt, Libya, Tunisa, Iraq, Israel, Kuwait, Oman, Saudi Arabia, Syria, United Arab Emirates, Iran and Pakistan, the articles are on Politics, Economics...
Characterization of the Pichia pastoris protein-O-mannosyltransferase gene family.
Directory of Open Access Journals (Sweden)
Juergen H Nett
Full Text Available The methylotrophic yeast, Pichiapastoris, is an important organism used for the production of therapeutic proteins. However, the presence of fungal-like glycans, either N-linked or O-linked, can elicit an immune response or enable the expressed protein to bind to mannose receptors, thus reducing their efficacy. Previously we have reported the elimination of β-linked glycans in this organism. In the current report we have focused on reducing the O-linked mannose content of proteins produced in P. pastoris, thereby reducing the potential to bind to mannose receptors. The initial step in the synthesis of O-linked glycans in P. pastoris is the transfer of mannose from dolichol-phosphomannose to a target protein in the yeast secretory pathway by members of the protein-O-mannosyltransferase (PMT family. In this report we identify and characterize the members of the P. pastoris PMT family. Like Candida albicans, P. pastoris has five PMT genes. Based on sequence homology, these PMTs can be grouped into three sub-families, with both PMT1 and PMT2 sub-families possessing two members each (PMT1 and PMT5, and PMT2 and PMT6, respectively. The remaining sub-family, PMT4, has only one member (PMT4. Through gene knockouts we show that PMT1 and PMT2 each play a significant role in O-glycosylation. Both, by gene knockouts and the use of Pmt inhibitors we were able to significantly reduce not only the degree of O-mannosylation, but also the chain-length of these glycans. Taken together, this reduction of O-glycosylation represents an important step forward in developing the P. pastoris platform as a suitable system for the production of therapeutic glycoproteins.
CNA Maritime Asia Project. Workshop Two: Naval Developments in Asia
2012-08-01
Latin America and the Mediterranean. Over time, the Pacific Fleet will become the most important fleet in Russia. It will receive most (if not all...this required them to assume commercial risk in starting programmes before the contracts were finalized. 8 Gray, op cit, p 48. 29 CNA Maritime Asia...Three times in early 2011, China Maritime Surveillance vessels and a Chinese fishing boat curtailed seismic survey ships operations in designated
Collart, F R; Osipiuk, J; Trent, J; Olsen, G J; Huberman, E
1996-10-03
We have cloned and characterized the gene encoding inosine monophosphate dehydrogenase (IMPDH) from Pyrococcus furiosus (Pf), a hyperthermophillic archeon. Sequence analysis of the Pf gene indicated an open reading frame specifying a protein of 485 amino acids (aa) with a calculated M(r) of 52900. Canonical Archaea promoter elements, Box A and Box B, are located -49 and -17 nucleotides (nt), respectively, upstream of the putative start codon. The sequence of the putative active-site region conforms to the IMPDH signature motif and contains a putative active-site cysteine. Phylogenetic relationships derived by using all available IMPDH sequences are consistent with trees developed for other molecules; they do not precisely resolve the history of Pf IMPDH but indicate a close similarity to bacterial IMPDH proteins. The phylogenetic analysis indicates that a gene duplication occurred prior to the division between rodents and humans, accounting for the Type I and II isoforms identified in mice and humans.
Vaish, Swati; Awasthi, Praveen; Tiwari, Siddharth; Tiwari, Shailesh Kumar; Gupta, Divya; Basantani, Mahesh Kumar
2018-05-01
Plant glutathione S-transferases (GSTs) are integral to normal plant metabolism and biotic and abiotic stress tolerance. The GST gene family has been characterized in diverse plant species using molecular biology and bioinformatics approaches. In the current study, in silico analysis identified 44 GSTs in Vigna radiata. Of the total 44 GSTs identified, chromosomal locations of 31 GSTs were confirmed. The pI value of GST proteins ranged from 5.10 to 9.40. The predicted molecular weights ranged from 13.12 to 50 kDa. Subcellular localization analysis revealed that all GSTs were predominantly localized in the cytoplasm. The active site amino acids were confirmed to be serine in tau, phi, theta, zeta, and TCHQD; cysteine in lambda, DHAR, and omega; and tyrosine in EF1G. The gene architecture conformed to the two-exon/one-intron and three-exon/two-intron organization in the case of tau and phi classes, respectively. MEME analysis identified 10 significantly conserved motifs with the width of 8-50 amino acids. The motifs identified were either specific to a specific GST class or were shared by multiple GST classes. The results of the current study will be of potential importance in the characterization of the GST gene family in V. radiata, an economically important leguminous crop.
Jeong, Chang-Bum; Kang, Hye-Min; Seo, Jung Soo; Park, Heum Gi; Rhee, Jae-Sung; Lee, Jae-Seong
2016-02-10
In copepods, no information has been reported on the structure or molecular characterization of the nitric oxide synthase (NOS) gene. In the intertidal copepod Tigriopus japonicus, we identified a NOS gene that is involved in immune responses of vertebrates and invertebrates. In silico analyses revealed that nitric oxide (NO) synthase domains, such as the oxygenase and reductase domains, are highly conserved in the T. japonicus NOS gene. The T. japonicus NOS gene was highly transcribed in the nauplii stages, implying that it plays a role in protecting the host during the early developmental stages. To examine the involvement of the T. japonicus NOS gene in the innate immune response, the copepods were exposed to lipopolysaccharide (LPS) and two Vibrio sp. After exposure to different concentrations of LPS and Vibrio sp., T. japonicus NOS transcription was significantly increased over time in a dose-dependent manner, and the NO/nitrite concentration increased as well. Taken together, our findings suggest that T. japonicus NOS transcription is induced in response to an immune challenge as part of the conserved innate immunity. Copyright © 2015 Elsevier B.V. All rights reserved.
Kojima, Kenji K; Kobayashi, Ichizo
2015-10-19
Asia and the Americas. In Malaysia, hrgC was horizontally transferred from hspEAsia to hpAsia2 strains. The PabI family of RM system behaves as a mobile, selfish genetic element, similar to the other families of Type II RM systems. Our analysis additionally revealed some cases of long-term inheritance. The distribution of the hrgC gene replacing the PabI family in the subpopulations of H. pylori, hspAmerind, hspEAsia and hpAsia2, corresponds to the two human migration events, one from East Asia to Americas and the other from China to Malaysia.