Rivard, M J; D'Errico, F; Tsai, J S; Ulin, K; Engler, M J
2002-01-01
The sup 2 sup 5 sup 2 Cf neutron air kerma strength conversion factor (S sub K sub N /m sub C sub f) is a parameter needed to convert the radionuclide mass (mu g) provided by Oak Ridge National Laboratory into neutron air kerma strength required by modern clinical brachytherapy dosimetry formalisms indicated by Task Group No. 43 of the American Association of Physicists in Medicine (AAPM). The impact of currently used or proposed encapsulating materials for sup 2 sup 5 sup 2 Cf brachytherapy sources (Pt/Ir-10%, 316L stainless steel, nitinol, and Zircaloy-2) on S sub K sub N /m sub C sub f was calculated and results were fit to linear equations. Only for substantial encapsulation thicknesses, did S sub K sub N /m sub C sub f decrease, while the impact of source encapsulation composition is increasingly negligible as Z increases. These findings are explained on the basis of the non-relativistic kinematics governing the majority of sup 2 sup 5 sup 2 Cf neutron interactions. Neutron kerma and energy spectra resul...
International Nuclear Information System (INIS)
Bigelow, J.E.; Cagle, E.B.; Knauer, J.B.
1987-01-01
The Transuranium Processing Plant (TPP) at ORNL has been requested by the Food and Drug Administration (FDA) to furnish 200 mg of 252 Cf for use in their new activation analysis facility. This paper discusses the procedure to be employed in fabricating the californium into four neutron sources, each containing a nominal 50-mg of 252 Cf. The ORNL Model LSD (Large, Stainless steel, Doubly encapsulated) neutron source consists of a 6.33-mm-diam aluminum pellet doubly encapsulated in Type 304L stainless steel. The pellet is comprised of an aluminum tube holding Cf 2 O 2 SO 4 microspheres confined by pressed aluminum powder. The microspheres are prepared in a separate vessel and then transferred into the specially designed aluminum tube prior to pressing
Determining {sup 252}Cf source strength by absolute passive neutron correlation counting
Energy Technology Data Exchange (ETDEWEB)
Croft, S. [Oak Ridge National Laboratory, Oak Ridge, TN 37831-6166 (United States); Henzlova, D., E-mail: henzlova@lanl.gov [Los Alamos National Laboratory, Los Alamos, NM 87545 (United States)
2013-06-21
Physically small, lightly encapsulated, radionuclide sources containing {sup 252}Cf are widely used for a vast variety of industrial, medical, educational and research applications requiring a convenient source of neutrons. For many quantitative applications, such as detector efficiency calibrations, the absolute strength of the neutron emission is needed. In this work we show how, by using a neutron multiplicity counter the neutron emission rate can be obtained with high accuracy. This provides an independent and alternative way to create reference sources in-house for laboratories such as ours engaged in international safeguards metrology. The method makes use of the unique and well known properties of the {sup 252}Cf spontaneous fission system and applies advanced neutron correlation counting methods. We lay out the foundation of the method and demonstrate it experimentally. We show that accuracy comparable to the best methods currently used by national bodies to certify neutron source strengths is possible.
Ternary-fragmentation-driving potential energies of 252Cf
Karthikraj, C.; Ren, Zhongzhou
2017-12-01
Within the framework of a simple macroscopic model, the ternary-fragmentation-driving potential energies of 252Cf are studied. In this work, all possible ternary-fragment combinations of 252Cf are generated by the use of atomic mass evaluation-2016 (AME2016) data and these combinations are minimized by using a two-dimensional minimization approach. This minimization process can be done in two ways: (i) with respect to proton numbers (Z1, Z2, Z3) and (ii) with respect to neutron numbers (N1, N2, N3) of the ternary fragments. In this paper, the driving potential energies for the ternary breakup of 252Cf are presented for both the spherical and deformed as well as the proton-minimized and neutron-minimized ternary fragments. From the proton-minimized spherical ternary fragments, we have obtained different possible ternary configurations with a minimum driving potential, in particular, the experimental expectation of Sn + Ni + Ca ternary fragmentation. However, the neutron-minimized ternary fragments exhibit a driving potential minimum in the true-ternary-fission (TTF) region as well. Further, the Q -value energy systematics of the neutron-minimized ternary fragments show larger values for the TTF fragments. From this, we have concluded that the TTF region fragments with the least driving potential and high Q values have a strong possibility in the ternary fragmentation of 252Cf. Further, the role of ground-state deformations (β2, β3, β4, and β6) in the ternary breakup of 252Cf is also studied. The deformed ternary fragmentation, which involves Z3=12 -19 fragments, possesses the driving potential minimum due to the larger oblate deformations. We also found that the ground-state deformations, particularly β2, strongly influence the driving potential energies and play a major role in determining the most probable fragment combinations in the ternary breakup of 252Cf.
Graphite moderated 252Cf source
International Nuclear Information System (INIS)
Sajo B, L.; Barros, H.; Greaves, E. D.; Vega C, H. R.
2014-08-01
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a 252 Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the 252 Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
System control for the modulated 252Cf source ''Shuffler''
International Nuclear Information System (INIS)
Stephens, M.M.
1975-06-01
The design and theory of operation of the control chassis for a 252 Cf nondestructive assay system are described. This system repetitively transfers a 252 Cf source from the irradiation region to a shielded position before measuring the delayed neutrons. The design criteria for the system were: rapid movement and precise positioning of the 252 Cf source, precise positioning of the sample, and very accurate timing of the irradiate and count cycles. To achieve these results crystal oscillators were used for timing, and stepping motors were used to position the sample and the source. (U.S.)
Laboratory-scale shielded cell for 252Cf
International Nuclear Information System (INIS)
Anderl, R.A.; Cargo, C.H.
1979-01-01
A shielded-cell facility for storing and handling remotely up to 2 milligram quantities of unencapsulated 252 Cf has been built in a radiochemistry laboratory at the Test Reactor Area of the Idaho National Engineering Laboratory. Unique features of this facility are its compact bulk radiation shield of borated gypsum and transfer lines which permit the transport of fission product activity from 252 Cf fission sources within the cell to a mass separator and to a fast radiochemistry system in nearby rooms
Graphite moderated {sup 252}Cf source
Energy Technology Data Exchange (ETDEWEB)
Sajo B, L.; Barros, H.; Greaves, E. D. [Universidad Simon Bolivar, Nuclear Physics Laboratory, Apdo. 89000, 1080A Caracas (Venezuela, Bolivarian Republic of); Vega C, H. R., E-mail: fermineutron@yahoo.com [Universidad Autonoma de Zacatecas, Unidad Academica de Estudios Nucleares, Cipres No. 10, Fracc. La Penuela, 98068 Zacatecas (Mexico)
2014-08-15
The thorium molten salt reactor is an attractive and affordable nuclear power option for developing countries with insufficient infrastructure and limited technological capability. In the aim of personnel training and experience gathering at the Universidad Simon Bolivar there is in progress a project of developing a subcritical thorium liquid fuel reactor. The neutron source to run this subcritical reactor is a {sup 252}Cf source and the reactor will use high-purity graphite as moderator. Using the MCNP5 code the neutron spectra of the {sup 252}Cf in the center of the graphite moderator has been estimated along the channel where the liquid thorium salt will be inserted; also the ambient dose equivalent due to the source has been determined around the moderator. (Author)
Testing Moderating Detection Systems with 252Cf-Based Reference Neutron Fields
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
Calibration measurements were carried out on a probe designed to measure ambient dose equivalent in accordance with ICRP Pub 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diameter spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV. The instrument was used to measure the dose rate in four separate neutron fields: unmoderated 252 Cf, D 2 O-moderated 252 Cf, polyethylene-moderated 252 Cf, and WEP neutron howitzer with 252 Cf at its center. Dose equivalent measurements were performed at source-detector centerline distances from 50 to 200 cm. The ratio of air-scatter- and room-return-corrected ambient dose equivalent rates to ambient dose equivalent rates calculated with the code MCNP are tabulated
Radiation ulcers in patients with cancer of the torgue after 252Cf therapy
International Nuclear Information System (INIS)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I.
1984-01-01
Interstitial therapy with 252 Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with 252 Cf doesn't differ sufficiently from the course of radiation injuries, occurring after γ-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with 252 Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongUe ulcers after interstitial therapy with 252 Cf
Neutron shielding for a 252 Cf source
International Nuclear Information System (INIS)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M.; Eduardo Gallego, Alfredo Lorente
2006-01-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a 252 Cf isotopic neutron source. During calculations a detailed model for the 252 Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare 252 Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
Neutron Spectra, Fluence and Dose Rates from Bare and Moderated Cf-252 Sources
Energy Technology Data Exchange (ETDEWEB)
Radev, Radoslav P. [Lawrence Livermore National Lab. (LLNL), Livermore, CA (United States)
2016-04-01
A new, stronger 252Cf source (serial number SR-CF-3050-OR) was obtained from Oak Ridge National Laboratory (ORNL) in 2014 to supplement the existing 252Cf sources which had significantly decayed. A new instrument positioning track system was designed and installed by Hopewell Designs, Inc. in 2011. The neutron field from the new, stronger 252Cf source in the modified calibration environment needed to be characterized as well as the modified neutron fields produced by the new source and seven different neutron moderators. Comprehensive information about our 252Cf source, its origin, production, and isotopic content and decay characteristics needed to be compiled as well. This technical report is intended to address these issues.
The status of low dose rate and future of high dose rate Cf-252 brachytherapy
International Nuclear Information System (INIS)
Rivard, M.J.; Wierzbicki, J.G.; Van den Heuvel, F.; Chuba, P.J.; Fontanesi, J.
1997-12-01
This work describes the current status of the US low dose rate (LDR) Cf-252 brachytherapy program. The efforts undertaken towards development of a high dose rate (HDR) remotely after loaded Cf-252 source, which can accommodate 1 mg or greater Cf-252, are also described. This HDR effort is a collaboration between Oak Ridge National Laboratory (ORNL), commercial remote after loader manufactures, the Gershenson Radiation Oncology Center (ROC), and Wayne State University. To achieve this goal, several advances in isotope chemistry and source preparation at ORNL must be achieved to yield a specific material source loading of greater than or equal 1 mg Cf-252 per mm3. Development work with both radioactive and non-radioactive stand-ins for Cf-252 have indicated the feasibility of fabricating such sources. As a result, the decreased catheter diameter and computer controlled source placement will permit additional sites (e.g. brain, breast, prostate, lung, parotid, etc.) to be treated effectively with Cf-252 sources. Additional work at the Radiochemical Engineering and Development Center (REDC) remains in source fabrication, after loader modification, and safe design. The current LDR Cf-252 Treatment Suite at the ROC is shielded and licensed to hold up to 1 mg of Cf-252. This was designed to maintain cumulative personnel exposure, both external to the room and in direct isotope handling, at less than 20 microSv/hr. However, cumulative exposure may be greatly decreased if a Cf-252 HDR unit is employed which would eliminate direct isotope handling and decrease treatment times from tilde 3 hours to an expected range of 3 to 15 minutes. Such a Cf-252 HDR source will also demonstrate improved dose distributions over current LDR treatments due to the ability to step the point-like source throughout the target volume and weight the dwell time accordingly
Radionuclide 252Cf neutron source
International Nuclear Information System (INIS)
Kolevatov, Yu.I.; Trykov, L.A.
1979-01-01
Characteristics of radionuclide neutron sourses of 252 Cf base with the activity from 10 6 to 10 9 n/s have been investigated. Energetic distributions of neutrons and gamma-radiation have been presented. The results obtained have been compared with other data available. The hardness parameter of the neutron spectrum for the energy range from 3 to 15 MeV is 1.4 +- 0.02 MeV
Radiation ulcers in patients with cancer of the tongue after /sup 252/Cf therapy
Energy Technology Data Exchange (ETDEWEB)
Galantseva, G.F.; Guseva, L.I.; Plichko, V.I. (Akademiya Meditsinskikh Nauk SSSR, Obninsk. Nauchno-Issledovatel' skij Inst. Meditsinskoj Radiologii)
1984-01-01
Interstitial therapy with /sup 252/Cf was conducted for 57 patients with cancer of the tongue. It was established that clinical course of radiation tungue ulcers after interstitial therapy with /sup 252/Cf doesn't differ sufficiently from the course of radiation injuries, occurring after ..gamma..-radiation application. Radiation ulcers are often observed in patients after the treatment of recurrent and residual tumors with /sup 252/Cf (in 33% of patients); the ulcers appeared in 15% of cases in patients after the treatment of initial ulcers tumors. Conservative treatment provide the cure of radiation tongue ulcers after interstitial therapy with /sup 252/Cf.
A survey of uses and users of 252Cf
International Nuclear Information System (INIS)
Bigelow, J.E.; Alexander, C.W.; King, L.J.; Knauer, J.B.; Notz, K.J.
1989-01-01
Californium-252, which is one of the transuranium-element isotopes being produced in the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL), has found many applications in service to industry and medicine. As a neutron source, 252 Cf is unique in providing a highly concentrated and extremely reliable neutron spectrum from a very small assembly. Over the past 22 years, 252 Cf has been applied with great success to cancer therapy, to neutron radiography of objects ranging from flowers to entire aircraft, to startup sources for nuclear reactors, to fission activation assay for quality control and safeguards of all commercial nuclear fuel, and to many other beneficial uses, some of which are now poised for further growth. The extensive exploitation of this highly specialized product has been made possible through 252 Sales/Loan programs sponsored by the US DOE Office of Nuclear Materials Production, initially at the Savannah River Laboratory and now at ORNL
Neutron shielding for a {sup 252} Cf source
Energy Technology Data Exchange (ETDEWEB)
Vega C, H.R.; Manzanares A, E.; Hernandez D, V.M. [Unidades Academicas de Estudios Nucleares e Ingenieria Electrica, Universidad Autonoma de Zacatecas, C. Cipres 10, Fracc. La Penuela, 98068 Zacatecas (Mexico); Eduardo Gallego, Alfredo Lorente [Depto. de Ingenieria Nuclear, ETS Ingenieros Industriales, Universidad Politecnica de Madrid, C. Jose Gutierrez Abascal 2, 28006 Madrid (Spain)]. e-mail: fermineutron@yahoo.com
2006-07-01
To determine the neutron shielding features of water-extended polyester a Monte Carlo study was carried out. Materials with low atomic number are predominantly used for neutron shielding because these materials effectively attenuate neutrons, mainly through inelastic collisions and absorption reactions. During the selection of materials to design a neutron shield, prompt gamma production as well as radionuclide production induced by neutron activation must be considered. In this investigation the Monte Carlo method was used to evaluate the performance of a water-extended polyester shield designed for the transportation, storage, and use of a {sup 252}Cf isotopic neutron source. During calculations a detailed model for the {sup 252}Cf and the shield was utilized. To compare the shielding features of water extended polyester, the calculations were also made for the bare {sup 252}Cf in vacuum, air and the shield filled with water. For all cases the calculated neutron spectra was utilized to determine the ambient equivalent neutron dose at four sites around the shielding. In the case of water extended polyester and water shielding the calculations were extended to include the prompt gamma rays produced during neutron interactions, with this information the Kerma in air was calculated at the same locations where the ambient equivalent neutron dose was determined. (Author)
A pneumatic transfer system for special form 252Cf
International Nuclear Information System (INIS)
Gehrke, R.J.; Berry, S.M.; Grafwallner, E.G.; Hoggan, J.M.
1996-09-01
A pneumatic transfer system has been developed for use with series 100 Special Form 252 Cf. It was developed to reduce the exposure to personnel handling sources of 252 Cf with masses up to 150 microg by permitting remotely activated two-way transfer between the storage container and the irradiation position. The pneumatic transfer system also permits transfers for reproducible repetitive irradiation periods. In addition to the storage container equipped with quick-release fittings, the transfer system consists of an irradiation station, a control box with momentary contact switches to activate the air-pressure control valves and indicators to identify the location of the source, and connecting air hose and electrical wire. A source of 20 psig air and 110 volt electrical power are required for operation of the transfer system which can be easily moved and set up by one individual in 5 to 10 minutes. Tests have shown that rarely does a source become lodged in the transfer tubing, but two methods have been developed to handle incomplete transfers of the 252 Cf source. The first method consists of closing one air vent to allow a pressure impulse to propel the source to the opposite side. The second method applies to those 252 Cf capsules with a threaded or tapped end to which a small ferromagnetic piece can be attached; an incompletely transferred source in the transfer tube can then be guided to a position of safety by surrounding the transfer tubing containing the capsule with a horseshoe magnet attached to the end of a long pole
Californium Cf-252 for pelvic radiotherapy
Energy Technology Data Exchange (ETDEWEB)
Maruyama, Y; Feola, J M; Tai, D; Wilson, L C; Van Nagell, J R; Yoneda, J
1978-01-01
Clinical data about therapy concerning tumors of the female gynecological cancers of the cervix, vagina and uterus are reviewed. Dosimetric, laboratory and radiobiological research data form the basis for an approach to such tumors using Cf-252 as a form of boost brachytherapy. Extreme personnel hazards are a real and important consideration and indicate that maximal containment and isolation procedures should be exercised in its use.
Determination of disintegration half-life of 252Cf
International Nuclear Information System (INIS)
Chen Keliang; Liu Guoxing; Wang Sufang; Zheng Jiwen
1991-01-01
The follow-up measurements have been made by using a Si(Au) detector with small solid angle geometry for α disintegration of 252 Cf. The measured half-life of disintegration is 2.638 ± 0.009 year. This value is in accordance with other previous results
Reactor production of 252Cf and transcurium isotopes
International Nuclear Information System (INIS)
Alexander, C.W.; Halperin, J.; Walker, R.L.; Bigelow, J.E.
1990-01-01
Berkelium, californium, einsteinium, and fermium are currently produced in the High Flux Isotope Reactor (HFIR) and recovered in the Radiochemical Engineering Development Center (REDC) at the Oak Ridge National Laboratory (ORNL). All the isotopes are used for research. In addition, 252 Cf, 253 Es, and 255 Fm have been considered or are used for industrial or medical applications. ORNL is the sole producer of these transcurium isotopes in the western world. A wide range of actinide samples were irradiated in special test assemblies at the Fast Flux Test Facility (FFTF) at Hanford, Washington. The purpose of the experiments was to evaluate the usefulness of the two-group flux model for transmutations in the special assemblies with an eventual goal of determining the feasibility of producing macro amounts of transcurium isotopes in the FFTF. Preliminary results from the production of 254g Es from 252 Cf will be discussed. 14 refs., 5 tabs
Characteristics of polyethylene-moderated 252Cf neutron sources
International Nuclear Information System (INIS)
Alejnikov, V.E.; Beskrovnaya, L.G.; Florko, B.V.
2000-01-01
Polyethylene-moderated 252 Cf neutron sources were designed to produce neutron reference fields' spectra that simulate the spectra observed in the workplaces within nuclear reactors and accelerators. The paper describes the neutron sources and fields. Neutron spectra were calculated by Monte Carlo method and compared with experimental data
International Nuclear Information System (INIS)
Ban, Sadayuki
1989-01-01
To assess the biological effects of neutrons, a man-made spontaneously fissioning isotope, Cf-252, is useful as an experimental model to obtain basic biological data on mixed radiation of gamma-rays and neutrons. The paper describes the lethal effect of Cf-252 radiation on human skin fibroblasts, its lethal and mutagenic effect on HeLa MR cells, and the micronuclei inducing effect on human peripheral lymphocytes. Dose-survival responses of three fibroblast cell strains exposed to Cf-252 radiation are measured. Individual difference is larger than the experimental fluctuation. D 10 values of each strain are obtained from the linear model and linear-quadratic model. Though the dose rate of X-ray is higher than that of Cf-252 radiations, the mean value of RBE(n+γ) is simply obtained as 1.86+0.31 (RBE:relative biological effectiveness). RBE(n) of Cf-252 neutrons to high-dose-rate X-rays is 2.29. After X-ray irradiation, the survival curve of HeLa MR cells gives an extrapolation number of 3.6. It is 1.3 after Cf-252 irradiation. At 50% survival, RBE(n+γ) and RBE(n) are 2.05 and 2.6, respectively. At 10% survival they are 2.05 and 2.6. The mutation frequencies after X-ray irradiation showed a significant non-linear increase with dose. Those after Cf-252 irradiation increase linearly with dose. (N.K.)
Decorporation of 241Am and 252Cf by Ca-DTPA from rat, Syrian and Chinese hamster
International Nuclear Information System (INIS)
Seidel, A.
1977-01-01
Retention and mobilization by Ca-DTPA of 241 Am and 252 Cf from rats, Syrian and Chinese hamsters are compared. Previous observations of a much longer residence time of actinides in hamsters liver than in rat liver are confirmed. Identical dose-effect functions were obtained for skeleton of rats and Syrian hamsters whereas 252 Cf removal from Chinese hamster skeleton was lower. The mobilization of 241 Am was lower than that of 252 Cf. With regard to species differences, qualitatively similar results were obtained for 241 Am as for 252 Cf. The results will be discussed with regard to the reduction by DTPA treatment of radiation risk in animal species with different biological half times of actinides in their livers. In this connection, attention will be paid to the usefulness of long-term DTPA treatment
Shielding experiments in different materials with 252Cf neutron spectra
International Nuclear Information System (INIS)
Sathian, Deepa; Marathe, P.K.; Pal, Rupali; Jayalakshmi, V.; Chourasiya, G.; Mayya, Y.S.
2008-01-01
Adequate shielding for neutron sources can be determined using analytical method or by actually measuring the attenuation for the target configuration. This paper describes the measurement of Half Value Thickness (HVT), Tenth Value Thickness (TVT), Σ values for four different shielding materials, using a standard 252 Cf neutron source and comparing with the values calculated using an empirical relationship. BF 3 based REM-counter is used for measurement of neutron dose equivalent, against different thickness of the shielding material. The experimental HVT and S values are in good agreement with the calculated values. From this study, it is concluded that, among the four materials studied, high density polyethylene (HDPE) is best suitable for the shielding of a 252 Cf neutron source. (author)
Energy and angular distributions of neutrons from 252Cf spontaneous fission
International Nuclear Information System (INIS)
Vasil'ev, Yu.A.; Sidorov, L.V.; Vasil'eva, N.K.
1982-01-01
Some results from a first series of measurements of energy and angular distributions of neutrons from 252 Cf spontaneous fission using a spectrometer with high neutron detection efficiency, i.e. a 4π neutron time-of-flight spectrometer, were already presented. Subsequently, a second series of measurements was performed using a more sophisticated technique. For this second series, we used a more intense 252 Cf layer (25,000 spontaneous fissions per second). The angular resolution was improved by a factor of 2-3 by combining the hexahedral counter modules, placed at the same angle with respect to the direction of motion of the fragments, in new panoramic counters. The neutron counters were calibrated against the average 252 Cf neutron spectrum at several positions of the axis of the fragment detector with respect to the neutron counters. In the spectrum measurements and calibration work, the scattered neutron background was not determined theoretically, as in the first series of measurements, but experimentally using four extra scintillation counters with scatter cones; the counters were set up at 60 deg., 80 deg., 100 deg., and 120 deg. to the direction of separation of the fragments
Time domain measurements for fast metal assemblies with /sup 252/Cf
Energy Technology Data Exchange (ETDEWEB)
Mihalczo, J T
1975-06-01
Time correlation measurements between the pulses from an ionization counter containing a /sup 252/Cf neutron source, which provided the initiators of fission chains in a neutron multiplying assembly and from sensors that detected particles from the fission chains are reviewed for fast uranium or plutonium metal assemblies. Comparisons are made between the correlated count rate from a /sup 252/Cf measurement and that from both one and two-detector Rossi-..cap alpha.. measurements. The assemblies studied were (1) unmoderated and polyethylene-moderated uranium (93 wt percent /sup 235/U) cylinders with masses from 12 to 160 kg; prompt neutron decay constants from 3 to 10/sup 3/ to 10/sup 8/ sec/sup -1/ and (2) unmoderated plutonium spheres and parts of spheres with plutonium masses from 2.2 to 16 kg with /sup 240/Pu contents of 4.5 to 20.1 at. percent. Measurements with a delayed critical uranium metal sphere determined the effective delayed neutron fraction and served as the basis for verification of the theory of the /sup 252/Cf measurement method in the time domain within a few per cent. (auth)
Implementation of 252Cf-source-driven power spectrum density measurement system
International Nuclear Information System (INIS)
Ren Yong; Wei Biao; Feng Peng; Li Jiansheng; Ye Cenming
2012-01-01
The principle of 252 Cf-source-driven power spectrum density measurement method is introduced. A measurement system and platform is realized accordingly, which is a combination of hardware and software, for measuring nuclear parameters. The detection method of neutron pulses based on an ultra-high-speed data acquisition card (three channels, 1 GHz sampling rate, 1 ns synchronization) is described, and the data processing process and the power spectrum density algorithm on PC are designed. This 252 Cf-source-driven power spectrum density measurement system can effectively obtain the nuclear tag parameters of nuclear random processes, such as correlation function and power spectrum density. (authors)
NAA using Cf-252 after preconcentration
International Nuclear Information System (INIS)
Panyo, O.; Moebius, S.; Keller, C.
1988-01-01
Neutron activation analysis (NAA) with thermal neutron using Cf-252 sources was applied to elemental analysis of elements in water samples. A high-resolution Ge(Li) detector was employed for gamma-radiation detection. Both suspended particulate matter and liquid fraction were investigated after filtration. Preconcentration method by co-precipitation using iron (III) hydroxide and oxine were chosen for use. Elements which were considered to be able to detect in the present study are Al, As, Cl, K, Mg, Mn, Na, Sr, Ti, U, V and Zn
Neutron emission during acceleration of 252Cf fission fragments
International Nuclear Information System (INIS)
Batenkov, O.I.; Blinov, M.V.; Blinov, A.B.; Smirnov, S.N.
1991-01-01
We investigate neutron emission during acceleration of fission fragments in the process of spontaneous fission of 252 Cf. Experimental angular and energy distributions of neutrons are compared with the results of calculations of neutron evaporation during fragment acceleration. (author). 8 refs, 3 figs
Determination of kinetics parameters using stochastic methods in a 252Cf system
International Nuclear Information System (INIS)
Difilippo, F.C.
1988-01-01
Safety analysis and control system design of nuclear systems require the knowledge of neutron kinetics related parameters like effective delayed neutron fraction, neutron lifetime, time between neutron generations and subcriticality margins. Many methods, deterministic and stochastic, are being used, some since the beginning of nuclear power, to measure these important parameters. The method based on the use of the 252 Cf neutron source has been under intense study at the Oak Ridge National Laboratory, both experimentally and theoretically, during the last years. The increasing demand for this isotope in industrial and medical applications and new designs of advanced high flux reactors to produce it make the isotope available as neutron source (only few micrograms are necessary). A thin layer of 252 Cf is deposited in one of the electrodes of a fission chamber which produces pulses each time the 252 Cf disintegrates via α or spontaneous fission decay; the smaller pulses associated with the α decay can be easily discriminated with the important result that we known the time when v/sub c/ neutrons are injected into the system (number of neutrons per fission of 252 Cf). Thus, a small (few cm 3 ) and nonintrusive device can be used as a random pulsed neutron source with known natural properties that do no depend on biases associated with more complex interrogating devices like accelerators. This paper presents a general formalism that relates the kinetics parameters with stochastic descriptors that naturally appear because of the random nature of the production and transport of neutrons
Analysis of geological material and especially ores by means of a 252Cf source
International Nuclear Information System (INIS)
Barrandon, J.N.; Borderie, B.; Melky, S.; Halfon, J.; Marce, A.
1976-01-01
Tests were made on the possibilities for analysis by 252 Cf activation in the earth sciences and mining research. The results obtained show that while 252 Cf activation can only resolve certain very specific geochemical research problems, it does allow the exact and rapid determination of numerous elements whose ores are of great economic importance such as fluorine, titanium, vanadium, manganese, copper, antimony, barium, and tungsten. The utilization of activation analysis methods in the earth sciences is not a recent phenomenon. It has generally been limited to the analysis of traces in relatively small volumes by means of irradiation in nuclear reactors. Traditional neutron sources were little used and were not very applicable. The development of 252 Cf isotopic sources emitting more intense neutron fluxes make it possible to consider carrying out more sensitive determinations without making use of a nuclear reactor. In addition, this technique can be adapted for in situ analysis in mines and mine borings. Our work which is centered upon the possibilities of instrumental laboratory analyses of geological materials through 252 Cf activation is oriented in two principal directions: the study of the experimental sensitivities of the various elements in different rocks with the usual compositions; and the study of the possibilities for routine ore analyses
Neutron activation analysis detection limits using 252Cf sources
International Nuclear Information System (INIS)
DiPrete, D.P.; Sigg, R.A.
2000-01-01
The Savannah River Technology Center (SRTC) developed a neutron activation analysis (NAA) facility several decades ago using low-flux 252 Cf neutron sources. Through this time, the facility has addressed areas of applied interest in managing the Savannah River Site (SRS). Some applications are unique because of the site's operating history and its chemical-processing facilities. Because sensitivity needs for many applications are not severe, they can be accomplished using an ∼6-mg 252 Cf NAA facility. The SRTC 252 Cf facility continues to support applied research programs at SRTC as well as other SRS programs for environmental and waste management customers. Samples analyzed by NAA include organic compounds, metal alloys, sediments, site process solutions, and many other materials. Numerous radiochemical analyses also rely on the facility for production of short-lived tracers, yielding by activation of carriers and small-scale isotope production for separation methods testing. These applications are more fully reviewed in Ref. 1. Although the flux [approximately2 x 10 7 n/cm 2 ·s] is low relative to reactor facilities, more than 40 elements can be detected at low and sub-part-per-million levels. Detection limits provided by the facility are adequate for many analytical projects. Other multielement analysis methods, particularly inductively coupled plasma atomic emission and inductively coupled plasma mass spectrometry, can now provide sensitivities on dissolved samples that are often better than those available by NAA using low-flux isotopic sources. Because NAA allows analysis of bulk samples, (a) it is a more cost-effective choice when its sensitivity is adequate than methods that require digestion and (b) it eliminates uncertainties that can be introduced by digestion processes
Evaluation of mass distribution data from 252Cf spontaneous fission
International Nuclear Information System (INIS)
Liu Tingjin
2003-01-01
The mass distribution data of 252 Cf spontaneous fission were evaluated based on 7 sets of available experimental data. The measured data were corrected for the standards and γ intensity used by using the new evaluated ones. The errors were made necessary adjusting. The evaluated experimental data were fitted with spline function without any restriction and with symmetric restriction. These two sets of fit data were recommended as reference data of the mass distribution of 252 Cf spontaneous fission. The errors of the recommended data were considerably reduced comparing with the measured ones. The light and heavy peaks are not completely symmetric. Also there are fine structures on the right side of the light peak at A=109-111 and left side of the heavy peak at A=137-139. These should be paid attention and studied further. (author)
Effective source size as related to 252Cf neutron radiography
International Nuclear Information System (INIS)
Wada, Nobuo; Enomoto, Shigemasa; Tachikawa, Noboru; Nojiri, Toshiaki.
1977-01-01
The effective source size in 252 Cf thermal neutron radiography, relating to its geometrical unsharpness in image formation, is experimentally studied. A neutron radiographic system consists of a 160 μg 252 Cf neutron source, water moderator and divergent cadmium lined collimator. Thermal neutron image detection is performed with using a LiF scintillator and a high speed X-ray film to employ direct exposure method. The modulation transfer function, used for describing image quality, is derived from radiographic image corresponding to a cadmium plate with sharp edge. The modulation transfer function for the system is expressed by the product of the function for both geometrical and inherent unsharpness, and allows isolation of geometrical unsharpness as related to the effective size of the thermal neutron source. It is found to be 80 -- 90% of the collimator inlet diameter. (auth.)
Production, Distribution, and Applications of Californium-252 Neutron Sources
International Nuclear Information System (INIS)
Balo, P.A.; Knauer, J.B.; Martin, R.C.
1999-01-01
The radioisotope 252 Cf is routinely encapsulated into compact, portable, intense neutron sources with a 2.6-year half-life. A source the size of a person's little finger can emit up to 10 11 neutrons/s. Californium-252 is used commercially as a reliable, cost-effective neutron source for prompt gamma neutron activation analysis (PGNAA) of coal, cement, and minerals, as well as for detection and identification of explosives, laud mines, and unexploded military ordnance. Other uses are neutron radiography, nuclear waste assays, reactor start-up sources, calibration standards, and cancer therapy. The inherent safety of source encapsulations is demonstrated by 30 years of experience and by U.S. Bureau of Mines tests of source survivability during explosions. The production and distribution center for the U. S Department of Energy (DOE) Californium Program is the Radiochemical Engineering Development Center (REDC) at Oak Ridge National Laboratory (ORNL). DOE sells 252 Cf to commercial reencapsulators domestically and internationally. Sealed 252 Cf sources are also available for loan to agencies and subcontractors of the U.S. government and to universities for educational, research, and medical applications. The REDC has established the Californium User Facility (CUF) for Neutron Science to make its large inventory of 252 Cf sources available to researchers for irradiations inside uncontaminated hot cells. Experiments at the CUF include a land mine detection system, neutron damage testing of solid-state detectors, irradiation of human cancer cells for boron neutron capture therapy experiments, and irradiation of rice to induce genetic mutations
International Nuclear Information System (INIS)
Ji Gang; Guo Yong; Luo Yisheng; Zhang Wenzhong
2001-01-01
Objective: To provide useful parameters for neutron radiotherapy, the author presents results of a Monte Carlo simulation study investigating the dosimetric characteristics of linear 252 Cf fission neutron sources. Methods: A 252 Cf fission source and tissue equivalent phantom were modeled. The dose of neutron and gamma radiations were calculated using Monte Carlo Code. Results: The dose of neutron and gamma at several positions for 252 Cf in the phantom made of equivalent materials to water, blood, muscle, skin, bone and lung were calculated. Conclusion: The results by Monte Carlo methods were compared with the data by measurement and references. According to the calculation, the method using water phantom to simulate local tissues such as muscle, blood and skin is reasonable for the calculation and measurements of dose distribution for 252 Cf
International Nuclear Information System (INIS)
Murali, M.S.; Nair, A.G.C.; Gujar, R.B.; Jain, A.; Tomar, B.S.; Godbole, S.V.; Reddy, A.V.R.; Manchanda, V.K.
2008-07-01
The present report gives a description of the methodology for the separation of 248 Cm(III) from decayed 252 Cf (III) waste solution. The waste solution was first assayed for 252 Cf content by neutron counting using a neutron well coincidence counter. The sample was subjected to the chemical separation of 248 Cm (III) from 252 Cf (III) following anion and cation exchange chromatography. The alpha spectrum of the separated curium fraction showed peaks due to 246 Cm and 248 Cm while the corresponding alpha spectrum of californium fraction showed 249,250,251,252 Cf. The gamma ray abundances of 249 Cf were determined with respect to its gamma rays of 387 keV and the data agreed well with that in literature. Separated Cm(III) was further characterized by recording its time resolved fluorescence spectrum (TRFS) in aqueous medium. (author)
Cf-252 based neutron radiography using real-time image processing system
International Nuclear Information System (INIS)
Mochiki, Koh-ichi; Koiso, Manabu; Yamaji, Akihiro; Iwata, Hideki; Kihara, Yoshitaka; Sano, Shigeru; Murata, Yutaka
2001-01-01
For compact Cf-252 based neutron radiography, a real-time image processing system by particle counting technique has been developed. The electronic imaging system consists of a supersensitive imaging camera, a real-time corrector, a real-time binary converter, a real-time calculator for centroid, a display monitor and a computer. Three types of accumulated NR image; ordinary, binary and centroid images, can be observed during a measurement. Accumulated NR images were taken by the centroid mode, the binary mode and ordinary mode using of Cf-252 neutron source and those images were compared. The centroid mode presented the sharpest image and its statistical characteristics followed the Poisson distribution, while the ordinary mode showed the smoothest image as the averaging effect by particle bright spots with distributed brightness was most dominant. (author)
Monte Carlo simulation using MCNP4B for an optimal shielding design of a 252 Cf source
International Nuclear Information System (INIS)
Silva, Ademir X. da; Crispim, Verginia R.
2001-01-01
This study aim to investigate an optimum shielding design against neutrons and gamma-rays from a source of 252 Cf, using Monte Carlo simulation. The shielding materials studied were: borated polyethylene, borated-lead polyethylene and stainless steel. The Monte Carlo code MCNP, version 4B, was used to design shielding for 252 Cf based neutron irradiator systems. By normalizing the dose equivalent rate values presented to the neutron production rate of the source, the resulting calculations are independents of the intensity of actual 252 Cf source. The results shown what the total dose equivalent rates were reduced significantly by the shielding system optimization. (author)
Cf-252 neutron brachytherapy: an advance for bulky localized cancer therapy
International Nuclear Information System (INIS)
Maruyama, Y.
1984-01-01
The physical and radiobiogical basis as well as the rationale for neutron brachytherapy, using Cf-252, in human cancer therapy is reviewed. Cf-252 brachytherapy represents an economical and effective form of neutron radiotherapy that is readily and safely applied clinically. It can be used anywhere in the world without unusual personnel, equipment or facilities, or prohibitive expenses or maintenance costs. Used on bulky head and neck, thoracic, abdominal, pelvic, brain and appendage cancers, it overcomes hypoxic radioresistance and produces remarkable rates of tumor clearance. It is easily combined with photon radiotherapy and in proper schedules and doses, it can control advanced but still localized regional cancers to produce tumor cure. It will clear the local manifestations of recurrent or metastatic tumors or advanced stages of primary tumors and therefore in conjunction with other adjuvant therapies offers much more effective tumor control and palliation than present conventional therapy. (Auth.)
The application of n-γ discrimination in 252Cf spontaneous neutron TOF spectra measurement
International Nuclear Information System (INIS)
Zhou Haojun; Zhang Yi; Li Jiansheng; Jin Yu; Wang Jie; Li Chunyuan
2004-01-01
The BC501 scintillator is used as a fast neutron detector. The effect that the pulse rise time method was used to discriminate γ from 252 Cf spontaneous neutron TOF spectra is studied in the experiment. A pulse rise time separation spectra of γ and 252 Cf spontaneous neuron upon 1 MeV is obtained, the n-γ separation function reaches to 4.6. When the result of pulse rise time separation coincides with the time-of-flight spectra in which the neutron energy is upon 0.5 MeV, 0.8 MeV and 1.0 MeV, comparing with the anticoincidence, γ was eliminated 99.90% at least. (authors)
Frequency spectrum analysis of 252Cf neutron source based on LabVIEW
International Nuclear Information System (INIS)
Mi Deling; Li Pengcheng
2011-01-01
The frequency spectrum analysis of 252 Cf Neutron source is an extremely important method in nuclear stochastic signal processing. Focused on the special '0' and '1' structure of neutron pulse series, this paper proposes a fast-correlation algorithm to improve the computational rate of the spectrum analysis system. And the multi-core processor technology is employed as well as multi-threaded programming techniques of LabVIEW to construct frequency spectrum analysis system of 252 Cf neutron source based on LabVIEW. It not only obtains the auto-correlation and cross correlation results, but also auto-power spectrum,cross-power spectrum and ratio of spectral density. The results show that: analysis tools based on LabVIEW improve the fast auto-correlation and cross correlation code operating efficiency about by 25% to 35%, also verify the feasibility of using LabVIEW for spectrum analysis. (authors)
A new facility for non-destructive assay using a 252Cf source
International Nuclear Information System (INIS)
Stevanato, L.; Caldogno, M.; Dima, R.; Fabris, D.; Hao, Xin; Lunardon, M.; Moretto, S.; Nebbia, G.; Pesente, S.; Pino, F.; Sajo-Bohus, L.; Viesti, G.
2013-01-01
A new laboratory facility for non-destructive analysis (NDA) using a time-tagged 252 Cf source is presented. The system is designed to analyze samples having maximum size of about 20×25 cm 2 , the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. - Highlights: ► Tagged 252 Cf source setup. ► Material recognition and sample imaging with measurements of gamma ray and neutron transmission. ► Material identification via energy dependent neutron and gamma ray transmission measurements. ► Identification of layered material. ► Effects due to the sample thickness on the above identification techniques
Physical and biological dosimetries of Cf-252 radiation
International Nuclear Information System (INIS)
Yamashita, Hisao; Wada, Tadashi; Dokiya, Takushi; Hashimoto, Shozo
1986-01-01
Recently Cf-252 sources containing 300 μg have become available in a size identical to 1 Ci of Cs-137 and with the use of remotely controlled afterloading apparatus, safe therapy with little exposure to the therapist is now possible. Radiation leakage from the Cf-252 apparatus and from the treatment room was measured with REM-meter and it was possible to reduce the leakage from the treatment room to less than 1 mrem/h (gamma rays) and 0.5 mrem/h (neutrons). Measurement of fast neutrons was made with a twin chamber composed of a tissue equivalent ionization chamber and a carbon ionization chamber. The neutron dose in air and the absorbed dose in tissue equivalent water tank were measured, which showed that in air, neutrons were 70% and photons were 30% of dose. In water, greater distances from the source, neutrons attenuate and gamma rays increase in dose. The results of studies on the skin reaction of mice and sperm cleavage delay time of sea urchins indicated that the RBE ranges from 1.5 to 3.0 using the high dose rate system. Neutrons are remarkably affected by a time factor. With the use of high dose rate sources, the dose rate has become higher, but the overall time has been extended through dose fractionation and it was considered advisable to employ an RBE of 3-4 in these studies. (Auth.)
INAA using 252Cf neutron source at University of Pune
International Nuclear Information System (INIS)
Rajurkar, N.S.
2006-01-01
The review presents the work done over last two decades on Instrumental Neutron Activation Analysis (INAA) by our research group at University of Pune using 252 Cf spontaneous fission neutron source. The technique has been applied in different fields viz. numismatics, industry, agriculture, ayurveda, environmental and health sciences and diffusion studies. A brief discussion of the work is presented in this article. (author)
A Phase I/II Protocol Using 252Cf for the Treatment of Cervical Carcinoma
International Nuclear Information System (INIS)
Anita Mahajan; Mark J. Rivard; Evelyn R. Nunez; David E. Wazer
2000-01-01
For this clinical study, external photon beam irradiation will be given in a standard fashion with intravenous cisplatinum (CDDP) every week as a radiosensitizing agent. We will incorporate 252 Cf as the brachytherapy source replacing 192 Ir, theoretically improving patient outcomes with its lack of cell cycle and oxygen dependence, and a therapeutic ratio possibly greater than unity. Local tumor control and control of systemic disease are potentially feasible using 252 Cf to initially debulk and destroy local bulky tumor with CDDP and X rays to enhance treatment efficacy and treat minimal microscopic and distant micrometastases. The initial 22 Cf dose will be 1 Gy per weekly fraction with 0.25-Gy increments toward a 2.5-Gy limit. Patients will be stratified according to their stage, toxicities and outcomes will be monitored closely, and the study will be halted if undo morbidities are noted
Design of a setup for {sup 252}Cf neutron source for storage and analysis purpose
Energy Technology Data Exchange (ETDEWEB)
Hei, Daqian [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Zhuang, Haocheng [Xi’an Middle School of Shanxi Province, Xi’an 710000 (China); Jia, Wenbao, E-mail: jiawenbao@163.com [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China); Cheng, Can; Jiang, Zhou; Wang, Hongtao [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Chen, Da [Department of Nuclear Science and Engineering, College of Materials Science and Engineering, Nanjing University of Aeronautics and Astronautics, Nanjing 211106 (China); Collaborative Innovation Center of Radiation Medicine of Jiangsu Higher Education Institutions, Suzhou 215000 (China)
2016-11-01
{sup 252}Cf is a reliable isotopic neutron source and widely used in the prompt gamma ray neutron activation analysis (PGNAA) technique. A cylindrical barrel made by polymethyl methacrylate contained with the boric acid solution was designed for storage and application of a 5 μg {sup 252}Cf neutron source. The size of the setup was optimized with Monte Carlo code. The experiments were performed and the results showed the doses were reduced with the setup and less than the allowable limit. The intensity and collimating radius of the neutron beam could also be adjusted through different collimator.
A 252Cf based nondestructive assay system for fissile material
International Nuclear Information System (INIS)
Menlove, H.O.; Crane, T.W.
1978-01-01
A modulated 252 Cf source assay system 'Shuffler' based on fast-or-thermal-neutron interrogation combined with delayed-neutron counting has been developed for the assay of fissile material. The 252 Cf neutron source is repetitively transferred from the interrogation position to a shielded position while the delayed neutrons are counted in a high efficiency 3 He neutron well-counter. For samples containing plutonium, this well-counter is also used in the passive coincidence mode to assay the effective 240 Pu content. The design of an optimized neutron tailoring assembly for fast-neutron interrogation using a Monte Carlo Neutron Computer Code is described. The Shuffler system has been applied to the assay of fuel pellets, inventory samples, irradiated fuel and plutonium mixed-oxide fuel. The system can assay samples with fissile contents from a few milligrams up to several kilograms using thermal-neutron interrogation for the low mass samples and fast-neutron interrogation for the high mass samples. Samples containing 235 U- 238 U, or 233 U-Th, or UO 2 -PuO 2 fuel mixtures have been assayed with the Shuffler system. (Auth.)
Prompt neutron energy spectrum for the spontaneous fission of Cf-252
International Nuclear Information System (INIS)
Blinov, M.V.; Boykov, G.S.; Vitenko, V.A.
1985-06-01
The prompt neutron spectrum for the spontaneous fission of Cf-252 has been measured in 0.01-10 MeV region by the time-of-flight technique using a fast ionization chamber with U-235 layers as the neutron detector. Numerical data for the spectrum are presented, with an error file. (author)
International Nuclear Information System (INIS)
Lamaze, G.P.; Schima, F.J.; Eisenhauer, C.M.; Spiegel, V.
1988-01-01
Because of the similarity in energy dependence of the /sup 103/Rh(n,n') differential cross section to the kerma muscle response function for neutrons, rhodium may be useful as a neutron kerma monitor. In support of its use as a neutron monitor, the spectrum-averaged cross section σ-bar has been measured for a /sup 252/Cf fission neutron spectrum. Pairs of thin rhodium samples were irradiated on opposite sides of a thinly encapsulated /sup 252/Cf neutron source. The neutron emission rate of the /sup 252/Cf source was determined by the manganous sulfate (MnSO/sub 4/) bath technique. In this method, the californium source emission rate is determined by comparison to the known emission rate of NBS-I, a standard radium-beryllium neutron source. The neutron fluence incident on the rhodium samples is determined from the californium source strength, average sample-to-source distance, and the duration of the irradiation. Corrections are made for neutron scattering saturation of activity, and attenuation of the X rays by the sample during counting. The X rays were detected with an intrinsic germanium detector designed specifically for low-energy X-ray detection. The activity was not determined by absolute counting so that the final results depend on the value of P/sub Κx/, to total Κ X-ray emission probability. The results of five separate irradiations yield a value of σ-bar . P/sub Κx/ = 62.3 +- 1.9 mb. Using the most recently published value of P/sub Κx/ gives a value of σ-bar = 739 +- 22 mb. A discussion of systematic uncertainties is given
Validation of IRDFF in 252Cf Standard and IRDF-2002 Reference Neutron Fields
Directory of Open Access Journals (Sweden)
Simakov Stanislav
2016-01-01
Full Text Available The results of validation of the latest release of International Reactor Dosimetry and Fusion File, IRDFF-1.03, in the standard 252Cf(s.f. and reference 235U(nth,f neutron benchmark fields are presented. The spectrum-averaged cross sections were shown to confirm IRDFF-1.03 in the 252Cf standard spontaneous fission spectrum; that was not the case for the current recommended spectra for 235U(nth,f. IRDFF was also validated in the spectra of the research reactor facilities ISNF, Sigma-Sigma and YAYOI, which are available in the IRDF-2002 collection. The ISNF facility was re-simulated to remove unphysical oscillations in the spectrum. IRDFF-1.03 was shown to reproduce reasonably well the spectrum-averaged data measured in these fields except for the case of YAYOI.
Brachytherapy of carcinoma of vulva with 252Cf
International Nuclear Information System (INIS)
Spikalovas, V.; Sinkevicius, V.; Drulia, E.; Kurtinaitis, J.
1996-01-01
Thirty patients with carcinoma of vulva were treated with interstitial neutron radiotherapy with 252 Cf. Age of patients was from 32 to 83 years. Stage I was in I patient, stage II - in 12, stage III was in 10 patients. The diagnosis of vulvar cancer was made for the first time in 11 cases, 19 patients had recurrences after the initial treatment. Most of these patients also received external irradiation for cancer of vulva and bilateral inguinal sites with a single fraction dose of 2 Gy to a total dose 30-50 Gy. Enlarged inguinal lymph nodes were irradiated additionally to 60 Gy with reduced field of irradiation. When radiotherapy was used repeatedly interstitial brachytherapy comprised the major part of irradiation dose or the therapy was used alone delivering 35-55 iGy. We used 252 Cf sources with increased activity at the ends 20-30 mm long. A number of inserted sources varied from 2 to 10, irradiation dose rate from 20.3 to 236.7 cGy/h, time of irradiation from 10.2 to 12. hours, RBE from 4.6 to 6.33. Special template device made it possible to implant sources in strictly pre-set geometry. Analysis of survival of patients showed that 2 years survival was 66%, 3 years - 60%, and 5 years survival was 49%. In two cases necrotic epithelitis developed with following radiation ulcer which were cured in 3-4 months. Clinical data showed great effectiveness of interstitial neutron therapy having in mind that 19 patients were treated for recurrences of vulvar cancer after previuos treatment
The fast neutron emission spectrum of 252-Cf
International Nuclear Information System (INIS)
Bensch, F.
1979-07-01
The aim of this work was a new measurement of the neutron emission spectrum of 252-Cf neutron standard sources as the IAEA is offering to users. The main feature was the application of gas-filled proton-recoil spectrometers and no TOF technique. The special interest of this document was in the temperature parameter of the Maxwellian distribution and in its relative deviations. In this connection, special measurements with high energy resolution were carried out in a search for fine structure neutron groups, which have been observed in some TOF measurements, but could not be reproduced during this measurement
Approaches for the generation of a covariance matrix for the Cf-252 fission-neutron spectrum
International Nuclear Information System (INIS)
Mannhart, W.
1983-01-01
After a brief retrospective glance is cast at the situation, the evaluation of the Cf-252 neutron spectrum with a complete covariance matrix based on the results of integral experiments is proposed. The different steps already taken in such an evaluation and work in progress are reviewed. It is shown that special attention should be given to the normalization of the neutron spectrum which must be reflected in the covariance matrix. The result of the least-squares adjustment procedure applied can easily be combined with the results of direct spectrum measurements and should be regarded as the first step in a new evaluation of the Cf-252 fission-neutron spectrum. (author)
Development of neutron induced prompt γ-ray spectroscopy system using 252Cf
International Nuclear Information System (INIS)
Park, Yong-Joon; Song, Byung-Chul; Jee, Kwang-Yong
2003-01-01
For the design and set-up of neutron induced prompt γ-ray spectroscopy system using 252 Cf neutron source, the effects of shielding and moderator materials have been examined. The 252 Cf source being used for TLD badge calibration in Korea Atomic Energy Research Institute was utilized for this preliminary experiment. The γ-ray background and prompt γ-ray spectrum of the sample containing Cl were measured using HPGe (GMX 69% relative efficiency) located at the inside of the system connected to notebook PC at the outside of the system (about 20 meter distance). The background activities of neutron and γ-rays were measured with neutron survey meter as well as γ-ray survey meters, respectively and the system was designed to minimize the activities. Prompt γ-ray spectrum was measured using γ-γ coincident system for reduce the background and the continuum spectrum. The optimum system was designed and set up using the experimental data obtained
Simultaneous investigation of fission fragments and neutrons in 252Cf(s,f)
International Nuclear Information System (INIS)
Budtz-Joergensen, C.; Knitter, H.H.
1986-01-01
The gridded twin ion chamber developed at CBNM is used to measure the kinetic energy-, mass- and angular distributions of the fission fragments of 252 Cf in an advantageous 4π-geometry. Together with a neutron time-of-flight detector this experimental arrangement permits to measure the correlation between neutron emission, fragment angle, mass and energy in the spontaneous fission of 252 Cf. With the present experimental set-up a mass resolution for fission fragments of 0.5 a.m.u., an angular resolution of Δcosθ = 0.05 and a timing resolution of 0.7 ns FWHM were observed. Preliminary evaluations of the raw experimental data are presented for the fission fragment mass distribution, the average total kinetic energy and their variance as function of mass, the angular distribution between fragments and neutrons, the number of neutrons emitted per fragment as function of fragment mass, the average neutron emission energies as function of mass, and the prompt fission neutron spectrum averaged over all fragments. (author)
International Nuclear Information System (INIS)
Yamashita, H.; Hashimoto, S.; Wada, M.; Dokiya, T.
1986-01-01
Cf-252 fast neutron therapy with high intensity Cf-252 sources was tested for the treatment of advanced gynaecological cancers using a remotely controlled afterloading machine designed by the author and manufactured by Toshiba. Using high intensity sources and short treatment times in a special treatment room, personnel or environment exposure to radiation was at a safe level, i.e. almost nil. During 1978-1983 18 stage III cases of cancer of the uterine cervix were treated with complete response in 78% and 44% 5 year survivals. The types of acute and delayed effects of Cf-252 were the same as Co-60 or Cs-137 but the rectum was found sensitive in this system of brachytherapy. A dose of 1,000-1,500 cGy/6-10 F in 10-22 days of Cf-252 radiation was tolerated and produced tumor cure
{sup 5}He ternary fission yields of {sup 252}Cf and {sup 235}U(n,f)
Energy Technology Data Exchange (ETDEWEB)
Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Ramayya, A. V. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Hamilton, J. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Beyer, C. J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Kormicki, J. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Zhang, X. Q. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Rodin, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Formichev, A. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Kliman, J. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation); Krupa, L. [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna, Russia (Russian Federation)] (and others)
2000-04-01
The relative {sup 4}He and {sup 5}He ternary fission yields were determined from a careful analysis of the energy distribution of {alpha} spectra from a new measurement with a {sup 252}Cf source and from published data on {sup 252}Cf and {sup 235}U(n,f). The kinetic energies of the {sup 5}He and {sup 4}He ternary particles were found to be approximately 11 and 16 MeV, respectively. {sup 5}He particles contribute 10-20 % to the total alpha yield with the remainder originating from {sup 4}He accompanied fission. (c) 2000 The American Physical Society.
Dosimetric evaluation of 252Cf beam for use in radiobiology studies at Hiroshima University
International Nuclear Information System (INIS)
Hoshi, M.; Takeoka, S.; Tsujimura, T.; Kuroda, T.; Kawami, M.; Sawada, S.
1988-01-01
This report provides reliable tissue kerma in free air data by characterising the 252 Cf irradiating system and by comparing three dosimetry methods, paired chambers (ICRU 1977, 1978), Fricke and thermoluminescence dosemeter. (author)
International Nuclear Information System (INIS)
Kohno, Hiroyuki; Tatsunami, Shinobu; Hiroi, Tomoko; Kouyama, Hiroshi; Taniguchi, Masashi; Yago, Nagasumi; Nakamura, Iwao
1995-01-01
Bisbenzylisoquinoline alkaloids of Stephania cepharantha have been used for various clinical purposes and recently reevaluated as stimulators of interleukin secretion in tissues. We analyzed molecular stuctures of bisbenzylisoquinoline alkaloids by determining their molecular weights using the 252 Cf-plasma desorption mass spectrometry (PDMS). The spectra were accumulated for 500 000 fission events. The acceleration voltage used here was 15 kV. Samples were analyzed using nitrocellulose-coated sample targets. Of the 5 alkaloids studied here, cepharanthine gave a main peak of molecular weight of 606.1 for the theoretical molecular weight of 606.7. The other minor peaks were considered to be demethylated fragment ions. 252 Cf-PDMS should be quite useful in studying structure, metabolism and pharmacokinetics of various drugs with extremely low coefficients of variation. (author)
Optimization of in situ prompt gamma-ray analysis using a HPGe-252Cf probe
International Nuclear Information System (INIS)
Chien Chung; Jiunnhsing Chao
1991-01-01
Application of in situ measurements by the neutron-induced prompt gamma-ray activation analysis (PGAA) technique to geochemical analysis and mineral survey have been investigated. An in situ survey of water pollutants by PGAA techniques was first proposed in the authors' previous study, where a 2.7-μg 252 Cf neutron source used in connection with a gamma-ray detecting system to determine water pollutants was described. In this paper the authors describe a modified detection probe designed and constructed to look for the optimum conditions of various-intensity 252 Cf neutron sources in measurement of some elements in lake water. Detecting efficiencies at high-energy regions and detection limits for elements commonly found in polluted lakes were evaluated and predicted to investigate the potential application of the probe for in situ measurements
Power spectral density measurements with 252Cf for a light water moderated research reactor
International Nuclear Information System (INIS)
King, W.T.; Mihalczo, J.T.
1979-01-01
A method of determining the reactivity of far subcritical systems from neutron noise power spectral density measurements with 252 Cf has previously been tested in fast reactor critical assemblies: a mockup of the Fast Flux Test Facility reactor and a uranium metal sphere. Calculations indicated that this measurement was feasible for a pressurized water reactor (PWR). In order to evaluate the ability to perform these measurements with moderated reactors which have long prompt neutron lifetimes, measurements were performed with a small plate-type research reactor whose neutron lifetime (57 microseconds) was about a factor of three longer than that of a PWR and approx. 50% longer than that of a boiling water reactor. The results of the first measurements of power spectral densities with 252 Cf for a water moderated reactor are presented
Group Representation of the Prompt Fission Neutron Spectrum of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Croft, S.; Miller, K. A. [Safeguards Science and Technology Group (N-1), Nuclear Nonproliferation Division, Los Alamos National Laboratory, Los Alamos(United States)
2011-12-15
We review the spectral representation used for the prompt fission neutron spectrum of 252Cf in the International Organization for Standardization document ISO 8529-1. We find corrections to Table A.2, the discrete group structure form, of this report are needed. We describe the approach to generating replacement values and provide a new tabulation.
Dispersions and correlations of the distributions of products of 252Cf spontaneous fission
International Nuclear Information System (INIS)
Vidyakin, G.S.; Vyrodov, V.N.; Gurevich, I.I.; Kirillov, B.F.; Kozlov, Y.V.; Martem'yanov, V.P.; Sukhotin, S.V.; Tarasenkov, V.G.; Khakimov, S.K.
1982-01-01
We report the results of two experiments on study of the dispersions and correlations of the distributions of products of the spontaneous fission of 252 Cf. In each experiment about 10 8 fissions were recorded with simultaneous measurement of the number of neutrons produced and in one case the fragment kinetic energy and in the other case the energy of the prompt #betta# rays. The quantities obtained were the probabilities of production of a given number of neutrons per fission, the dispersions of the distributions of the number of neutrons produced and of the fragment kinetic energy, and the dependence of the average #betta#-ray energy and the average fragment kinetic energy on the number of neutrons produced. A calculation is made of the spectrum of the total energy carried away by fragments and neutrons, and its dispersion is determined. An estimate of the total energy release in the 252 Cf fission process is made
An evaluation of the spontaneous fission prompt neutron spectrum of 252Cf
International Nuclear Information System (INIS)
Bojkov, G.S.; Yurevich, V.I.
1987-01-01
An evaluation of the spontaneous fission prompt neutron spectrum of 252 Cf from 1 keV to 20 MeV is described. Variance-covariance matrices for a number of recent experimental data sets were constructed and used to evaluate the neutron spectrum following a Bayesian procedure. The evaluated spectrum is compared with various experimental and theoretical representations. (author)
Mass spectrometry with ionization induced by 252Cf fission fragments
International Nuclear Information System (INIS)
Sysoev, A.A.; Artaev, V.B.
1991-01-01
The review deals with mass-spectrometry with ionization induced by 252 Cf fission fragments. Equipment and technique of the analysis, analytic possibilities of the method are considered. The method permits to determine molecular masses of large nonvolatile biological molecules. The method is practically nondestructive, it possesses a high resolution over the depth and surface, which permits to use it for the analysis of surface of semiconductors, dielectrics, catalysts, for the study of formation kinetics of complex unstable molecules on the surface
Correlation studies of neutron multiplicities in the 252Cf spontaneous fission
International Nuclear Information System (INIS)
Alkhazov, I.D.; Dmitriev, V.D.; Kovalenko, S.S.; Kuznetsov, A.V.; Malkin, L.Z.; Petrzhak, K.A.; Petrov, B.F.; Shpakov, V.I.
1988-01-01
Correlations between the numbers of neutrons emitted by the 252 Cf spontaneous fission fragments have been studied as a function of the fragment mass and total kinetic energy. Behaviour of the neutron number dispersions and covariances was studied for the region of symmetric fission. Parameters of the complementary fragment excitation energy distribution (mean values, dispersions, covariances) were determined. Various factors describing correlations between the complementary fragment excitation energies are considered
Validating criticality calculations for spent fuel with 252Cf-source-driven noise measurements
International Nuclear Information System (INIS)
Mihalczo, J.T.; Krass, A.W.; Valentine, T.E.
1992-01-01
The 252 Cf-Source-driven noise analysis method can be used for measuring the subcritical neutron multiplication factor k of arrays of spent light water reactor (LWR) fuel. This type of measurement provides a parameter that is directly related to the criticality state of arrays of LWR fuel. Measurements of this parameter can verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. The practicality of a measurement depends on the ability to install the hardware required to perform the measurement. Source chambers containing the 252 Cf at the required source intensity for this application have been constructed and have operated successfully for ∼10 years and can be fabricated to fit into control rod guide tubes of PWR fuel elements. Fission counters especially developed for spent-fuel measurements are available that would allow measurements of a special 3 x 3 spent fuel array and a typical burnup credit rail cask with spent fuel in unborated water. Adding a moderator around these fission counters would allow measurements with the typical burnup credit rail cask with borated water and the special 3 x 3 array with borated water. The recent work of Ficaro on modifying the KENO Va code to calculate by the Monte Carlo method the time sequences of pulses at two detectors near a fissile assembly from the fission chain multiplication process, initiated by a 252 Cf source in the assembly allows a direct computer calculation of the noise analysis data from this measurement method
Dosimetric analysis of BNCT - Boron Neutron Capture Therapy - coupled to 252Cf brachytherapy
International Nuclear Information System (INIS)
Brandao, Samia F.; Campos, Tarcisio P.R.
2009-01-01
The incidence of brain tumors is increasing in world population; however, the treatments employed in this type of tumor have a high rate of failure and in some cases have been considered palliative, depending on histology and staging of tumor. Its necessary to achieve the control tumor dose without the spread irradiation cause damage in the brain, affecting patient neurological function. Stereotactic radiosurgery is a technique that achieves this; nevertheless, other techniques that can be used on the brain tumor control must be developed, in order to guarantee lower dose on health surroundings tissues other techniques must be developing. The 252 Cf brachytherapy applied to brain tumors has already been suggested, showing promising results in comparison to photon source, since the active source is placed into the tumor, providing greater dose deposition, while more distant regions are spared. BNCT - Boron Neutron Capture Therapy - is another technique that is in developing to brain tumors control, showing theoretical superiority on the rules of conventional treatments, due to a selective irradiation of neoplasics cells, after the patient receives a borate compound infusion and be subjected to a epithermal neutrons beam. This work presents dosimetric studies of the coupling techniques: BNCT with 252 Cf brachytherapy, conducted through computer simulation in MCNP5 code, using a precise and well discretized voxel model of human head, which was incorporated a representative Glioblastoma Multiform tumor. The dosimetric results from MCNP5 code were exported to SISCODES program, which generated isodose curves representing absorbed dose rate in the brain. Isodose curves, neutron fluency, and dose components from BNCT and 252 Cf brachytherapy are presented in this paper. (author)
International Nuclear Information System (INIS)
Maruyama, Y.; Wierzbicki, J.; Feola, J.M.
1993-01-01
Data for the 30 day bone marrow syndrome (BM-50) and the 6-10 day gastrointestinal (GI-50) syndrome for a one and two fraction schedule and acute and low dose rate irradiation using pure and mixed Cf-252 and photon radiation are presented. The radiation of Cf-252 is a mixture of neutrons and gamma rays. Balb/c mice of both sexes were total body irradiated with acute Co-60, low dose rate Cs-137 and Cf-252 using a 1 x and 2 x schedule. For low linear energy transfer radiations of Co-60 or Cs-137 there was expected to be an increase in the dose to produce the gastrointestinal and bone marrow syndromes with minimal change for Cf-252 neutrons. The proportion of photons in the Cf-252 radiation field were further altered by mixing Cs-137 with the Cf-252 sources and mice were total body irradiated with different proportions of photons to determine the effect on the radiation syndromes. The effects of mixing Cf-252 neutrons with different proportions of photons on the syndromes was determined. There was increase in BM-50 and GI-50 doses with fractionated or low dose rate photon irradiations and the dose modifying factors were 1.3-1.4 for the GI syndrome and 1.2 for the bone marrow syndrome. For Cf-252 there was minimal fractionation effect for the GI-50 syndrome, which increased by 1.1 for x 1 vs. x 2 fractions; for the BM-50 syndrome it rose by a 1.1 factor. For LDR Cs-137 the dose for the GI-50 syndrome rose 2.2-fold. For mixed neutron-photon radiation of 0%, 15%, 35%, and 65% η/γ mixtures, the dose to produce the BM-50 and GI-50 endpoints dropped sharply from 0 to 35% neutrons and remained flat thereafter. For major tissues such as the bone marrow and GI tract, Cf-252 behaved as high linear energy transfer for mixtures of neutrons and gamma rays when the radiations were delivered simultaneously at the low dose rates studied. 35 refs., 3 figs., 2 tabs
International Nuclear Information System (INIS)
Maruyama, Y.; Feola, J.M.; Magura, C.; Beach, J.L.
1986-01-01
R.B.E. of Cf-252 on lymphoid tissue was assessed by radiation study of spleen weight loss following acute Co-60, and low dose rate (L.D.R.) Cs-137 and Cf-252 irradiations. Acute Co-60 and L.D.R. Cs-137 dose-response followed two component exponential curves with a 1.3-fold greater effect of L.D.R. Cs-137 vs. acute Co-60 on the first slope and 1.9-fold greater effect for the 2nd slope. L.D.R. Cf-252 response was 1.3 x greater than acute Co-60 but was 1.0 vs. L.D.R. Cs-137 for the first slope indicating a similar effect of Cf-252 mixed neutron/gamma radiation to L.D.R. gamma radiation in producing spleen shrinkage. There was no effect of different sequences and schedules of mixing acute Co-60 with Cf-252 irradiation observed by endogenous CFU-S survival. The R.B.E. of 1.0 - 1.9 indicates that lymphohemopoietic in vivo, presumably well oxygenated, does not respond acutely or as sensitively as hypoxic tumor where R.B.E. is 5 - 7. (author)
International Nuclear Information System (INIS)
Vasil'ev, Yu.A.; Barashkov, Yu.A.; Golovanov, O.A.; Sidorov, L.V.
1977-01-01
A method for determining the average number of secondary neutrons anti ν produced in nuclear fission by the neutrons of the 252 Cf fission spectra by means of a 4π time-of-flight spectrometer is described. Layers of 252 Cf and an isotope studied are placed close to each other; if the isotope layer density is 1 mg/cm 2 probability of its fission is about 10 -5 per one spontaneous fission of californium. Fission fragments of 252 Cf and the isotope investigated have been detected by two surface-barrier counters with an efficiency close to 100%. The layers and the counters are situated in a measuring chamber placed in the center of the 4π time-of-flight spectrometer. The latter is utilized as a neutron counter because of its fast response. The method has been verified by carrying out measurements for 235 U and 239 Pu. A comparison of the experimental and calculated results shows that the method suggested can apply to determine the number of secondary neutrons in fission of isotopes that have not been investigated yet
In situ prompt gamma-ray activation analysis of water pollutants using a shallow 252Cf-HPGe probe
International Nuclear Information System (INIS)
Chung Chien; Tseng Tzucheng
1988-01-01
A shallow 252 Cf-HPGe probe used for in situ prompt γ-ray activation of water pollutants is described. A 2.7 μg 252 Cf neutron source and a 10% HPGe detector are inserted into a waterproof stainless steel probe, which is designed to be submerged and recovered in field operation. A laboratory test is performed to obtain the neutron flux distribution and prompt γ-ray contribution to the HPGe detector counts from around the submerged probe. The concentrations of toxic cadmium and chlorine in water are determined in the prompt γ-ray spectrum. The detection limit of industrial pollutants and some improvements of the current design are discussed. (orig.)
Neutron dose rate for {sup 252} Cf AT source in medical applications
Energy Technology Data Exchange (ETDEWEB)
Paredes, L.; Balcazar, M. [ININ, 52045 Ocoyoacac, Estado de Mexico (Mexico); Azorin, J. [UAM-I, 09340 Mexico D.F. (Mexico); Francois, J.L. [FI-UNAM, 04510 Mexico D.F. (Mexico)
2006-07-01
The AAPM TG-43 modified protocol was used for the calculation of the neutron dose rate of {sup 252}Cf sources for two tissue substitute materials, five normal tissues and six tumours. The {sup 252}Cf AT source model was simulated using the Monte Carlo MCNPX code in spherical geometry for the following factors: a) neutron air kerma strength conversion factor, b) dose rate constant, c) radial dose function, d) geometry factor, e) anisotropy function and f) neutron dose rate. The calculated dose rate in water at 1 cm and 90 degrees from the source long axis, using the Watt fission spectrum, was D{sub n}(r{sub 0}, {theta}{sub 0})= 1.9160 cGy/h-{mu}g. When this value is compared with Rivard et al. calculation using MCNP4B code, 1.8730 cGy/h-{mu}g, a difference of 2.30% is obtained. The results for the reference neutron dose rate in other media show how small variations in the elemental composition between the tissues and malignant tumours, produce variations in the neutron dose rate up to 12.25%. (Author)
Correlated spins of complementary fragment pairs in the spontaneous fission of 252Cf
International Nuclear Information System (INIS)
Smith, A. G.; Simpson, G. S.; Billowes, J.; Dagnall, P. J.; Durell, J. L.; Freeman, S. J.; Leddy, M.; Phillips, W. R.; Roach, A. A.; Smith, J. F.
1999-01-01
A study of the γ-ray decay of low-lying excited states in fragments produced in the spontaneous fission of 252 Cf has revealed a significant correlation between the angles of emission of the 2 1 + →0 1 + transitions of complementary fragment pairs. Calculations of the amount of dealignment that is needed to reproduce the measured a 2 values, and a comparison with the results of previous fragment-γ angular distribution measurements, suggests that at scission there may be significant population of m≠0 substates associated with the projection of the fragment spin vector on the fission axis. Fragments from the spontaneous fission of 248 Cm emit 2 1 + →0 1 + γ rays that show markedly reduced interfragment correlations, suggesting that either a larger role is played by the relative angular momentum of the fragments, or that the dealignment introduced by the neutron emission and statistical γ decay to the 2 1 + state is larger in 248 Cm than 252 Cf fission. (c) 1999 The American Physical Society
Fresnel zone plate imaging of a 252Cf spontaneous fission source
International Nuclear Information System (INIS)
Stalker, K.T.; Hessel, K.R.
1976-11-01
The feasibility of coded aperture imaging for nuclear fuel motion monitoring is shown using Cf 252 spontaneous fission source. The theory of coded aperture imaging for Fresnel zone plate apertures is presented and design considerations for zone plate construction are discussed. Actual images are obtained which demonstrate a transverse resolution of 1.7 mm and a tomographic resolution of 1.5 millimeters. The capability of obtaining images through 12.7 mm of stainless steel is also shown
Test and evaluation results of the 252Cf shuffler at the Savannah River Plant
International Nuclear Information System (INIS)
Crane, T.W.
1981-03-01
The 252 Cf Shuffler, a nondestructive assay instrument employing californium neutron source irradiation and delayed-neutron counting, was developed for measuring 235 U content of scrap and waste items generated at the Savannah River Plant (SRP) reactor fuel fabrication facility. The scrap and waste items include high-purity uranium-aluminum alloy ingots as well as pieces of castings, saw and lathe chips from machining operations, low-purity items such as oxides of uranium or uranium intermixed with flux materials found in recovery operations, and materials not recoverable at SRP such as floor sweepings or residues from the uranium scrap recovery operation. The uranium contains about 60% 235 U with the remaining isotopes being 236 U, 238 U, and 234 U in descending order. The test and evaluation at SRP concluded that the accuracy, safety, reliability, and ease of use made the 252 Cf Shuffler a suitable instrument for routine use in an industrial, production-oriented plant
International Nuclear Information System (INIS)
Valentine, T.E.; Mihalczo, J.T.
1993-01-01
The 252 Cf-source-driven noise analysis method has been used in measurements for subcritical configurations of fissile systems for a variety of applications. Measurements of 25 fissile systems have been performed with a wide variety of materials and configurations. This method has been applied to measurements for (1) initial fuel loading of reactors, (2) quality assurance of reactor fuel elements, (3) fuel preparation facilities, (4) fuel processing facilities, (5) fuel storage facilities, (6) zero-power testing of reactors, and (7) verification of calculational methods for assemblies with the neutron k 252 Cf source and commercially available detectors was feasible and to determine if the measurement could characterize the ability of the concrete to isolate the fissile material
International Nuclear Information System (INIS)
Vijayaraghavan, K.R.; Balasubramaniam, M.; Oertzen, W. von
2014-01-01
Splitting of heavy radioactive nucleus into three fragments is known as ternary fission. If the size of the fragments are almost equal it is referred to as true ternary fission. Recently, Yu. V. Pyatkov et al observed/reported the experimental observation of true ternary fission in 252 Cf. In this work, the possibilities of different true ternary fission modes of 252 Cf through potential energy surface (PES) calculations based on three cluster model (TCM) are discussed. In TCM a condition on the mass numbers of the fission fragments is implied as A 1 ≥ A 2 ≥ A 3 in order to avoid repetition of combinations. Due to this condition, the values of Z 3 vary from 0 to 36 and Z 2 vary from 16 to 51. Of the different pairs having similar (Z 2 , Z 3 ) with different potential energy, a pair possessing minimum potential energy is chosen. Thus identified favourable combinations are plotted. For the PES calculations the arrangement of the fragments is considered in the order of A 1 +A 2 +A 3 . i.e. the heavy and the lightest fragments are kept at the ends. It is seen that the deepest minimum in the PES occurs for Z 3 =2 labelled as (Z 2 ; 2) indicating He accompanied breakup as the most favourable one. Of which, the breakup with Z 2 around 46 to 48 is the least (shown by dashed (Z 1 = 50) and dotted (Z 1 = 52) lines indicating a constant Z 1 value). The other notable minima in the PES are labelled and they correspond to the (Z 2 , Z 3 ) pairs viz., (20, 20), (28, 20), (28, 28) and (32, 32). Of these four minima, the first three are associated with the magic numbers 20 and 28. For Z 3 =20, there are two minimums at (20,20) and (28,20) among them (28,20) is the lowest minimum through which the minimum-path passes, and it is the ternary decay observed by Yu. V. Pyatkov et al. The fourth minima is the most interesting due to the fact that it corresponds to true ternary fission mode with Z 2 =32, Z 3 =32 and Z 1 =34. The minimum potential energy path also goes through this true
Energy Technology Data Exchange (ETDEWEB)
Joshi, Jay Prakash [Los Alamos National Laboratory
2017-03-30
The effective application of international safeguards to research reactors requires verification of spent fuel as well as fresh fuel. To accomplish this goal various nondestructive and destructive assay techniques have been developed in the US and around the world. The Advanced Experimental Fuel Counter (AEFC) is a nondestructive assay (NDA) system developed at Los Alamos National Laboratory (LANL) combining both neutron and gamma measurement capabilities. Since spent fuel assemblies are stored in water, the system was designed to be watertight to facilitate underwater measurements by inspectors. The AEFC is comprised of six 3He detectors as well as a shielded and collimated ion chamber. The 3He detectors are used for active and passive neutron coincidence counting while the ion chamber is used for gross gamma counting. Active coincidence measurement data is used to measure residual fissile mass, whereas the passive coincidence measurement data along with passive gamma measurement can provide information about burnup, cooling time, and initial enrichment. In the past, most of the active interrogation systems along with the AEFC used an AmLi neutron interrogation source. Owing to the difficulty in obtaining an AmLi source, a 252Cf spontaneous fission (SF) source was used during a 2014 field trail in Uzbekistan as an alternative. In this study, experiments were performed to calibrate the AEFC instrument and compare use of the 252Cf spontaneous fission source and the AmLi (α,n) neutron emission source. The 252Cf source spontaneously emits bursts of time-correlated prompt fission neutrons that thermalize in the water and induce fission in the fuel assembly. The induced fission (IF) neutrons are also time correlated resulting in more correlated neutron detections inside the 3He detector, which helps reduce the statistical errors in doubles when using the 252Cf interrogation source instead of
Regularities in dose field formation for fixation of 252Cf and 60Co sources on the same plane
International Nuclear Information System (INIS)
Ivanov, V.N.; Vtyurin, B.M.; Ivanova, L.F.; Kondzhariya, Yu.R.
1983-01-01
A computerized study was made of a change in the correlation between the sizes of an irradiated volume and the distribution of sources. Criteria have been established for the utilization of 252 Cf and 60 Co sources of different active length and design placed on the same plane. Reference dose rate and its derivatives have been chosen as the main parameters that characterize a dose field. A dosimetric analysis was performed using the data for an adsorbed dose of neutrons in the tissue, taking account of high RBE of 252 Cf fast neutrons that equals 6-7, and a slight change of the local RBE value near the source resulting from a change of the effective spectrum of neutrons in combination with the growth of a contribution of #betta#-radiation into the summary dose with the removal from the source. The irradiated volume was evaluated by introducing 3 linear parameters - length, thickness and width. It has been shown that the ratio of the length of an irradiated volume to the active length of 252 Cf sources with radionuclide regular linear density changes from 0.7 with the isodose value of 85% up to 0.97 with the isodose value of 60%. For 60 Co sources with a higher linear density of the radionuclide on the edges the lower limit of this value equals 1. Intervals of changes in the rest of parameters have also been defined. The results obtained are presented graphically. The results of the study are used for a dosimetric control of the clinical trials of 252 Cf and 60 Co sources in the treatment of patients with tumors of the tongue, oral cavity fundus, lip and other sites
Identification of new neutron-rich rare-earth nuclei produced in /sup 252/Cf spontaneous fission
Greenwood, R C; Gehrke, R J; Meikrantz, D H
1981-01-01
A program of systematic study of the decay properties of neutron-rich rare-earth nuclei with 30 s
Investigation of the far asymmetric region in 252Cf(sf)
International Nuclear Information System (INIS)
Hambsch, F.-J.; Oberstedt, S.
1997-01-01
A twin Frisch-gridded ionization chamber has been used to measure the fission fragment mass, kinetic-energy and angular correlations for 252 Cf(sf). In total 2.5 x 10 8 events were collected. The focus was in the far asymmetric mass region, where enhancements in the yield had been found earlier. It could be shown, that these findings are due to false events, coming from either close geometries not properly taking into account the angular-dependent energy loss in the sample and backing, from a too large angular cone selected in case of studies employing ionization chambers, or even from poor target qualities. (orig.)
Trajectory calculations for the ternary cold fission of 252Cf
International Nuclear Information System (INIS)
Misicu, S.
1998-01-01
We compute the final kinetic energies of the fragments emitted in the light charged particle accompanied by cold fission of 252 Cf taking into account the deformation and the finite-size effects of the fragments and integrating the equations of motion for a three-body system subjected only to Coulomb forces. The initial conditions for the trajectory calculations were derived in the framework of a deformed cluster model which includes also the effect due to the absorbative nuclear part. Although the distributions of initial kinetic energies are rather broad we show that in cold fission the initial conditions can be better determined than in the usual spontaneous fission
Energy Technology Data Exchange (ETDEWEB)
Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Belier, G.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Inst.de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)
1997-06-01
The prompt {gamma} emission in the spontaneous fission of {sup 252}Cf is characterized by an energy spectrum which extends up to 20 MeV. It was established that the spectrum presents in the neighbourhood of symmetric fission an intensity bump in the 3-8 MeV {gamma} energy interval. The origin of this phenomenon is still not well understood, so that it was found interesting to carry out new measurements. The spectrum of the {gamma} rays emitted in spontaneous fission of {sup 252}Cf has been measurement in the EUROGAM II multidetector using photovoltaic cells to detect fragments. The aim of the experiment was to investigate the {gamma} yield enhancement which appears for mass fragment ratio near 132/120. This enhancement was found to be composed of two peaks located at 4 MeV and 5.5 MeV respectively. The results obtained confirm the intensity bound in the 3-8 MeV region but this augmentation reaches the maximum when the heavy fragment is near the mass 132. Beyond mass 140 the phenomenon diminish and the {gamma} spectrum regains the behaviour expected for a statistic emission. The additional structure at 5.5 MeV does not vary with excitation energy while the excitation function of the 4 MeV structure is more structured and presents a maximum when the excitation energy is near 8 MeV. It is likely that all or part of this observed phenomenon is due to a particular excitation mode of this isotope associated for instance with a low energy dipole resonance. A theoretical study of this collective effect is under way 3 refs.
Energy Technology Data Exchange (ETDEWEB)
Brandao, Samia de Freitas, E-mail: samiabrandao@gmail.com [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil). Departamento de Engenharia Nuclear; Campos, Tarcisio Passos Ribeiro de [Universidade Federal de Minas Gerais (UFMG), Belo Horizonte, MG (Brazil)
2013-06-15
Objective: comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and methods: simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results: intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively, on the healthy tissue, on the balloon periphery and on the /{sub 1} and /{sub 2} tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h{sup -1}.p{sup -1}.s, respectively on the healthy tissue, on the target tumor and on the /{sub 1} and /{sub 2} infiltration zones. Conclusion: Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones. (author)
Directory of Open Access Journals (Sweden)
Samia de Freitas Brandao
2013-07-01
Full Text Available Objective Comparative analysis of dosimetry in intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT for treatment of brain tumors. Materials and Methods Simulations of intracavitary balloon catheter brachytherapy with I-125 and in Cf-252 brachytherapy combined with BNCT were performed with the MCNP5 code, modeling the treatment of a brain tumor on a voxel computational phantom representing a human head. Absorbed dose rates were converted into biologically weighted dose rates. Results Intracavitary balloon catheter brachytherapy with I-125 produced biologically weighted mean dose rates of 3.2E-11, 1.3E-10, 1.9E-11 and 6.9E-13 RBE.Gy.h-1.p-1.s, respectively, on the healthy tissue, on the balloon periphery and on the I 1 and I 2 tumor infiltration zones. On the other hand, Cf-252 brachytherapy combined with BNCT produced a biologically weighted mean dose rate of 5.2E-09, 2.3E-07, 8.7E-09 and 2.4E-09 RBE.Gy.h-1.p-1.s, respectively on the healthy tissue, on the target tumor and on the I 1 and I 2 infiltration zones. Conclusion Cf-252 brachytherapy combined with BNCT delivered a selective irradiation to the target tumor and to infiltration zones, while intracavitary balloon catheter brachytherapy with I-125 delivered negligible doses on the tumor infiltration zones.
Application of modular neutron spectrometer to measure neutron spectra from fission of 252Cf
International Nuclear Information System (INIS)
Szeflinski, Z.; Osuch, S.; Popkiewicz, M.; Wilhelmi, Z.; Zelazny, Z.
1996-01-01
The neutron spectrometer MONA (Modular Neutron Array) and its test has been described. The spectrometers consist of eight BC-501A liquid scintillator detectors of BICRON which allow one to distinguish between the pulses from gamma quanta and neutrons using pulse shape discrimination (PSD) method. The electronic equipment for the PSD and the test result using the 252 Cf radioactive source are presented
An absolute measurement of 252Cf prompt fission neutron spectrum at low energy range
International Nuclear Information System (INIS)
Lajtai, A.; Dyachenko, P.P.; Kutzaeva, L.S.; Kononov, V.N.; Androsenko, P.A.; Androsenko, A.A.
1983-01-01
Prompt neutron energy spectrum at low energies (25 keV 252 Cf spontaneous fission has been measured with a time-of-flight technique on a 30 cm flight-path. Ionization chamber and lithium-glass were used as fission fragment and neutron detectors, respectively. Lithium glasses of NE-912 (containing 6 Li) and of NE-913 (containing 7 Li) 45 mm in diameter and 9.5 mm in thickness have been employed alternatively, for the registration of fission neutrons and gammas. For the correct determination of the multiscattering effects - the main difficulty of the low energy neutron spectrum measurements - a special geometry for the neutron detector was used. Special attention was paid also to the determination of the absolute efficiency of the neutron detector. The real response function of the spectrometer was determined by a Monte-Carlo calculation. The scattering material content of the ionization chamber containing a 252 Cf source was minimized. As a result of this measurement a prompt fission neutron spectrum of Maxwell type with a T=1.42 MeV parameter was obtained at this low energy range. We did not find any neutron excess or irregularities over the Maxwellian. (author)
Subcriticality determination by a new time-domain correlation experiment with a 252Cf neutron source
International Nuclear Information System (INIS)
Nishina, K.; Yamane, Y.; Ishiguro, S.; Miyoshi, Y.; Suzaki, T.; Kobayahi, I.
1985-01-01
As a candidate for the on-site subcriticality-monitoring method, a new time-domain correlation experiment is proposed. Hinted by the Cf-252 detector method of Mihalczo, three covariances are taken between the count of three detectors; namely an ionization chamber with Cf-252 coating, and two He-3 proportional counters. A ratio Q is formed from the three quantities such that it does not depend either on detector efficiencies or counting gate duration T, and then related to reactivity. A formulation is given deriving a theoretical expression for this Q, with the effect of higher spatial modes included. Experiments were carried out with a loading at Tank-type Critical Assembly of Japan Atomic Energy Research Institute, which is a slightly-enriched, and light-water moderated system. With fundamental mode approximation adopted in the data processing, reasonable agreements are observed between the present method and the reactivity scale that has been calibrated by water-level variety. The possibility of the present method is to be investigated further beyond the range of 7$ reported
252Cf-source-driven neutron noise analysis method
International Nuclear Information System (INIS)
Mihalczo, J.T.; King, W.T.; Blakeman, E.D.
1985-01-01
The 252 Cf-source-driven neutron noise analysis method has been tested in a a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor, k/sub eff/ has been satisfactorily determined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments and the development of theoretical methods to predict the experimental observables
252Cf-source-driven neutron noise analysis method
International Nuclear Information System (INIS)
Mihalczo, J.T.; King, W.T.; Blakeman, E.D.
1985-01-01
The 252 Cf-source-driven neutron noise analysis method has been tested in a wide variety of experiments that have indicated the broad range of applicability of the method. The neutron multiplication factor k/sub eff/ has been satisfactorily detemined for a variety of materials including uranium metal, light water reactor fuel pins, fissile solutions, fuel plates in water, and interacting cylinders. For a uranyl nitrate solution tank which is typical of a fuel processing or reprocessing plant, the k/sub eff/ values were satisfactorily determined for values between 0.92 and 0.5 using a simple point kinetics interpretation of the experimental data. The short measurement times, in several cases as low as 1 min, have shown that the development of this method can lead to a practical subcriticality monitor for many in-plant applications. The further development of the method will require experiments oriented toward particular applications including dynamic experiments and the development of theoretical methods to predict the experimental observables
A new facility for non-destructive assay using a 252Cf source.
Stevanato, L; Caldogno, M; Dima, R; Fabris, D; Hao, Xin; Lunardon, M; Moretto, S; Nebbia, G; Pesente, S; Pino, F; Sajo-Bohus, L; Viesti, G
2013-03-01
A new laboratory facility for non-destructive analysis (NDA) using a time-tagged (252)Cf source is presented. The system is designed to analyze samples having maximum size of about 20 × 25 cm(2), the material recognition being obtained by measuring simultaneously total and energy dependent transmission of neutrons and gamma rays. The equipment technical characteristics and performances of the NDA system are presented, exploring also limits due to the sample thickness. Some recent applications in the field of cultural heritage are presented. Copyright © 2012 Elsevier Ltd. All rights reserved.
A new type-B cask design for transporting 252Cf
International Nuclear Information System (INIS)
Simmons, C.M.
2000-01-01
A project to design, certify, and build a new US Department of Energy (DOE) Type B container for transporting >5 mg of 252 Cf is more than halfway to completion. This project was necessitated by the fact that the existing Oak Ridge National Laboratory (ORNL) Type B containers were designed and built many years ago and thus do not have the records and supporting data that current regulations require. Once the new cask is available, it will replace the existing Type B containers. The cask design is driven by the unique properties of 252 Cf, which is a very intense spontaneous fission neutron source and necessitates a large amount of neutron shielding. The cask is designed to contain up to 60 mg of 252 Cf in the form of californium oxide or californium oxysulfate, in pellet, wire, or sintered material forms that are sealed inside small special-form capsules. The new cask will be capable of all modes of transport (land, sea, and air). The ORNL team, composed of technical and purchasing personnel and using rigorous selection criteria, chose NAC, International (NAC), as the subcontractor for the project. In January 1997, NAC started work on developing the conceptual design and performing the analyses. The original design concept was for a tungsten alloy gamma shield surrounded by two concentric shells of NS-4-FR neutron shield material. A visit to US Nuclear Regulatory Commission (NRC) regulators in November 1997 to present the conceptual design for their comments resulted in a design modification when the question of potential straight-line cracking in the NS-4-FR neutron shield material arose. NAC's modified design includes offset, wedgelike segments of the neutron shield material. The new geometry eliminates concerns about straight-line cracking but increases the weight of the packaging and makes the fabrication more complex. NAC has now completed the cask design and performed the analyses (shielding, structural, thermal, etc.) necessary to certify the cask. The cask
Angular momenta of fission fragments in the {alpha}-accompanied fission of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Jandel, M.; Kliman, J.; Krupa, L.; Morhac, M. [Slovak Academy of Sciences, Department of Nuclear Physics, Bratislava (Slovakia); Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Hamilton, J.H.; Kormicki, J.; Ramayya, A.V.; Hwang, J.K.; Luo, Y.X.; Fong, D.; Gore, P. [Vanderbilt University, Department of Physics, Nashville, TN (United States); Ter-Akopian, G.M.; Oganessian, Yu.Ts.; Rodin, A.M.; Fomichev, A.S.; Popeko, G.S. [Joint Institute for Nuclear Research, Flerov Laboratory for Nuclear Reactions, Dubna (Russian Federation); Daniel, A.V. [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Rasmussen, J.O.; Macchiavelli, A.O.; Stoyer, M.A. [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R.; Cole, J.D.
2005-06-01
For the first time, average angular momenta of the ternary fission fragments {sup 100,102}Zr, {sup 106}Mo, {sup 144,146}Ba and {sup 138,140,142}Xe from the {alpha}-accompanied fission of {sup 252}Cf were obtained from relative intensities of prompt {gamma}-ray transitions with the use of the statistical model calculation. Average values of the angular momenta were compared with the corresponding values for the same fission fragments from the binary fission of {sup 252}Cf. Results indicate the presence of a decreasing trend in the average values of angular momenta induced in ternary fission fragments compared to the same binary fission fragments. On the average, the total angular momentum extracted for ternary fission fragments is {proportional_to}1.4{Dirac_h} lower than in binary fission. Consequently, results indicate that the mechanism of the ternary {alpha}-particles emission may directly effect an induction of angular momenta of fission fragments, and possible scenarios of such mechanisms are discussed. Further, the dependence of the angular momenta of {sup 106}Mo and {sup 140}Xe on the number of emitted neutrons from correlated pairs of primary fragments was obtained also showing a decreasing dependence of average angular momenta with increasing number of emitted neutrons. Consequences are briefly discussed. (orig.)
International Nuclear Information System (INIS)
Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R.
1997-01-01
The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of 252 Cf. The determination of the temperature was based on the measurement of the neutron spectra
International Nuclear Information System (INIS)
Yu Runlan; Li Xueliang; Cui Anzhi; Guo Jingru; Yan Shuhen; Tang Peijia; Liu Daming
1991-07-01
A rapid radiochemical procedure for Pd separation was developed. It was the first time to use radiochemical techniques to determine 114 Pd cumulative yield (2.50 ± 0.14)% in 252 Cf spontaneous fission. The cumulative yields of (3.50 ± 0.13)% and (3.70 ± 0.11)% for 112 Pd and 113g Ag were also obtained. These are in agreement with Skovorodkin's results. The cumulative yields determined show that there is a fine-structure at light peak of mass number A = 113 in the mass distribution of 252 Cf spontaneous fission
Energy Technology Data Exchange (ETDEWEB)
Bleuel, D L; Bernstein, L A; Burke, J T; Gibelin, J; Heffner, M D; Mintz, J; Norman, E B; Phair, L; Scielzo, N D; Sheets, S A; Snyderman, N J; Stoyer, M A; Wiedeking, M
2008-04-23
Coincident {gamma} rays from a {sup 252}Cf source were measured using an array of six segmented high-purity germanium (HPGe) Clover detectors each enclosed by 16 bismuth-germanate (BGO) detectors. The detectors were arranged in a cubic pattern around a 1 {micro}Ci {sup 252}Cf source to cover a large solid angle for {gamma}-ray measurement with a reasonable reconstruction of the multiplicity. Neutron multiplicity was determined in certain cases by identifying the prompt {gamma} rays from individual fission fragment pairs. Multiplicity distributions from previous experiments and theoretical models were convolved with the response function of the array and compared to the present results. These results suggest a {gamma}-ray multiplicity spectrum broader than previous measurements and models, and provide no evidence of correlation with neutron multiplicity.
International Nuclear Information System (INIS)
Pickrell, M.M.
1992-01-01
The 252 Cf shuffler assays fissile uranium and plutonium using active neutron interrogation and then counting the induced delayed neutrons. Using the shuffler, we conducted over 1700 assays of 55-gal. drums with 28 different matrices and several different fissionable materials. We measured the drums to diagnose the matrix and position effects on 252 Cf shuffler assays. The matrices incorporated metals, neutron poisons, and hydrogen in densities ranging from 0≤ pH ≤ 0.086 g/cm 3 , a range of cases more extreme than typically found in routine plant use. We used several neutron flux monitors during irradiation and kept statistics on the count rates of individual detector banks. The intent of these measurements was to gauge the effect of the matrix independently from the uranium assay
Average cross sections for the 252Cf neutron spectrum
International Nuclear Information System (INIS)
Dezso, Z.; Csikai, J.
1977-01-01
A number of average cross sections have been measured for 252 Cf neutrons in (n, γ), (n,p), (n,2n), (n,α) reactions by the activation method and for fission by fission chamber. Cross sections have been determined for 19 elements and 45 reactions. The (n,γ) cross section values lie in the interval from 0.3 to 200 mb. The data as a function of target neutron number increases up to about N=60 with minimum near to dosed shells. The values lie between 0.3 mb and 113 mb. These cross sections decrease significantly with increasing the threshold energy. The values are below 20 mb. The data do not exceed 10 mb. Average (n,p) cross sections as a function of the threshold energy and average fission cross sections as a function of Zsup(4/3)/A are shown. The results obtained are summarized in tables
Californium-252 radiotherapy sources for interstitial afterloading
International Nuclear Information System (INIS)
Permar, P.H.; Walker, V.W.
1976-01-01
Californium-252 neutron sources for interstitial afterloading were developed to investigate the value of this radionuclide in cancer therapy. Californium-252 seed assemblies contain essentially point sources of 252 Cf permanently sealed on 1-cm centers within a flexible plastic tube. The seed assemblies are fabricated with remotely operated, specially designed machines. The fabrication process involves the production of a Pt-10 percent Ir-clad wire with a 252 Cf 2 O 3 -Pd cermet core. The wire is swaged and drawn to size, cut to length, and welded in a Pt-10 percent Ir capsule 0.8 mm in diameter and 6 mm long. Each seed capsule contains approximately 0.5 microgram of 252 Cf. Because the effective half-life of 252 Cf is 2.6 years, the seed assemblies are not disposable and must be reused until their activities have decreased to unsuitable levels. The flexible plastic components must therefore have sufficient resistance to radiation damage to survive the neutron-plus-gamma radiation from 252 Cf. On the basis of accelerated irradiation tests with a large 252 Cf source, a recently developed fluoropolymer, ''Tefzel'' (trademark of E. I. du Pont de Nemours and Company) has adequate radiation resistance for this application. Californium-252 seed assembly systems are loaned by the United States Energy Research and Development Administration for clinical investigations under a protocol of the Radiation Therapy Oncology Group, U.S. National Cancer Institute
Energy Technology Data Exchange (ETDEWEB)
Paredes G, L.; Balcazar G, M. [ININ, 52045 Ocoyocac, Estado de Mexico (Mexico); Azorin N, J. [Universidad Autonoma Metropolitana, 09000 Mexico D.F. (Mexico); Francois L, J.L. [UNAM, 04500 Mexico D.F. (Mexico)]. e-mail: lpg@nuclear.inin.mx
2006-07-01
The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10{sup 6} n/s-{mu}g and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E{sub n} > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E{sub n} > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of {sup 252}Cf, to optimize and to individualize the patients treatments. (Author)
Burnout and gate rupture of power MOS transistors with fission fragments of 252Cf
International Nuclear Information System (INIS)
Tang Benqi; Wang Yanping; Geng Bin; Chen Xiaohua; He Chaohui; Yang Hailiang
2000-01-01
A study to determine the single event burnout (SEB) and single event gate rupture (SEGR) sensitivities of power MOSFET devices is carried out by exposure to fission fragments from 252 Cf source. The test method, test results, a description of observed burnout current waveforms and a discussion of a possible failure mechanism are presented. The test results include the observed dependence upon applied drain or gate to source bias and effect of external capacitors and limited resistors
Viability of neutron brachytherapy technique using Cf252 for tumors of salivary glands therapy
International Nuclear Information System (INIS)
Andrade, Lidia M.; Campos, Tarcisio P.R.
2000-01-01
Gland salivary tumors, although uncommon, present significant characteristics such as distant metastasis, recurrence and average survive of five year for treated patients. Those tumors presents low response to a conventional radiotherapy, photon and electron therapy; thus, this modality is associated with surgery. Fast neutron therapy has been presented better results in controlling the local tumor in comparison with conventional radiotherapy. Brachytherapy with Cf-252 presents an alternative treatment for tumors. Those radiotherapy technique are discussed and analyzed. (author)
HeLa cell tumor response to 60Co, Cs-137, Cf-252 radiations and cisplatin chemotherapy in nude mice
International Nuclear Information System (INIS)
Maruyama, Y.; Feola, J.M.; Beach, J.L.
1984-01-01
HeLa cells were implanted into athymic nude mice from tissue culture and solid tumors established (HeLa cell tumor or HCT). Large cell numbers of 1 X 10 7 were required to obtain consistent and progressive growth, and tumor growth followed a Gompertzian mode. Irradiation studies were carried out using acute Cobalt-60 (60Co), low-dose-rate (LDR) Cs-137 and LDR Cf-252. Cf-252, a neutron-emitting radioisotope, produced an immediate tumor shrinkage and regression response after a dose of 279 cGy. Acute 60Co or LDR Cs-137 irradiation with 1000 cGy had little effect on the HCT. After a dose of 2000 cGy of 60Co radiation tumor shrinkage followed a latent period of approximately 5 days. Cisplatin had no effect on the HCT in nude mice in stationary or late exponential growth
Californium-252: a remarkable versatile radioisotope
International Nuclear Information System (INIS)
Osborne-Lee, I.W.; Alexander, C.W.
1995-01-01
A product of the nuclear age, Californium-252 ( 252 Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, 252 Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of 252 Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the 252 Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, 252 Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of 252 Cf from ORNL is summarized herein
Californium-252: a remarkable versatile radioisotope
Energy Technology Data Exchange (ETDEWEB)
Osborne-Lee, I.W.; Alexander, C.W.
1995-10-10
A product of the nuclear age, Californium-252 ({sup 252}Cf) has found many applications in medicine, scientific research, industry, and nuclear science education. Californium-252 is unique as a neutron source in that it provides a highly concentrated flux and extremely reliable neutron spectrum from a very small assembly. During the past 40 years, {sup 252}Cf has been applied with great success to cancer therapy, neutron radiography of objects ranging from flowers to entire aircraft, startup sources for nuclear reactors, fission activation for quality analysis of all commercial nuclear fuel, and many other beneficial uses, some of which are now ready for further growth. Californium-252 is produced in the High Flux Isotope Reactor (HFIR) and processed in the Radiochemical Engineering Development Center (REDC), both of which are located at the Oak Ridge National Laboratory (ORNL) in Oak Ridge, Tennessee. The REDC/HFIR facility is virtually the sole supplier of {sup 252}Cf in the western world and is the major supplier worldwide. Extensive exploitation of this product was made possible through the {sup 252}Cf Market Evaluation Program, sponsored by the United States Department of Energy (DOE) [then the Atomic Energy Commission (AEC) and later the Energy Research and Development Administration (ERDA)]. This program included training series, demonstration centers, seminars, and a liberal loan policy for fabricated sources. The Market Evaluation Program was instituted, in part, to determine if large-quantity production capability was required at the Savannah River Laboratory (SRL). Because of the nature of the product and the means by which it is produced, {sup 252}Cf can be produced only in government-owned facilities. It is evident at this time that the Oak Ridge research facility can meet present and projected near-term requirements. The production, shipment, and sales history of {sup 252}Cf from ORNL is summarized herein.
Metronidazole in the treatment of cervical cancer using Cf-252 neutron brachytherapy
International Nuclear Information System (INIS)
Maruyama, Y.
1986-01-01
Metronidazole was tested for its possible use in the Cf-252 brachytherapy of cervical cancer as a radiosensitizer and to deal with anaerobic pelvic infection. 15 patients were treated by only 14 were evaluable. All stages from stage IB-IVB were treated and complete local tumor regression was noted in all cases although it could take place very slowly. 5/14 (36%) are 1.5-3 year survivors but only among the patients with stage I-II disease. No unusual radio-enhancing action was observed but metronidazole appeared to be useful to treat the vaginal, cervix and uterine infections often associated with high stage disease and bulky, ulcerative or necrotic tumors
Photon contributions from the 252Cf and 241Am–Be neutron sources at the PSI Calibration Laboratory
International Nuclear Information System (INIS)
Hoedlmoser, H.; Boschung, M.; Meier, K.; Stadtmann, H.; Hranitzky, C.; Figel, M.; Mayer, S.
2012-01-01
At the accredited PSI Calibration Laboratory neutron reference fields traceable to the national standards of the Physikalisch-Technische Bundesanstalt (PTB) in Germany are available for the calibration of ambient and personal dose equivalent (rate) meters and passive dosimeters. The photon contribution to the ambient dose equivalent in the neutron fields of the 252 Cf and 241 Am–Be sources was measured using various photon dose rate meters and active and passive dosimeters. Measuring photons from a neutron source usually involves considerable uncertainties due to the presence of neutron induced photons in the room, due to a non-zero neutron sensitivity of the photon detector, and last but not least due to the energy response of the photon detectors. Therefore eight independent detectors and methods were used to obtain a reliable estimate for the photon contribution of the two sources as an average of the individual methods. For the 241 Am–Be source a photon contribution of approximately 4.9% was determined and for the 252 Cf source a contribution of 3.6%.
International Nuclear Information System (INIS)
Soliman, N.F.
2012-01-01
Mining activities contribute immensely to trace element pollution .The present work studied the possibility of measuring heavy metals arising from gold mining areas Eastern Desert in Egypt using the isotopic 252 Cf neutron source. 38.5 g of the sample is irradiated in a neutron field of 252 Cf for 36.75 days and 0.3 mg of the sample is irradiated at the Pneumatic Irradiation Rabbit System (PIRS) built in the vertical thermal column of the ET-RR-2 reactor . The induced activities in the samples are measured using two high resolution f ray spectrometry systems (including two calibrated HPGe detectors). The kο standardization neutron activation analysis (kο-NAA) method was used to analyze the sample under investigation. Thermal to epithermal flux ratio fat the two irradiation positions are measured. The obtained results indicated that the values of the suspected heavy metals such as sodium, magnesium, potassium, manganese, arsenic, ruthenium and tantalum were higher than the background values, signifying accumulation of these heavy metals due to gold mining activities .The accuracy and precision of the method has been evaluated
International Nuclear Information System (INIS)
Yoshida, T.; Kanai, K.; Tsujimura, N.
2002-01-01
The authors developed the neutron reference calibration fields using a 252 Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the 252 Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO 2 -UO 2 mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments
International Nuclear Information System (INIS)
Mihalczo, J.T.; Valentine, T.E.; Mattingly, J.K.
1996-01-01
The 252 Cf-source-driven frequency analysis method can be used for measuring the subcritical neutron multiplication factor of arrays of LWR fuel and as little as a single PWR fuel assembly. These measurements can be used to verify the criticality safety margins of spent LWR fuel configurations and thus could be a means of obtaining the information to justify burnup credit for spent LWR transportation/storage casks. In addition, the data can be used to validate calculational methods for criticality safety. These measurements provide parameters that have a higher sensitivity to changes in fissile mass than neutron multiplication factor and thus serve as a better test of calculational methods. The analysis have also shown that measurement of the cross power spectral density (CPSD) between detectors on one side of a single fuel assembly and an internal or external 252 Cf source driving the fission chain multiplication process can be used for nondestructive assay of fissile mass along the length of the assembly. This CPSD is a smooth function of fissile mass and does not depend on the varying inherent source in the fuel assembly and thus is ideal for fissile mass assay
Design, Construction, and Modeling of a 252Cf Neutron Irradiator
Directory of Open Access Journals (Sweden)
Blake C. Anderson
2016-01-01
Full Text Available Neutron production methods are an integral part of research and analysis for an array of applications. This paper examines methods of neutron production, and the advantages of constructing a radioisotopic neutron irradiator assembly using 252Cf. Characteristic neutron behavior and cost-benefit comparative analysis between alternative modes of neutron production are also examined. The irradiator is described from initial conception to the finished design. MCNP modeling shows a total neutron flux of 3 × 105 n/(cm2·s in the irradiation chamber for a 25 μg source. Measurements of the gamma-ray and neutron dose rates near the external surface of the irradiator assembly are 120 μGy/h and 30 μSv/h, respectively, during irradiation. At completion of the project, total material, and labor costs remained below $50,000.
Cross-sections of 197Au(n,α)198Au and 63Cu(n,α)64Cu induced by 252Cf neutrons
International Nuclear Information System (INIS)
Mandal, Ranjita; Sengupta, D.; Roy, Malobika; Naik, Mamta; Bhoraskar, V.N.
2014-01-01
Analytical work, employing nuclear techniques, is normally carried out through (n,α) reaction because of the availability of neutrons either from reactors or laboratory sources such as Sb-Be, Am-Be, Ra-Be, Po-Be, 252 Cf, etc. The laboratory neutron sources are though portable and adaptable to a particular experimental arrangement, suffer from the disadvantage of slow neutron yield (except 252 Cf). In this set up since the neutrons available are monoenergetic, it was thought appropriate to initiate a program to measure cross-sections of a few nuclear reactions which have practical applications. Earlier studies on cross-section measurement of the reaction 197 Au(n,α) 198 Au and 63 Cu(n,α) 64 Cu has been carried out using different sources, monitors and techniques
International Nuclear Information System (INIS)
Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.R.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.
1990-01-01
The technique of particle detection by solid track detectors, types of developing and analysis of results are presented. Efficiency measurements of alpha particle detection with Makrofol e and surface barrier detector are made. Detection of Cf-252 fission fragments is shown. (L.C.)
International Nuclear Information System (INIS)
Kantelo, M.V.; Crandall, B.S.
1992-01-01
The iodine isotopes I-132, 1-133, I-134, and I-135, which have half-lives ranging from 53 minutes to 21 hours, are measured in the atmospheric effluent from the Savannah River Technology Center (SRTC) at the Savannah River Site (SRS) near Aiken, South Carolina. SRS is operated by Westinghouse Savannah River Company for the US Department of Energy (DOE). The isotopes' release rates range from 10 to 300 microcuries per week compared to the rate. The resulting annual dose from all iodine isotopes is minor; it comprises 0.01 percent of the total offsite dose due to atmospheric releases from SRS in 1990. Circumstantial evidence indicates the radioiodine originates from traces of unencapsulated Cf-252. The determination that spontaneous fission of Cf-252 is the source of the radioiodine has several ramifications. Radioactive fission-product isotopes of the noble gas elements krypton and xenon must also be released. Noble gases are more volatile and mobile than iodine. Also, the released iodine isotopes decay to xenon isotopes. The noble gases decay to non-gaseous elements that are transported along with radioiodine to the terrestrial environment by deposition from the SRTC plume. Only Sr-89 is believed to accumulate sufficiently in the environment to approach detectable levels. Given similar conditions in earlier years, releases of short-lived radioiodine have occurred undetected in routine monitoring since the early 1970s. Release rates 20 years ago would have been 200 times greater than current release rates. This report documents preliminary experiments conducted by SRTC and Environmental Monitoring Section (EMS) scientists. The release process and the environmental impact of fission products from Cf-252 should be thoroughly researched
Neutron-neutron angular correlations in spontaneous fission of 252Cf and 240Pu
Verbeke, J. M.; Nakae, L. F.; Vogt, R.
2018-04-01
Background: Angular anisotropy has been observed between prompt neutrons emitted during the fission process. Such an anisotropy arises because the emitted neutrons are boosted along the direction of the parent fragment. Purpose: To measure the neutron-neutron angular correlations from the spontaneous fission of 252Cf and 240Pu oxide samples using a liquid scintillator array capable of pulse-shape discrimination. To compare these correlations to simulations combining the Monte Carlo radiation transport code MCNPX with the fission event generator FREYA. Method: Two different analysis methods were used to study the neutron-neutron correlations with varying energy thresholds. The first is based on setting a light output threshold while the second imposes a time-of-flight cutoff. The second method has the advantage of being truly detector independent. Results: The neutron-neutron correlation modeled by FREYA depends strongly on the sharing of the excitation energy between the two fragments. The measured asymmetry enabled us to adjust the FREYA parameter x in 240Pu, which controls the energy partition between the fragments and is so far inaccessible in other measurements. The 240Pu data in this analysis was the first available to quantify the energy partition for this isotope. The agreement between data and simulation is overall very good for 252Cf(sf ) and 240Pu(sf ) . Conclusions: The asymmetry in the measured neutron-neutron angular distributions can be predicted by FREYA. The shape of the correlation function depends on how the excitation energy is partitioned between the two fission fragments. Experimental data suggest that the lighter fragment is disproportionately excited.
International Nuclear Information System (INIS)
Paredes G, L.; Balcazar G, M.; Azorin N, J.; Francois L, J.L.
2006-01-01
The Cf-252 is a fast neutrons emitting radioisotope by spontaneous fission that can be used as sealed source in medicine applications, industry and research. Commercially its offer sources of different sizes, compact and with a fast neutrons emission of the order of 10 6 n/s-μg and an energy spectra that presents respectively maxim and average energy in 2.1 MeV and 0.7 MeV. In medicine new applications are being developed for the treatment of patient with hypoxic and voluminous tumors, where the therapy with photons has not given positive results, as well as for the protocols of therapy treatment by boron neutron capture, where very small sources of Cf-252 will be used with the interstitial brachytherapy technique of high and low dose rate. In this work an analysis of how the small differences that exist in the elementary composition of 4 wicked tumors, 4 ICRU healthy tissues and 3 substitute materials of ICRU tissue used in dosimetry are presented, its generate changes in the neutrons kerma coefficient in function of the energy and consequently in the absorbed dose in the interval of 11 eV to 29 MeV. These differences can produce maximum variations of the neutron kerma coefficients ratio for E n > 1 keV of the one: 15% tumor/ICRU guest healthy tissue, 12% ICRU tumor/muscle, 12% ICRU healthy tissues ICRU/ICRU muscle, 22% substitutes tissue/tumor and 22% ICRU substitutes tissue/muscle. Also, it was found that the average value of the neutrons kerma coefficient for the 4 wicked tumors is from 6% to 7% smaller that the average value for the soft tissue in the interval energy of interest for therapy with fast neutrons with E n > 1 MeV. These results have a special importance during the planning process of brachytherapy treatments with sources of 252 Cf, to optimize and to individualize the patients treatments. (Author)
Energy Technology Data Exchange (ETDEWEB)
Popkiewicz, M.; Osuch, S.; Szeflinski, Z.; Sztampke, A.; Wilhelmi, Z.; Wolinska, M.; Zaganczyk, R. [Warsaw Univ., Inst. of Experimental Physics, Nuclear Physics Div., Warsaw (Poland)
1997-12-31
The detection system MONA (Modular Neutron Array) consisting of eight large BC-501A liquid scintillators, was applied to determine the temperature of fission fragments emitted in spontaneous fission of {sup 252}Cf. The determination of the temperature was based on the measurement of the neutron spectra. 5 refs, 2 figs.
Prompt neutron fission spectrum mean energies for the fissile nuclides and 252Cf
International Nuclear Information System (INIS)
Holden, N.E.
1985-01-01
The international standard for a neutron spectrum is that produced from the spontaneous fission of 252 Cf, while the thermal neutron induced fission neutron spectra for the four fissile nuclides, 233 U, 235 U, 239 Pu, and 241 Pu are of interest from the standpoint of nuclear reactors. The average neutron energies of these spectra are tabulated. The individual measurements are recorded with the neutron energy range measured, the method of detection as well as the average neutron energy for each author. Also tabulated are the measurements of the ratio of mean energies for pairs of fission neutron spectra. 75 refs., 9 tabs
International Nuclear Information System (INIS)
Melhus, C. S.; Rivard, M. J.; KurKomelis, J.; Liddle, C. B.; Masse, F. X.
2005-01-01
In support of the effort to begin high-dose rate 252 Cf brachytherapy treatments at Tufts-New England Medical Center, the shielding capabilities of a clinical accelerator vault against the neutron and photon emissions from a 1.124 mg 252 Cf source were examined. Outside the clinical accelerator vault, the fast neutron dose equivalent rate was below the lower limit of detection of a CR-39 etched track detector and below 0.14 ± 0.02 μSv h -1 with a proportional counter, which is consistent, within the uncertainties, with natural background. The photon dose equivalent rate was also measured to be below background levels (0.1 μSv h -1 ) using an ionisation chamber and an optically stimulated luminescence dosemeter. A Monte Carlo simulation of neutron transport through the accelerator vault was performed to validate measured values and determine the thermal-energy to low-energy neutron component. Monte Carlo results showed that the dose equivalent rate from fast neutrons was reduced by a factor of 100,000 after attenuation through the vault wall, and the thermal-energy neutron dose equivalent rate would be an additional factor of 1000 below that of the fast neutrons. Based on these findings, the shielding installed in this facility is sufficient for the use of at least 5.0 mg of 252 Cf. (authors)
Estimation of the LET threshold of single event upset of microelectronics in experiments with Cf-252
International Nuclear Information System (INIS)
Kuznetsov, N.V.; Nymmik, R.A.
1996-01-01
A method is proposed for analyzing single event upsets (SEU) in large scale integration circuits of random access memory (RAM) when exposed to Cf-252 fission fragments. The method makes is possible to find the RAM linear energy transfer (LET) threshold to be used for estimations of RAM SEU rates in space. The method is illustrated by analyzing experimental data for the 2 x 8 kbit CMOS/bulk RAM. (author)
Physics of the 252Cf-source-driven noise analysis measurement
International Nuclear Information System (INIS)
Valentine, T.E.; Mihalczo, J.T.; Perez, R.B.; Mattingly, J.K.
1997-01-01
The 252 Cf-source-driven noise analysis method is a versatile measurements tool that has been applied to measurements for initial loading of reactors, quality assurance of reactor fuel elements, fuel processing facilities, fuel reprocessing facilities, fuel storage facilities, zero-power testing of reactors, verification of calculational methods, process monitoring, characterization of storage vaults, and nuclear weapons identification. This method's broad range of application is due to the wide variety of time- and frequency domain signatures, each with unique properties, obtained from the measurement. The following parameters are obtained from this measurement: average detector count rates, detector multiplicities, detector autocorrelations, cross-correlation between detectors, detector autopower spectral densities, cross-power spectral densities between detectors, coherences, and ratios of spectral densities. All of these measured parameters can also be calculated using the MCNP-DSP Monte Carlo code. This paper presents a review of the time-domain signatures obtained from this measurement
International Nuclear Information System (INIS)
Khouri, M.T.F.C.; Koskinas, M.F.; Andrade, C. de; Vilela, E.C.; Hinostroza, H.; Kaschiny, J.E.A.; Costa, M.S. da; Rizzo, P.; Santos, W.M.S.
1990-01-01
A technique for particle detection by using track solid detector and also types of revealing and result analysis are presented concerned to Cf-252 fission fragments detection. Measurements of alpha particles detection efficiency using Makrofol E and surface barrier detector are performed. (L.C.J.A.)
Parameters for several plutonium nuclides and 252Cf of safeguards interest
International Nuclear Information System (INIS)
Zucker, M.S.; Holden, N.E.
1984-01-01
Sets of the neutron emission multiplicity distribution gleaned from the literature for plutonium nuclides and 252 Cf are considered. A methodology for rendering the different sets comparable is presented and used to convert the sets to a common basis such that the differences can be evaluated objectively and that allows realistic estimate of the uncertainties. This in turn permits development of a canonical consensus set in certain instances. Evaluated data on the average neutron multiplicity, the total half-lives, and the half-lives for spontaneous fission are also given. A careful search of the literature reveals that the data on neutron multiplicity distributions for many nuclides is surprisingly sparse, considering that almost thirty years has elapsed since the original pioneering work, which in some cases, yield the only reported value. 93 references, 26 tables
Energy Technology Data Exchange (ETDEWEB)
Yoshida, T.; Kanai, K.; Tsujimura, N. [Japan Nuclear Cycle Development Institute, Ibaraki-ken (Japan)
2002-07-01
The authors developed the neutron reference calibration fields using a {sup 252} Cf standard source surrounded with PMMA moderators at the Japan Nuclear Cycle Development (JNC), Tokai Works. The moderators are co-axial, hollow cylinders made of lead-contained PMMA with a thickness of 13.5, 35.0, 59.5 and 77.0mm, and the {sup 252} Cf source is guided to the geometric center of moderators by the pneumatic system. These fields can provide the moderated neutron spectra very similar to those encountered around the globe-boxes of the fabrication process of MOX (PuO{sub 2}-UO{sub 2} mixed oxide) fuel. The neutron energy spectrum at the reference calibration point was evaluated from the calculations by MCNP4B and the measurements by the INS-type Bonner multi-sphere spectrometer and the hydrogen-filled proportional counters. The calculated neutron spectra were in good agreements with the measured ones. These fields were characterized in terms of the neutron fluence rate, spectral composition and ambient dose equivalent rate, and have served for the response-characterization of various neutron survey instruments.
International Nuclear Information System (INIS)
Mihalczo, J.T.; Valentine, T.E.
1995-01-01
The development of MCNP-DSP, which allows direct calculation of the measured time and frequency analysis parameters from subcritical measurements using the 252 Cf-source-driven noise analysis method, permits the validation of calculational methods for criticality safety with in-plant subcritical measurements. In addition, a method of obtaining the bias in the calculations, which is essential to the criticality safety specialist, is illustrated using the results of measurements with 17.771-cm-diam, enriched (93.15), unreflected, and unmoderated uranium metal cylinders. For these uranium metal cylinders the bias obtained using MCNP-DSP and ENDF/B-V cross-section data increased with subcriticality. For a critical experiment [height (h) = 12.629 cm], it was -0.0061 ± 0.0003. For a 10.16-cm-high cylinder (k ∼ 0.93), it was 0.0060 ± 0.0016, and for a subcritical cylinder (h = 8.13 cm, k ∼ 0.85), the bias was -0.0137 ± 0.0037, more than a factor of 2 larger in magnitude. This method allows the nuclear criticality safety specialist to establish the bias in calculational methods for criticality safety from in-plant subcritical measurements by the 252 Cf-source-driven noise analysis method
Methods for Cf-252 cervix cancer therapy and treatment planning for GYN malignancies in Lexington
International Nuclear Information System (INIS)
Coffey, C.W.; Yoneda, J.; Beach, J.L.; Maruyama, Y.
1986-01-01
This paper presents the clinical physics methods and treatment planning techniques used in both the external beam and brachytherapy treatment of GYN malignancies in the Radiotherapy Department of the University of Kentucky Medical Center. Specific description of the departmental implant suite and brachytherapy procedures are included. The optimization of brachytherapy applicator placement, source arrangement, and normal and tumor total dose and dose distributions are presented. Quality assurance protocols for teletherapy and brachytherapy and patient and staff safety procedures with Cf-252 are discussed
Californium-252 interstitial implants in carcinoma of the tongue
International Nuclear Information System (INIS)
Vtyurin, B.M.; Ivanov, V.N.; Medvedev, V.S.; Galantseva, G.F.; Abdulkadyrov, S.A.; Ivanova, L.F.; Petrovskaya, G.A.; Plichko, V.I.
1985-01-01
A clinical study using 252 Cf sources in brachytherapy of tumors began in the Research Institute of Medical Radiology of the Academy of Medical Sciences of the USSR in 1973. 252 Cf afterloading cells were utilized by the method of simple afterloading. Dosimetry and radiation protection of medical personnel were developed. To substantiate optimal therapeutic doses of 252 Cf neutrons, a correlation of dose, time, and treatment volume factors with clinical results of 252 Cf interstitial implants in carcinoma of the tongue for 47 patients with a minimum follow-up period of 1 year was studied. Forty-nine interstitial implants have been performed. Seventeen patients received 252 Cf implants alone (Group I), 17 other patients received 252 Cf implants in combination with external radiation (Group II), and 15 patients were treated with interstitial implants for recurrent or residual tumors (Groups III). Complete regression of carcinoma of the tongue was obtained in 48 patients (98%). Thirteen patients (27%) developed radiation necrosis. The therapeutic dose of neutron radiation from 252 Cf sources in interstitial radiotherapy of primary tongue carcinomas (Group I) was found to be 7 to 9 Gy. Optimal therapeutic neutron dose in combined interstitial and external radiotherapy of primary tumors (Group II) was 5 to 6 Gy with an external radiation dose of 40 Gy. For recurrent and residual tumors (Group III), favorable results were obtained with tumor doses of 6.5 to 7 Gy
International Nuclear Information System (INIS)
Naito, H.; Sakurai, Y.; Maruhashi, A.
2006-01-01
10 B concentrations in the blood samples for BNCT has been estimated due to amounts of prompt gamma rays from 10 B in the fields of thermal neutrons from a special guide tube attached to research reactor. A system using radioisotopes as the source of thermal neutron fields has advantages that are convenient and low cost because it doesn't need running of a reactor or an accelerator. The validity of 252 Cf as a neutron source for 10 B concentrations detection system was investigated. This system is composed of D 2 O moderator, Pb reflector/filter, C reflector, and LiF filter. A thermal neutron field with low background gamma-rays is obtained. A large source of 252 Cf is required to obtain a sufficient flux. (author)
Energy Technology Data Exchange (ETDEWEB)
Joshi, Jay Prakash [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-05-01
The objectives of this project are to calibrate the Advanced Experimental Fuel Counter (AEFC), benchmark MCNP simulations using experimental results, investigate the effects of change in fuel assembly geometry, and finally to show the boost in doubles count rates with 252Cf active soruces due to the time correlated induced fission (TCIF) effect.
International Nuclear Information System (INIS)
Mihalczo, J.T.
1987-01-01
The 252 Cf-source-driven neutron noise analysis method was evaluated to determine if it could be used to measure the subcriticality of storage casks of burnt LWR fuel submerged in fuel storage pools, fully loaded and as they are being loaded. The motivation for this evaluation was that measurements of k/sub eff/ would provide the parameter most directly related to the criticality safety of storage cask configurations of LWR fuel and could allow proper credit for fuel burnup without reliance on calculations. This in turn could lead to more cost-effective cask designs. Evaluation of the method for this application was based on (1) experiments already completed at a critical experiments facility using arrays of PWR fuel pins typical of the size of storage cask configurations, (2) the existence of neutron detectors that can function in shipping cask environments, and (3) the ability to construct ionization chambers containing 252 Cf of adequate intensity for these measurements. These three considerations are discussed
Spectroscopy of neutron-rich nuclei populated in the spontaneous fission of 252Cf and 248Cm
International Nuclear Information System (INIS)
Smith, A. G.; Simpson, G. S.; Billowes, J.; Durell, J. L.; Phillips, W. R.; Dagnall, P. J.; Freeman, S. J.; Leddy, M.; Roach, A. A.; Smith, J. F.
1999-01-01
In this paper we present research that has been carried out using the Euroball and Eurogam arrays to detect γ rays emitted from spontaneously fissioning 248 Cm and 252 Cf. The paper focuses on three sub-areas of current activity, namely, the measurement of yields of secondary fragment pairs, the measurement of state lifetimes at around spin 10, and recent measurements of g-factors of excited states in fission fragments. (c) 1999 American Institute of Physics
International Nuclear Information System (INIS)
Spurny, Frantisek; Medioni, Roger; Chapuis, A.; Portal, Guy.
1975-07-01
The specific sensitivity of various thermoluminescent, radiophotoluminescent and photographic detectors to the neutron spectrum of a 252 Cf source was measured and the effect of the size and composition of the containers in which they might be put was investigated. PB33 radiophotoluminescent glasses, radiothermoluminescent alumina and calcium sulfate were less sensitive to fission neutrons whereas photographic emulsions were more sensitive. The former should be used for γ detection in mixed fields of photons and fission neutrons [fr
Use of californium-252 sources in Hungary for teaching and research
International Nuclear Information System (INIS)
Csikai, J.
1976-01-01
An activation facility was designed to accommodate up to 50 mg of 252 Cf; it contains at present a 500 μg source. The absolute values of thermal, epithermal and fast neutron fluxes were determined by the foil activation method using In, Dy, Au, Al and Fe detectors. Cross-sections averaged for unmoderated 252 Cf neutrons were determined for 22 different reactions for elements with atomic weights lying between A=27 and 204. The sensitivity for determination of Al, Ti, Cu, As, Sr, Mo, In, Cd, Ba, Au, Hg and Pb was calculated for NaI(Tl) and Ge(Li) detectors. Average (n,2n) cross-sections for 252 Cf spectrum were calculated for 49 nuclei lying between A=14 and 204. Angular distributions and cross-sections for the fragments from 252 Cf neutron-induced fission of 232 Th and 238 U were measured. Titanium in bauxite and manganese in aluminium alloys were determined with a 252 Cf source. The applicability of solid-state track detectors for neutron dosimetry, radiography and for the determination of fuel burn-up were investigated using 252 Cf neutron and fragment sources. Characteristics of a jumping spark counter for counting fission fragments were studied with 252 Cf sources. (author)
New isomeric states in 152,154,156Nd produced by spontaneous fission of 252Cf
International Nuclear Information System (INIS)
Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C.; Belier, G.; Girod, M.; Meot, V.; Peru, S.; Astier, A.; Ducroux, L.; Meyer, M.; Redon, N.
1998-01-01
Isomeric states have been observed in fission-fragments produced by spontaneous fission of 252 Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between γ-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2μs have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the 152,154,156 Nd show evidence for K-isomers. (orig.)
International Nuclear Information System (INIS)
Qing, Yi; Wang, Ge; Wang, Dong; Yang, Xue-Qin; Zhong, Zhao-Yang; Lei, Xin; Xie, Jia-Yin; Li, Meng-Xia; Xiang, De-Bing; Li, Zeng-Peng; Yang, Zhen-Zhou
2010-01-01
The aim of the study was to obtain stable radioresistant sub-lines from the human cervical cancer cell line HeLa by prolonged exposure to 252 Cf neutron and X-rays. Radioresistance mechanisms were investigated in the resulting cells using microarray analysis of DNA damage repair genes. HeLa cells were treated with fractionated 252 Cf neutron and X-rays, with a cumulative dose of 75 Gy each, over 8 months, yielding the sub-lines HeLaNR and HeLaXR. Radioresistant characteristics were detected by clone formation assay, ultrastructural observations, cell doubling time, cell cycle distribution, and apoptosis assay. Gene expression patterns of the radioresistant sub-lines were studied through microarray analysis and verified by Western blotting and real-time PCR. The radioresistant sub-lines HeLaNR and HeLaXR were more radioresisitant to 252 Cf neutron and X-rays than parental HeLa cells by detecting their radioresistant characteristics, respectively. Compared to HeLa cells, the expression of 24 genes was significantly altered by at least 2-fold in HeLaNR cells. Of these, 19 genes were up-regulated and 5 down-regulated. In HeLaXR cells, 41 genes were significantly altered by at least 2-fold; 38 genes were up-regulated and 3 down-regulated. Chronic exposure of cells to ionizing radiation induces adaptive responses that enhance tolerance of ionizing radiation and allow investigations of cellular radioresistance mechanisms. The insights gained into the molecular mechanisms activated by these 'radioresistance' genes will lead to new therapeutic targets for cervical cancer
International Nuclear Information System (INIS)
Hertel, Nolan E.; Sweezy, Jeremy; Sauber, Jeremiah S.; Vaughn, David; Cook, Andrew; Tays, Jeff; Ro, Tae-Ik
2001-01-01
In recent years, Georgia Institute of Technology (Georgia Tech) has been involved in a number of neutron dosimetry research projects. Several reference neutron fields are now available for such projects. They are all based on the use of a 252 Cf source. The source can be used by itself to create a reference un-moderated 252 Cf neutron field, or it can be placed inside several different moderating assemblies. The spectra created by placing the source inside these assemblies and the un-moderated source are employed to investigate detector and dosimeter responses. Currently, the set of moderators available includes a 30-cm diam cadmium-covered D 2 O spherical shell, a 30-cm-thick iron spherical shell, a 30-cm-diam polyethylene spherical shell, an 18.3-cm-thick tungsten spherical shell, a 16-cm-thick lead spherical shell, and a 9-cm-thick tantalum spherical shell. In addition, the 252 Cf source can be placed inside a neutron howitzer recently constructed at Georgia Tech. The howitzer is a WEP cylinder loaded with boron that has a 10.16-cm-diam cylindrical opening. When the source is placed in the cylindrical penetration of the howitzer, a neutron field ∼30 cm in diameter is created at a distance of 50 cm from the californium source. Over the last few years, Bonner sphere spectrometers using LiI(Eu) scintillators and LiF thermoluminescence dosimeters have been calibrated using this facility at Georgia Tech. Recently, the Neely Nuclear Research Center (NNRC) acquired an LB 6411 neutron probe (product of EG and G Berthold). This probe is designed to measure ambient dose equivalent in accordance with International Commission on Radiological Protection Publication 60 recommendations. It consists of a cylindrical 3 He proportional counter surrounded by a 25-cm-diam spherical polyethylene moderator. Its neutron response is optimized for dose rate measurements of neutrons between thermal energies and 20 MeV (Ref. 5). As a test of the instrument's ability to measure ambient
Teratogenic effect of Californium-252 irradiation in rats
International Nuclear Information System (INIS)
Satow, Yukio; Lee, Juing-Yi; Hori, Hiroshi; Okuda, Hiroe; Tsuchimoto, Shigeo; Sawada, Shozo; Yokoro, Kenjiro
1989-01-01
The teratogenicity of Californium-252 (Cf-252) irradiation which generates approximately 70% 2.3 MeV fast neutron and 30% gamma rays was evaluated. A single whole body exposure of Cf-252 at various doses was given to pregnant rats on day 8 or 9 of pregnancy, followed by microscopic autopsy of the fetuses at the terminal stage of pregnancy to search for external and internal malformations. For comparison, pregnant rats were irradiated with various doses of Cobalt-60 (Co-60) standard gamma rays at the same dose rate (1 rad/min.). The doses were 20-120 rad of Cf-252 and 80-220 rad of Co-60. Using frequency of radiation induced malformations observed on day 8 of pregnancy as an index, relative biological effectiveness (RBE) of 2.3-2.7 was obtained from the straight line obtained by modifying by the least squares method the frequency curves of malformed fetuses in total implants and in surviving fetuses. The types of malformations induced by Cf-252 and Co-60 irradiation were alike. Using fetal LD 50 as an index, 2.4 was obtained as RBE when irradiated on day 8 of pregnancy and 3.1 as that when irradiated on day 9. The results showed that Cf-252 had stronger a teratogenic effect than Co-60 gamma rays. (author)
Survey of potential markets for devices using Californium-252
International Nuclear Information System (INIS)
Permar, P.H.
1975-01-01
Potential applications for devices or systems containing 252 Cf in the years from 1975 to 1980 are estimated. The estimated number of devices and associated business value were derived from a survey of 46 industrial, educational and governmental organizations conducted from Jan. to May, 1975. Applications for devices and systems based on 252 Cf are expected to increase by a factor of 7 in the 6-y period from 1975 to 1980. The annual business value of 252 Cf devices should increase from 1.5 million dollars in 1975 to 10.8 million dollars in 1980. The potential European market should be several times as large as the US market, based on actual sales of 252 Cf, which have been two to four times greater in Europe than in the US
International Nuclear Information System (INIS)
Jiunnhsing Chao; Chien Chung
1991-01-01
A portable HPGe- 252 Cf probe dedicated to in situ survey of river water salinity was placed on board a fishing boat to survey the Tamsui River in northern Taiwan. The variation of water salinity is surveyed by measuring the 6111 keV chlorine prompt photopeak along the river. Results indicate that the probe can be used as a salinometer for rapid, in situ measurement in polluted rivers or sea. (author)
Investigation of short-living fission products from the spontaneous fission of Cf-252
International Nuclear Information System (INIS)
Klonk, H.
1976-01-01
In this paper, a method of separating and measuring fission products of Cf-252 is presented. The measurement was achieved by means of γ-spectrometry and thus provides a quantitative analysis with a good separation of the fission products with respect to both atomic number Z and mass number A. The separation of the fission products from the fission source was achieved by means of solid traps. An automatic changing apparatus made it possible to keep irradiation and measuring times short, so even very short-lived fission products could be registered. The quantitative evaluation of primary fission products was made possible by correction according to Bateman equations. With that, the yields of single nuclides and the dispersion of charge can be determined. (orig./WL) [de
Neutron calibration field of bare {sup 252}Cf source in Vietnam
Energy Technology Data Exchange (ETDEWEB)
Le, Ngoc Thiem; Tran, Hoai Nam; Nguyen, Khai Tuan [Institute for Nuclear Science and Technology, Hanoi (Viet Nam); Trinh, Glap Van [Institute of Research and Development, Duy Tan University, Da Nang (Viet Nam)
2017-02-15
This paper presents the establishment and characterization of a neutron calibration field using a bare {sup 252}Cf source of low neutron source strength in Vietnam. The characterization of the field in terms of neutron flux spectra and neutron ambient dose equivalent rates were performed by Monte Carlo simulations using the MCNP5 code. The anisotropy effect of the source was also investigated. The neutron ambient dose equivalent rates at three reference distances of 75, 125, and 150 cm from the source were calculated and compared with the measurements using the Aloka TPS-451C neutron survey meters. The discrepancy between the calculated and measured values is found to be about 10%. To separate the scattered and the direct components from the total neutron flux spectra, an in-house shadow cone of 10% borated polyethylene was used. The shielding efficiency of the shadow cone was estimated using the MCNP5 code. The results confirmed that the shielding efficiency of the shadow cone is acceptable.
Exclusive radiation therapy of endometrial carcinoma using HDR Co-60 and Cf-252 sources
International Nuclear Information System (INIS)
Inciura, A.; Janulionis, E.; Atkocius, V.
2000-01-01
Although the main treatment of endometrial cancer is surgery, the gross spread of carcinoma in pelvis, elderly age of the patients and serious therapeutical diseases do not allow to operate 20% of the patients. For these patients only radical treatment decision is the combined radiation therapy. However, using various modalities of combined radiotherapy, the treatment results are not satisfying: only 52% of patients survive 5 years. There was implemented a new method of combined radiotherapy, using a three-channel applicator with two-positional locating of HDR Co-60 radioactive sources (group I). A new method of brachytherapy for endometrial carcinoma using a HDR Cf 252 sources (group II) was implemented too. For group I the medium total dose of the point A was 77.6 Gy, point I - 69.6 Gy. point 2 - 84.2 Gy, point B - 52.6 Gy, For group II the medium total dose the points A, 3 and 4 was 50 iGy. For group I 1 year overaII survival rate was 85%, 3 year - 73%. The 3 year survival rate for stage I was 79%, for stage II - 89%, for stage III - 33%. 3 year survival for highly virulent tumours - 56% and for low virulent (adenocarcinoma) - 82% was statistically different. The loss of tumour differentiation correlated with the worse prognosis: 3 year survival for G1 and G2 tumours was 92%, for G3 - 45%. Low hemoglobin level was also associated with low survival rate: 2 year survival for Hb≥120g/l was 85% and Hb<120g/l - 23%. 1 year survival rate was 87%, 3 year - 66%, 5 year - 58% for group II, treated with Cf-252. Radiation complications occurred for 13.8% of the patients for group I and 6.2% for group II. Good survival rates and a small number of complications sufficiently proofed treatment method. (author)
International Nuclear Information System (INIS)
Watanabe, Hiromitsu; Takahashi, Tadateru; Lee, Juing-Yi
1996-01-01
Experiments were conducted to determine whether neutron-induced genetic damage in parental germline cells can lead to the development of cancer in the offspring. Seven-week-old C3H male mice were irradiated with 252 Cf neutrons at a dose of 0, 50, 100, or 200 cGy. Two weeks or 3 months after irradiation, the male mice were mated with virgin 9-week-old C57BL females. Two weeks after irradiation, the irradiated male mice showed an increased incidence of sperm abnormalities, which led to embryo lethalities in a dose-dependent manner when they were mated with unirradiated female mice. Furthermore, liver tumors in male offspring of male mice in the 50 cGy group were significantly increased in 19 of 44 (43.2%) animals, in clear contrast to the unirradiated group (1 of 31; 3.2%) (P 1 generation may be caused by genetic transmission of hepatoma-associated trait (s) induced by 252 Cf neutron irradiation. (author)
Californium-252 sales and loans at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
King, L.J.
1987-01-01
The production and distribution in the United States of 252 Cf has recently been consolidated at the Oak Ridge National Laboratory (ORNL). The 252 Cf Industrial Sales/Loan Program and the 252 Cf University Load Program, which were formerly located at the Savannah River Plant (SRP), have been combined with the californium production and distribution activities of the Transuranium Element Production Program at ORNL. Californium-252 is sold to commercial users in the form of bulk californium oxide, palladium-californium alloy pellets, or alloy wires. Neutron source capsules, which are fabricated for loans to DOE or other US government agencies, are still available in all forms previously available. The consolidation of all 252 Cf distribution activities at the production site is expected to result in better service to users. In particular, customers for neutrons sources will be ale to select from a wider range of neutron source forms, including custom designs, through a single contact point
Gamma ray transitions in de-excitation of 252Cf spontaneous fission fragments
International Nuclear Information System (INIS)
Khan, N.A.; Rashid, K.; Ahmad, M.; Qureshi, I.E.; Alam, G.D.; Ali, A.; Bhatti, N.; Horsch, F.
1983-11-01
Gamma rays in the range from 60 keV to 730 keV have been observed following the spontaneous fission of 252 Cf, with high resolution Ge(Li) detector, full width at half maximum (FWHM) of 700 eV at 122 keV, in coincidence with the two fission fragments observed with surface barrier detectors. A total number of 18, 636, 549 events were recorded over a run period of about 150 hours stretching over three weeks. The events were sorted to generate gamma ray spectra belonging to 2 amu intervals gamma of the fragment masses and 6 MeV intervals of the total kinetic energy released. Some of the prominent gamma lines belonging to various masses of the fission fragments have been identified. For some gamma lines, the intensities have been evaluated as a function of the total kinetic energy of the fission fragments. (authors)
Fragment angular momentum and descent dynamics in {sup 252}Cf spontaneous fission
Energy Technology Data Exchange (ETDEWEB)
Popeko, G.S.; Ter-Akopian, G.M.; Daniel, A.V.; Oganessian, Y.T.; Kliman, J. [JINR, Dubna, 141980 (Russia); Ter-Akopian, G.M.; Hamilton, J.H.; Kormicki, J.; Daniel, A.V.; Ramayya, A.V.; Hwang, J.K.; Sandulescu, A.; Florescu, A.; Greiner, W. [Vanderbilt University, Nashville, Tennessee 37235 (United States); Ter-Akopian, G.M.; Daniel, A.V.; Florescu, A.; Greiner, W. [JIHIR, Oak Ridge, Tennessee 37831 (United States); Greiner, W. [ITP, J.W. Goethe University, D-60054, Frankfurt am Main (Germany); Florescu, A. [IAP, Bucharest, P.O. Box MG-6, (Russian Federation); Kliman, J.; Morhac, M. [IP SASc, Bratislava (Slovak Republic); Rasmussen, J.O. [LBNL, Berkeley, California 94720 (United States); Stoyer, M.A. [LLNL, Livermore , California 94550 (United States); Cole, J.D. [INEL, Idaho Falls, Idaho 83415 (United States)
1998-12-01
Fragment angular momenta as a function of neutron multiplicity were extracted for the first time for the Mo-Ba and Zr-Ce charge splits of {sup 252}Cf by studying prompt coincident {gamma}-rays. The obtained primary fragment angular momenta do not continuously rise with the increase in the number of neutrons evaporated. In frame of the scission point bending oscillation model such regularity is explained due the decrease of the bending temperature. Adiabatic bending oscillations (T=0) are obtained at large ({nu}{sub tot}{gt}5) and small ({nu}{sub tot}=0) scission point elongation. These oscillations are excited to the temperature of 2{endash}3 MeV for the most probable scission configurations indicating a weak coupling between collective and internal degrees of freedom. A strong coupling between the collective bending and dipole oscillations was found. {copyright} {ital 1998 American Institute of Physics.}
Calculation of neutron spectra for a 252Cf transport cask using ANISN running on a PC
International Nuclear Information System (INIS)
West, L.; Akin, B.P.; Lemley, E.C.
1995-01-01
Neutron spectra have been calculated using the ANISN one-dimensional discrete ordinates code for the case of a 152 Cf source in a transport cask of a particular design. All computations were done on personal computers (PCs) (mostly 486 models) with the ANISN-ORNL (486 version) computer code. With a source of 252 Cf fission neutrons, the neutron flux spectrum in the cask cannot be characterized as open-quotes moderated.close quotes Concern about an appropriate choice for the cross-section data set has led to a comparison, for this application, of three different cross-section libraries: DABL, HILO, and BUGLE-80. Although the cross-section sets were not originally designed for PC use, the libraries have been successfully employed for PC computations. Work with yet another data library, BUGLE-93, is incomplete at this stage. From neutron flux spectra on the surface of the cask, personnel dosimetric quantities (such as dose equivalent) have been determined for the DABL, HILO, and BUGLE-80 ANISN calculations
A search for back-to-back e+e- pairs in the spontaneous-fission disintegration of 252Cf
International Nuclear Information System (INIS)
Tsunoda, T.; Nakamura, S.; Orito, S.; Minowa, M.
1995-01-01
A back-to-back electron-positron pair is searched for in spontaneous-fission disintegration of 252 Cf. The emission of such a pair, if observed, might be a manifestation of production and prompt decay of a heretofore unknown neutral particle. The emission rate of such a pair is found to be less than (2.5-5.5) . 10 -10 per fission at the 95% confidence level depending on the mass of the hypothetical particle which is between 40 and 200 MeV/c 2 . (orig.)
Application of californium-252 neutron sources for analytical chemistry
International Nuclear Information System (INIS)
Ishii, Daido
1976-01-01
The researches made for the application of Cf-252 neutron sources to analytical chemistry during the period from 1970 to 1974 including partly 1975 are reviewed. The first part is the introduction to the above. The second part deals with general review of symposia, publications and the like. Attention is directed to ERDA publishing the periodical ''Californium-252 Progress'' and to a study group of Cf-252 utilization held by Japanese Radioisotope Association in 1974. The third part deals with its application for radio activation analysis. The automated absolute activation analysis (AAAA) of Savannha River is briefly explained. The joint experiment of Savannha River operation office with New Brunswick laboratory is mentioned. Cf-252 radiation source was used for the non-destructive analysis of elements in river water. East neutrons of Cf-252 were used for the quantitative analysis of lead in paints. Many applications for industrial control processes have been reported. Attention is drawn to the application of Cf-252 neutron sources for the field search of neutral resources. For example, a logging sonde for searching uranium resources was developed. the fourth part deals with the application of the analysis with gamma ray by capturing neutrons. For example, a bore hole sonde and the process control analysis of sulfur in fuel utilized capture gamma ray. The prompt gamma ray by capturing neutrons may be used for the nondestructive analysis of enrivonment. (Iwakiri, K.)
Energy Technology Data Exchange (ETDEWEB)
Gilliam, David M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)], E-mail: david.gilliam@nist.gov; Yue, Andrew [Department of Physics and Astronomy, University of Tennessee, Knoxville, TN (United States); Scott Dewey, M. [National Institute of Standards and Technology, Gaithersburg, MD 20899 (United States)
2008-06-01
It is demonstrated that a thin polyimide foil can be employed to prevent contamination from the self-sputtering of a {sup 252}Cf source under vacuum, with small energy loss of the emitted fission fragments, with very small effect on the efficiency of counting the fission fragments, and with a long lifetime of the plastic foils.
Study of scission shapes in spontaneous ternary fission of 252Cf
International Nuclear Information System (INIS)
Singer, P.; Schwalm, D.; Thirolf, P.; Goennenwein, F.; Hesse, M.
1995-06-01
A new kinematic study on the ternary fission of 252 Cf has been conducted by registering prompt neutrons and fission γ rays coincidence with light charged particles (LCP) and fission fragments. The aim is to investigate changes in fragment deformation energy between the binary and ternary fission modes from measured prompt neutron angular distributions and multiplicities, and to explore the influence of light particle emission on the energy distribution, multiplicity and angular anisotropy of γ rays emitted during fragment de-excitation. The experiment was performed at the MPI Heidelberg using the Darmstadt-Heidelberg crystal ball spectrometer as γ-ray and neutron detector. Fragments were identified by a double-E measurement with an angular sensitive twin ionization chamber (IC). Light charged particles from fission were measured by ΔE-E telescopes composed of ΔE ICs and silicon PIN diodes. The telescopes enable to identify various LCPs which are emitted much more rarely than ternary α particles. The parameters of the experiment and the method of data analysis are described and first results presented. (orig.)
Neutron gauging applications using a small 252Cf source
International Nuclear Information System (INIS)
Helf, S.
1975-01-01
The use of a small 252 Cf source, in the 3 to 4 μg range, for neutron gauging applications is described. Emphasis is placed on determination of low concentrations of moisture in homogeneous media, e.g., solvents, explosives, dried food products, etc. and on measurement of charge or fill weight of hydrogenous materials in sealed items, e.g., propellant in a cartridge case. Both moderation of fast neutrons and attenuation of thermalized neutrons have been explored for these applications. Parameters related to the attainment of optimum sensitivity for each method are discussed. Fast neutron moderation is superior for low level moisture measurement whereas thermal neutron attenuation is more sensitive for ''neutron weighing'' applications. Under optimum conditions, sensitivity for moisture measurement approaches 0.1 weight percent whereas ''neutron weighing'' can detect changes in hydrogeneous material content as little as a fraction of a gram. Examples are given for each technique. A number of different thermal neutron detectors are compared for neutron gauging measurements. A 6 LiI (Eu) scintillation detector is judged to be superior with regard to high thermal neutron detection efficiency and low fast neutron and gamma ray response. In this study, emphasis is placed on the use of simple, portable equipment easily adaptable to field or plant use and for on-line process or quality control. (U.S.)
Measurement of Neutron Energy Spectrum Emitted by Cf-252 Source Using Time-of-Flight Method
Energy Technology Data Exchange (ETDEWEB)
Lee, Cheol Ho; Son, Jaebum; Kim, Tae Hoon; Lee, Sangmin; Kim, Yong-Kyun [Hanyang University, Seoul (Korea, Republic of)
2016-10-15
The techniques proposed to detect the neutrons usually require the detection of a secondary recoiling nucleus in a scintillator (or other type of detector) to indicate the rare collision of a neutron with a nucleus. This is the same basic technique, in this case detection of a recoil proton that was used by Chadwick in the 1930 s to discover and identify the neutron and determine its mass. It is primary technique still used today for detection of fast neutron, which typically involves the use of a hydrogen based organic plastic or liquid scintillator coupled to a photo-multiplier tube. The light output from such scintillators is a function of the cross section and nuclear kinematics of the n + nucleus collision. With the exception of deuterated scintillators, the scintillator signal does not necessarily produce a distinct peak in the scintillator spectrum directly related to the incident neutron energy. Instead neutron time-of-flight (TOF) often must be utilized to determine the neutron energy, which requires generation of a prompt start signal from the nuclear source emitting the neutrons. This method takes advantage of the high number of prompt gamma rays. The Time-of-Flight method was used to measure neutron energy spectrum emitted by the Cf-252 neutron source. Plastic scintillator that has a superior discrimination ability of neutron and gamma-ray was used as a stop signal detector and liquid scintillator was used as a stat signal detector. In experiment, neutron and gamma-ray spectrum was firstly measured and discriminated using the TOF method. Secondly, neutron energy spectrum was obtained through spectrum analysis. Equation of neutron energy spectrum that was emitted by Cf-252 source using the Gaussian fitting was obtained.
Prompt neutron spectrum of the spontaneous fission of californium-252
International Nuclear Information System (INIS)
Zamyatnin, Yu.S.; Kroshkin, N.I.; Korostylev, V.A.; Nefedov, V.N.; Ryazanov, D.K.; Starostov, B.I.; Semenov, A.F.
1976-01-01
The californium-252 spontaneous fission neutron spectrum was measured in the energy range of 0.01 to 10 MeV by the time-of-flight technique using various neutron detectors. The measurements of 252 Cf neutron spectrum at energies of 0.01 to 5 MeV were performed as a function of fission fragment kinetic energy. The mean neutron spectrum energy in the range of 0.7 to 10 MeV was found from the results of measurements. The irregularity in the 252 Cf neutron spectrum in the neutron energy range of less than 0.7 MeV compared to theoretical values is discussed. The mechanism of 252 Cf neutron emission is also discussed on the basis of neutron yield angle measurements. 12 references
Charge distribution in the ternary fragmentation of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Senthil Kannan, M.T.; Balasubramaniam, M. [Bharathiar University, Department of Physics, Coimbatore (India)
2017-08-15
We present here, for the first time, a study on ternary fragmentation charge distribution of {sup 252}Cf using the convolution integral method and the statistical theory. The charge distribution for all possible charge combinations of a ternary breakup are grouped as a bin containing different mass partitions. Different bins corresponding to various third fragments with mass numbers from A{sub 3} = 16 to 84 are identified with the available experimental masses. The corresponding potential energy surfaces are calculated using the three cluster model for the two arrangements A{sub 1} + A{sub 2} + A{sub 3} and A{sub 1} + A{sub 3} + A{sub 2}. The ternary fragmentation yield values are calculated for the ternary combination from each bin possessing minimum potential energy. The yields of the resulting ternary combinations as a function of the charge numbers of the three fragments are analyzed for both the arrangements. The calculations are carried out at different excitation energies of the parent nucleus. For each excitation energy the temperature of the three fragments are iteratively computed conserving the total energy. The distribution of fragment temperatures corresponding to different excitation energies for some fixed third fragments are discussed. The presence of the closed shell nucleus Sn in the favourable ternary fragmentation is highlighted. (orig.)
International Nuclear Information System (INIS)
Wogman, N.A.; Rieck, H.G. Jr.; Laul, J.C.; MacMurdo, K.W.
1976-09-01
A 252 Cf activation analysis facility has been developed for routine multielement analysis of a wide variety of solid and liquid samples. The facility contains six sources of 252 Cf totaling slightly over 100 mg. These sources are placed in a 93 percent 235 U-enriched uranium core which is subcritical with a K effective of 0.985 (multiplication factor of 66). The system produces a thermal flux on the order of 10 +1 neutrons per square centimeter per second. A pneumatic rabbit system permits automatic irradiation, decay, and counting regimes to be performed unattended on the samples. The activated isotopes are analyzed through their photon emissions with state-of-the-art intrinsic Ge detectors, Ge(Li) detectors, and NaI(Tl) multidimensional gamma ray spectrometers. High efficiency (25 percent), low background, anticoincidence shielded Ge(Li) gamma ray detector systems have been constructed to provide the lowest possible background, yet maintain a peak to Compton ratio of greater than 1000 to 1. The multidimensional gamma ray spectrometer systems are composed of 23 cm diameter x 20 cm thick NaI(Tl) crystals surrounded by NaI(Tl) anticoincidence shields. The detection limits for over 65 elements have been determined for this system. Over 40 elements are detectable at the 1 part per million level at a precision of +-10 percent
International Nuclear Information System (INIS)
Zaborowski, H.L.
1976-10-01
The project 252 Cf-D 2 O is articulated upon the utilization of a 200μg nominal 252 Cf spontaneous neutron fission source, used bare and under D 2 O spherical moderators, giving leakage neutron spectra experimentally known and/or calculated. This project has for objective the applications of those sources to Health Physics, in dosimetry (calibration of ''rad'' and ''rem-meters'') and in spectrometry, associated with the experimental system of measurements made by the generalization of the BONNER Spheres, known as ''the Multisphere System''. This communication describes the normalization method used and the results obtained leading to the adoption of a reference matrix called ''the Log-Normal Multisphere Matrix'' (LN-MM) giving the energies response functions of the generalized system for all the spheres diameters between 40 and 400 millimeters and for all the energies between 0.4eV and 15MeV [fr
New isomeric states in {sup 152,154,156}Nd produced by spontaneous fission of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Phan, X.H.; Theisen, C. [Commissariat l`Energie Atomique de Saclay, Gif sur Yvette (France). DSM/DAPINA/SPhN; Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires de Bordeaux-Gradignan, Domaine du Haut Vigneau, F-33175 Gradignan (France); Belier, G.; Girod, M.; Meot, V.; Peru, S. [Commissariat a l`Energie Atomique de Bruyeres-le-Chatel, DAM/SPN, BP12, F-91680 Bruyeres-le-Chatel (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Institut de Physique Nucleaire de Lyon, F-69622 Villeurbanne Cedex (France)
1998-04-01
Isomeric states have been observed in fission-fragments produced by spontaneous fission of {sup 252}Cf. These states are found in neutron rich nuclei of different structure and deformations. About 50 isomeric nuclei have been observed using coincidences between {gamma}-rays identified in EUROGAM II and fission fragments detected in photovoltaic cells (SAPhIR). Lifetimes in the range from 20 ns to 2{mu}s have been measured. Presented calculations based on HFB+D1S force on new measured isomeric states in the {sup 152,154,156}Nd show evidence for K-isomers. (orig.) With 8 figs., 27 refs.
International Nuclear Information System (INIS)
Ullo, J.J.
1977-08-01
The Harwell Boron Pile measurement of the average number of prompt neutrons emitted per fission, ν-bar/sub p/, of 252 Cf was analyzed in detail by a Monte Carlo method. From the calculated energy dependence of the neutron detection efficiency a value of ν-bar/sub p/ = 3.733 +- 0.022 was obtained. This value is 0.76 percent higher than the original reported value of 3.705 +- 0.015. Possible causes for this increase are discussed. 3 figures, 6 tables
Shielding of radiation fields generated by 252Cf in a concrete maze. Part 2 -- Simulation
International Nuclear Information System (INIS)
Fasso, A.; Ipe, N.E.; Reyna, A.
1998-03-01
A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare 252 Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation
International Nuclear Information System (INIS)
Danigel, H.
1983-01-01
Cf-252 PDMS is well suited for routine applications and can be combined with HPLC. This combined analytical system can be used for measuring the concentrations of pharmaceutical substances in body fluids on the basis of an internal standard. The results (pharmacokinetics, metabolism) indicate the necessary therapeutical dose and the efficacy of the substance applied. (DG) [de
Study of ternary and quaternary spontaneous fission of 252Cf with the NESSI detector
International Nuclear Information System (INIS)
Tishchenko, V.G.; Jahnke, U.; Herbach, C.M.; Hilscher, D.
2002-11-01
Ternary and quaternary spontaneous decay of 252 Cf was studied with the NESSI detector, a combination of two 4π detectors for charged particles, neutrons and γ-rays. The applied method of particle identification by measuring the energies and relative time-of-flights of the decay products is shown to be very effective for the study of rare decay modes. The energy and angular distributions of the decay products, the associated neutron multiplicities, the total energy of the prompt γ-radiation as well as correlations between the various observables were measured for the first time in a single full-scale experiment. The characteristics of ternary fission known from previous investigations are confirmed in the frame of a methodically independent experiment. Preliminary estimates of the quaternary fission yield are presented. An attempt is made to determine the mechanism of quaternary fission. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Shanglian, Bao; Jinquan, Liu [Beijing Univ., BJ (China); Batenkov, O I; Blinov, M V; Smirnov, S N [V.G. Khlopin Radium Institute, ST. Petersburg (Russian Federation)
1994-09-01
The {sup 252}Cf spontaneous prompt fission neutron spectrum at 0 degree and 180 degree relative to the motion direction of corresponding fission fragments was measured. High angular resolution for fragment measurements and high energy resolution for neutron measurements were obtained using multi-parameter TOF spectrometer. The results showed that there is a symmetric distribution of `forward` and `backward` for low energy in C.M.S. neutrons, which was an evidence of nonequilibrium neutrons existed in fission process.
Absolute measurement of ν/sub p/-bar for 252Cf by the large liquid scintillator tank technique
International Nuclear Information System (INIS)
Spencer, R.R.
1979-01-01
A vigorous effect to dispel the scandal of the approx. 2% dispersion in reported experimental values of 252 Cf ν-bar, the average number of neutrons emitted in spontaneous fission, has been underway over the past 5 years. The goal is to reduce the uncertainty in this fundamental parameter to the +- 0.25% level needed for reactor physics applications. Both new measurements and revaluation of older measurements are involved. At ORNL a new measurement is being carried out using the leage liquid scintillator neutron detector. Findings of the most recent experiment, incorporating improvements suggested in a preliminary study are discussed. 6 figures, 2 tables
International Nuclear Information System (INIS)
Melky, Sami.
1975-01-01
The 252 Cf neutron activation experimental set-up is composed of four sources of 225μg each, symmetrically disposed with regard to the sample axis. This installation permits the irradiation of 5 to 40cm 3 of ores, so that the analysis is done on sample weighing about 100g. This method allows, not only the determination of major and minor constituents in the sample, but also the determination of some trace elements. The experimental sensitivity of some important elements are given in mining prospection and it is shown that direct gamma spectrometry after activation permits a fast and precise determination of many elements in ores [fr
Californium-252 progress, report No. 7, April 1971
Energy Technology Data Exchange (ETDEWEB)
1971-12-31
This report contains discusses of the following topics on Californium-252: First sales of californium-252; encapsulation services discussed; three new participants in market evaluation program; summer training programs to use californium; Californium-252 shipping casks available; Californium-252 questions and answers, radiotherapy; neutron radiography; natural resources exploration; nuclear safeguards; process control; dosimetry; neutron radiography; neutron shielding; and nuclear safeguards.
Health physics aspects of 252Cf
International Nuclear Information System (INIS)
Bhagwat, A.M.
1974-01-01
After briefly describing the methods of production, radioactive, chemical and biological properties of californium-252, its health physics aspects are reviewed in detail. Its external and internal radiation hazards can be minimised through control of radiation and contamination and proper shield design. Use of various shielding materials is evaluated. The following aspects are also discussed : (1) radiation detectors for neutrons and gamma radiation (2) personnel monitoring techniques (3) bioassay and (4) storage and transportation. (M.G.B.)
Energy Technology Data Exchange (ETDEWEB)
Gonçalves, A.S.; Silva, F.S.; Patrão, K.C.S.; Fonseca, E.S. da; Pereira, W.W., E-mail: angela.souzagon@gmail.com [Instituto de Radioproteção e Dosimetria (IRD/CNEN-RJ), Rio de Janeiro, RJ (Brazil). Laboratório de Metrologia de Nêutrons
2017-07-01
Recent studies have demonstrated the importance of characterizing the spectrum of neutron sources for various energies in order to make the understanding of neutron interaction closer to reality they work with. This work presents the determination of neutron energy flux from the source of {sup 241}AmBe (0.6 TBq), {sup 238}PuBe (1.8 TBq) and {sup 252}Cf (120 μg) free in the air and inserted into spheres of various diameters containing distilled water. The determination of the spectrum is based on the measurement and simulation by the Monte Carlo computational method, using the sources under study, with the Bonner multisphere spectrometer containing readings with the detector without sphere and covered with polyethylene balls of diameters: 5,08 cm (2 ″), 7.62 cm (3″), 12.70 cm (5 ″), 20.32 cm (8 ″), 25.40 cm (10 ″) and 30.48 cm (12 ″). It is sought to characterize a new moderate spectrum in water using the sources of {sup 241}AmBe, {sup 238}PuBe and {sup 252}Cf that may be useful for testing, calibration and irradiation of individual and area monitors for neutrons.
Investigation of the characteristics of 252Cf-detectors
International Nuclear Information System (INIS)
Karlsson, Erik
2004-12-01
In the first chapter the characteristic behaviors of two Cf detectors have been investigated by performing pilot measurements. The detector with the stronger source gives an unstable signal with a low signal/noise ratio. Therefore this detector has not been further investigated. The ionization chamber reacts on both fission products and alpha decay. An energy experiment showed that there were large difficulties to separate those decays. A plastic scintillator, which reacts on both photons and neutrons, was used for neutron detection. Energy spectrums were performed and the result showed that it is difficult to set an energy threshold to separate the neutrons and the photons. The discrimination will rather be achieved by time of flight methods which is discussed under the second chapter in this thesis; Experimental results. An other experiment was done in order to investigate whether it is possible to detect any delayed components from the spontaneous fission of Cf. The result showed that delayed components existed. Either they are delayed neutrons from exited fission products, or it is some delay related to the charge collection in the Cf detector. Correlation measurements showed that few events are coincident. Only 50% of the signals from the plastic scintillator are correlated with the Cf source
Gamma-ray multiplicity distribution in ternary fission of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Jandel, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Kliman, J [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Krupa, L [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Morhac, M [Department of Nuclear Physics, Slovak Academy of Sciences, Dubravska cesta 9, Bratislava (Slovakia); Hamilton, J H [Department of Physics, Vanderbilt University, Nashville, TN (United States); Kormicki, J [Department of Physics, Vanderbilt University, Nashville, TN (United States); Ramayya, A V [Department of Physics, Vanderbilt University, Nashville, TN (United States); Hwang, J K [Department of Physics, Vanderbilt University, Nashville, TN (United States); Luo, Y X [Department of Physics, Vanderbilt University, Nashville, TN (United States); Fong, D [Department of Physics, Vanderbilt University, Nashville, TN (United States); Gore, P [Department of Physics, Vanderbilt University, Nashville, TN (United States); Akopian, G M Ter; Oganessian, Yu Ts; Rodin, A M; Fomichev, A S; Popeko, G S; Daniel, A V [Flerov Laboratory for Nuclear Reactions, Joint Institute for Nuclear Research, Dubna (Russian Federation); Rasmussen, J O; Macchiavelli, A O [Lawrence Berkeley National Laboratory, Berkeley, CA (United States); Stoyer, M A [Lawrence Livermore National Laboratory, Livermore, CA (United States); Donangelo, R [Instituto de Fisica, Universidade Federal do Rio de Janeiro, 21945-970 Rio de Janeiro (Brazil); Cole, J D [Idaho National Engineering and Environmental Laboratory, Idaho Falls, ID (United States)
2002-12-01
From multiparameter data obtained at Lawrence Berkeley National Laboratory, the integral characteristics of the prompt {gamma}-ray emission were extracted for tripartition of {sup 252}Cf with He, Be and C being the third light charged particle. We used multifold {gamma}-ray coincidence spectra for the determination of {gamma}-ray multiplicities assuming a Gaussian distribution for {gamma}-ray multiplicity. The multiplicity distribution characteristics, i.e. mean multiplicity and its dispersion were obtained by minimizing with respect to the calculated values of probabilities of multifold {gamma}-ray coincidences using a combinatoric method. Comparison with the known experimental data from binary fission was made. Further, we investigated dependencies of the mean {gamma}-ray multiplicity on the kinetic energy of the light charged particle. The mean {gamma}-ray multiplicity for He ternary fission is found to increase rapidly with increasing kinetic energy of He in the region less than 11 MeV and then decrease slowly with increasing kinetic energy of He. The anomalous behaviour of {gamma}-ray emission is discussed. The mean {gamma}-ray multiplicity was determined for the first time for Be and C ternary fission. For Be, the {gamma}-ray multiplicity as a function of kinetic energy was obtained as well.
Shielding of radiation fields generated by {sup 252}Cf in a concrete maze. Part 2 -- Simulation
Energy Technology Data Exchange (ETDEWEB)
Fasso, A.; Ipe, N.E.; Reyna, A. [Stanford Univ., CA (US). Stanford Linear Accelerator Center; McCall, R.C. [McCall Associates, Woodside, CA (US)
1998-03-01
A streaming experiment performed in a concrete maze of shape and size typical of a radiotherapy room was simulated with the Monte Carlo program FLUKA. The purpose of the calculation was to test the performance of the code in the low energy neutron range, and at the same time to provide additional information which could help in optimizing shielding of medical facilities. Instrument responses were calculated at different maze locations for several experimental configurations and were compared with measurements. In addition, neutron and gamma fluence, ambient dose equivalent and effective dose were calculated at the same positions. Both sources used in the experiment, namely a bare {sup 252}Cf source and one shielded by a tungsten shell 5 cm thick, were considered in the simulation.
Californium-252: isotope for modern radiotherapy of cervix, uterine and vaginal carcinomas
International Nuclear Information System (INIS)
Maruyama, J.; Beach, J.L.; Nagell, J.R. van
1984-01-01
Cf-252 is an isotope that can easily be afterloaded into available gynecological applicators and used for bulky cervix, uterus or vaginal cancer therapy. It is economical, time and cost effective in use, and can be applied to the therapy of many patients throughout the world. It is more effective for neutron therapy than machine fast neutron therapy and is the only form of neutron therapy producing consistent complication-free 5-year cure of advanced cancers currently available. Cf-252 is an isotope for modern gynecological tumor therapy for the future. Isodose curves for Cf-252 implants revealed dose distributions conforming well to tumor. (orig.) [de
Historical review of californium-252 discovery and development
International Nuclear Information System (INIS)
Stoddard, D.H.
1985-01-01
This paper discusses the discovery and history of californium 252. This isotope may be synthesized by irradiating plutonium 239, plutonium 242, americium 243, or curium 244 with neutrons in a nuclear reactor. Various experiments and inventions involving 252 Cf conducted at the Savannah River Plant are discussed. The evolution of radiotherapy using californium 252 is reviewed
International Nuclear Information System (INIS)
Narkhede, S.S.; Turel, Z.R.
1995-01-01
Dy, Mn, Eu, Na, Ga, W, La and Sm respond very well to INAA technique because of their favourable nuclear properties such as high thermal neutron cross-section or abundance. In the present work a method has been developed for the determination of these elements employing cycle irradiation with 252 Cf thermal neutron source. Radioassaying of the irradiated sample and standard was done employing HPGe detector in conjunction with a PC based MCA units. (author). 2 tabs
Determination of the average number of neutrons per fission event for californium-252
International Nuclear Information System (INIS)
Aleksandrov, B.M.; Belov, L.M.; Drapchinskij, L.V.
1982-01-01
By means of a separate determination of neutron yields and fission event rates, the value of #betta#-bar( 252 Cf) has been measured for a series of new high-purity sources. The improved quality of the source active layers has reduced the error in determining the fission rate to 0.35%. The value obtained for #betta#-bar( 252 Cf) is 3.747+-0.036. A description is given of the design and the parameters of a spherical manganese bath in which the work on refining the value of #betta#-bar( 252 Cf) will be continued. (author)
International Nuclear Information System (INIS)
Maruyama, Y.; van Nagell, J.R.; Yoneda, J.; Donaldson, E.; Gallion, H.; Higgins, R.; Powell, D.; Turner, C.; Kryscio, R.
1988-01-01
A fast-neutron-emitting radioisotope, 252 Cf, is being tested in clinical trials of neutron brachytherapy for cervical cancer. The efficacy for histological eradication of bulky stage IB cervical tumors (mean diameter, approximately 6 cm) using combined radiation and surgery was studied in 65 patients treated with 137 Cs or 252 Cf before surgery during 1983-1986. Forty-four patients were treated with 137 Cs and 21 were treated with 252 Cf at equivalent doses of radiation. Fifteen of the 44 specimens (34%) were positive after 137Cs therapy. Only one of the 21 specimens was positive after 252 Cf therapy (P = .025), and that patient was treated in a delayed schedule 21 days after the start of external-beam irradiation rather than early in the course. 252 Cf therapy required a much lower radiation dose and shorter treatment time. The study compared tumor destruction of an identically staged human cervical tumor in situ by direct histological means, using 252 Cf neutron therapy or conventional photon therapy at an identical and equivalent dose adjusted by a relative biological effectiveness of 6.0 for 252 Cf
Structures of the neutron-rich nuclei observed in fission of {sup 252}Cf
Energy Technology Data Exchange (ETDEWEB)
Ramayya, A. V.; Hamilton, J. H.; Goodin, C. J.; Brewer, N. T.; Hwang, J. K. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 (United States); Luo, Y. X. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Liu, S. H. [Department of Physics, Vanderbilt University, Nashville, Tennessee 37235 USA and UNRIB/Oak Ridge Associated Universities, Oak Ridge, Tennessee 37831 (United States); Rasmussen, J. O.; Lee, I. Y. [Lawrence Berkeley National Laboratory, Berkeley, California 94720 (United States); Stone, N. J. [Department of Physics, Oxford University, Oxford OX1 3PU (United Kingdom); Daniel, A. V. [Flerov Laboratory of Nuclear Reactions, JINR, Dubna (Russian Federation); Zhu, S. J. [Department of Physics, Tsinghua University, Beijing 100084 (China)
2014-08-14
Analysis of high statistics triple coincidence fission γ data from {sup 252}Cf at Gammasphere including angular correlations yielded well-expanded high-spin level schemes with more complete and reliable spin/parity assignments for {sup 82}Ge, {sup 118,120,122}Cd and {sup 114,115}Rh. Both the quasi-particle/hole couplings and quasi-rotational degrees of freedom are implied to play roles in these Cd isotopes. Evidence for triaxial shapes and octupole components in the Cd isotopes is presented. These Cd isotopes may have triaxial deformations. High-spin level schemes of {sup 114,115}Rh have been established for the first time. The existence of a relatively large signature splitting and an yrare band shows typical features of a triaxially deformed nucleus. Possible excited deformed rotational bands are observed, for the first time, in {sup 82}Ge. From the multipole mixing ratio measurement, the ground state configurations of {sup 109,111}Ru, as well as excited states in {sup 103,107}Mo and {sup 111}Ru were determined.
Transport-level description of the 252Cf-source method using the Langevin technique
International Nuclear Information System (INIS)
Stolle, A.M.; Akcasu, A.Z.
1991-01-01
The fluctuations in the neutron number density and detector outputs in a nuclear reactor can be analyzed conveniently by using the Langevin equation approach. This approach can be implemented at any level of approximation to describe the time evolution of the neutron population, from the most complete transport-level description to the very basic point reactor analysis of neutron number density fluctuations. In this summary, the complete space- and velocity-dependent transport-level formulation of the Langevin equation approach is applied to the analysis of the 252 Cf-source-driven noise analysis (CSDNA) method, an experimental technique developed by J.T. Mihalczo at Oak Ridge National Laboratory, which makes use of noise analysis to determine the reactivity of subcritical media. From this analysis, a theoretical expression for the subcritical multiplication factor is obtained that can then be used to interpret the experimental data. Results at the transport level are in complete agreement with an independent derivation performed by Sutton and Doub, who used the probability density method to interpret the CSDNA experiment, but differed from other expressions that have appeared in the literature
Resistive plate chamber neutron and gamma sensitivity measurement with a {sup 252}Cf source
Energy Technology Data Exchange (ETDEWEB)
Abbrescia, M.; Altieri, S.; Baratti, V.; Barnaba, O.; Belli, G.; Bruno, G.; Colaleo, A.; DeVecchi, C.; Guida, R. E-mail: roberto.guida@pv.infn.it; Iaselli, G.; Imbres, E.; Loddo, F.; Maggi, M.; Marangelli, B.; Musitelli, G.; Nardo, R.; Natali, S.; Nuzzo, S.; Pugliese, G.; Ranieri, A.; Ratti, S.; Riccardi, C.; Romano, F.; Torre, P.; Vicini, A.; Vitulo, P.; Volpe, F
2003-06-21
A bakelite double gap Resistive Plate Chamber (RPC), operating in avalanche mode, has been exposed to the radiation emitted from a {sup 252}Cf source to measure its neutron and gamma sensitivity. One of the two gaps underwent the traditional electrodes surface coating with linseed oil. RPC signals were triggered by fission events detected using BaF{sub 2} scintillators. A Monte Carlo code, inside the GEANT 3.21 framework with MICAP interface, has been used to identify the gamma and neutron contributions to the total number of collected RPC signals. A neutron sensitivity of (0.63{+-}0.02)x10{sup -3} (average energy 2 MeV) and a gamma sensitivity of (14.0{+-}0.5)x10{sup -3} (average energy 1.5 MeV) have been measured in double gap mode. Measurements done in single gap mode have shown that both neutron and gamma sensitivity are independent of the oiling treatment.
A search for fine structure of the time-of-flight spectrum of the fission neutrons of 252Cf
International Nuclear Information System (INIS)
Scobie, J.; Scott, R.D.; Feather, N.; Vass, D.G.
1977-01-01
A standard time-of-flight arrangement, in which start pulses were supplied by fission fragments and stop pulses by neutrons, has been employed in an attempt to check recent claims of the existence of fine structures in the time-of-flight spectrum of the fission neutrons of 252 Cf. This structure, in the form of spikes with tails towards longer times, has been attributed to the emission of neutrons of short delay (with half-lives of a few to a hundred or so nanoseconds) in the fission process. It has not been possible to find any convincing evidence for the existence of such structure. (author)
International Nuclear Information System (INIS)
Yoshikawa, Isao; Hoshi, Masaharu; Ikenaga, Mituo
1996-01-01
The relative biological effectiveness (RBE) of 252 Cf neutrons was determined for two different types of somatic mutations, i.e., loss of heterozygosity for wing-hair mutations and reversion of the mutant white-ivory eye-color, in Drosophila melanogaster. Loss of heterozygosity for wing-hair mutations results predominantly from mitotic crossing over induced in wing anlage cells of larvae, while the reverse mutation of eye-color is due to an intragenic structural change in the white locus on the X-chromosome. For a quantitative comparison of RBE values for these events, we have constructed a combined mutation assay system so that induced mutant wing-hair clones as well as revertant eye-color clones can be detected simultaneously in the same individuals. Larvae were irradiated at the age of 80±4 h post-oviposition with 252 Cf neutrons or 137 Cs γ-rays, and male adult flies were examined under the microscope for the presence of the two types of clonal mosaic spots appearing. The induction of wing-hair spots per dose unit was much greater for 252 Cf neutrons than for 137 Cs γ -rays, whereas the frequencies of eye-color reversion were similar for neutrons and γ-rays. The estimated RBE values of neutrons were 8.5 and 1.2 for the induction of mutant wing-hair spots and revertant eye-color spots, respectively. These results indicate that the RBE of neutrons is much greater for mitotic crossing over in comparison to the intragenic white-ivory reversion events. Possible causes for the difference in RBE are discussed
Proposed Californium-252 User Facility for Neutron Science at Oak Ridge National Laboratory
International Nuclear Information System (INIS)
Martin, R.C.; Laxson, R.R.; Knauer, J.B.
1996-01-01
The Radiochemical Engineering Development Center (REDC) at ORNL has petitioned to establish a Californium-252 User Facility for Neutron Science for academic, industrial, and governmental researchers. The REDC Californium Facility (CF) stores the national inventory of sealed 252 Cf neutron source for university and research loans. Within the CF, the 252 Cf storage pool and two uncontaminated hot cells currently in service for the Californium Program will form the physical basis for the User Facility. Relevant applications include dosimetry and experiments for neutron tumor therapy; fast and thermal neutron activation analysis of materials; experimental configurations for prompt gamma neutron activation analysis; neutron shielding and material damage studies; and hardness testing of radiation detectors, cameras, and electronics. A formal User Facility simplifies working arrangements and agreements between US DOE facilities, academia, and commercial interests
Measurements of gamma-ray dose from a moderated 252Cf source
International Nuclear Information System (INIS)
McDonald, J.C.; Griffith, R.V.; Plato, P.; Miklos, J.
1983-06-01
The gamma-ray dose fraction from a moderated 252 Cf source was determined by using three types of dosimetry systems. Measurements were carried out in air at a distance of 35 cm from the surface of the moderating sphere (50 cm from the source which is at the center of the sphere) to the geometrical center of each detector. The moderating sphere is 0.8-mm-thick stainless steel shell filled with D 2 O and covered with 0.5 mm of cadmium. Measurements were also carried out with instruments and dosimeters positioned at the surface of a 40 cm x 40 cm x 15 cm plexiglass irradiation phantom whose front surface was also 35 cm from the surface of the moderating sphere. A-150 tissue-equivalent (TE) plastic ionization chambers and a TE proportional counter (TEPC) were used to measure tissue dose, from which the neutron dose equivalent was computed. The ratio of gamma-ray dose to the neutron dose equivalent was determined by using a relatively neutron-insensitive Geiger-Mueller (GM) counter and thermoluminescent dosimeters (TLD). In addition, the event-size spectrum measured by the TEPC was also used to compute the gamma-ray dose fraction. The average value for the ratio of gamma-ray dose to neutron dose equivalent was found to be 0.18 with an uncertainty of about +-18%
Energy Technology Data Exchange (ETDEWEB)
Gautherin, C
1997-09-01
This thesis is devoted to the study of the nuclear structure of neutron-rich nuclei, via the search of isomeric nuclear states. Neutron-rich nuclei were produced in the spontaneous fission of {sup 252}Cf. The experimental study of isomeric states in these nuclei was performed with the {gamma}-array EUROGAM II, coupled to an additional and original fission fragment detector composed by photovoltaic cells, SAPhIR. The photovoltaic cells are well adapted to detect low energy heavy ions and have good energy and time resolutions to obtain a good fission fragment detection. This experiment led to the discovery of new isomeric states in {sup 135}Xe, {sup 104}Mo, {sup 146,147,148}Ce and {sup 152,154,156}Nd, with lifetimes between 60 ns and 2 {mu}s. Level schemes of these nuclei have been completed. An interpretation of the isomeric states in the nuclei {sup 154,156}Nd and {sup 156,158}Sm was performed by Hartree-Fock-Bogolyubov calculations using the DIS Gogny force with two quasi-particles excitations. The confrontation with the experimental results led to an interpretation of these isomeric states as K-isomers. (author)
American Society for Testing and Materials. Philadelphia
2008-01-01
1.1 This test method covers the nondestructive assay of scrap and waste items for U, Pu, or both, using a 252Cf shuffler. Shuffler measurements have been applied to a variety of matrix materials in containers of up to several 100 L. Corrections are made for the effects of matrix material. Applications of this test method include measurements for safeguards, accountability, TRU, and U waste segregation, disposal, and process control purposes (1, 2, 3). 1.1.1 This test method uses passive neutron coincidence counting (4) to measure the 240Pu-effective mass. It has been used to assay items with total Pu contents between 0.03 g and 1000 g. It could be used to measure other spontaneously fissioning isotopes such as Cm and Cf. It specifically describes the approach used with shift register electronics; however, it can be adapted to other electronics. 1.1.2 This test method uses neutron irradiation with a moveable Cf source and counting of the delayed neutrons from the induced fissions to measure the 235U equiva...
International Nuclear Information System (INIS)
Lorenz, A.; Kharitonov, I.A.
1994-02-01
The methods used and the results obtained in measurements of the 252 Cf half-life are analyzed. In calculating the weighted mean value, additional error components as well as those given by the authors are taken into account. In order to reduce the error in the weighted mean value to less than 0.1%, the need and the requirements for an exact measurement are specified. A half-life of 2.6473±0.0028 years is recommended. (author). 16 refs, 3 tabs
Thermal neutron imaging with rare-earth-ion-doped LiCaAlF6 scintillators and a sealed 252Cf source
International Nuclear Information System (INIS)
Kawaguchi, Noriaki; Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei; Fukuda, Kentaro; Suyama, Toshihisa; Watanabe, Kenichi; Yamazaki, Atsushi; Chani, Valery; Yoshikawa, Akira
2011-01-01
Thermal neutron imaging with Ce-doped LiCaAlF 6 crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF 6 scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF 6 single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm 2 was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The 252 Cf source ( 6 .
Californium-252 Program Equipment Evaluation
Energy Technology Data Exchange (ETDEWEB)
Chattin, Fred Rhea [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Wilson, Kenton [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States); Ezold, Julie G. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2017-12-01
To successfully continue the 252Cf production and meet the needs of the customers, a comprehensive evaluation of the Building 7920 processing equipment was requested to identify equipment critical to the operational continuity of the program.
International Nuclear Information System (INIS)
Wang Yuexing; Yang Yifang; Lu Yongjie; Zhang Jianguo; Xing Hongchuan
2011-01-01
Objective: To investigate the specific activity of '2 4 Na per unit neutron fluence, A B/Φ ,in blood produced for Chinese reference man irradiated by 252 Cf neutron source,and to analyze the effects of scattering neutrons from ground,wall,and ceiling in irradiation site on it.Methods: A 252 Cf neutron source of 3×10 8 n/s and the anthropomorphic phantom were used for experiments. The phantom was made from 4 mm thick of outer covering by perspex and the liquid tissue-equivalent substitute in it. The data of phantom dimensions fit into Chinese reference man.The weight ratios of H, N, O and C in substitute equal from source to long axis of phantom were 1.1, 2.1, 3.1 and 4.1 m, respectively. Both the neutron source and the position of xiphisternum of the phantom were 1.6 m above the floor. Results: The average specific activity of 24 Na per unit neutron fluence was related to the irradiation-distances, d, and its maximum value, A B/ΦM , deduced by experimental data was about 1.85×10 -7 Bq·cm 2 ·g -1 . Conclusions: The A B/ΦM corresponds to that of phantom irradiated by plane-parallel beams, and the value is about more 3% than that by BOMAB phantom reported in literature. It has shown that floor-(wall-)scattered neutrons in irradiation site have significant contribution to the specific activity of 24 Na, but they contributed relatively little to the induced neutron doses. Consequently,using the specific activity of 24 Na for assessing accidental neutron doses received by an individual, the contribution of scattered neutrons in accident site will lead dose to be overestimated, and need to be correct. (authors)
Long-term effects of an intracavitary treatment with californium-252 on normal tissue
International Nuclear Information System (INIS)
Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.
1976-01-01
About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with 252 Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from 252 Cf and 7000 rad from 226 Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for 252 Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from 252 Cf and 5000 rad from 226 Ra
Directory of Open Access Journals (Sweden)
Firoozabadi M. M.
2017-03-01
Full Text Available Background: In neutron interaction with matter and reduction of neutron energy due to multiple scatterings to the thermal energy range, increasing the probability of thermal neutron capture by neutron captures makes dose enhancement in the tumors loaded with these materials. Objective: The purpose of this study is to evaluate dose distribution in the presence of 10B, 157Gd and 33S neutron capturers and to determine the effect of these materials on dose enhancement rate for 252Cf brachytherapy source. Methods: Neutron-ray flux and energy spectra, neutron and gamma dose rates and dose enhancement factor (DEF are determined in the absence and presence of 10B, 157Gd and 33S using Monte Carlo simulation. Results: The difference in the thermal neutron flux rate in the presence of 10B and 157Gd is significant, while the flux changes in the fast and epithermal energy ranges are insensible. The dose enhancement factor has increased with increasing distance from the source and reached its maximum amount equal to 258.3 and 476.1 cGy/h/µg for 157Gd and 10B, respectively at about 8 cm distance from the source center. DEF for 33S is equal to one. Conclusion: Results show that the magnitude of dose augmentation in tumors containing 10B and 157Gd in brachytherapy with 252Cf source will depend not only on the capture product dose level, but also on the tumor distance from the source. 33S makes dose enhancement under specific conditions that these conditions depend on the neutron energy spectra of source, the 33S concentration in tumor and tumor distance from the source.
Study of fission mechanism with the reactions 230Th, 231Pa, 235U, 237Np(n,f) and 252Cf(fs)
International Nuclear Information System (INIS)
Benfoughal, T.
1983-01-01
In this work, the different stages of the nuclear fission process have been investigated. The analysis of fission cross-section and fission fragment angular distribution measurements are made using the hypothesis of asymmetrically deformed states. From the correlation between fissioning nucleus excitation energy and fragment total kinetic energy measurement for several fissioning systems, it is shown that the nuclear viscosity is relatively strong during the saddle-point to scission-point transition. The study of the spontaneous fission of 252 Cf shows that the fragment mass and kinetic energy distributions are mainly determinated by the nucleon shell effects and pairing correlations [fr
International Nuclear Information System (INIS)
Uckan, T.; Mihalczo, J.T.; Valentine, T.E.; Mullens, J.A.
1998-01-01
Characterization of a hydrated uranyl fluoride (UO 2 F 2 ·nH 2 O) deposit in a 17-ft-long, 24-in.-OD process pipe at the former Oak Ridge Gaseous Diffusion Plant was successfully performed by using 252 Cf-source-correlated time-of-flight (TOF) transmission measurements. These measurements of neutrons and gamma rays through the pipe from an external 2521 Cf fission source were used to measure the deposit profile and its distribution along the pipe, the hydration (or H/U), and the total uranium mass. The measurements were performed with a source in an ionization chamber on one side of the pipe and detectors on the other. Scanning the pipe vertically and horizontally produced a spatial and time-dependent radiograph of the deposit in which transmitted gamma rays and neutrons were separated in time. The cross-correlation function between the source and the detector was measured with the Nuclear Weapons Identification System. After correcting for pipe effects, the deposit thickness was determined from the transmitted neutrons and H/U from the gamma rays. Results were consistent with a later intrusive observation of the shape and the color of the deposit; i.e., the deposit was annular and was on the top of the pipe at some locations, demonstrating the usefulness of this method for deposit characterization
International Nuclear Information System (INIS)
Tavakkoli Farsouli, A.
1999-01-01
Bombs concealed in luggage have threatened human life and property throughout the world's traffic. The plastic explosives could not checked by the X-ray detecting device. Thermal Neutron Activation method has been tested in the present work for non-destructive detection of explosives. A radioisotope neutron source 252 Cf and two gamma spectroscopy systems have been used as a tool to find explosives, regardless of the bomb's shape and the packing materials. The MCNP code has been used to design the neutronic section of the system. The measured thermal neutron fluxes by the gold foils in some location of the system were in good agreement with those data obtained by the MCNP code. Also, detection limits for nitrogen in various counting times were measured. The measurements show that the system is capable to detect 417 gr of HMX explosive material (158 gr nitrogen) by 10 minutes of counting time. To modify the system and to decrease the detection limits some opinions are given
Undergraduate experiments using the neutron radiation from californium-252
International Nuclear Information System (INIS)
Rossel, J.; Golecki, I.
1976-01-01
Three experiments designed to demonstrate and measure several properties of the neutron radiation emitted by a 3μg 252 Cf source are described. The experiments constitute a special project carried out by a third-year undergraduate student at the Institute of Physics of the University of Neuchatel. The 252 Cf source is enclosed in a shield which allows a pencil of fast neutrons to pass through a central tube, while reducing the ambient radiation below the tolerance level. The shield consists of layers of borated paraffin wax, iron and cadmium. The first experiment uses an air-alcohol diffusion cloud chamber for the demonstration of tracks of recoil protons produced by the neutrons. Semi-quantitative measurements of track lengths give the correct order of magnitude of the proton energies. In the second experiment a liquid scintillator detector is used to scan the beam profile across the radiation shield enclosing the source. A pulse-shape-discrimination system discriminates between neutrons and gamma photons. The third experiment makes use of the nuclear emulsion technique to study the neutron energy distribution of 252 Cf. Preliminary results are compared with published values. (author)
International Nuclear Information System (INIS)
Horley, E.C.; Bjork, C.W.; Bourret, S.C.; Polk, P.J.; Schneider, C.J.; Studley, R.V.
1992-01-01
For the first time, a shuffler waste-assay system has been made a part of material access and accountability boundary (MAAB). A 252 Cf Pass-Thru shuffler integrated with a conveyor handling system, will process box or drum waste across the MAAB. This automated system will significantly reduce personnel operating costs because security forces will not be required at the MAAB during waste transfer. Further, the system eliminates the chance of a mix-up between measured and nonmeasured waste. This Pass-Thru shuffler is to be installed in the Westinghouse Savannah River Company 321M facility to screen waste boxes and drums for 235 U. An automated conveyor will load waste containers into the shuffler, and upon verification, will transfer the containers across the MAAB. Verification will consist of a weight measurement followed by active neutron interrogation. Containers that pass low-level waste criteria will be conveyed to an accumulator section outside the MAAB. If a container fails to meet the waste criteria, it will be rejected and sent back to the load station for manual inspection and repackaging
International Nuclear Information System (INIS)
Bartle, C. Murray
2014-01-01
DEXA (dual-energy X-ray absorption) is widely used in airport scanners, industrial scanners and bone densitometers. DEXA determines the properties of materials by measuring the absorption differences of X-rays from a bremsstrahlung tube source with and without filtering. Filtering creates a beam with a higher mean energy, which causes lower material absorption. The absorption difference between measurements (those with a filter subtracted from those without a filter) is a positive number that increases with the effective atomic number of the material. In this paper, the concept of using a filter to create a dual beam and an absorption difference in materials is applied to radiation from a 252 Cf source, called NEUDEG (neutron and dual-energy gamma absorption). NEUDEG includes absorptions for fast neutrons as well as the dual photon beams and thus an incentive for developing the method is that, unlike DEXA, it is inherently sensitive to the hydrogen content of materials. In this paper, a model for the absorption difference and absorption sum in NEUDEG is presented using the combined gamma ray and fast neutron mass attenuation coefficients. Absorption differences can be either positive or negative in NEUDEG, increasing with increases in the effective atomic number and decreasing with increases in the hydrogen content. Sample sets of absorption difference curves are calculated for materials with typical gamma-ray and fast neutron mass attenuation coefficients. The model, which uses tabulated mass attenuated coefficients, agrees with experimental data for porcelain tiles and polyethylene sheets. The effects of “beam hardening” are also investigated. - Highlights: • Creation of a dual neutron/gamma beam from 252 Cf is described. • An absorption model is developed using mass attenuation coefficients. • A graphical method is used to show sample results from the model. • The model is successfully compared with experimental results. • The importance of
Energy Technology Data Exchange (ETDEWEB)
Lewis, D.G.; Natto, S.S.A.; Evans, C.J. [Swansea In Vivo Analysis and Cancer Research Group, Department of Physics, University of Wales, Swansea (United Kingdom); Ryde, S.J.S. [Swansea In Vivo Analysis and Cancer Research Group, Department of Medical Physics and Clinical Engineering, Singleton Hospital, Swansea (United Kingdom)
1997-04-01
The Monte Carlo computer code MCNP has been used to design a moderated 2{sup 52}Cf neutron source for in vivo neutron activation analysis of aluminium (Al) in the bones of the hand. The clinical motivation is the need to monitor l body burden in subjects with renal dysfunction, at risk of Al toxicity. The design involves the source positioned on the central axis at one end of a cylindrical deuterium oxide moderator. The moderator is surrounded by a graphite reflector, with the hand inserted at the end of the moderator opposing the source. For a 1 mg {sup 252}Cf source, 15 cm long x 20 cm radius moderator and 20 cm thick reflector, the estimated minimum detection limit is .5 mg Al for a 20 min irradiation, with an equivalent dose of 16.5 mSv to the hand. Increasing the moderator length and/or introducing a fast neutron filter (for example silicon) further reduces interference from fast-neutron-induced reactions on phosphorus in bone, at the expense of decreased fluence of the thermal neutrons which activate Al. Increased source strengths may be necessary to compensate for this decreased thermal fluence, or allow measurements to be made within an acceptable time limit for the comfort of the patient. (author)
Induction of external abnormalities in offspring of male mice irradiated with 252Cf neutron
International Nuclear Information System (INIS)
Kurishita, Akihiro; Ono, Tetsuya; Mori, Yuriko; Okada, Shigefumi; Sawada, Syozo
1992-01-01
To assess the genetic effects of fission neutron, the induction of external malformations was studied in F 1 fetuses after F 0 male mice were irradiated. Male mice of the ICR:MCH strain were irradiated with 252 Cf neutron at doses of 0.238, 0.475, 0.95 and 1.9 Gy. They were mated with non-irradiated female mice at 71-120 days after irradiation. Pregnant females were autopsied on day 18 of gestation and their fetuses were examined for deaths and external abnormalities. No increases of pre- and post-implantation losses were noted at any dose. External abnormalities were observed at rates of 1.40% in the 0.238 Gy, 2.23% in the 0.475 Gy, 3.36% in the 0.95 and 3.26% in the 1.9 Gy groups; the rate in the control group was 1.65%. The dose-response curve was linear up to 0.95 Gy, and then flattened out; the induction rate of external abnormalities was 2.7x10 -4 /gamete/cGy based on the linear regression. These results indicated that fission neutron effectively induces external abnormalities in F 1 fetuses after spermatogonial irradiation. (author). 29 refs.; 1 fig.; 2 tabs
International Nuclear Information System (INIS)
Starostov, B.I.; Semenov, A.F.; Nefedov, V.N.
1978-01-01
The measurement results on the prompt neutron spectra in 233 U, 235 U, 239 Pu thermal neutron fission in the energy range of 0.01-5 MeV and in 252 Cf spontaneous fission in the energy range of 0.01-10 MeV are presented. The time-of-flight method was used. The exceeding of the spectra over the Maxwell distributions is observed at E 252 Cf neutron fission spectra. The spectra analysis was performed after normalization of the spectra and corresponding Maxwell distributions for one and the same area. In the range of 0.05-0.22 MeV the yield of 235 U + nsub(t) fission neutrons is approximately 8 and approximately 15 % greater than the yield of 252 Cf and 239 Pu + nsub(t) fission neutrons, respectively. In the range of 0.3-1.2 MeV the yield of 235 U + nsub(t) fission neutrons is 8 % greater than the fission neutron yield in case of 239 Pu + nsub(t) fission. The 235 U + nsub(t) and 233 U + nsub(t) fission neutron spectra do not differ from one another in the 0.05-0.6 MeV range
International Nuclear Information System (INIS)
Mihalczo, J.T.; Blakeman, E.D.; Ragan, G.E.; Kryter, R.C.; Robinson, R.C.; Seino, H.
1987-08-01
In order to study nuclear criticality safety related to the development of fast breeder technology, 252 Cf-source-driven neutron noise analysis measurements were performed with a Pu-U nitrate solution in a slab tank of various heights and thickness varying 11.43 cm to 19.05 cm. The results and conclusions of these experiments are (1) a capability to measure the subcriticality of a multiplying system of slab geometry to a k/sub eff/ as low as 0.7 was demonstrated, (2) calculated neutron multiplication factors agreed with those from the experiments within ∼0.02, and (3) the applicability of the method for plutonium solution systems was demonstrated. This paper describes measurements in which the height of the slab was varied for a fixed thickness and the thickness varied for a fixed height, which are the first applications of this measurement method to slab geometry
Energy Technology Data Exchange (ETDEWEB)
Sullivan, M.F.; Beamer, J.L.; Mahony, T.D.; Cross, F.T.; Lund, J.E.; Endres, G.W.R.
1976-01-01
About one hundred fifty swine were exposed to either radium-226 or californium-252 sources in the uterine cervix to determine an RBE for both acute and long-term effects. That value for early changes in the tissues at risk in the treatment of cervical cancer was between 6.2 and 6.8. The incidence of complications increased with time after exposure, especially among animals treated with /sup 252/Cf. Analysis of rectal injury showed that ulceration occurred frequently within a year postexposure at doses between 1600 and 2400 rad calculated at 2 cm lateral to the source midline. Fat necrosis and smooth muscle atrophy, resulting in a local rectal stricture, were delayed changes observed in some animals. The lower ureter was the site for a greater frequency of complications than the GI tract. Ureteral stricture often occurred at doses of 1200 rad from /sup 252/Cf and 7000 rad from /sup 226/Ra. Observation of delayed effects in the uterine-cervix in animals held up to 4 years postexposure indicate that the RBE for /sup 252/Cf may be increased to a value as high as 18, while repair may have even decreased it to about 5.6 in the rectum. Fifty swine are still being observed for long-term effects after doses above 800 rad from /sup 252/Cf and 5000 rad from /sup 226/Ra.
Energy Technology Data Exchange (ETDEWEB)
Gautherin, C.; Houry, M.; Korten, W.; Le Coz, Y.; Lucas, R.; Thiesen, Ch. [Dept. d`Astrophysique, de la Physique des Particules, de la Physique Nucleaire et de l`Instrumentation Associee, CEA Centre d`Etudes de Saclay, 91 - Gif-sur-Yvette (France); Badimon, C.; Barreau, G.; Doan, T.P.; Pedemay, G. [Centre d`Etudes Nucleaires, Bordeaux-1 Univ., 33 Gradignan (France); Belier, G.; Girod, M.; Meot, M.V. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, G.; Meot, V.; Peru, S. [CEA Centre d`Etudes de Bruyeres-le-Chatel, 91 (France); Astier, A.; Ducroux, L.; Meyer, M.; Redon, N. [Inst.de Physique Nucleaire, Lyon-1 Univ., 69 - Villeurbanne (France)
1997-06-01
Isomeric states have been studied in fission fragments produced by spontaneous fission of {sup 252}Cf. 34 isomeric nuclei have been identified by using coincidences between {gamma}-rays detected in EUROGAM II and fission fragments detected in photovoltaic cells. Lifetimes from 20 ns up to 2 {mu}s have been measured. Microscopic interpretation of the isomeric levels discovered has been tried by means of the Hartree-Fock-Bogolyubov procedure using Gogny force. It was found that the {sup 152,154,156}Nd nuclei have prolate deformation in their ground state; the rotational band built on this ground state is well reproduced by the calculation. For these nuclei the 2 quasi-particle excited states energies are above 1 MeV in agreement with the experiment. The computation confirms the similitude of the {sup 156}Nd and {sup 158}Sm isomeric states associated to neutron 2 quasi-particles of J{sup {pi}} K{sup {pi}} = 5{sup -} ({nu} 5/2 (642) x {nu} 5/2 (523)) while such similitude does not occur for the isotone nuclei {sup 154}Nd and {sup 156}Sm. The computation predicts a proton 2 quasi-particle excited states of J{sup {pi}} = 5{sup -}, near the isomeric level measured in {sup 156}Sm but not for that of {sup 154}Nd. Concerning the {sup 152}Nd the calculated level density is very near that of the states measured in the 1.6 to 2.3 MeV interval. However, the lack of precise information on spins and parities of the measured levels does make not possible a confrontation with the calculations. An up-graded equipment implying 32 photovoltaic cells instead of 2 cells is to be developed and installed by the EUROGAM 3 refs.
International Nuclear Information System (INIS)
Kamensky, I.; Haakansson, P.; Kjellberg, J.; Sundqvist, B.; Fohlman, J.; Peterson, P.A.
1983-01-01
A method involving fast heavy-ion bombardment of a solid sample called 252 Cf-plasma desorption mass spectrometry has been used to study a non-enzymatic, non-toxic phospholipase homolog from Australian tiger snake (Notechis scutatus) venom. The protein consists of 119 amino acids in a single polypeptide chain cross-linked by 7 disulfide bridges. The isotopically averaged molecular mass as determined by protein sequence analysis is 13309 atomic mass units (amu). The mass distributions were studied by means of time-of-flight measurements. Quasi-molecular ions associated to the molecule and its dimer were observed. The mass of the quasi-molecular ion corresponding to the molecule was determined to be 13285 +- 25 amu. (Auth.)
International Nuclear Information System (INIS)
Perez, R.B.; Valentine, T.E.; Mihalczo, J.T.; Mattingly, J.K.
1997-01-01
A brief discussion of the Cf-252 source driven method for subcritical measurements serves as an introduction to the concept and use of the spectral ratio, Γ. It has also been shown that the Monte Carlo calculation of spectral densities and effective multiplication factors have as a common denominator the transport propagator. This commonality follows from the fact that the Neumann series expansion of the propagator lends itself to the Monte Carlo method. On this basis a linear relationship between the spectral ratio and the effective multiplication factor has been shown. This relationship demonstrates the ability of subcritical measurements of the ratio of spectral densities to validate transport theory methods and cross sections
Testing of ENDF/B cross section data in the Californium-252 neutron benchmark field
International Nuclear Information System (INIS)
Mannhart, W.
1979-01-01
The fission neutron field of 252 Cf presently represents one of the most well-known neutron benchmark fields. For 13 neutron reactions which are of importance in reactor metrology, measurements of spectrum-averaged cross sections, [sigma], performed in this neutron field were compared with calculated average cross sections. This comparison allows one to draw conclusions as to the quality of different sigma(E) data taken from ENDF/B-IV, from ENDF/B-V, and from recent experiments and used in the calculation of average cross sections. The comparison includes an uncertainty analysis regarding the different uncertainty contributions of [sigma], of sigma(E), and of the spectral distribution of 252 Cf fission neutrons. Additionally, in a few examples, sensitivity studies were carried out. The sensitivity of the spectrum-averaged cross sections to individual characteristics of the sigma(E) data, such as normalization factors or shifts in the energy scale, was investigated. Similarly, the sensitivity of [sigma] to the spectral distribution of 252 Cf was determined. 4 figures, 2 tables
International Nuclear Information System (INIS)
Gwin, R.; Spencer, R.R.; Ingle, R.W.; Todd, J.H.; Weaver, H.
1980-01-01
The average number of prompt neutrons emitted per fission ν/sub p/-bar(E), was measured for 235 U relative to ν/sub p/-bar for the spontaneous fission of 252 Cf over the neutron energy range from 500 eV to 10 MeV. The samples of 235 U and 252 Cf were contained in fission chambers located in the center of a large liquid scintillator. Fission neutrons were detected by the large liquid scintillator. The present values of ν/sub p/-bar(E) for 235 U are about 0.8% larger than those measured by Boldeman. In earlier work with the present system, it was noted that Boldeman's value of ν/sub p/-bar(E) for thermal energy neutrons was about 0.8% lower than obtained at ORELA. It is suggested that the thickness of the fission foil used in Boldeman's experiment may cause some of the discrepancy between his and the present values of ν/sub p/-bar(E). For the energy region up to 700 keV, the present values of ν/sub p/-bar(E) for 235 U agree, within the uncertainty, with those given in ENDF/B-V. Above 1 MeV the present results for ν/sub p/-bar(E) range about the ENDF/B-V values with differences up to 1.3%. 6 figures, 1 table
5He, 7He, and 8Li (E*=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf
International Nuclear Information System (INIS)
Kopatch, Yu.N.; Mutterer, M.; Schwalm, D.; Thirolf, P.; Goennenwein, F.
2002-01-01
The neutron-unstable odd-N isotopes 5 He, 7 He, and 8 Li (in its excited state of E*=2.26 MeV) were measured to show up as short-lived (τ≅10 -21 -10 -20 s) intermediate light charged particles (LCPs) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs, and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1x10 -21 s, and 4x10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E*=2.26 MeV (lifetime: 2x10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the 'true' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α particles registered, and to 16.4(3) MeV for the true ternary α particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li* was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed
5He, 7He and 8Li (E=2.26 MeV) intermediate ternary particles in the spontaneous fission of 252Cf
International Nuclear Information System (INIS)
Kopatch, Yu. N.; Goennenwein, F.
2002-02-01
The neutron-unstable odd-N isotopes 5 He, 7 He and 8 Li (in its excited state of E * = 2.26 MeV) were measured to show up as short-lived intermediate light-charged-particles (LCP) in ternary fission of 252 Cf. For the study a high-efficiency angular correlation measurement between neutrons, LCPs and main fission fragments has been performed. The evidence for the ternary 5 He and 7 He particles (lifetimes: 1 x 10 -21 s, and 4 x 10 -21 s, respectively) was disclosed from the measured angular distributions of their decay neutrons focused by the emission in flight towards the direction of motion of 4 He and 6 He ternary particles. Similarly, neutrons observed to be peaked around Li-particle motion could be attributed to the decay of the second excited state at E * = 2.26 MeV (lifetime: 2 x 10 -20 s) of 8 Li. The fractional yields of the intermediate 5 He and 7 He ternary fission modes relative to the ''true'' ternary 4 He and 6 He modes, respectively, were determined to be 0.21(5) for both cases. The mean energy of the 4 He residues resulting from the 5 He decay was determined to be 12.4(3) MeV, compared to 15.7(2) MeV for all ternary α-particles registered, and to 16.4(3) MeV for the true ternary α-particles. The mean energy of the 6 He residues from the 7 He decay is 11.0(15) MeV, compared to 12.3(5) MeV for all ternary 6 He particles. The population of 8 Li * was deduced to be 0.06(2) relative to Li ternary fission, and 0.33(20) relative to the yield of particle stable 8 Li. The perspective of using the observed intermediate LCPs for probing the ternary scission configuration in 252 Cf fission with the aid of trajectory calculations is briefly discussed. (orig.)
Energy Technology Data Exchange (ETDEWEB)
Espinosa, G.; Golzarri, J. I. [UNAM, Instituto de Fisica, Circuito Exterior, Ciudad Universitaria, 04510 Mexico D. F. (Mexico); Castano, V. M. [UNAM, Centro de Fisica Aplicada y Tecnologia Avanzada, Boulevard Juriquilla 3001, Santiago de Queretaro, 76230 Queretaro (Mexico); Gaso, I. [ININ, Carretera Mexico-Toluca s/n, Ocoyoacac 52750, Estado de Mexico (Mexico); Mena, M.; Segovia, N. [UNAM, Instituto de Geofisica, Circuito de la Investigacion Cientifica, Ciudad Universitaria, 04510 Mexico D. F. (Mexico)
2010-02-15
The energy spectrum of {sup 252}Cf fission fragments was measured using nuclear track detectors and digital image analysis system. The detection material was fused silica glass. The detectors were chemically etched in an 8% HF solution. After experimenting with various etching time, it was found that the best resolution of the track diameter distribution was obtained after 30 minutes of etching. Both Gaussian and Lorentzian curves were fit to the track diameter distribution histograms and used to determine the basic parameters of the distribution of the light (N{sub L}) and heavy (N{sub H}) formed peaks and the minimum of the central valley (N{sub V}). Advantages of the method presented here include the fully-automated analysis process, the low cost of the nuclear track detectors and the simplicity of the nuclear track method. The distribution resolution obtained by this method is comparable with the resolution obtained by electronic analysis devices. The descriptive variables calculated were very close to those obtained by other methods based on the use of semiconductor detectors. (Author)
International Nuclear Information System (INIS)
Montoya, Modesto
2013-01-01
The Coulomb effect hypothesis, formerly used to interpret fluctuations in the curve of maximal total kinetic energy as a function of light fragment mass in reactions 233 U(n th ,f), 235 U(n th ,f) and 239 Pu(n th ,f), is confirmed in high kinetic energy as well as in low excitation energy windows, respectively. Data from reactions 233 U(n th ,f), 235 U(n th ,f), 239 Pu(n th ,f) and 252 Cf(sf) show that, between two isobaric fragmentations with similar Q-values, the more asymmetric charge split reaches the higher value of total kinetic energy. Moreover, in isobaric charge splits with different Q-values, similar preference for asymmetrical fragmentations is observed in low excitation energy windows. (author).
Sensitivity of the 252Cf(sf neutron observables to the FREYA input yield functions Y(A, Z, TKE
Directory of Open Access Journals (Sweden)
Randrup Jørgen
2017-01-01
Full Text Available Within the framework of the fission event generator FREYA, we are studying the sensitivity of various neutron observables to the yield distribution Y (A,Z,TKE used as input to the code. Concentrating on spontaneous fission of 252Cf, we have sampled a large number of different input yield functions based on χ2 fits to the experimental data on Y (A and Y (TKE|A. For each of these input yield distributions, we then use FREYA to generate a large sample of complete fission events from which we extract a variety of neutron observables, including the multiplicity distribution, the associated correlation coefficients, and its factorial moments, the dependence of the mean neutron multiplicity on the total fragment kinetic energy TKE and on the fragment mass number A, the neutron energy spectrum, and the two-neutron angular correlation function. In this way, we can determine the variation of these observables resulting from the uncertainties in the experimental mesurements. The imposition of a constraint on the resulting mean neutron multiplicity reduces the variation of the calculated neutron observables and provides a means for shrinking the uncertainties associated with the measured data.
Sensitivity of the 252Cf(sf) neutron observables to the FREYA input yield functions Y(A, Z, TKE)
Randrup, Jørgen; Talou, Patrick; Vogt, Ramona
2017-09-01
Within the framework of the fission event generator FREYA, we are studying the sensitivity of various neutron observables to the yield distribution Y (A,Z,TKE) used as input to the code. Concentrating on spontaneous fission of 252Cf, we have sampled a large number of different input yield functions based on χ2 fits to the experimental data on Y (A) and Y (TKE|A). For each of these input yield distributions, we then use FREYA to generate a large sample of complete fission events from which we extract a variety of neutron observables, including the multiplicity distribution, the associated correlation coefficients, and its factorial moments, the dependence of the mean neutron multiplicity on the total fragment kinetic energy TKE and on the fragment mass number A, the neutron energy spectrum, and the two-neutron angular correlation function. In this way, we can determine the variation of these observables resulting from the uncertainties in the experimental mesurements. The imposition of a constraint on the resulting mean neutron multiplicity reduces the variation of the calculated neutron observables and provides a means for shrinking the uncertainties associated with the measured data.
International Nuclear Information System (INIS)
1975-01-01
This meeting constituted the third phase of a project initiated by the Dosimetry Section of the IAEA in 1973. The first step, early in 1973, consisted of the development of a programme for the loan of Cf-252 sources to the Member States in support of education, training and some limited research. To date, 14 institutions in 13 Member States have participated in this loan programme. In August last year, the Agency published an instructional syllabus and laboratory manual authored by Professors Eric J. Hall and Harald H. Rossi of Columbia University (Californium-252 in Teaching and Research, Technical Reports Series No. 159). The appearance of this publication, including guidance on the design and construction of a storage and use facility, was the second phase of this programme aimed at providing some support to potential users in the fields of radiation biology and dosimetry. The objective of the programme's third phase - the convening of an Educational Seminar - was to provide a forum to bring together participants in the Agency's loan programme and experts in various scientific fields. Specifically, the Seminar consisted of a series of expert presentations in spectrometry, activation and prompt gamma analyses, on-stream analysis, dosimetry, health physics, radiology and radiotherapy. (author)
International Nuclear Information System (INIS)
Mihalczo, J.T.; Ragan, G.E.; Blakeman, E.D.
1988-01-01
A portable measurement system consisting of a personal computer used as a Fourier analyzer and three detection channels (with associated electronics that provide the signals to analog-to-digital (A/D) convertors) has been assembled to measure subcriticality by the /sup 252/Cf-source-driven neutron noise analysis method. The /sup 252/Cf-source-driven neutron noise analysis method for obtaining the subcritical neutron multiplication factor of a configuration of fissile material requires measurement of the frequency-dependent cross-power spectral density (CPSD), G/sub 23/(ω), between a pair of detectors (Nos. 2 and 3) located in or near the fissile material and CPSDs G/sub 12/(ω) and G/sub 13/(ω) between these same detectors and a source of neutrons emanating from an ionization chamber (No. 1) containing /sup 252/Cf, also positioned in or near the fissile material. The auto-power spectral density (APSD), G/sub 11/(ω), of the source is also required. A particular ratio of spectral densities, G/sub 12//sup */G/sub 13//G/sub 11/G/sub 23/ (/sup */ denotes complex conjugation), is then formed. This ratio is related to the subcritical neutron multiplication factor and is independent of detector efficiencies
International Nuclear Information System (INIS)
Lei Xin; Qian Chengyuan; Qing Yi; Zhao Kewei; Yang Zhengzhou; Dai Nan; Zhong Zhaoyang; Tang Cheng; Li Zheng; Gu Xianqing; Zhou Qian; Feng Yan; Xiong Yanli; Shan Jinlu; Wang Dong
2011-01-01
Purpose: To observe, by retrospective analysis, the curative effects and complications due to californium-252 ( 252 Cf) neutron intracavitary brachytherapy (ICBT) combined with external-beam radiotherapy (EBRT) in the treatment of cervical cancer. Methods and Materials: From February 1999 to December 2007, 696 patients with cervical cancer (Stages IB to IIIB) were treated with 252 Cf-ICBT in combination of EBRT. Of all, 31 patients were at Stage IB, 104 at IIA, 363 at IIB, 64 at IIIA, and 134 at IIIB. Californium-252 ICBT was delivered at 7–12 Gy per insertion per week, with a total dose of 29–45 Gy to reference point A in three to five insertions. The whole pelvic cavity was treated with 8-MV X-ray external irradiation at 2 Gy per fraction, four times per week. After 16–38 Gy of external irradiation, the center of the whole pelvic field was blocked with a 4-cm-wide lead shield, with a total external irradiation dose of 44–56 Gy. The total treatment course was 5 to 6 weeks. Results: Overall survival rate at 3 and 5 years for all patients was 76.0% and 64.9%, respectively. Disease-free 3- and 5-year survival rates of patients were 71.2% and 58.4%, respectively. Late complications included vaginal contracture and adhesion, radiation proctitis, radiation cystitis, and inflammatory bowel, which accounted for 5.8%, 7.1%, 6.2%, and 4.9%, respectively. Univariate analysis results showed significant correlation of stage, age, histopathologic grade, and lymph node status with overall survival. Cox multiple regression analysis showed that the independent variables were stage, histopathologic grade, tumor size, and lymphatic metastasis in all patients. Conclusion: Results of this series suggest that the combined use of 252 Cf-ICBT with EBRT is an effective method for treatment of cervical cancer.
Feasibility of fissile mass assay of spent nuclear fuel using 252Cf-source-driven frequency-analysis
International Nuclear Information System (INIS)
Mattingly, J.K.; Valentine, T.E.; Mihalczo, J.T.
1996-01-01
The feasibility was evaluated using MCNP-DSP, an analog Monte Carlo transport cod to simulate source-driven measurements. Models of an isolated Westinghouse 17x17 PWR fuel assembly in a 1500-ppM borated water storage pool were used. In the models, the fuel burnup profile was represented using seven axial burnup zones, each with isotopics estimated by the PDQ code. Four different fuel assemblies with average burnups from fresh to 32 GWd/MTU were modeled and analyzed. Analysis of the fuel assemblies was simulated by inducing fission in the fuel using a 252 Cf source adjacent to the assembly and correlating source fissions with the response of a bank of 3 He detectors adjacent to the assembly opposite the source. This analysis was performed at 7 different axial positions on each of the 4 assemblies, and the source-detector cross-spectrum signature was calculated for each of these 28 simulated measurements. The magnitude of the cross-spectrum signature follows a smooth upward trend with increasing fissile material ( 235 U and 239 Pu) content, and the signature is independent of the concentration of spontaneously fissioning isotopes (e.g., 244 Cm) and (α,n) sources. Furthermore, the cross-spectrum signature is highly sensitive to changes in fissile material content. This feasibility study indicated that the signature would increase ∼100% in response to an increase of only 0.1 g/cm 3 of fissile material
International Nuclear Information System (INIS)
Hurd, J.R.
1998-01-01
The active-passive 252 Cf shuffler instrument, installed and certified several years ago in Los Alamos National Laboratory's plutonium facility, has now been calibrated for different matrices to measure Waste Isolation Pilot Plant (WIPP)-destined transuranic (TRU)-waste. Little or no data currently exist for these types of measurements in plant environments where sudden large changes in the neutron background radiation can significantly distort the results. Measurements and analyses of twenty-two 55-gallon drums, consisting of mixtures of varying quantities of uranium and plutonium in mostly noncombustible matrices, have been recently completed at the plutonium facility. The calibration and measurement techniques, including the method used to separate out the plutonium component, will be presented and discussed. Calculations used to adjust for differences in uranium enrichment from that of the calibration standards will be shown. Methods used to determine various sources of both random and systematic error will be indicated. Particular attention will be directed to those problems identified as arising from the plant environment. The results of studies to quantify the aforementioned distortion effects in the data will be presented. Various solution scenarios will be outlined, along with those adopted here
Energy Technology Data Exchange (ETDEWEB)
Kawaguchi, Noriaki, E-mail: famicom@mail.tagen.tohoku.ac.jp [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yanagida, Takayuki; Fujimoto, Yutaka; Yokota, Yuui; Kamada, Kei [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Fukuda, Kentaro; Suyama, Toshihisa [Tokuyama Corporation, Shibuya 3-chome, Shibuya-ku, Tokyo 150-8383 (Japan); Watanabe, Kenichi; Yamazaki, Atsushi [Nagoya University, Furo-cho, Chikusa-ku, Nagoya 464-8603 (Japan); Chani, Valery [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); Yoshikawa, Akira [IMRAM, Tohoku University, 2-1-1 Katahira, Aoba-ku, Sendai, Miyagi 980-8577 (Japan); New Industry Creation Hatchery Center, Tohoku University, Sendai 980-8579 (Japan)
2011-10-01
Thermal neutron imaging with Ce-doped LiCaAlF{sub 6} crystals has been performed. The prototype of the neutron imager using a Ce-doped LiCaAlF{sub 6} scintillating crystal and a position sensitive photomultiplier tube (PSPMT) which had 64 multi-channel anode was developed. The Ce-doped LiCaAlF{sub 6} single crystal was grown by the Czochralski method. A plate with dimensions of a diameter of 50x2 mm{sup 2} was cut from the grown crystal, polished, and optically coupled to PSPMT by silicone grease. The {sup 252}Cf source (<1 MBq) was sealed with 43 mm of polyethylene for neutron thermalization. Alphabet-shaped Cd pieces with a thickness of 2 mm were used as a mask for the thermal neutrons. After corrections for the pedestals and gain of each pixel, we successfully obtained two-dimensional neutron images using Ce-doped LiCaAlF{sub 6}.
Limonene encapsulation in freeze dried gellan systems.
Evageliou, Vasiliki; Saliari, Dimitra
2017-05-15
The encapsulation of limonene in freeze-dried gellan systems was investigated. Surface and encapsulated limonene content was determined by measurement of the absorbance at 252nm. Gellan matrices were both gels and solutions. For a standard gellan concentration (0.5wt%) gelation was induced by potassium or calcium chloride. Furthermore, gellan solutions of varying concentrations (0.25-1wt%) were also studied. Limonene was added at two different concentrations (1 and 2mL/100g sample). Gellan gels encapsulated greater amounts of limonene than solutions. Among all gellan gels, the KCl gels had the greater encapsulated limonene content. However, when the concentration of limonene was doubled in these KCl gels, the encapsulated limonene decreased. The surface limonene content was significant, especially for gellan solutions. The experimental conditions and not the mechanical properties of the matrices were the dominant factor in the interpretation of the observed results. Copyright © 2016 Elsevier Ltd. All rights reserved.
International Nuclear Information System (INIS)
Hurd, J.R.
1999-01-01
An active-passive 252 Cf shuffler instrument, installed and certified several years ago at Los Alamos National Laboratory's plutonium facility, has now been calibrated for different matrices to measure Waste Isolation Pilot Plant (WIPP)-destined transuranic (TRU) waste. Little or no data currently exist for these types of measurements in plant environments where sudden large changes in the neutron background radiation can significantly distort the results. Measurements and analyses of twenty-two 55-gallon drums, consisting of mixtures of varying quantities of uranium and plutonium in mostly noncombustible matrices, have been recently completed at the plutonium facility. The calibration and measurement techniques, including the method used to separate out the plutonium component, will be presented and discussed. Calculations used to adjust for differences in uranium enrichment from that of the calibration standards will be shown. Methods used to determine various sources of both random and systematic error will be indicated. Particular attention will be directed to those problems identified as arising from the plant environment. The results of studies to quantify the aforementioned distortion effects in the data will be presented. Various solution scenarios will be outlined, along with those adopted here
Fabrication of californium-252 sources in the United Kingdom
International Nuclear Information System (INIS)
Ainsworth, A.; Brady, M.W.; Thornett, W.H.
1975-01-01
The advent of californium-252 in weighable quantities and at a reasonable price has caused some rethinking among neutron source suppliers. To explore this market the Radiochemical Center Ltd. has purchased 2 mg of californium-252, and subdivided this into a wide range of sources. To take advantage of its high specific neutron emission, a small double welded stainless steel capsule 7.8mm diameter x 10mm high was chosen for stock sources and this entailed the use of a microdispensing technique which had to be specially developed. The apparatus and procedure for subdividing milligram amounts of californium-252 are described. Some details of our experience in processing these one milligram shipments are given. 100 sources with activities from 200 microgram to 0.01 microgram have been produced. Losses have been small. Measurement of neutron spectra gamma spectra and dose rates from encapsulated sources has confirmed published data. Though it is early days, little industrial interest in californium-252 sources has been detected, most of the sources have so far been required for research into activation analysis and two examples of this are given. (U.S.)
100 mg 251Cf activation analysis facility at the Savannah River Laboratory
International Nuclear Information System (INIS)
MacMurdo, K.W.; Bowman, W.W.
1975-01-01
The 252 Cf Activation Analysis Facility at the Savannah River Laboratory (SRL) is used routinely for multielement analyses of a wide variety of solid and liquid samples (e.g., metal alloys, fly ash and other airborne particles, rocks, and aqueous and nonaqueous solutions). An automated absolute activation analysis technique, developed to use neutron transport codes to calculate multienergy group neutron spectra and fluxes, converts counting data directly into elemental concentrations expressed in parts per million. The facility contains four sources of 252 Cf totaling slightly over 100 mg. A pneumatic ''rabbit'' system permits automatic irradiation/decay/counting regimes to be performed unattended on up to 100 samples. Detection sensitivities of less than or equal to 400 ppb natural uranium and less than or equal to 0.5 nCi/g for 239 Pu are observed. Detection limits for over 65 elements have been determined. Over 40 elements are detectable at the one part per million level or less. Overall accuracies of +- 10 percent are observed for most elements. (auth)
International Nuclear Information System (INIS)
Endo, A.; Sato, T.
2013-01-01
Absorbed doses, linear energy transfers (LETs) and quality factors of secondary charged particles in organs and tissues, generated via the interactions of the spontaneous fission neutrons from. 252 Cf and. 244 Pu within the human body, were studied using the Particle and Heavy Ion Transport Code System (PHITS) coupled with the ICRP Reference Phantom. Both the absorbed doses and the quality factors in target organs generally decrease with increasing distance from the source organ. The analysis of LET distributions of secondary charged particles led to the identification of the relationship between LET spectra and target-source organ locations. A comparison between human body-averaged mean quality factors and fluence-averaged radiation weighting factors showed that the current numerical conventions for the radiation weighting factors of neutrons, updated in ICRP103, and the quality factors for internal exposure are valid. (authors)
Role of energy cost in the yield of cold ternary fission of Cf
Indian Academy of Sciences (India)
Abstract. The energy costs in the cold ternary fission of 252Cf for various light charged particle emission are calculated by including Wong's correction for Coulomb potential. Energy cost is found to be higher in cold fission than in normal fission. It is found that energy cost always increases with decrease in experimental yield ...
Discrepancies in the half-lives of 90Sr, 137Cs and 252Cf
International Nuclear Information System (INIS)
Rajput, M.U.; Mac Mahon, T.D.
1990-01-01
Recent reports have pointed out that significant discrepancies exist in published half-life data for 90 Sr, 137 Cs and 252 Cr, amongst others. These discrepancies make the estimation of evaluated half-lives for these isotopes difficult and contentious. This paper reviews the current situation, takes into account recently available data and attempts to derive recommended half-lives and associated uncertainties for the three isotopes. 37 refs, 3 tabs
Study of the 249-251Cf + 48Ca reactions: recent results and outlook
Voinov, A. A.; Oganessian, Yu Ts; Abdullin, F. Sh; Brewer, N. T.; Dmitriev, S. N.; Grzywacz, R. K.; Hamilton, J. H.; Itkis, M. G.; Miernik, K.; Polyakov, A. N.; Roberto, J. B.; Rykaczewski, K. P.; Sabelnikov, A. V.; Sagaidak, R. N.; Shirokovsky, I. V.; Shumeiko, M. V.; Stoyer, M. A.; Subbotin, V. G.; Sukhov, A. M.; Tsyganov, Yu S.; Utyonkov, V. K.; Vostokin, G. K.
2018-02-01
Experiment aiming at the synthesis of heavy isotopes of Z=118 (Og) using beam of 48Ca and a target of 249-251Cf was undertaken in October 2015 - April 2016 employing the Dubna Gas-Filled Recoil Separator (FLNR JINR). The target of mixed isotopes of 249-251Cf (50.7% of 249Cf, 12.9% of 250Cf, and 36.4% of 251Cf) was irradiated by 48Ca ions at two beam energies of 252 and 258 MeV with the corresponding accumulated beam doses of 1.6×1019 and 1.1×1019. A single event observed at lower beam energy was assigned to the isotope 294Og, the product of the reaction 249Cf(48Ca, 3n); its decay pattern and the observed radioactive properties of the nuclides in the decay chain reproduce in full those observed for 294Og in our earlier experiments of 2002-2005 and 2012. At higher beam energy we observed no decay chains that could be attributed to the isotopes of Og. The possibility of renewal of this experiment in the future is discussed.
International Nuclear Information System (INIS)
Wogman, N.A.
1976-12-01
Instrumentation has been designed for in situ analysis of marine and terrestrial minerals using the techniques of x-ray fluorescence and neutron activation analysis. The energy-dispersive x-ray fluorescence analyzer allows more than 20 elements to be quantitatively measured at the 10 ppM level in water depths to 300 m. The analyzer consists of a solid cryogen-cooled Si(Li) detector, a 50 mCi 109 Cd or 57 Co excitation source, and an analyzer-computer system for data storage and manipulation. The neutron activation analysis, which is designed to measure up to 30 elements at parts per hundred to ppM levels, utilizes the man-made element 252 Cf as its neutron activation source. The resulting radioelements which emit characteristic gamma radiation are then analyzed in situ during 2- to 200-s counting intervals with Ge(Li) or NaI(T1) detector systems. An extension of this latter technique, which uses a 252 Cf- 235 U fueled subcritical multiplier, is also being studied. The subcritical facility allows the neutrons from the 252 Cf source to be multiplied, thus providing greater neutron flux. Details of these in situ analysis systems, actual in situ spectra, and recorded data are discussed with respect to the detection of minerals at their varying concentration levels. The system response of each illustrates its usefulness for various rapid environmental mineral exploration studies. These techniques can be utilized on terrestrial surfaces and marine or fresh water sediments. 5 figures, 2 tables
International Nuclear Information System (INIS)
Reber, E.L.; Gehrke, R.J.; Aryaeinejad, R.; Hartwell, J.K.
2005-01-01
Gamma-ray spectrometry measurements have been made of the fission yields of selected γ -rays emitted by the spontaneously fissioning isotopes 252 Cf and 244 Cm. The measured γ-rays were selected based on their relative abundance in the spectrum and their freedom from interference or, in a few instances, ease of interference correction. From these data and the cumulative and independent yield data of England and Rider, those γ-rays that are primarily produced by radioactive decay, as opposed to direct yield, were converted into the decays per spontaneous fission expressed in percent and compared to cumulative yield values of England and Rider. For those γ-rays whose production is dominated by direct (independent) yield, the ratio of γ-rays per spontaneous fission is reported. The γ-ray yield can be compared to the independent yield values of England and Rider when 100% of the direct feeding passes through the γ-ray. In those cases where both cumulative and independent yields contribute to the observed γ-ray emission rate, a direct comparison is not possible but a method to quantify the contribution from each is proposed. (author)
International Nuclear Information System (INIS)
Madland, D.G.; LaBauve, R.J.; Nix, J.R.
1984-01-01
Because of their importance as neutron standards, we present comparisons of measured and calculated prompt fission neutron spectra N(E) and average prompt neutron multiplicities anti nu/sub p/ for the spontaneous fission of 252 Cf. In particular, we test three representations of N(E) against recent experimental measurements of the differential spectrum and threshold integral cross sections. These representations are the Maxwellian spectrum, the NBS spectrum, and the Los Alamos spectrum of Madland and Nix. For the Maxwellian spectrum, we obtain the value of the Maxwellian temperature T/sub M/ by a least-squares adjustment to the experimental differential spectrum of Poenitz and Tamura. For the Los Alamos spectrum, a similar least-squares adjustment determines the nuclear level-density parameter a, which is the single unknown parameter that appears. The NBS spectrum has been previously constructed by adjustments to eight differential spectra measured during the period 1965 to 1974. Among these three representations, we find that the Los Alamos spectrum best reproduces both the differential and integral measurements, assuming ENDF/B-V cross sections in the calculation of the latter. Although the NBS spectrum reproduces the integral measurements fairly well, it fails to satisfactorily reproduce the new differential measurement, and the Maxwellian spectrum fails to satisfactorily reproduce the integral measurements. Additionally, we calculate a value of anti nu/sub p/ from the Los Alamos theory that is within approximately 1% of experiment. 25 references
Fabrication of intense neutron sources for medical applications
International Nuclear Information System (INIS)
Boulogne, A.R.; Walker, V.W.
1975-01-01
Simulated sources containing 252 Cf equivalents of 0.1 to 1.0 milligrams were prepared. Samarium was used as the simulant in a modified chemical plating technique similar to that used to prepare palladium-californium oxide cermet for industrial applications. The length of the platinum-10 percent iridium doubly encapsulated source with its protective sheath is 0.545 in. (14.1 mm). Outside dia of the source, including its sheath, is 0.109 in. (2.8 mm). Existing ''Brachytrons'' can accommodate this source form. This capsule system will withstand internal gas pressures from helium due to alpha decay and fission gases from a 1 mg 252 Cf source after ten years if the source is subjected to a maximum temperature of 800 0 C, the theoretical temperature of an accidental fire. Under these conditions the safety factor is 3. The capsule system is being tested with tracer amounts of 252 Cf to ensure that it will withstand adverse service conditions as well as tests specified for Special Form Materials. (auth)
Energy Technology Data Exchange (ETDEWEB)
Crane, T.W.
1980-03-01
A summary of the status and applicability of nondestructive assay (NDA) techniques for the measurement of uranium and plutonium in 55-gal barrels of solid waste is reported. The NDA techniques reviewed include passive gamma-ray and x-ray counting with scintillator, solid state, and proportional gas photon detectors, passive neutron counting, and active neutron interrogation with neutron and gamma-ray counting. The active neutron interrogation methods are limited to those employing isotopic neutron sources. Three generic neutron sources (alpha-n, photoneutron, and /sup 252/Cf) are considered. The neutron detectors reviewed for both prompt and delayed fission neutron detection with the above sources include thermal (/sup 3/He, /sup 10/BF/sub 3/) and recoil (/sup 4/He, CH/sub 4/) proportional gas detectors and liquid and plastic scintillator detectors. The instrument found to be best suited for low-level measurements (< 10 nCi/g) is the /sup 252/Cf Shuffler. The measurement technique consists of passive neutron counting followed by cyclic activation using a /sup 252/Cf source and delayed neutron counting with the source withdrawn. It is recommended that a waste assay station composed of a /sup 252/Cf Shuffler, a gamma-ray scanner, and a screening station be tested and evaluated at a nuclear waste site. 34 figures, 15 tables.
International Nuclear Information System (INIS)
Mihalczo, J.T.; Ragan, G.E.; Blakeman, E.D.
1987-01-01
A portable measurement system consisting of a personal computer used as a Fourier analyzer and three detection channels (with associated electronics that provide the signals to analog-to-digital (A/D) convertors) has been assembled to measure subcriticality by the 252 Cf-source-driven neutron noise analysis method. 8 refs
Pozzi, S A
2002-01-01
The present simulations performed with the Monte Carlo code MCNP-POLIMI [1] have the scope of evaluating the associated-particle sealed tube neutron generator (APSTNG) for use as an interrogation source in the source-driven noise analysis method for the assay of nuclear materials. In the Nuclear Materials Identification System (NMIS) developed at the Oak Ridge National Laboratory, the time dependent cross-correlation of the timed neutron source and detector responses is one of the signatures acquired. Previous studies and measurements have demonstrated the sensitivity of this and other related signatures to fissile mass [2-3]. In a recent report [4], we outlined the advantages of the APSTNG interrogation source for use with NMIS when compared with the Cf-252 source. In particular, we showed that when the distance between the source and the sample and the sample and the detectors is large, the APSTNG source outperforms the Cf-252 in sensitivity to fissile mass. This is the case when performing measurements of ...
1987 Neutron and gamma personnel dosimeter intercomparison study using a D2O-moderated 252Cf source
International Nuclear Information System (INIS)
Swaja, R.E.; West, L.E.; Sims, C.S.; Welty, T.J.
1989-05-01
The thirteenth Personnel Dosimetry Intercomparison Study (i.e., PDIS 13) was conducted during April 1987 as a joint effort by Oak Ridge National Laboratory's (ORNL) Dosimetry Applications Research Group and the Southwest Radiation Calibration Center at the University of Arkansas. A total of 48 organizations (34 from the US and 14 from abroad) participated in PDIS 13. Participants submitted a total of 1,113 neutron and gamma dosimeters for this mixed field study. The dosimeters were transferred by mail and were handled by experimental personnel at ORNL and the University of Arkansas. The type of neutron dosimeter and the percentage of participants submitting that type are as follows: TLD-albedo (49%), direct interaction TLD (31%), CR-39 (17%), film (3%). The type of gamma dosimeter and the percentage of participants submitting that type are as follows: Li 2 B 4 O 7 , alone or in combination with CaSO 4 , (69%), 7 LiF (28%), natural LiF (3%). Radiation exposures in PDIS 13 were limited to 0.5 and 1.5 mSv from 252 Cf moderated by 15-cm of D 2 O. Traditional exposures using the Health Physics Research Reactor (HPRR) were not possible due to the fact that all reactors at ORNL, including the HPRR, were shutdown by order of the Department of Energy at the time the intercomparison was performed. Planned exposures using a 238 PuBe source were negated by a faulty timing mechanism. Based on accuracy and precision, direct interaction TLD dosimeters exhibited the best performance in PDIS 13 neutron measurements. They were followed, in order of best performance, by CR-39, TLD albedo, and film. The Li 2 B 4 O 7 type TLD dosimeters exhibited the best performance in PDIS 13 gamma measurements. They were followed by natural LiF, 7 LiF, and film. 12 refs., 1 fig., 5 tabs
International Nuclear Information System (INIS)
Todd, P.; Feola, J.M.
1986-01-01
Metabolically deoxygenated suspensions of human T-1 cells were used to determine the RBE in hypoxia of low dose rate (LDR) Cf-252 radiation compared to LDR gamma radiation. Based upon the initial portion of the survival curves the RBE was 5.0 ± 1.0 for all components of the Cf-252 radiation and 7.1 ± 1.7 for the neutrons alone. An inverse dose rate effect was observed for LDR gamma radiation in which greater cell sensitivity was observed at lower dose rates and longer irradiation periods. It was demonstrated that there was little or no sublethal damage repair or cell progression during LDR at 21 deg C, and the observed decrease in cell survival probability with increasing irradiation time at a given dose was attributable to reoxygenation of the cell suspensions during the course of LDR exposures. (Auth.)
Energy Technology Data Exchange (ETDEWEB)
Feldman, Alexander [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2014-04-24
This document describes the development and approach for the radiological characterization of Cf-252 sealed sources for shipment to the Waste Isolation Pilot Plant. The report combines information on the nuclear material content of each individual source (mass or activity and date of manufacture) with information and data on the radionuclide distributions within the originating nuclear material. This approach allows for complete and accurate characterization of the waste container without the need to take additional measurements. The radionuclide uncertainties, developed from acceptable knowledge (AK) information regarding the source material, are applied to the summed activities in the drum. The AK information used in the characterization of Cf-252 sealed sources has been qualified by the peer review process, which has been reviewed and accepted by the Environmental Protection Agency.
International Nuclear Information System (INIS)
Sharma, S.
1986-01-01
A storage and shielding facility for 300 μg of Californium-252 sources was designed and constructed. Though the safe was in a permanent location, the fact that it consisted of a lead bucket surrounded by polyethylene pellets made it simple, movable and inexpensive. If need be, more quantities of Cf-252 could be added without altering the basic design and sacrificing the radiation protection guidelines. The measured radiation levels from 300 μg of stored Cf-252 in and around the storage vault were lower than the expected dose rates by a factor of 5. The measured radiation levels around the occupied environs of the facility were below the maximum permissible yearly dose of 500mrem for non-occupational workers. A transport vessel was designed and constructed to carry up to 50 μg of Californium-252 sources. It consisted of a standard 55 gallon steel drum on casters containing cylindrical lead shield surrounded by polyethylene pellets. The measured maximum surface dose rates on the drum and at one meter away were within the radiation protection guidelines and were less than the expected dose rates. A portable shield was designed and constructed to protect the body in afterloading operations and handling of the sources. It consisted of polyethylene pellets in an aluminum box and an attached 10 cm thick plexiglass eye shield. The simple design, with the ease of using polyethylene pellets can be extended to construct bedside shields
Quality of life in children with CF: Psychometrics and relations with stress and mealtime behaviors.
Driscoll, Kimberly A; Modi, Avani C; Filigno, Stephanie S; Brannon, Erin E; Chamberlin, Leigh Ann; Stark, Lori J; Powers, Scott W
2015-06-01
The purpose of this study was to evaluate the utility of the Cystic Fibrosis Questionnaire-Revised (CFQ-R) with toddlers and preschool-aged children. Clinically relevant relations between health-related quality of life (HRQOL), stress, and mealtime behaviors have not been examined. It was hypothesized that problematic mealtime behaviors and increased stress would be negatively associated with HRQOL. Parents of 73 children (2-6 years) with CF completed questionnaires assessing their children's generic (PedsQL) and CF-specific HRQOL, parenting and CF-specific stress, and mealtime behaviors. CFQ-R Physical, Eating, and Respiratory HRQOL subscales had acceptable to strong reliability (alphas = 0.73-0.86); other scales approached acceptable reliability. Lower CF-specific stress was associated with higher CFQ-R Eating HRQOL (B = -0.84; P < 0.05) scores. Fewer eating problems were associated with higher CFQ-R Eating (B = -1.17; P < 0.0001) and Weight HRQOL (B = -0.78; P < 0.01) scores. As hypothesized, problematic eating and higher CF-specific stress was associated with lower CF-specific HRQOL. The CFQ-R has promise for use in young children with CF, but will need to be modified to exchange items not relevant to preschoolers with items that are more relevant to this age group. © 2014 Wiley Periodicals, Inc.
Micelle-encapsulated fullerenes in aqueous electrolytes
Energy Technology Data Exchange (ETDEWEB)
Ala-Kleme, T., E-mail: timo.ala-kleme@utu.fi [Department of Chemistry, University of Turku, 20014 Turku (Finland); Maeki, A.; Maeki, R.; Kopperoinen, A.; Heikkinen, M.; Haapakka, K. [Department of Chemistry, University of Turku, 20014 Turku (Finland)
2013-03-15
Different micellar particles Mi(M{sup +}) (Mi=Triton X-100, Triton N-101 R, Triton CF-10, Brij-35, M{sup +}=Na{sup +}, K{sup +}, Cs{sup +}) have been prepared in different aqueous H{sub 3}BO{sub 3}/MOH background electrolytes. It has been observed that these particles can be used to disperse the highly hydrophobic spherical [60]fullerene (1) and ellipsoidal [70]fullerene (2). This dispersion is realised as either micelle-encapsulated monomers Mi(M{sup +})1{sub m} and Mi(M{sup +})2{sub m} or water-soluble micelle-bound aggregates Mi(M{sup +})1{sub agg} and Mi(M{sup +})2{sub agg}, where especially the hydration degree and polyoxyethylene (POE) thickness of the micellar particle seems to play a role of vital importance. Further, the encapsulation microenvironment of 1{sub m} was found to depend strongly on the selected monovalent electrolyte cation, i.e., the encapsulated 1{sub m} is accommodated in the more hydrophobic microenvironment the higher the cationic solvation number is. - Highlights: Black-Right-Pointing-Pointer Different micellar particles is used to disperse [60]fullerene and [70]fullerene. Black-Right-Pointing-Pointer Fullerene monomers or aggregates are dispersed encaging or bounding by micelles. Black-Right-Pointing-Pointer Effective facts are hydration degree and polyoxyethylene thickness of micelle.
Directory of Open Access Journals (Sweden)
Pronyaev Vladimir G.
2017-01-01
Full Text Available An IAEA project to update the Neutron Standards is near completion. Traditionally, the Thermal Neutron Constants (TNC evaluated data by Axton for thermal-neutron scattering, capture and fission on four fissile nuclei and the total nu-bar of 252Cf(sf are used as input in the combined least-square fit with neutron cross section standards. The evaluation by Axton (1986 was based on a least-square fit of both thermal-spectrum averaged cross sections (Maxwellian data and microscopic cross sections at 2200 m/s. There is a second Axton evaluation based exclusively on measured microscopic cross sections at 2200 m/s (excluding Maxwellian data. Both evaluations disagree within quoted uncertainties for fission and capture cross sections and total multiplicities of uranium isotopes. There are two factors, which may lead to such difference: Westcott g-factors with estimated 0.2% uncertainties used in the Axton's fit, and deviation of the thermal spectra from Maxwellian shape. To exclude or mitigate the impact of these factors, a new combined GMA fit of standards was undertaken with Axton's TNC evaluation based on 2200 m/s data used as a prior. New microscopic data at the thermal point, available since 1986, were added to the combined fit. Additionally, an independent evaluation of TNC was undertaken using CONRAD code. Both GMA and CONRAD results are consistent within quoted uncertainties. New evaluation shows a small increase of fission and capture thermal cross sections, and a corresponding decrease in evaluated thermal nubar for uranium isotopes and 239Pu.
48 CFR 53.301-252 - Standard Form 252, Architect-Engineer Contract.
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Standard Form 252, Architect-Engineer Contract. 53.301-252 Section 53.301-252 Federal Acquisition Regulations System FEDERAL..., Architect-Engineer Contract. EC01MY91.035 EC01MY91.036 ...
Chivanov, V D; Zubarev, R A; Aksenov, S A; Bordunova, O G; Eremenko, V I; Kabanets, V M; Tatarinova, V I; Mishnev, A K; Kuraev, V V; Knysh, A N; Eremenko, I A
1996-08-01
The addition of organic acids (picric, oxalic, citric, or tartaric) to peptide and protein samples was found to significantly increase the yield of their quasi-molecular ions (QMI) in time-of-flight 252Cf plasma desorption mass spectrometry. The yield of the ions depended on the pKa of the acid added.
Atmospheric Chemistry of (CF3)2CF-C≡N
DEFF Research Database (Denmark)
Andersen, Mads Peter Sulbæk; Kyte, Mildrid; Thirstrup Andersen, Simone
2017-01-01
FTIR/smog chamber experiments and ab initio quantum calculations were performed to investigate the atmospheric chemistry of (CF3)2CFCN, a proposed replacement compound for the industrially important sulfur hexafluoride, SF6. The present study determined k(Cl + (CF3)2CFCN) = (2.33 ± 0.87) × 10–17, k......(OH + (CF3)2CFCN) = (1.45 ± 0.25) × 10–15, and k(O3 + (CF3)2CFCN) ≤ 6 × 10–24 cm3 molecule–1 s–1, respectively, in 700 Torr of N2 or air diluent at 296 ± 2 K. The main atmospheric sink for (CF3)2CFCN was determined to be reaction with OH radicals. Quantum chemistry calculations, supported by experimental...
Sorption data bases for generic Swiss argillaceous rock systems
International Nuclear Information System (INIS)
Bradbury, M. H.; Baeyens, B.; Thoenen, T.
2010-09-01
In Switzerland the site selection procedure for both high level waste (HLW) and low and intermediate level waste (L/ILW) repositories is specified by the Swiss Federal Office of Energy in the Sectoral Plan for Deep Geological Repositories. In the forthcoming stage 2 of this plan, potential sites will be identified within regions previously selected based on the presence of suitable host rocks, namely Opalinus Clay, 'Brauner Dogger', Effingen Member and Helvetic Marl. Preliminary safety analyses are an integral part of this procedure, and require, amongst other information, the radionuclide sorption properties of the host rock. This report describes a methodology to develop a Generic Rock Sorption Data Base (GR-SDB) for argillaceous rocks. The method will be used to compile specific SDBs for the above mentioned host rocks. Arguments are presented that the main factor influencing sorption on argillaceous rocks is the phyllosilicate mineral content. These minerals are particularly effective at binding metals to their surfaces by cation exchange and surface complexation. Generally, the magnitude of sorption is directly correlated with the phyllosilicate content (2:1 type clays: illite/smectite/illitesmectite mixed layers), and this parameter best reflects the sorption potential of a given mineral assembly. Consequently, sorption measurements on illite were preferably used as source data for the GR-SDB. The second component influencing radionuclide sorption is the porewater chemistry. In the present report, generic water compositions were extracted from the analytical ranges of deep ground waters in various sedimentary formations in Switzerland. In order to cover the range of ionic strength (I) and pH values of Swiss ground waters in argillaceous rocks, five types of generic water compositions were defined, combining low, intermediate and high values of ionic strength and pH. The GR-SDB for in situ conditions was derived using conversion factors (CF). As the name
International Nuclear Information System (INIS)
Simabuco, S.M.
1984-01-01
To study the possibility of using two non-destructive (neutron activation and X-ray fluorescence) analyses in simultaneous quali-quantitative evaluations of some elements in mineral supplement for animals, a Cf-252 neutron source (11.3 mCi; 21.1 μgrams) and a Am-241 low energy gamma-ray emitter source (59.5 KeV; 100 mCi) were employed. For these sources, shieldings and sample irradiation systems were built. For the neutron activation analysis a reservoir of 72 cm height and 43 cm diameter was filled with paraffine, and the samples and neutron sources were put inside this reservoir using polypropilene and nylon tubes. To detect the gamma-rays emitted by the radioisotopes a well-type solid NaI(Tl) crystal scintillator (3x3') was used, coupled to a multi-channel analyser. For the X-ray fluorescence analysis a lead cylinder of 9.75 cm height and 5.6 cm diameter (with 0.7 cm thickness) was made and internally lined with a 0.36 mm copper and 0.1 mm aluminium foil. (Author) [pt
Optimizing relational algebra operations using generic equivalence discriminators and lazy products
DEFF Research Database (Denmark)
Henglein, Fritz
2010-01-01
We show how to efficiently evaluate generic map-filter-product queries, generalizations of select-project-join (SPJ) queries in re- lational algebra, based on a combination of two novel techniques: generic discrimination-based joins and lazy (formal) products. Discrimination-based joins are based...... that discriminators can be constructed generically (by structural recursion on equivalence expressions), purely func- tionally, and efficiently (worst-case linear time). The array-based basic multiset discrimination algorithm of Cai and Paige (1995) provides a base discriminator that is both asymptotically and prac...... on relational algebra equalities, without need for a query preprocessing phase. They require no indexes and behave purely functionally. They can be considered a form of symbolic execution of set expressions that automate and encapsulate dynamic program transformation of such expressions and lead to asymptotic...
Díaz-de-Mera, Yolanda; Aranda, Alfonso; Bravo, Iván; Rodríguez, Diana; Rodríguez, Ana; Moreno, Elena
2008-10-01
The adverse environmental impacts of chlorinated hydrocarbons on the Earth's ozone layer have focused attention on the effort to replace these compounds by nonchlorinated substitutes with environmental acceptability. Hydrofluoroethers (HFEs) and fluorinated alcohols are currently being introduced in many applications for this purpose. Nevertheless, the presence of a great number of C-F bonds drives to atmospheric long-lived compounds with infrared absorption features. Thus, it is necessary to improve our knowledge about lifetimes and global warming potentials (GWP) for these compounds in order to get a complete evaluation of their environmental impact. Tropospheric degradation is expected to be initiated mainly by OH reactions in the gas phase. Nevertheless, Cl atoms reaction may also be important since rate constants are generally larger than those of OH. In the present work, we report the results obtained in the study of the reactions of Cl radicals with HFE-7000 (CF(3)CF(2)CF(2)OCH(3)) (1) and its isomer CF(3)CF(2)CF(2)CH(2)OH (2). Kinetic rate coefficients with Cl atoms have been measured using the discharge flow tube-mass spectrometric technique at 1 Torr of total pressure. The reactions of these chlorofluorocarbons (CFCs) substitutes have been studied under pseudo-first-order kinetic conditions in excess of the fluorinated compounds over Cl atoms. The temperature ranges were 266-333 and 298-353 K for reactions of HFE-7000 and CF(3)CF(2)CF(2)CH(2)OH, respectively. The measured room temperature rate constants were k(Cl+CF(3)CF(2)CF(2)OCH(3)) = (1.24 +/- 0.28) x 10(-13) cm(3) molecule(-1) s(-1)and k(Cl+CF(3)CF(2)CF(2)CH(2)OH) = (8.35 +/- 1.63) x 10(-13) cm(3) molecule(-1) s(-1) (errors are 2sigma + 10% to cover systematic errors). The Arrhenius expression for reaction 1 was k (1)(266-333 K) = (6.1 +/- 3.8) x 10(-13)exp[-(445 +/- 186)/T] cm(3) molecule(-1) s(-1) and k (2)(298-353 K) = (1.9 +/- 0.7) x 10(-12)exp[-(244 +/- 125)/T] cm(3) molecule(-1) s(-1) (errors
Two-quasineutron states in 98248Cf and 98250Cf and the neutron-neutron residual interactions
International Nuclear Information System (INIS)
Katori, K.; Ahmad, I.; Friedman, A. M.
2008-01-01
Two-quasineutron states in 248 Cf and 250 Cf were investigated by single-neutron transfer reactions, 249 Cf(d,t) 248 Cf and 249 Cf(d,p) 250 Cf. The majority of levels observed were assigned to 12 bands in 248 Cf and six bands in 250 Cf, constructed from the single-particle states in neighboring Cf nuclei. The effective two-body interactions between two odd neutrons coupled outside a deformed core were deduced from the differences in the energies of the bandheads formed by the parallel and antiparallel coupling of the intrinsic spins of the two single-particle states
Atmospheric chemistry of (CF3)2CHOCH3, (CF3)2CHOCHO, and CF3C(O)OCH3
DEFF Research Database (Denmark)
Østerstrøm, Freja From; Wallington, Timothy J.; Andersen, Mads Peter Sulbæk
2015-01-01
Smog chambers with in situ FTIR detection were used to measure rate coefficients in 700 Torr of air and 296 ± 2 K of: k(Cl+(CF3)2CHOCH3) = (5.41 ± 1.63) × 10(-12), k(Cl+(CF3)2CHOCHO) = (9.44 ± 1.81) × 10(-15), k(Cl+CF3C(O)OCH3) = (6.28 ± 0.98) × 10(-14), k(OH+(CF3)2CHOCH3) = (1.86 ± 0.41) × 10(-1...
Lifescience Database Archive (English)
Full Text Available SL (Link to library) SLH252 (Link to dictyBase) - - - - SLH252F (Link to Original site) SLH2...52F 158 - - - - - - Show SLH252 Library SL (Link to library) Clone ID SLH252 (Link to dictyBase) At...las ID - NBRP ID - dictyBase ID - Link to Contig - Original site URL http://dictycdb.biol.tsukuba.ac.jp/CSM/SL/SLH2-C/SLH2...52Q.Seq.d/ Representative seq. ID SLH252F (Link to Original site) R...epresentative DNA sequence >SLH252 (SLH252Q) /CSM/SL/SLH2-C/SLH252Q.Seq.d/ ACAGAATGGGTAAAGTACATGGTGGTTTGAATC
2010-01-01
... head means the Secretary of the Department of Commerce, or designee. Benefit means, except as the... 15 Commerce and Foreign Trade 1 2010-01-01 2010-01-01 false Definitions. 25.2 Section 25.2 Commerce and Foreign Trade Office of the Secretary of Commerce PROGRAM Fraud Civil Remedies § 25.2...
Sensitivity Analysis of Cf-252 (sf) Neutron and Gamma Observables in CGMF
Energy Technology Data Exchange (ETDEWEB)
Carter, Austin Lewis [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Talou, Patrick [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Stetcu, Ionel [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Kiedrowski, Brian Christopher [Los Alamos National Lab. (LANL), Los Alamos, NM (United States); Jaffke, Patrick John [Los Alamos National Lab. (LANL), Los Alamos, NM (United States)
2017-12-06
CGMF is a Monte Carlo code that simulates the decay of primary fission fragments by emission of neutrons and gamma rays, according to the Hauser-Feshbach equations. As the CGMF code was recently integrated into the MCNP6.2 transport code, great emphasis has been placed on providing optimal parameters to CGMF such that many different observables are accurately represented. Of these observables, the prompt neutron spectrum, prompt neutron multiplicity, prompt gamma spectrum, and prompt gamma multiplicity are crucial for accurate transport simulations of criticality and nonproliferation applications. This contribution to the ongoing efforts to improve CGMF presents a study of the sensitivity of various neutron and gamma observables to several input parameters for Californium-252 spontaneous fission. Among the most influential parameters are those that affect the input yield distributions in fragment mass and total kinetic energy (TKE). A new scheme for representing Y(A,TKE) was implemented in CGMF using three fission modes, S1, S2 and SL. The sensitivity profiles were calculated for 17 total parameters, which show that the neutron multiplicity distribution is strongly affected by the TKE distribution of the fragments. The total excitation energy (TXE) of the fragments is shared according to a parameter RT, which is defined as the ratio of the light to heavy initial temperatures. The sensitivity profile of the neutron multiplicity shows a second order effect of RT on the mean neutron multiplicity. A final sensitivity profile was produced for the parameter alpha, which affects the spin of the fragments. Higher values of alpha lead to higher fragment spins, which inhibit the emission of neutrons. Understanding the sensitivity of the prompt neutron and gamma observables to the many CGMF input parameters provides a platform for the optimization of these parameters.
... Accommodations for College Scholarships and Financial Aid 10 Things I Wish I Knew Before Coming to College CF and College: The Secret to Getting it All Done View All Managing My CF in College Resources ...
Biomedical neutron research at the Californium User Facility for neutron science
International Nuclear Information System (INIS)
Martin, R.C.; Byrne, T.E.; Miller, L.F.
1997-01-01
The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy
Photoionisation study of Xe.CF{sub 4} and Kr.CF{sub 4} van-der-Waals molecules
Energy Technology Data Exchange (ETDEWEB)
Alekseev, V. A., E-mail: alekseev@va3474.spb.edu; Kevorkyants, R. [St. Petersburg State University, 7/9 Universitetskaya Nab., St. Petersburg 199034 (Russian Federation); Garcia, G. A.; Nahon, L. [Synchrotron Soleil, Orme des Merisiers, St. Aubin BP 48, 91192 Gif sur Yvette Cedex (France)
2016-05-14
We report on photoionization studies of Xe.CF{sub 4} and Kr.CF{sub 4} van-der-Waals complexes produced in a supersonic expansion and detected using synchrotron radiation and photoelectron-photoion coincidence techniques. The ionization potential of CF{sub 4} is larger than those of the Xe and Kr atoms and the ground state of the Rg.CF{sub 4}{sup +} ion correlates with Rg{sup +} ({sup 2}P{sub 3/2}) + CF{sub 4}. The onset of the Rg.CF{sub 4}{sup +} signals was found to be only ∼0.2 eV below the Rg ionization potential. In agreement with experiment, complementary ab initio calculations show that vertical transitions originating from the potential minimum of the ground state of Rg.CF{sub 4} terminate at a part of the potential energy surfaces of Rg.CF{sub 4}{sup +}, which are approximately 0.05 eV below the Rg{sup +} ({sup 2}P{sub 3/2}) + CF{sub 4} dissociation limit. In contrast to the neutral complexes, which are most stable in the face geometry, for the Rg.CF{sub 4}{sup +} ions, the calculations show that the minimum of the potential energy surface is in the vertex geometry. Experiments which have been performed only with Xe.CF{sub 4} revealed no Xe.CF{sub 4}{sup +} signal above the first ionization threshold of Xe, suggesting that the Rg.CF{sub 4}{sup +} ions are not stable above the first dissociation limit.
Improving the safety of a body composition analyser based on the PGNAA method
Energy Technology Data Exchange (ETDEWEB)
Miri-Hakimabad, Hashem; Izadi-Najafabadi, Reza; Vejdani-Noghreiyan, Alireza; Panjeh, Hamed [FUM Radiation Detection And Measurement Laboratory, Ferdowsi University of Mashhad (Iran, Islamic Republic of)
2007-12-15
The {sup 252}Cf radioisotope and {sup 241}Am-Be are intense neutron emitters that are readily encapsulated in compact, portable and sealed sources. Some features such as high flux of neutron emission and reliable neutron spectrum of these sources make them suitable for the prompt gamma neutron activation analysis (PGNAA) method. The PGNAA method can be used in medicine for neutron radiography and body chemical composition analysis. {sup 252}Cf and {sup 241}Am-Be sources generate not only neutrons but also are intense gamma emitters. Furthermore, the sample in medical treatments is a human body, so it may be exposed to the bombardments of these gamma-rays. Moreover, accumulations of these high-rate gamma-rays in the detector volume cause simultaneous pulses that can be piled up and distort the spectra in the region of interest (ROI). In order to remove these disadvantages in a practical way without being concerned about losing the thermal neutron flux, a gamma-ray filter made of Pb must be employed. The paper suggests a relatively safe body chemical composition analyser (BCCA) machine that uses a spherical Pb shield, enclosing the neutron source. Gamma-ray shielding effects and the optimum radius of the spherical Pb shield have been investigated, using the MCNP-4C code, and compared with the unfiltered case, the bare source. Finally, experimental results demonstrate that an optimised gamma-ray shield for the neutron source in a BCCA can reduce effectively the risk of exposure to the {sup 252}Cf and {sup 241}Am-Be sources.
7 CFR 3565.252 - Housing types.
2010-01-01
... 7 Agriculture 15 2010-01-01 2010-01-01 false Housing types. 3565.252 Section 3565.252 Agriculture Regulations of the Department of Agriculture (Continued) RURAL HOUSING SERVICE, DEPARTMENT OF AGRICULTURE GUARANTEED RURAL RENTAL HOUSING PROGRAM Property Requirements § 3565.252 Housing types. The property may...
Biomedical neutron research at the Californium User Facility for Neutron Science
International Nuclear Information System (INIS)
Martin, R.C.; Byrne, T.E.; Miller, L.F.
1998-01-01
The Californium User Facility for Neutron Science has been established at Oak Ridge National Laboratory (ORNL). The Californium User Facility (CUF) is a part of the larger Californium Facility, which fabricates and stores compact 252 Cf neutron sources for worldwide distribution. The CUF can provide a cost-effective option for research with 252 Cf sources. Three projects at the CUF that demonstrate the versatility of 252 Cf for biological and biomedical neutron-based research are described: future establishment of a 252 Cf-based neutron activation analysis system, ongoing work to produce miniature high-intensity, remotely afterloaded 252 Cf sources for tumor therapy, and a recent experiment that irradiated living human lung cancer cells impregnated with experimental boron compounds to test their effectiveness for boron neutron capture therapy. (author)
14 CFR 252.9 - Ventilation systems.
2010-01-01
... 14 Aeronautics and Space 4 2010-01-01 2010-01-01 false Ventilation systems. 252.9 Section 252.9... REGULATIONS SMOKING ABOARD AIRCRAFT § 252.9 Ventilation systems. Air carriers shall prohibit smoking whenever the ventilation system is not fully functioning. Fully functioning for this purpose means operating so...
Guo, Qin; Zhang, Ni; Uchimaru, Tadafumi; Chen, Liang; Quan, Hengdao; Mizukado, Junji
2018-04-01
The rate constants for the gas-phase reactions of cyc-CF2CF2CF2CH=CH- with OH radicals were determined by a relative rate method between 253 and 328 K. The rate constant k1 at 298 K was measured to be (1.08 ± 0.04) × 10-13 cm3 molecule-1 s-1, and the Arrhenius expression was k1 = (3.72 ± 0.14) × 10-13 exp [(-370 ± 12)/T]. The atmospheric lifetime of cyc-CF2CF2CF2CH=CH- was calculated to be 107 d. The products and mechanism for the reaction of cyc-CF2CF2CF2CH=CH- with OH radicals were also investigated. CO, CO2, and COF2 were identified as the main carbon-containing products following the OH-initiated reaction. Moreover, the radiative efficiency (RE) was determined to be 0.143 W m-2 ppb-1, and the global warming potentials (GWPs) for 20, 100, and 500 yr were 54, 15, and 4, respectively. The photochemical ozone creation potential of the title compound was estimated to be 1.3.
Avni, A; Avital, S; Gromet-Elhanan, Z
1991-04-25
Incubation of tobacco and lettuce thylakoids with 2 M LiCl in the presence of MgATP removes the beta subunit from their CF1-ATPase (CF1 beta) together with varying amounts of the CF1 alpha subunit (CF1 alpha). These 2 M LiCl extracts, as with the one obtained from spinach thylakoids (Avital, S., and Gromet-Elhanan, Z. (1991) J. Biol. Chem. 266, 7067-7072), could form active hybrid ATPases when reconstituted into inactive beta-less Rhodospirillum rubrum chromatophores. Pure CF1 beta fractions that have been isolated from these extracts could not form such active hybrids by themselves, but could do so when supplemented with trace amounts (less than 5%) of CF1 alpha. A mitochondrial F1-ATPase alpha subunit was recently reported to be a heat-shock protein, having two amino acid sequences that show a highly conserved identity with sequences found in molecular chaperones (Luis, A. M., Alconada, A., and Cuezva, J. M. (1990) J. Biol. Chem. 265, 7713-7716). These sequences are also conserved in CF1 alpha isolated from various plants, but not in F1 beta subunits. The above described reactivation of CF1 beta by trace amounts of CF1 alpha could thus be due to a chaperonin-like function of CF1 alpha, which involves the correct, active folding of isolated pure CF1 beta.
Enhancement of discharge performance of Li/CF x cell by thermal treatment of CF x cathode material
Zhang, Sheng S.; Foster, Donald; Read, Jeffrey
In this work we demonstrate that the thermal treatment of CF x cathode material just below the decomposition temperature can enhance discharge performance of Li/CF x cells. The performance enhancement becomes more effective when heating a mixture of CF x and citric acid (CA) since CA serves as an extra carbon source. Discharge experiments show that the thermal treatment not only reduces initial voltage delay, but also raises discharge voltage. Whereas the measurement of powder impedance indicates the thermal treatment does not increase electronic conductivity of CF x material. Based on these facts, we propose that the thermal treatment results in a limited decomposition of CF x, which yields a subfluorinated carbon (CF x- δ), instead of a highly conductive carbon. In the case of CF x/AC mixture, the AC provides extra carbon that reacts with F 2 and fluorocarbon radicals generated by the thermal decomposition of CF x to form subfluorinated carbon. The process of thermal treatment is studied by thermogravimetric analysis and X-ray diffraction, and the effect of treatment conditions such as heating temperature, heating time and CF x/CA ratio on the discharge performance of CF x cathode is discussed. As an example, a Li/CF x cell using CF x treated with CA at 500 °C under nitrogen for 2 h achieved theretical specific capacity when being discharged at C/5. Impedance analysis indicates that the enhanced performance is attributed to a significant reduction in the cell reaction resistance.
The electronic encapsulation of knowledge in hydraulics, hydrology and water resources
Abbott, Michael B.
The rapidly developing practice of encapsulating knowledge in electronic media is shown to lead necessarily to the restructuring of the knowledge itself. The consequences of this for hydraulics, hydrology and more general water-resources management are investigated in particular relation to current process-simulation, real-time control and advice-serving systems. The generic properties of the electronic knowledge encapsulator are described, and attention is drawn to the manner in which knowledge 'goes into hiding' through encapsulation. This property is traced in the simple situations of pure mathesis and in the more complex situations of taxinomia using one example each from hydraulics and hydrology. The consequences for systems architectures are explained, pointing to the need for multi-agent architectures for ecological modelling and for more general hydroinformatics systems also. The relevance of these developments is indicated by reference to ongoing projects in which they are currently being realised. In conclusion, some more general epistemological aspects are considered within the same context. As this contribution is so much concerned with the processes of signification and communication, it has been partly shaped by the theory of semiotics, as popularised by Eco ( A Theory of Semiotics, Indiana University, Bloomington, 1977).
Kinetics and mechanisms of reactions of CF, CHF, and CF2 radicals
International Nuclear Information System (INIS)
Hsu, D.S.Y.; Umstead, M.E.; Lin, M.C.
1978-01-01
This chapter reviews briefly methods for the production of CF, CHF and CF 2 , and inmore detail, the reactions of these interesting and important radicals. Although a considerable, but not extensive, amount of work has been done on the reactions of CF 2 , little of the chemistry of CF and CHF is known. This chapter also includes the preliminary results of some experiments carried out in this Laboratory on the dynamics of some of the reactions involving these radicals. These results were largely arrived at through investigations of the degree of vibrational excitation of the HF and CO reaction products, determined by HF and CO laser emission and CO laser resonance absorption measurements. The coverage of this review is restricted to the gas phase chemistry of these radicals, and does not include their addition reactions to olefins
International Nuclear Information System (INIS)
Straker, E.A.; Gritzner, M.L.; Harris, L. Jr.
1978-01-01
Calculations of neutron and gamma-ray fluences from 14-MeV neutron and 252 Cf sources in liquid air and liquid nitrogen have been performed. These calculations were made specifically for comparison with experimental data measured at Stohl, Federal Republic of Germany. The discrete-ordinates method was utilized with neutron and gamma-ray cross sections from ENDF/B-IV. One-dimensional calculational models were developed for the sources and tank. Limited comparisons are made with experimental data
Comparison of generic-to-brand switchback patterns for generic and authorized generic drugs
Hansen, Richard A.; Qian, Jingjing; Berg, Richard; Linneman, James; Seoane-Vazquez, Enrique; Dutcher, Sarah K.; Raofi, Saeid; Page, C. David; Peissig, Peggy
2018-01-01
Background While generic drugs are therapeutically equivalent to brand drugs, some patients and healthcare providers remain uncertain about whether they produce identical outcomes. Authorized generics, which are identical in formulation to corresponding brand drugs but marketed as a generic, provide a unique post-marketing opportunity to study whether utilization patterns are influenced by perceptions of generic drugs. Objectives To compare generic-to-brand switchback rates between generics and authorized generics. Methods A retrospective cohort study was conducted using claims and electronic health records data from a regional U.S. healthcare system. Ten drugs with authorized generics and generics marketed between 1999 and 2014 were evaluated. Eligible adult patients received a brand drug during the 6 months preceding generic entry, and then switched to a generic or authorized generic. Patients in this cohort were followed for up to 30 months from the index switch date to evaluate occurrence of generic-to-brand switchbacks. Switchback rates were compared between patients on authorized generics versus generics using Kaplan-Meier curves and Cox proportional hazards models, controlling for individual drug effects, age, sex, Charlson comorbidity score, pre-index drug use characteristics, and pre-index healthcare utilization. Results Among 5,542 unique patients that switched from brand-to-generic or brand-to-authorized generic, 264 (4.8%) switched back to the brand drug. Overall switchback rates were similar for authorized generics compared with generics (HR=0.86; 95% CI 0.65-1.15). The likelihood of switchback was higher for alendronate (HR=1.64; 95% CI 1.20-2.23) and simvastatin (HR=1.81; 95% CI 1.30-2.54) and lower for amlodipine (HR=0.27; 95% CI 0.17-0.42) compared with other drugs in the cohort. Conclusions Overall switchback rates were similar between authorized generic and generic drug users, indirectly supporting similar efficacy and tolerability profiles for
Directory of Open Access Journals (Sweden)
R.P. Kelley
2015-03-01
Full Text Available An empirical investigation of the scintillation mechanism in a pressurized 4He gas fast neutron detector was conducted using pulse shape fitting. Scintillation signals from neutron interactions were measured and averaged to produce a single generic neutron pulse shape from both a 252Cf spontaneous fission source and a (d,d neutron generator. An expression for light output over time was then developed by treating the decay of helium excited states in the same manner as the decay of radioactive isotopes. This pulse shape expression was fitted to the measured neutron pulse shape using a least-squares optimization algorithm, allowing an empirical analysis of the mechanism of scintillation inside the 4He detector. A further understanding of this mechanism in the 4He detector will advance the use of this system as a neutron spectrometer. For 252Cf neutrons, the triplet and singlet time constants were found to be 970 ns and 686 ns, respectively. For neutrons from the (d,d generator, the time constants were found to be 884 ns and 636 ns. Differences were noted in the magnitude of these parameters compared to previously published data, however the general relationships were noted to be the same and checked with expected trends from theory. Of the excited helium states produced from a 252Cf neutron interaction, 76% were found to be born as triplet states, similar to the result from the neutron generator of 71%. The two sources yielded similar pulse shapes despite having very different neutron energy spectra, validating the robustness of the fits across various neutron energies.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Contract. 252.13 Section 252.13 Shipping MARITIME ADMINISTRATION, DEPARTMENT OF TRANSPORTATION REGULATIONS AFFECTING SUBSIDIZED VESSELS AND OPERATORS OPERATING... Contract. Upon approval by the Board of an application for ODS, the applicant and the United States may...
2010-01-01
... 7 Agriculture 4 2010-01-01 2010-01-01 false Administration. 252.3 Section 252.3 Agriculture Regulations of the Department of Agriculture (Continued) FOOD AND NUTRITION SERVICE, DEPARTMENT OF AGRICULTURE... Administration. (a) Role of FNS. The Secretary will designate those commodities which will be available under the...
International Nuclear Information System (INIS)
Kobayashi, Hiromasa.
1975-01-01
Object: To easily increase a start-up power of a reactor without irradiation in other reactors. Structure: A neutron source comprises Cf 252 , a natural antimony rod, a layer of beryllium, and a vessel of neutron source. On upper and lower portion of Cf 252 are arranged natural antimony rods, which are surrounded by the Be layer, the entirety being charged into the vessel. The Cf 252 may emit neutron, has a half life more than a period of operating cycle of the reactor and is less deteriorated even irradiated by radioactive rays while being left within the reactor. The natural antimony rod is radioactivated by neutron from Cf 252 and neutron as reactor power increases to emit γ rays. The Be absorbs γ rays to emit the neutron. The antimony rod is irradiated within the reactor. Further, since the Cf 252 is small in neutron absorption cross section, it is hard to be deteriorated even while being inserted within the reactor. (Kamimura, M.)
Methods for characterization of wafer-level encapsulation applied on silicon to LTCC anodic bonding
International Nuclear Information System (INIS)
Khan, M F; Ghavanini, F A; Enoksson, P; Haasl, S; Löfgren, L; Persson, K; Rusu, C; Schjølberg-Henriksen, K
2010-01-01
This paper presents initial results on generic characterization methods for wafer-level encapsulation. The methods, developed specifically to evaluate anodic bonding of low-temperature cofired ceramics (LTCC) to Si, are generally applicable to wafer-level encapsulation. Different microelectromechanical system (MEMS) structures positioned over the whole wafer provide local information about the bond quality. The structures include (i) resonating cantilevers as pressure sensors for bond hermeticity, (ii) resonating bridges as stress sensors for measuring the stress induced by the bonding and (iii) frames/mesas for pull tests. These MEMS structures have been designed, fabricated and characterized indicating that local information can easily be obtained. Buried electrodes to enable localized bonding have been implemented and their effectiveness is indicated from first results of the novel Si to LTCC anodic bonding.
Comparison of Generic-to-Brand Switchback Rates Between Generic and Authorized Generic Drugs.
Hansen, Richard A; Qian, Jingjing; Berg, Richard; Linneman, James; Seoane-Vazquez, Enrique; Dutcher, Sarah K; Raofi, Saeid; Page, C David; Peissig, Peggy
2017-04-01
Generic drugs contain identical active ingredients as their corresponding brand drugs and are pharmaceutically equivalent and bioequivalent, whereas authorized generic drugs (AGs) contain both identical active and inactive ingredients as their corresponding brand drugs but are marketed as generics. This study compares generic-to-brand switchback rates between generic and AGs. Retrospective cohort study. Claims and electronic health record data from a regional U.S. health care system. The full cohort consisted of 5542 unique patients who received select branded drugs during the 6 months prior to their generic drug market availability (between 1999 and 2014) and then were switched to an AG or generic drug within 30 months of generic drug entry. For these patients, 5929 unique patient-drug combinations (867 with AGs and 5062 with generic drugs) were evaluated. Ten drugs with AGs and generics marketed between 1999 and 2014 were evaluated. The date of the first generic prescription was considered the index date for each drug, and it marked the beginning of follow-up to evaluate the occurrence of generic-to-brand switchback patterns over the subsequent 30 months. Switchback rates were compared between patients receiving AGs versus those receiving generics using multivariable Cox proportional hazards models, controlling for individual drug effects, age, sex, Charlson Comorbidity Score, pre-index drug use characteristics, and pre-index health care utilization. Among the 5542 unique patients who switched from brand to generic or brand to AG, 264 (4.8%) switched back to the brand drug. Overall switchback rates were similar for AGs compared with generics (hazard ratio [HR] 0.86, 95% confidence interval [CI] 0.65-1.15). The likelihood of switchback was higher for alendronate (HR 1.64, 95% CI 1.20-2.23) and simvastatin (HR 1.81, 95% CI 1.30-2.54) and lower for amlodipine (HR 0.27, 95% CI 0.17-0.42) compared with the other drugs evaluated. Overall switchback rates were similar
DEFF Research Database (Denmark)
Andersen, Mads Peter Sulbæk; Hurley, MD; Ball, JC
2003-01-01
The synthesis, IR spectrum, and first-principles characterization of CF3CH(ONO)CF3 as well as its use as an OH radical source in kinetic and mechanistic studies are reported. CF3CH(ONO)CF3 exists in two conformers corresponding to rotation about the RCO-NO bond. The more prevalent trans conformer......C(O)CF3 and, by implication, OH radicals in 100% yield. CF3CH(ONO)CF3 photolysis is a convenient source of OH radicals in the studies of the yields of CO, CO2, HCHO, and HC(O)OH products which can be difficult to measure using more conventional OH radical sources (e.g., CH3ONO photolysis). CF3CH...
Mordon, Serge R.; Begu, Sylvie; Buys, Bruno; Tourne-Peteilh, Corine; Devoisselle, Jean-Marie
2001-05-01
Vascular endothelium serves as an extensive interface between circulating blood and various tissues and organs of the body. As such, it offers an accessible target for blood-borne pharmacological and genetic manipulations that can mediate both local and systemic effects. Thus, targeting of liposomes to activated vascular endothelial cells may provide a strategy for site-selective delivery in the vascular system with broad therapeutic applicability. This study aimed to evaluate an intravital fluorescence imaging technique to visualize in-situ and in real-time the activation of platelets after staining by 5,6-CF- encapsulated PEGylated liposomes injected intravenously. The study was performed on skin by using a dorsal skin-fold chamber implanted in golden hamsters using intravital microscopy. The skin micro circulation was observed with an intravital microscope (using x25 and x40 magnification) fitted with a Xenon light source and an epi-fluorescence assembly. An ultra-high sensitivity video-camera mounted on the microscope projected the image onto a monitor, and the images were recorded for play-back analysis with a digital video cassette recorder. An inflammatory response was induced by an Argon laser emitting at 514.5nm. The 80micrometers laser beam was focused on a vessel and its position was controlled with the microscope imaging system, it was possible to see individual platelets flowing in blood vessels. As liposomes were labeled with a fluorescent probe which was hydrophilic (located in the aqueous phase), the fluorescence of platelets was due only to the uptake of liposomes. After laser irradiation, platelets activation at sites of vascular injury was obtained. Tethering, translocation of some platelets inside the irradiated zone were clearly seen. At last, detachment and extravasation of platelets were observed. A perivascular fluorescence confirmed that platelets migrated across the basal lamina into the dermal connective tissue. In conclusion, staining of
48 CFR 252.231-7000 - Supplemental cost principles.
2010-10-01
... principles. 252.231-7000 Section 252.231-7000 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.231-7000 Supplemental cost principles. As prescribed in 231.100-70, use the following clause: Supplemental Cost Principles (DEC 1991) When the allowability of costs under...
Encapsulation layer design and scalability in encapsulated vertical 3D RRAM
International Nuclear Information System (INIS)
Yu, Muxi; Fang, Yichen; Wang, Zongwei; Chen, Gong; Pan, Yue; Yang, Xue; Yin, Minghui; Yang, Yuchao; Li, Ming; Cai, Yimao; Huang, Ru
2016-01-01
Here we propose a novel encapsulated vertical 3D RRAM structure with each resistive switching cell encapsulated by dielectric layers, contributing to both the reliability improvement of individual cells and thermal disturbance reduction of adjacent cells due to the effective suppression of unwanted oxygen vacancy diffusion. In contrast to the traditional vertical 3D RRAM, encapsulated bar-electrodes are adopted in the proposed structure substituting the previous plane-electrodes, thus encapsulated resistive switching cells can be naturally formed by simply oxidizing the tip of the metal bar-electrodes. In this work, TaO x -based 3D RRAM devices with SiO 2 and Si 3 N 4 as encapsulation layers are demonstrated, both showing significant advantages over traditional unencapsulated vertical 3D RRAM. Furthermore, it was found thermal conductivity and oxygen blocking ability are two key parameters of the encapsulation layer design influencing the scalability of vertical 3D RRAM. Experimental and simulation data show that oxygen blocking ability is more critical for encapsulation layers in the relatively large scale, while thermal conductivity becomes dominant as the stacking layers scale to the sub-10 nm regime. Finally, based on the notable impacts of the encapsulation layer on 3D RRAM scaling, an encapsulation material with both excellent oxygen blocking ability and high thermal conductivity such as AlN is suggested to be highly desirable to maximize the advantages of the proposed encapsulated structure. The findings in this work could pave the way for reliable ultrahigh-density storage applications in the big data era. (paper)
Absolute rate constants for the reaction of CF3O2 and CF3O radicals with NO at 295 K
DEFF Research Database (Denmark)
Sehested, J.; Nielsen, O.J.
1993-01-01
Using a pulse radiolysis UV absorption technique and subsequent simulations of experimental NO2 and FNO absorption transients, rate constants for reaction between CF3O and CF3O2 radicals with NO were determined, CF3O2+NO-->CF3O+NO2 (3), CF3O+NO-->CF2O+FNO (5). k3 was derived to be (1.68+/-0.26)x10...
46 CFR 252.33 - Hull and machinery insurance.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Hull and machinery insurance. 252.33 Section 252.33... Subsidy Rates § 252.33 Hull and machinery insurance. (a) Subsidy items. The fair and reasonable net premium costs (including stamp taxes) of hull and machinery, increased value, excess general average...
Scandinavian Nurse Specialist Group/Cystic Fibrosis (SNSG/CF)
DEFF Research Database (Denmark)
Bregnballe, Vibeke; Erwander, Inger
2006-01-01
/CF comprises one CF nurse from each of the centers. The board meets twice a year to plan workshops and courses. SNSG/CF is part of the International Nurse Specialist Group/Cystic Fibrosis (INSG/CF). Results: Within the framework of SNSG/CF a 2-day workshop is held every second year for approximately 40...
DEFF Research Database (Denmark)
Hurley, MD; Ball, JC; Wallington, TJ
2004-01-01
Smog chamber/FTIR techniques were used to study the products and mechanism of the Cl atom initiated oxidation of 4:2 fluorotelomer alcohol (CF3(CF2)(3)CH2CH2OH) in 700 Torr of N-2/O-2 diluent at 296 K. CF3(CF2)(3)CH2CHO is the sole primary oxidation product. CF3(CF2)(3)CHO, CF3(CF2)(3)CH2COOH...... respectively. Using relative rate techniques, a value of k(Cl + CF3(CF2)(3)CH2CHO) = (1.84 +/- 0.30) x 10(-11) cm(3) molecule(-1) s(-1) was determined. The yield of the perfluorinated acid, CF3(CF2)(3)COOH, from the 4:2 fluorotelomer alcohol increased with the diluent gas oxygen concentration......, and CF3(CF2)(3)CH2C(O)OOH are secondary oxidation products. Further irradiation results in the formation of CF3(CF2)(3)COOH, COF2, and CF3OH. CF3(CF2)(3)CHO, CF3(CF2)(3)CH2COOH, and CF3(CF2)(3)CH2C(O)OOH are formed from CF3(CF2)(3)CH2CHO oxidation in yields of 46 27 and less than or equal to 27...
48 CFR 252.217-7010 - Performance.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Performance. 252.217-7010... Clauses 252.217-7010 Performance. As prescribed in 217.7104(a), use the following clause: Performance (JUL..., scrap or other ship's material of the Government resulting from performance of the work as items of...
48 CFR 252.217-7009 - Default.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Default. 252.217-7009... Clauses 252.217-7009 Default. As prescribed in 217.7104(a), use the following clause: Default (DEC 1991... of default to the Contractor, terminate the whole or any part of a job order if the Contractor fails...
40 CFR 265.252 - Waste analysis.
2010-07-01
... 40 Protection of Environment 25 2010-07-01 2010-07-01 false Waste analysis. 265.252 Section 265... FACILITIES Waste Piles § 265.252 Waste analysis. In addition to the waste analyses required by § 265.13, the... in the pile to which it is to be added. The analysis conducted must be capable of differentiating...
Energy Technology Data Exchange (ETDEWEB)
Stepanov, Sergey
2010-04-26
Tunable Diode Laser Absorption Spectroscopy in the mid InfraRed spectral range (IR-TDLAS) has been applied to investigate the behaviour of CF, CF{sub 2} and C{sub 2}F{sub 4} species produced in pulsed CF{sub 4}/H{sub 2} capacitively coupled radio frequency plasmas (13.56 MHz CCP). This experimental technique was shown to be suitable for temporally resolved measurements of the absolute number density of the target molecules in the studied fluorocarbon discharges. The temporal resolution of about 20..40 ms typically achieved in the standard data acquisition mode (''stream mode'') was sufficient for the real-time measurements of CF{sub 2} and C{sub 2}F{sub 4}, but not of CF whose kinetics was observed to be much faster. Therefore, a more sophisticated approach (''burst mode'') providing a temporal resolution of 0.94 ms was established and successfully applied to CF density measurements. In order to enable the TDLAS measurements of the target species, preliminary investigations on their spectroscopic data had been carried out. In particular, pure C{sub 2}F{sub 4} has been produced in laboratory by means of vacuum thermal decomposition (pyrolysis) of polytetrafluoroethylene and used as a reference gas. Therefore, an absorption structure consisting of several overlapping C{sub 2}F{sub 4} lines around 1337.11 cm{sup -1} was selected and carefully calibrated, which provided the first absolute measurements of the species by means of the applied experimental technique. The absolute number density traces measured for CF, CF{sub 2} and C{sub 2}F{sub 4} in the studied pulsed plasmas were then analysed, in which two differential balance equations were proposed for each of the species to describe their behaviour during both ''plasma on'' and ''plasma off'' phases. Analytical solutions of the balance equations were used to fit the experimental data and hence to deduce important information on the
Energy Technology Data Exchange (ETDEWEB)
Stepanov, Sergey
2010-04-26
Tunable Diode Laser Absorption Spectroscopy in the mid InfraRed spectral range (IR-TDLAS) has been applied to investigate the behaviour of CF, CF{sub 2} and C{sub 2}F{sub 4} species produced in pulsed CF{sub 4}/H{sub 2} capacitively coupled radio frequency plasmas (13.56 MHz CCP). This experimental technique was shown to be suitable for temporally resolved measurements of the absolute number density of the target molecules in the studied fluorocarbon discharges. The temporal resolution of about 20..40 ms typically achieved in the standard data acquisition mode (''stream mode'') was sufficient for the real-time measurements of CF{sub 2} and C{sub 2}F{sub 4}, but not of CF whose kinetics was observed to be much faster. Therefore, a more sophisticated approach (''burst mode'') providing a temporal resolution of 0.94 ms was established and successfully applied to CF density measurements. In order to enable the TDLAS measurements of the target species, preliminary investigations on their spectroscopic data had been carried out. In particular, pure C{sub 2}F{sub 4} has been produced in laboratory by means of vacuum thermal decomposition (pyrolysis) of polytetrafluoroethylene and used as a reference gas. Therefore, an absorption structure consisting of several overlapping C{sub 2}F{sub 4} lines around 1337.11 cm{sup -1} was selected and carefully calibrated, which provided the first absolute measurements of the species by means of the applied experimental technique. The absolute number density traces measured for CF, CF{sub 2} and C{sub 2}F{sub 4} in the studied pulsed plasmas were then analysed, in which two differential balance equations were proposed for each of the species to describe their behaviour during both ''plasma on'' and ''plasma off'' phases. Analytical solutions of the balance equations were used to fit the experimental data and hence to deduce important information on the kinetics of the studied molecules. In particular, during the ''plasma off'' phase
International Nuclear Information System (INIS)
Brunson, G.S. Jr.
1982-06-01
An array of eight high-speed plastic scintillation detectors has been used to infer a mathematical model for the emission multipliciy of prompt gammas in the spontaneous fission of 252 Cf. Exceptional time resolution and coincidence capability permitted the separation of gammas from fast neutrons over a flight path of approximately 10 cm. About 20 different distribution models were tested. The average energy of the prompt gammas is inversely related to the number emitted; however, this inverse relationship is not strong and the total gamma energy does increase with increasing gamma number. An extension of the experiment incorporated a lithium-drifted germanium gamma spectrometer that resolved nearly 100 discrete gammas associated with fission. Of these gammas, some were preferentially associated with fission in which few gammas were emitted. Certain others were more frequent when many gammas were emitted. Results are presented
48 CFR 252.236-7000 - Modification proposals-price breakdown.
2010-10-01
...-price breakdown. 252.236-7000 Section 252.236-7000 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.236-7000 Modification proposals—price breakdown. As prescribed in 236.570(a), use the following clause: Modification Proposals—Price Breakdown (DEC 1991) (a) The...
Directory of Open Access Journals (Sweden)
D. Hassell
2017-12-01
Full Text Available The CF (Climate and Forecast metadata conventions are designed to promote the creation, processing, and sharing of climate and forecasting data using Network Common Data Form (netCDF files and libraries. The CF conventions provide a description of the physical meaning of data and of their spatial and temporal properties, but they depend on the netCDF file encoding which can currently only be fully understood and interpreted by someone familiar with the rules and relationships specified in the conventions documentation. To aid in development of CF-compliant software and to capture with a minimal set of elements all of the information contained in the CF conventions, we propose a formal data model for CF which is independent of netCDF and describes all possible CF-compliant data. Because such data will often be analysed and visualised using software based on other data models, we compare our CF data model with the ISO 19123 coverage model, the Open Geospatial Consortium CF netCDF standard, and the Unidata Common Data Model. To demonstrate that this CF data model can in fact be implemented, we present cf-python, a Python software library that conforms to the model and can manipulate any CF-compliant dataset.
48 CFR 252.217-7002 - Offering property for exchange.
2010-10-01
... exchange. 252.217-7002 Section 252.217-7002 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.217-7002 Offering property for exchange. As prescribed in 217.7005, use the following provision: Offering Property for Exchange (DEC 1991) (a) The property described in item...
Engelbrecht, Siegfried; Lill, H; Junge, Wolfgang
1986-01-01
Chloroplast ATPase (CF1) was isolated from spinach, pea and maize thylakoids by EDTA extraction followed by anion-exchange chromatography. CF1 was purified and resolved by HPLC into integral CF1, and CF1 lacking the delta & epsilon subunits: CF1(-delta) and CF1(-epsilon). Washing Mono-Q-bound CF1
International Nuclear Information System (INIS)
Wang Dong; Qing Yi; Zhong Zhaoyang; Li Zengpeng; Zhang Xinhong; Yang Yuxin
2007-01-01
Objective: To knock down APE1 gene expression in HOS cells, and explore its antitumor effects in combination with 252 Cf neutron radiotherapy. Methods: pSilence APE1 siBNA plasmid was transfected into HOS cells by SuperFect Transfection liposome. The transfected HOS cells were irradiated by 252 Cf neutron, then MTY assay, clone formation assay and alkaline comet assay were used to detect the radiobiological reaction, and cell apoptosis was detected with flow cytometry. Results: The D 37 value was 3.02 vs. 2.42 in the control and transfected HOS cells respectively after irradiation with 252 Cf neutron, the DMF value is 1.43. The tail moments and cell apoptosis rate at 200, 500 and 1000 cGy showed significant difference between the two groups (P 252 Cf neutron radiotherapy may be a promising approach to therapy of human osteosarcoma in the future. (authors)
Immunoliposome-PCR: a generic ultrasensitive quantitative antigen detection system
Directory of Open Access Journals (Sweden)
He Junkun
2012-06-01
encapsulate multiple reporters per liposome also helps overcome the effect of polymerase inhibitors present in biological specimens. Finally, the biotin-labeled liposome detection reagent can be coupled through a NeutrAvidin bridge to a multitude of biotin-labeled probes, making ILPCR a highly generic assay system.
46 CFR 252.31 - Wages of officers and crews.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Wages of officers and crews. 252.31 Section 252.31... Subsidy Rates § 252.31 Wages of officers and crews. (a) Definitions. When used in this part: (1) Base period. The first base period under the wage index systems, as provided in section 603 of the Act, is the...
Studying fission neutrons with 2E-2v and 2E
Directory of Open Access Journals (Sweden)
Al-Adili Ali
2018-01-01
The 2E technique utilizes an ionization chamber together with two liquid scintillator detectors. Two measurements have been performed, one of 252Cf(sf and another one of thermal-neutron induced fission in 235U(n,f. Results from 252Cf(sf are reported here.
Decomposition of Potent Greenhouse Gases SF6, CF4 and SF5CF3 by Dielectric Barrier Discharge
International Nuclear Information System (INIS)
Zhang Renxi; Wang Jingting; Cao Xu; Hou Huiqi
2016-01-01
For their distinguished global warming potential (GWP100) and long atmosphere lifespan, CF 4 , SF 6 and SF 5 CF 3 were significant in the field of greenhouse gas research. The details of discharging character and the optimal parameter were discussed by using a Dielectric Barrier Discharge (DBD) reactor to decompose these potent greenhouse gases in this work. The results showed that SF 6 could be decomposed by 92% under the conditions of 5 min resident time and 3000 V applied voltage with the partial pressure of 2.0 kPa, 28.2 kPa, and 1.8 kPa for SF 6 , air and water vapor, respectively. 0.4 kPa CF 4 could be decomposed by 98.2% for 4 min resident time with 30 kPa Ar added. The decomposition of SF 5 CF 3 was much more effective than that of SF 6 and CF 4 and moreover, 1.3 kPa SF 5 CF 3 , discharged with 30 kPa O 2 , Ar and air, could not be detected when the resident time was 80 s, 40 s, and 120 s, respectively. All the results indicated that DBD was a feasible technique for the abatement of potent greenhouse gases. (paper)
48 CFR 252.237-7011 - Preparation history.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Preparation history. 252... Provisions And Clauses 252.237-7011 Preparation history. As prescribed in 237.7003(b), use the following clause: Preparation History (DEC 1991) For each body prepared, or for each casket handled in a group...
48 CFR 252.217-7016 - Plant protection.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Plant protection. 252.217... Clauses 252.217-7016 Plant protection. As prescribed in 217.7104(a), use the following clause: Plant Protection (DEC 1991) (a) The Contractor shall provide, for the plant and work in process, reasonable...
48 CFR 252.227-7000 - Non-estoppel.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Non-estoppel. 252.227-7000... Clauses 252.227-7000 Non-estoppel. As prescribed at 227.7009-1, insert the following clause in patent releases, license agreements, and assignments: Non-Estoppel (OCT 1966) The Government reserves the right at...
Encapsulation plant at Forsmark
International Nuclear Information System (INIS)
Nystroem, Anders
2007-08-01
SKB has already carried out a preliminary study of an encapsulation plant detached from Clab (Central interim storage for spent fuels). This stand-alone encapsulation plant was named FRINK and its assumed siting was the above-ground portion of the final repository, irrespective of the repository's location. The report previously presented was produced in cooperation with BNFL Engineering Ltd in Manchester and the fuel reception technical solution was examined by Gesellschaft fuer Nuklear-Service mbH (GNS) in Hannover and by Societe Generale pour les Techniques Nouvelles (SGN) in Paris. This report is an update of the earlier preliminary study report and is based on the assumption that the encapsulation plant and also the final repository will be sited in the Forsmark area. SKB's main alternative for siting the encapsulation plant is next to Clab. Planning of this facility is ongoing and technical solutions from the planning work have been incorporated in this report. An encapsulation plant placed in proximity to any final repository in Forsmark forms part of the alternative presentation in the application for permission to construct and operate an installation at Clab. The main technical difference between the planned encapsulation plant at Clab and an encapsulation plant at a final repository at Forsmark is how the fuel is managed and prepared before actual encapsulation. Fuel reception at the encapsulation plant in Forsmark would be dry, i.e. there would be no water-filled pools at the facility. Clab is used for verificatory fuel measurements, sorting and drying of the fuel before transport to Forsmark. This means that Clab will require a measure of rebuilding and supplementary equipment. In purely technical terms, the prospects for building an encapsulation plant sited at Forsmark are good. A description of the advantages and drawbacks of siting the encapsulation plant at Clab as opposed to any final repository at Forsmark is presented in a separate report
Encapsulation plant at Forsmark
Energy Technology Data Exchange (ETDEWEB)
Nystroem, Anders
2007-08-15
SKB has already carried out a preliminary study of an encapsulation plant detached from Clab (Central interim storage for spent fuels). This stand-alone encapsulation plant was named FRINK and its assumed siting was the above-ground portion of the final repository, irrespective of the repository's location. The report previously presented was produced in cooperation with BNFL Engineering Ltd in Manchester and the fuel reception technical solution was examined by Gesellschaft fuer Nuklear-Service mbH (GNS) in Hannover and by Societe Generale pour les Techniques Nouvelles (SGN) in Paris. This report is an update of the earlier preliminary study report and is based on the assumption that the encapsulation plant and also the final repository will be sited in the Forsmark area. SKB's main alternative for siting the encapsulation plant is next to Clab. Planning of this facility is ongoing and technical solutions from the planning work have been incorporated in this report. An encapsulation plant placed in proximity to any final repository in Forsmark forms part of the alternative presentation in the application for permission to construct and operate an installation at Clab. The main technical difference between the planned encapsulation plant at Clab and an encapsulation plant at a final repository at Forsmark is how the fuel is managed and prepared before actual encapsulation. Fuel reception at the encapsulation plant in Forsmark would be dry, i.e. there would be no water-filled pools at the facility. Clab is used for verificatory fuel measurements, sorting and drying of the fuel before transport to Forsmark. This means that Clab will require a measure of rebuilding and supplementary equipment. In purely technical terms, the prospects for building an encapsulation plant sited at Forsmark are good. A description of the advantages and drawbacks of siting the encapsulation plant at Clab as opposed to any final repository at Forsmark is presented in a separate
Generic medicines and generic substitution: contrasting perspectives of stakeholders in Ireland.
O'Leary, A; Usher, C; Lynch, M; Hall, M; Hemeryk, L; Spillane, S; Gallagher, P; Barry, M
2015-12-15
The Health (Pricing and Supply of Medical Goods) Act 2013 passed into law in July 2013 and legislated for generic substitution in Ireland. The aim of the study was to ascertain the knowledge and perceptions of stakeholders i.e. patients, pharmacists and prescribers, of generic medicines and to generic substitution with the passing of legislation. Three stakeholder specific questionnaires were developed to assess knowledge of and perceptions to generic medicines and generic substitution. Purposive samples of patients, prescribers and pharmacists were analysed. Descriptive quantitative and qualitative analyses were undertaken. A total of 762 healthcare professionals and 353 patients were recruited. The study highlighted that over 84% of patients were familiar with generic medicines and are supportive of the concept of generic substitution. Approximately 74% of prescribers and 84% of pharmacists were supportive of generic substitution in most cases. The main areas of concern highlighted by the healthcare professionals that might impact on the successful implementation of the policy, were the issue of bioequivalence with generic medicines, the computer software systems used at present in general practitioner (GP) surgeries and the availability of branded generics. The findings from this study identify a high baseline rate of acceptance to generic medicines and generic substitution among patients, prescribers and pharmacists in the Irish setting. The concerns of the main stakeholders provide a valuable insight into the potential difficulties that may arise in its implementation, and the need for on-going reassurance and proactive dissemination of the impact of the generic substitution policy. The existing positive attitude to generic medicines and generic substitution among key stakeholders in Ireland to generic substitution, combined with appropriate support and collaboration should result in the desired increase in rates of prescribing, dispensing and use of generic
International Nuclear Information System (INIS)
Kim, Jung-Hyung; Shin, Yong-Hyeon; Chung, Kwang-Hwa; Yoo, Yong-Shim
2004-01-01
The behavior of the CF 2 radical was studied in a CF 4 inductively coupled plasma. The CF 2 radical was measured using a laser-induced fluorescence method. Absolute electron density was measured using a cutoff probe and the electron temperature was measured using a double probe to study the relationship between these electron properties and the CF 2 radical. To examine the relationship between them, the CF 2 radical and electron density were measured as a function of the rf power, which is a major external parameter influencing the electron density. As the rf power was increased, the CF 2 radical density increased in the range of low electron density, and then decreased beyond a critical electron density. The dependence of the CF 2 radical density on the electron density was theoretically analyzed with rate equations. The theoretical result was in good agreement with experiment
Atmospheric chemistry of (CF3)2CFOCH3
DEFF Research Database (Denmark)
Andersen, Lene Løffler; Østerstrøm, Freja From; Nielsen, Ole John
2014-01-01
FTIR smog chamber techniques were used to measure k(Cl + (CF 3)2CFOCH3) = (1.80 ± 0.42) × 10-13, k(Cl + (CF3)2CFOCHO) = (1.47 ± 0.56) × 10-14, and k(OH + (CF3) 2CFOCH3) = (1.55 ± 0.24) × 10-14 cm3 molecule-1 s-1. The chlorine-atom initiated oxidation of (CF3)2CFOCH3 in air in the absence of NOX r...
48 CFR 252.217-7001 - Surge option.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Surge option. 252.217-7001... Clauses 252.217-7001 Surge option. As prescribed in 217.208-70(b), use the following clause: Surge Option (AUG 1992) (a) General. The Government has the option to— (1) Increase the quantity of supplies or...
48 CFR 252.225-7025 - Restriction on acquisition of forgings.
2010-10-01
... of forgings. 252.225-7025 Section 252.225-7025 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.225-7025 Restriction on acquisition of forgings. As prescribed in 225.7102-4, use the following clause: Restriction on Acquisition of Forgings (DEC 2009) (a...
48 CFR 252.225-7031 - Secondary Arab boycott of Israel.
2010-10-01
... Israel. 252.225-7031 Section 252.225-7031 Federal Acquisition Regulations System DEFENSE ACQUISITION... of Provisions And Clauses 252.225-7031 Secondary Arab boycott of Israel. As prescribed in 225.7605, use the following provision: Secondary Arab Boycott of Israel (JUN 2005) (a) Definitions. As used in...
24 CFR 92.252 - Qualification as affordable housing: Rental housing.
2010-04-01
... 24 Housing and Urban Development 1 2010-04-01 2010-04-01 false Qualification as affordable housing: Rental housing. 92.252 Section 92.252 Housing and Urban Development Office of the Secretary, Department of Housing and Urban Development HOME INVESTMENT PARTNERSHIPS PROGRAM Project Requirements § 92.252...
48 CFR 252.235-7011 - Final scientific or technical report.
2010-10-01
... technical report. 252.235-7011 Section 252.235-7011 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.235-7011 Final scientific or technical report. As prescribed in 235.072(d), use the following clause: Final Scientific or Technical Report (NOV 2004) The Contractor...
48 CFR 252.235-7002 - Animal welfare.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Animal welfare. 252.235... Clauses 252.235-7002 Animal welfare. As prescribed in 235.072(a), use the following clause: Animal Welfare... animals only from dealers licensed by the Secretary of Agriculture under 7 U.S.C. 2133 and 9 CFR subpart A...
48 CFR 252.229-7001 - Tax relief.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Tax relief. 252.229-7001... Clauses 252.229-7001 Tax relief. As prescribed in 229.402-70(a), use the following clause: Tax Relief (JUN 1997) (a) Prices set forth in this contract are exclusive of all taxes and duties from which the United...
Encapsulation of radioactive waste
International Nuclear Information System (INIS)
Pordes, O.; Plows, J.P.
1980-01-01
A method is described for encapsulating a particular radioactive waste which consists of suspending the waste in a viscous liquid encapsulating material, of synthetic resin monomers or prepolymers, and setting the encapsulating material by addition or condensation polymerization to form a solid material in which the waste is dispersed. (author)
Hoorn, Van der R.A.L.; Roth, R.; Wit, De P.J.G.M.
2001-01-01
The tomato resistance genes Cf-4 and Cf-9 confer specific, hypersensitive response-associated recognition of Cladosporium carrying the avirulence genes Avr4 and Avr9, respectively. Cf-4 and Cf-9 encode type I transmembrane proteins with extracellular leucine-rich repeats (LRRs). Compared with Cf-9,
Modeling of silicon etching in CF sub 4 /O sub 2 and CF sub 4 /H sub 2 plasmas
Energy Technology Data Exchange (ETDEWEB)
Trachtenberg, I.; Edgar, T.F. (Dept. of Chemical Engineering, Univ. of Texas at Austin, Austin, TX (US)); Venkatesan, S.P. (Morgantown Energy Technology Center, Morgantown, WV (US))
1990-07-01
A one-dimensional radial flow reactor model that includes fairly detailed free radical gas-phase chemistry has been developed for the etching of silicon in CF{sub 4}/O{sub 2} and CF{sub 4}/H{sub 2} plasmas. Attention has been restricted to transport and reaction of neutral species. The model equations were solved by orthogonal collocation. The sensitivities of the model predictions to flow rate, inlet gas composition, electron density, silicon loading, and other factors have been examined. The major loss path for fluorine atoms is different in CF{sub 4}/O{sub 2} and CF{sub 4}/H{sub 2} systems, and this results in significant qualitative differences in the parametric sensitivities of the two systems.
Application of TSH bioindicator for studying the biological efficiency of radiation
International Nuclear Information System (INIS)
Kim, Jin Kyu; Cebulska-Wasilewska, A.
1996-10-01
Dose response relationships for various endpoints (gene and lethal mutations, cell cycle alterations) in somatic cells of Tradescantia clone 4430 were established for X-rays and for mixed fast and thermal neutrons from Cf-252 source of KAERI and from U-120 cyclotron of INP. This was a pilot experiment to check if it is possible to establish the relative biological effectiveness values for Cf-252 irradiated TSH cells, with and without boron ion pretreatment, in conditions of mutual KAERI-INP experiment. When T-4430 was pretreated with boron ion, there was and enhancement in biological efficacy of neutron form Cf-252 source. 2 tabs., 7 figs., 7 refs. (Author)
Selective encapsulation by Janus particles
Energy Technology Data Exchange (ETDEWEB)
Li, Wei, E-mail: wel208@mrl.ucsb.edu [Materials Research Laboratory, University of California, Santa Barbara, California 93106 (United States); Ruth, Donovan; Gunton, James D. [Department of Physics, Lehigh University, Bethlehem, Pennsylvania 18015 (United States); Rickman, Jeffrey M. [Department of Physics, Lehigh University, Bethlehem, Pennsylvania 18015 (United States); Department of Materials Science and Engineering, Lehigh University, Bethlehem, Pennsylvania 18015 (United States)
2015-06-28
We employ Monte Carlo simulation to examine encapsulation in a system comprising Janus oblate spheroids and isotropic spheres. More specifically, the impact of variations in temperature, particle size, inter-particle interaction range, and strength is examined for a system in which the spheroids act as the encapsulating agents and the spheres as the encapsulated guests. In this picture, particle interactions are described by a quasi-square-well patch model. This study highlights the environmental adaptation and selectivity of the encapsulation system to changes in temperature and guest particle size, respectively. Moreover, we identify an important range in parameter space where encapsulation is favored, as summarized by an encapsulation map. Finally, we discuss the generalization of our results to systems having a wide range of particle geometries.
International Nuclear Information System (INIS)
Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.
1981-01-01
Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads mg -1 h -1 +- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads mg -1 h -1 . These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less
International Nuclear Information System (INIS)
Oswald, R.A.; Lanzl, L.H.; Rozenfeld, M.
1981-01-01
Fission track detectors were applied to a unique problem in neutron dosimetry. Measurements of neutron doses were required at locations within a tumor of 1 cm diameter implanted on the back of a mouse and surrounded by a square array of four 252 Cf medical sources. Measurements made in a tissue-equivalent mouse phantom showed that the neutron dose rate to the center of the tumor was 2.18 rads micrograms-1 h-1 +/- 8.4%. The spatial variation of neutron dose to the tumor ranged from 1.88 to 2.55 rads micrograms-1 h-1. These measurements agree with calculated values of neutron dose to those locations in the phantom. Fission track detectors have been found to be a reliable tool for neutron dosimetry for geometries in which one wishes to know neutron dose values which may vary considerably over distances of 1 cm or less
... exocrine.html. UPCMD (1998 – 2002). Cystic Fibrosis. University Pathology Consortium, LLC [On-line information]. Available online at http://www.upcmd.com/dot/examples/00218/description.html. Sainato, D., (2002, March). Genetic Testing for CF Going Mainstream? Clinical Laboratory ...
Cytokine production induced by non-encapsulated and encapsulated Porphyromonas gingivalis strains
Kunnen, A.; Dekker, D.C.; van Pampus, M.G.; Harmsen, H.J.; Aarnoudse, J.G.; Abbas, F.; Faas, M.M.
Objective: Although the exact reason is not known, encapsulated gram-negative Porphyromonas gingivalis strains are more virulent than non-encapsulated strains. Since difference in virulence properties may be due to difference in cytokine production following recognition of the bacteria or their
International Nuclear Information System (INIS)
Boddy, K.
1978-11-01
A simple and cheap facility for partial body neutron activation analysis has been designed, based on the use of two 100 μg 252 Cf neutron sources. The results reported show that calcium can be measured in parts of the body such as the tibia with a precision as good as +- 1.6 % for a radiation dose of 2 rem. The uniformity of the thermal neutron flux density is better than +- 3 % over 10 cm. Some applications of this irradiation facility for studies of trace elements, in particular cadmium in liver and aluminium in liver or brain, have also been explored. However, the sensitivity attainable is not yet sufficient for the study of normal levels, but could be of interest in toxicological investigations
Encapsulation by Janus spheroids
Li, Wei; Liu, Ya; Brett, Genevieve; Gunton, James D.
2011-01-01
The micro/nano encapsulation technology has acquired considerable attention in the fields of drug delivery, biomaterial engineering, and materials science. Based on recent advances in chemical particle synthesis, we propose a primitive model of an encapsulation system produced by the self-assembly of Janus oblate spheroids, particles with oblate spheroidal bodies and two hemi-surfaces coded with dissimilar chemical properties. Using Monte Carlo simulation, we investigate the encapsulation sys...
Experimental studies on californium bioavailability to marine benthic invertebrates
International Nuclear Information System (INIS)
Fowler, S.W.; Carvalho, F.P.; Aston, S.R.
1986-01-01
252 Cf is readily taken up by benthic invertebrates from sea water, reaching whole-body concentration factors of 763 in the polychaete Hermione hystrix, 220 in the shrimp Lysmata seticaudata, 665 in the crab Pilumnus hirtellus and 78 in the bivalve mollusc Venerupis decussata after 3 weeks exposure. Surface sorption plays a predominant role in the uptake process. Depuration in clean sea water was a relatively slow process. The shrimp Lysmata eliminated 252 Cf very rapidly due to moulting. Absorption coefficients for ingested 252 Cf were high, approx. 23% in crabs and approx. 97% in brittlestars. The absorbed fraction was excreted twice as fast from crabs as brittlestars. Exposure of organisms to labelled sediment resulted in low transfer factors that were species dependent. There is some evidence to suggest that uptake from sediments is primarily due to 252 Cf transfer from the pore water. Comparison of these results with published experimental data on other transuranic nuclides in the same or similar species suggests that californium bioavailability is roughly equivalent to that of plutonium and americium. (author)
The mass transfer mechanism of fissile material due to fission
International Nuclear Information System (INIS)
Shafrir, N.H.
1975-01-01
A thin 252 Cf source of a mean thickness of an approXimately mono-atomic layer was used as an experimental model for the study of the basic mechanism of the knock-on process taking place in fissile material. Because of the thinness of the source it can be assumed that mainly primary knock-ons are formed. The ejection rate of knock-ons created by direct collisions between fission fragments and source atoms was measured as follows: the ejected atoms were collected in high vacuum on a catcher foil and 252 Cf determined by alpha spectroscopy using a silicon surface barrier detector. The number of 252 Cf ejected from the source in unit time could thus be determined while considering the anisotropy of ejection, geometry and counting efficiency. Taking into account the chemical composition of the source, eta(theor.) = 252 Cf atoms/fission was obtained. This result can be considered in reasonable agreement with experiment confirming that under the experimental conditions described, practically no knock-on cascade is formed. (B.G.)
48 CFR 252.222-7002 - Compliance with local labor laws (overseas).
2010-10-01
... labor laws (overseas). 252.222-7002 Section 252.222-7002 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7002 Compliance with local labor laws (overseas). As prescribed in 222.7201(a), use the following clause: Compliance with Local Labor Laws (Overseas) (JUN 1997...
24 CFR 252.6 - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 252.6 Section 252.6 Housing and Urban Development Regulations Relating to Housing and..., AND BOARD AND CARE HOMES § 252.6 Method of payment of mortgage insurance premiums. The provisions of..., DEPARTMENT OF HOUSING AND URBAN DEVELOPMENT MORTGAGE AND LOAN INSURANCE PROGRAMS UNDER NATIONAL HOUSING ACT...
24 CFR 236.252 - First, second, and third mortgage insurance premiums.
2010-04-01
... insurance premiums. 236.252 Section 236.252 Housing and Urban Development Regulations Relating to Housing... insurance premiums. All of the provisions of § 207.252 of this chapter governing the first, second, and third mortgage insurance premiums shall apply to mortgages insured under this subpart, except: (a) Where...
International Nuclear Information System (INIS)
Young, J.P.; Haire, R.G.; Peterson, J.R.; Ensor, D.D.; Fellows, R.L.
1980-01-01
Spectrophotometric and x-ray powder diffraction methods have been applied to a study of the ingrowth of californium-249 by β - decay of berkelium-249 in crystalline 249 BkBr 3 . It was found that the Cf daughter grows in with the same oxidation state and crystal structure as the parent. Thus, six-coordinate BkBr 3 (AlCl 3 -type monoclinic structure) generates six-coordinate CfBr 3 , and eight-coordinate BkBr 3 (PuBr 3 -type orthorhombic structure) generates eight-coordinate CfBr 3 , a previously unknown form of CfBr 3 . It was also found that the daughter Cf(III) in the BkBr 3 parent compound can be reduced to Cf(II) by treatment with H 2 , as it can in pure CfBr 3 . 5 figures
International Nuclear Information System (INIS)
Prochaska, F.T.; Andrews, L.
1978-01-01
The molecules CFBr 3 , CF 2 Br 2 , CF 3 Br, and C-13 enriched CF 3 Br have been subjected to matrix radiolysis and argon resonance photoionization during condensation with excess argon at 15 K. Infrared spectra showed stable and free radical products and new absorptions due to charged species. The molecular ion bands exhibited different behavior on filtered high-pressure mercury arc photolysis. Absorptions reduced by 220 to 1000-nm light are assigned to CFBr 2 + , CF 2 Br + , and CF 3 + ; other bands destroyed by photolysis are assigned to the parent cations. Li and Na atom reactions with the fluorobromomethane molecules confirmed the identification of the CFBr 2 and CF 2 Br free radicals. Other product bands destroyed by mercury arc light, some of which were generated upon photolysis of the sodium-fluorobromomethane samples, are assigned to molecular anions. 5 figures, 6 tables
International Nuclear Information System (INIS)
King, L.J.; Bigelow, J.E.; Collins, E.D.
1981-08-01
During this period, transuranium elements were obtained from 26 irradiated HFIT targets. The products included 86 mg of 249 Bk, 686 mg of 252 Cf, 3.1 mg of 253 Es, and an estimated 1.4 pg of 257 Fm. In addition, about 326 mg of high-purity 248 Cm was separated from previously purified 252 Cf. One hundred seven product shipments were made from TRU; recipients and the amounts of nuclides shipped are listed in a table. Forty-two standard and two special HFIR targets were fabricated. During the next 18 months, production totals of 110 mg of 249 Bk, 1200 mg of 252 Cf, 5.5 mg of 253 Es, and 2 pg of 257 Fm are anticipated. Also, a total of 225 mg of 248 Cm is expected to be made available. During this report period, a charcoal adsorber system for radioiodine removal was installed, tested, and placed in service. This system serves as a backup to the Hopcalite-charcoal system for adsorption of 131 I from the VOG stream. Seven 252 Cf neutron sources were fabricated during this report period. A total of 100 neutron sources have been fabricated previously at TRU. The original and current contents ( 252 Cf and 248 Cm) of the existing sources and the individuals to whom the sources are currently loaned are listed in a table. In addition to neutron sources, nine fission sources were prepared by electroplating 252 Cf onto platinum disks or foils.Special projects during this report period included (1) purification of two batches of isotopically pure 240 Pu, (2) fabrication of two special HFIR targets, (3) repurification of the residues of the einsteinium product from Campaign 56, (4) production of approx. 235 μg of 250 Cf by irradiation of 249 Bk, (5) radiography of 28 irradiated, stainless steel alloy, fracture-strain specimens, and (6) preparations for the production of 40 μg of 245 Es by irradiation of 253 Es
Californium oxygen system for 1.50 < O/Cf < 1.72
International Nuclear Information System (INIS)
Turcotte, R.P.; Haire, R.G.
1975-01-01
The californium-oxygen system was studied as a function of temperature, oxygen pressure, and stoichiometry by manometric and x-ray diffraction methods. The results establish rhombohedral Cf 7 O 12 as the stable compound obtained by heating Cf 2 O 3 in air. The isobaric oxidation-reduction cycles Cf 2 O 3 → Cf 7 O 12 → Cf 2 O 3 , observed in constant rate of heating (cooling) experiments, occur with large hysteresis. A close parallel to other fluorite related lanthanide and actinide oxide systems is established. (auth)
Preparations for the start-up of a research program in nuclear safeguards at Chalmers
International Nuclear Information System (INIS)
Avdic, Senada; Pazsit, Imre
2004-03-01
The Department of Reactor Physics at Chalmers University of Technology plans to start-up a research program in nuclear safeguards and nuclear material management. The program is aimed at utilizing the experimental facilities as well as the experience in reactor physics, criticality safety, signal processing and unfolding, and experimental nuclear techniques, in tackling problems in non-destructive assay (NDA) of nuclear materials. For the introductory part of this program, support has been received from the Swedish Nuclear Power Inspectorate to host Dr. Senada Avdic, University of Tuzla, Bosnia, as a post-doc for three months to participate in the preparatory program. The preparations were focussed on a survey of existing active non-destructive assay methods and preparations of their application in the experimental and theoretical/calculational research of our Department. The methods surveyed comprise - the use of a 252 Cf source in active NDA measurements; - planning of an experiment with the existing equipments of the Department; - time correlation measurements with a 252 Cf source and/or a 252 Cf detector; - Monte Carlo simulations of the time correlations between gammas and neutrons from a measurement with a 252 Cf detector: the MCNP-PoliMi code; - Identification of fissile material (enrichment/mass) with 252 Cf measurements; the use of various unfolding techniques (artificial neural networks) for identifying nuclear parameters; use of neutron activation analysis with a neutron generator for determination of distribution of material in an unknown sample; - determination of fissile material content by measurements of delayed neutrons
7 CFR 766.252 - Unauthorized assistance resulting from submission of false information.
2010-01-01
... false information. 766.252 Section 766.252 Agriculture Regulations of the Department of Agriculture... Unauthorized Assistance § 766.252 Unauthorized assistance resulting from submission of false information. A... behalf, submits information to the Agency that the borrower knows to be false. ...
Cluster structure in Cf nuclei
International Nuclear Information System (INIS)
Singh, Shailesh K.; Biswal, S.K.; Bhuyan, M.; Patra, S.K.; Gupta, R.K.
2014-01-01
Due to the availability of advance experimental facilities, it is possible to probe the nuclei upto their nucleon level very precisely and analyzed the internal structure which will help us to resolve some mysterious problem of the decay of nuclei. Recently, the relativistic nuclear collision, confirmed the α cluster type structure in the 12 C which is the mile stone for the cluster structure in nuclei. The clustering phenomena in light and intermediate elements in nuclear chart is very interesting. There is a lot of work done by our group in the clustering behaviour of the nuclei. In this paper, the various prospectus of clustering in the isotopes of Cf nucleus including fission state is discussed. Here, 242 Cf isotope for the analysis, which is experimentally known is taken. The relativistic mean field model with well established NL3 parameter set is taken. For getting the exact ground state configuration of the isotopes, the calculation for minimizing the potential energy surface is performed by constraint method. The clustering structure of other Cf isotopes is discussed
Directory of Open Access Journals (Sweden)
Ahmed Hassan
2016-10-01
Full Text Available Phase change materials (PCMs have been identified as potential candidates for building energy optimization by increasing the thermal mass of buildings. The increased thermal mass results in a drop in the cooling/heating loads, thus decreasing the energy demand in buildings. However, direct incorporation of PCMs into building elements undermines their structural performance, thereby posing a challenge for building integrity. In order to retain/improve building structural performance, as well as improving energy performance, micro-encapsulated PCMs are integrated into building materials. The integration of microencapsulation PCMs into building materials solves the PCM leakage problem and assures a good bond with building materials to achieve better structural performance. The aim of this article is to identify the optimum micro-encapsulation methods and materials for improving the energy, structural and safety performance of buildings. The article reviews the characteristics of micro-encapsulated PCMs relevant to building integration, focusing on safety rating, structural implications, and energy performance. The article uncovers the optimum combinations of the shell (encapsulant and core (PCM materials along with encapsulation methods by evaluating their merits and demerits.
Farkas, D.F.; Swart, Henriëtte de
2005-01-01
We take a fresh look at the connection between genericity and (in)definiteness by reconsidering a long-standing puzzle concerning the relation between definiteness and genericity. We contrast English on the one hand and Romance languages and Hungarian on the other, focusing on generic sentences
46 CFR 252.23 - Financial and other reporting requirements.
2010-10-01
... 46 Shipping 8 2010-10-01 2010-10-01 false Financial and other reporting requirements. 252.23... SERVICES Operation § 252.23 Financial and other reporting requirements. (a) Voyage report. The operator... total loss covered by a policy of insurance. (d) Financial statements. The operator shall submit, in...
48 CFR 252.204-7001 - Commercial and Government Entity (CAGE) code reporting.
2010-10-01
... Entity (CAGE) code reporting. 252.204-7001 Section 252.204-7001 Federal Acquisition Regulations System... Entity (CAGE) Code Reporting (AUG 1999) (a) The offeror is requested to enter its CAGE code on its offer... AND CONTRACT CLAUSES Text of Provisions And Clauses 252.204-7001 Commercial and Government Entity...
48 CFR 252.222-7005 - Prohibition on use of nonimmigrant aliens-Guam.
2010-10-01
... nonimmigrant aliens-Guam. 252.222-7005 Section 252.222-7005 Federal Acquisition Regulations System DEFENSE... CLAUSES Text of Provisions And Clauses 252.222-7005 Prohibition on use of nonimmigrant aliens—Guam. As prescribed in 222.7302, use the following clause: Prohibition on Use of Nonimmigrant Aliens—Guam (SEP 1999...
24 CFR 207.252e - Method of payment of mortgage insurance premiums.
2010-04-01
... insurance premiums. 207.252e Section 207.252e Housing and Urban Development Regulations Relating to Housing... Premiums § 207.252e Method of payment of mortgage insurance premiums. In the cases that the Commissioner... mortgagees, that mortgage insurance premiums be remitted electronically. [63 FR 1303, Jan. 8, 1998] ...
Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent.
Schuch, Raymond; Khan, Babar K; Raz, Assaf; Rotolo, Jimmy A; Wittekind, Michael
2017-07-01
Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC 90 ) value of ≤0.25 μg/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes , and Streptococcus agalactiae were also sensitive to disruption, with MBEC 90 values ranging from 0.25 to 8 μg/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component. Copyright © 2017 American Society for Microbiology.
Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent
Schuch, Raymond; Khan, Babar Khalid; Raz, Assaf; Rotolo, Jimmy A.; Wittekind, Michael
2017-01-01
Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC90) value of <= 0.25 mu g/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes, and Streptococcus agalactiae were also sensitive to disruption, with MBEC90 values ranging from 0.25 to 8 mu g/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component.
Bacteriophage Lysin CF-301, a Potent Antistaphylococcal Biofilm Agent
Schuch, Raymond
2017-05-02
Biofilms pose a unique therapeutic challenge because of the antibiotic tolerance of constituent bacteria. Treatments for biofilm-based infections represent a major unmet medical need, requiring novel agents to eradicate mature biofilms. Our objective was to evaluate bacteriophage lysin CF-301 as a new agent to target Staphylococcus aureus biofilms. We used minimum biofilm-eradicating concentration (MBEC) assays on 95 S. aureus strains to obtain a 90% MBEC (MBEC90) value of <= 0.25 mu g/ml for CF-301. Mature biofilms of coagulase-negative staphylococci, Streptococcus pyogenes, and Streptococcus agalactiae were also sensitive to disruption, with MBEC90 values ranging from 0.25 to 8 mu g/ml. The potency of CF-301 was demonstrated against S. aureus biofilms formed on polystyrene, glass, surgical mesh, and catheters. In catheters, CF-301 removed all biofilm within 1 h and killed all released bacteria by 6 h. Mixed-species biofilms, formed by S. aureus and Staphylococcus epidermidis on several surfaces, were removed by CF-301, as were S. aureus biofilms either enriched for small-colony variants (SCVs) or grown in human synovial fluid. The antibacterial activity of CF-301 was further demonstrated against S. aureus persister cells in exponential-phase and stationary-phase populations. Finally, the antibiofilm activity of CF-301 was greatly improved in combinations with the cell wall hydrolase lysostaphin when tested against a range of S. aureus strains. In all, the data show that CF-301 is highly effective at disrupting biofilms and killing biofilm bacteria, and, as such, it may be an efficient new agent for treating staphylococcal infections with a biofilm component.
Groups of galaxies. III. the CfA survey
International Nuclear Information System (INIS)
Geller, M.J.; Huchra, J.P.
1983-01-01
We present a statistically homogeneous group catalog (CfA) based on the CfA redshift survey (Huchra et al.). Groups in the catalog are all density enhancements in redshift space of a factor greater than 20. Group members are identified according to the procedure described in our previous study (Huchra and Geller) of a shallower whole-sky sample. All groups contain at least three members. Of the 176 groups in the CfA catalog, 102 have been identified in one or more previous studies. Because our algorithm searches for volume rather than surface density enhancements, the groups in a given region generally change only through the addition of fainter members when the magnitude limit of the galaxy catalog increases. In the region of overlap, agreement between our shallow catalog and the CfA catalog is excellent
Rosenthal, Mark; Narang, Indra; Edwards, Liz; Bush, Andrew
2009-03-01
Peripheral muscle dysfunction is increasingly recognized as complicating respiratory disease, but this is difficult to measure non-invasively. Can skeletal muscle function and efficiency be measured during exercise non-invasively using respiratory mass spectrometry (RMS); and is the known exercise dysfunction in cystic fibrosis (CF) children related in part to a disease specific defect of skeletal muscle, or a non-specific manifestation of chronic airway infection and inflammation. Calculations of effective pulmonary blood flow and stroke volume, blood oxygen content and oxygen dispatch from the lungs, skeletal muscle oxygen extraction and consumption, anerobic threshold and capacity, and gross, net and work efficiency in 106 controls and 36 children (18 CF) with bronchiectasis, all aged from 8 to 17 years. Normal values for control subjects are tabulated. CF and non-CF bronchiectatic subjects had similar physiology, and skeletal muscle abnormalities could not be detected. Reduced oxygen dispatch from the lungs, due to an inability to raise stroke volume, without an increase in functional residual capacity was the major factor in reduced exercise ability. Non-invasive RMS can be used to determine skeletal muscle function in children. The changes observed in CF subjects were very similar to non-CF bronchiectatic subjects and thus a CF specific defect was not demonstrated.
Encapsulation of nodal segments of lobelia chinensis
Directory of Open Access Journals (Sweden)
Weng Hing Thong
2015-04-01
Full Text Available Lobelia chinensis served as an important herb in traditional chinese medicine. It is rare in the field and infected by some pathogens. Therefore, encapsulation of axillary buds has been developed for in vitro propagation of L. chinensis. Nodal explants of L. chinensis were used as inclusion materials for encapsulation. Various combinations of calcium chloride and sodium alginate were tested. Encapsulation beads produced by mixing 50 mM calcium chloride and 3.5% sodium alginate supported the optimal in vitro conversion potential. The number of multiple shoots formed by encapsulated nodal segments was not significantly different from the average of shoots produced by non-encapsulated nodal segments. The encapsulated nodal segments regenerated in vitro on different medium. The optimal germination and regeneration medium was Murashige-Skoog medium. Plantlets regenerated from the encapsulated nodal segments were hardened, acclimatized and established well in the field, showing similar morphology with parent plants. This encapsulation technology would serve as an alternative in vitro regeneration system for L. chinensis.
Atmospheric chemistry of CF3CH2CH2OH
DEFF Research Database (Denmark)
Hurley, Michael D.; Misner, Jessica A.; Ball, James C.
2005-01-01
Relative rate techniques were used to study the kinetics of the reactions of Cl atoms and OH radicals with CF3CH2C(O)H and CF3CH2CH2OH in 700 Torr of N-2 or air diluent at 296 2 K. The rate constants determined were k(Cl+CF3CH2C(O)H) = (1.81 +/- 0.27) x 10(-11), k(OH+CF3CH2C(O)H) = (2.57 +/- 0.44...
Preparations for the start-up of a research program in nuclear safeguards at Chalmers
Energy Technology Data Exchange (ETDEWEB)
Avdic, Senada; Pazsit, Imre
2004-03-01
The Department of Reactor Physics at Chalmers University of Technology plans to start-up a research program in nuclear safeguards and nuclear material management. The program is aimed at utilizing the experimental facilities as well as the experience in reactor physics, criticality safety, signal processing and unfolding, and experimental nuclear techniques, in tackling problems in non-destructive assay (NDA) of nuclear materials. For the introductory part of this program, support has been received from the Swedish Nuclear Power Inspectorate to host Dr. Senada Avdic, University of Tuzla, Bosnia, as a post-doc for three months to participate in the preparatory program. The preparations were focussed on a survey of existing active non-destructive assay methods and preparations of their application in the experimental and theoretical/calculational research of our Department. The methods surveyed comprise - the use of a {sup 252}Cf source in active NDA measurements; - planning of an experiment with the existing equipments of the Department; - time correlation measurements with a {sup 252}Cf source and/or a {sup 252}Cf detector; - Monte Carlo simulations of the time correlations between gammas and neutrons from a measurement with a {sup 252}Cf detector: the MCNP-PoliMi code; - Identification of fissile material (enrichment/mass) with {sup 252}Cf measurements; the use of various unfolding techniques (artificial neural networks) for identifying nuclear parameters; use of neutron activation analysis with a neutron generator for determination of distribution of material in an unknown sample; - determination of fissile material content by measurements of delayed neutrons.
Energy Technology Data Exchange (ETDEWEB)
Guimaraes, Carla Aiolfi, E-mail: carlaaiolfi@usp.br [Department of Pharmacy, Faculty of Pharmaceutical Sciences, University of Sao Paulo, Sao Paulo, SP 05508-000 (Brazil); Menaa, Farid [Department of Dermatology, School of Medicine Wuerzburg, Wuerzburg 97080 (Germany); Fluorotronics, Inc., 1425 Russ Bvld, San Diego Technology Incubator, San Diego, CA 92101 (United States); Menaa, Bouzid, E-mail: bouzid.menaa@gmail.com [Fluorotronics, Inc., 1425 Russ Bvld, San Diego Technology Incubator, San Diego, CA 92101 (United States); Quenca-Guillen, Joyce S. [Department of Pharmacy, Faculty of Pharmaceutical Sciences, University of Sao Paulo, Sao Paulo, SP 05508-000 (Brazil); Matos, Jivaldo do Rosario [Department of Fundamental Chemistry, Institute of Chemistry, University of Sao Paulo, Sao Paulo, SP 05508-000 (Brazil); Mercuri, Lucildes Pita [Department of Exact and Earth Sciences, Federal University of Sao Paulo, Diadema, SP 09972-270 (Brazil); Braz, Andre Borges [Department of Engineering of Mines and Oil, Polytechnical School, University of Sao Paulo, SP 05508-900 (Brazil); Rossetti, Fabia Cristina [Department of Pharmaceutical Sciences, Faculty of Pharmaceutical Sciences of Ribeirao Preto, University of Sao Paulo, Ribeirao Preto, SP 14015-120 (Brazil); Kedor-Hackmann, Erika Rosa Maria; Santoro, Maria Ines Rocha Miritello [Department of Pharmacy, Faculty of Pharmaceutical Sciences, University of Sao Paulo, Sao Paulo, SP 05508-000 (Brazil)
2010-06-10
Isotretinoin is the drug of choice for the management of severe recalcitrant nodular acne. Nevertheless, some of its physical-chemical properties are still poorly known. Hence, the aim of our study consisted to comparatively evaluate the particle size distribution (PSD) and characterize the thermal behavior of the three encapsulated isotretinoin products in oil suspension (one reference and two generics) commercialized in Brazil. Here, we show that the PSD, estimated by laser diffraction and by polarized light microscopy, differed between the generics and the reference product. However, the thermal behavior of the three products, determined by thermogravimetry (TGA), differential thermal (DTA) analyses and differential scanning calorimetry (DSC), displayed no significant changes and were more thermostable than the isotretinoin standard used as internal control. Thus, our study suggests that PSD analyses in isotretinoin lipid-based formulations should be routinely performed in order to improve their quality and bioavailability.
[Generic drugs: good or bad? Physician's knowledge of generic drugs and prescribing habits].
García, A J; Martos, F; Leiva, F; Sánchez de la Cuesta, F
2003-01-01
In this article we analyze the responses of 1220 Spanish physicians who participated in a survery about generic drugs. A previously validated questionnaire was sent to physicians through the Spanish Medical Councils of the different provinces. Four items were analyzed: what doctors know about generic drugs (knowledge); physicians' prescribing habits concerning these drugs (attitude and professional competence); how prescription of generic drugs effects pharmaceutical costs amd, finally, what doctors believe a generic drug should be. The influence of physician-related variables (age, type of contract, specialty, workload, etc.) on prescribing of generic drugs was also analyzed. In view of the results, we believe that to rationalize expenditure through and appropriate policy on generic drugs Spanish health authorities should offer more and better training and information (clear and independent) about what generic drugs are.
CFTR mutation analysis and haplotype associations in CF patients☆
Cordovado, S.K.; Hendrix, M.; Greene, C.N.; Mochal, S.; Earley, M.C.; Farrell, P.M.; Kharrazi, M.; Hannon, W.H.; Mueller, P.W.
2011-01-01
Most newborn screening (NBS) laboratories use second-tier molecular tests for cystic fibrosis (CF) using dried blood spots (DBS). The Centers for Disease Control and Prevention’s NBS Quality Assurance Program offers proficiency testing (PT) in DBS for CF transmembrane conductance regulator (CFTR) gene mutation detection. Extensive molecular characterization on 76 CF patients, family members or screen positive newborns was performed for quality assurance. The coding, regulatory regions and por...
Encapsulation process for diffraction gratings.
Ratzsch, Stephan; Kley, Ernst-Bernhard; Tünnermann, Andreas; Szeghalmi, Adriana
2015-07-13
Encapsulation of grating structures facilitates an improvement of the optical functionality and/or adds mechanical stability to the fragile structure. Here, we introduce novel encapsulation process of nanoscale patterns based on atomic layer deposition and micro structuring. The overall size of the encapsulated structured surface area is only restricted by the size of the available microstructuring and coating devices; thus, overcoming inherent limitations of existing bonding processes concerning cleanliness, roughness, and curvature of the components. Finally, the process is demonstrated for a transmission grating. The encapsulated grating has 97.5% transmission efficiency in the -1st diffraction order for TM-polarized light, and is being limited by the experimental grating parameters as confirmed by rigorous coupled wave analysis.
Neutron total cross section measurements on 249Cf
International Nuclear Information System (INIS)
Carlton, R.F.; Harvey, J.A.; Hill, N.W.; Pandey, M.S.; Benjamin, R.W.
1979-01-01
Neutron total cross section measurements were performed on a sample of 249 Cf (5.65 mg total weight) with the ORELA as a source of pulsed neutrons. The sample, the inverse thickness of which was 1542 barns/atom, consisted of 85.3% 249 Cf and 14.4% 249 Bk, and was cooled to liquid nitrogen temperature. Analyses were also made of data from a thin sample (l/n = 17430) of 65% 249 Cf in the region of the large fission resonance at 0.7 eV. Fifty-five resonances in 249 Cf were observed and analyzed over the energy range 0.1 eV to 90 eV by use of an R-matrix multilevel formalism. The resonance parameters obtained were used to determine the level spacing and the s-wave neutron and fission strength functions. Thermal total cross section measurements were also performed. 5 figures, 3 tables
Branching ratios of α-decay to ground and excited states of Fm, Cf, Cm and Pu
Hassanabadi, H.; Hosseini, S. S.
2018-06-01
We use the well-known Wentzel-Kramers-Brillouin (WKB) barrier penetration probability to calculate α-decay branching ratios for ground and excited states of heavy even-even nuclei of Fermium (248-254Fm), Californium (244-252Cf), Curium (238-248Cm) and Plutonium (234-244Pu) with 94 ≤Zp ≤100. We obtained the branching ratios for the excited states of daughter nucleus by the α-decay energy (Qα), the angular momentum of α-particle (ℓα), and the excitation probability of the daughter nucleus with the excitation energy of state ℓ in the daughter nucleus (i.e. Eℓ*). α-Decay half-lives have been evaluated by using the proximity potential model for the heavy even-even nuclei. We have reported the half-lives and compared the results with the experimental data. The theoretical branching ratios of α-transitions in our calculation are found to agree with the available experimental data well for 0+→ 0+, 0+→ 2+, 0+→ 4+, 0+→ 6+ and 0+ → 8+α-transitions.
Papadimitriou, Vassileios C; Lazarou, Yannis G; Talukdar, Ranajit K; Burkholder, James B
2011-01-20
Rate coefficients, k, for the gas-phase reactions of Cl atoms and NO(3) radicals with 2,3,3,3-tetrafluoropropene, CF(3)CF═CH(2) (HFO-1234yf), and 1,2,3,3,3-pentafluoropropene, (Z)-CF(3)CF═CHF (HFO-1225ye), are reported. Cl-atom rate coefficients were measured in the fall-off region as a function of temperature (220-380 K) and pressure (50-630 Torr; N(2), O(2), and synthetic air) using a relative rate method. The measured rate coefficients are well represented by the fall-off parameters k(0)(T) = 6.5 × 10(-28) (T/300)(-6.9) cm(6) molecule(-2) s(-1) and k(∞)(T) = 7.7 × 10(-11) (T/300)(-0.65) cm(3) molecule(-1) s(-1) for CF(3)CF═CH(2) and k(0)(T) = 3 × 10(-27) (T/300)(-6.5) cm(6) molecule(-2) s(-1) and k(∞)(T) = 4.15 × 10(-11) (T/300)(-0.5) cm(3) molecule(-1) s(-1) for (Z)-CF(3)C═CHF with F(c) = 0.6. Reaction product yields were measured in the presence of O(2) to be (98 ± 7)% for CF(3)C(O)F and (61 ± 4)% for HC(O)Cl in the CF(3)CF═CH(2) reaction and (108 ± 8)% for CF(3)C(O)F and (112 ± 8)% for HC(O)F in the (Z)-CF(3)CF═CHF reaction, where the quoted uncertainties are 2σ (95% confidence level) and include estimated systematic errors. NO(3) reaction rate coefficients were determined using absolute and relative rate methods. Absolute measurements yielded upper limits for both reactions between 233 and 353 K, while the relative rate measurements yielded k(3)(295 K) = (2.6 ± 0.25) × 10(-17) cm(3) molecule(-1) s(-1) and k(4)(295 K) = (4.2 ± 0.5) × 10(-18) cm(3) molecule(-1) s(-1) for CF(3)CF═CH(2) and (Z)-CF(3)CF═CHF, respectively. The Cl-atom reaction with CF(3)CF═CH(2) and (Z)-CF(3)CF═CHF leads to decreases in their atmospheric lifetimes and global warming potentials and formation of a chlorine-containing product, HC(O)Cl, for CF(3)CF═CH(2). The NO(3) reaction has been shown to have a negligible impact on the atmospheric lifetimes of CF(3)CF═CH(2) and (Z)-CF(3)CF═CHF. The energetics for the reaction of Cl, NO(3), and OH with CF
Review of encapsulation technologies
International Nuclear Information System (INIS)
Shaulis, L.
1996-09-01
The use of encapsulation technology to produce a compliant waste form is an outgrowth from existing polymer industry technology and applications. During the past 12 years, the Department of Energy (DOE) has been researching the use of this technology to treat mixed wastes (i.e., containing hazardous and radioactive wastes). The two primary encapsulation techniques are microencapsulation and macroencapsulation. Microencapsulation is the thorough mixing of a binding agent with a powdered waste, such as incinerator ash. Macroencapsulation coats the surface of bulk wastes, such as lead debris. Cement, modified cement, and polyethylene are the binding agents which have been researched the most. Cement and modified cement have been the most commonly used binding agents to date. However, recent research conducted by DOE laboratories have shown that polyethylene is more durable and cost effective than cements. The compressive strength, leachability, resistance to chemical degradation, etc., of polyethylene is significantly greater than that of cement and modified cement. Because higher waste loads can be used with polyethylene encapsulant, the total cost of polyethylene encapsulation is significantly less costly than cement treatment. The only research lacking in the assessment of polyethylene encapsulation treatment for mixed wastes is pilot and full-scale testing with actual waste materials. To date, only simulated wastes have been tested. The Rocky Flats Environmental Technology Site had planned to conduct pilot studies using actual wastes during 1996. This experiment should provide similar results to the previous tests that used simulated wastes. If this hypothesis is validated as anticipated, it will be clear that polyethylene encapsulation should be pursued by DOE to produce compliant waste forms
48 CFR 252.227-7012 - Patent license and release contract.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Patent license and release contract. 252.227-7012 Section 252.227-7012 Federal Acquisition Regulations System DEFENSE ACQUISITION REGULATIONS SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text...
Glattes, R Christopher; Burton, Douglas C; Lai, Sue Min; Frasier, Elizabeth; Asher, Marc A
2007-07-15
This is a clinic-based cross-sectional study involving 2 health-related quality-of-life (HRQL) questionnaires. To compare the score distribution and reliability of the spinal deformity specific Scoliosis Research Society-22r (SRS-22r) questionnaire and the established generic Child Health Questionnaire-CF87 (CHQ-CF87), and to assess the concurrent validity of the SRS-22r using the CHQ-CF87 in an adolescent spine deformity population. Different questionnaires are commonly thought to be necessary to assess the HRQL of adolescent and adult populations. But since spinal deformities usually begin in the second decade of life, longitudinal follow-up with the same HRQL is desirable. The SRS-22r HRQL has recently been validated for score distribution and internal consistency in a spinal deformity population ranging in age from 7 to 78 years. The SRS-22r and CHQ-CF87 HRQLs were completed by 70 orthopedic spinal deformity outpatients 8 to 18 years of age, of whom 54 returned mailed retest questionnaires at an average of 24 days later. The ceiling effect averaged 27% for the SRS-22r and 36% for the CHQ-CF87. Respective values for internal consistency (Cronbach alpha) were 0.81 and 0.82, and for test-retest reproducibility the intraclass correlations (ICC) were 0.73 and 0.61. Concurrent validity was r > or = 0.68 or more for relevant function, pain, and mental health domains. The SRS Self-Image and particularly the Satisfaction/Dissatisfaction with Management domains did not correlate well with any CHQ-CF87 domains (r = 0.50 and 0.30, respectively). In a spinal deformity population 8 to 18 years of age, the score distribution and reliability, internal consistency, and reproducibility of the SRS-22r were at least as good as the CHQ-CF87. The SRS-22r function, pain, and mental health domains were concurrently valid in comparison to relevant CHQ-CF87 domains, but the SRS-22r self-image and satisfaction/dissatisfaction domains were not, thereby providing health-related quality
Directory of Open Access Journals (Sweden)
Paperna I.
2002-03-01
Full Text Available Hepatozoon kisrae n. sp. was found infecting a starred lizard at a site in southeastern Samaria, Palestine. These lizards were also hosts to the ixodid tick Hyolomma cf. aegyptium, which was demonstrated to be the vector of this hemogregarine. Hepatozoon and tick infections occurred in lizards within a very restricted locality; at a second site, nearby, ticks occurred without Hepatozoon infection. Micro- and macromeronts occurred mainly in the lungs, while cyst-like merogonic stages, mainly dizoic, occurred in the liver. Mature intraerythrocytic gametocytes were stout and encapsulated. Development from oocysts to sporocysts took place in the tick hemocoel, and was examined by transmission electron microscopy. Lizards were successfully infected when fed on sporocyst-infected ticks or viscera of infected lizards. Ticks become infected when fed on infected lizards; sporogony was complete when the ticks reached adult stage, over 40 days after initial attachment.
Bai, Feng-Yang; Jia, Zi-Man; Pan, Xiu-Mei
2018-06-01
In this work, a systematic investigation of the atmospheric oxidation mechanism of (CF3)2CXOCH3 and their oxidative products (CF3)2CXOCHO (X = H, F) initiated by OH radical or Cl atom is performed by density functional theory. This study reveals that the introduction of NO and O2 promotes the formation of organic nitrates, which are hygroscopic and are inclined to form secondary organic aerosols (SOA) and can affect the air quality. The rate constants of the individual reactions are found to be in agreement with the experimental results. One of the intriguing findings of this work is that the peroxynitrite of (CF3)2CHOCH2OONO formed from the subsequent reactions of (CF3)2CHOCH3 is more favorable to isomerize to organic nitrate (CF3)2CHOCH2ONO2 than to dissociate into alkoxy radical (CF3)2CHOCH2O and NO2 because of the lower energy barrier of isomerization. The second significant observation is that the organic nitrate can be degraded more favorably with the presence of NH3, CH3NH2, and CH3NHCH3 than its naked decomposition reaction (CF3)2CHOCH2ONO2→(CF3)2CHOCHO + HONO. The ammonium salt, a vital part of haze, is harmful to human health and can be formed in the existence of the NH3, CH3NH2, and CH3NHCH3. In addition, the toxic substance of peroxyalkyl nitrate (CF3)2CHOC(O)ONO2 which can reduce the visibility of the atmosphere is produced as the primary subsequent oxidation product of (CF3)2CHOCHO in a NO-rich environment. The main species detected experimentally are confirmed by this study. The computational results are crucial to risk assessment and pollution prevention of the volatile organic compounds (VOCs).
Baxam, Carl C.; Margalit, N.
1991-01-01
Swelling of (CF(x))(sub n) electrodes in commercial Li/(CF(x))(sub n) cells presents a limiting factor in cell design optimization. Examination of cathodes from such cells, after discharge, reveals a relation between cell operating temperatures and cathode swelling. Attempts to explain the swelling using the prevailing model for the cathode reaction have failed. A more suitable reaction mechanism is proposed based on the observed behavior of (CF(x))(sub n) electrodes on discharge and a comparison of the reaction products of (CF(x))(sub n) and polytetra fluoroethylene (PTFE) with lithium amalgams. The proposed mechanism is in agreement with the experimental data found in the literature.
Alatawi, Y; Rahman, Md M; Cheng, N; Qian, J; Peissig, P L; Berg, R L; Page, C D; Hansen, R A
2018-06-01
Some public scepticism exists about generics in terms of whether brand and generic drugs produce identical outcomes. This study explores whether adverse event (AE) reporting patterns are similar between brand and generic drugs, using authorized generics (AGs) as a control for possible generic drug perception biases. Events reported to the FDA Adverse Event Reporting System from the years 2004-2015 were analysed. Drugs were classified as brand, AG or generic based on drug and manufacturer names. Reports were included if amlodipine, losartan, metoprolol extended release (ER) or simvastatin were listed as primary or secondary suspect drugs. Disproportionality analyses using the reporting odds ratio (ROR) assessed the relative rate of reporting labelled AEs compared to reporting these AEs with all other drugs. The Breslow-Day test compared RORs across brand, AG and generic. Interrupted time series analysis evaluated the impact of generic entry on reporting trends. Generics accounted for significant percentages of total U.S. reports, but AGs accounted for smaller percentages of reports, including for amlodipine (14.26%), losartan (1.48%), metoprolol ER (0.35%) and simvastatin (0.70%). Whereas the RORs were significantly different for multiple brand vs generic comparisons, the AG vs generic comparisons yielded fewer statistically significant findings. Namely, only the ROR for AG differed from generic for amlodipine with peripheral oedema (P brand and generic compared with AG and generic. Use of AGs as a control for perception biases against generics is useful, but this approach can be limited by small AG report numbers. Requiring the manufacturer name to be printed on the prescription bottle or packaging could improve the accuracy of assignment for products being reported. © 2017 John Wiley & Sons Ltd.
Burke, D G; Harrison, M J; Fleming, C; McCarthy, M; Shortt, C; Sulaiman, I; Murphy, D M; Eustace, J A; Shanahan, F; Hill, C; Stanton, C; Rea, M C; Ross, R P; Plant, B J
2017-03-01
Clostridium difficile is an anaerobic Gram-positive, spore-forming, toxin-producing bacillus transmitted among humans through the faecal-oral route. Despite increasing carriage rates and the presence of C. difficile toxin in stool, patients with CF rarely appear to develop typical manifestations of C. difficile infection (CDI). In this study, we examined the carriage, toxin production, ribotype distribution and antibiotic susceptibility of C. difficile in a cohort of 60 adult patients with CF who were pre-lung transplant. C. difficile was detected in 50% (30/60) of patients with CF by culturing for the bacteria. C. difficile toxin was detected in 63% (19/30) of C. difficile-positive stool samples. All toxin-positive stool samples contained toxigenic C. difficile strains harbouring toxin genes, tcdA and tcdB. Despite the presence of C. difficile and its toxin in patient stool, no acute gastrointestinal symptoms were reported. Ribotyping of C. difficile strains revealed 16 distinct ribotypes (RT), 11 of which are known to be disease-causing including the hyper-virulent RT078. Additionally, strains RT002, RT014, and RT015, which are common in non-CF nosocomial infection were described. All strains were susceptible to vancomycin, metronidazole, fusidic acid and rifampicin. No correlation was observed between carriage of C. difficile or any characteristics of isolated strains and any recorded clinical parameters or treatment received. We demonstrate a high prevalence of hypervirulent, toxigenic strains of C. difficile in asymptomatic patients with CF. This highlights the potential role of asymptomatic patients with CF in nosocomial transmission of C. difficile. Copyright © 2016 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.
[Early aseptic loosening of the CF 30 femoral stem].
Kovanda, M; Havlícek, V; Hudec, J
2007-02-01
The CF 30 stem in combination with a cementless acetabulum was used at the First Department of Orthopedic Surgery in Brno in the years 1994 to 1995. From the second year following implantation, aseptic stem loosening was recorded. In order to find explanation of this early loosening, the authors, in cooperation with the Institute of Solid Mechanics, Mechatronics and Biomechanics, carried out the stress-strain analysis in a model system. Eighty patients (31 men and 49 women) received a cemented CF30 femoral component in 1994. Of them, 16 patients underwent revision arthroplasty, three died of causes unrelated to the surgery, and four were lost to follow-up. The final clinical and radiographic check-up was carried out in 2001. The results of a comprehensive examination were available in 57 patients with a CF30 stem. The patients were evaluated on the basis of the Harris hip score and anteroposterior radiographs of the hip. X-ray films obtained immediately after surgery and those taken at regular intervals during follow-up were compared. The following characteristics were noted: translucent lines in individual zones along the stem at the cement-bone interface; osteolysis, i. e., non-linear translucent areas, at least 5 mm long, at the cement-bone interface; and subsidence of the femoral component, i. e., migration of the stem distal to the tip of the greater trochanter. The CF 30 stem survival curve showed that aseptic stem loosening occurred from post-implantation year 2, and increased during the following years. At 6 years and 6 months, a total of 16 patients underwent revision surgery, involving reimplantation in 14 and implant removal in 2 patients. Potential causes of aseptic loosening: Polyethylene wear.However, no acetabular loosening was found in this group, although acetabular components are reported to become loose more often than femoral components. By comparison of the stem survival curves for Poldi and CF 30 stems it appeared that, at 6 years and 6 months
Encapsulation of nuclear wastes
International Nuclear Information System (INIS)
Arnold, J.L.; Boyle, R.W.
1978-01-01
Toxic waste materials are encapsulated by the method wherein the waste material in liquid or finely divided solid form is uniformly dispersed in a vinyl ester resin or an unsaturated polyester and the resin cured under conditions that the exotherm does not rise above the temperature at which the integrity of the encapsulating material is destroyed
Transport of encapsulated nuclear fuels
International Nuclear Information System (INIS)
Broman, Ulrika; Dybeck, Peter; Ekendahl, Ann-Mari
2005-12-01
The transport system for encapsulated fuel is described, including a preliminary drawing of a transport container. In the report, the encapsulation plant is assumed to be located to Oskarshamn, and the repository to Oskarshamn or Forsmark
Fujimura, Shigeru; Watanabe, Akira
2012-08-01
Generic drugs have been used extensively in many developed countries, although their use in Japan has been limited. Generic drugs reduce drug expenses and thereby national medical expenditure. Because generic drugs provide advantages for both public administration and consumers, it is expected that they will be more widely used in the future. However, the diffusion rate of generic drugs in Japan is quite low compared with that of other developed countries. An investigation on generic drugs conducted by the Ministry of Health, Labour and Welfare in Japan revealed that 17.2 % of doctors and 37.2 % of patients had not used generic drugs. The major reasons for this low use rate included distrust of off-patent products and lower drug price margin compared with the brand name drug. The generic drugs available in the market include external drugs such as wet packs, antihypertensive agents, analgesics, anticancer drugs, and antibiotics. Among them, antibiotics are frequently used in cases of acute infectious diseases. When the treatment of these infections is delayed, the infection might be aggravated rapidly. The pharmacokinetics-pharmacodynamics (PK-PD) theory has been adopted in recent chemotherapy, and in many cases, the most appropriate dosage and administration of antibiotics are determined for individual patients considering renal function; high-dosage antibiotics are used preferably for a short duration. Therefore, a highly detailed antimicrobial agent is necessary. However, some of the generic antibiotics have less antibacterial potency or solubility than the brand name products. We showed that the potency of the generic products of vancomycin and teicoplanin is lower than that of the branded drugs by 14.6 % and 17.3 %, respectively. Furthermore, we confirmed that a generic meropenem drug for injection required about 82 s to solubilize in saline, whereas the brand product required only about 21 s. It was thought that the cause may be the difference in size of bulk
Radiography using californium-252 neutron sources
International Nuclear Information System (INIS)
Ray, J.W.
1975-01-01
The current status in the technology of neutron radiography using californium-252 neutron sources is summarized. Major emphasis is on thermal neutron radiography since it has the widest potential applicability at the present time. Attention is given to four major factors which affect the quality and useability of thermal neutron radiography: source neutron thermalization, neutron beam extraction geometry, neutron collimator dimensions, and neutron imaging methods. Each of these factors has a major effect on the quality of the radiographs which are obtained from a californium source neutron radiography system and the exposure times required to obtain the radiographs; radiograph quality and exposure time in turn affect the practicality of neutron radiography for specific nondestructive inspection applications. A brief discussion of fast neutron radiography using californium-252 neutron sources is also included. (U.S.)
OSR encapsulation basis -- 100-KW
International Nuclear Information System (INIS)
Meichle, R.H.
1995-01-01
The purpose of this report is to provide the basis for a change in the Operations Safety Requirement (OSR) encapsulated fuel storage requirements in the 105 KW fuel storage basin which will permit the handling and storing of encapsulated fuel in canisters which no longer have a water-free space in the top of the canister. The scope of this report is limited to providing the change from the perspective of the safety envelope (bases) of the Safety Analysis Report (SAR) and Operations Safety Requirements (OSR). It does not change the encapsulation process itself
Micro-Encapsulation of Probiotics
Meiners, Jean-Antoine
Micro-encapsulation is defined as the technology for packaging with the help of protective membranes particles of finely ground solids, droplets of liquids or gaseous materials in small capsules that release their contents at controlled rates over prolonged periods of time under the influences of specific conditions (Boh, 2007). The material encapsulating the core is referred to as coating or shell.
Encapsulation of Clay Platelets inside Latex Particles
Voorn, D.J.; Ming, W.; Herk, van A.M.; Fernando, R.H.; Sung, Li-Piin
2009-01-01
We present our recent attempts in encapsulating clay platelets inside latex particles by emulsion polymerization. Face modification of clay platelets by cationic exchange has been shown to be insufficient for clay encapsulation, leading to armored latex particles. Successful encapsulation of
Neutron radiography with 252Cf in forensic science
International Nuclear Information System (INIS)
Cason, J.L.
1972-01-01
Equipment and methods for neutron radiographic examination of objects in forensic science are described. Examples discussed include booby-trapped ammunition, bomb in a matchbook, gun barrel analysis, narcotics in pen, and chemicals and metals in body tissue
The establishment, nurturing, and fruition of a national transplutonium production program
International Nuclear Information System (INIS)
Bigelow, J.E.
1992-01-01
The first two slides describe the discovery of 252 Cf and the properties that make it useful as a neutron source. The next two describe the applications. The next two cover the history of the Market Development Program, which is pretty much phased out now, with most residual responsibilities transferred to Oak Ridge. The final slide illustrates the uses of 252 Cf that has been sold and commercially fabricated into neutron sources
Scripting XML with Generic Haskell
Atanassow, F.; Clarke, D.; Jeuring, J.T.
2003-01-01
A generic program is written once and works on values of many data types. Generic Haskell is a recent extension of the functional programming language Haskell that supports generic programming. This paper discusses how Generic Haskell can be used to implement XML tools whose behaviour depends on
Scripting XML with Generic Haskell
Atanassow, F.; Clarke, D.; Jeuring, J.T.
2007-01-01
A generic program is written once and works on values of many data types. Generic Haskell is a recent extension of the functional programming language Haskell that supports generic programming. This paper discusses how Generic Haskell can be used to implement XML tools whose behaviour depends on
2010-04-01
... TREASURY LIQUORS BEER Removal of Brewer's Yeast and Other Articles § 25.252 Records. (a) Production. The brewer shall keep records of the production of malt syrup, wort, and other articles which are removed... of brewer's yeast, malt and other articles from the brewery. The record shall include the quantity...
International Nuclear Information System (INIS)
Gourgiotis, A.; Isnard, H.; Nonell, A.; Aubert, M.; Stadelmann, G.; Dupont, E.; AlMahamid, I.; Tiang, G.; Rao, L.; Lukens, W.; Cassette, P.; Panebianco, S.; Letourneau, A.; Chartier, F.
2013-01-01
The French Atomic Energy Commission has carried out several experiments for the study of minor-actinide transmutation processes in high intensity thermal neutron flux. In this context a Cm sample enriched in 248 Cm (97%) was irradiated in a thermal neutron flux at the High Flux Reactor (HFR) of the Laue-Langevin Institute (ILL). The precise and accurate determination of Cf isotope ratios and of 249 Bk/ 248 Cm and 249 Cf/ 248 Cm elemental ratios in the 248 Cm irradiated sample is crucial for the calculation of actinide neutron capture cross-sections.This work describes an analytical procedure for the separation and the isotope ratio measurement of Bk and Cf in the irradiated sample.The Bk and Cf separation is based on a lanthanides separation protocol previously developed by the laboratory. Well-defined retention times for Bk and Cf were obtained by coupling the Ionic Chromatography (IC) with an ICP-QMS. All conditions of element separation by IC and the different steps of the analytical protocol in order to obtain the isotopic and elemental ratios are presented. Relative uncertainties of Cf isotopic ratios range from 0.3% to 0.5% and the uncertainty of the 249 Bk/ 248 Cm and 249 Cf/ 248 Cm elemental ratios are respectively 6.1% and 3.2%.This level of uncertainty for both isotopic and elemental ratios is in perfect agreement with the requirement for transmutation studies. (authors)
Encapsulation methods for organic electrical devices
Blum, Yigal D.; Chu, William Siu-Keung; MacQueen, David Brent; Shi, Yijian
2013-06-18
The disclosure provides methods and materials suitable for use as encapsulation barriers in electronic devices. In one embodiment, for example, there is provided an electroluminescent device or other electronic device encapsulated by alternating layers of a silicon-containing bonding material and a ceramic material. The encapsulation methods provide, for example, electronic devices with increased stability and shelf-life. The invention is useful, for example, in the field of microelectronic devices.
DEFF Research Database (Denmark)
Andersen, Mads Peter Sulbæk; Hurley, MD; Wallington, TJ
2004-01-01
Smog chambers equipped with FTIR spectrometers were used to study the Cl atom and OH radical initiated oxidation of CH3O(CF2CF2O)(n)CH3 (n = 1-3) in 720 +/- 20 Torr of air at 296 +/- 3 K. Relative rate techniques were used to measure k(Cl + CH3O(CF2CF2O)(n)CH3) (3.7 +/- 10.7) x 10(-13) and k......(OH + CH3O(CF2CF2O)(n)CH3) = (2.9 +/- 0.5) x 10(-11) cm(3) molecule(-1) s(-1) leading to an estimated atmospheric lifetime of 2 years for CH3O(CF2CF2O),CH3. The Cl initiated oxidation of CH3O(CF2CF2O),CH3 in air diluent gives CH3O(CF2CF2O)(n)C(O)H in a yield which is indistinguishable from 100 Further...... oxidation leads to the diformate, H(O)CO(CF2CF2O)(n)C(O)H. A rate constant of k(Cl + CH3O(CF2CF2O)(n)CHO) = (1.81 +/- 0.36) x 10(-13) cm(3) molecule(-1) s-1 was determined. Quantitative infrared spectra for CH3O(CF2CF2O)(n)CH3 (n = 1-3) were recorded and used to estimate halocarbon global warming potentials...
Melting of Pb clusters encapsulated in large fullerenes
International Nuclear Information System (INIS)
Delogu, Francesco
2011-01-01
Graphical abstract: Encapsulation significantly increases the melting point of nanometer-sized Pb particles with respect to the corresponding unsupported ones. Highlights: → Nanometer-sized Pb particles are encapsulated in fullerene cages. → Their thermal behavior is studied by molecular dynamics simulations. → Encapsulated particles undergo a pressure rise as temperature increases. → Encapsulated particles melt at temperatures higher than unsupported ones. - Abstract: Molecular dynamics simulations have been employed to explore the melting behavior of nanometer-sized Pb particles encapsulated in spherical and polyhedral fullerene cages of suitable size. The encapsulated particles, as well as the corresponding unsupported ones for comparison, were submitted to a gradual temperature rise. Encapsulation is shown to severely affect the thermodynamic behavior of Pb particles due to the different thermal expansion coefficients of particles and cages. This determines a volume constraint that induces a rise of pressure inside the fullerene cages, which operate for particles as rigid confinement systems. The result is that surface pre-melting and melting processes occur in encapsulated particles at temperatures higher than in unsupported ones.
48 CFR 252.225-7044 - Balance of Payments Program-Construction Material.
2010-10-01
... Program-Construction Material. 252.225-7044 Section 252.225-7044 Federal Acquisition Regulations System...—Construction Material. As prescribed in 225.7503(a), use the following clause: Balance of Payments Program—Construction Material (JAN 2009) (a) Definitions. As used in this clause— Commercially available off-the-shelf...
Atmospheric chemistry of CF3O radicals: Reaction with H2O
DEFF Research Database (Denmark)
Wallington, T.J.; Hurley, M.D.; Schneider, W.F.
1993-01-01
Evidence is presented that CF3O radicals react with H2O in the gas phase at 296 K to give CF3OH and OH radicals. This reaction is calculated to be exothermic by 1.7 kcal mol-I implying a surprisingly strong CF3O-H bond energy of 120 +/- 3 kcal mol-1. Results from a relative rate experimental study...... suggest that the rate constant for the reaction of CF3O radicals with H2O lies in the range (0.2-4.0) X 10(-17) cm3 molecule-1 s-1. Implications for the atmospheric chemistry of CF3O radicals are discussed....
Equivalent properties of single event burnout induced by different sources
International Nuclear Information System (INIS)
Yang Shiyu; Cao Zhou; Da Daoan; Xue Yuxiong
2009-01-01
The experimental results of single event burnout induced by heavy ions and 252 Cf fission fragments in power MOSFET devices have been investigated. It is concluded that the characteristics of single event burnout induced by 252 Cf fission fragments is consistent to that in heavy ions. The power MOSFET in the 'turn-off' state is more susceptible to single event burnout than it is in the 'turn-on' state. The thresholds of the drain-source voltage for single event burnout induced by 173 MeV bromine ions and 252 Cf fission fragments are close to each other, and the burnout cross section is sensitive to variation of the drain-source voltage above the threshold of single event burnout. In addition, the current waveforms of single event burnouts induced by different sources are similar. Different power MOSFET devices may have different probabilities for the occurrence of single event burnout. (authors)
38 CFR 3.252 - Annual income; pension; Mexican border period and later war periods.
2010-07-01
...; Mexican border period and later war periods. 3.252 Section 3.252 Pensions, Bonuses, and Veterans' Relief... Dependency, Income and Estate § 3.252 Annual income; pension; Mexican border period and later war periods. (a) Annual income limitations; old-law pension. Where the right to old-law pension is payable under section...
Photopolymerizable liquid encapsulants for microelectronic devices
Baikerikar, Kiran K.
2000-10-01
Plastic encapsulated microelectronic devices consist of a silicon chip that is physically attached to a leadframe, electrically interconnected to input-output leads, and molded in a plastic that is in direct contact with the chip, leadframe, and interconnects. The plastic is often referred to as the molding compound, and is used to protect the chip from adverse mechanical, thermal, chemical, and electrical environments. Encapsulation of microelectronic devices is typically accomplished using a transfer molding process in which the molding compound is cured by heat. Most transfer molding processes suffer from significant problems arising from the high operating temperatures and pressures required to fill the mold. These aspects of the current process can lead to thermal stresses, incomplete mold filling, and wire sweep. In this research, a new strategy for encapsulating microelectronic devices using photopolymerizable liquid encapsulants (PLEs) has been investigated. The PLEs consist of an epoxy novolac-based vinyl ester resin (˜25 wt.%), fused silica filler (70--74 wt.%), and a photoinitiator, thermal initiator, and silane coupling agent. For these encapsulants, the use of light, rather than heat, to initiate the polymerization allows precise control over when the reaction starts, and therefore completely decouples the mold filling and the cure. The low viscosity of the PLEs allows for low operating pressures and minimizes problems associated with wire sweep. In addition, the in-mold cure time for the PLEs is equivalent to the in-mold cure times of current transfer molding compounds. In this thesis, the thermal and mechanical properties, as well as the viscosity and adhesion of photopolymerizable liquid encapsulants, are reported in order to demonstrate that a UV-curable formulation can have the material properties necessary for microelectronic encapsulation. In addition, the effects of the illumination time, postcure time, fused silica loading, and the inclusion
DEFF Research Database (Denmark)
Wallington, TJ; Hurley, MD; Nielsen, OJ
2004-01-01
Fourier transform infrared (FTIR) smog chamber techniques were used to measure k(Cl + CF3CFHCF2OCF3) = (4.09 +/- 0.42) x 10(-17), k(OH + CF3CFHCF2OCF3) = (1.43 +/- 0.28) x 10(-15), k(Cl + CF3CFHCF2OCF2H) = (6.89 +/- 1.29) x 10(-17), and k(OH + CF3CFHCF2OCF2H) = (1.79 +/- 0.34) x 10(-15) cm(3) mol...... respectively. The 100-year time horizon global warming potentials of CF3CFHCF2OCF3 and CF3CFHCF2OCF2H relative to CO2 are 4530 and 4340. Results are discussed with respect to the atmospheric chemistry of hydrofluoroethers....
24 CFR 207.252c - Premiums-mortgages insured pursuant to section 238(c) of the Act.
2010-04-01
.... All of the provisions of §§ 207.252 and 207.252a governing mortgage insurance premiums shall apply to... insurance premiums due on such mortgages in accordance with §§ 207.252 and 207.252a shall be calculated on... 24 Housing and Urban Development 2 2010-04-01 2010-04-01 false Premiums-mortgages insured pursuant...
50 CFR 14.252 - What definitions do I need to know?
2010-10-01
... 50 Wildlife and Fisheries 1 2010-10-01 2010-10-01 false What definitions do I need to know? 14.252... PLANTS IMPORTATION, EXPORTATION, AND TRANSPORTATION OF WILDLIFE Captive Wildlife Safety Act § 14.252 What... which any individual other than an authorized keeper or caregiver may potentially touch or otherwise...
Hybrid chip-on-board LED module with patterned encapsulation
Soer, Wouter Anthon; Helbing, Rene; Huang, Guan
2018-02-27
Different wavelength conversion materials, or different concentrations of a wavelength conversion material are used to encapsulate the light emitting elements of different colors of a hybrid light emitting module. In an embodiment of this invention, second light emitting elements (170) of a particular color are encapsulated with a transparent second encapsulant (120;420;520), while first light emitting elements (160) of a different color are encapsulated with a wavelength conversion first encapsulant (110;410;510). In another embodiment of this invention, a particular second set of second and third light emitting elements (170,580) of different colors is encapsulated with a different encapsulant than another first set of first light emitting elements (160).
Acoustically excited encapsulated microbubbles and mitigation of biofouling
Qamar, Adnan
2017-08-31
Provided herein is a universally applicable biofouling mitigation technology using acoustically excited encapsulated microbubbles that disrupt biofilm or biofilm formation. For example, a method of reducing biofilm formation or removing biofilm in a membrane filtration system is provided in which a feed solution comprising encapsulated microbubbles is provided to the membrane under conditions that allow the encapsulated microbubbles to embed in a biofilm. Sonication of the embedded, encapsulated microbubbles disrupts the biofilm. Thus, provided herein is a membrane filtration system for performing the methods and encapsulated microbubbles specifically selected for binding to extracellular polymeric substances (EFS) in a biofilm.
2011-05-11
... methods: Federal eRulemaking Portal: Go to http://www.regulations.gov . Follow the instructions for... Investigation of a General Electric Company (GE) CF34-10E turbofan engine experiencing high fan frame vibrations... likely to exist or develop in other products of the same type design. Proposed AD Requirements This...
Thin film Encapsulations of Flexible Organic Light Emitting Diodes
Directory of Open Access Journals (Sweden)
Tsai Fa-Ta
2016-01-01
Full Text Available Various encapsulated films for flexible organic light emitting diodes (OLEDs were studied in this work, where gas barrier layers including inorganic Al2O3 thin films prepared by atomic layer deposition, organic Parylene C thin films prepared by chemical vapor deposition, and their combination were considered. The transmittance and water vapor transmission rate of the various organic and inorgabic encapsulated films were tested. The effects of the encapsulated films on the luminance and current density of the OLEDs were discussed, and the life time experiments of the OLEDs with these encapsulated films were also conducted. The results showed that the transmittance are acceptable even the PET substrate were coated two Al2O3 and Parylene C layers. The results also indicated the WVTR of the PET substrate improved by coating the barrier layers. In the encapsulation performance, it indicates the OLED with Al2O3 /PET, 1 pair/PET, and 2 pairs/PET presents similarly higher luminance than the other two cases. Although the 1 pair/PET encapsulation behaves a litter better luminance than the 2 pairs/PET encapsulation, the 2 pairs/PET encapsulation has much better life time. The OLED with 2 pairs/PET encapsulation behaves near double life time to the 1 pair encapsulation, and four times to none encapsulation.
CF 2000 ECUMÊNICA: EPISÓDIO OU NOVA FASE DA CF?
Directory of Open Access Journals (Sweden)
Gabriele Cipriani
2001-01-01
Full Text Available No ano 2000, sete igrejas cristãs, membros do Conselho Nacional de Igrejas Cristãs do Brasil (CONIC, surpreenderam a opinião pública brasileira colocando-se na contramão da competição cotidiana que caracteriza o anúncio do Evangelho no Brasil. Promoveram em conjunto uma Campanha da Fraternidade (CF criada e realizada há 36 anos pela CNBB. Isso tinha algo de incrível.
Perspective of metal encapsulation of waste
International Nuclear Information System (INIS)
Jardine, L.J.; Steindler, M.J.
1978-01-01
A conceptual flow sheet is presented for encapsulating solid, stabilized calcine (e.g., supercalcine) in a solid lead alloy, using existing or developing technologies. Unresolved and potential problem areas of the flow sheet are outlined and suggestions are made as how metal encapsulation might be applied to other solid wastes from the fuel cycle. It is concluded that metal encapsulation is a technique applicable to many forms of solid wastes and is likely to meet future waste isolation criteria and regulations
Upset due to a single particle caused propagated transients in a bulk CMOS microprocessor
International Nuclear Information System (INIS)
Leavy, J.F.; Hoffmann, L.F.; Shoran, R.W.; Johnson, M.T.
1991-01-01
This paper reports on data pattern advances observed in preset, single event upset (SEU) hardened clocked flip-flops, during static Cf-252 exposures on a bulk CMOS microprocessor, that were attributable to particle caused anomalous clock signals, or propagated transients. SPICE simulations established that particle strikes in the output nodes of a clock control logic flip-flop could produce transients of sufficient amplitude and duration to be accepted as legitimate pulses by clock buffers fed by the flip-flop's output nodes. The buffers would then output false clock pulses, thereby advancing the state of the present flip-flops. Masking the clock logic on one of the test chips made the flip-flop data advance cease, confirming the clock logic as the source of the SEU. By introducing N 2 gas, at reduced pressures, into the SEU test chamber to attenuate Cf-252 particle LET's, a 24-26 MeV-cm 2 /mg LET threshold was deduced. Subsequent tests, at the 88-inch cyclotron at Berkeley, established an LET threshold of 30 MeV-cm 2 /mg (283 MeV Cu at 0 degrees) for the generation of false clocks. Cyclotron SEU tests are considered definitive, while Cf-252 data usually is not. However, in this instance Cf-252 tests proved analytically useful, providing SEU characterization data that was both timely and inexpensive
48 CFR 252.244-7000 - Subcontracts for Commercial Items and Commercial Components (DoD Contracts).
2010-10-01
... under this contract: (a) 252.225-7009 Restriction on Acquisition of Certain Articles Containing... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Subcontracts for Commercial Items and Commercial Components (DoD Contracts). 252.244-7000 Section 252.244-7000 Federal...
Alimarine, A.; Smetsers, J.E.W.
2004-01-01
Generic functions are defined by induction on the structural representation of types. As a consequence, by defining just a single generic operation, one acquires this operation over any particular type. An instance on a specific type is generated by interpretation of the type's structure. A direct
Automated absolute activation analysis with californium-252 sources
International Nuclear Information System (INIS)
MacMurdo, K.W.; Bowman, W.W.
1978-09-01
A 100-mg 252 Cf neutron activation analysis facility is used routinely at the Savannah River Laboratory for multielement analysis of many solid and liquid samples. An absolute analysis technique converts counting data directly to elemental concentration without the use of classical comparative standards and flux monitors. With the totally automated pneumatic sample transfer system, cyclic irradiation-decay-count regimes can be pre-selected for up to 40 samples, and samples can be analyzed with the facility unattended. An automatic data control system starts and stops a high-resolution gamma-ray spectrometer and/or a delayed-neutron detector; the system also stores data and controls output modes. Gamma ray data are reduced by three main programs in the IBM 360/195 computer: the 4096-channel spectrum and pertinent experimental timing, counting, and sample data are stored on magnetic tape; the spectrum is then reduced to a list of significant photopeak energies, integrated areas, and their associated statistical errors; and the third program assigns gamma ray photopeaks to the appropriate neutron activation product(s) by comparing photopeak energies to tabulated gamma ray energies. Photopeak areas are then converted to elemental concentration by using experimental timing and sample data, calculated elemental neutron capture rates, absolute detector efficiencies, and absolute spectroscopic decay data. Calculational procedures have been developed so that fissile material can be analyzed by cyclic neutron activation and delayed-neutron counting procedures. These calculations are based on a 6 half-life group model of delayed neutron emission; calculations include corrections for delayed neutron interference from 17 O. Detection sensitivities of 239 Pu were demonstrated with 15-g samples at a throughput of up to 140 per day. Over 40 elements can be detected at the sub-ppM level
Electron and photon impact studies of CF3I
International Nuclear Information System (INIS)
Mason, N.J.; Eden, S.; Limao Vieire, P.; Kendall, P.; Pathak, S.; Dawes, A.; Tegeder, P.; Kitajima, M.; Okamoto, M.; Tanaka, H.; Samukawa, S.; Cho, H.; Hoffmann, S.
2002-01-01
The manufacture of ultra-large-scale-integrated circuits, requires a well collimated, specially uniform, high density plasma source operating under low pressure conditions. The main feed gases used are perfluorocarbons, however these are also strong greenhouse gases, therefore must be replaced by alternative compounds with low global warming potentials. CF 3 I is one possible replacement, due to its high photolysis rate, is expected to have a very short lifetime in the atmosphere. It is also predicted to be able to produced high yields of CF 3 radicals in any etching plasma, since its weak C - I bond should be possible to break by direct electron impact. Prior adapting existing industrial plasma reactors to use CF 3 I, it is necessary to run simulations of the reactant plasma, requiring a detailed database of the electron interactions with the feed gases, however such CF 3 I data does not exist. Thus an exhaustive series of experiments to measure elastic and inelastic scattering from CF 3 I including a study of its electronic state spectroscopy using photon absorption and electron scattering techniques were performed. Electron energy loss spectroscopy (EELS) and photo-absorption spectroscopy were employed. A comprehensive set of differential cross sections for the elastic scattering CF 3 I over the impact energy region from 1.5 to 60 eV for scattering angles between 20 and 130 were compiled. The photo-absorption spectrum is characterized by three regions, the first is a very weak continuum around centered about 4.7 eV; the second consists of four prominent band structures observed around 7.4, 8.1, 9.0 and 9.8 eV, respectively, containing vibrational structure from 7 to 10 eV; the third (above the ionization potentials) could only be studied by using EELS and additional broad peaks were observed. (nevyjel)
International Nuclear Information System (INIS)
Menlove, H.O.; Eccleston, G.; Close, D.A.; Speir, L.G.
1978-05-01
A neutron interrogation assay system is being designed for the measurement of waste canisters and spent fuel packages at the new Idaho Chemical Processing Plant to be operated by Allied Chemical Corp. The assay samples consist of both waste canisters from the fluorinel dissolution process and spent fuel assemblies. The assay system is a 252 Cf ''Shuffler'' that employs a cyclic sequence of fast-neutron interrogation with a 252 Cf source followed by delayed-neutron counting to determine the 235 U content
K-252a, a novel microbial product, inhibits smooth muscle myosin light chain kinase
International Nuclear Information System (INIS)
Nakanishi, S.; Yamada, K.; Kase, H.; Nakamura, S.; Nonomura, Y.
1988-01-01
Effects of K-252a, purified from the culture broth of Nocardiopsis sp., on the activity of myosin (light chain kinase were investigated. 1) K-252a affected three characteristic properties of chicken gizzard myosin-B, natural actomyosin, to a similar degree: the Ca 2+ -dependent activity of ATPase, superprecipitation, and the phosphorylation of the myosin light chain. 2) K-252a inhibited the activities of the purified myosin light chain kinase and a Ca 2+ -independent form of the enzyme which was constructed by cross-linking of myosin light chain kinase and calmodulin using glutaraldehyde. The degrees of inhibition by 3 x 10 -6 M K-252a were 69 and 48% of the control activities with the purified enzyme and the cross-linked complex, respectively. Chlorpromazine (3 x 10 -4 M), a calmodulin antagonist, inhibited the native enzyme, but not the cross-linked one. These results suggested that K-252a inhibited myosin light chain kinase by direct interaction with the enzyme, whereas chlorpromazine suppressed the enzyme activation by interacting with calmodulin. 3) The inhibition by K-252a of the cross-linked kinase was affected by the concentration of ATP, a phosphate donor. The concentration causing 50% inhibition was two orders magnitude lowere in the presence of 100 μM ATP than in the presence of 2 mM ATP. 4) Kinetic analyses using [γ- 32 P]ATP indicated that the inhibitory mode of K-252a was competitive with respect to ATP. These results suggest that K-252a interacts at the ATP-binding domain of myosin light chain kinase
Zhao, Hang; Lu, Yinxiang
2016-01-01
Nickel films were grown on citric acid (CA), malic acid (MA) and oxalic acid (OA) modified cuprammonium fabric (CF) substrates via electroless nickel deposition. The nickel films were examined using scanning electron microscopy (SEM) and X-ray diffraction (XRD). Their individual deposition rate and electromagnetic interference (EMI) shielding effectiveness (SE) were also investigated to compare the properties of electroless nickel films. SEM images illustrated that the nickel film on MA modified CF substrate was smooth and uniform, and the density of nickel nuclei was much higher. Compared with that of CA modified CF, the coverage of nickel nuclei on OA and MA modified CF substrate was very limited and the nickel particles size was too big. XRD analysis showed that the nickel films deposited on the different modified CF substrates had a structure with Ni (1 1 1) preferred orientation. All the nickel coatings via different acid modification were firmly adhered to the CF substrates, as demonstrated by an ultrasonic washing test. The result of tensile test indicated that the electroless nickel plating on CF has ability to strengthen the CF substrate while causes limited effect on tensile elongation. Moreover, the nickel film deposited on MA modified CF substrate showed more predominant in EMI SE than that deposited on CA or OA modified CF.
Enterococcus faecalis Sex Pheromone cCF10 Enhances Conjugative Plasmid Transfer In Vivo.
Hirt, Helmut; Greenwood-Quaintance, Kerryl E; Karau, Melissa J; Till, Lisa M; Kashyap, Purna C; Patel, Robin; Dunny, Gary M
2018-02-13
Cell-cell communication mediated by peptide pheromones (cCF10 [CF]) is essential for high-frequency plasmid transfer in vitro in Enterococcus faecalis To examine the role of pheromone signaling in vivo , we established either a CF-producing (CF+) recipient or a recipient producing a biologically inactive variant of CF (CF- recipient) in a germfree mouse model 3 days before donor inoculation and determined transfer frequencies of the pheromone-inducible plasmid pCF10. Plasmid transfer was detected in the upper and middle sections of the intestinal tract 5 h after donor inoculation and was highly efficient in the absence of antibiotic selection. The transconjugant/donor ratio reached a maximum level approaching 1 on day 4 in the upper intestinal tract. Plasmid transfer was significantly lower with the CF- recipient. While rescue of the CF- mating defect by coculture with CF+ recipients is easily accomplished in vitro , no extracellular complementation occurred in vivo This suggests that most pheromone signaling in the gut occurs between recipient and donor cells in very close proximity. Plasmid-bearing cells (donors plus transconjugants) steadily increased in the population from 0.1% after donor inoculation to about 10% at the conclusion of the experiments. This suggests a selective advantage of pCF10 carriage distinct from antibiotic resistance or bacteriocin production. Our results demonstrate that pheromone signaling is required for efficient pCF10 transfer in vivo In the absence of CF+ recipients, a low level of transfer to CF- recipients occurred in the gut. This may result from low-level host-mediated induction of the donors in the gastrointestinal (GI) tract, similar to that previously observed in serum. IMPORTANCE Horizontal gene transfer is a major factor in the biology of Enterococcus faecalis , an important nosocomial pathogen. Previous studies showing efficient conjugative plasmid transfer in the gastrointestinal (GI) tracts of experimental animals did
Angular dependence of dose equivalent response of an albedo neutron dosimeter
International Nuclear Information System (INIS)
Torres, B.A.; Boswell, E.; Schwartz, R.B.
1994-01-01
The ANSI provides procedures for testing the performance of dosimetry services. Although neutron dose equivalent angular response studies are not now mandated, future standards may well require that such studies be performed. Current studies with an albedo dosimeter will yield information regarding the angular dependence of dose equivalent response for this type of personnel dosimeter. Preliminary data for bare 252 Cf fluences show a marked decrease in dosimeter reading with increasing angle. The response decreased by an approximate factor of four. For the horizontal orientation, the same response was noted from both positive and negative angles. However, for the vertical orientation, the response was unexplainably assymetric. We are also examining the response of the personnel badge in moderated 252 Cf fluences. Responses from the moderated and unmoderated 252 Cf fields and theoretical calculations of the neutron angular response will be compared. This information will assist in building a data base for future comparisons of neutron angular responses with other neutron albedo dosimeters and phantoms
Encapsulation Efficiency, Oscillatory Rheometry
Directory of Open Access Journals (Sweden)
Z. Mohammad Hassani
2014-01-01
Full Text Available Nanoliposomes are one of the most important polar lipid-based nanocarriers which can be used for encapsulation of both hydrophilic and hydrophobic active compounds. In this research, nanoliposomes based on lecithin-polyethylene glycol-gamma oryzanol were prepared by using a modified thermal method. Only one melting peak in DSC curve of gamma oryzanol bearing liposomes was observed which could be attributed to co-crystallization of both compounds. The addition of gamma oryzanol, caused to reduce the melting point of 5% (w/v lecithin-based liposome from 207°C to 163.2°C. At high level of lecithin, increasing of liposome particle size (storage at 4°C for two months was more obvious and particle size increased from 61 and 113 to 283 and 384 nanometers, respectively. The encapsulation efficiency of gamma oryzanol increased from 60% to 84.3% with increasing lecithin content. The encapsulation stability of oryzanol in liposome was determined at different concentrations of lecithin 3, 5, 10, 20% (w/v and different storage times (1, 7, 30 and 60 days. In all concentrations, the encapsulation stability slightly decreased during 30 days storage. The scanning electron microscopy (SEM images showed relatively spherical to elliptic particles which indicated to low extent of particles coalescence. The oscillatory rheometry showed that the loss modulus of liposomes were higher than storage modulus and more liquid-like behavior than solid-like behavior. The samples storage at 25°C for one month, showed higher viscoelastic parameters than those having been stored at 4°C which were attributed to higher membrane fluidity at 25°C and their final coalescence.Nanoliposomes are one of the most important polar lipid based nanocarriers which can be used for encapsulation of both hydrophilic and hydrophobic active compounds. In this research, nanoliposomes based on lecithin-polyethylene glycol-gamma oryzanol were prepared by using modified thermal method. Only one
Generic Example Proving Criteria for All
Yopp, David; Ely, Rob; Johnson-Leung, Jennifer
2015-01-01
We review literature that discusses generic example proving and highlight ambiguities that pervade our research community's discourse about generic example arguments. We distinguish between pedagogical advice for choosing good examples that can serve as generic examples when teaching and advice for developing generic example arguments. We provide…
48 CFR 252.245-7000 - Government-furnished mapping, charting, and geodesy property.
2010-10-01
... mapping, charting, and geodesy property. 252.245-7000 Section 252.245-7000 Federal Acquisition Regulations..., charting, and geodesy property. As prescribed in 245.107-70, use the following clause: Government-Furnished Mapping, Charting, and Geodesy Property (DEC 1991) (a) Definition—Mapping, charting, and geodesy (MC&G...
48 CFR 53.236-2 - Architect-engineer services (SF's 252 and 330).
2010-10-01
... 48 Federal Acquisition Regulations System 2 2010-10-01 2010-10-01 false Architect-engineer... ACQUISITION REGULATION (CONTINUED) CLAUSES AND FORMS FORMS Prescription of Forms 53.236-2 Architect-engineer...-engineer and related services: (a) SF 252 (Rev. 10/83), Architect-Engineer Contract. SF 252 is prescribed...
Generic and biosimilar medicines: quid?
Directory of Open Access Journals (Sweden)
Steven Simoens
2012-12-01
Full Text Available Once intellectual property protection, data and marketing exclusivity of reference medicines have expired, generic medicines and biosimilar medicines can enter the off-patent market. This market entry is conditional on the approval of marketing authorization, pricing and reimbursement. Given that there tends to be confusion surrounding generic and biosimilar medicines, this Editorial introduces basic concepts related to generic and biosimilar medicines and presents the different studies and articles included in this supplement dedicated to generic and biosimilar medicines.
Enterococcus faecalis Sex Pheromone cCF10 Enhances Conjugative Plasmid Transfer In Vivo
Directory of Open Access Journals (Sweden)
Helmut Hirt
2018-02-01
Full Text Available Cell-cell communication mediated by peptide pheromones (cCF10 [CF] is essential for high-frequency plasmid transfer in vitro in Enterococcus faecalis. To examine the role of pheromone signaling in vivo, we established either a CF-producing (CF+ recipient or a recipient producing a biologically inactive variant of CF (CF− recipient in a germfree mouse model 3 days before donor inoculation and determined transfer frequencies of the pheromone-inducible plasmid pCF10. Plasmid transfer was detected in the upper and middle sections of the intestinal tract 5 h after donor inoculation and was highly efficient in the absence of antibiotic selection. The transconjugant/donor ratio reached a maximum level approaching 1 on day 4 in the upper intestinal tract. Plasmid transfer was significantly lower with the CF− recipient. While rescue of the CF− mating defect by coculture with CF+ recipients is easily accomplished in vitro, no extracellular complementation occurred in vivo. This suggests that most pheromone signaling in the gut occurs between recipient and donor cells in very close proximity. Plasmid-bearing cells (donors plus transconjugants steadily increased in the population from 0.1% after donor inoculation to about 10% at the conclusion of the experiments. This suggests a selective advantage of pCF10 carriage distinct from antibiotic resistance or bacteriocin production. Our results demonstrate that pheromone signaling is required for efficient pCF10 transfer in vivo. In the absence of CF+ recipients, a low level of transfer to CF− recipients occurred in the gut. This may result from low-level host-mediated induction of the donors in the gastrointestinal (GI tract, similar to that previously observed in serum.
Preliminary investigation of cryopreservation by encapsulation ...
African Journals Online (AJOL)
Protocorm-like bodies (PLBs) of Brassidium Shooting Star, a new commercial ornamental orchid hybrid, were cryopreserved by an encapsulation-dehydration technique. The effects of PLB size, various sucrose concentrations in preculture media and sodium alginate concentration for encapsulation were the main ...
Advertising and generic market entry.
Königbauer, Ingrid
2007-03-01
The effect of purely persuasive advertising on generic market entry and social welfare is analysed. An incumbent has the possibility to invest in advertising which affects the prescribing physician's perceived relative qualities of the brand-name and the generic version of the drug. Advertising creates product differentiation and can induce generic market entry which is deterred without differentiation due to strong Bertrand competition. However, over-investment in advertising can deter generic market entry under certain conditions and reduces welfare as compared to accommodated market entry.
On-line high-resolution mass spectroscopy. Progress report, January 1, 1975--July 1, 1975
International Nuclear Information System (INIS)
Macfarlane, R.D.
1975-01-01
The report begins with a brief introduction, summary of activities, and lists of personnel, facilities used, publications, and presentations. Work on xanthine--tyrosine and sulfuric acid esters was completed in the project on 252 Cf-plasma desorption mass spectroscopy of involatile molecules. Work is continuing in the following areas: beta--gamma directional correlations and second-class currents in nuclear beta decay (mass-20 system), beta--neutrino directional correlations in mass 8, atomic mass measurements, and 252 Cf-plasma desorption mass spectroscopy of large biomolecules. (3 figures) (RWR)
Photovoltaic module encapsulation design and materials selection, volume 1
Cuddihy, E.; Carroll, W.; Coulbert, C.; Gupta, A.; Liang, R. H.
1982-01-01
Encapsulation material system requirements, material selection criteria, and the status and properties of encapsulation materials and processes available are presented. Technical and economic goals established for photovoltaic modules and encapsulation systems and their status are described. Available encapsulation technology and data are presented to facilitate design and material selection for silicon flat plate photovoltaic modules, using the best materials available and processes optimized for specific power applications and geographic sites. The operational and environmental loads that encapsulation system functional requirements and candidate design concepts and materials that are identified to have the best potential to meet the cost and performance goals for the flat plate solar array project are described. Available data on encapsulant material properties, fabrication processing, and module life and durability characteristics are presented.
Cystic Fibrosis (CF): Chloride Sweat Test
... on this topic for: Parents Kids Teens Cystic Fibrosis Cystic Fibrosis and Nutrition Cystic Fibrosis (CF) Respiratory Screen: Sputum Cystic Fibrosis: Diet and Nutrition Cystic Fibrosis Cystic Fibrosis: Diet and Nutrition View more Partner Message ...
Encouraging generic use can yield significant savings.
Zimmerman, Christina
2012-11-01
Key findings. (1) Zero copayment for generic drugs is the greatest influencer of generic statin utilization. (2) Both higher copayments for generic drugs and lower copayments for competing brands are associated with a decreased probability of using generic statins. (3) Prior authorization and step therapy requirements for brand-name statins are associated with an increased use of generic drugs. (4) Greater use of generic statins should reduce costs for patients, plans, and Medicare.
International Nuclear Information System (INIS)
Mullens, J.A.
1999-01-01
The Nuclear Weapons Identification System (NWIS) is a system that performs radiation signature measurements on objects such as nuclear weapons components. NWIS consists of a 252 Cf fission source, radiation detectors and associated analog electronics, data acquisition boards, and a computer running Windows NT and the application software. NWIS uses signal processing techniques to produce a radiation signature from the radiation emitted from the object. This signature can be stored and later compared to another signature to determine whether two objects are similar. A library of such signatures can be used to identify objects in closed containers as well as determine attributes such as fissile mass and in some cases enrichment. NWIS uses a 252 Cf source on one side of the object to produce radiation that its detectors measure on the other side of the target (active mode). If the object naturally emits enough radiation, the 252 Cf source is not required (passive mode). The NWIS data acquisition hardware has five detector channels. Each channel receives shaped detector pulses and times those pulses with 1 nanosecond resolution. In active mode measurements one of these channels receives pulses from a detector measuring the 252 Cf source fissions. Thus, for active mode measurements, NWIS has the time of each 252 Cf fission and the subsequent injection of neutrons and gamma rays into the object. The remaining channels receive pulses from the detectors measuring radiation from the object. These detectors record the amount and time of radiation exiting the object. By correlating the radiation events among the source and the other detectors, and among the detectors themselves, a characteristic response of the object to 252 Cf radiation or its own internal radiation is measured. The data acquisition hardware consists of two custom-made boards. The Data Capture and Compression (DCC) board is built around a Gallium Arsine (GaAs) chip designed at ORNL. This chip assigns a time
Different encapsulation strategies for implanted electronics
Directory of Open Access Journals (Sweden)
Winkler Sebastian
2017-09-01
Full Text Available Recent advancements in implant technology include increasing application of electronic systems in the human body. Hermetic encapsulation of electronic components is necessary, specific implant functions and body environments must be considered. Additional functions such as wireless communication systems require specialized technical solutions for the encapsulation.
Rate constants for the reaction of CF3O radicals with hydrocarbons at 298 K
DEFF Research Database (Denmark)
Kelly, C.; Treacy, J.; Sidebottom, H.W.
1993-01-01
Rate constant ratios of the reactions of CF3O radicals with a number of hydrocarbons have been determined at 298 +/- 2 K and atmospheric pressure using a relative rate method. Using a previously determined value k(CF30 + C2H6) = 1.2 x 10(-12) cm3 molecule-1 s-1 these rate constant ratios provide...... estimates of the rate constants: k(CF3O + CH4) = (1.2 +/- 0.1) x 10(-14), k(CF3O + c-C3H6) = (3.6 +/- 0.2) x 10(-13), k(CF3O + C3H8) = (4.7 +/- 0.7) x 10(-12), k(CF3O + (CH3)3CH) = (7.2 +/- 0.5) x 10(-12), k(CF3O + C2H4) = (3.0 +/- 0.1) x 10(-11) and k(CF3O + C6H6) = (3.6 +/- 0.1) x 10(-11) cm3 molecule-1 s......-1. The importance of the reactions of CF3O radicals with hydrocarbons under atmospheric conditions is discussed....
Reproductive Toxicity Screen of Trifluoroiodomethane (CF31) in Sprague-Dawley Rats
National Research Council Canada - National Science Library
Dodd, Darol
1998-01-01
.... The purpose of this study was to determine and evaluate the potential for CF3I to produce reproductive toxicity and to provide additional information on the effect of CF3I exposure on the thyroid...
2011-09-16
... NUCLEAR REGULATORY COMMISSION [NRC-2011-0204] Proposed Generic Communication; Draft NRC Generic Letter 2011-XX: Seismic Risk Evaluations for Operating Reactors AGENCY: Nuclear Regulatory Commission... FR 54507), that requested public comment on Draft NRC Generic Letter 2011- XX: Seismic Risk...
International Nuclear Information System (INIS)
Roy, R.; Vance, E.R.; McCarthy, G.J.; White, W.B.
1981-01-01
This paper describes the encapsulation strategy as applied to microscopic-scale encapsulation in ceramics composed of micron-sized grains of possibly more leachable radiophases intimately surrounded by micron-sized grains of more insoluble phases. The encapsulation approach should be valid, almost axiomatic, for defense waste. However, there are still problems to be investigated experimentally. These are (a) because of the dilution, it is difficult to confirm the geometry of the radionuclide-bearing phases relative to that of the matrix: one almost has to use the inverse approach by making leach measurements, (b) deciding between using the highly reactive oxyhydroxide sludges themselves or sintered calcine to be coated, (c) verification of the insolubility of the encapsulant phases in a variety of groundwaters, and (d) the production of ceramics of near-zero porosity, using hot-isostatic pressing, or incorporation in either silicate or phosphate cements
Encapsulated Islet Transplantation: Where Do We Stand?
Vaithilingam, Vijayaganapathy; Bal, Sumeet; Tuch, Bernard E
2017-01-01
Transplantation of pancreatic islets encapsulated within immuno-protective microcapsules is a strategy that has the potential to overcome graft rejection without the need for toxic immunosuppressive medication. However, despite promising preclinical studies, clinical trials using encapsulated islets have lacked long-term efficacy, and although generally considered clinically safe, have not been encouraging overall. One of the major factors limiting the long-term function of encapsulated islets is the host's immunological reaction to the transplanted graft which is often manifested as pericapsular fibrotic overgrowth (PFO). PFO forms a barrier on the capsule surface that prevents the ingress of oxygen and nutrients leading to islet cell starvation, hypoxia and death. The mechanism of PFO formation is still not elucidated fully and studies using a pig model have tried to understand the host immune response to empty alginate microcapsules. In this review, the varied strategies to overcome or reduce PFO are discussed, including alginate purification, altering microcapsule geometry, modifying alginate chemical composition, co-encapsulation with immunomodulatory cells, administration of pharmacological agents, and alternative transplantation sites. Nanoencapsulation technologies, such as conformal and layer-by-layer coating technologies, as well as nanofiber, thin-film nanoporous devices, and silicone based NanoGland devices are also addressed. Finally, this review outlines recent progress in imaging technologies to track encapsulated cells, as well as promising perspectives concerning the production of insulin-producing cells from stem cells for encapsulation.
Assessment of CF lung disease using motion corrected PROPELLER MRI: a comparison with CT
Energy Technology Data Exchange (ETDEWEB)
Ciet, Pierluigi [General Hospital Ca' Foncello, Radiology Department, Treviso (Italy); Sophia Children' s Hospital, Pediatric Pulmonology Erasmus MC, Rotterdam (Netherlands); Erasmus MC, Radiology, Rotterdam (Netherlands); Serra, Goffredo; Catalano, Carlo [University of Rome ' ' Sapienza' ' , Radiology, Rome (Italy); Bertolo, Silvia; Morana, Giovanni [General Hospital Ca' Foncello, Radiology Department, Treviso (Italy); Spronk, Sandra [Erasmus MC, Radiology, Rotterdam (Netherlands); Erasmus MC, Epidemiology, Rotterdam (Netherlands); Ros, Mirco [Ca' Foncello Hospital, Pediatrics, Treviso (Italy); Fraioli, Francesco [University College London (UCL), Institute of Nuclear Medicine, London (United Kingdom); Quattrucci, Serena [University of Rome Sapienza, Pediatrics, Rome (Italy); Assael, M.B. [Azienda Ospedaliera di Verona, Verona CF Center, Verona (Italy); Pomerri, Fabio [University of Padova, Department of Medicine-DIMED, Padova (Italy); Tiddens, Harm A.W.M. [Sophia Children' s Hospital, Pediatric Pulmonology Erasmus MC, Rotterdam (Netherlands); Erasmus MC, Radiology, Rotterdam (Netherlands)
2016-03-15
To date, PROPELLER MRI, a breathing-motion-insensitive technique, has not been assessed for cystic fibrosis (CF) lung disease. We compared this technique to CT for assessing CF lung disease in children and adults. Thirty-eight stable CF patients (median 21 years, range 6-51 years, 22 female) underwent MRI and CT on the same day. Study protocol included respiratory-triggered PROPELLER MRI and volumetric CT end-inspiratory and -expiratory acquisitions. Two observers scored the images using the CF-MRI and CF-CT systems. Scores were compared with intra-class correlation coefficient (ICC) and Bland-Altman plots. The sensitivity and specificity of MRI versus CT were calculated. MRI sensitivity for detecting severe CF bronchiectasis was 0.33 (CI 0.09-0.57), while specificity was 100 % (CI 0.88-1). ICCs for bronchiectasis and trapped air were as follows: MRI-bronchiectasis (0.79); CT-bronchiectasis (0.85); MRI-trapped air (0.51); CT-trapped air (0.87). Bland-Altman plots showed an MRI tendency to overestimate the severity of bronchiectasis in mild CF disease and underestimate bronchiectasis in severe disease. Motion correction in PROPELLER MRI does not improve assessment of CF lung disease compared to CT. However, the good inter- and intra-observer agreement and the high specificity suggest that MRI might play a role in the short-term follow-up of CF lung disease (i.e. pulmonary exacerbations). (orig.)
Assessment of CF lung disease using motion corrected PROPELLER MRI: a comparison with CT
International Nuclear Information System (INIS)
Ciet, Pierluigi; Serra, Goffredo; Catalano, Carlo; Bertolo, Silvia; Morana, Giovanni; Spronk, Sandra; Ros, Mirco; Fraioli, Francesco; Quattrucci, Serena; Assael, M.B.; Pomerri, Fabio; Tiddens, Harm A.W.M.
2016-01-01
To date, PROPELLER MRI, a breathing-motion-insensitive technique, has not been assessed for cystic fibrosis (CF) lung disease. We compared this technique to CT for assessing CF lung disease in children and adults. Thirty-eight stable CF patients (median 21 years, range 6-51 years, 22 female) underwent MRI and CT on the same day. Study protocol included respiratory-triggered PROPELLER MRI and volumetric CT end-inspiratory and -expiratory acquisitions. Two observers scored the images using the CF-MRI and CF-CT systems. Scores were compared with intra-class correlation coefficient (ICC) and Bland-Altman plots. The sensitivity and specificity of MRI versus CT were calculated. MRI sensitivity for detecting severe CF bronchiectasis was 0.33 (CI 0.09-0.57), while specificity was 100 % (CI 0.88-1). ICCs for bronchiectasis and trapped air were as follows: MRI-bronchiectasis (0.79); CT-bronchiectasis (0.85); MRI-trapped air (0.51); CT-trapped air (0.87). Bland-Altman plots showed an MRI tendency to overestimate the severity of bronchiectasis in mild CF disease and underestimate bronchiectasis in severe disease. Motion correction in PROPELLER MRI does not improve assessment of CF lung disease compared to CT. However, the good inter- and intra-observer agreement and the high specificity suggest that MRI might play a role in the short-term follow-up of CF lung disease (i.e. pulmonary exacerbations). (orig.)
Energy Technology Data Exchange (ETDEWEB)
Zhao, Hang; Lu, Yinxiang, E-mail: yxlu@fudan.edu.cn
2016-01-30
Graphical abstract: - Highlights: • An etchant-free and moderate surface pre-treatment process was studied. • Citric acid, malic acid and oxalic acid were selected as modification agents. • High adhesive nickel coating on cuprammonium fabric was obtained. • The electromagnetic parameters were evaluated from the experimental data. - Abstract: Nickel films were grown on citric acid (CA), malic acid (MA) and oxalic acid (OA) modified cuprammonium fabric (CF) substrates via electroless nickel deposition. The nickel films were examined using scanning electron microscopy (SEM) and X-ray diffraction (XRD). Their individual deposition rate and electromagnetic interference (EMI) shielding effectiveness (SE) were also investigated to compare the properties of electroless nickel films. SEM images illustrated that the nickel film on MA modified CF substrate was smooth and uniform, and the density of nickel nuclei was much higher. Compared with that of CA modified CF, the coverage of nickel nuclei on OA and MA modified CF substrate was very limited and the nickel particles size was too big. XRD analysis showed that the nickel films deposited on the different modified CF substrates had a structure with Ni (1 1 1) preferred orientation. All the nickel coatings via different acid modification were firmly adhered to the CF substrates, as demonstrated by an ultrasonic washing test. The result of tensile test indicated that the electroless nickel plating on CF has ability to strengthen the CF substrate while causes limited effect on tensile elongation. Moreover, the nickel film deposited on MA modified CF substrate showed more predominant in EMI SE than that deposited on CA or OA modified CF.
Sol-gel method for encapsulating molecules
Brinker, C. Jeffrey; Ashley, Carol S.; Bhatia, Rimple; Singh, Anup K.
2002-01-01
A method for encapsulating organic molecules, and in particular, biomolecules using sol-gel chemistry. A silica sol is prepared from an aqueous alkali metal silicate solution, such as a mixture of silicon dioxide and sodium or potassium oxide in water. The pH is adjusted to a suitably low value to stabilize the sol by minimizing the rate of siloxane condensation, thereby allowing storage stability of the sol prior to gelation. The organic molecules, generally in solution, is then added with the organic molecules being encapsulated in the sol matrix. After aging, either a thin film can be prepared or a gel can be formed with the encapsulated molecules. Depending upon the acid used, pH, and other processing conditions, the gelation time can be from one minute up to several days. In the method of the present invention, no alcohols are generated as by-products during the sol-gel and encapsulation steps. The organic molecules can be added at any desired pH value, where the pH value is generally chosen to achieve the desired reactivity of the organic molecules. The method of the present invention thereby presents a sufficiently mild encapsulation method to retain a significant portion of the activity of the biomolecules, compared with the activity of the biomolecules in free solution.
Measurement of nanosize etched pits in SiO2 optical fiber conduit using AFM
International Nuclear Information System (INIS)
Espinosa, G.; Golzarri, J.I.; Vazquez, C.; Fragoso, R.
2003-01-01
Fission fragment tracks from 252 Cf have been observed in SiO 2 optical fiber, using an atomic force microscope (AFM), after a very short chemical etching in hydrofluoric acid solution at normal temperature. The nuclear track starting and evolution process is followed by the AFM direct measurements on the material surface and beyond a fine layer of the surface material. The images of the scanned cones were determined observing the two predominant energies from 252 Cf fission fragments and the development of the tracks in the 150 μm diameter optical fiber conduit
76 FR 68634 - Airworthiness Directives; General Electric Company (GE) CF6 Turbofan Engines
2011-11-07
... Airworthiness Directives; General Electric Company (GE) CF6 Turbofan Engines AGENCY: Federal Aviation... ``(c) This AD applies to * * * and CF6-80A3 turbofan engines with left-hand links * * *.'' to ``(c) This AD applies to * * * and CF6-80A3 turbofan engines, including engines marked on the engine data...
Generics Pricing: The Greek Paradox.
Karafyllis, Ioannis; Variti, Lamprini
2017-01-01
This paper explains and develops a methodological framework to help evaluate the performance of generic pharmaceutical policies and the correct evaluation of generics sales. Until today erroneous recording of generics does not help proper pricing and their penetration in the Greek market. This classifies Greece on the outliners in every study or comparison that is referred on papers or studies.
24 CFR 252.2 - GNMA right to assignment.
2010-04-01
... COINSURANCE OF MORTGAGES COVERING NURSING HOMES, INTERMEDIATE CARE FACILITIES, AND BOARD AND CARE HOMES § 252... section, in order to allow an appropriate endorsement and necessary changes in the Commissioner's records...
Encapsulated microsensors for reservoir interrogation
Scott, Eddie Elmer; Aines, Roger D.; Spadaccini, Christopher M.
2016-03-08
In one general embodiment, a system includes at least one microsensor configured to detect one or more conditions of a fluidic medium of a reservoir; and a receptacle, wherein the receptacle encapsulates the at least one microsensor. In another general embodiment, a method include injecting the encapsulated at least one microsensor as recited above into a fluidic medium of a reservoir; and detecting one or more conditions of the fluidic medium of the reservoir.
OligoG CF-5/20 normalizes cystic fibrosis mucus by chelating calcium.
Ermund, Anna; Recktenwald, Christian V; Skjåk-Braek, Gudmund; Meiss, Lauren N; Onsøyen, Edvar; Rye, Philip D; Dessen, Arne; Myrset, Astrid Hilde; Hansson, Gunnar C
2017-06-01
The goal of this study was to determine whether the guluronate (G) rich alginate OligoG CF-5/20 (OligoG) could detach cystic fibrosis (CF) mucus by calcium chelation, which is also required for normal mucin unfolding. Since bicarbonate secretion is impaired in CF, leading to insufficient mucin unfolding and thereby attached mucus, and since bicarbonate has the ability to bind calcium, we hypothesized that the calcium chelating property of OligoG would lead to detachment of CF mucus. Indeed, OligoG could compete with the N-terminus of the MUC2 mucin for calcium binding as shown by microscale thermophoresis. Further, effects on mucus thickness and attachment induced by OligoG and other alginate fractions of different length and composition were evaluated in explants of CF mouse ileum mounted in horizontal Ussing-type chambers. OligoG at 1.5% caused effective detachment of CF mucus and the most potent alginate fraction tested, the poly-G fraction of about 12 residues, had similar potency compared to OligoG whereas mannuronate-rich (M) polymers had minimal effect. In conclusion, OligoG binds calcium with appropriate affinity without any overt harmful effect on the tissue and can be exploited for treating mucus stagnation. © 2017 John Wiley & Sons Australia, Ltd.
NET 40 Generics Beginner's Guide
Mukherjee, Sudipta
2012-01-01
This is a concise, practical guide that will help you learn Generics in .NET, with lots of real world and fun-to-build examples and clear explanations. It is packed with screenshots to aid your understanding of the process. This book is aimed at beginners in Generics. It assumes some working knowledge of C# , but it isn't mandatory. The following would get the most use out of the book: Newbie C# developers struggling with Generics. Experienced C++ and Java Programmers who are migrating to C# and looking for an alternative to other generic frameworks like STL and JCF would find this book handy.
Rotation and Morphology of Comet 252P/LINEAR
Woodney, Laura; Schambeau, Charles A.; Fernandez, Yanga R.
2017-10-01
Comet 252P/LINEAR had an incredibly close approach early in 2016 - minimum distance 0.036 AU on March 21 - that allowed detailed investigation of its behavior. Analysis of observations of the morphology of 252P have resulted in several possible rotational periods. Knight and Schleicher found that repetition of features in narrowband imaging from April 2016 indicated a period of 7.35 +/- 0.05 hr [1]. HST broadband data obtained by Li et al. in March and April partially fit the 7.35 hr period, but found 5.5 hr was a better fit for the April 4 r’ band data [2]. Given this discrepancy, additional observations may shed light on the true rotation state, and we present here the pieces of the puzzle obtained by our group.We observed 252P with the Kitt Peak National Observatory WIYN 0.9 m telescope on 7 nights: May 2 - 5 and June 6,8,9, 2016 using a Harris R filter. An oscillating jet is clearly visible in our data. While there is insufficient phase coverage to determine a best fit period from our data alone, we will present how our observations of the morphology fit the two proposed periods.[1] Knight, M.M and D.G. Schleicher. AAS, DPS Meeting #48, id.207.02, 2016 [2] Li, J.-Y. et al. AAS, DPS Meeting #48, id. 206.03, 2016.
Phenotype abnormality: 252 [Arabidopsis Phenome Database[Archive
Lifescience Database Archive (English)
Full Text Available lant flowering stage in environment of short day length regimen in environment of short day length regimen h... 252 http://metadb.riken.jp/db/SciNetS_ria224i/cria224u1ria224u758i delayed whole p
Encapsulation - how it will be achieved
International Nuclear Information System (INIS)
Barlow, P.
1990-01-01
The work of the new Encapsulation Plant at British Nuclear Fuel Limited's (BNFL) Sellafield site is described in this article. Intermediate-level radioactive materials are encapsulated in a cement matrix in 500 litre stainless steel drums suitable for storage, transport and disposal. The drums will be stored in an above-ground air-cooled store until UK Nirex Limited have built the planned underground disposal facility. The concept of product specification is explored as it applies to the four stages of nuclear waste management, namely, processing, storage, transport and disposal. By following this approach the encapsulation plant will work within government regulations and the public concerns over safety and environmental issues can be met. U.K
Encapsulation in the food industry: a review.
Gibbs, B F; Kermasha, S; Alli, I; Mulligan, C N
1999-05-01
Encapsulation involves the incorporation of food ingredients, enzymes, cells or other materials in small capsules. Applications for this technique have increased in the food industry since the encapsulated materials can be protected from moisture, heat or other extreme conditions, thus enhancing their stability and maintaining viability. Encapsulation in foods is also utilized to mask odours or tastes. Various techniques are employed to form the capsules, including spray drying, spray chilling or spray cooling, extrusion coating, fluidized bed coating, liposome entrapment, coacervation, inclusion complexation, centrifugal extrusion and rotational suspension separation. Each of these techniques is discussed in this review. A wide variety of foods is encapsulated--flavouring agents, acids bases, artificial sweeteners, colourants, preservatives, leavening agents, antioxidants, agents with undesirable flavours, odours and nutrients, among others. The use of encapsulation for sweeteners such as aspartame and flavours in chewing gum is well known. Fats, starches, dextrins, alginates, protein and lipid materials can be employed as encapsulating materials. Various methods exist to release the ingredients from the capsules. Release can be site-specific, stage-specific or signalled by changes in pH, temperature, irradiation or osmotic shock. In the food industry, the most common method is by solvent-activated release. The addition of water to dry beverages or cake mixes is an example. Liposomes have been applied in cheese-making, and its use in the preparation of food emulsions such as spreads, margarine and mayonnaise is a developing area. Most recent developments include the encapsulation of foods in the areas of controlled release, carrier materials, preparation methods and sweetener immobilization. New markets are being developed and current research is underway to reduce the high production costs and lack of food-grade materials.
Polycaprolactone Thin-Film Micro- and Nanoporous Cell-Encapsulation Devices.
Nyitray, Crystal E; Chang, Ryan; Faleo, Gaetano; Lance, Kevin D; Bernards, Daniel A; Tang, Qizhi; Desai, Tejal A
2015-06-23
Cell-encapsulating devices can play an important role in advancing the types of tissue available for transplantation and further improving transplant success rates. To have an effective device, encapsulated cells must remain viable, respond to external stimulus, and be protected from immune responses, and the device itself must elicit a minimal foreign body response. To address these challenges, we developed a micro- and a nanoporous thin-film cell encapsulation device from polycaprolactone (PCL), a material previously used in FDA-approved biomedical devices. The thin-film device construct allows long-term bioluminescent transfer imaging, which can be used for monitoring cell viability and device tracking. The ability to tune the microporous and nanoporous membrane allows selective protection from immune cell invasion and cytokine-mediated cell death in vitro, all while maintaining typical cell function, as demonstrated by encapsulated cells' insulin production in response to glucose stimulation. To demonstrate the ability to track, visualize, and monitor the viability of cells encapsulated in implanted thin-film devices, we encapsulated and implanted luciferase-positive MIN6 cells in allogeneic mouse models for up to 90 days. Lack of foreign body response in combination with rapid neovascularization around the device shows promise in using this technology for cell encapsulation. These devices can help elucidate the metrics required for cell encapsulation success and direct future immune-isolation therapies.
48 CFR 252.225-7016 - Restriction on acquisition of ball and roller bearings.
2010-10-01
... of ball and roller bearings. 252.225-7016 Section 252.225-7016 Federal Acquisition Regulations System... and roller bearings. As prescribed in 225.7009-5, use the following clause: Restriction on Acquisition of Ball and Roller Bearings (MAR 2006) (a) Definitions. As used in this clause' (1) Bearing...
48 CFR 252.227-7027 - Deferred ordering of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7027 Section 252.227-7027 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(b), use the following clause: Deferred Ordering of Technical Data or Computer Software (APR 1988) In addition to technical data or computer software...
48 CFR 252.227-7026 - Deferred delivery of technical data or computer software.
2010-10-01
... technical data or computer software. 252.227-7026 Section 252.227-7026 Federal Acquisition Regulations... data or computer software. As prescribed at 227.7103-8(a), use the following clause: Deferred Delivery of Technical Data or Computer Software (APR 1988) The Government shall have the right to require, at...
Boers, Sarah N; de Winter-de Groot, Karin M; Noordhoek, Jacquelien; Gulmans, Vincent; van der Ent, Cornelis K; van Delden, Johannes J M; Bredenoord, Annelien L
2018-03-06
Organoid technology enables the cultivation of human tissues in a dish. Its precision medicine potential could revolutionize the Cystic Fibrosis (CF) field. We provide a first thematic exploration of the patient perspective on organoid technology to set the further research agenda, which is necessary for responsible development of this ethically challenging technology. 23 semi-structured qualitative interviews with 14 Dutch adult CF patients and 12 parents of young CF patients to examine their experiences, opinions, and attitudes regarding organoid technology. Four themes emerged: (1) Respondents express a close as well as a distant relationship to organoids; (2) the open-endedness of organoid technology sparks hopes and concerns, (3) commercial use evokes cautiousness. (4) Respondents mention the importance of sound consent procedures, long-term patient engagement, responsible stewardship, and stringent conditions for commercial use. The precision medicine potential of organoid technology can only be realized if the patient perspective is taken adequately into account. Copyright © 2018 European Cystic Fibrosis Society. Published by Elsevier B.V. All rights reserved.
Efficient Generic Functional Programming
Alimarine, A.; Smetsers, J.E.W.
2005-01-01
Generic functions are defined by induction on the structural representation of types. As a consequence, by defining just a single generic operation, one acquires this operation over any particular data type. An instance on a specific type is generated by interpretation of the type's structure. A
Apatin, V. M.; Lokhman, V. N.; Makarov, G. N.; Ogurok, N.-D. D.; Ryabov, E. A.
2018-02-01
We report the results of research on the experimental control of CF3Br molecule clustering under gas-dynamic expansion of the CF3Br - Ar mixture at a nozzle exit by using IR laser radiation. A cw CO2 laser is used for exciting molecules and clusters in the beam and a time-of-flight mass-spectrometer with laser UV ionisation of particles for their detection. The parameters of the gas above the nozzle are determined (compositions and pressure) at which intensive molecule clustering occurs. It is found that in the case of the CF3Br gas without carrier when the pressure P0 above the nozzle does not exceed 4 atm, molecular clusters actually are not generated in the beam. If the gas mixture of CF3Br with argon is used at a pressure ratio 1 : N, where N >= 3, and the total pressure above the nozzle is P0 >= 2 atm, then there occurs molecule clustering. We study the dependences of the efficiency of suppressing the molecule clustering on parameters of the exciting pulse, gas parameters above the nozzle, and on a distance of the molecule irradiation zone from the nozzle exit section. It is shown that in the case of resonant vibrational excitation of gas-dynamically cooled CF3Br molecules at the nozzle exit one can realise isotope-selective suppression of molecule clustering with respect to bromine isotopes. With the CF3Br - Ar mixtures having the pressure ratio 1 : 3 and 1 : 15, the enrichment factors obtained with respect to bromine isotopes are kenr ≈ 1.05 ± 0.005 and kenr ≈ 1.06 ± 0.007, respectively, under jet irradiation by laser emission in the 9R(30) line (1084.635 cm-1). The results obtained let us assume that this method can be used to control clustering of molecules comprising heavy element isotopes, which have a small isotopic shift in IR absorption spectra.
Bruemmer, David J [Idaho Falls, ID; Few, Douglas A [Idaho Falls, ID
2010-09-21
The present invention provides methods, computer readable media, and apparatuses for a generic robot architecture providing a framework that is easily portable to a variety of robot platforms and is configured to provide hardware abstractions, abstractions for generic robot attributes, environment abstractions, and robot behaviors. The generic robot architecture includes a hardware abstraction level and a robot abstraction level. The hardware abstraction level is configured for developing hardware abstractions that define, monitor, and control hardware modules available on a robot platform. The robot abstraction level is configured for defining robot attributes and provides a software framework for building robot behaviors from the robot attributes. Each of the robot attributes includes hardware information from at least one hardware abstraction. In addition, each robot attribute is configured to substantially isolate the robot behaviors from the at least one hardware abstraction.
48 CFR 252.247-7017 - Erroneous shipments.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Erroneous shipments. 252... SYSTEM, DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of..., articles of personal property inadvertently packed with goods of other than the rightful owner. (2) Ensure...
Improving the care of patients with cystic fibrosis (CF)
Khan, Ahsan Aftab; Nash, Edward F; Whitehouse, Joanna; Rashid, Rifat
2017-01-01
Background The West Midlands Adult Cystic Fibrosis (CF) Centre based at Birmingham Heartlands Hospital provides care for adults with CF in the West Midlands. People with CF are prone to pulmonary exacerbations, which often require inpatient admission for intravenous antibiotics. We observed that the admission process was efficient during working hours (9:00–17:00, Monday–Friday) when the CF team are routinely available, but out-of-working hours, there were delays in these patients being clerked and receiving their first antibiotic dose. We were concerned that this was resulting in quality and potential safety issues by causing delays in starting treatment and prolonging hospital inpatient stays. We therefore undertook a quality improvement project (QIP) aimed at addressing these issues. An initial survey showed median time to clerk of 5 hours, with 60% of patients missing their first dose of antibiotics and mean length of stay of 16 days. Methods We applied the Plan-Do-Study-Act (PDSA) cycle approach, with the first PDSA cycle involving raising awareness of the issue through education to doctors, nurses and patients. Results This led to a reduction of median time to clerk from 5 to 2 hours with 23% of patients missing their first antibiotic dose and mean length of stay reducing to 14 days. The second cycle involved introducing an admissions checklist and displaying education posters around the hospital, resulting in median time to clerk remaining at 2 hours but only 20% of patients missing their first antibiotic dose and the mean length of stay remaining at 14 days. Conclusion This QIP has improved the out-of-hours admissions process for adults with CF in our centre. We plan to review the longer term effects of the project including sustainability, effects on clinical outcomes and patient satisfaction. PMID:28959778
Flat-plate solar array project. Volume 7: Module encapsulation
Cuddihy, E.; Coulbert, C.; Gupta, A.; Liang, R.
1986-01-01
The objective of the Encapsulation Task was to develop, demonstrate, and qualify photovoltaic (PV) module encapsulation systems that would provide 20 year (later decreased to 30 year) life expectancies in terrestrial environments, and which would be compatible with the cost and performance goals of the Flat-Plate Solar Array (FSA) Project. The scope of the Encapsulation Task included the identification, development, and evaluation of material systems and configurations required to support and protect the optically and electrically active solar cell circuit components in the PV module operating environment. Encapsulation material technologies summarized include the development of low cost ultraviolet protection techniques, stable low cost pottants, soiling resistant coatings, electrical isolation criteria, processes for optimum interface bonding, and analytical and experimental tools for evaluating the long term durability and structural adequacy of encapsulated modules. Field testing, accelerated stress testing, and design studies have demonstrated that encapsulation materials, processes, and configurations are available that meet the FSA cost and performance goals.
48 CFR 252.229-7004 - Status of contractors as a direct contractor (Spain).
2010-10-01
... direct contractor (Spain). 252.229-7004 Section 252.229-7004 Federal Acquisition Regulations System... contractor (Spain). As prescribed in 229.402-70(d), use the following clause: Status of Contractor as a Director Contractor (Spain) (JUN 1997) (a) “Direct Contractor,” as used in this clause, means an individual...
Californium Recovery from Palladium Wire
Energy Technology Data Exchange (ETDEWEB)
Burns, Jon D. [Oak Ridge National Lab. (ORNL), Oak Ridge, TN (United States)
2014-08-01
The recovery of 252Cf from palladium-252Cf cermet wires was investigated to determine the feasibility of implementing it into the cermet wire production operation at Oak Ridge National Laboratory’s Radiochemical Engineering Development Center. The dissolution of Pd wire in 8 M HNO3 and trace amounts of HCl was studied at both ambient and elevated temperatures. These studies showed that it took days to dissolve the wire at ambient temperature and only 2 hours at 60°C. Adjusting the ratio of the volume of solvent to the mass of the wire segment showed little change in the kinetics of dissolution, which ranged from 0.176 mL/mg down to 0.019 mL/mg. A successful chromatographic separation of 153Gd, a surrogate for 252Cf, from Pd was demonstrated using AG 50x8 cation exchange resin with a bed volume of 0.5 mL and an internal diameter of 0.8 cm.
Freitas, B M; Martins, M M; Pereira, W W; da Silva, A X; Mauricio, C L P
2016-09-01
The Brazilian Instituto de Radioproteção e Dosimetria (IRD) runs a neutron individual monitoring system with a home-made TLD albedo dosemeter. It has already been characterised and calibrated in some reference fields. However, the complete energy response of this dosemeter is not known, and the calibration factors for all monitored workplace neutron fields are difficult to be obtained experimentally. Therefore, to overcome such difficulties, Monte Carlo simulations have been used. This paper describes the simulation of the HP(10) neutron response of the IRD TLD albedo dosemeter using the MCNPX transport code, for energies from thermal to 20 MeV. The validation of the MCNPX modelling is done comparing the simulated results with the experimental measurements for ISO standard neutron fields of (241)Am-Be, (252)Cf, (241)Am-B and (252)Cf(D2O) and also for (241)Am-Be source moderated with paraffin and silicone. Bare (252)Cf are used for normalisation. © The Author 2015. Published by Oxford University Press. All rights reserved. For Permissions, please email: journals.permissions@oup.com.
Radioactive materials production
International Nuclear Information System (INIS)
Anon.
1985-01-01
The Radiochemical Processing Plant (RPP) at ORNL has served as the national repository and distribution center for 233 U for > 20 years. Several hundred kilograms of uranium, containing approximately 90 to 98% 233 U, are stored there in the form of metal, oxides, and nitrate solutions. All of these uranium materials contain small, but significant, concentrations of 232 U, ranging from 2 to 225 ppm. Most of the radioactivity associated with the 233 U comes from the decay daughters of 232 U (74-year half-life). The 252 Cf Industrial Sales/Loan Program involves loans of 252 Cf neutron sources to agencies of the US Government and sales of 252 Cf as the bulk oxide and as palladium-californium alloy pellets and wires. The program has been operated since 1968 in temporary facilities at the Savannah River Laboratory (SRL). The obsolete hot-cell facilities at SRL are now being decommissioned, and the program activities are being transferred to ORNL's Californium Facility in Bldg. 7930, which is managed by the staff of the Transuranium Processing Plant
Corrosion of Continuous Fiber Reinforced Aluminum Metal Matrix Composites (CF-AMCs)
Tiwari, Shruti
The first objective of this research is to study the atmospheric corrosion behavior of continuous reinforced aluminum matrix composites (CF-AMCs). The materials used for this research were alumina (Al2O3) and nickel (Ni) coated carbon (C) fibers reinforced AMCs. The major focus is to identify the correlation between atmospheric parameters and the corrosion rates of CF-AMCs in the multitude of microclimates and environments in Hawai'i. The micro-structures of CF-AMCs were obtained to correlate the microstructures with their corrosion performances. Also electrochemical polarization experiments were conducted in the laboratory to explain the corrosion mechanism of CF-AMCs. In addition, CF-AMCs were exposed to seven different test sites for three exposure periods. The various climatic conditions like temperature (T), relative humidity (RH), rainfall (RF), time of wetness (TOW), chloride (Cl- ) and sulfate (SO42-) deposition rate, and pH were monitored for three exposure period. Likewise, mass losses of CF-AMCs at each test site for three exposure periods were determined. The microstructure of the CF-AMCS showed that Al/C/50f MMCs contained a Ni-rich phase in the matrix, indicating that the Ni coating on the C fiber dissolved in the matrix. The intermetallic phases obtained in Al-2wt% Cu/Al 2O3/50f-T6 MMC and Al-2wt%-T6 monolith were rich in Cu and Fe. The intermetallic phases obtained in Al 7075/Al2O3/50f-T6 MMC and Al 7075-T6 monolith also contained traces of Mg, Zn, Ni, and Si. Electrochemical polarization experiment indicated that the Al/Al 2O3/50f Al-2wt% Cu/Al2O3/50f-T6 and Al 7075/Al2O3/50f-T6 MMC showed similar corrosion trends as their respective monoliths pure Al, Al-2wt%-T6 and Al 7075-T6 in both aerated and deaerated condition. Al2O3 fiber, being an insulator, did not have a great effect on the polarization behavior of the composites. Al/C/50f MMCs corroded at a much faster rate as compared to pure Al monolith due to the galvanic effect between C and Al
Performance of Deacetyled Glucomannan as Iron Encapsulation Excipient
Directory of Open Access Journals (Sweden)
Wardhani Dyah H.
2018-01-01
Full Text Available Encapsulation protects iron from degradation or oxidation possibilities due to its encapsulation material. Glucomannan (GM is a neutral polysaccharide consist of D-mannose and D-glucose connected with β-1,4 linkage. Deactylation transforms solubility of glucomannan as well as its gel structure. These properties support for excipient application. The aim of this work was to determine performance of deacetylated glucomannan as iron matrix. Deacetylation was conducted heterogeneously. Deacetylation did not change the backbone of GM. Higher alkali concentration has better ability to encapsulate iron. Extended deacetylation time and alkali concentration affect insignificantly on the performance of encapsulation to protect iron from oxidation. The release of iron from the matrix influences by deacetylation degree.
Role of excited CF3CFHO radicals in the atmospheric chemistry of HFC-134a
DEFF Research Database (Denmark)
Wallington, T.J.; Hurley, M.D.; Fracheboud, J.M.
1996-01-01
with Oz, CF3CFHO + O-2 --> CF3C(O)F + HO2, and decomposition via C-C bond scission, CF3CFHO + M --> CS3 + HC(O)F + M. CF3CFHO radicals were produced by two different reactions: either via the self-reaction of CF3CFHO2 radicals or via the CF3CFHO2 + NO reaction. It was found that decomposition was much...
42 CFR 447.506 - Authorized generic drugs.
2010-10-01
... 42 Public Health 4 2010-10-01 2010-10-01 false Authorized generic drugs. 447.506 Section 447.506... (CONTINUED) MEDICAL ASSISTANCE PROGRAMS PAYMENTS FOR SERVICES Payment for Drugs § 447.506 Authorized generic drugs. (a) Authorized generic drug defined. For the purposes of this subpart, an authorized generic drug...
48 CFR 252.237-7017 - Individual laundry.
2010-10-01
... clause: Individual Laundry (DEC 1991) (a) The Contractor shall provide laundry service under this... services. (c) Charges for individual laundry will be on a per unit bundle or a piece-rate basis. The... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Individual laundry. 252...
High throughput single-cell and multiple-cell micro-encapsulation.
Lagus, Todd P; Edd, Jon F
2012-06-15
Microfluidic encapsulation methods have been previously utilized to capture cells in picoliter-scale aqueous, monodisperse drops, providing confinement from a bulk fluid environment with applications in high throughput screening, cytometry, and mass spectrometry. We describe a method to not only encapsulate single cells, but to repeatedly capture a set number of cells (here we demonstrate one- and two-cell encapsulation) to study both isolation and the interactions between cells in groups of controlled sizes. By combining drop generation techniques with cell and particle ordering, we demonstrate controlled encapsulation of cell-sized particles for efficient, continuous encapsulation. Using an aqueous particle suspension and immiscible fluorocarbon oil, we generate aqueous drops in oil with a flow focusing nozzle. The aqueous flow rate is sufficiently high to create ordering of particles which reach the nozzle at integer multiple frequencies of the drop generation frequency, encapsulating a controlled number of cells in each drop. For representative results, 9.9 μm polystyrene particles are used as cell surrogates. This study shows a single-particle encapsulation efficiency P(k=1) of 83.7% and a double-particle encapsulation efficiency P(k=2) of 79.5% as compared to their respective Poisson efficiencies of 39.3% and 33.3%, respectively. The effect of consistent cell and particle concentration is demonstrated to be of major importance for efficient encapsulation, and dripping to jetting transitions are also addressed. Continuous media aqueous cell suspensions share a common fluid environment which allows cells to interact in parallel and also homogenizes the effects of specific cells in measurements from the media. High-throughput encapsulation of cells into picoliter-scale drops confines the samples to protect drops from cross-contamination, enable a measure of cellular diversity within samples, prevent dilution of reagents and expressed biomarkers, and amplify
Air encapsulation. I. Measurement in a field soil
International Nuclear Information System (INIS)
Fayer, M.J.; Hillel, D.
1986-01-01
Encapsulated air is an important component of shallow water table fluctuations. Their objective was to measure the quantity and persistence of encapsulated air in a field setting. Using sprinkling rates of either 3.5 x 10 -6 or 3.8 x 10 -5 m s -1 , they brought the water table in a field soil from a depth of 1.5 m to the surface on several occasions. Moisture contents during and after sprinkling were monitored with a neutron probe. Twice following sprinkling, the water table was maintained at the surface for more than 20 d, during which time they continued to monitor moisture contents. With the water table at the surface, differences between the porosity and the measured moisture content were attributed to encapsulated air. Encapsulated air contents ranged from 1.1 to 6.3% of the bulk soil volume, depending on the rate of sprinkling, soil depth, and initial soil moisture content. During ponding, encapsulated air persisted at the 0.3-m depth for up to 28 d. The results indicate that encapsulated air is measurable in a field situation and that its quantity and persistence should be considered in analyzing the results of similar field experiments. 16 references
CF3SF5 : a ‘super’ greenhouse gas
Tuckett, R. P.
2008-01-01
One molecule of the anthropogenic pollutant trifluoromethyl sulphur pentafluoride (CF\\(_3\\)SF\\(_5\\)), an adduct of the CF\\(_3\\) and SF\\(_5\\) free radicals, causes more global warming than one molecule of any other greenhouse gas yet detected in the Earth’s atmosphere. That is, it has the highest per molecule radiative forcing of any greenhouse pollutant, and the value of its global warming potential is only exceeded by that of SF\\(_6\\). First, the greenhouse effect is described, the propertie...
Generic phytosanitary irradiation treatments
International Nuclear Information System (INIS)
Hallman, Guy J.
2012-01-01
The history of the development of generic phytosanitary irradiation (PI) treatments is discussed beginning with its initial proposal in 1986. Generic PI treatments in use today are 150 Gy for all hosts of Tephritidae, 250 Gy for all arthropods on mango and papaya shipped from Australia to New Zealand, 300 Gy for all arthropods on mango shipped from Australia to Malaysia, 350 Gy for all arthropods on lychee shipped from Australia to New Zealand and 400 Gy for all hosts of insects other than pupae and adult Lepidoptera shipped to the United States. Efforts to develop additional generic PI treatments and reduce the dose for the 400 Gy treatment are ongoing with a broad based 5-year, 12-nation cooperative research project coordinated by the joint Food and Agricultural Organization/International Atomic Energy Agency Program on Nuclear Techniques in Food and Agriculture. Key groups identified for further development of generic PI treatments are Lepidoptera (eggs and larvae), mealybugs and scale insects. A dose of 250 Gy may suffice for these three groups plus others, such as thrips, weevils and whiteflies. - Highlights: ► The history of phytosanitary irradiation (PI) treatments is given. ► Generic PI treatments in use today are discussed. ► Suggestions for future research are presented. ► A dose of 250 Gy for most insects may suffice.
Yields of fission products produced by thermal-neutron fission of 249Cf
International Nuclear Information System (INIS)
Dickens, J.K.; McConnell, J.W.
1981-01-01
Absolute yields have been determined for 107 gamma rays emitted in the decay of 97 fission products representing 54 mass chains created during thermal-neutron fission of 249 Cf. These results include 14 mass chains for which no prior yield data exist. Using a Ge(Li) detector, spectra were obtained of gamma rays emanating from a 0.4 μg sample of 249 Cf between 45 s and 0.4 yr after very short irradiations of the 249 Cf by thermal neutrons. On the basis of measured gamma-ray yields and known nuclear data, total chain mass yields and relative uncertainties were obtained for 51 masses between 89 and 156. The absolute overall normalization uncertainty is approx.8%. The measured A-chain cumulative yields make up 77% of the total light mass (A 249 Cf
A formulation to encapsulate nootkatone for tick control.
Behle, Robert W; Flor-Weiler, Lina B; Bharadwaj, Anuja; Stafford, Kirby C
2011-11-01
Nootkatone is a component of grapefruit oil that is toxic to the disease-vectoring tick, Ixodes scapularis Say, but unfortunately causes phytotoxicity to treated plants and has a short residual activity due to volatility. We prepared a lignin-encapsulated nootkatone formulation to compare with a previously used emulsifiable formulation for volatility, plant phytotoxicity, and toxicity to unfed nymphs of I. scapularis. Volatility of nootkatone was measured directly by trapping nootkatone vapor in a closed system and indirectly by measuring nootkatone residue on treated filter paper after exposure to simulated sunlight (Xenon). After 24 h in the closed system, traps collected only 15% of the nootkatone applied as the encapsulated formulation compared with 40% applied as the emulsifiable formulation. After a 1-h light exposure, the encapsulated formulation retained 92% of the nootkatone concentration compared with only 26% retained by the emulsifiable formulation. For plant phytotoxicity, cabbage, Brassica oleracea L., leaves treated with the encapsulated formulation expressed less necrosis, retaining greater leaf weight compared with leaves treated with the emusifiable formulation. The nootkatone in the emulsifiable formulation was absorbed by cabbage and oat, Avena sativa L., plants (41 and 60% recovered 2 h after application, respectively), as opposed to 100% recovery from the plants treated with encapsulated nootkatone. Using a treated vial technique, encapsulated nootkatone was significantly more toxic to I. scapularis nymphs (LC50 = 20 ng/cm2) compared with toxicity of the emulsifiable formulation (LC50 = 35 ng/cm2). Thus, the encapsulation of nootkatone improved toxicity for tick control, reduced nootkatone volatility, and reduced plant phytotoxicity.
235Cf anti ν discrepancy and the sulfur discrepancy
International Nuclear Information System (INIS)
Smith, J.R.
1979-01-01
The cantankerous discrepancy among measured values of anti ν for 235 Cf appears at last to be nearing a final resolution. A recent review has summarized the progress that has been achieved through revaluation upward by 0.5% of two manganese bath values anti ν and the performance of a new liquid scintillator measurement. A new manganese bath measurement at INEL is in reasonably good agreement with previous manganese bath values of 235 Cf anti ν. It now appears that the manganese bath values could still be systematically low by as much as 0.4% because the BNL-325 thermal absorption cross section for sulfur may be as much as 10% low. There is a bona fide discrepancy between measurements of the sulfur cross section by pile oscillators and the values derived from transmission measurements. The resolution of this discrepancy is a prerequisite to the final resolution of the 235 Cf anti ν discrepancy. 22 references
Determinants of generic drug substitution in Switzerland
Directory of Open Access Journals (Sweden)
Lufkin Thomas M
2011-01-01
Full Text Available Abstract Background Since generic drugs have the same therapeutic effect as the original formulation but at generally lower costs, their use should be more heavily promoted. However, a considerable number of barriers to their wider use have been observed in many countries. The present study examines the influence of patients, physicians and certain characteristics of the generics' market on generic substitution in Switzerland. Methods We used reimbursement claims' data submitted to a large health insurer by insured individuals living in one of Switzerland's three linguistic regions during 2003. All dispensed drugs studied here were substitutable. The outcome (use of a generic or not was modelled by logistic regression, adjusted for patients' characteristics (gender, age, treatment complexity, substitution groups and with several variables describing reimbursement incentives (deductible, co-payments and the generics' market (prices, packaging, co-branded original, number of available generics, etc.. Results The overall generics' substitution rate for 173,212 dispensed prescriptions was 31%, though this varied considerably across cantons. Poor health status (older patients, complex treatments was associated with lower generic use. Higher rates were associated with higher out-of-pocket costs, greater price differences between the original and the generic, and with the number of generics on the market, while reformulation and repackaging were associated with lower rates. The substitution rate was 13% lower among hospital physicians. The adoption of the prescribing practices of the canton with the highest substitution rate would increase substitution in other cantons to as much as 26%. Conclusions Patient health status explained a part of the reluctance to substitute an original formulation by a generic. Economic incentives were efficient, but with a moderate global effect. The huge interregional differences indicated that prescribing behaviours and
A neutron irradiator applied to cancer treatment
International Nuclear Information System (INIS)
Campos, Tarcisio P.R.; Andrade, Ana P. de
2000-01-01
Cancer and the way of treating it with neutron capture therapy are addressed. This paper discusses also the type of neutron facilities used to treat cancer around the world, as follow: discrete neutron sources, accelerators, and nuclear reactors. The major features of an epithermal neutron irradiation facility applied to BNCT treatment are addressed. The main goal is to give another choice of neutron irradiators to be set in a hospital. The irradiation facility embeds a set of 252 Cf neutron source coupled with a homogeneous mixture of uranium-zirconium hydride alloy containing 8.4 wt % uranium enriched to 20% U 235 . The facility delivers an epithermal neutron beam with low background of fast neutron and gamma rays. The N particle transport code (MCNP-4A) has been used during the simulation in order to achieve the desired configurations and to estimate the multiplication factor, k eff . The present facility loaded with 30 mg of 252 Cf neutron source generates an external beam with an intensity of 10 7 n/cm 2 .s on the spectrum of 4 eV to 40 KeV. The 252 Cf - facility coupled with fissile material was able to amplify the epithermal flux to 10 8 n/cm 2 .s, maintaining the figure-of-merits represented by the ratios of the fast dose and gamma dose in air per epithermal neutron flux closed to those values presented by BMRR, MITR-II and Petten Reactor. The medical irradiation facility loaded with 252 Cf- 235 U can be a choice for BNCT. (author)
Characterization of human exposure to mineral sands dust in a brazilian village
International Nuclear Information System (INIS)
Cunha, K. Dias da; Santos, M.S.; Medeiros, G.; Dalia, K.C.; Lima, C.; Leite, Barros C. V.
2008-01-01
The aim of this study was to characterize human exposure to mineral dust particles using PIXE (Particle Induced X rays Emission) and 252 Cf-PDMS (Plasma Desorption Mass Spectrometry) techniques. The dust particles were generated during the separation process of mineral sands to obtain rutile, ilmenite, zircon and monazite concentrates. The aerosol samples were collected at the village and during the process to concentrate ilmenite. A cascade impactor with six stages was used to collect mineral dust particles with aerodynamic diameter in the range of 0.64 to 19.4 μm. The particles impacted on each stage of the cascade impactor were analyzed by PIXE (Particle Induced X ray Emission) and the elemental mass concentration and the MMAD (Mass Median Aerodynamic Diameter) were determined. Employing the 252 Cf-PDMS technique the chemical compound present in aerosols particles and in urine samples were identified. The mass spectra ( 252 Cf-PDMS technique) of dust samples showed the presence of the thorium silicate, thorite and zircon in the fine fraction of aerosol. The 252 Cf-PDMS technique was, also, used to characterize urine sample from a inhabitant of the village. The results show that Buena village inhabitants inhale mineral sands dust particles. Based on the results from the lichen samples it could be concluded that at least during the last 15 years the inhabitants of the village have been exposed to monazite particles. Results suggest that the there is natural source of aerosol particles containing 226 Ra and 210 Pb (probably the swamp) besides the mineral sands dust. (author)
International Nuclear Information System (INIS)
Bossio, M.C.; Muniz, C.C.
2009-01-01
This paper analyzes the Generic Clearance Values established for natural and artificial radionuclides with the objective of evaluating their degree of conservatism in views of adopting them into the regulatory body. Generic clearance values for natural radionuclides have been chosen by experts judgments as the optimum boundary between, on one hand, the ubiquitous unmodified soil concentrations and, on the other hand, activity concentrations in ores, mineral sands, industrial residues and wastes. For artificial radionuclides the clearance levels have been derived from the scenarios postulated in the document 'Safety Reports Series Nr 44' of the IAEA considering quantitative exemption criteria. A set of 8 scenarios were postulated covering external, ingestion and inhalation exposure pathways. For each radionuclide, the generic clearance level was derived as the more restrictive value obtained from the scenarios, that is the lowest ratio between the applicable individual dose and the dose per unit activity concentration (Bq/g). The individual dose was calculated by a formula depending on each scenario and pathway, with different parameters, such as exposure time, dosimetric factors, dilution factor, density of the material, geometric factors, etc. It was concluded that the basis and parameters used for the derivation of the generic clearance levels are quite conservative and therefore its the adoption in Argentina has been recommended. It is expected that their implementation will contribute to optimize the regulatory management system. (author)
International Nuclear Information System (INIS)
Bossio, M.C.; Muniz, C.C.
2010-01-01
This paper analyzes the Generic Clearance Values established for natural and artificial radionuclides with the objective of evaluating their degree of conservatism in views of adopting them into the regulatory body. Generic clearance values for natural radionuclides have been chosen by experts judgments as the optimum boundary between, on the one hand, the ubiquitous unmodified soil concentrations and, on the other hand, activity concentrations in ores, mineral sands, industrial residues and wastes. For artificial radionuclides the clearance levels have been derived from the scenarios postulated in the document Safety Reports Series 44 of the IAEA considering quantitative exemption criteria. A set of 8 scenarios were postulated covering external, ingestion and inhalation exposure pathways. For each radionuclide, the generic clearance level was derived as the more restrictive value obtained from the scenarios, that is the lowest ratio between the applicable individual dose and the dose per unit activity concentration (Bq/g). The individual dose was calculated by a formula depending on each scenario and pathway, with different parameters, such as exposure time, dosimetric factors, dilution factor, density of the material, geometric factors, etc. It was concluded that the basis and parameters used for the derivation of the generic clearance levels are quite conservative and therefore its the adoption in Argentina has been recommended. It is expected that their implementation will contribute to optimize the regulatory management system. (authors) [es
Encapsulation of gold nanoparticles into self-assembling protein nanoparticles
Directory of Open Access Journals (Sweden)
Yang Yongkun
2012-10-01
Full Text Available Abstract Background Gold nanoparticles are useful tools for biological applications due to their attractive physical and chemical properties. Their applications can be further expanded when they are functionalized with biological molecules. The biological molecules not only provide the interfaces for interactions between nanoparticles and biological environment, but also contribute their biological functions to the nanoparticles. Therefore, we used self-assembling protein nanoparticles (SAPNs to encapsulate gold nanoparticles. The protein nanoparticles are formed upon self-assembly of a protein chain that is composed of a pentameric coiled-coil domain at the N-terminus and trimeric coiled-coil domain at the C-terminus. The self-assembling protein nanoparticles form a central cavity of about 10 nm in size, which is ideal for the encapsulation of gold nanoparticles with similar sizes. Results We have used SAPNs to encapsulate several commercially available gold nanoparticles. The hydrodynamic size and the surface coating of gold nanoparticles are two important factors influencing successful encapsulation by the SAPNs. Gold nanoparticles with a hydrodynamic size of less than 15 nm can successfully be encapsulated. Gold nanoparticles with citrate coating appear to have stronger interactions with the proteins, which can interfere with the formation of regular protein nanoparticles. Upon encapsulation gold nanoparticles with polymer coating interfere less strongly with the ability of the SAPNs to assemble into nanoparticles. Although the central cavity of the SAPNs carries an overall charge, the electrostatic interaction appears to be less critical for the efficient encapsulation of gold nanoparticles into the protein nanoparticles. Conclusions The SAPNs can be used to encapsulate gold nanoparticles. The SAPNs can be further functionalized by engineering functional peptides or proteins to either their N- or C-termini. Therefore encapsulation of gold
Etching properties of BLT films in CF4/Ar plasma
International Nuclear Information System (INIS)
Kim, Dong Pyo; Kim, Kyoung Tae; Kim, Chang Il
2003-01-01
CF 4 /Ar plasma mass content and etching rate behavior of BLT thin films were investigated in inductively coupled plasma (ICP) reactor as functions of CF 4 /Ar gas mixing ratio, rf power, and dc bias voltage. The variation of relative volume densities for F and Ar atoms were measured by the optical emission spectroscopy (OES). The etching rate as functions of Ar content showed the maximum of 803 A/min at 80 % Ar addition into CF 4 plasma. The presence of maximum etch rate may be explained by the concurrence of two etching mechanisms such as physical sputtering and chemical reaction. The role of Ar ion bombardment includes destruction of metal (Bi, La, Ti)-O bonds as well as support of chemical reaction of metals with fluorine atoms
Source storage and transfer cask: Users Guide
International Nuclear Information System (INIS)
Eccleston, G.W.; Speir, L.G.; Garcia, D.C.
1985-04-01
The storage and shield cask for the dual californium source is designed to shield and transport up to 3.7 mg (2 Ci) of 252 Cf. the cask meets Department of Transportation (DOT) license requirements for Type A materials (DOT-7A). The cask is designed to transfer sources to and from the Flourinel and Fuel Storage (FAST) facility delayed-neutron interrogator. Californium sources placed in the cask must be encapsulated in the SR-CF-100 package and attached to Teleflex cables. The cask contains two source locations. Each location contains a gear box that allows a Teleflex cable to be remotely moved by a hand crank into and out of the cask. This transfer procedure permits sources to be easily removed and inserted into the delayed-neutron interrogator and reduces personnel radiation exposure during transfer. The radiation dose rate with the maximum allowable quantity of californium (3.7 mg) in the cask is 30 mR/h at the surface and less than 2 mR/h 1 m from the cask surface. This manual contains information about the cask, californium sources, describes the method to ship the cask, and how to insert and remove sources from the cask. 28 figs
Gladstone-Dale constant for CF4. [experimental design
Burner, A. W., Jr.; Goad, W. K.
1980-01-01
The Gladstone-Dale constant, which relates the refractive index to density, was measured for CF4 by counting fringes of a two-beam interferometer, one beam of which passes through a cell containing the test gas. The experimental approach and sources of systematic and imprecision errors are discussed. The constant for CF4 was measured at several wavelengths in the visible region of the spectrum. A value of 0.122 cu cm/g with an uncertainty of plus or minus 0.001 cu cm/g was determined for use in the visible region. A procedure for noting the departure of the gas density from the ideal-gas law is discussed.
48 CFR 252.225-7045 - Balance of Payments Program-Construction Material Under Trade Agreements.
2010-10-01
.... Designated country means— (1) A World Trade Organization Government Procurement Agreement (WTO GPA) country... another country, has been substantially transformed in a Free Trade Agreement country into a new and... Program-Construction Material Under Trade Agreements. 252.225-7045 Section 252.225-7045 Federal...
Generic phytosanitary irradiation treatments
Energy Technology Data Exchange (ETDEWEB)
Hallman, Guy J [United States Department of Agriculture, Agricultural Research Service, Weslaco, TX (United States)
2013-01-15
The history of the development of generic phytosanitary irradiation (PI) treatments is discussed beginning with its initial proposal in 1986. Generic PI treatments in use today are 150 Gy for all hosts of Tephritidae, 250 Gy for all arthropods on mango and papaya shipped from Australia to New Zealand, 300 Gy for all arthropods on mango shipped from Australia to Malaysia, 350 Gy for all arthropods on lychee shipped from Australia to New Zealand and 400 Gy for all hosts of insects other than pupae and adult Lepidoptera shipped to the United States. Efforts to develop additional generic PI treatments and reduce the dose for the 400 Gy treatment are ongoing with a broad based 5-year, 12-nation cooperative research project coordinated by the joint Food and Agricultural Organization/International Atomic Energy Agency Program on Nuclear Techniques in Food and Agriculture. Key groups identified for further development of generic PI treatments are Lepidoptera (eggs and larvae), mealybugs and scale insects. A dose of 250 Gy may suffice for these three groups plus others, such as thrips, weevils and whiteflies. (author)
Generic phytosanitary irradiation treatments
Hallman, Guy J.
2012-07-01
The history of the development of generic phytosanitary irradiation (PI) treatments is discussed beginning with its initial proposal in 1986. Generic PI treatments in use today are 150 Gy for all hosts of Tephritidae, 250 Gy for all arthropods on mango and papaya shipped from Australia to New Zealand, 300 Gy for all arthropods on mango shipped from Australia to Malaysia, 350 Gy for all arthropods on lychee shipped from Australia to New Zealand and 400 Gy for all hosts of insects other than pupae and adult Lepidoptera shipped to the United States. Efforts to develop additional generic PI treatments and reduce the dose for the 400 Gy treatment are ongoing with a broad based 5-year, 12-nation cooperative research project coordinated by the joint Food and Agricultural Organization/International Atomic Energy Agency Program on Nuclear Techniques in Food and Agriculture. Key groups identified for further development of generic PI treatments are Lepidoptera (eggs and larvae), mealybugs and scale insects. A dose of 250 Gy may suffice for these three groups plus others, such as thrips, weevils and whiteflies.
Encapsulation of electroless copper patterns into diamond films
Energy Technology Data Exchange (ETDEWEB)
Pimenov, S.M.; Shafeev, G.A.; Lavrischev, S.V. [General Physics Institute, Moscow (Russian Federation)] [and others
1995-12-31
The results are reported on encapsulating copper lines into diamond films grown by a DC plasma CVD. The process includes the steps of (i) laser activation of diamond for electroless metal plating, (ii) electroless copper deposition selectively onto the activated surface regions, and (iii) diamond regrowth on the Cu-patterned diamond films. The composition and electrical properties of the encapsulated copper lines were examined, revealing high purity and low electrical resistivity of the encapsulated electroless copper.
Indian Academy of Sciences (India)
First page Back Continue Last page Overview Graphics. Generic Advantages. Scalability an incremental coverage. Standardization. Business Plan Flexibility. Lifecycle Flexibility. Reliability. Service Interoperability. Changed Industry dynamics.
DWH MC 252: Subsurface Oil Transport
Beegle-Krause, C. J.; Boyer, T.; Murray, D.
2010-12-01
Before reaching the ocean surface, the oil and gas released from the DWH MC 252 blowout at 1500 m moves as a buoyant plume until the trapping depth and plume transition point are reached (Zheng et al 2002). At the transition point, the oil droplets and bubbles move independently of each other, and rise at a rate related to their diameter. The oil density, droplet size distribution and currents primarily determine the distribution of the oil between: Large droplets that rise quickly and create a surface expression of the oil. Moderate size droplets that rise over the course of days, and so spread out quite differently than the surface oil, and commonly do not reach the surface in large enough quantities to create a surface sheen. These droplets separate in the currents, particularly in the strong current shear in upper 500 m currents. Very tiny droplets that rise very slowly, over the course or weeks to months, and may be removed by dissolution, biodegradation or marine snow before ever reaching the surface. Modeling and observations (Joint Analysis Group, 2010) confirm the presence of a deep layer of oil and gas between approximately 1100 and 1300 m over the release location and spreading out along the isopycnal surfaces. Later in the event, a small oxygen depression was a proxy for where oil and gas had been. The DWH MC252 well is located at intermediate depth in the Gulf of Mexico (GoM). The water mass is Antarctic Intermediate Water, which enters and exits the GoM through the Yucatan Straits. Surface influences, such as Loop Current Frontal Eddies (e.g. Berger et al 2000) can reach down to these depths, and alter the flow within De Soto Canyon. The water mass containing the deep layer of oil droplets changes depth within the GoM, but does not reach above a depth of about 900 m. There are no physical processes that could cause this deep layer of oil to reach the continental shelf or the Florida Straits. Observed and historical hydrographic data, observations
Symposium on fast atom and ion induced mass spectrometry of nonvolatile organic solids
International Nuclear Information System (INIS)
McNeal, C.J.
1982-01-01
The mechanisms of molecular and fragment ion production and the various parameters affecting ion yields were discussed by 6 invited speakers from Europe, Canada, and the US at this symposium. The work reported was almost equally divided between that using low-energy (keV) primary ion (or atom) beams, e.g. fast atom bombardment mass spectrometry (FABMS) and secondary ion mass spectrometry (SIMS) and that using high energy (MeV) particles, e.g. heavy ion induced mass spectrometry (HIIDMS) and 252 Cf-plasma desorption mass spectrometry ( 252 Cf-PDMS). Both theoretical foundations and observed experimental results for both techniques are included
Encapsulation of iron nanoparticles in alginate biopolymer for trichloroethylene remediation
International Nuclear Information System (INIS)
Bezbaruah, Achintya N.; Shanbhogue, Sai Sharanya; Simsek, Senay; Khan, Eakalak
2011-01-01
Nanoscale zero-valent iron (NZVI) particles (10–90 nm) were encapsulated in biodegradable calcium-alginate capsules for the first time for application in environmental remediation. Encapsulation is expected to offers distinct advances over entrapment. Trichloroethylene (TCE) degradation was 89–91% in 2 h, and the reaction followed pseudo first order kinetics for encapsulated NZVI systems with an observed reaction rate constant (k obs ) of 1.92–3.23 × 10 −2 min −1 and a surface normalized reaction rate constant (k sa ) of 1.02–1.72 × 10 −3 L m −2 min −1 . TCE degradation reaction rates for encapsulated and bare NZVI were similar indicating no adverse affects of encapsulation on degradation kinetics. The shelf-life of encapsulated NZVI was found to be four months with little decrease in TCE removal efficiency.
Generic penetration in the retail antidepressant market.
Ventimiglia, Jeffrey; Kalali, Amir H
2010-06-01
In this article, we explore the accelerated penetration of generic antidepressants in the United States market following the availability of generic citalopram and sertraline. Analysis suggests that overall, generic penetration into the antidepressant market has grown from approximately 41 percent in January 2004 to over 73 percent in January 2010. Similar trends are uncovered when branded and generic prescriptions are analyzed by specialty.
Tereshchenko, D. S.; Morozov, I. V.; Boltalin, A. I.; Karpova, E. V.; Glazunova, T. Yu.; Troyanov, S. I.
2013-01-01
A series of fluoro(trifluoroacetato)metallates were synthesized by crystallization from solutions in trifluoroacetic acid containing nickel(II) or cobalt(II) nitrate hydrates and alkali metal or ammonium fluorides: Li[Ni3(μ3-F)(CF3COO)6(CF3COOH)3](CF3COOH)3 ( I), M'[Ni3(μ3-F)(CF3COO)6(CF3COOH)3] ( M' = Na ( II), NH4 ( IV), Rb ( V), and Cs ( VI)), NH4[Co3(μ3-F) (CF3COO)6(CF3COOH)3] ( III), and Cs[Ni3(μ3-F)(CF3COO)6(CF3COOH)3](CF3COOH)0.5 ( VII). The crystal structures of these compounds were determined by single-crystal X-ray diffraction. All structures contain triangular trinuclear complex anions [ M 3″(μ3-F)(CF3COO)6(CF3COOH)3]- ( M″ = Ni, Co) structurally similar to trinuclear 3d metal oxo carboxylate complexes. The three-coordinated F atom is located at the center of the triangle formed by Ni(II) or Co(II) atoms. The metal atoms are linked in pairs by six bridging trifluoroacetate groups located above and below the plane of the [ M″3 F] triangle. The oxygen atoms of the axial CF3COOH molecules complete the coordination environment of M″ atoms to an octahedron.
46 CFR 252.40 - Payment of subsidy.
2010-10-01
... Payment and Billing Procedures § 252.40 Payment of subsidy. (a) Submission of voucher. At the close of each calendar month, the subsidized operator may submit a voucher, and include for payment in such... submit an initial voucher and include for payment in such voucher a percentage of the ODS payable for the...
48 CFR 252.227-7005 - License term.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false License term. 252.227-7005..., DEPARTMENT OF DEFENSE CLAUSES AND FORMS SOLICITATION PROVISIONS AND CONTRACT CLAUSES Text of Provisions And... referred to in the “License Grant” clause of this contract and any and all patents hereafter issued on...
Critical factors affecting cell encapsulation in superporous hydrogels
International Nuclear Information System (INIS)
Desai, Esha S; Tang, Mary Y; Gemeinhart, Richard A; Ross, Amy E
2012-01-01
We recently showed that superporous hydrogel (SPH) scaffolds promote long-term stem cell viability and cell driven mineralization when cells were seeded within the pores of pre-fabricated SPH scaffolds. The possibility of cell encapsulation within the SPH matrix during its fabrication was further explored in this study. The impact of each chemical component used in SPH fabrication and each step of the fabrication process on cell viability was systematically examined. Ammonium persulfate, an initiator, and sodium bicarbonate, the gas-generating compound, were the two components having significant toxicity toward encapsulated cells at the concentrations necessary for SPH fabrication. Cell survival rates were 55.7% ± 19.3% and 88.8% ± 9.4% after 10 min exposure to ammonium persulfate and sodium bicarbonate solutions, respectively. In addition, solution pH change via the addition of sodium bicarbonate had significant toxicity toward encapsulated cells with cell survival of only 50.3% ± 2.5%. Despite toxicity of chemical components and the SPH fabrication method, cells still exhibited significant overall survival rates within SPHs of 81.2% ± 6.8% and 67.0% ± 0.9%, respectively, 48 and 72 h after encapsulation. This method of cell encapsulation holds promise for use in vitro and in vivo as a scaffold material for both hydrogel matrix encapsulation and cell seeding within the pores. (paper)
A restructuring of CF package for MIDAS computer code
International Nuclear Information System (INIS)
Park, S. H.; Kim, K. R.; Kim, D. H.; Cho, S. W.
2004-01-01
CF package, which evaluates user-specified 'control functions' and applies them to define or control various aspects of computation, has been restructured for the MIDAS computer code. MIDAS is being developed as an integrated severe accident analysis code with a user-friendly graphical user interface and modernized data structure. To do this, data transferring methods of current MELCOR code are modified and adopted into the CF package. The data structure of the current MELCOR code using FORTRAN77 causes a difficult grasping of meaning of the variables as well as waste of memory, difficulty is more over because its data is location information of other package's data due to characteristics of CF package. New features of FORTRAN90 make it possible to allocate the storage dynamically and to use the user-defined data type, which lead to an efficient memory treatment and an easy understanding of the code. Restructuring of the CF package addressed in this paper includes module development, subroutine modification, and treats MELGEN, which generates data file, as well as MELCOR, which is processing a calculation. The verification has been done by comparing the results of the modified code with those from the existing code. As the trends are similar to each other, it hints that the same approach could be extended to the entire code package. It is expected that code restructuring will accelerate the code domestication thanks to direct understanding of each variable and easy implementation of modified or newly developed models
Sclerosing encapsulating peritonitis: a case report
Energy Technology Data Exchange (ETDEWEB)
Candido, Paula de Castro Menezes; Werner, Andrea de Freitas; Pereira, Izabela Machado Flores; Matos, Breno Assuncao; Pfeilsticker, Rudolf Moreira; Silva Filho, Raul, E-mail: paulacmcandido@yahoo.com.br [Hospital Felicio Rocho, Belo Horizonte, MG (Brazil)
2015-01-15
Sclerosing encapsulating peritonitis, a rare cause of bowel obstruction, was described as a complication associated with peritoneal dialysis which is much feared because of its severity. The authors report a case where radiological findings in association with clinical symptoms have allowed for a noninvasive diagnosis of sclerosing encapsulating peritonitis, emphasizing the high sensitivity and specificity of computed tomography to demonstrate the characteristic findings of such a condition. (author)
FEM Simulation of Influence of Protective Encapsulation on MEMS Pressure Sensor
DEFF Research Database (Denmark)
Yao, Qingshan; Janting, Jakob; Branebjerg, Jens
2003-01-01
The objective of the work is to evaluate the feasibility of packaging a MEMS silicon pressure sensor by using either a polymer encapsulation or a combination of a polymer encapsulation and a metallic protection Membrane (fig. 1). The potential application of the protected sensor is for harsh...... environments. Several steps of simulation are carried out:1) Comparisons of the sensitivities are made among the non-encapsulated silicon sensor, the polymer encapsulated and polymer with metal encapsulated sensor. This is for evaluating whether the encapsulating materials reduce the pressure sensitivity...... whether the metallic membrane / coating will peel off when applying the maximum pressure, which is 4000 bar leading to high shear stress between the metallic membrane and the polymer encapsulation material.3) Thermal calculations are made to evaluate the influence of the environment on the packaged sensor...
A simple encapsulation method for organic optoelectronic devices
International Nuclear Information System (INIS)
Sun Qian-Qian; An Qiao-Shi; Zhang Fu-Jun
2014-01-01
The performances of organic optoelectronic devices, such as organic light emitting diodes and polymer solar cells, have rapidly improved in the past decade. The stability of an organic optoelectronic device has become a key problem for further development. In this paper, we report one simple encapsulation method for organic optoelectronic devices with a parafilm, based on ternary polymer solar cells (PSCs). The power conversion efficiencies (PCE) of PSCs with and without encapsulation decrease from 2.93% to 2.17% and from 2.87% to 1.16% after 168-hours of degradation under an ambient environment, respectively. The stability of PSCs could be enhanced by encapsulation with a parafilm. The encapsulation method is a competitive choice for organic optoelectronic devices, owing to its low cost and compatibility with flexible devices. (atomic and molecular physics)
A quantitative method for photovoltaic encapsulation system optimization
Garcia, A., III; Minning, C. P.; Cuddihy, E. F.
1981-01-01
It is pointed out that the design of encapsulation systems for flat plate photovoltaic modules requires the fulfillment of conflicting design requirements. An investigation was conducted with the objective to find an approach which will make it possible to determine a system with optimum characteristics. The results of the thermal, optical, structural, and electrical isolation analyses performed in the investigation indicate the major factors in the design of terrestrial photovoltaic modules. For defect-free materials, minimum encapsulation thicknesses are determined primarily by structural considerations. Cell temperature is not strongly affected by encapsulant thickness or thermal conductivity. The emissivity of module surfaces exerts a significant influence on cell temperature. Encapsulants should be elastomeric, and ribs are required on substrate modules. Aluminum is unsuitable as a substrate material. Antireflection coating is required on cell surfaces.
48 CFR 252.225-7023 - Preference for products or services from Iraq or Afghanistan.
2010-10-01
... services from Iraq or Afghanistan. 252.225-7023 Section 252.225-7023 Federal Acquisition Regulations System... from Iraq or Afghanistan. As prescribed in 225.7703-5(a), use the following provision: Requirement for Products or Services from Iraq or Afghanistan (APR 2010) (a) Definitions. Product from Iraq or Afghanistan...
Process engineering of high voltage alginate encapsulation of mesenchymal stem cells
International Nuclear Information System (INIS)
Gryshkov, Oleksandr; Pogozhykh, Denys; Zernetsch, Holger; Hofmann, Nicola; Mueller, Thomas; Glasmacher, Birgit
2014-01-01
Encapsulation of stem cells in alginate beads is promising as a sophisticated drug delivery system in treatment of a wide range of acute and chronic diseases. However, common use of air flow encapsulation of cells in alginate beads fails to produce beads with narrow size distribution, intact spherical structure and controllable sizes that can be scaled up. Here we show that high voltage encapsulation (≥ 15 kV) can be used to reproducibly generate spherical alginate beads (200–400 μm) with narrow size distribution (± 5–7%) in a controlled manner under optimized process parameters. Flow rate of alginate solution ranged from 0.5 to 10 ml/h allowed producing alginate beads with a size of 320 and 350 μm respectively, suggesting that this approach can be scaled up. Moreover, we found that applied voltages (15–25 kV) did not alter the viability and proliferation of encapsulated mesenchymal stem cells post-encapsulation and cryopreservation as compared to air flow. We are the first who employed a comparative analysis of electro-spraying and air flow encapsulation to study the effect of high voltage on alginate encapsulated cells. This report provides background in application of high voltage to encapsulate living cells for further medical purposes. Long-term comparison and work on alginate–cell interaction within these structures will be forthcoming. - Highlights: • High voltage alginate encapsulation of mesenchymal stem cells (MSCs) was designed. • Reproducible and spherical alginate beads were generated via high voltage. • Air flow encapsulation was utilized as a comparative approach to high voltage. • High voltage did not alter the viability and proliferation of encapsulated MSCs. • High voltage encapsulation can be scaled up and applied in cell-based therapy
48 CFR 252.225-7020 - Trade Agreements Certificate.
2010-10-01
... 48 Federal Acquisition Regulations System 3 2010-10-01 2010-10-01 false Trade Agreements... of Provisions And Clauses 252.225-7020 Trade Agreements Certificate. As prescribed in 225.1101(5), use the following provision: Trade Agreements Certificate (JAN 2005) (a) Definitions. Designated...
Reactions of CF3O radicals with selected alkenes and aromatics under atmospheric conditions
DEFF Research Database (Denmark)
Kelly, C.; Sidebottom, H.W.; Treacy, J.
1994-01-01
Rate data for the reactions of CF3O radicals with alkenes and aromatic compounds have been determined at 298 K using a relative rate method. The data are analyzed in terms of structure-reactivity relationships, and their importance to the atmospheric chemistry of CF3O discussed.......Rate data for the reactions of CF3O radicals with alkenes and aromatic compounds have been determined at 298 K using a relative rate method. The data are analyzed in terms of structure-reactivity relationships, and their importance to the atmospheric chemistry of CF3O discussed....
Magnetic susceptibility of 244Cm metal and 249Cf metal
International Nuclear Information System (INIS)
Fujita, D.K.; Parsons, T.C.; Edelstein, N.; Noe, M.; Peterson, J.R.
1975-07-01
The first magnetic susceptibility measurements made on the expanded fcc phase of 249 Cf metal are reported. Further measurements are needed on other Cf metal phases. Another measurement of the magnetic susceptibility of 244 Cm metal in a limited temperature range has been reported. The result does not agree with previously reported values. Further work is continuing on the synthesis of 244 Cm metal and 248 Cm metal and magnetic measurements on these samples. (auth)